#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
XKRX	402415	genome.wustl.edu	37	X	100182986	100182986	+	Missense_Mutation	SNP	T	T	G			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chrX:100182986T>G	ENST00000372956.2	-	1	912	c.308A>C	c.(307-309)cAt>cCt	p.H103P	XKRX_ENST00000328526.5_Missense_Mutation_p.H116P|XKRX_ENST00000468904.1_Missense_Mutation_p.H103P			Q6PP77	XKR2_HUMAN	XK, Kell blood group complex subunit-related, X-linked	103						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(3)	22						GAGGATTAGATGCATAAATAA	0.403																																																	0								ENSG00000182489						107.0	105.0	105.0					X																	100182986		2203	4300	6503	XKRX	SO:0001583	missense	0			-	HGNC	AY589511	CCDS14476.1, CCDS14476.2	Xq22	2008-02-05	2006-01-12		ENSG00000182489	ENSG00000182489			29845	protein-coding gene	gene with protein product		300684	"""X Kell blood group precursor-related, X-linked"""				Standard	NM_212559		Approved	XPLAC, XKR2	uc004egn.2	Q6PP77	OTTHUMG00000022010	ENST00000372956.2:c.308A>C	X.37:g.100182986T>G	ENSP00000362047:p.His103Pro	Somatic	0	51	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	75	8.54	B2RNN6|B4DKU2|Q5H9J6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transport_prot_XK	p.H116P	ENST00000372956.2	37	c.347	CCDS14476.2	X	.	.	.	.	.	.	.	.	.	.	T	20.4	3.992575	0.74703	.	.	ENSG00000182489	ENST00000328526;ENST00000372956;ENST00000468904	T;T;T	0.74632	-0.86;-0.86;-0.86	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.84602	0.5508	M	0.73962	2.25	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.85786	0.1364	10	0.59425	D	0.04	-9.6927	11.8978	0.52665	0.0:0.0:0.0:1.0	.	103	Q6PP77	XKR2_HUMAN	P	116;103;103	ENSP00000327570:H116P;ENSP00000362047:H103P;ENSP00000419884:H103P	ENSP00000327570:H116P	H	-	2	0	XKRX	100069642	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.975000	0.76128	1.712000	0.51347	0.350000	0.21858	CAT	-	pfam_Transport_prot_XK		0.403	XKRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKRX	protein_coding	OTTHUMT00000057501.3	T	NM_212559	-		100182986	-1	no_errors	ENST00000328526	ensembl	human	known	74_37	missense	SNP	1.000	G
ARID2	196528	genome.wustl.edu	37	12	46299067	46299067	+	3'UTR	DEL	A	A	-			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr12:46299067delA	ENST00000334344.6	+	0	5886				ARID2_ENST00000444670.1_3'UTR|ARID2_ENST00000457135.1_3'UTR|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)						chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		aagaaaaaggaaaaaaaaaaa	0.358			"""N, S, F"""		hepatocellular carcinoma																																			Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	0								ENSG00000189079																																			ARID2	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.*206A>-	12.37:g.46299067delA		Somatic	0	32	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	31	13.89	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000334344.6	37	NULL	CCDS31783.1	12																																																																																			-	-		0.358	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID2	protein_coding	OTTHUMT00000318380.2	A	XM_350875			46299067	+1	no_errors	ENST00000479608	ensembl	human	known	74_37	rna	DEL	0.911	-
LILRB1	10859	genome.wustl.edu	37	19	55147089	55147089	+	Intron	SNP	A	A	G			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr19:55147089A>G	ENST00000396331.1	+	14	2007				LILRB1_ENST00000324602.7_Intron|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000396315.1_Intron|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000396332.4_Intron|LILRB1_ENST00000427581.2_Intron|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000434867.2_Intron|LILRB1_ENST00000396327.3_Intron|LILRB1_ENST00000396317.1_Intron|LILRB1_ENST00000462628.1_3'UTR	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1						cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		CCCAGGCACCAAAGGCCTCCT	0.622										HNSCC(37;0.09)																																							0								ENSG00000104972						81.0	91.0	87.0					19																	55147089		2203	4300	6503	LILRB1	SO:0001627	intron_variant	0			-	HGNC	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1650+29A>G	19.37:g.55147089A>G		Somatic	0	49	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	70	14.63	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000396331.1	37	NULL	CCDS42617.1	19																																																																																			-	-		0.622	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB1	protein_coding	OTTHUMT00000140796.4	A		-		55147089	+1	no_errors	ENST00000462628	ensembl	human	known	74_37	rna	SNP	0.000	G
MAPK8IP3	23162	genome.wustl.edu	37	16	1817853	1817853	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr16:1817853G>C	ENST00000250894.4	+	28	3611	c.3454G>C	c.(3454-3456)Gtc>Ctc	p.V1152L	MAPK8IP3_ENST00000356010.5_Missense_Mutation_p.V1146L	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	1152					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						GGCCCTGCTTGTCGCGGGCAG	0.667																																																	0								ENSG00000138834						62.0	73.0	70.0					16																	1817853		2102	4219	6321	MAPK8IP3	SO:0001583	missense	0			-	HGNC	AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.3454G>C	16.37:g.1817853G>C	ENSP00000250894:p.Val1152Leu	Somatic	0	69	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	68	19.05	A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.V1152L	ENST00000250894.4	37	c.3454	CCDS10442.2	16	.	.	.	.	.	.	.	.	.	.	G	8.197	0.797212	0.16327	.	.	ENSG00000138834	ENST00000250894;ENST00000356010	T;T	0.35236	1.32;1.32	3.32	2.22	0.28083	WD40 repeat-like-containing domain (1);	0.065638	0.64402	D	0.000012	T	0.27765	0.0683	L	0.45285	1.41	0.38553	D	0.949511	B;B;B	0.10296	0.001;0.003;0.0	B;B;B	0.13407	0.004;0.009;0.001	T	0.10337	-1.0634	10	0.56958	D	0.05	-10.2558	7.4172	0.27050	0.887:0.0:0.113:0.0	.	1153;1146;1152	B7ZMF3;E9PFH7;Q9UPT6	.;.;JIP3_HUMAN	L	1152;1146	ENSP00000250894:V1152L;ENSP00000348290:V1146L	ENSP00000250894:V1152L	V	+	1	0	MAPK8IP3	1757854	1.000000	0.71417	0.123000	0.21794	0.075000	0.17131	4.702000	0.61817	0.390000	0.25115	-0.379000	0.06801	GTC	-	superfamily_WD40_repeat_dom		0.667	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK8IP3	protein_coding	OTTHUMT00000250508.2	G	NM_001040439	-		1817853	+1	no_errors	ENST00000250894	ensembl	human	known	74_37	missense	SNP	0.951	C
CPA2	1358	genome.wustl.edu	37	7	129908843	129908843	+	Missense_Mutation	SNP	A	A	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr7:129908843A>T	ENST00000222481.4	+	2	201	c.146A>T	c.(145-147)cAt>cTt	p.H49L		NM_001869.2	NP_001860.2	P48052	CBPA2_HUMAN	carboxypeptidase A2 (pancreatic)	49					protein catabolic process in the vacuole (GO:0007039)	extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Melanoma(18;0.0435)					GCTCAAGAACATCTCCAGGTA	0.363																																																	0								ENSG00000158516						102.0	98.0	100.0					7																	129908843		2203	4300	6503	CPA2	SO:0001583	missense	0			-	HGNC	U19977	CCDS5817.2	7q32	2012-02-10			ENSG00000158516	ENSG00000158516	3.4.17.15		2297	protein-coding gene	gene with protein product		600688				7896805, 10860668	Standard	NM_001869		Approved		uc003vpq.3	P48052	OTTHUMG00000157019	ENST00000222481.4:c.146A>T	7.37:g.129908843A>T	ENSP00000222481:p.His49Leu	Somatic	0	59	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	44	21.43	A4D1M4|C9JIK1|Q53XS1|Q96A12|Q96QN3|Q9UCF1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.H49L	ENST00000222481.4	37	c.146	CCDS5817.2	7	.	.	.	.	.	.	.	.	.	.	A	14.85	2.657731	0.47467	.	.	ENSG00000158516	ENST00000222481	T	0.43294	0.95	5.32	5.32	0.75619	Proteinase inhibitor, propeptide (1);Proteinase inhibitor, carboxypeptidase propeptide (2);	0.493395	0.22206	N	0.063175	T	0.41351	0.1155	M	0.67700	2.07	0.43054	D	0.994669	B;B	0.15719	0.014;0.001	B;B	0.18561	0.022;0.005	T	0.27839	-1.0062	10	0.20046	T	0.44	.	12.9401	0.58337	1.0:0.0:0.0:0.0	.	47;49	B4DDX9;P48052	.;CBPA2_HUMAN	L	49	ENSP00000222481:H49L	ENSP00000222481:H49L	H	+	2	0	CPA2	129696079	1.000000	0.71417	0.977000	0.42913	0.783000	0.44284	3.768000	0.55295	2.152000	0.67230	0.459000	0.35465	CAT	-	pfam_Prot_inh_M14A,superfamily_Prot_inh_propept		0.363	CPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA2	protein_coding	OTTHUMT00000347124.2	A	NM_001869	-		129908843	+1	no_errors	ENST00000222481	ensembl	human	known	74_37	missense	SNP	0.996	T
MBNL1	4154	genome.wustl.edu	37	3	152017897	152017898	+	5'UTR	INS	-	-	T	rs368507124		TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr3:152017897_152017898insT	ENST00000463374.1	+	0	426_427				MBNL1_ENST00000282486.6_5'UTR|MBNL1_ENST00000493459.1_Intron|MBNL1_ENST00000282488.7_5'UTR|MBNL1_ENST00000324210.5_5'UTR|MBNL1_ENST00000357472.3_5'UTR|MBNL1_ENST00000545754.1_5'UTR|MBNL1_ENST00000355460.2_5'UTR|MBNL1_ENST00000461436.1_3'UTR|MBNL1_ENST00000498502.1_5'UTR|MBNL1_ENST00000492948.1_5'Flank|MBNL1_ENST00000485910.1_5'UTR|MBNL1_ENST00000324196.5_5'UTR|MBNL1_ENST00000485509.1_5'Flank	NM_207293.1	NP_997176.1	Q9NR56	MBNL1_HUMAN	muscleblind-like splicing regulator 1						alternative mRNA splicing, via spliceosome (GO:0000380)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|mRNA splice site selection (GO:0006376)|myoblast differentiation (GO:0045445)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|skeletal muscle tissue development (GO:0007519)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			ATCAGTTCAGCTTTTTTTTTTT	0.371																																																	0								ENSG00000152601																																			MBNL1	SO:0001623	5_prime_UTR_variant	0				HGNC	Y13829	CCDS3163.1, CCDS3164.1, CCDS3165.1, CCDS3166.1, CCDS3167.1, CCDS3168.1, CCDS54656.1	3q25	2013-01-18	2012-02-23	2003-03-14	ENSG00000152601	ENSG00000152601		"""Zinc fingers, CCCH-type domain containing"""	6923	protein-coding gene	gene with protein product		606516	"""muscleblind (Drosophila)-like"", ""muscleblind-like (Drosophila)"""	MBNL			Standard	NM_021038		Approved	KIAA0428, EXP42, EXP40, EXP35, EXP	uc003ezm.3	Q9NR56	OTTHUMG00000159163	ENST00000463374.1:c.-85->T	3.37:g.152017908_152017908dupT		Somatic	0	55	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	37	11.90	E9PBW7|O43311|O43797|Q86UV8|Q86UV9|Q96P92|Q96RE3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000463374.1	37	NULL	CCDS3165.1	3																																																																																			-	-		0.371	MBNL1-006	KNOWN	basic|CCDS	protein_coding	MBNL1	protein_coding	OTTHUMT00000353604.1	-	NM_021038			152017898	+1	no_errors	ENST00000461436	ensembl	human	putative	74_37	rna	INS	0.829:0.026	T
RAPGEF6	51735	genome.wustl.edu	37	5	130764659	130764659	+	Silent	SNP	C	C	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr5:130764659C>T	ENST00000509018.1	-	27	4921	c.4716G>A	c.(4714-4716)agG>agA	p.R1572R	RAPGEF6_ENST00000307984.5_Intron|RAPGEF6_ENST00000507093.1_Intron|CTC-432M15.3_ENST00000514667.1_Silent_p.R1622R|RAPGEF6_ENST00000296859.6_Silent_p.R1580R	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	1572					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		GCAAATTATGCCTCTGAGGCT	0.458																																					Melanoma(168;435 1955 13113 13877 23213)												0								ENSG00000158987						133.0	123.0	126.0					5																	130764659		2203	4300	6503	RAPGEF6	SO:0001819	synonymous_variant	0			-	HGNC	AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.4716G>A	5.37:g.130764659C>T		Somatic	0	27	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RasGRF_CDC25,pfam_PDZ,pfam_Ras-assoc,pfam_cNMP-bd_dom,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,superfamily_PDZ,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ras-like_Gua-exchang_fac_N,smart_PDZ,smart_Ras-assoc,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_PDZ,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.R1572	ENST00000509018.1	37	c.4716	CCDS34225.1	5																																																																																			-	NULL		0.458	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPGEF6	protein_coding	OTTHUMT00000370059.1	C	NM_016340	-		130764659	-1	no_errors	ENST00000509018	ensembl	human	known	74_37	silent	SNP	1.000	T
CELSR1	9620	genome.wustl.edu	37	22	46835181	46835181	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr22:46835181C>A	ENST00000262738.3	-	3	4310	c.4311G>T	c.(4309-4311)agG>agT	p.R1437S		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1437	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CACAGTAGGGCCTCTCATACT	0.642																																																	0								ENSG00000075275						99.0	78.0	86.0					22																	46835181		2203	4300	6503	CELSR1	SO:0001583	missense	0			-	HGNC	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.4311G>T	22.37:g.46835181C>A	ENSP00000262738:p.Arg1437Ser	Somatic	0	81	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	58	36.56	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.R1437S	ENST00000262738.3	37	c.4311	CCDS14076.1	22	.	.	.	.	.	.	.	.	.	.	C	6.720	0.501495	0.12822	.	.	ENSG00000075275	ENST00000262738	T	0.78481	-1.18	5.1	0.554	0.17241	Concanavalin A-like lectin/glucanase (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.170591	0.36303	U	0.002674	T	0.52451	0.1735	N	0.17345	0.48	0.80722	D	1	B	0.33345	0.409	B	0.32393	0.145	T	0.29427	-1.0012	10	0.11485	T	0.65	.	4.6649	0.12660	0.112:0.5812:0.1096:0.1972	.	1437	Q9NYQ6	CELR1_HUMAN	S	1437	ENSP00000262738:R1437S	ENSP00000262738:R1437S	R	-	3	2	CELSR1	45213845	0.959000	0.32827	0.910000	0.35882	0.078000	0.17371	0.359000	0.20233	-0.048000	0.13401	-1.134000	0.01955	AGG	-	superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom		0.642	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	protein_coding	OTTHUMT00000318037.1	C	NM_014246	-		46835181	-1	no_errors	ENST00000262738	ensembl	human	known	74_37	missense	SNP	0.997	A
CCL16	6360	genome.wustl.edu	37	17	34308401	34308401	+	Nonsense_Mutation	SNP	G	G	T	rs199602184		TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr17:34308401G>T	ENST00000293275.3	-	1	131	c.56C>A	c.(55-57)tCg>tAg	p.S19*		NM_004590.2	NP_004581.1	O15467	CCL16_HUMAN	chemokine (C-C motif) ligand 16	19					cell chemotaxis (GO:0060326)|cell communication (GO:0007154)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive chemotaxis (GO:0050918)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|chemokine activity (GO:0008009)			endometrium(1)|lung(2)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GCGAGAAGCCGAAGTAATGAT	0.572																																																	0								ENSG00000161573						66.0	51.0	56.0					17																	34308401		2203	4300	6503	CCL16	SO:0001587	stop_gained	0			-	HGNC	AB007454	CCDS11303.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000161573	ENSG00000275152		"""Chemokine ligands"", ""Endogenous ligands"""	10614	protein-coding gene	gene with protein product		601394	"""small inducible cytokine subfamily A (Cys-Cys), member 16"""	SCYA16		8661057	Standard	NM_004590		Approved	NCC-4, SCYL4, LEC, HCC-4, LMC, LCC-1, CKb12, Mtn-1	uc002hkl.3	O15467	OTTHUMG00000188402	ENST00000293275.3:c.56C>A	17.37:g.34308401G>T	ENSP00000293275:p.Ser19*	Somatic	0	19	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	13	43.48	Q4KKU0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.S19*	ENST00000293275.3	37	c.56	CCDS11303.1	17	.	.	.	.	.	.	.	.	.	.	G	18.64	3.667040	0.67814	.	.	ENSG00000161573	ENST00000293275	.	.	.	3.76	1.64	0.23874	.	.	.	.	.	.	.	.	.	.	.	0.58432	A	0.999995	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.3932	0.11350	0.13:0.238:0.6319:0.0	.	.	.	.	X	19	.	ENSP00000293275:S19X	S	-	2	0	CCL16	31332514	0.000000	0.05858	0.000000	0.03702	0.103000	0.19146	0.391000	0.20784	0.864000	0.35578	0.462000	0.41574	TCG	-	NULL		0.572	CCL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL16	protein_coding	OTTHUMT00000256579.1	G	NM_004590	-		34308401	-1	no_errors	ENST00000293275	ensembl	human	known	74_37	nonsense	SNP	0.000	T
MAGEB16	139604	genome.wustl.edu	37	X	35821013	35821013	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chrX:35821013G>T	ENST00000399989.1	+	2	979	c.700G>T	c.(700-702)Gta>Tta	p.V234L	MAGEB16_ENST00000399988.1_Missense_Mutation_p.V234L|MAGEB16_ENST00000399987.1_Missense_Mutation_p.V234L|MAGEB16_ENST00000399992.1_Missense_Mutation_p.V266L|MAGEB16_ENST00000399985.1_Missense_Mutation_p.V234L	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	234	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						TTTGACGGGAGTATATTCTGG	0.498																																																	0								ENSG00000189023						65.0	61.0	62.0					X																	35821013		2170	4283	6453	MAGEB16	SO:0001583	missense	0			-	HGNC		CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.700G>T	X.37:g.35821013G>T	ENSP00000382871:p.Val234Leu	Somatic	0	16	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	12	62.50	A8MU30	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.V266L	ENST00000399989.1	37	c.796	CCDS43927.1	X	.	.	.	.	.	.	.	.	.	.	G	1.667	-0.510049	0.04231	.	.	ENSG00000189023	ENST00000399988;ENST00000399992;ENST00000399987;ENST00000399989;ENST00000399985	T;T;T;T;T	0.03663	3.85;3.85;3.85;3.85;3.85	3.13	-2.7	0.06004	.	0.928117	0.09192	N	0.835878	T	0.01421	0.0046	N	0.02973	-0.45	0.09310	N	1	B	0.20988	0.05	B	0.27076	0.076	T	0.47774	-0.9091	10	0.22109	T	0.4	.	1.0124	0.01500	0.5138:0.1757:0.1363:0.1742	.	234	A2A368	MAGBG_HUMAN	L	234;266;234;234;234	ENSP00000382870:V234L;ENSP00000382874:V266L;ENSP00000382869:V234L;ENSP00000382871:V234L;ENSP00000382867:V234L	ENSP00000382867:V234L	V	+	1	0	MAGEB16	35730934	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.470000	0.02346	-0.663000	0.05331	-2.607000	0.00160	GTA	-	pfam_MAGE,pfscan_MAGE		0.498	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB16	protein_coding	OTTHUMT00000251034.1	G		-		35821013	+1	no_errors	ENST00000399992	ensembl	human	known	74_37	missense	SNP	0.000	T
ARHGEF28	64283	genome.wustl.edu	37	5	73045768	73045768	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr5:73045768C>T	ENST00000426542.2	+	2	160	c.140C>T	c.(139-141)gCa>gTa	p.A47V	ARHGEF28_ENST00000296794.6_Missense_Mutation_p.A47V|ARHGEF28_ENST00000545377.1_Missense_Mutation_p.A47V|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.A47V|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.A47V|ARHGEF28_ENST00000287898.5_Missense_Mutation_p.A47V			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	47					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										GTCATGATTGCAGAGCGCATC	0.448																																																	0								ENSG00000214944						175.0	175.0	175.0					5																	73045768		2108	4244	6352	ARHGEF28	SO:0001583	missense	0			-	HGNC		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.140C>T	5.37:g.73045768C>T	ENSP00000412175:p.Ala47Val	Somatic	0	25	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	40	23.08	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.A47V	ENST00000426542.2	37	c.140	CCDS54870.1	5	.	.	.	.	.	.	.	.	.	.	C	19.64	3.865423	0.71949	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000509848;ENST00000437974;ENST00000426542	T;T;T;T;T;T	0.15952	2.62;2.62;2.62;2.38;2.62;2.62	5.35	5.35	0.76521	.	.	.	.	.	T	0.42086	0.1187	M	0.64997	1.995	0.37174	D	0.903192	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.996;0.996;0.993;0.998	T	0.44236	-0.9341	9	0.66056	D	0.02	.	18.6881	0.91573	0.0:1.0:0.0:0.0	.	47;47;47;47	Q8N1W1;E9PC75;Q8N1W1-2;Q8N1W1-4	RGNEF_HUMAN;.;.;.	V	47	ENSP00000296794:A47V;ENSP00000441913:A47V;ENSP00000441436:A47V;ENSP00000287898:A47V;ENSP00000411459:A47V;ENSP00000412175:A47V	ENSP00000287898:A47V	A	+	2	0	RP11-428C6.1	73081524	0.998000	0.40836	0.287000	0.24848	0.359000	0.29487	4.918000	0.63376	2.529000	0.85273	0.655000	0.94253	GCA	-	NULL		0.448	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF28	protein_coding	OTTHUMT00000368975.1	C		-		73045768	+1	no_errors	ENST00000545377	ensembl	human	known	74_37	missense	SNP	0.946	T
PRAMEF12	390999	genome.wustl.edu	37	1	12837633	12837633	+	Missense_Mutation	SNP	T	T	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr1:12837633T>A	ENST00000357726.4	+	3	1370	c.1343T>A	c.(1342-1344)aTt>aAt	p.I448N		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	448					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CAGCCCAAGATTATTGTGTTC	0.552																																																	0								ENSG00000116726						126.0	126.0	126.0					1																	12837633		2203	4300	6503	PRAMEF12	SO:0001583	missense	0			-	HGNC		CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.1343T>A	1.37:g.12837633T>A	ENSP00000350358:p.Ile448Asn	Somatic	0	73	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	63	18.18		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I448N	ENST00000357726.4	37	c.1343	CCDS41254.1	1	.	.	.	.	.	.	.	.	.	.	.	3.456	-0.111037	0.06881	.	.	ENSG00000116726	ENST00000357726	T	0.46819	0.86	2.73	-5.46	0.02608	.	2.279220	0.02196	N	0.061819	T	0.19685	0.0473	N	0.03608	-0.345	0.09310	N	1	B	0.21753	0.06	B	0.23574	0.047	T	0.11348	-1.0591	10	0.15499	T	0.54	.	2.3184	0.04204	0.1487:0.4682:0.1309:0.2522	.	448	O95522	PRA12_HUMAN	N	448	ENSP00000350358:I448N	ENSP00000350358:I448N	I	+	2	0	PRAMEF12	12760220	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-2.138000	0.01303	-2.096000	0.00852	-1.309000	0.01313	ATT	-	NULL		0.552	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF12	protein_coding	OTTHUMT00000005457.1	T	XM_372760	-		12837633	+1	no_errors	ENST00000357726	ensembl	human	known	74_37	missense	SNP	0.000	A
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037819	10037819	+	RNA	SNP	T	T	G	rs5005396		TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chrY:10037819T>G	ENST00000515896.1	+	0	56									RNA, 5.8S ribosomal pseudogene 6																		CAGCTAGCTGTGAGAATTAAT	0.527																																																	0								ENSG00000251705																																			RNA5-8SP6			0			-	HGNC			Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037819T>G		Somatic	0	85	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	51	8.93		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			-	-		0.527	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	rRNA		T		-		10037819	+1	no_errors	ENST00000515896	ensembl	human	known	74_37	rna	SNP	1.000	G
AGAP2	116986	genome.wustl.edu	37	12	58131125	58131125	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr12:58131125G>A	ENST00000547588.1	-	1	904	c.905C>T	c.(904-906)gCc>gTc	p.A302V	AGAP2_ENST00000257897.3_Intron	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	302	Interaction with PLCG1. {ECO:0000250}.				axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						GACAGCAGTGGCTGGACTCGG	0.672																																																	0								ENSG00000135439						44.0	61.0	56.0					12																	58131125		1568	3582	5150	AGAP2	SO:0001583	missense	0			-	HGNC	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.905C>T	12.37:g.58131125G>A	ENSP00000449241:p.Ala302Val	Somatic	0	126	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	168	1492	10.10	A8K9F7|O00578|Q548E0|Q8IWU3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ArfGAP,pfam_MIRO-like,pfam_Small_GTPase,pfam_Ankyrin_rpt,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Pleckstrin_homology,smart_ArfGAP,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP,prints_Small_GTPase	p.A302V	ENST00000547588.1	37	c.905	CCDS44932.1	12	.	.	.	.	.	.	.	.	.	.	G	3.540	-0.093828	0.07053	.	.	ENSG00000135439	ENST00000547588	T	0.35973	1.28	4.83	0.59	0.17458	.	1.533620	0.03866	N	0.274804	T	0.23965	0.0580	N	0.08118	0	0.09310	N	1	B;B	0.12630	0.006;0.003	B;B	0.08055	0.003;0.001	T	0.36335	-0.9752	10	0.66056	D	0.02	.	11.6268	0.51151	0.0:0.3579:0.5218:0.1203	.	302;302	F8VVT9;Q99490	.;AGAP2_HUMAN	V	302	ENSP00000449241:A302V	ENSP00000449241:A302V	A	-	2	0	AGAP2	56417392	0.000000	0.05858	0.006000	0.13384	0.002000	0.02628	-0.022000	0.12480	-0.039000	0.13602	-1.358000	0.01219	GCC	-	NULL		0.672	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AGAP2	protein_coding	OTTHUMT00000408367.1	G	NM_014770	-		58131125	-1	no_errors	ENST00000547588	ensembl	human	known	74_37	missense	SNP	0.002	A
KRTAP9-9	81870	genome.wustl.edu	37	17	39411670	39411671	+	In_Frame_Ins	INS	-	-	ACCTGCTGCAGGACC	rs67700678|rs540633489	byFrequency	TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr17:39411670_39411671insACCTGCTGCAGGACC	ENST00000394008.1	+	1	35_36	c.33_34insACCTGCTGCAGGACC	c.(34-36)acc>ACCTGCTGCAGGACCacc	p.12_12T>TCCRTT		NM_030975.2	NP_112237.2	Q9BYP9	KRA99_HUMAN	keratin associated protein 9-9	12	14 X 5 AA repeats of C-C-[RQVGE]- [SPSTNQ]-[TASL].					keratin filament (GO:0045095)				endometrium(3)|skin(2)|upper_aerodigestive_tract(1)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			GCTGTCAGCCTACCTGCTGCAG	0.604														2488	0.496805	0.298	0.647	5008	,	,		16406	0.4196		0.5805	False		,,,				2504	0.6524																0								ENSG00000198083																																			KRTAP9-9	SO:0001652	inframe_insertion	0				HGNC	AJ406951	CCDS54127.1	17q21.2	2010-06-03			ENSG00000198083	ENSG00000198083		"""Keratin associated proteins"""	16773	protein-coding gene	gene with protein product			"""keratin associated protein 9-5"""	KRTAP9-5		11279113	Standard	NM_030975		Approved	KAP9.9, KAP9.5	uc021txh.1	Q9BYP9	OTTHUMG00000133602	ENST00000394008.1:c.34_48dupACCTGCTGCAGGACC	17.37:g.39411670_39411671insACCTGCTGCAGGACC	Exception_encountered	Somatic	NA	NA	NA		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B5MDD6|Q9BYQ1	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.15in_frame_insTTCCR	ENST00000394008.1	37	c.33_34	CCDS54127.1	17																																																																																			-	NULL		0.604	KRTAP9-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP9-9	protein_coding	OTTHUMT00000257710.1	-	NM_030975			39411671	+1	no_errors	ENST00000394008	ensembl	human	known	74_37	in_frame_ins	INS	0.053:0.940	ACCTGCTGCAGGACC
KIF16B	55614	genome.wustl.edu	37	20	16385512	16385512	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr20:16385512G>A	ENST00000354981.2	-	17	1887	c.1730C>T	c.(1729-1731)aCc>aTc	p.T577I	KIF16B_ENST00000408042.1_Missense_Mutation_p.T577I|KIF16B_ENST00000355755.3_Missense_Mutation_p.T577I|KIF16B_ENST00000378003.2_5'UTR	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	577					ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						CGAGAGGTCGGTCATGGACAA	0.527																																																	0								ENSG00000089177						101.0	86.0	91.0					20																	16385512		2203	4300	6503	KIF16B	SO:0001583	missense	0			-	HGNC	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.1730C>T	20.37:g.16385512G>A	ENSP00000347076:p.Thr577Ile	Somatic	0	32	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	18	51.35	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.T577I	ENST00000354981.2	37	c.1730	CCDS13122.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.8|22.8	4.341415|4.341415	0.81911|0.81911	.|.	.|.	ENSG00000089177|ENSG00000089177	ENST00000450176|ENST00000354981;ENST00000355755;ENST00000377997;ENST00000408042	.|T;T;T	.|0.70986	.|-0.53;-0.53;-0.53	5.76|5.76	4.81|4.81	0.61882|0.61882	.|.	.|0.049468	.|0.85682	.|D	.|0.000000	T|T	0.73521|0.73521	0.3597|0.3597	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	.|D;D;P;P	.|0.67145	.|0.987;0.996;0.95;0.916	.|P;D;P;P	.|0.63703	.|0.843;0.917;0.718;0.526	T|T	0.77582|0.77582	-0.2534|-0.2534	5|10	.|0.66056	.|D	.|0.02	.|.	15.7521|15.7521	0.77994|0.77994	0.0:0.1371:0.8629:0.0|0.0:0.1371:0.8629:0.0	.|.	.|577;577;577;577	.|Q96L93-4;Q96L93-2;Q96L93-6;Q96L93	.|.;.;.;KI16B_HUMAN	S|I	1|577	.|ENSP00000347076:T577I;ENSP00000347995:T577I;ENSP00000384164:T577I	.|ENSP00000347076:T577I	P|T	-|-	1|2	0|0	KIF16B|KIF16B	16333512|16333512	1.000000|1.000000	0.71417|0.71417	0.889000|0.889000	0.34880|0.34880	0.993000|0.993000	0.82548|0.82548	6.867000|6.867000	0.75511|0.75511	1.423000|1.423000	0.47198|0.47198	0.555000|0.555000	0.69702|0.69702	CCG|ACC	-	NULL		0.527	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF16B	protein_coding	OTTHUMT00000078104.2	G	NM_017683	-		16385512	-1	no_errors	ENST00000408042	ensembl	human	known	74_37	missense	SNP	0.998	A
PRICKLE3	4007	genome.wustl.edu	37	X	49040116	49040117	+	Intron	DEL	GT	GT	-			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chrX:49040116_49040117delGT	ENST00000376317.3	-	3	407				PRICKLE3_ENST00000536904.1_Frame_Shift_Del_p.T60fs|PRICKLE3_ENST00000376310.3_Intron|PRICKLE3_ENST00000540849.1_Intron|PRICKLE3_ENST00000538114.1_Frame_Shift_Del_p.T128fs	NM_006150.3	NP_006141.2	O43900	PRIC3_HUMAN	prickle homolog 3 (Drosophila)								zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|skin(2)	22						TCCCACCTGAGTGTGTGTGTGT	0.604																																																	0								ENSG00000012211																																			PRICKLE3	SO:0001627	intron_variant	0				HGNC	BC016856	CCDS14320.1	Xp11.23	2008-02-05	2007-09-18	2007-09-18	ENSG00000012211	ENSG00000012211			6645	protein-coding gene	gene with protein product		300111	"""LIM domain only 6"""	LMO6		9344658	Standard	XM_005272605		Approved		uc004dmy.1	O43900	OTTHUMG00000024134	ENST00000376317.3:c.312+69AC>-	X.37:g.49040126_49040127delGT		Somatic	0	20	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	19	9.52	B7Z8F2|O76007|Q53XR5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_LIM,pfam_PET_domain,smart_Znf_LIM,pfscan_Znf_LIM	p.T60fs	ENST00000376317.3	37	c.179_178	CCDS14320.1	X																																																																																			-	NULL		0.604	PRICKLE3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRICKLE3	protein_coding	OTTHUMT00000060811.1	GT	NM_006150			49040117	-1	no_errors	ENST00000536904	ensembl	human	known	74_37	frame_shift_del	DEL	0.149:0.119	-
CEP170	9859	genome.wustl.edu	37	1	243289697	243289697	+	3'UTR	SNP	T	T	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr1:243289697T>A	ENST00000366542.1	-	0	4860				CEP170_ENST00000468254.1_5'UTR|CEP170_ENST00000366544.1_3'UTR|CEP170_ENST00000366543.1_3'UTR|CEP170_ENST00000481987.1_3'UTR|CEP170_ENST00000490813.1_3'UTR	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa							centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			CTATGCTGCTTCCAATATTCC	0.368																																																	0								ENSG00000143702																																			CEP170	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.*54A>T	1.37:g.243289697T>A		Somatic	0	36	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	26	16.13	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366542.1	37	NULL	CCDS44339.1	1																																																																																			-	-		0.368	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	CEP170	protein_coding	OTTHUMT00000096178.2	T	NM_014812	-		243289697	-1	no_errors	ENST00000466495	ensembl	human	known	74_37	rna	SNP	1.000	A
VIPAS39	63894	genome.wustl.edu	37	14	77919693	77919693	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr14:77919693C>T	ENST00000553888.1	-	3	655	c.145G>A	c.(145-147)Gat>Aat	p.D49N	VIPAS39_ENST00000343765.2_Missense_Mutation_p.D49N|VIPAS39_ENST00000448935.2_Missense_Mutation_p.D49N|VIPAS39_ENST00000556412.1_Missense_Mutation_p.D75N|VIPAS39_ENST00000327028.4_Missense_Mutation_p.D49N|VIPAS39_ENST00000557658.1_Missense_Mutation_p.D49N	NM_001193314.1|NM_001193317.1|NM_022067.3	NP_001180243.1|NP_001180246.1|NP_071350.2	Q9H9C1	SPE39_HUMAN	VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog	49					cell differentiation (GO:0030154)|endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|late endosome (GO:0005770)|recycling endosome (GO:0055037)											TCATCGTCATCATCATCCACG	0.522																																																	0								ENSG00000151445						289.0	282.0	284.0					14																	77919693		2203	4300	6503	VIPAS39	SO:0001583	missense	0			-	HGNC	AK022925	CCDS9862.1, CCDS53905.1	14q24.3-q31	2013-08-14	2012-07-24	2012-07-24	ENSG00000151445	ENSG00000151445			20347	protein-coding gene	gene with protein product	"""VPS33B interacting protein, apical-basolateral polarity regulator"""	613401	"""chromosome 14 open reading frame 133"""	C14orf133		20190753, 19109425, 22753090, 23002115, 23918659	Standard	NM_022067		Approved	VIPAR, VPS16B, SPE-39, SPE39, hSPE-39	uc001xtu.2	Q9H9C1		ENST00000553888.1:c.145G>A	14.37:g.77919693C>T	ENSP00000452181:p.Asp49Asn	Somatic	0	53	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	42	25.00	B4DPI6|O95434|Q9H7E1|Q9H9I9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Golgin_subfamily_A_member_5	p.D49N	ENST00000553888.1	37	c.145	CCDS9862.1	14	.	.	.	.	.	.	.	.	.	.	C	24.1	4.499314	0.85069	.	.	ENSG00000151445	ENST00000343765;ENST00000553888;ENST00000327028;ENST00000557658;ENST00000448935;ENST00000556412	T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9	5.98	5.98	0.97165	.	0.134608	0.64402	D	0.000003	T	0.36331	0.0963	L	0.29908	0.895	0.80722	D	1	B;B	0.15930	0.006;0.015	B;B	0.16289	0.007;0.015	T	0.06110	-1.0845	10	0.27785	T	0.31	-5.3406	20.4292	0.99080	0.0:1.0:0.0:0.0	.	49;49	B4DPI6;Q9H9C1	.;VIPAR_HUMAN	N	49;49;49;49;49;75	ENSP00000339122:D49N;ENSP00000452181:D49N;ENSP00000313098:D49N;ENSP00000452191:D49N;ENSP00000404815:D49N;ENSP00000451857:D75N	ENSP00000313098:D49N	D	-	1	0	VIPAR	76989446	1.000000	0.71417	0.937000	0.37676	0.770000	0.43624	7.329000	0.79170	2.839000	0.97877	0.650000	0.86243	GAT	-	pfam_Golgin_subfamily_A_member_5		0.522	VIPAS39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIPAS39	protein_coding	OTTHUMT00000414008.1	C	NM_022067	-		77919693	-1	no_errors	ENST00000343765	ensembl	human	known	74_37	missense	SNP	1.000	T
NOTCH4	4855	genome.wustl.edu	37	6	32191658	32191659	+	In_Frame_Ins	INS	-	-	AGCAGC	rs534749933|rs548737956|rs546167192|rs35795312|rs150280230|rs72110219|rs543450919|rs550565259|rs148340623	byFrequency	TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr6:32191658_32191659insAGCAGC	ENST00000375023.3	-	1	185_186	c.47_48insGCTGCT	c.(46-48)cta>ctGCTGCTa	p.16_16L>LLL		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	16					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CTGAGACACATagcagcagcag	0.639																																																	0								ENSG00000204301																																			NOTCH4	SO:0001652	inframe_insertion	0				HGNC		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.42_47dupGCTGCT	6.37:g.32191659_32191664dupAGCAGC	ENSP00000364163:p.LeuLeu16dup	Somatic	NA	NA	NA		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pirsf_Notch,pfam_EG-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd_dom,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_4,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.17in_frame_insLL	ENST00000375023.3	37	c.48_47	CCDS34420.1	6																																																																																			-	pirsf_Notch		0.639	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	protein_coding	OTTHUMT00000076045.2	-				32191659	-1	no_errors	ENST00000375023	ensembl	human	known	74_37	in_frame_ins	INS	0.002:0.003	AGCAGC
GPR116	221395	genome.wustl.edu	37	6	46832779	46832779	+	Splice_Site	SNP	C	C	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr6:46832779C>A	ENST00000283296.7	-	14	2278	c.1990G>T	c.(1990-1992)Ggg>Tgg	p.G664W	GPR116_ENST00000456426.2_Splice_Site_p.G522W|GPR116_ENST00000362015.4_Splice_Site_p.G664W|GPR116_ENST00000265417.7_Splice_Site_p.G664W|GPR116_ENST00000545669.1_Splice_Site_p.G93W	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	664					energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			ACGTTCTTACCAGGAACCAGA	0.363																																					NSCLC(59;410 1274 8751 36715 50546)												0								ENSG00000069122						128.0	113.0	118.0					6																	46832779		2203	4300	6503	GPR116	SO:0001630	splice_region_variant	0			-	HGNC	AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.1990+1G>T	6.37:g.46832779C>A		Somatic	0	54	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	51	22.73	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_SEA_dom,pfam_GPS_dom,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom,prints_GPCR_2_Ig-hepta_rcpt,prints_GPCR_2_secretin-like	p.G664W	ENST00000283296.7	37	c.1990	CCDS4919.1	6	.	.	.	.	.	.	.	.	.	.	C	14.26	2.483723	0.44147	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000456426;ENST00000265417;ENST00000545669	T;T;T;T;T	0.28666	1.64;2.02;1.64;1.64;1.6	5.91	5.03	0.67393	.	0.828570	0.10842	N	0.628083	T	0.17109	0.0411	M	0.62723	1.935	0.30798	N	0.740237	B;B;B;B;B	0.22080	0.008;0.011;0.01;0.064;0.01	B;B;B;B;B	0.21917	0.024;0.01;0.001;0.037;0.001	T	0.13683	-1.0500	9	.	.	.	-1.8338	12.612	0.56556	0.0:0.9218:0.0:0.0782	.	93;219;664;522;664	F5GWK9;B4DTV3;E9PBS6;Q8IZF2-3;Q8IZF2	.;.;.;.;GP116_HUMAN	W	664;664;664;522;664;93	ENSP00000283296:G664W;ENSP00000354563:G664W;ENSP00000412866:G522W;ENSP00000265417:G664W;ENSP00000441581:G93W	.	G	-	1	0	GPR116	46940738	0.992000	0.36948	1.000000	0.80357	0.965000	0.64279	2.594000	0.46189	1.493000	0.48517	0.644000	0.83932	GGG	-	NULL		0.363	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR116	protein_coding	OTTHUMT00000040806.2	C	NM_015234	-	Missense_Mutation	46832779	-1	no_errors	ENST00000265417	ensembl	human	known	74_37	missense	SNP	1.000	A
BEND7	222389	genome.wustl.edu	37	10	13570570	13570584	+	5'Flank	DEL	GCGGCAGCGGCGGCA	GCGGCAGCGGCGGCA	-	rs184014070		TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	GCGGCAGCGGCGGCA	GCGGCAGCGGCGGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr10:13570570_13570584delGCGGCAGCGGCGGCA	ENST00000396900.2	-	0	0				RP11-214D15.2_ENST00000438431.1_RNA|BEND7_ENST00000396898.2_5'Flank			Q8N7W2	BEND7_HUMAN	BEN domain containing 7							extracellular vesicular exosome (GO:0070062)				breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|stomach(1)	17						tgaggaggcggcggcagcggcggcagcggcagcgg	0.735																																																	0								ENSG00000227175																																			RP11-214D15.2	SO:0001631	upstream_gene_variant	0				Clone_based_vega_gene	BC031618	CCDS7099.1, CCDS41490.1	10p14	2012-11-22	2008-10-03	2008-10-03	ENSG00000165626	ENSG00000165626		"""BEN domain containing"""	23514	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 30"""	C10orf30			Standard	NM_152751		Approved	FLJ40283	uc001imm.2	Q8N7W2	OTTHUMG00000017699		10.37:g.13570570_13570584delGCGGCAGCGGCGGCA	Exception_encountered	Somatic	NA	NA	NA		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5SYY7|Q5SYY8|Q5SYY9|Q8N5T7	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000396900.2	37	NULL		10																																																																																			-	-		0.735	BEND7-202	KNOWN	basic	protein_coding	ENSG00000227175	protein_coding		GCGGCAGCGGCGGCA	NM_152751			13570584	+1	no_errors	ENST00000438431	ensembl	human	known	74_37	rna	DEL	0.005:0.008:0.010:0.011:0.013:0.013:0.014:0.014:0.013:0.013:0.012:0.010:0.008:0.006:0.003	-
KRBA1	84626	genome.wustl.edu	37	7	149422472	149422472	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr7:149422472G>T	ENST00000485033.2	+	9	1193	c.1193G>T	c.(1192-1194)gGg>gTg	p.G398V	KRBA1_ENST00000479560.1_3'UTR|KRBA1_ENST00000319551.8_Missense_Mutation_p.G398V|KRBA1_ENST00000255992.10_Missense_Mutation_p.G398V			A5PL33	KRBA1_HUMAN	KRAB-A domain containing 1	408										breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(17)|ovary(1)|prostate(1)	27	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCCCCAAATGGGTCGTCACCT	0.587																																																	0								ENSG00000133619						35.0	39.0	38.0					7																	149422472		1990	4171	6161	KRBA1	SO:0001583	missense	0			-	HGNC	AB058765	CCDS75674.1	7q36	2014-02-12	2006-08-15		ENSG00000133619	ENSG00000133619		"""-"""	22228	protein-coding gene	gene with protein product			"""KRAB A domain containing 1"""				Standard	NM_001290187		Approved	KIAA1862	uc003wfz.3	A5PL33	OTTHUMG00000157886	ENST00000485033.2:c.1193G>T	7.37:g.149422472G>T	ENSP00000420112:p.Gly398Val	Somatic	0	40	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	29	21.62	A7E2F5|E7ENE9|Q8N4X0|Q96JG5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G398V	ENST00000485033.2	37	c.1193		7	.	.	.	.	.	.	.	.	.	.	G	7.191	0.591457	0.13812	.	.	ENSG00000133619	ENST00000255992;ENST00000319551;ENST00000485033	T;T;T	0.35973	1.29;1.28;1.28	5.18	-0.168	0.13343	.	0.769092	0.11130	N	0.596439	T	0.25494	0.0620	L	0.32530	0.975	0.19300	N	0.999975	B;B	0.19331	0.035;0.019	B;B	0.14023	0.01;0.01	T	0.19321	-1.0309	10	0.48119	T	0.1	-4.13	8.4474	0.32849	0.0:0.406:0.3131:0.2808	.	398;398	E7ENE9;A5PL33	.;KRBA1_HUMAN	V	398	ENSP00000255992:G398V;ENSP00000317165:G398V;ENSP00000420112:G398V	ENSP00000255992:G398V	G	+	2	0	KRBA1	149053405	0.026000	0.19158	0.000000	0.03702	0.009000	0.06853	-0.101000	0.10973	-0.335000	0.08451	0.655000	0.94253	GGG	-	NULL		0.587	KRBA1-004	PUTATIVE	basic	protein_coding	KRBA1	protein_coding	OTTHUMT00000349841.3	G	NM_032534	-		149422472	+1	no_errors	ENST00000255992	ensembl	human	known	74_37	missense	SNP	0.000	T
CCPG1	9236	genome.wustl.edu	37	15	55677813	55677813	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr15:55677813G>A	ENST00000310958.6	-	3	458	c.160C>T	c.(160-162)Cag>Tag	p.Q54*	DYX1C1-CCPG1_ENST00000565113.1_RNA|CCPG1_ENST00000442196.3_Nonsense_Mutation_p.Q54*|CCPG1_ENST00000569205.1_Nonsense_Mutation_p.Q54*|CCPG1_ENST00000425574.3_Nonsense_Mutation_p.Q54*	NM_001204450.1|NM_001204451.1|NM_004748.4|NM_020739.3	NP_001191379.1|NP_001191380.1|NP_004739.3|NP_065790.2	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1	54	Interaction with MCF2L and SRC. {ECO:0000250}.				cell cycle (GO:0007049)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001106)	integral component of membrane (GO:0016021)				autonomic_ganglia(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|stomach(3)	30				all cancers(107;0.0354)		TGCTCTATCTGCAATGCTTGA	0.418																																																	0								ENSG00000260916						49.0	49.0	49.0					15																	55677813		1830	4076	5906	CCPG1	SO:0001587	stop_gained	0			-	HGNC	AF212228	CCDS42039.1, CCDS55966.1, CCDS55967.1	15q21.1	2011-04-20				ENSG00000260916			24227	protein-coding gene	gene with protein product		611326				9383053, 10574462	Standard	NM_004748		Approved	KIAA1254, CPR8	uc010bfk.2	Q9ULG6		ENST00000310958.6:c.160C>T	15.37:g.55677813G>A	ENSP00000311656:p.Gln54*	Somatic	0	67	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	38	24.00	A0PJH3|A8K9T0|O14712|Q05DG4|Q5U5S7|Q8IYV8|Q9BY53|Q9HA17	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q54*	ENST00000310958.6	37	c.160	CCDS42039.1	15	.	.	.	.	.	.	.	.	.	.	G	15.96	2.986244	0.53934	.	.	ENSG00000256061	ENST00000310958;ENST00000442196;ENST00000425574	.	.	.	4.51	3.57	0.40892	.	1.158660	0.06064	N	0.658925	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	.	9.0895	0.36601	0.1031:0.0:0.8969:0.0	.	.	.	.	X	54	.	ENSP00000311656:Q54X	Q	-	1	0	DYX1C1	53465105	0.016000	0.18221	0.004000	0.12327	0.160000	0.22226	1.670000	0.37502	1.226000	0.43582	0.650000	0.86243	CAG	-	NULL		0.418	CCPG1-001	KNOWN	basic|CCDS	protein_coding	CCPG1	protein_coding	OTTHUMT00000419850.1	G	NM_004748	-		55677813	-1	no_errors	ENST00000310958	ensembl	human	known	74_37	nonsense	SNP	0.004	A
ECE2	9718	genome.wustl.edu	37	3	184002758	184002758	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr3:184002758C>T	ENST00000402825.3	+	9	1367	c.1367C>T	c.(1366-1368)gCg>gTg	p.A456V	ECE2_ENST00000404464.3_Missense_Mutation_p.A338V|EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000359140.4_Missense_Mutation_p.A309V|ECE2_ENST00000357474.5_Missense_Mutation_p.A384V	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	456	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CAGGCTCTGGCGCCCTCCATG	0.542											OREG0015945	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000145194						65.0	65.0	65.0					3																	184002758		2203	4300	6503	ECE2	SO:0001583	missense	0			-	HGNC	AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.1367C>T	3.37:g.184002758C>T	ENSP00000384223:p.Ala456Val	Somatic	0	44	0.00	1988	0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,pfam_Methyltransf_11,prints_Peptidase_M13_C	p.A456V	ENST00000402825.3	37	c.1367	CCDS3256.2	3	.	.	.	.	.	.	.	.	.	.	C	12.52	1.961248	0.34565	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	T;T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74;-0.74	4.21	3.32	0.38043	Peptidase M13 (1);	0.115420	0.64402	D	0.000019	T	0.62048	0.2396	N	0.22421	0.69	0.54753	D	0.999984	D;D;D;P;D;D;D	0.63046	0.985;0.992;0.985;0.743;0.991;0.981;0.992	B;P;B;B;P;B;P	0.49829	0.325;0.623;0.325;0.066;0.488;0.218;0.623	T	0.61783	-0.6992	10	0.02654	T	1	-17.3667	12.0082	0.53272	0.1746:0.8254:0.0:0.0	.	58;309;327;338;384;309;456	B4DHU4;B4DKF3;B4DF19;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;.;.;ECE2_HUMAN	V	456;309;338;384;330	ENSP00000384223:A456V;ENSP00000352052:A309V;ENSP00000385846:A338V;ENSP00000350066:A384V;ENSP00000398444:A330V	ENSP00000350066:A384V	A	+	2	0	ECE2	185485452	0.999000	0.42202	0.877000	0.34402	0.977000	0.68977	4.230000	0.58632	0.962000	0.38057	0.643000	0.83706	GCG	-	pfam_Peptidase_M13_N		0.542	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECE2	protein_coding	OTTHUMT00000318874.3	C	NM_014693	-		184002758	+1	no_errors	ENST00000402825	ensembl	human	known	74_37	missense	SNP	0.891	T
ITPK1	3705	genome.wustl.edu	37	14	93408170	93408170	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr14:93408170C>T	ENST00000267615.6	-	11	1154	c.981G>A	c.(979-981)atG>atA	p.M327I	ITPK1_ENST00000354313.3_Intron|ITPK1_ENST00000556603.2_Missense_Mutation_p.M327I|ITPK1_ENST00000555495.1_Missense_Mutation_p.M208I			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase	327					blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		CTGTGGCTGCCATGGCTGTGC	0.687																																																	0								ENSG00000100605						19.0	17.0	18.0					14																	93408170		2091	4106	6197	ITPK1	SO:0001583	missense	0			-	HGNC	U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.981G>A	14.37:g.93408170C>T	ENSP00000267615:p.Met327Ile	Somatic	0	22	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	82	19	80.39	Q9BTL6|Q9H2E7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Inositol_tetrakis-P_1-kinase	p.M327I	ENST00000267615.6	37	c.981	CCDS9907.1	14	.	.	.	.	.	.	.	.	.	.	c	0.009	-1.841767	0.00573	.	.	ENSG00000100605	ENST00000405174;ENST00000556603;ENST00000555495;ENST00000267615;ENST00000311458	.	.	.	3.27	-6.54	0.01860	.	1.091490	0.06803	N	0.789042	T	0.14960	0.0361	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17228	-1.0376	9	0.38643	T	0.18	4.6798	3.8705	0.09035	0.0956:0.1138:0.2858:0.5048	.	327	Q13572	ITPK1_HUMAN	I	357;327;208;327;327	.	ENSP00000267615:M327I	M	-	3	0	ITPK1	92477923	0.000000	0.05858	0.000000	0.03702	0.119000	0.20118	-2.794000	0.00765	-3.458000	0.00159	-0.448000	0.05591	ATG	-	NULL		0.687	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPK1	protein_coding	OTTHUMT00000412421.2	C	NM_014216	-		93408170	-1	no_errors	ENST00000267615	ensembl	human	known	74_37	missense	SNP	0.000	T
DAB2	1601	genome.wustl.edu	37	5	39394370	39394370	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr5:39394370G>C	ENST00000320816.6	-	2	520	c.53C>G	c.(52-54)gCc>gGc	p.A18G	DAB2_ENST00000545653.1_Missense_Mutation_p.A18G|DAB2_ENST00000512525.1_5'Flank|DAB2_ENST00000339788.6_Missense_Mutation_p.A18G|DAB2_ENST00000509337.1_Missense_Mutation_p.A18G	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	18					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			TTTTGGTGCGGCCTGTTGGTC	0.493																																																	0								ENSG00000153071						162.0	141.0	148.0					5																	39394370		2203	4300	6503	DAB2	SO:0001583	missense	0			-	HGNC	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.53C>G	5.37:g.39394370G>C	ENSP00000313391:p.Ala18Gly	Somatic	0	35	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	85	13.27	A6NES5|Q13598|Q9BTY0|Q9UK04	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom	p.A18G	ENST00000320816.6	37	c.53	CCDS34149.1	5	.	.	.	.	.	.	.	.	.	.	G	19.92	3.916673	0.73098	.	.	ENSG00000153071	ENST00000320816;ENST00000339788;ENST00000545653;ENST00000509337;ENST00000511792;ENST00000503513;ENST00000515700	T;T;T;T	0.38401	1.14;1.2;1.14;1.14	5.93	5.93	0.95920	.	0.528179	0.21802	N	0.068910	T	0.47303	0.1438	L	0.46157	1.445	0.37699	D	0.924144	P;P	0.52061	0.651;0.95	B;P	0.50708	0.15;0.648	T	0.47182	-0.9137	10	0.56958	D	0.05	-15.4919	20.34	0.98759	0.0:0.0:1.0:0.0	.	18;18	P98082;P98082-3	DAB2_HUMAN;.	G	18	ENSP00000313391:A18G;ENSP00000345508:A18G;ENSP00000439919:A18G;ENSP00000426245:A18G	ENSP00000313391:A18G	A	-	2	0	DAB2	39430127	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	4.961000	0.63681	2.817000	0.96982	0.561000	0.74099	GCC	-	NULL		0.493	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAB2	protein_coding	OTTHUMT00000367014.1	G	NM_001343	-		39394370	-1	no_errors	ENST00000320816	ensembl	human	known	74_37	missense	SNP	0.995	C
DIP2C	22982	genome.wustl.edu	37	10	390977	390979	+	In_Frame_Del	DEL	GCC	GCC	-			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	GCC	GCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr10:390977_390979delGCC	ENST00000280886.6	-	27	3390_3392	c.3303_3305delGGC	c.(3301-3306)gcggct>gct	p.1101_1102AA>A		NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1101						nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.A1102delA(1)		breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		GACGTCCACAGCCGCCGCCGCCT	0.596																																																	1	Deletion - In frame(1)	large_intestine(1)						ENSG00000151240																																			DIP2C	SO:0001651	inframe_deletion	0				HGNC	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.3303_3305delGGC	10.37:g.390986_390988delGCC	ENSP00000280886:p.Ala1102del	Somatic	0	39	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	22	8.33	B4DPI5|Q5SS78	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.A1102in_frame_del	ENST00000280886.6	37	c.3305_3303	CCDS7054.1	10																																																																																			-	pfam_AMP-dep_Synth/Lig		0.596	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2C	protein_coding	OTTHUMT00000046389.1	GCC	NM_014974			390979	-1	no_errors	ENST00000280886	ensembl	human	known	74_37	in_frame_del	DEL	0.979:0.971:0.194	-
UROD	7389	genome.wustl.edu	37	1	45479966	45479967	+	Intron	INS	-	-	T	rs57055690|rs575204537	byFrequency	TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr1:45479966_45479967insT	ENST00000246337.4	+	7	755				HECTD3_ENST00000372172.4_5'Flank|UROD_ENST00000494399.1_3'UTR	NM_000374.4	NP_000365.3	P06132	DCUP_HUMAN	uroporphyrinogen decarboxylase						heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	uroporphyrinogen decarboxylase activity (GO:0004853)			endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4	Acute lymphoblastic leukemia(166;0.155)					AGGAAAGtaaattttttttttt	0.426									Porphyria Cutanea Tarda, Type II		OREG0013449	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000126088																																			UROD	SO:0001627	intron_variant	0	Familial Cancer Database	PCT-II		HGNC	BC001778	CCDS518.1	1p34	2012-10-02			ENSG00000126088	ENSG00000126088	4.1.1.37		12591	protein-coding gene	gene with protein product		613521				3015909, 3460962	Standard	NM_000374		Approved		uc001cna.2	P06132	OTTHUMG00000008949	ENST00000246337.4:c.637-144->T	1.37:g.45479977_45479977dupT		Somatic	0	30	0.00	931	0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39	A8K762|Q16863|Q16883|Q53YB8|Q53ZP6|Q6IB28|Q9BUZ0	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000246337.4	37	NULL	CCDS518.1	1																																																																																			-	-		0.426	UROD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UROD	protein_coding	OTTHUMT00000024803.1	-	NM_000374			45479967	+1	no_errors	ENST00000472254	ensembl	human	known	74_37	rna	INS	0.001:0.007	T
EEA1	8411	genome.wustl.edu	37	12	93171868	93171868	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr12:93171868C>T	ENST00000322349.8	-	26	4006	c.3742G>A	c.(3742-3744)Gaa>Aaa	p.E1248K		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	1248					early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						CCTAAGTTTTCATTTAATGCT	0.383																																																	0								ENSG00000102189						219.0	201.0	207.0					12																	93171868		2203	4300	6503	EEA1	SO:0001583	missense	0			-	HGNC	L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.3742G>A	12.37:g.93171868C>T	ENSP00000317955:p.Glu1248Lys	Somatic	0	46	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	45	18.18	Q14221	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Znf_C2H2	p.E1248K	ENST00000322349.8	37	c.3742	CCDS31874.1	12	.	.	.	.	.	.	.	.	.	.	C	31	5.068572	0.93950	.	.	ENSG00000102189	ENST00000322349	T	0.69306	-0.39	5.61	5.61	0.85477	.	0.000000	0.56097	D	0.000040	T	0.72969	0.3527	L	0.36672	1.1	0.80722	D	1	D	0.63880	0.993	D	0.66196	0.942	T	0.65278	-0.6207	10	0.12766	T	0.61	.	19.6334	0.95719	0.0:1.0:0.0:0.0	.	1248	Q15075	EEA1_HUMAN	K	1248	ENSP00000317955:E1248K	ENSP00000317955:E1248K	E	-	1	0	EEA1	91695999	1.000000	0.71417	1.000000	0.80357	0.648000	0.38561	7.594000	0.82698	2.629000	0.89072	0.585000	0.79938	GAA	-	NULL		0.383	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEA1	protein_coding	OTTHUMT00000407304.1	C	NM_003566	-		93171868	-1	no_errors	ENST00000322349	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNRD1-AS1	80862	genome.wustl.edu	37	6	30024687	30024687	+	RNA	DEL	A	A	-			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr6:30024687delA	ENST00000431012.1	-	0	984				ZNRD1-AS1_ENST00000420251.1_RNA|ZNRD1-AS1_ENST00000421692.1_RNA|ZNRD1-AS1_ENST00000376797.3_RNA|ZNRD1-AS1_ENST00000452229.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000437417.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000422224.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		CGAGCATTTGAAAAAAAAAAG	0.308																																																	0								ENSG00000204623																																			ZNRD1-AS1			0				HGNC	AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.30024687delA		Somatic	0	21	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	19	9.52		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000431012.1	37	NULL		6																																																																																			-	-		0.308	ZNRD1-AS1-005	KNOWN	basic|exp_conf	antisense	ZNRD1-AS1	antisense	OTTHUMT00000253082.1	A	NR_026751			30024687	-1	no_errors	ENST00000431012	ensembl	human	known	74_37	rna	DEL	0.017	-
PHKA2	5256	genome.wustl.edu	37	X	18959720	18959720	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chrX:18959720G>A	ENST00000379942.4	-	8	1456	c.791C>T	c.(790-792)tCc>tTc	p.S264F		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	264					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					GGCCGGGAAGGAAATAATGGA	0.403																																																	0								ENSG00000044446						119.0	109.0	112.0					X																	18959720		2203	4300	6503	PHKA2	SO:0001583	missense	0			-	HGNC		CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.791C>T	X.37:g.18959720G>A	ENSP00000369274:p.Ser264Phe	Somatic	0	27	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.S264F	ENST00000379942.4	37	c.791	CCDS14190.1	X	.	.	.	.	.	.	.	.	.	.	g	28.4	4.917218	0.92249	.	.	ENSG00000044446	ENST00000379942	D	0.93133	-3.17	5.52	5.52	0.82312	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.97698	0.9245	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.98742	1.0717	10	0.87932	D	0	-14.0871	18.4804	0.90809	0.0:0.0:1.0:0.0	.	264	P46019	KPB2_HUMAN	F	264	ENSP00000369274:S264F	ENSP00000369274:S264F	S	-	2	0	PHKA2	18869641	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.807000	0.99171	2.306000	0.77630	0.597000	0.82753	TCC	-	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like		0.403	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKA2	protein_coding	OTTHUMT00000055960.1	G	NM_000292	-		18959720	-1	no_errors	ENST00000379942	ensembl	human	known	74_37	missense	SNP	1.000	A
DCAF8L2	347442	genome.wustl.edu	37	X	27765613	27765613	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chrX:27765613C>A	ENST00000451261.2	+	5	1000	c.601C>A	c.(601-603)Cgt>Agt	p.R201S		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	201										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						GCTGGGTTCACGTCCCCGCTT	0.587																																																	0								ENSG00000189186						46.0	42.0	43.0					X																	27765613		692	1591	2283	DCAF8L2	SO:0001583	missense	0			-	HGNC		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.601C>A	X.37:g.27765613C>A	ENSP00000462745:p.Arg201Ser	Somatic	0	23	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	10	68.75	B2RXH9|J3KT06	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R201S	ENST00000451261.2	37	c.601	CCDS59162.1	X																																																																																			-	NULL		0.587	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L2	protein_coding	OTTHUMT00000056143.4	C	XM_293354	-		27765613	+1	no_errors	ENST00000451261	ensembl	human	known	74_37	missense	SNP	0.003	A
PRSS1	5644	genome.wustl.edu	37	7	142460339	142460339	+	Missense_Mutation	SNP	G	G	A	rs200973660		TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr7:142460339G>A	ENST00000311737.7	+	4	518	c.512G>A	c.(511-513)tGt>tAt	p.C171Y	PRSS1_ENST00000486171.1_Missense_Mutation_p.C185Y	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	171	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	CAGGCTAAGTGTGAAGCCTCC	0.527																																																	0								ENSG00000204983						293.0	285.0	288.0					7																	142460339		2203	4300	6503	PRSS1	SO:0001583	missense	0			-	HGNC	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.512G>A	7.37:g.142460339G>A	ENSP00000308720:p.Cys171Tyr	Somatic	0	60	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	90	10.89	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.C171Y	ENST00000311737.7	37	c.512	CCDS5872.1	7	.	.	.	.	.	.	.	.	.	.	G	13.16	2.153199	0.38021	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243;ENST00000492062	D;D;D	0.96992	-4.2;-4.2;-2.52	3.28	3.28	0.37604	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.98918	0.9633	H	0.99104	4.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98703	1.0701	10	0.87932	D	0	.	14.0086	0.64481	0.0:0.0:1.0:0.0	.	185;171	E7EQ64;P07477	.;TRY1_HUMAN	Y	185;171;161;121	ENSP00000417854:C185Y;ENSP00000308720:C171Y;ENSP00000419912:C121Y	ENSP00000308720:C171Y	C	+	2	0	PRSS1	142139913	1.000000	0.71417	0.080000	0.20451	0.020000	0.10135	9.762000	0.98944	1.789000	0.52484	0.398000	0.26397	TGT	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.527	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS1	protein_coding	OTTHUMT00000352538.2	G		rs200973660		142460339	+1	no_errors	ENST00000311737	ensembl	human	known	74_37	missense	SNP	0.978	A
IGSF21	84966	genome.wustl.edu	37	1	18691829	18691829	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr1:18691829G>A	ENST00000251296.1	+	6	1036	c.653G>A	c.(652-654)cGt>cAt	p.R218H		NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	218						extracellular region (GO:0005576)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		CTTCTGCACCGTGACCTGGAT	0.662																																																	0								ENSG00000117154						50.0	56.0	54.0					1																	18691829		2203	4300	6503	IGSF21	SO:0001583	missense	0			-	HGNC	AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.653G>A	1.37:g.18691829G>A	ENSP00000251296:p.Arg218His	Somatic	0	41	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q8NBR8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.R218H	ENST00000251296.1	37	c.653	CCDS184.1	1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.545454	0.86022	.	.	ENSG00000117154	ENST00000251296	T	0.59906	0.23	5.03	4.11	0.48088	.	0.000000	0.85682	D	0.000000	T	0.62672	0.2447	L	0.32530	0.975	0.58432	D	0.999998	D	0.89917	1.0	D	0.66196	0.942	T	0.62627	-0.6814	10	0.45353	T	0.12	-13.3939	12.2106	0.54377	0.0845:0.0:0.9155:0.0	.	218	Q96ID5	IGS21_HUMAN	H	218	ENSP00000251296:R218H	ENSP00000251296:R218H	R	+	2	0	IGSF21	18564416	1.000000	0.71417	0.833000	0.33012	0.988000	0.76386	8.905000	0.92613	1.244000	0.43870	0.561000	0.74099	CGT	-	NULL		0.662	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF21	protein_coding	OTTHUMT00000006924.1	G	NM_032880	-		18691829	+1	no_errors	ENST00000251296	ensembl	human	known	74_37	missense	SNP	0.995	A
DOCK6	57572	genome.wustl.edu	37	19	11347061	11347061	+	Missense_Mutation	SNP	G	G	A	rs199700158		TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr19:11347061G>A	ENST00000294618.7	-	20	2364	c.2353C>T	c.(2353-2355)Cgt>Tgt	p.R785C	C19orf80_ENST00000591200.1_5'Flank|DOCK6_ENST00000319867.7_Missense_Mutation_p.R89C|RN7SL298P_ENST00000581369.1_RNA	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	785					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						ATGACCAGACGCACGAGCTTG	0.617																																																	0								ENSG00000130158						20.0	25.0	23.0					19																	11347061		2054	4191	6245	DOCK6	SO:0001583	missense	0			-	HGNC		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.2353C>T	19.37:g.11347061G>A	ENSP00000294618:p.Arg785Cys	Somatic	0	46	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_DOCK_C/D_N	p.R785C	ENST00000294618.7	37	c.2353	CCDS45975.1	19	.	.	.	.	.	.	.	.	.	.	G	12.22	1.872318	0.33069	.	.	ENSG00000130158	ENST00000294618;ENST00000319867	T;T	0.31510	1.49;1.49	5.11	5.11	0.69529	.	0.614837	0.16879	N	0.195789	T	0.28699	0.0711	L	0.38175	1.15	0.23991	N	0.996246	B;P	0.48998	0.001;0.918	B;B	0.40741	0.003;0.339	T	0.16778	-1.0391	10	0.49607	T	0.09	-0.9938	17.2907	0.87156	0.0:0.0:1.0:0.0	.	89;785	C9IZV6;Q96HP0	.;DOCK6_HUMAN	C	785;89	ENSP00000294618:R785C;ENSP00000321556:R89C	ENSP00000294618:R785C	R	-	1	0	DOCK6	11208061	0.927000	0.31430	0.065000	0.19835	0.408000	0.30992	5.149000	0.64863	2.378000	0.81104	0.561000	0.74099	CGT	-	NULL		0.617	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK6	protein_coding	OTTHUMT00000453155.1	G	NM_020812	rs199700158		11347061	-1	no_errors	ENST00000294618	ensembl	human	known	74_37	missense	SNP	0.241	A
NOTCH3	4854	genome.wustl.edu	37	19	15285085	15285085	+	Silent	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr19:15285085G>A	ENST00000263388.2	-	25	4605	c.4530C>T	c.(4528-4530)cgC>cgT	p.R1510R		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1510					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CCAGCACGCCGCGGGCCAGCA	0.697																																																	0								ENSG00000074181						9.0	11.0	10.0					19																	15285085		2128	4159	6287	NOTCH3	SO:0001819	synonymous_variant	0			-	HGNC	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.4530C>T	19.37:g.15285085G>A		Somatic	0	37	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	31	16.22	Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_3,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.R1510	ENST00000263388.2	37	c.4530	CCDS12326.1	19																																																																																			-	pirsf_Notch,pfam_Notch_NOD_dom		0.697	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	protein_coding	OTTHUMT00000465714.1	G	NM_000435	-		15285085	-1	no_errors	ENST00000263388	ensembl	human	known	74_37	silent	SNP	0.171	A
GABRB2	2561	genome.wustl.edu	37	5	160761819	160761819	+	Missense_Mutation	SNP	T	T	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr5:160761819T>A	ENST00000393959.1	-	7	771	c.772A>T	c.(772-774)Atc>Ttc	p.I258F	GABRB2_ENST00000520240.1_Missense_Mutation_p.I258F|GABRB2_ENST00000353437.6_Missense_Mutation_p.I258F|GABRB2_ENST00000517547.1_Missense_Mutation_p.I98F|GABRB2_ENST00000274547.2_Missense_Mutation_p.I258F|GABRB2_ENST00000517901.1_Missense_Mutation_p.I195F			P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 2	258					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|GABA-A receptor activity (GO:0004890)|inhibitory extracellular ligand-gated ion channel activity (GO:0005237)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	26	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CAGGAGAGGATGGTAATCAGG	0.438																																																	0								ENSG00000145864						184.0	166.0	173.0					5																	160761819		2203	4300	6503	GABRB2	SO:0001583	missense	0			-	HGNC		CCDS4354.1, CCDS4355.1	5q34	2012-06-22			ENSG00000145864	ENSG00000145864		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4082	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 2"""	600232				7851879	Standard	NM_000813		Approved		uc003lys.1	P47870	OTTHUMG00000130349	ENST00000393959.1:c.772A>T	5.37:g.160761819T>A	ENSP00000377531:p.Ile258Phe	Somatic	0	78	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	42	22.22	A8K115|A8K1A0|D1LYT0|D1LYT1|Q16323|Q4FZB2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAb_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,prints_GABAAa_rcpt,tigrfam_Neur_channel	p.I258F	ENST00000393959.1	37	c.772	CCDS4355.1	5	.	.	.	.	.	.	.	.	.	.	T	28.5	4.926117	0.92319	.	.	ENSG00000145864	ENST00000393959;ENST00000274547;ENST00000353437;ENST00000520240;ENST00000517901;ENST00000517547	D;D;D;D;D;D	0.86497	-2.13;-2.13;-2.13;-2.13;-2.13;-2.13	5.34	5.34	0.76211	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.88983	0.6586	N	0.20986	0.625	0.80722	D	1	D;D;D;D	0.89917	0.999;0.996;1.0;0.999	D;D;D;D	0.87578	0.996;0.995;0.998;0.991	D	0.90829	0.4715	10	0.87932	D	0	.	15.3443	0.74324	0.0:0.0:0.0:1.0	.	98;195;258;258	B7Z279;E7EV50;P47870;P47870-1	.;.;GBRB2_HUMAN;.	F	258;258;258;258;195;98	ENSP00000377531:I258F;ENSP00000274547:I258F;ENSP00000274546:I258F;ENSP00000429320:I258F;ENSP00000430532:I195F;ENSP00000429750:I98F	ENSP00000274547:I258F	I	-	1	0	GABRB2	160694397	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.939000	0.87685	2.015000	0.59207	0.528000	0.53228	ATC	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,tigrfam_Neur_channel		0.438	GABRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRB2	protein_coding	OTTHUMT00000252704.1	T		-		160761819	-1	no_errors	ENST00000274547	ensembl	human	known	74_37	missense	SNP	1.000	A
DOCK9	23348	genome.wustl.edu	37	13	99498220	99498220	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr13:99498220G>A	ENST00000376460.1	-	38	4167	c.4087C>T	c.(4087-4089)Cag>Tag	p.Q1363*	DOCK9_ENST00000448493.2_Missense_Mutation_p.A1387V|DOCK9_ENST00000339416.2_Nonsense_Mutation_p.Q1364*	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	1364					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CCCAGCTGCTGCAATCTGGCA	0.507																																																	0								ENSG00000088387						130.0	133.0	132.0					13																	99498220		2093	4225	6318	DOCK9	SO:0001587	stop_gained	0			-	HGNC	AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.4087C>T	13.37:g.99498220G>A	ENSP00000365643:p.Gln1363*	Somatic	0	35	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Q1364*	ENST00000376460.1	37	c.4090	CCDS45062.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	42|42	9.649815|9.649815	0.99229|0.99229	.|.	.|.	ENSG00000088387|ENSG00000088387	ENST00000448493|ENST00000376460;ENST00000357329;ENST00000400235;ENST00000428223;ENST00000400220;ENST00000339416;ENST00000376453;ENST00000340449	T|.	0.20332|.	2.08|.	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	.|0.054840	.|0.85682	.|D	.|0.000000	T|.	0.78136|.	0.4236|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.78383|.	-0.2225|.	6|.	0.17832|0.54805	T|T	0.49|0.06	.|.	19.76|19.76	0.96311|0.96311	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	V|X	1387|1363;1364;1364;1363;294;1364;6;7	ENSP00000401958:A1387V|.	ENSP00000401958:A1387V|ENSP00000341086:Q1364X	A|Q	-|-	2|1	0|0	DOCK9|DOCK9	98296221|98296221	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.430000|9.430000	0.97488|0.97488	2.666000|2.666000	0.90696|0.90696	0.655000|0.655000	0.94253|0.94253	GCA|CAG	-	superfamily_ARM-type_fold		0.507	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK9	protein_coding	OTTHUMT00000045566.1	G	NM_015296	-		99498220	-1	no_errors	ENST00000339416	ensembl	human	known	74_37	nonsense	SNP	1.000	A
UBE3B	89910	genome.wustl.edu	37	12	109949045	109949045	+	Silent	SNP	C	C	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr12:109949045C>T	ENST00000342494.3	+	18	2488	c.1893C>T	c.(1891-1893)gaC>gaT	p.D631D	UBE3B_ENST00000434735.2_Silent_p.D631D|UBE3B_ENST00000280774.5_Silent_p.D631D|UBE3B_ENST00000535900.1_3'UTR	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	631					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						AAGAACTCGACAGGGACAGAA	0.488																																																	0								ENSG00000151148						169.0	133.0	145.0					12																	109949045		2203	4300	6503	UBE3B	SO:0001819	synonymous_variant	0			-	HGNC	BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.1893C>T	12.37:g.109949045C>T		Somatic	0	39	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HECT,pfam_IQ_motif_EF-hand-BS,superfamily_HECT,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.D631	ENST00000342494.3	37	c.1893	CCDS9129.1	12																																																																																			-	NULL		0.488	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3B	protein_coding	OTTHUMT00000403119.1	C	NM_183415	-		109949045	+1	no_errors	ENST00000342494	ensembl	human	known	74_37	silent	SNP	1.000	T
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037835	10037835	+	RNA	SNP	T	T	C			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chrY:10037835T>C	ENST00000515896.1	+	0	72									RNA, 5.8S ribosomal pseudogene 6																		TTAATGTGAATTGCAGGACAC	0.517																																																	0								ENSG00000251705																																			RNA5-8SP6			0			-	HGNC			Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037835T>C		Somatic	0	85	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	52	8.77		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			-	-		0.517	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	rRNA		T		-		10037835	+1	no_errors	ENST00000515896	ensembl	human	known	74_37	rna	SNP	1.000	C
IGSF1	3547	genome.wustl.edu	37	X	130413262	130413262	+	Frame_Shift_Del	DEL	G	G	-			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chrX:130413262delG	ENST00000361420.3	-	10	1779	c.1700delC	c.(1699-1701)acgfs	p.T567fs	IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370903.3_Frame_Shift_Del_p.T567fs|IGSF1_ENST00000370910.1_Frame_Shift_Del_p.T558fs|IGSF1_ENST00000370904.1_Frame_Shift_Del_p.T558fs			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	567					regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						GAGAAGGGCCGTGACTATGAA	0.617																																																	0								ENSG00000147255						57.0	53.0	54.0					X																	130413262		2203	4300	6503	IGSF1	SO:0001589	frameshift_variant	0				HGNC	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.1700delC	X.37:g.130413262delG	ENSP00000355010:p.Thr567fs	Somatic	0	36	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29	B5MEG2|H9KV64|O15070|Q9NTC8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T567fs	ENST00000361420.3	37	c.1700	CCDS14629.1	X																																																																																			-	NULL		0.617	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	protein_coding	OTTHUMT00000058288.1	G				130413262	-1	no_errors	ENST00000370903	ensembl	human	known	74_37	frame_shift_del	DEL	0.036	-
ITGAD	3681	genome.wustl.edu	37	16	31429830	31429830	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr16:31429830G>C	ENST00000389202.2	+	23	2774	c.2725G>C	c.(2725-2727)Gcc>Ccc	p.A909P		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	909					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						AAGCAGCAAGGCCACCTTCCA	0.577																																																	0								ENSG00000156886						129.0	118.0	121.0					16																	31429830		2197	4300	6497	ITGAD	SO:0001583	missense	0			-	HGNC	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.2725G>C	16.37:g.31429830G>C	ENSP00000373854:p.Ala909Pro	Somatic	0	27	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	17	26.09	Q15575|Q15576	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.A909P	ENST00000389202.2	37	c.2725	CCDS32438.1	16	.	.	.	.	.	.	.	.	.	.	G	13.59	2.283371	0.40394	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.46451	0.87	5.05	3.96	0.45880	Integrin alpha-2 (1);	.	.	.	.	T	0.38268	0.1034	L	0.27053	0.805	0.09310	N	1	P;P	0.45212	0.853;0.758	P;P	0.50162	0.633;0.633	T	0.15694	-1.0428	9	0.62326	D	0.03	.	6.9748	0.24669	0.8917:0.0:0.1083:0.0	.	925;909	Q59H14;Q13349	.;ITAD_HUMAN	P	925;909	ENSP00000373854:A909P	ENSP00000373854:A909P	A	+	1	0	ITGAD	31337331	0.136000	0.22515	0.137000	0.22149	0.430000	0.31655	0.955000	0.29188	0.774000	0.33427	-0.312000	0.09012	GCC	-	pfam_Integrin_alpha-2		0.577	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAD	protein_coding	OTTHUMT00000432836.1	G	NM_005353	-		31429830	+1	no_errors	ENST00000389202	ensembl	human	known	74_37	missense	SNP	0.194	C
CECR2	27443	genome.wustl.edu	37	22	17978464	17978464	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr22:17978464G>A	ENST00000400573.5	+	4	369	c.362G>A	c.(361-363)cGt>cAt	p.R121H	CECR2_ENST00000497534.1_3'UTR|CECR2_ENST00000342247.5_Missense_Mutation_p.R101H|CECR2_ENST00000262608.8_Missense_Mutation_p.R102H|CECR2_ENST00000400585.2_5'UTR			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	143					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		GACAGTCTCCGTGTGGAGCCA	0.488																																																	0								ENSG00000099954						93.0	90.0	91.0					22																	17978464		1880	4107	5987	CECR2	SO:0001583	missense	0			-	HGNC	AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400573.5:c.362G>A	22.37:g.17978464G>A	ENSP00000383417:p.Arg121His	Somatic	0	31	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	14	61.11	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R121H	ENST00000400573.5	37	c.362		22	.	.	.	.	.	.	.	.	.	.	G	36	5.696980	0.96802	.	.	ENSG00000099954	ENST00000342247;ENST00000400573;ENST00000262608	T;T;T	0.48836	0.8;0.8;0.8	6.01	6.01	0.97437	.	0.000000	0.31809	U	0.007022	T	0.74703	0.3751	M	0.85373	2.75	0.54753	D	0.999983	D	0.89917	1.0	D	0.85130	0.997	T	0.76900	-0.2788	10	0.87932	D	0	-11.2533	20.5141	0.99211	0.0:0.0:1.0:0.0	.	143	Q9BXF3	CECR2_HUMAN	H	101;121;102	ENSP00000341219:R101H;ENSP00000383417:R121H;ENSP00000262608:R102H	ENSP00000262608:R102H	R	+	2	0	CECR2	16358464	1.000000	0.71417	0.982000	0.44146	0.959000	0.62525	9.381000	0.97205	2.850000	0.98022	0.655000	0.94253	CGT	-	NULL		0.488	CECR2-001	NOVEL	basic|appris_candidate_longest	protein_coding	CECR2	protein_coding	OTTHUMT00000316104.5	G	NM_031413	-		17978464	+1	no_errors	ENST00000400573	ensembl	human	novel	74_37	missense	SNP	1.000	A
WDR83	84292	genome.wustl.edu	37	19	12784098	12784098	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr19:12784098G>A	ENST00000418543.3	+	10	1115	c.766G>A	c.(766-768)Gac>Aac	p.D256N	WDR83OS_ENST00000596731.1_5'Flank|WDR83OS_ENST00000600694.1_5'Flank|WDR83_ENST00000242796.4_Missense_Mutation_p.D256N	NM_001099737.2	NP_001093207.1	Q9BRX9	WDR83_HUMAN	WD repeat domain 83	256					mRNA splicing, via spliceosome (GO:0000398)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)				breast(2)|large_intestine(1)|lung(1)	4						CTGTTCTGAGGACGGGAAGGT	0.567																																																	0								ENSG00000123154						146.0	133.0	138.0					19																	12784098		2203	4300	6503	WDR83	SO:0001583	missense	0			-	HGNC	AK074525	CCDS12275.1	19p13.13	2013-01-09			ENSG00000123154	ENSG00000123154		"""WD repeat domain containing"""	32672	protein-coding gene	gene with protein product	"""MAPK organizer 1"""					15118098, 16407229	Standard	NM_032332		Approved	MORG1	uc010dyw.3	Q9BRX9	OTTHUMG00000169356	ENST00000418543.3:c.766G>A	19.37:g.12784098G>A	ENSP00000402653:p.Asp256Asn	Somatic	0	16	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	13	35.00	B2RAF1|Q53FT6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.D256N	ENST00000418543.3	37	c.766	CCDS12275.1	19	.	.	.	.	.	.	.	.	.	.	G	19.18	3.777954	0.70107	.	.	ENSG00000123154	ENST00000418543;ENST00000242796	D;D	0.88975	-2.45;-2.45	5.43	4.4	0.53042	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.044316	0.85682	D	0.000000	D	0.92008	0.7468	M	0.93328	3.405	0.80722	D	1	B	0.24426	0.103	B	0.31946	0.138	D	0.91963	0.5580	10	0.87932	D	0	.	12.5293	0.56104	0.082:0.0:0.918:0.0	.	256	Q9BRX9	WDR83_HUMAN	N	256	ENSP00000402653:D256N;ENSP00000242796:D256N	ENSP00000242796:D256N	D	+	1	0	WDR83	12645098	1.000000	0.71417	0.988000	0.46212	0.986000	0.74619	6.043000	0.71004	2.549000	0.85964	0.561000	0.74099	GAC	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep		0.567	WDR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR83	protein_coding	OTTHUMT00000403648.1	G	NM_032332	-		12784098	+1	no_errors	ENST00000242796	ensembl	human	known	74_37	missense	SNP	1.000	A
ANKRD31	256006	genome.wustl.edu	37	5	74400097	74400097	+	Nonsense_Mutation	SNP	C	C	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr5:74400097C>A	ENST00000274361.3	-	21	5307	c.5116G>T	c.(5116-5118)Gga>Tga	p.G1706*	ANKRD31_ENST00000504022.1_5'UTR|ANKRD31_ENST00000506364.2_Nonsense_Mutation_p.G1763*	NM_001164443.1	NP_001157915.1	Q8N7Z5	ANR31_HUMAN	ankyrin repeat domain 31	1706										endometrium(1)|kidney(4)	5						TTAATTCTTCCTAGTAATATC	0.284																																																	0								ENSG00000145700						35.0	29.0	31.0					5																	74400097		692	1591	2283	ANKRD31	SO:0001587	stop_gained	0			-	HGNC	AK097510	CCDS47233.1	5q13.3	2013-01-10			ENSG00000145700	ENSG00000145700		"""Ankyrin repeat domain containing"""	26853	protein-coding gene	gene with protein product							Standard	NM_001164443		Approved	FLJ40191	uc003kdo.2	Q8N7Z5	OTTHUMG00000162649	ENST00000274361.3:c.5116G>T	5.37:g.74400097C>A	ENSP00000274361:p.Gly1706*	Somatic	0	70	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	86	15.69		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.G1706*	ENST00000274361.3	37	c.5116		5	.	.	.	.	.	.	.	.	.	.	C	37	6.045109	0.97231	.	.	ENSG00000145700	ENST00000510320;ENST00000274361	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.8426	0.96695	0.0:1.0:0.0:0.0	.	.	.	.	X	25;1706	.	ENSP00000274361:G1706X	G	-	1	0	ANKRD31	74435853	0.999000	0.42202	0.987000	0.45799	0.997000	0.91878	5.320000	0.65841	2.751000	0.94390	0.591000	0.81541	GGA	-	NULL		0.284	ANKRD31-201	KNOWN	basic|appris_principal	protein_coding	ANKRD31	protein_coding		C	NM_001164443	-		74400097	-1	no_errors	ENST00000274361	ensembl	human	known	74_37	nonsense	SNP	0.997	A
FBXO5	26271	genome.wustl.edu	37	6	153293621	153293621	+	Intron	SNP	G	G	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr6:153293621G>T	ENST00000229758.3	-	4	968				FBXO5_ENST00000477822.1_5'UTR|FBXO5_ENST00000367241.3_Intron	NM_012177.3	NP_036309.1	Q9UKT4	FBX5_HUMAN	F-box protein 5						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibition of mitotic anaphase-promoting complex activity (GO:0060565)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|negative regulation of meiosis (GO:0045835)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|oocyte maturation (GO:0001556)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly involved in female meiosis I (GO:0007057)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	15		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		ATAGAATTTAGAAATTATTTC	0.294																																					NSCLC(121;372 1757 17721 17977 29669)												0								ENSG00000112029						19.0	19.0	19.0					6																	153293621		2149	4283	6432	FBXO5	SO:0001627	intron_variant	0			-	HGNC	AF129535	CCDS5242.1, CCDS47501.1	6q25-q26	2008-02-05	2004-06-15		ENSG00000112029	ENSG00000112029		"""F-boxes /  ""other"""""	13584	protein-coding gene	gene with protein product		606013	"""F-box only protein 5"""			10531035, 10531037	Standard	NM_012177		Approved	FBX5, Fbxo31, EMI1	uc003qpg.3	Q9UKT4	OTTHUMG00000015854	ENST00000229758.3:c.910-32C>A	6.37:g.153293621G>T		Somatic	0	13	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	70	25.53	B3KNX5|Q5TF47|Q8WV29|Q9UGC8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000229758.3	37	NULL	CCDS5242.1	6																																																																																			-	-		0.294	FBXO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO5	protein_coding	OTTHUMT00000042757.1	G		-		153293621	-1	no_errors	ENST00000477822	ensembl	human	known	74_37	rna	SNP	0.001	T
AK5	26289	genome.wustl.edu	37	1	77857162	77857163	+	Intron	INS	-	-	TGTA	rs201658908		TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr1:77857162_77857163insTGTA	ENST00000354567.2	+	7	1154				AC095030.1_ENST00000408737.1_RNA|AK5_ENST00000344720.5_Intron	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5						ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						acatatgtgtgtgtgtatgtgt	0.233																																																	0								ENSG00000221664																																			AC095030.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.892-19503->TGTA	1.37:g.77857162_77857163insTGTA		Somatic	0	30	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	25	16.67	Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000354567.2	37	NULL	CCDS675.1	1																																																																																			-	-		0.233	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221664	protein_coding	OTTHUMT00000026993.4	-	NM_174858			77857163	-1	no_errors	ENST00000408737	ensembl	human	novel	74_37	rna	INS	0.991:0.991	TGTA
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037867	10037867	+	RNA	SNP	C	C	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chrY:10037867C>T	ENST00000515896.1	+	0	104									RNA, 5.8S ribosomal pseudogene 6																		ACACTTCGAACGCACTTGCGG	0.557																																																	0								ENSG00000251705																																			RNA5-8SP6			0			-	HGNC			Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037867C>T		Somatic	0	78	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	36	23.40		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			-	-		0.557	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	rRNA		C		-		10037867	+1	no_errors	ENST00000515896	ensembl	human	known	74_37	rna	SNP	1.000	T
BGLAP	632	genome.wustl.edu	37	1	156212062	156212062	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr1:156212062G>A	ENST00000368272.4	+	1	310	c.40G>A	c.(40-42)Gca>Aca	p.A14T	PMF1_ENST00000567140.1_Intron|PAQR6_ENST00000492619.1_5'Flank|PMF1-BGLAP_ENST00000320139.5_Intron|PMF1-BGLAP_ENST00000490491.1_Intron|PMF1_ENST00000565805.1_Intron|PMF1-BGLAP_ENST00000368276.4_Intron	NM_199173.4	NP_954642.1	P02818	OSTCN_HUMAN	bone gamma-carboxyglutamate (gla) protein	14					bone development (GO:0060348)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cell aging (GO:0007569)|cellular response to growth factor stimulus (GO:0071363)|cellular response to vitamin D (GO:0071305)|odontogenesis (GO:0042476)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|regulation of bone mineralization (GO:0030500)|regulation of bone resorption (GO:0045124)|regulation of osteoclast differentiation (GO:0045670)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to gravity (GO:0009629)|response to hydroxyisoflavone (GO:0033594)|response to mechanical stimulus (GO:0009612)|response to testosterone (GO:0033574)|response to vitamin D (GO:0033280)|response to vitamin K (GO:0032571)|response to zinc ion (GO:0010043)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|perikaryon (GO:0043204)|rough endoplasmic reticulum (GO:0005791)	calcium ion binding (GO:0005509)|hydroxyapatite binding (GO:0046848)|structural constituent of bone (GO:0008147)|structural molecule activity (GO:0005198)			large_intestine(3)|lung(1)|urinary_tract(1)	5	Hepatocellular(266;0.158)				Gallium nitrate(DB05260)|Menadione(DB00170)|Phylloquinone(DB01022)	GGCCCTGGCCGCACTTTGCAT	0.672																																																	0								ENSG00000242252						66.0	51.0	56.0					1																	156212062		2202	4299	6501	BGLAP	SO:0001583	missense	0			-	HGNC	X04143	CCDS1134.1	1q22	2014-05-13	2008-08-01		ENSG00000242252	ENSG00000242252			1043	protein-coding gene	gene with protein product	"""osteocalcin"""	112260				2785029, 2394711	Standard	NM_199173		Approved	OCN	uc001fnt.3	P02818	OTTHUMG00000014819	ENST00000368272.4:c.40G>A	1.37:g.156212062G>A	ENSP00000357255:p.Ala14Thr	Somatic	0	16	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	17	51.43	Q5TCK6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GLA_domain,superfamily_GLA_domain,smart_GLA_domain,pfscan_GLA_domain,prints_Osteocalcin/MGP	p.A14T	ENST00000368272.4	37	c.40	CCDS1134.1	1	.	.	.	.	.	.	.	.	.	.	G	13.32	2.201356	0.38905	.	.	ENSG00000242252	ENST00000368272	T	0.45668	0.89	4.77	-2.64	0.06114	.	.	.	.	.	T	0.11239	0.0274	N	0.25380	0.74	0.09310	N	1	B	0.13594	0.008	B	0.06405	0.002	T	0.33240	-0.9876	9	0.38643	T	0.18	.	10.8847	0.46960	0.621:0.0:0.379:0.0	.	14	P02818	OSTCN_HUMAN	T	14	ENSP00000357255:A14T	ENSP00000357255:A14T	A	+	1	0	BGLAP	154478686	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-0.006000	0.12833	-0.629000	0.05575	-1.267000	0.01435	GCA	-	NULL		0.672	BGLAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BGLAP	protein_coding	OTTHUMT00000040867.2	G	NM_199173	-		156212062	+1	no_errors	ENST00000368272	ensembl	human	known	74_37	missense	SNP	0.003	A
MAL	4118	genome.wustl.edu	37	2	95719133	95719133	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr2:95719133C>T	ENST00000309988.4	+	4	504	c.395C>T	c.(394-396)tCc>tTc	p.S132F	MAL_ENST00000353004.3_Missense_Mutation_p.S90F|MAL_ENST00000354078.3_Missense_Mutation_p.S76F|AC103563.9_ENST00000442200.1_RNA|MAL_ENST00000349807.3_Missense_Mutation_p.S34F	NM_002371.3	NP_002362.1	P21145	MAL_HUMAN	mal, T-cell differentiation protein	132	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|central nervous system development (GO:0007417)|membrane raft polarization (GO:0001766)|myelination (GO:0042552)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	channel activity (GO:0015267)|lipid binding (GO:0008289)|peptidase activator activity involved in apoptotic process (GO:0016505)|structural constituent of myelin sheath (GO:0019911)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|prostate(2)	10				STAD - Stomach adenocarcinoma(1183;0.18)		CAGGTGTTCTCCTACATAGCC	0.532																																																	0								ENSG00000172005						236.0	217.0	223.0					2																	95719133		2203	4300	6503	MAL	SO:0001583	missense	0			-	HGNC		CCDS2006.1, CCDS2007.1, CCDS2008.1, CCDS2009.1	2q11.1	2008-07-29			ENSG00000172005	ENSG00000172005			6817	protein-coding gene	gene with protein product		188860					Standard	NM_002371		Approved		uc002stx.2	P21145	OTTHUMG00000132011	ENST00000309988.4:c.395C>T	2.37:g.95719133C>T	ENSP00000310880:p.Ser132Phe	Somatic	0	62	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	50	39.76	Q6FH77	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Marvel,prints_MAL	p.S132F	ENST00000309988.4	37	c.395	CCDS2006.1	2	.	.	.	.	.	.	.	.	.	.	C	22.8	4.336498	0.81801	.	.	ENSG00000172005	ENST00000309988;ENST00000353004;ENST00000354078;ENST00000349807	T;T	0.45276	1.75;0.9	5.57	5.57	0.84162	Marvel (1);MARVEL-like domain (1);	0.475476	0.25205	N	0.032352	T	0.62756	0.2454	M	0.78049	2.395	0.09310	N	1	P;P;P;P	0.52463	0.514;0.915;0.942;0.953	P;P;P;P	0.59761	0.452;0.784;0.684;0.863	T	0.59386	-0.7464	10	0.87932	D	0	.	15.4703	0.75437	0.0:1.0:0.0:0.0	.	34;90;76;132	P21145-4;P21145-2;P21145-3;P21145	.;.;.;MAL_HUMAN	F	132;90;76;34	ENSP00000310880:S132F;ENSP00000306568:S90F	ENSP00000310880:S132F	S	+	2	0	MAL	95082860	0.356000	0.24930	0.016000	0.15963	0.969000	0.65631	4.313000	0.59160	2.808000	0.96608	0.650000	0.86243	TCC	-	pfam_Marvel,prints_MAL		0.532	MAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAL	protein_coding	OTTHUMT00000254982.3	C	NM_002371	-		95719133	+1	no_errors	ENST00000309988	ensembl	human	known	74_37	missense	SNP	0.144	T
MT-CO2	4513	genome.wustl.edu	37	M	7595	7595	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chrM:7595G>A	ENST00000361739.1	+	1	10	c.10G>A	c.(10-12)Gca>Aca	p.A4T	MT-ND4L_ENST00000361335.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND3_ENST00000361227.2_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	4					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						TAATGGCACATGCAGCGCAAG	0.373																																																	0								ENSG00000198712																																			MT-CO2	SO:0001583	missense	0			-	HGNC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.10G>A	M.37:g.7595G>A	ENSP00000354876:p.Ala4Thr	Somatic	0	418	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	67	614	9.84	Q37526	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_c_oxidase_su2_C,pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cupredoxin,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	p.A4T	ENST00000361739.1	37	c.10		MT																																																																																			-	pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom		0.373	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	MT-CO2	protein_coding		G	YP_003024029	-		7595	+1	no_errors	ENST00000361739	ensembl	human	known	74_37	missense	SNP	NULL	A
OR4K5	79317	genome.wustl.edu	37	14	20388807	20388807	+	Silent	SNP	G	G	T	rs375886777		TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr14:20388807G>T	ENST00000315915.4	+	1	67	c.42G>T	c.(40-42)ctG>ctT	p.L14L		NM_001005483.1	NP_001005483.1	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K, member 5	14						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|liver(1)|lung(27)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AATTTGTACTGTTGGGACTCT	0.373																																																	0								ENSG00000176281	G		1,4405		0,1,2202	149.0	156.0	154.0		42	-1.2	0.0	14		154	0,8600		0,0,4300	no	coding-synonymous	OR4K5	NM_001005483.1		0,1,6502	TT,TG,GG		0.0,0.0227,0.0077		14/324	20388807	1,13005	2203	4300	6503	OR4K5	SO:0001819	synonymous_variant	0			-	HGNC	BK004355	CCDS32024.1	14q11.22	2012-08-09				ENSG00000176281		"""GPCR / Class A : Olfactory receptors"""	14745	protein-coding gene	gene with protein product						14983052	Standard	NM_001005483		Approved		uc010tkw.2	Q8NGD3		ENST00000315915.4:c.42G>T	14.37:g.20388807G>T		Somatic	0	40	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	54	8.47	Q6IFA7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L14	ENST00000315915.4	37	c.42	CCDS32024.1	14																																																																																			-	NULL		0.373	OR4K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K5	protein_coding	OTTHUMT00000409867.1	G	NM_001005483	-		20388807	+1	no_errors	ENST00000315915	ensembl	human	known	74_37	silent	SNP	0.000	T
RRN3	54700	genome.wustl.edu	37	16	15188050	15188050	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr16:15188050G>C	ENST00000198767.6	-	1	124	c.41C>G	c.(40-42)gCg>gGg	p.A14G	RRN3_ENST00000563559.1_Missense_Mutation_p.A14G|PDXDC1_ENST00000535621.2_Intron|RRN3_ENST00000429751.2_Missense_Mutation_p.A14G|RRN3_ENST00000327307.7_5'Flank|RP11-72I8.1_ENST00000569858.1_RNA|RRN3_ENST00000564131.1_Missense_Mutation_p.A14G	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	14					cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						CGAAGCGGCCGCATCTCCCGG	0.637																																																	0								ENSG00000085721						18.0	16.0	17.0					16																	15188050		2197	4296	6493	RRN3	SO:0001583	missense	0			-	HGNC	AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.41C>G	16.37:g.15188050G>C	ENSP00000198767:p.Ala14Gly	Somatic	0	67	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	58	35.56	A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNA_pol_I_trans_ini_fac_RRN3,superfamily_ARM-type_fold	p.A14G	ENST00000198767.6	37	c.41	CCDS10559.1	16	.	.	.	.	.	.	.	.	.	.	.	11.12	1.546510	0.27652	.	.	ENSG00000085721	ENST00000198767;ENST00000429751	T;T	0.53423	0.81;0.62	3.13	-2.24	0.06909	.	.	.	.	.	T	0.21468	0.0517	N	0.08118	0	0.18873	N	0.999987	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.14643	-1.0465	9	0.36615	T	0.2	.	3.7071	0.08405	0.3114:0.4106:0.278:0.0	.	14;14;14	F5H148;Q3MHU9;Q9NYV6	.;.;RRN3_HUMAN	G	14	ENSP00000198767:A14G;ENSP00000402027:A14G	ENSP00000198767:A14G	A	-	2	0	RRN3	15095551	0.000000	0.05858	0.049000	0.19019	0.037000	0.13140	-0.353000	0.07691	-0.169000	0.10834	0.305000	0.20034	GCG	-	NULL		0.637	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRN3	protein_coding	OTTHUMT00000252087.2	G	NM_018427	-		15188050	-1	no_errors	ENST00000198767	ensembl	human	known	74_37	missense	SNP	0.021	C
CDK5RAP3	80279	genome.wustl.edu	37	17	46053334	46053334	+	Silent	SNP	A	A	G	rs202125432	byFrequency	TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr17:46053334A>G	ENST00000338399.4	+	8	859	c.753A>G	c.(751-753)gaA>gaG	p.E251E	CDK5RAP3_ENST00000536708.2_Silent_p.E276E|RP11-6N17.9_ENST00000582262.1_RNA	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3	251					brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)	p.E251E(1)		NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						CTGTGGTGGAACGACCCCACC	0.602																																																	1	Substitution - coding silent(1)	prostate(1)						ENSG00000108465																																			CDK5RAP3	SO:0001819	synonymous_variant	0			-	HGNC	AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.753A>G	17.37:g.46053334A>G		Somatic	0	38	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	36	17.78	B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF773	p.E251	ENST00000338399.4	37	c.753	CCDS42356.1	17																																																																																			-	pfam_DUF773		0.602	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK5RAP3	protein_coding	OTTHUMT00000442913.1	A	NM_176096	rs202125432		46053334	+1	no_errors	ENST00000338399	ensembl	human	known	74_37	silent	SNP	1.000	G
RBM15	64783	genome.wustl.edu	37	1	110883880	110883880	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr1:110883880G>T	ENST00000369784.3	+	1	2753	c.1853G>T	c.(1852-1854)cGg>cTg	p.R618L	RP5-1074L1.1_ENST00000449169.1_RNA|RBM15_ENST00000602849.1_Missense_Mutation_p.R618L|RBM15_ENST00000487146.2_Missense_Mutation_p.R618L	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	618	Arg-rich.				negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		GATCGCAGGCGGGATGGTTGG	0.617			T	MKL1	acute megakaryocytic leukemia																																			Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	0								ENSG00000162775						46.0	44.0	45.0					1																	110883880		2203	4300	6503	RBM15	SO:0001583	missense	0			-	HGNC	AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.1853G>T	1.37:g.110883880G>T	ENSP00000358799:p.Arg618Leu	Somatic	0	38	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPOC_C,pfam_RRM_dom,superfamily_SPOC_like_C_dom,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.R618L	ENST00000369784.3	37	c.1853	CCDS822.1	1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.022553	0.54683	.	.	ENSG00000162775	ENST00000369784	T	0.20200	2.09	4.77	4.77	0.60923	.	0.000000	0.42172	D	0.000757	T	0.14013	0.0339	L	0.48642	1.525	0.45205	D	0.998211	P;P	0.52170	0.951;0.918	P;B	0.45377	0.478;0.286	T	0.01378	-1.1370	10	0.40728	T	0.16	-8.3528	13.6747	0.62447	0.0:0.1549:0.8451:0.0	.	618;618	Q96T37-3;Q96T37	.;RBM15_HUMAN	L	618	ENSP00000358799:R618L	ENSP00000358799:R618L	R	+	2	0	RBM15	110685403	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.108000	0.64609	2.480000	0.83734	0.655000	0.94253	CGG	-	NULL		0.617	RBM15-001	KNOWN	basic|CCDS	protein_coding	RBM15	protein_coding	OTTHUMT00000031114.2	G	NM_022768	-		110883880	+1	no_errors	ENST00000369784	ensembl	human	known	74_37	missense	SNP	0.998	T
RP1	6101	genome.wustl.edu	37	8	55537592	55537592	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr8:55537592G>A	ENST00000220676.1	+	4	1298	c.1150G>A	c.(1150-1152)Gca>Aca	p.A384T		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	384					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AAAGCTTGCAGCATGTTCATT	0.413																																					Colon(91;1014 1389 7634 14542 40420)												0								ENSG00000104237						73.0	69.0	71.0					8																	55537592		2203	4300	6503	RP1	SO:0001583	missense	0			-	HGNC	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.1150G>A	8.37:g.55537592G>A	ENSP00000220676:p.Ala384Thr	Somatic	0	43	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	45	13.46		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.A384T	ENST00000220676.1	37	c.1150	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	G	2.175	-0.388889	0.04932	.	.	ENSG00000104237	ENST00000220676	T	0.22336	1.96	5.08	-0.714	0.11219	.	0.602886	0.15771	N	0.245438	T	0.13927	0.0337	L	0.48362	1.52	0.09310	N	1	B	0.26195	0.144	B	0.18561	0.022	T	0.16808	-1.0390	10	0.35671	T	0.21	.	4.7153	0.12893	0.3404:0.0:0.4231:0.2365	.	384	P56715	RP1_HUMAN	T	384	ENSP00000220676:A384T	ENSP00000220676:A384T	A	+	1	0	RP1	55700145	0.067000	0.21026	0.005000	0.12908	0.002000	0.02628	1.164000	0.31810	-0.065000	0.13021	-0.895000	0.02911	GCA	-	NULL		0.413	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	protein_coding	OTTHUMT00000378532.2	G	NM_006269	-		55537592	+1	no_errors	ENST00000220676	ensembl	human	known	74_37	missense	SNP	0.003	A
ORC1	4998	genome.wustl.edu	37	1	52854898	52854898	+	Missense_Mutation	SNP	T	T	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr1:52854898T>A	ENST00000371568.3	-	7	1396	c.1178A>T	c.(1177-1179)cAg>cTg	p.Q393L	ORC1_ENST00000371566.1_Missense_Mutation_p.Q393L	NM_001190818.1|NM_001190819.1|NM_004153.3	NP_001177747.1|NP_001177748.1|NP_004144.2	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	393					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear origin of replication recognition complex (GO:0005664)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CCGAAGCTGCTGCCTAATCCG	0.443																																																	0								ENSG00000085840						151.0	130.0	137.0					1																	52854898		2203	4300	6503	ORC1	SO:0001583	missense	0			-	HGNC		CCDS566.1	1p32	2010-10-12	2010-10-12	2010-10-12	ENSG00000085840	ENSG00000085840		"""ATPases / AAA-type"""	8487	protein-coding gene	gene with protein product	"""origin recognition complex, subunit 1, S. cerevisiae, homolog-like"", ""origin recognition complex 1"", ""replication control protein 1"""	601902	"""origin recognition complex, subunit 1 (yeast homolog)-like"", ""origin recognition complex, subunit 1-like (yeast)"", ""origin recognition complex, subunit 1 homolog (S. cerevisiae)"""	ORC1L		8884289	Standard	NM_004153		Approved	HSORC1, PARC1	uc001ctu.3	Q13415	OTTHUMG00000008104	ENST00000371568.3:c.1178A>T	1.37:g.52854898T>A	ENSP00000360623:p.Gln393Leu	Somatic	0	34	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	47	9.62	D3DQ34|Q13471|Q5T0F5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BAH_dom,pfam_ATPase_AAA_core,pfam_Cdc6_C_dom,pfam_DUF2075,superfamily_P-loop_NTPase,smart_BAH_dom,smart_AAA+_ATPase,pfscan_BAH_dom	p.Q393L	ENST00000371568.3	37	c.1178	CCDS566.1	1	.	.	.	.	.	.	.	.	.	.	T	12.86	2.064493	0.36470	.	.	ENSG00000085840	ENST00000371568;ENST00000371566	T;T	0.43294	0.95;0.95	4.41	3.29	0.37713	.	0.367561	0.33457	N	0.004882	T	0.35248	0.0925	M	0.66939	2.045	0.35114	D	0.766386	B;B	0.32717	0.258;0.381	B;B	0.26969	0.075;0.075	T	0.46938	-0.9155	10	0.46703	T	0.11	-11.9877	6.9356	0.24464	0.0:0.1021:0.0:0.8979	.	393;393	B7Z8H0;Q13415	.;ORC1_HUMAN	L	393	ENSP00000360623:Q393L;ENSP00000360621:Q393L	ENSP00000360621:Q393L	Q	-	2	0	ORC1	52627486	1.000000	0.71417	0.998000	0.56505	0.705000	0.40729	1.773000	0.38563	1.024000	0.39682	-0.274000	0.10170	CAG	-	NULL		0.443	ORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORC1	protein_coding	OTTHUMT00000022202.1	T	NM_004153	-		52854898	-1	no_errors	ENST00000371566	ensembl	human	known	74_37	missense	SNP	0.998	A
ZNF521	25925	genome.wustl.edu	37	18	22805711	22805711	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr18:22805711C>T	ENST00000361524.3	-	4	2319	c.2171G>A	c.(2170-2172)tGc>tAc	p.C724Y	ZNF521_ENST00000538137.2_Missense_Mutation_p.C724Y|ZNF521_ENST00000584787.1_Missense_Mutation_p.C504Y|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	724					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GCAGAGGGTGCAGCGAAAGAA	0.453			T	PAX5	ALL																																			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0								ENSG00000198795						83.0	84.0	84.0					18																	22805711		2203	4300	6503	ZNF521	SO:0001583	missense	0			-	HGNC	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.2171G>A	18.37:g.22805711C>T	ENSP00000354794:p.Cys724Tyr	Somatic	0	25	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	16	20.00	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C724Y	ENST00000361524.3	37	c.2171	CCDS32806.1	18	.	.	.	.	.	.	.	.	.	.	C	10.42	1.345637	0.24426	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.58358	0.34;0.34	6.17	6.17	0.99709	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.80008	0.4545	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82076	-0.0636	10	0.87932	D	0	-23.4339	20.8794	0.99867	0.0:1.0:0.0:0.0	.	724	Q96K83	ZN521_HUMAN	Y	724;758;724	ENSP00000354794:C724Y;ENSP00000382352:C724Y	ENSP00000354794:C724Y	C	-	2	0	ZNF521	21059709	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	TGC	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.453	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	protein_coding	OTTHUMT00000446781.2	C	NM_015461	-		22805711	-1	no_errors	ENST00000361524	ensembl	human	known	74_37	missense	SNP	1.000	T
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037863	10037863	+	RNA	DEL	C	C	-	rs373540942		TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chrY:10037863delC	ENST00000515896.1	+	0	100									RNA, 5.8S ribosomal pseudogene 6																		ATCGACACTTCGAACGCACTT	0.552																																																	0								ENSG00000251705																																			RNA5-8SP6			0				HGNC			Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037863delC		Somatic	0	80	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	44	10.20		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			-	-		0.552	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	rRNA		C				10037863	+1	no_errors	ENST00000515896	ensembl	human	known	74_37	rna	DEL	1.000	-
LILRB5	10990	genome.wustl.edu	37	19	54759174	54759174	+	Silent	SNP	G	G	A	rs535392919		TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr19:54759174G>A	ENST00000316219.5	-	5	1034	c.927C>T	c.(925-927)agC>agT	p.S309S	LILRB5_ENST00000449561.2_Silent_p.S309S|LILRB5_ENST00000345866.6_Silent_p.S209S|LILRB5_ENST00000450632.1_Silent_p.S300S	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	309	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCAGGGGGTCGCTGGGGGCCG	0.667													.|||	1	0.000199681	0.0	0.0	5008	,	,		14414	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000105609						28.0	30.0	30.0					19																	54759174		2202	4298	6500	LILRB5	SO:0001819	synonymous_variant	0			-	HGNC	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.927C>T	19.37:g.54759174G>A		Somatic	1	125	0.79		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	130	16.13	Q8N760	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S300	ENST00000316219.5	37	c.900	CCDS12885.1	19																																																																																			-	smart_Ig_sub		0.667	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB5	protein_coding	OTTHUMT00000142877.2	G		-		54759174	-1	no_errors	ENST00000450632	ensembl	human	known	74_37	silent	SNP	0.822	A
ZNF605	100289635	genome.wustl.edu	37	12	133502016	133502016	+	Silent	SNP	C	C	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr12:133502016C>A	ENST00000360187.4	-	5	2217	c.1869G>T	c.(1867-1869)ggG>ggT	p.G623G	ZNF605_ENST00000392321.3_Silent_p.G654G|ZNF605_ENST00000331711.7_5'Flank	NM_183238.3	NP_899061.1	Q86T29	ZN605_HUMAN	zinc finger protein 605	623					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(16)|large_intestine(5)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	28	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00227)|all_epithelial(31;0.142)		OV - Ovarian serous cystadenocarcinoma(86;9.24e-09)|Epithelial(86;2.11e-07)|all cancers(50;5.27e-06)		TGAAGGTGGTCCCACACTCAT	0.388																																																	0								ENSG00000196458						120.0	115.0	116.0					12																	133502016		2203	4300	6503	ZNF605	SO:0001819	synonymous_variant	0			-	HGNC	AL832623	CCDS31938.1, CCDS53850.1	12q24.33	2013-01-08	2009-09-11	2009-09-11		ENSG00000196458		"""Zinc fingers, C2H2-type"", ""-"""	28068	protein-coding gene	gene with protein product							Standard	NM_183238		Approved		uc001uli.3	Q86T29		ENST00000360187.4:c.1869G>T	12.37:g.133502016C>A		Somatic	0	47	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	23	25.81	B3KVG4|D3DXJ0|Q86T91	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G623	ENST00000360187.4	37	c.1869	CCDS31938.1	12																																																																																			-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.388	ZNF605-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF605	protein_coding	OTTHUMT00000397135.2	C	NM_183238	-		133502016	-1	no_errors	ENST00000360187	ensembl	human	known	74_37	silent	SNP	0.445	A
FUK	197258	genome.wustl.edu	37	16	70503093	70503093	+	Silent	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr16:70503093G>A	ENST00000288078.6	+	10	1054	c.822G>A	c.(820-822)gaG>gaA	p.E274E	FUK_ENST00000378912.2_Silent_p.E306E|FUK_ENST00000571514.1_Intron	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	274						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				GCATGGCTGAGAACGTGACCA	0.592																																																	0								ENSG00000157353						127.0	129.0	128.0					16																	70503093		2000	4162	6162	FUK	SO:0001819	synonymous_variant	0			-	HGNC		CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.822G>A	16.37:g.70503093G>A		Somatic	0	18	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	24	38.46	Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fucokinase,pfam_GHMP_kinase_C_dom,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Trimer_LpxA-like,prints_Galkinase	p.E306	ENST00000288078.6	37	c.918	CCDS10891.2	16																																																																																			-	pfam_Fucokinase		0.592	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUK	protein_coding	OTTHUMT00000157291.2	G	NM_145059	-		70503093	+1	no_errors	ENST00000378912	ensembl	human	known	74_37	silent	SNP	0.796	A
AGAP2	116986	genome.wustl.edu	37	12	58131104	58131104	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr12:58131104G>A	ENST00000547588.1	-	1	925	c.926C>T	c.(925-927)tCc>tTc	p.S309F	AGAP2_ENST00000257897.3_Intron	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	309	Interaction with PLCG1. {ECO:0000250}.				axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						GGGCTGCGCGGAAGCAGCGGT	0.687																																																	0								ENSG00000135439						41.0	56.0	51.0					12																	58131104		1568	3582	5150	AGAP2	SO:0001583	missense	0			-	HGNC	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.926C>T	12.37:g.58131104G>A	ENSP00000449241:p.Ser309Phe	Somatic	0	109	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	163	1307	11.09	A8K9F7|O00578|Q548E0|Q8IWU3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ArfGAP,pfam_MIRO-like,pfam_Small_GTPase,pfam_Ankyrin_rpt,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Pleckstrin_homology,smart_ArfGAP,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP,prints_Small_GTPase	p.S309F	ENST00000547588.1	37	c.926	CCDS44932.1	12	.	.	.	.	.	.	.	.	.	.	G	10.83	1.461427	0.26248	.	.	ENSG00000135439	ENST00000547588	T	0.39229	1.09	4.83	2.85	0.33270	.	1.274000	0.05812	N	0.614090	T	0.20740	0.0499	N	0.08118	0	0.29772	N	0.834685	B;B	0.32467	0.372;0.255	B;B	0.24848	0.056;0.025	T	0.23511	-1.0186	9	.	.	.	.	5.6569	0.17647	0.1013:0.0:0.7065:0.1922	.	309;309	F8VVT9;Q99490	.;AGAP2_HUMAN	F	309	ENSP00000449241:S309F	.	S	-	2	0	AGAP2	56417371	1.000000	0.71417	0.995000	0.50966	0.017000	0.09413	2.785000	0.47782	1.163000	0.42636	-0.300000	0.09419	TCC	-	NULL		0.687	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AGAP2	protein_coding	OTTHUMT00000408367.1	G	NM_014770	-		58131104	-1	no_errors	ENST00000547588	ensembl	human	known	74_37	missense	SNP	0.951	A
AMZ2	51321	genome.wustl.edu	37	17	66247426	66247427	+	Intron	INS	-	-	CTGTATAG	rs200969552|rs58359332	byFrequency	TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr17:66247426_66247427insCTGTATAG	ENST00000359904.3	+	4	1718				AMZ2_ENST00000577273.1_Intron|AMZ2_ENST00000359783.4_Intron|AMZ2_ENST00000577985.1_Intron|AMZ2_ENST00000580753.1_Intron|AMZ2_ENST00000392720.2_Intron|AMZ2_ENST00000585050.1_Intron|AMZ2_ENST00000577866.1_Intron	NM_016627.4	NP_057711.3	Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2								metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			GATATTTAAAATATTTTCAGTT	0.356														1657	0.330871	0.5121	0.3487	5008	,	,		15358	0.2768		0.1918	False		,,,				2504	0.272																0								ENSG00000196704																																			AMZ2	SO:0001627	intron_variant	0				HGNC	CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000359904.3:c.586+107->CTGTATAG	17.37:g.66247426_66247427insCTGTATAG		Somatic	NA	NA	NA		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NLD9|B3KR44|Q5XKF1|Q9NZE2	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000359904.3	37	NULL	CCDS11674.1	17																																																																																			-	-		0.356	AMZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ2	protein_coding	OTTHUMT00000448261.1	-	NM_016627			66247427	+1	no_errors	ENST00000581779	ensembl	human	known	74_37	rna	INS	0.001:0.003	CTGTATAG
MCM3	4172	genome.wustl.edu	37	6	52142390	52142390	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr6:52142390C>T	ENST00000229854.7	-	7	1052	c.976G>A	c.(976-978)Gaa>Aaa	p.E326K	MCM3_ENST00000419835.2_Missense_Mutation_p.E280K|MCM3_ENST00000596288.1_Missense_Mutation_p.E371K|MCM3_ENST00000476448.1_5'UTR			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	326	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					AGGTCTCGTTCCACCCCTCCC	0.478																																																	0								ENSG00000112118						117.0	101.0	107.0					6																	52142390		2203	4300	6503	MCM3	SO:0001583	missense	0			-	HGNC	X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.976G>A	6.37:g.52142390C>T	ENSP00000229854:p.Glu326Lys	Somatic	0	75	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	54	26.03	B4DWW4|Q92660|Q9BTR3|Q9NUE7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,superfamily_NA-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase,prints_Mcm3	p.E371K	ENST00000229854.7	37	c.1111		6	.	.	.	.	.	.	.	.	.	.	C	36	5.737834	0.96865	.	.	ENSG00000112118	ENST00000229854;ENST00000419835	T;T	0.06218	3.33;3.33	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.19406	0.0466	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.00214	-1.1912	10	0.52906	T	0.07	-15.3088	19.6941	0.96016	0.0:1.0:0.0:0.0	.	280;326	B4DUQ9;P25205	.;MCM3_HUMAN	K	326;280	ENSP00000229854:E326K;ENSP00000388647:E280K	ENSP00000229854:E326K	E	-	1	0	MCM3	52250349	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.651000	0.83577	2.885000	0.99019	0.655000	0.94253	GAA	-	pfam_MCM_DNA-dep_ATPase,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase		0.478	MCM3-006	KNOWN	basic|appris_principal	protein_coding	MCM3	protein_coding	OTTHUMT00000470784.1	C		-		52142390	-1	no_errors	ENST00000596288	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC17A8	246213	genome.wustl.edu	37	12	100811922	100811922	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr12:100811922G>C	ENST00000323346.5	+	11	1726	c.1413G>C	c.(1411-1413)atG>atC	p.M471I	SLC17A8_ENST00000552697.1_3'UTR|SLC17A8_ENST00000392989.3_Missense_Mutation_p.M421I	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	471					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						TCGGTGCAATGACCAGGCACA	0.507																																																	0								ENSG00000179520						160.0	147.0	151.0					12																	100811922		2203	4300	6503	SLC17A8	SO:0001583	missense	0			-	HGNC	AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.1413G>C	12.37:g.100811922G>C	ENSP00000316909:p.Met471Ile	Somatic	0	34	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	18	37.93	B3KXZ6|B7ZKV4|Q17RQ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.M471I	ENST00000323346.5	37	c.1413	CCDS9077.1	12	.	.	.	.	.	.	.	.	.	.	G	11.77	1.736394	0.30774	.	.	ENSG00000179520	ENST00000323346;ENST00000392989	T;T	0.38401	1.14;1.14	5.51	5.51	0.81932	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.043945	0.85682	D	0.000000	T	0.19604	0.0471	N	0.05031	-0.125	0.53005	D	0.99996	B;B	0.11235	0.004;0.004	B;B	0.12837	0.005;0.008	T	0.13710	-1.0499	10	0.02654	T	1	.	19.8472	0.96713	0.0:0.0:1.0:0.0	.	471;421	Q8NDX2;Q8NDX2-2	VGLU3_HUMAN;.	I	471;421	ENSP00000316909:M471I;ENSP00000376715:M421I	ENSP00000316909:M471I	M	+	3	0	SLC17A8	99336053	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.434000	0.73408	2.769000	0.95229	0.650000	0.86243	ATG	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.507	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A8	protein_coding	OTTHUMT00000408673.2	G	NM_139319	-		100811922	+1	no_errors	ENST00000323346	ensembl	human	known	74_37	missense	SNP	1.000	C
F8	2157	genome.wustl.edu	37	X	154197706	154197706	+	Silent	SNP	C	C	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chrX:154197706C>T	ENST00000360256.4	-	7	1109	c.909G>A	c.(907-909)gcG>gcA	p.A303A	F8_ENST00000483822.1_5'Flank	NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	303	F5/8 type A 1.|Plastocyanin-like 2.		A -> E (in HEMA; mild). {ECO:0000269|PubMed:8759905, ECO:0000269|PubMed:9886318}.|A -> P (in HEMA; mild). {ECO:0000269|PubMed:9029040}.		acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TTTCCAAGGACGCCTGGCGAT	0.453																																																	0								ENSG00000185010						147.0	129.0	135.0					X																	154197706		2203	4300	6503	F8	SO:0001819	synonymous_variant	0			-	HGNC	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.909G>A	X.37:g.154197706C>T		Somatic	0	27	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	14.81	Q14286|Q5HY69	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.A303	ENST00000360256.4	37	c.909	CCDS35457.1	X																																																																																			-	superfamily_Cupredoxin		0.453	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	protein_coding	OTTHUMT00000058869.4	C		-		154197706	-1	no_errors	ENST00000360256	ensembl	human	known	74_37	silent	SNP	0.891	T
OVOL1	5017	genome.wustl.edu	37	11	65562102	65562102	+	Nonsense_Mutation	SNP	A	A	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr11:65562102A>T	ENST00000335987.3	+	3	764	c.412A>T	c.(412-414)Aag>Tag	p.K138*	RP11-770G2.5_ENST00000531155.1_RNA|OVOL1_ENST00000532448.1_Nonsense_Mutation_p.K76*	NM_004561.3	NP_004552.2	O14753	OVOL1_HUMAN	ovo-like zinc finger 1	138					cytoskeleton organization (GO:0007010)|epidermal cell differentiation (GO:0009913)|germline cell cycle switching, mitotic to meiotic cell cycle (GO:0051729)|kidney development (GO:0001822)|mesoderm development (GO:0007498)|negative regulation of meiotic cell cycle phase transition (GO:1901994)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	6				READ - Rectum adenocarcinoma(159;0.17)		CCGCCACATGAAGTGTCACAA	0.577																																																	0								ENSG00000172818						132.0	98.0	109.0					11																	65562102		2201	4297	6498	OVOL1	SO:0001587	stop_gained	0			-	HGNC	BC059408	CCDS8112.1	11q13	2013-10-17	2013-10-17		ENSG00000172818	ENSG00000172818		"""Zinc fingers, C2H2-type"""	8525	protein-coding gene	gene with protein product		602313	"""ovo (Drosophila) homolog-like 1"", ""ovo-like 1(Drosophila)"""			9383297	Standard	NM_004561		Approved	HOVO1	uc001ofp.3	O14753	OTTHUMG00000166600	ENST00000335987.3:c.412A>T	11.37:g.65562102A>T	ENSP00000337862:p.Lys138*	Somatic	0	29	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	16	20.00	Q6PCB1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K138*	ENST00000335987.3	37	c.412	CCDS8112.1	11	.	.	.	.	.	.	.	.	.	.	A	40	7.942391	0.98574	.	.	ENSG00000172818	ENST00000335987;ENST00000532448	.	.	.	5.0	5.0	0.66597	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-22.153	12.6455	0.56731	1.0:0.0:0.0:0.0	.	.	.	.	X	138;76	.	ENSP00000337862:K138X	K	+	1	0	OVOL1	65318678	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.256000	0.95535	1.875000	0.54330	0.459000	0.35465	AAG	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.577	OVOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OVOL1	protein_coding	OTTHUMT00000390690.1	A	NM_004561	-		65562102	+1	no_errors	ENST00000335987	ensembl	human	known	74_37	nonsense	SNP	1.000	T
GHDC	84514	genome.wustl.edu	37	17	40345107	40345107	+	Intron	SNP	G	G	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr17:40345107G>T	ENST00000301671.8	-	3	707				GHDC_ENST00000593209.1_Intron|GHDC_ENST00000436923.2_Intron|GHDC_ENST00000428494.2_Intron|GHDC_ENST00000587427.1_Intron|GHDC_ENST00000590520.1_5'UTR|GHDC_ENST00000414034.3_Intron			Q8N2G8	GHDC_HUMAN	GH3 domain containing							endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)		BRCA - Breast invasive adenocarcinoma(366;0.124)		TTTCAGGCAAGACTGGTGAGA	0.517																																																	0								ENSG00000167925																																			GHDC	SO:0001627	intron_variant	0			-	HGNC	AF316997, BC011056	CCDS11422.1, CCDS45682.1	17q21.2	2006-08-02				ENSG00000167925			24438	protein-coding gene	gene with protein product		608587				11161808, 11735219	Standard	NR_024573		Approved	LGP1	uc002hzf.4	Q8N2G8		ENST00000301671.8:c.266-62C>A	17.37:g.40345107G>T		Somatic	0	41	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B4DQS4|E9PDB5|Q9BXM6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S93Y	ENST00000301671.8	37	c.278	CCDS11422.1	17																																																																																			-	NULL		0.517	GHDC-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	GHDC	protein_coding	OTTHUMT00000449794.1	G	NM_032484	-		40345107	-1	no_errors	ENST00000588762	ensembl	human	known	74_37	missense	SNP	0.004	T
ZNF98	148198	genome.wustl.edu	37	19	22575766	22575766	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr19:22575766C>A	ENST00000357774.5	-	4	392	c.271G>T	c.(271-273)Gcc>Tcc	p.A91S		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	91					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				AGGTCTTGGGCAAAATAAGAA	0.274																																																	0								ENSG00000197360						26.0	21.0	22.0					19																	22575766		1829	4109	5938	ZNF98	SO:0001583	missense	0			-	HGNC		CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.271G>T	19.37:g.22575766C>A	ENSP00000350418:p.Ala91Ser	Somatic	0	43	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A91S	ENST00000357774.5	37	c.271	CCDS46031.1	19	.	.	.	.	.	.	.	.	.	.	.	6.532	0.466385	0.12402	.	.	ENSG00000197360	ENST00000357774	T	0.06371	3.31	1.44	1.44	0.22558	.	.	.	.	.	T	0.07458	0.0188	L	0.54965	1.715	0.09310	N	1	B	0.27316	0.175	B	0.28139	0.086	T	0.32428	-0.9907	9	0.35671	T	0.21	.	7.7324	0.28793	0.0:1.0:0.0:0.0	.	91	A6NK75	ZNF98_HUMAN	S	91	ENSP00000350418:A91S	ENSP00000350418:A91S	A	-	1	0	ZNF98	22367606	0.002000	0.14202	0.210000	0.23637	0.238000	0.25445	-0.193000	0.09573	0.300000	0.22699	0.305000	0.20034	GCC	-	NULL		0.274	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF98	protein_coding	OTTHUMT00000464398.1	C	NM_001098626	-		22575766	-1	no_errors	ENST00000357774	ensembl	human	known	74_37	missense	SNP	0.006	A
VIPAS39	63894	genome.wustl.edu	37	14	77920424	77920424	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr14:77920424C>T	ENST00000553888.1	-	2	532	c.22G>A	c.(22-24)Gag>Aag	p.E8K	VIPAS39_ENST00000343765.2_Missense_Mutation_p.E8K|VIPAS39_ENST00000448935.2_Missense_Mutation_p.E8K|VIPAS39_ENST00000556412.1_Missense_Mutation_p.E34K|VIPAS39_ENST00000327028.4_Missense_Mutation_p.E8K|VIPAS39_ENST00000557658.1_Missense_Mutation_p.E8K	NM_001193314.1|NM_001193317.1|NM_022067.3	NP_001180243.1|NP_001180246.1|NP_071350.2	Q9H9C1	SPE39_HUMAN	VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog	8					cell differentiation (GO:0030154)|endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|late endosome (GO:0005770)|recycling endosome (GO:0055037)											TACTCCTCCTCATCACCCTTT	0.448																																																	0								ENSG00000151445						159.0	126.0	138.0					14																	77920424		2203	4300	6503	VIPAS39	SO:0001583	missense	0			-	HGNC	AK022925	CCDS9862.1, CCDS53905.1	14q24.3-q31	2013-08-14	2012-07-24	2012-07-24	ENSG00000151445	ENSG00000151445			20347	protein-coding gene	gene with protein product	"""VPS33B interacting protein, apical-basolateral polarity regulator"""	613401	"""chromosome 14 open reading frame 133"""	C14orf133		20190753, 19109425, 22753090, 23002115, 23918659	Standard	NM_022067		Approved	VIPAR, VPS16B, SPE-39, SPE39, hSPE-39	uc001xtu.2	Q9H9C1		ENST00000553888.1:c.22G>A	14.37:g.77920424C>T	ENSP00000452181:p.Glu8Lys	Somatic	0	57	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	59	15.71	B4DPI6|O95434|Q9H7E1|Q9H9I9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Golgin_subfamily_A_member_5	p.E8K	ENST00000553888.1	37	c.22	CCDS9862.1	14	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656591	0.88154	.	.	ENSG00000151445	ENST00000343765;ENST00000553888;ENST00000327028;ENST00000557658;ENST00000448935;ENST00000556412;ENST00000557466	T;T;T;T;T;T;D	0.83075	-1.33;-1.33;-1.39;-1.33;-1.49;-1.38;-1.68	5.21	5.21	0.72293	.	0.107652	0.64402	D	0.000005	T	0.80226	0.4584	L	0.44542	1.39	0.54753	D	0.999987	P;P	0.49090	0.799;0.919	B;B	0.42692	0.272;0.395	T	0.83304	-0.0026	10	0.72032	D	0.01	-25.7044	17.0945	0.86631	0.0:1.0:0.0:0.0	.	8;8	B4DPI6;Q9H9C1	.;VIPAR_HUMAN	K	8;8;8;8;8;34;8	ENSP00000339122:E8K;ENSP00000452181:E8K;ENSP00000313098:E8K;ENSP00000452191:E8K;ENSP00000404815:E8K;ENSP00000451857:E34K;ENSP00000452176:E8K	ENSP00000313098:E8K	E	-	1	0	VIPAR	76990177	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.615000	0.74201	2.706000	0.92434	0.655000	0.94253	GAG	-	NULL		0.448	VIPAS39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIPAS39	protein_coding	OTTHUMT00000414008.1	C	NM_022067	-		77920424	-1	no_errors	ENST00000343765	ensembl	human	known	74_37	missense	SNP	1.000	T
ANKRD18B	441459	genome.wustl.edu	37	9	33566235	33566235	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr9:33566235G>A	ENST00000290943.6	+	13	2389	c.2293G>A	c.(2293-2295)Gag>Aag	p.E765K		NM_001244752.1	NP_001231681.1	A2A2Z9	AN18B_HUMAN	ankyrin repeat domain 18B	765										NS(1)|breast(1)|endometrium(2)|lung(1)|prostate(1)|stomach(1)	7						TCTTATGGCCGAGAAGGAAGC	0.323																																																	0								ENSG00000230453																																			ANKRD18B	SO:0001583	missense	0			-	HGNC			9p13.3	2013-01-10			ENSG00000230453	ENSG00000230453		"""Ankyrin repeat domain containing"""	23644	protein-coding gene	gene with protein product							Standard	NM_001244752		Approved	bA255A11.3	uc010mjw.2	A2A2Z9	OTTHUMG00000019776	ENST00000290943.6:c.2293G>A	9.37:g.33566235G>A	ENSP00000290943:p.Glu765Lys	Somatic	0	78	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	86	19.63		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E765K	ENST00000290943.6	37	c.2293		9	.	.	.	.	.	.	.	.	.	.	g	1.164	-0.642849	0.03531	.	.	ENSG00000230453	ENST00000290943;ENST00000357927	T;T	0.25579	1.79;3.23	1.64	-1.53	0.08611	.	.	.	.	.	T	0.08537	0.0212	.	.	.	0.22034	N	0.9994	.	.	.	.	.	.	T	0.41197	-0.9522	5	0.07482	T	0.82	.	4.7384	0.13001	0.4568:0.0:0.5432:0.0	.	.	.	.	K	765;146	ENSP00000290943:E765K;ENSP00000350607:E146K	ENSP00000290943:E765K	E	+	1	0	ANKRD18B	33556235	0.005000	0.15991	0.000000	0.03702	0.002000	0.02628	-0.474000	0.06607	-0.379000	0.07906	0.460000	0.39030	GAG	-	NULL		0.323	ANKRD18B-002	KNOWN	basic|appris_principal	protein_coding	ANKRD18B	protein_coding	OTTHUMT00000313729.2	G	XM_001718334	-		33566235	+1	no_errors	ENST00000290943	ensembl	human	known	74_37	missense	SNP	0.000	A
DENND4B	9909	genome.wustl.edu	37	1	153907279	153907287	+	In_Frame_Del	DEL	CTGCTGCTG	CTGCTGCTG	-	rs3835302|rs368800700|rs375006474|rs199597671		TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	CTGCTGCTG	CTGCTGCTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr1:153907279_153907287delCTGCTGCTG	ENST00000361217.4	-	18	3140_3148	c.2722_2730delCAGCAGCAG	c.(2722-2730)cagcagcagdel	p.QQQ908del	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	908	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ACACctgctcctgctgctgctgctgctgc	0.636																																																	0								ENSG00000198837																																			DENND4B	SO:0001651	inframe_deletion	0				HGNC	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2722_2730delCAGCAGCAG	1.37:g.153907288_153907296delCTGCTGCTG	ENSP00000354597:p.Gln908_Gln910del	Somatic	NA	NA	NA		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5T4K0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.QQQ908in_frame_del	ENST00000361217.4	37	c.2730_2722	CCDS44228.1	1																																																																																			-	NULL		0.636	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4B	protein_coding	OTTHUMT00000090278.2	CTGCTGCTG	XM_375806			153907287	-1	no_errors	ENST00000361217	ensembl	human	known	74_37	in_frame_del	DEL	0.792:0.815:0.846:0.964:0.974:0.990:0.990:0.986:0.989	-
DCSTAMP	81501	genome.wustl.edu	37	8	105367287	105367287	+	Silent	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr8:105367287G>A	ENST00000297581.2	+	3	1261	c.1212G>A	c.(1210-1212)gtG>gtA	p.V404V	DCSTAMP_ENST00000520080.1_3'UTR|DPYS_ENST00000521601.1_Intron|DCSTAMP_ENST00000517991.1_Intron	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	404					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											AAATCCTGGTGTCAGCATCTT	0.443																																																	0								ENSG00000164935						143.0	140.0	141.0					8																	105367287		2203	4300	6503	DCSTAMP	SO:0001819	synonymous_variant	0			-	HGNC	AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.1212G>A	8.37:g.105367287G>A		Somatic	0	48	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	41	21.15	B7ZVW2|E7ESG0|Q2M2D5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DC_STAMP-like,superfamily_ABC1_TM_dom	p.V404	ENST00000297581.2	37	c.1212	CCDS6301.1	8																																																																																			-	pfam_DC_STAMP-like,superfamily_ABC1_TM_dom		0.443	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCSTAMP	protein_coding	OTTHUMT00000380810.1	G	NM_030788	-		105367287	+1	no_errors	ENST00000297581	ensembl	human	known	74_37	silent	SNP	0.997	A
PALLD	23022	genome.wustl.edu	37	4	169846211	169846211	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr4:169846211G>T	ENST00000505667.1	+	20	3513	c.3340G>T	c.(3340-3342)Gcc>Tcc	p.A1114S	PALLD_ENST00000335742.7_Missense_Mutation_p.A939S|CBR4_ENST00000509108.1_Intron|PALLD_ENST00000507735.1_Missense_Mutation_p.A610S|PALLD_ENST00000512127.1_Missense_Mutation_p.A715S|PALLD_ENST00000261509.6_Missense_Mutation_p.A1097S			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	1321					cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		GTCCTGTACTGCCAGGCTGGA	0.448									Pancreatic Cancer, Familial Clustering of																												Esophageal Squamous(109;1482 1532 18347 40239 51172)												0								ENSG00000129116						132.0	126.0	128.0					4																	169846211		2203	4300	6503	PALLD	SO:0001583	missense	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	-	HGNC	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.3340G>T	4.37:g.169846211G>T	ENSP00000425556:p.Ala1114Ser	Somatic	0	51	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	100	9.91	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A1097S	ENST00000505667.1	37	c.3289	CCDS54818.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.6|28.6	4.934556|4.934556	0.92458|0.92458	.|.	.|.	ENSG00000129116|ENSG00000129116	ENST00000261509;ENST00000335742;ENST00000505667;ENST00000512127;ENST00000507735|ENST00000503290	T;T;T;T;T|.	0.70516|.	-0.49;-0.49;-0.49;-0.49;-0.49|.	5.6|5.6	5.6|5.6	0.85130|0.85130	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.000000|.	0.31897|.	U|.	0.006890|.	T|T	0.77478|0.77478	0.4136|0.4136	M|M	0.74546|0.74546	2.27|2.27	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.91635|.	0.999;0.998;0.998;0.999|.	T|T	0.76225|0.76225	-0.3037|-0.3037	10|5	0.49607|.	T|.	0.09|.	.|.	19.6074|19.6074	0.95586|0.95586	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1114;1321;715;1097|.	B7ZMM5;Q8WX93;B3KTG2;B2RTX2|.	.;PALLD_HUMAN;.;.|.	S|F	1097;939;1114;715;610|150	ENSP00000261509:A1097S;ENSP00000336735:A939S;ENSP00000425556:A1114S;ENSP00000426947:A715S;ENSP00000424016:A610S|.	ENSP00000261509:A1097S|.	A|C	+|+	1|2	0|0	PALLD|PALLD	170082786|170082786	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.800000|0.800000	0.45204|0.45204	9.869000|9.869000	0.99810|0.99810	2.627000|2.627000	0.88993|0.88993	0.650000|0.650000	0.86243|0.86243	GCC|TGC	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom		0.448	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PALLD	protein_coding	OTTHUMT00000363762.1	G	NM_016081	-		169846211	+1	no_errors	ENST00000261509	ensembl	human	known	74_37	missense	SNP	1.000	T
ATRX	546	genome.wustl.edu	37	X	76931772	76931772	+	Nonsense_Mutation	SNP	G	G	C			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chrX:76931772G>C	ENST00000373344.5	-	10	3972	c.3758C>G	c.(3757-3759)tCa>tGa	p.S1253*	ATRX_ENST00000395603.3_Nonsense_Mutation_p.S1215*|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1253	Interaction with DAXX.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						GACAGGCACTGATTTAGATAA	0.338			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224						126.0	101.0	110.0					X																	76931772		2203	4296	6499	ATRX	SO:0001587	stop_gained	0			-	HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.3758C>G	X.37:g.76931772G>C	ENSP00000362441:p.Ser1253*	Somatic	0	17	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	6	66.67	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S1253*	ENST00000373344.5	37	c.3758	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	G	43	10.119481	0.99340	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	.	.	.	4.74	3.81	0.43845	.	0.698539	0.12459	N	0.467049	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-4.8902	14.6483	0.68777	0.0:0.1424:0.8576:0.0	.	.	.	.	X	1253;1215;1180	.	ENSP00000362441:S1253X	S	-	2	0	ATRX	76818428	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.038000	0.57318	2.068000	0.61886	0.506000	0.49869	TCA	-	NULL		0.338	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	G	NM_000489	-		76931772	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	nonsense	SNP	1.000	C
ZNF284	342909	genome.wustl.edu	37	19	44590253	44590254	+	Frame_Shift_Ins	INS	-	-	G			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr19:44590253_44590254insG	ENST00000421176.3	+	5	838_839	c.622_623insG	c.(622-624)tgtfs	p.C208fs	RNU6-902P_ENST00000517212.1_RNA|ZNF223_ENST00000591793.1_3'UTR	NM_001037813.2	NP_001032902.1	Q2VY69	ZN284_HUMAN	zinc finger protein 284	208					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0435)				GTGTGATGTGTGTAGTAAGGCA	0.411																																																	0								ENSG00000186026																																			ZNF284	SO:0001589	frameshift_variant	0				HGNC	AY166789	CCDS46099.1	19q13.32	2013-01-08				ENSG00000186026		"""Zinc fingers, C2H2-type"", ""-"""	13078	protein-coding gene	gene with protein product						12743021	Standard	NM_001037813		Approved	DKFZp781F1775	uc002oyg.1	Q2VY69		ENST00000421176.3:c.623dupG	19.37:g.44590254_44590254dupG	ENSP00000411032:p.Cys208fs	Somatic	0	29	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	Q86WM1	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C208fs	ENST00000421176.3	37	c.622_623	CCDS46099.1	19																																																																																			-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.411	ZNF284-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF284	protein_coding	OTTHUMT00000460473.1	-	NM_001037813			44590254	+1	no_errors	ENST00000421176	ensembl	human	known	74_37	frame_shift_ins	INS	0.992:1.000	G
DBT	1629	genome.wustl.edu	37	1	100671856	100671856	+	Splice_Site	SNP	A	A	G			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr1:100671856A>G	ENST00000370132.4	-	10	1224	c.1211T>C	c.(1210-1212)aTt>aCt	p.I404T		NM_001918.3	NP_001909.3	P11182	ODB2_HUMAN	dihydrolipoamide branched chain transacylase E2	404					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity (GO:0043754)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(1)	19		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)		GGTACCACCAATCtatttttt	0.328																																																	0								ENSG00000137992						52.0	53.0	53.0					1																	100671856		2203	4300	6503	DBT	SO:0001630	splice_region_variant	0			-	HGNC	BC016675	CCDS767.1	1p31	2008-02-05	2004-11-15		ENSG00000137992	ENSG00000137992			2698	protein-coding gene	gene with protein product		248610	"""dihydrolipoamide branched chain transacylase (E2 component of branched chain keto acid dehydrogenase complex; maple syrup urine disease)"""			1420314, 1429740	Standard	NM_001918		Approved		uc001dta.3	P11182	OTTHUMG00000010921	ENST00000370132.4:c.1210-1T>C	1.37:g.100671856A>G		Somatic	0	90	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	52	30.67	B2R811|Q5VVL8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_2-oxoacid_DH_actylTfrase,pfam_Biotin_lipoyl,pfam_E3-bd,superfamily_Single_hybrid_motif,superfamily_E3-bd,pfscan_Biotin_lipoyl	p.I404T	ENST00000370132.4	37	c.1211	CCDS767.1	1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.071790	0.76301	.	.	ENSG00000137992	ENST00000543138;ENST00000370132	T	0.45668	0.89	5.97	5.97	0.96955	2-oxoacid dehydrogenase acyltransferase, catalytic domain (1);Chloramphenicol acetyltransferase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.67183	0.2866	M	0.91300	3.195	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.992;0.994	T	0.75850	-0.3172	10	0.72032	D	0.01	-25.0619	16.4608	0.84044	1.0:0.0:0.0:0.0	.	223;404	F5H1F9;P11182	.;ODB2_HUMAN	T	223;404	ENSP00000359151:I404T	ENSP00000359151:I404T	I	-	2	0	DBT	100444444	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	8.855000	0.92236	2.288000	0.76882	0.533000	0.62120	ATT	-	pfam_2-oxoacid_DH_actylTfrase		0.328	DBT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBT	protein_coding	OTTHUMT00000030101.2	A	NM_001918	-	Missense_Mutation	100671856	-1	no_errors	ENST00000370132	ensembl	human	known	74_37	missense	SNP	1.000	G
PNPLA4	8228	genome.wustl.edu	37	X	7894060	7894060	+	Missense_Mutation	SNP	T	T	G			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chrX:7894060T>G	ENST00000381042.4	-	2	271	c.101A>C	c.(100-102)aAg>aCg	p.K34T	PNPLA4_ENST00000444736.1_Missense_Mutation_p.K34T|PNPLA4_ENST00000537427.1_Intron	NM_004650.2	NP_004641.1	P41247	PLPL4_HUMAN	patatin-like phospholipase domain containing 4	34	Patatin.				lipid catabolic process (GO:0016042)		triglyceride lipase activity (GO:0004806)			kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7		Colorectal(8;0.0329)|Medulloblastoma(8;0.232)				TTTGACATCCTTCACAAGTTT	0.463											OREG0019651	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000006757						95.0	80.0	85.0					X																	7894060		2203	4299	6502	PNPLA4	SO:0001583	missense	0			-	HGNC	U03886	CCDS14129.1, CCDS55368.1	Xp22.3	2014-03-14			ENSG00000006757	ENSG00000006757	3.1.1.3	"""Patatin-like phospholipase domain containing"""	24887	protein-coding gene	gene with protein product		300102				7806223, 16799181, 19029121	Standard	NM_004650		Approved	DXS1283E, GS2, iPLA2eta	uc011mhr.1	P41247	OTTHUMG00000021103	ENST00000381042.4:c.101A>C	X.37:g.7894060T>G	ENSP00000370430:p.Lys34Thr	Somatic	0	21	0.00	645	0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	19	20.83	A8K1H3|B4E362|Q8WW83	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	p.K34T	ENST00000381042.4	37	c.101	CCDS14129.1	X	.	.	.	.	.	.	.	.	.	.	T	2.060	-0.415517	0.04766	.	.	ENSG00000006757	ENST00000381042;ENST00000444736;ENST00000442940	T;T;T	0.77750	-1.12;-1.12;-1.12	3.76	1.3	0.21679	Acyl transferase/acyl hydrolase/lysophospholipase (1);Patatin/Phospholipase A2-related (1);	0.601636	0.17785	N	0.162105	T	0.69223	0.3087	L	0.42632	1.34	0.19945	N	0.99994	P	0.45044	0.849	P	0.46585	0.521	T	0.57791	-0.7750	10	0.17832	T	0.49	-4.7109	6.911	0.24335	0.0:0.1963:0.0:0.8037	.	34	P41247	PLPL4_HUMAN	T	34	ENSP00000370430:K34T;ENSP00000415245:K34T;ENSP00000406698:K34T	ENSP00000370430:K34T	K	-	2	0	PNPLA4	7854060	0.932000	0.31603	0.009000	0.14445	0.065000	0.16274	1.472000	0.35376	0.014000	0.14944	0.486000	0.48141	AAG	-	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase		0.463	PNPLA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PNPLA4	protein_coding	OTTHUMT00000055687.1	T	NM_004650	-		7894060	-1	no_errors	ENST00000381042	ensembl	human	known	74_37	missense	SNP	0.128	G
CORIN	10699	genome.wustl.edu	37	4	47625635	47625635	+	Silent	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr4:47625635G>A	ENST00000273857.4	-	19	2492	c.2493C>T	c.(2491-2493)gtC>gtT	p.V831V	CORIN_ENST00000508498.1_Silent_p.V692V|CORIN_ENST00000505909.1_Silent_p.V794V|CORIN_ENST00000515827.1_5'UTR|CORIN_ENST00000502252.1_Silent_p.V764V	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	831	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						TGGCAATGAGGACACAGCCAC	0.517																																																	0								ENSG00000145244						106.0	101.0	103.0					4																	47625635		2203	4300	6503	CORIN	SO:0001819	synonymous_variant	0			-	HGNC	AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.2493C>T	4.37:g.47625635G>A		Somatic	0	39	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	63	11.11	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Peptidase_S1A_corin,pfam_Peptidase_S1,pfam_LDrepeatLR_classA_rpt,pfam_Frizzled_dom,superfamily_Trypsin-like_Pept_dom,superfamily_Frizzled_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_Frizzled_dom,smart_LDrepeatLR_classA_rpt,smart_Srcr_rcpt-rel,smart_Peptidase_S1,prints_LDrepeatLR_classA_rpt,prints_Peptidase_S1A,pfscan_Frizzled_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1	p.V831	ENST00000273857.4	37	c.2493	CCDS3477.1	4																																																																																			-	pirsf_Peptidase_S1A_corin,pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Peptidase_S1		0.517	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORIN	protein_coding	OTTHUMT00000216906.2	G		-		47625635	-1	no_errors	ENST00000273857	ensembl	human	known	74_37	silent	SNP	0.992	A
ITSN2	50618	genome.wustl.edu	37	2	24423529	24423530	+	IGR	DEL	AA	AA	-			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr2:24423529_24423530delAA	ENST00000355123.4	-	0	6300				AC008073.9_ENST00000429717.1_RNA	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2						endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCCTGTGGGAAAAAGAGTGAT	0.599																																																	0								ENSG00000186453																																			FAM228A	SO:0001628	intergenic_variant	0				HGNC	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818		2.37:g.24423531_24423532delAA		Somatic	0	25	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	22	24.14	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.R111fs	ENST00000355123.4	37	c.327_328	CCDS1710.2	2																																																																																			-	NULL		0.599	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM228A	protein_coding	OTTHUMT00000207620.2	AA	NM_006277			24423530	+1	no_errors	ENST00000415196	ensembl	human	novel	74_37	frame_shift_del	DEL	0.000:0.011	-
NCOA3	8202	genome.wustl.edu	37	20	46279815	46279823	+	In_Frame_Del	DEL	GCAGCAGCA	GCAGCAGCA	-	rs3830810		TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	GCAGCAGCA	GCAGCAGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr20:46279815_46279823delGCAGCAGCA	ENST00000371998.3	+	20	3932_3940	c.3741_3749delGCAGCAGCA	c.(3739-3750)atgcagcagcag>atg	p.QQQ1272del	NCOA3_ENST00000371997.3_In_Frame_Del_p.QQQ1263del|NCOA3_ENST00000372004.3_In_Frame_Del_p.QQQ1268del|NCOA3_ENST00000341724.6_In_Frame_Del_p.QQQ1198del			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1272	Acetyltransferase.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						CTATGATGATgcagcagcagcagcagcag	0.545																																																	0								ENSG00000124151																																			NCOA3	SO:0001651	inframe_deletion	0				HGNC	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3741_3749delGCAGCAGCA	20.37:g.46279824_46279832delGCAGCAGCA	ENSP00000361066:p.Gln1272_Gln1274del	Somatic	NA	NA	NA		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_SRC-1,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.QQQ1251in_frame_del	ENST00000371998.3	37	c.3741_3749	CCDS13407.1	20																																																																																			-	pirsf_Nuclear_rcpt_coactivator		0.545	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA3	protein_coding	OTTHUMT00000080405.1	GCAGCAGCA	NM_006534			46279823	+1	no_errors	ENST00000371998	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
ZC3H3	23144	genome.wustl.edu	37	8	144522387	144522389	+	In_Frame_Del	DEL	GAG	GAG	-	rs2272753|rs2272754	byFrequency	TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr8:144522387_144522389delGAG	ENST00000262577.5	-	11	2668_2670	c.2637_2639delCTC	c.(2635-2640)tcctca>tca	p.879_880SS>S		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	879	Poly-Ser.				mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			Gggaggggatgaggaggaggagg	0.655																																																	0								ENSG00000014164																																			ZC3H3	SO:0001651	inframe_deletion	0				HGNC	D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.2637_2639delCTC	8.37:g.144522396_144522398delGAG	ENSP00000262577:p.Ser881del	Somatic	0	33	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	Q14163|Q8N4E2|Q9BUS4	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_CCCH,smart_Znf_CCCH	p.S881in_frame_del	ENST00000262577.5	37	c.2639_2637	CCDS6402.1	8																																																																																			-	NULL		0.655	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H3	protein_coding	OTTHUMT00000382011.2	GAG	NM_015117			144522389	-1	no_errors	ENST00000262577	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.000:0.001	-
PTPRVP	148713	genome.wustl.edu	37	1	202156135	202156136	+	RNA	INS	-	-	CCTCGCT	rs369231344|rs139095833|rs78957599|rs368169635	byFrequency	TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr1:202156135_202156136insCCTCGCT	ENST00000482597.1	+	0	3411_3412					NR_002930.2				protein tyrosine phosphatase, receptor type, V, pseudogene																		CTGCAGGCCCCcctcgctcctc	0.639														3092	0.617412	0.3094	0.6816	5008	,	,		20478	0.6835		0.7137	False		,,,				2504	0.8211																0								ENSG00000243323																																			PTPRVP			0				HGNC	AJ629456		1q32.1	2013-09-26	2010-03-16	2010-03-16	ENSG00000243323	ENSG00000243323		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	13421	pseudogene	pseudogene				PTPRV		15358244	Standard	NR_002930		Approved	OST-PTP, ESP	uc009xaa.2		OTTHUMG00000040524		1.37:g.202156136_202156142dupCCTCGCT		Somatic	NA	NA	NA		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000482597.1	37	NULL		1																																																																																			-	-		0.639	PTPRVP-003	KNOWN	basic	processed_transcript	PTPRVP	pseudogene	OTTHUMT00000334021.1	-	XM_086287			202156136	+1	no_errors	ENST00000482597	ensembl	human	known	74_37	rna	INS	0.022:0.016	CCTCGCT
MUC16	94025	genome.wustl.edu	37	19	9080536	9080536	+	Silent	SNP	C	C	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr19:9080536C>A	ENST00000397910.4	-	2	9698	c.9495G>T	c.(9493-9495)gtG>gtT	p.V3165V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3166	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTATGGTGGTCACTAGCGTTC	0.463																																																	0								ENSG00000181143						141.0	134.0	136.0					19																	9080536		1943	4152	6095	MUC16	SO:0001819	synonymous_variant	0			-	HGNC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.9495G>T	19.37:g.9080536C>A		Somatic	0	75	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	102	11.30	Q6ZQW5|Q96RK2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.V3165	ENST00000397910.4	37	c.9495	CCDS54212.1	19																																																																																			-	NULL		0.463	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	C	NM_024690	-		9080536	-1	no_errors	ENST00000397910	ensembl	human	known	74_37	silent	SNP	0.001	A
LMNB1	4001	genome.wustl.edu	37	5	126154807	126154807	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr5:126154807G>A	ENST00000261366.5	+	6	1494	c.1133G>A	c.(1132-1134)aGg>aAg	p.R378K	LMNB1_ENST00000395354.1_Missense_Mutation_p.R378K|LMNB1_ENST00000460265.1_3'UTR	NM_001198557.1|NM_005573.3	NP_001185486.1|NP_005564.1	P20700	LMNB1_HUMAN	lamin B1	378	Coil 2.|Rod.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	lamin filament (GO:0005638)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.103)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.033)|OV - Ovarian serous cystadenocarcinoma(64;0.0398)|all cancers(49;0.0903)		AGTGCTTACAGGAAACTCTTA	0.413																																																	0								ENSG00000113368						84.0	83.0	84.0					5																	126154807		2203	4300	6503	LMNB1	SO:0001583	missense	0			-	HGNC	L37737	CCDS4140.1	5q23.2	2013-01-16			ENSG00000113368	ENSG00000113368		"""Intermediate filaments type V, lamins"""	6637	protein-coding gene	gene with protein product		150340				7557986, 8838815	Standard	NM_005573		Approved		uc003kud.2	P20700	OTTHUMG00000128969	ENST00000261366.5:c.1133G>A	5.37:g.126154807G>A	ENSP00000261366:p.Arg378Lys	Somatic	0	21	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	15	62.50	B2R6J6|Q3SYN7|Q96EI6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,pfam_Lamin_tail_dom	p.R378K	ENST00000261366.5	37	c.1133	CCDS4140.1	5	.	.	.	.	.	.	.	.	.	.	G	33	5.291023	0.95546	.	.	ENSG00000113368	ENST00000261366;ENST00000395354	D;D	0.94184	-3.37;-3.37	5.74	4.88	0.63580	Filament (1);Intermediate filament protein, conserved site (1);	0.049512	0.85682	D	0.000000	D	0.97247	0.9100	M	0.91663	3.23	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97942	1.0326	10	0.62326	D	0.03	.	15.0508	0.71867	0.0681:0.0:0.9319:0.0	.	378	P20700	LMNB1_HUMAN	K	378	ENSP00000261366:R378K;ENSP00000378761:R378K	ENSP00000261366:R378K	R	+	2	0	LMNB1	126182706	1.000000	0.71417	0.976000	0.42696	0.995000	0.86356	9.813000	0.99286	1.576000	0.49790	0.563000	0.77884	AGG	-	pfam_IF		0.413	LMNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMNB1	protein_coding	OTTHUMT00000250956.2	G	NM_005573	-		126154807	+1	no_errors	ENST00000261366	ensembl	human	known	74_37	missense	SNP	1.000	A
COL4A6	1288	genome.wustl.edu	37	X	107415762	107415762	+	Splice_Site	SNP	C	C	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chrX:107415762C>A	ENST00000372216.4	-	32	3242	c.3142G>T	c.(3142-3144)Ggt>Tgt	p.G1048C	COL4A6_ENST00000334504.7_Splice_Site_p.G1047C|COL4A6_ENST00000394872.2_Splice_Site_p.G1048C|COL4A6_ENST00000538570.1_Splice_Site_p.G1047C|COL4A6_ENST00000545689.1_Splice_Site_p.G1047C	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	1048	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						CCTTGTGAACCCTTCGAAGCA	0.502									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)												0								ENSG00000197565						134.0	118.0	123.0					X																	107415762		2203	4300	6503	COL4A6	SO:0001630	splice_region_variant	0	Familial Cancer Database		-	HGNC	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.3142-1G>T	X.37:g.107415762C>A		Somatic	0	29	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	20	35.48	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G1048C	ENST00000372216.4	37	c.3142	CCDS14541.1	X	.	.	.	.	.	.	.	.	.	.	C	11.13	1.548160	0.27652	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.99637	-6.29;-6.29;-6.29;-6.29;-6.29	5.29	5.29	0.74685	.	0.000000	0.42053	D	0.000763	D	0.99819	0.9920	H	0.98682	4.3	0.45172	D	0.998189	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.96755	0.9557	10	0.87932	D	0	.	16.8375	0.85960	0.0:1.0:0.0:0.0	.	1047;1047;1048;1047	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	C	1048;1047;1048;1047;1047;1047	ENSP00000361290:G1048C;ENSP00000334733:G1047C;ENSP00000378340:G1048C;ENSP00000443707:G1047C;ENSP00000445236:G1047C	ENSP00000334733:G1047C	G	-	1	0	COL4A6	107302418	1.000000	0.71417	1.000000	0.80357	0.349000	0.29174	6.050000	0.71063	2.549000	0.85964	0.600000	0.82982	GGT	-	pfam_Collagen		0.502	COL4A6-001	KNOWN	basic|CCDS	protein_coding	COL4A6	protein_coding	OTTHUMT00000057875.2	C		-	Missense_Mutation	107415762	-1	no_errors	ENST00000372216	ensembl	human	known	74_37	missense	SNP	1.000	A
TRIM48	79097	genome.wustl.edu	37	11	55036763	55036763	+	Silent	SNP	G	G	A	rs201463527		TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr11:55036763G>A	ENST00000417545.2	+	5	710	c.624G>A	c.(622-624)gcG>gcA	p.A208A		NM_024114.3	NP_077019.2	Q8IWZ4	TRI48_HUMAN	tripartite motif containing 48	192						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(13)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						TGAATCTAGCGCTCAGGGCAG	0.488																																																	0								ENSG00000150244	G		0,4192		0,0,2096	47.0	39.0	41.0		624	0.6	0.0	11		41	2,7954		0,2,3976	no	coding-synonymous	TRIM48	NM_024114.3		0,2,6072	AA,AG,GG		0.0251,0.0,0.0165		208/225	55036763	2,12146	2096	3978	6074	TRIM48	SO:0001819	synonymous_variant	0			-	HGNC	AF521869	CCDS7947.2	11q12	2013-01-09	2011-01-25		ENSG00000150244	ENSG00000150244		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19021	protein-coding gene	gene with protein product			"""tripartite motif-containing 48"""				Standard	NM_024114		Approved	RNF101	uc010rid.2	Q8IWZ4	OTTHUMG00000157011	ENST00000417545.2:c.624G>A	11.37:g.55036763G>A		Somatic	0	171	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	118	26.25	Q9BUW4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.A208	ENST00000417545.2	37	c.624	CCDS7947.2	11																																																																																			-	NULL		0.488	TRIM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM48	protein_coding	OTTHUMT00000347088.1	G		rs201463527		55036763	+1	no_errors	ENST00000417545	ensembl	human	known	74_37	silent	SNP	0.036	A
COL2A1	1280	genome.wustl.edu	37	12	48380662	48380662	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr12:48380662C>A	ENST00000380518.3	-	22	1539	c.1375G>T	c.(1375-1377)Ggt>Tgt	p.G459C	COL2A1_ENST00000337299.6_Missense_Mutation_p.G390C|COL2A1_ENST00000493991.1_5'UTR	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	459	Triple-helical region.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CCAGCAATACCAGGTTCACCC	0.567																																																	0								ENSG00000139219						151.0	153.0	152.0					12																	48380662		2203	4300	6503	COL2A1	SO:0001583	missense	0			-	HGNC	X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.1375G>T	12.37:g.48380662C>A	ENSP00000369889:p.Gly459Cys	Somatic	0	53	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.G459C	ENST00000380518.3	37	c.1375	CCDS41778.1	12	.	.	.	.	.	.	.	.	.	.	C	22.5	4.291947	0.80914	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	D;D	0.99637	-6.29;-6.29	4.25	4.25	0.50352	.	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	H	0.99211	4.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.96411	0.9304	10	0.87932	D	0	.	15.9765	0.80071	0.0:1.0:0.0:0.0	.	390;459	P02458-1;P02458	.;CO2A1_HUMAN	C	459;390;390	ENSP00000369889:G459C;ENSP00000338213:G390C	ENSP00000338213:G390C	G	-	1	0	COL2A1	46666929	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.654000	0.67974	2.384000	0.81235	0.462000	0.41574	GGT	-	NULL		0.567	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL2A1	protein_coding	OTTHUMT00000313810.2	C	NM_001844	-		48380662	-1	no_errors	ENST00000380518	ensembl	human	known	74_37	missense	SNP	1.000	A
CFHR2	3080	genome.wustl.edu	37	1	196876137	196876137	+	Intron	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr1:196876137G>A	ENST00000367421.3	+	2	135				CFHR4_ENST00000367416.2_Missense_Mutation_p.D195N|CFHR4_ENST00000608469.1_Intron|CFHR4_ENST00000251424.4_Intron|CFHR4_ENST00000367418.2_Intron			P36980	FHR2_HUMAN	complement factor H-related 2							extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						GTGTGGTGAAGATGGCTGGTC	0.348																																																	0								ENSG00000134365																																			CFHR4	SO:0001627	intron_variant	0			-	HGNC	X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367421.3:c.59-42448G>A	1.37:g.196876137G>A		Somatic	0	102	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	103	17.60	Q14310|Q5T9T1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.D195N	ENST00000367421.3	37	c.583		1	.	.	.	.	.	.	.	.	.	.	.	12.39	1.923872	0.34002	.	.	ENSG00000134365	ENST00000367416	T	0.63913	-0.07	2.96	-4.26	0.03755	.	.	.	.	.	T	0.34919	0.0914	N	0.20574	0.59	0.09310	N	1	B;B	0.25486	0.127;0.056	B;B	0.34346	0.18;0.026	T	0.39781	-0.9597	9	0.02654	T	1	.	0.6278	0.00789	0.3505:0.1685:0.31:0.1711	.	195;196	C9J7J7;Q5DVJ7	.;.	N	195	ENSP00000356386:D195N	ENSP00000356386:D195N	D	+	1	0	CFHR4	195142760	0.000000	0.05858	0.000000	0.03702	0.630000	0.37929	-0.520000	0.06252	-1.075000	0.03129	-0.450000	0.05554	GAT	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP		0.348	CFHR2-201	KNOWN	basic|appris_principal	protein_coding	CFHR4	protein_coding		G	NM_005666	-		196876137	+1	no_errors	ENST00000367416	ensembl	human	known	74_37	missense	SNP	0.000	A
CTGF	1490	genome.wustl.edu	37	6	132271222	132271222	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr6:132271222C>T	ENST00000367976.3	-	4	820	c.620G>A	c.(619-621)aGc>aAc	p.S207N	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	207	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		GGAACAGGCGCTCCACTCTGT	0.577											OREG0017666	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(127;510 1660 12817 24400 38449)												0								ENSG00000118523						74.0	68.0	70.0					6																	132271222		2203	4300	6503	CTGF	SO:0001583	missense	0			-	HGNC	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.620G>A	6.37:g.132271222C>T	ENSP00000356954:p.Ser207Asn	Somatic	0	39	0.00	1594	0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	69	11.54	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cys_knot,pfam_IGFBP-like,pfam_VWF_C,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_IGFBP-like,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_Cys_knot_C,pirsf_IGFBP_CNN,pfscan_Cys_knot_C,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.S207N	ENST00000367976.3	37	c.620	CCDS5151.1	6	.	.	.	.	.	.	.	.	.	.	C	22.4	4.278664	0.80692	.	.	ENSG00000118523	ENST00000367976	T	0.63744	-0.06	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.86091	0.5850	H	0.97465	4.01	0.54753	D	0.999986	D	0.89917	1.0	D	0.91635	0.999	D	0.90617	0.4556	10	0.87932	D	0	.	19.4542	0.94880	0.0:1.0:0.0:0.0	.	207	P29279	CTGF_HUMAN	N	207	ENSP00000356954:S207N	ENSP00000356954:S207N	S	-	2	0	CTGF	132312915	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.671000	0.90904	0.555000	0.69702	AGC	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pirsf_IGFBP_CNN,pfscan_Thrombospondin_1_rpt		0.577	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTGF	protein_coding	OTTHUMT00000042239.2	C	NM_001901	-		132271222	-1	no_errors	ENST00000367976	ensembl	human	known	74_37	missense	SNP	1.000	T
RAET1G	353091	genome.wustl.edu	37	6	150240213	150240213	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr6:150240213C>A	ENST00000367360.2	-	3	664	c.597G>T	c.(595-597)atG>atT	p.M199I	RAET1E-AS1_ENST00000446954.2_RNA|RAET1E-AS1_ENST00000605899.1_RNA|RAET1G_ENST00000479265.1_Missense_Mutation_p.M199I|RP11-244K5.8_ENST00000606915.1_RNA	NM_001001788.2	NP_001001788.2			retinoic acid early transcript 1G											NS(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|urinary_tract(1)	13		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.73e-12)		TGTCCATGCCCATCAAGAAGT	0.453																																																	0								ENSG00000203722						197.0	188.0	191.0					6																	150240213		2203	4300	6503	RAET1G	SO:0001583	missense	0			-	HGNC	AY172579	CCDS43514.1	6q24.1-25.1	2009-04-29	2004-11-22		ENSG00000203722	ENSG00000203722			16795	protein-coding gene	gene with protein product		609244	"""retinoic acid early transcript 1G pseudogene"""			11827464, 15240696	Standard	NM_001001788		Approved	ULBP5	uc010kii.1	Q6H3X3	OTTHUMG00000015802	ENST00000367360.2:c.597G>T	6.37:g.150240213C>A	ENSP00000356329:p.Met199Ile	Somatic	0	52	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	86	12.24		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	p.M199I	ENST00000367360.2	37	c.597	CCDS43514.1	6	.	.	.	.	.	.	.	.	.	.	C	2.583	-0.296880	0.05532	.	.	ENSG00000203722	ENST00000367360;ENST00000479265	T;T	0.60920	0.15;0.15	2.1	0.0637	0.14350	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.	.	.	.	T	0.17365	0.0417	N	0.17082	0.46	0.09310	N	1	B	0.09022	0.002	B	0.19148	0.024	T	0.27739	-1.0065	9	0.87932	D	0	.	4.214	0.10526	0.2668:0.4719:0.2613:0.0	.	199	Q6H3X3	RET1G_HUMAN	I	199	ENSP00000356329:M199I;ENSP00000417503:M199I	ENSP00000356329:M199I	M	-	3	0	RAET1G	150281906	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.767000	0.00782	0.001000	0.14605	0.505000	0.49811	ATG	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog		0.453	RAET1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAET1G	protein_coding	OTTHUMT00000042668.2	C		-		150240213	-1	no_errors	ENST00000367360	ensembl	human	known	74_37	missense	SNP	0.000	A
NTM	50863	genome.wustl.edu	37	11	132206330	132206330	+	3'UTR	SNP	G	G	A			TCGA-3B-A9HS-01A-11D-A38Z-09	TCGA-3B-A9HS-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac8e72b9-4469-4d80-a5a0-df3fc36380ff	25e4da82-09d2-4931-b4ca-50d5f74599d1	g.chr11:132206330G>A	ENST00000374786.1	+	0	2804				NTM_ENST00000374791.3_3'UTR|NTM_ENST00000474900.1_3'UTR	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin						cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						CTTTCCAGGTGTGGCTCTGCG	0.458																																																	0								ENSG00000182667																																			NTM	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.*1290G>A	11.37:g.132206330G>A		Somatic	0	14	0.00		0.6502032266926295	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	7	46.15	A0MTT2|Q6UXJ3|Q86VJ9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000374786.1	37	NULL	CCDS8491.1	11																																																																																			-	-		0.458	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTM	protein_coding	OTTHUMT00000141937.1	G	NM_016522	-		132206330	+1	no_errors	ENST00000474900	ensembl	human	known	74_37	rna	SNP	1.000	A
