#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
TGS1	96764	genome.wustl.edu	37	8	56686236	56686236	+	Missense_Mutation	SNP	A	A	G			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr8:56686236A>G	ENST00000260129.5	+	1	536	c.59A>G	c.(58-60)gAg>gGg	p.E20G	TMEM68_ENST00000519784.1_5'Flank|TMEM68_ENST00000434581.2_5'Flank|TMEM68_ENST00000334667.2_5'Flank|TMEM68_ENST00000523073.1_5'Flank|TMEM68_ENST00000522576.1_5'Flank|TMEM68_ENST00000521229.1_5'Flank	NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	20					7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			GAGGAGCGGGAGGATTGTAAG	0.502																																					Esophageal Squamous(34;275 823 4842 34837 48447)												0								ENSG00000137574						142.0	140.0	141.0					8																	56686236		2203	4300	6503	TGS1	SO:0001583	missense	0			-	HGNC	AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.59A>G	8.37:g.56686236A>G	ENSP00000260129:p.Glu20Gly	Somatic	0	55	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNA_cap_Gua-N2-MeTrfase,pfam_RNA_methylase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	p.E20G	ENST00000260129.5	37	c.59	CCDS34894.1	8	.	.	.	.	.	.	.	.	.	.	A	14.04	2.417785	0.42918	.	.	ENSG00000137574	ENST00000260129	T	0.16897	2.31	4.83	3.67	0.42095	.	0.709658	0.13993	N	0.348675	T	0.26231	0.0640	L	0.36672	1.1	0.29417	N	0.860819	D	0.76494	0.999	D	0.69654	0.965	T	0.09079	-1.0691	10	0.66056	D	0.02	-28.2492	5.1667	0.15088	0.7257:0.1813:0.093:0.0	.	20	Q96RS0	TGS1_HUMAN	G	20	ENSP00000260129:E20G	ENSP00000260129:E20G	E	+	2	0	TGS1	56848790	1.000000	0.71417	0.985000	0.45067	0.016000	0.09150	3.894000	0.56250	0.971000	0.38288	-0.256000	0.11100	GAG	-	NULL		0.502	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGS1	protein_coding	OTTHUMT00000378152.1	A	NM_024831	-		56686236	+1	no_errors	ENST00000260129	ensembl	human	known	74_37	missense	SNP	0.972	G
ARSK	153642	genome.wustl.edu	37	5	94927274	94927274	+	Silent	SNP	C	C	T	rs140272875		TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr5:94927274C>T	ENST00000380009.4	+	6	1246	c.1041C>T	c.(1039-1041)gcC>gcT	p.A347A		NM_198150.2	NP_937793.1	Q6UWY0	ARSK_HUMAN	arylsulfatase family, member K	347					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(1)	16		all_cancers(142;3.38e-06)|all_epithelial(76;6.57e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)		all cancers(79;6.5e-16)		GAATTAAAGCCGGCCTACAAG	0.398													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21141	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000164291	C		4,4402	8.1+/-20.4	0,4,2199	210.0	221.0	217.0		1041	3.9	1.0	5	dbSNP_134	217	0,8600		0,0,4300	no	coding-synonymous	ARSK	NM_198150.2		0,4,6499	TT,TC,CC		0.0,0.0908,0.0308		347/537	94927274	4,13002	2203	4300	6503	ARSK	SO:0001819	synonymous_variant	0			-	HGNC		CCDS4073.1	5q15	2013-02-14	2006-03-07		ENSG00000164291	ENSG00000164291		"""Arylsulfatase family"""	25239	protein-coding gene	gene with protein product		610011	"""arylsulfatase K"""			12975309, 16174644	Standard	NM_198150		Approved	DKFZp313G1735, TSULF	uc003kld.3	Q6UWY0	OTTHUMG00000121166	ENST00000380009.4:c.1041C>T	5.37:g.94927274C>T		Somatic	0	57	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	50	37.50	A2BDE3|B4E1I4|Q3ZCW3|Q8N3Q8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.A347	ENST00000380009.4	37	c.1041	CCDS4073.1	5																																																																																			-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core		0.398	ARSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSK	protein_coding	OTTHUMT00000241652.2	C	NM_198150	rs140272875		94927274	+1	no_errors	ENST00000380009	ensembl	human	known	74_37	silent	SNP	0.970	T
NBEAL1	65065	genome.wustl.edu	37	2	203880879	203880882	+	5'UTR	DEL	ATTT	ATTT	-			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	ATTT	ATTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr2:203880879_203880882delATTT	ENST00000449802.1	+	0	105_108				NBEAL1_ENST00000478884.1_3'UTR|WDR12_ENST00000477723.1_5'Flank	NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1											NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						TCTTTCACAGATTTATTTAATTGC	0.338																																																	0								ENSG00000144426																																			NBEAL1	SO:0001623	5_prime_UTR_variant	0				HGNC	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.-226ATTT>-	2.37:g.203880883_203880886delATTT		Somatic	0	18	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	10	37.50	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000449802.1	37	NULL	CCDS46495.1	2																																																																																			-	-		0.338	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	protein_coding	OTTHUMT00000333982.4	ATTT				203880882	+1	no_errors	ENST00000478884	ensembl	human	known	74_37	rna	DEL	0.540:0.499:0.269:0.151	-
FLAD1	80308	genome.wustl.edu	37	1	154965395	154965395	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr1:154965395G>T	ENST00000292180.3	+	7	1968	c.1646G>T	c.(1645-1647)aGt>aTt	p.S549I	FLAD1_ENST00000405236.2_3'UTR|FLAD1_ENST00000368428.1_Missense_Mutation_p.S90I|LENEP_ENST00000392487.1_5'Flank|FLAD1_ENST00000368432.1_3'UTR|FLAD1_ENST00000315144.10_Missense_Mutation_p.S452I|FLAD1_ENST00000295530.2_3'UTR	NM_025207.4	NP_079483.3	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase 1	549	FAD synthase.				FAD biosynthetic process (GO:0006747)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|FMN adenylyltransferase activity (GO:0003919)			endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|ovary(3)|skin(3)	22	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TCACTGGGGAGTCGGGAGAAT	0.592																																																	0								ENSG00000160688						65.0	58.0	61.0					1																	154965395		2203	4300	6503	FLAD1	SO:0001583	missense	0			-	HGNC		CCDS1078.1, CCDS1079.1, CCDS53371.1, CCDS53372.1	1q22	2013-03-05	2013-03-05		ENSG00000160688	ENSG00000160688	2.7.7.2		24671	protein-coding gene	gene with protein product		610595	"""Fad1, flavin adenine dinucleotide synthetase, homolog (yeast)"", ""FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)"", ""flavin adenine dinucleotide synthetase"""				Standard	NM_001184891		Approved	PP591, FAD1	uc001fgf.2	Q8NFF5	OTTHUMG00000037416	ENST00000292180.3:c.1646G>T	1.37:g.154965395G>T	ENSP00000292180:p.Ser549Ile	Somatic	0	31	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	34	12.82	Q8N5J1|Q8N686|Q8WU93|Q8WUJ4|Q96CR8|Q99764|Q9HBN6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PAPS_reduct	p.S90I	ENST00000292180.3	37	c.269	CCDS1078.1	1	.	.	.	.	.	.	.	.	.	.	G	19.67	3.871379	0.72065	.	.	ENSG00000160688	ENST00000315144;ENST00000292180;ENST00000368428	.	.	.	4.96	4.96	0.65561	Phosphoadenosine phosphosulphate reductase (1);	0.042990	0.85682	D	0.000000	T	0.71451	0.3341	M	0.81112	2.525	0.80722	D	1	D	0.55385	0.971	P	0.54759	0.76	T	0.76443	-0.2957	9	0.72032	D	0.01	-12.4013	17.9901	0.89166	0.0:0.0:1.0:0.0	.	549	Q8NFF5	FAD1_HUMAN	I	452;549;90	.	ENSP00000292180:S549I	S	+	2	0	FLAD1	153232019	1.000000	0.71417	0.963000	0.40424	0.169000	0.22640	8.641000	0.91032	2.599000	0.87857	0.511000	0.50034	AGT	-	pfam_PAPS_reduct		0.592	FLAD1-001	NOVEL	basic|CCDS	protein_coding	FLAD1	protein_coding	OTTHUMT00000091089.1	G	NM_025207	-		154965395	+1	no_errors	ENST00000368428	ensembl	human	putative	74_37	missense	SNP	1.000	T
FGD3	89846	genome.wustl.edu	37	9	95766308	95766308	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr9:95766308C>T	ENST00000375482.3	+	5	1065	c.569C>T	c.(568-570)gCg>gTg	p.A190V	FGD3_ENST00000416701.2_Missense_Mutation_p.A190V|FGD3_ENST00000337352.6_Missense_Mutation_p.A190V	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	190	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.A190V(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						CTGACGGATGCGGGGATCCCT	0.597											OREG0019318	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)						ENSG00000127084						76.0	79.0	78.0					9																	95766308		2059	4215	6274	FGD3	SO:0001583	missense	0			-	HGNC	AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.569C>T	9.37:g.95766308C>T	ENSP00000364631:p.Ala190Val	Somatic	0	39	0.00	1315	0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.A190V	ENST00000375482.3	37	c.569	CCDS43849.1	9	.	.	.	.	.	.	.	.	.	.	C	22.0	4.230760	0.79688	.	.	ENSG00000127084	ENST00000375482;ENST00000416701;ENST00000337352	T;T;T	0.64085	-0.08;-0.08;-0.08	4.62	3.72	0.42706	Dbl homology (DH) domain (5);	0.208574	0.24285	N	0.039865	T	0.79470	0.4451	M	0.85041	2.73	0.80722	D	1	D;P	0.89917	1.0;0.945	D;P	0.76071	0.987;0.876	T	0.82123	-0.0613	10	0.62326	D	0.03	.	12.4461	0.55651	0.0:0.9156:0.0:0.0844	.	190;190	F8W7P2;Q5JSP0	.;FGD3_HUMAN	V	190	ENSP00000364631:A190V;ENSP00000413833:A190V;ENSP00000336914:A190V	ENSP00000336914:A190V	A	+	2	0	FGD3	94806129	0.974000	0.33945	0.967000	0.41034	0.634000	0.38068	3.685000	0.54678	1.275000	0.44379	-0.119000	0.15052	GCG	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.597	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FGD3	protein_coding	OTTHUMT00000055493.1	C	NM_033086	-		95766308	+1	no_errors	ENST00000337352	ensembl	human	known	74_37	missense	SNP	0.999	T
CFAP46	54777	genome.wustl.edu	37	10	134663926	134663926	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr10:134663926G>A	ENST00000368586.5	-	41	5874	c.5774C>T	c.(5773-5775)aCg>aTg	p.T1925M	TTC40_ENST00000263170.5_Missense_Mutation_p.T86M	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CCGCTTCAGCGTGAACCATTG	0.667																																																	0								ENSG00000171811						23.0	15.0	17.0					10																	134663926		2193	4291	6484	TTC40	SO:0001583	missense	0			-	HGNC																												ENST00000368586.5:c.5774C>T	10.37:g.134663926G>A	ENSP00000357575:p.Thr1925Met	Somatic	0	152	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	41	47.44		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T86M	ENST00000368586.5	37	c.257	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	G	9.394	1.076253	0.20227	.	.	ENSG00000171811	ENST00000368586;ENST00000263170	T;T	0.12984	2.85;2.63	4.14	-6.38	0.01957	.	3.319490	0.01335	N	0.011369	T	0.09247	0.0228	L	0.46157	1.445	0.09310	N	0.999999	P	0.38745	0.645	B	0.26094	0.066	T	0.33420	-0.9869	10	0.48119	T	0.1	.	5.3622	0.16093	0.5663:0.0:0.1765:0.2572	.	86	Q8IYW2	CJ092_HUMAN	M	1925;86	ENSP00000357575:T1925M;ENSP00000263170:T86M	ENSP00000263170:T86M	T	-	2	0	C10orf93	134513916	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.936000	0.03946	-1.000000	0.03438	-0.150000	0.13652	ACG	-	NULL		0.667	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	protein_coding	OTTHUMT00000051095.3	G		-		134663926	-1	no_errors	ENST00000263170	ensembl	human	known	74_37	missense	SNP	0.001	A
POLM	27434	genome.wustl.edu	37	7	44116110	44116110	+	Missense_Mutation	SNP	G	G	T	rs149703411		TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr7:44116110G>T	ENST00000242248.5	-	6	934	c.833C>A	c.(832-834)gCg>gAg	p.A278E	POLM_ENST00000492971.1_5'UTR|POLM_ENST00000395831.3_Intron|POLM_ENST00000335195.6_Missense_Mutation_p.A278E	NM_013284.2	NP_037416.1	Q9NP87	DPOLM_HUMAN	polymerase (DNA directed), mu	278					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(3)|skin(2)	22						GGGCTCACCCGCTTTCTGCTG	0.607								DNA polymerases (catalytic subunits)																																									0								ENSG00000122678						114.0	109.0	111.0					7																	44116110		2203	4300	6503	POLM	SO:0001583	missense	0			-	HGNC	AF176097	CCDS34625.1, CCDS64635.1, CCDS64636.1	7p13	2012-05-18			ENSG00000122678	ENSG00000122678		"""DNA polymerases"""	9185	protein-coding gene	gene with protein product	"""Pol iota"""	606344				10982892	Standard	XM_005249708		Approved	Tdt-N	uc003tjt.3	Q9NP87	OTTHUMG00000155353	ENST00000242248.5:c.833C>A	7.37:g.44116110G>T	ENSP00000242248:p.Ala278Glu	Somatic	0	23	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	D3DVK4|Q6P5X8|Q86WQ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA_pol_lambd_fingers_domain,superfamily_DNA_pol_b-like_N,superfamily_DNA_pol_lambd_fingers_domain,superfamily_BRCT_dom,smart_DNA-dir_DNA_pol_X,pirsf_TdT/Mu,pfscan_BRCT_dom,prints_TdT/Mu,prints_DNA_pol_X,prints_DNA_pol_X_beta-like	p.A278E	ENST00000242248.5	37	c.833	CCDS34625.1	7	.	.	.	.	.	.	.	.	.	.	G	14.52	2.559204	0.45590	.	.	ENSG00000122678	ENST00000335195;ENST00000242248	T;T	0.48201	0.82;0.82	5.68	2.58	0.30949	DNA-directed DNA polymerase X (1);DNA polymerase lambda, fingers domain (2);	.	.	.	.	T	0.64724	0.2624	M	0.81942	2.565	0.80722	D	1	D;D	0.71674	0.993;0.998	D;D	0.72075	0.964;0.976	T	0.62807	-0.6776	9	0.72032	D	0.01	.	7.3723	0.26808	0.3134:0.0:0.6866:0.0	.	278;278	Q6P5X8;Q9NP87	.;DPOLM_HUMAN	E	278	ENSP00000335141:A278E;ENSP00000242248:A278E	ENSP00000242248:A278E	A	-	2	0	POLM	44082635	1.000000	0.71417	0.966000	0.40874	0.719000	0.41307	2.174000	0.42482	0.206000	0.20587	-0.143000	0.13931	GCG	-	pfam_DNA_pol_lambd_fingers_domain,superfamily_DNA_pol_lambd_fingers_domain,smart_DNA-dir_DNA_pol_X,pirsf_TdT/Mu,prints_DNA_pol_X_beta-like		0.607	POLM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	POLM	protein_coding	OTTHUMT00000339594.1	G	NM_013284	-		44116110	-1	no_errors	ENST00000242248	ensembl	human	known	74_37	missense	SNP	0.996	T
ETV5	2119	genome.wustl.edu	37	3	185823486	185823486	+	Nonsense_Mutation	SNP	C	C	A			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr3:185823486C>A	ENST00000306376.5	-	3	307	c.61G>T	c.(61-63)Gaa>Taa	p.E21*	DGKG_ENST00000447054.1_5'UTR|ETV5_ENST00000537818.1_Nonsense_Mutation_p.E63*|ETV5_ENST00000434744.1_Nonsense_Mutation_p.E21*	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	21					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			CCTCTGCATTCCTCAGATCGA	0.463			T	"""TMPRSS2, SCL45A3"""	Prostate																																			Dom	yes		3	3q28	2119	ets variant gene 5		E	0								ENSG00000244405						96.0	94.0	94.0					3																	185823486		2203	4300	6503	ETV5	SO:0001587	stop_gained	0			-	HGNC	BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.61G>T	3.37:g.185823486C>A	ENSP00000306894:p.Glu21*	Somatic	0	91	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	46	47.13	A6NH46|B7Z7D7|Q6IBN5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ETS_PEA3_N,pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.E63*	ENST00000306376.5	37	c.187	CCDS33906.1	3	.	.	.	.	.	.	.	.	.	.	C	36	5.867951	0.97043	.	.	ENSG00000244405	ENST00000306376;ENST00000434744;ENST00000537818;ENST00000440773;ENST00000421809;ENST00000413301;ENST00000422039	.	.	.	5.71	5.71	0.89125	.	0.499554	0.22290	N	0.062015	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	16.7708	0.85537	0.0:1.0:0.0:0.0	.	.	.	.	X	21;21;63;21;21;21;21	.	ENSP00000306894:E21X	E	-	1	0	ETV5	187306180	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.081000	0.50120	2.699000	0.92147	0.462000	0.41574	GAA	-	pfam_ETS_PEA3_N		0.463	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV5	protein_coding	OTTHUMT00000344947.1	C	NM_004454	-		185823486	-1	no_errors	ENST00000537818	ensembl	human	known	74_37	nonsense	SNP	1.000	A
RP1	6101	genome.wustl.edu	37	8	55539286	55539286	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr8:55539286C>A	ENST00000220676.1	+	4	2992	c.2844C>A	c.(2842-2844)agC>agA	p.S948R		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	948					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TAAATTGTAGCAATAATAGTT	0.318																																					Colon(91;1014 1389 7634 14542 40420)												0								ENSG00000104237						42.0	45.0	44.0					8																	55539286		2203	4300	6503	RP1	SO:0001583	missense	0			-	HGNC	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.2844C>A	8.37:g.55539286C>A	ENSP00000220676:p.Ser948Arg	Somatic	0	93	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	51	46.32		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.S948R	ENST00000220676.1	37	c.2844	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	C	4.642	0.119367	0.08881	.	.	ENSG00000104237	ENST00000220676	T	0.47177	0.85	5.54	-2.04	0.07343	.	0.519751	0.18706	N	0.133430	T	0.33644	0.0870	L	0.29908	0.895	0.09310	N	1	B	0.16166	0.016	B	0.13407	0.009	T	0.34625	-0.9821	10	0.87932	D	0	.	13.486	0.61366	0.0:0.5115:0.0:0.4885	.	948	P56715	RP1_HUMAN	R	948	ENSP00000220676:S948R	ENSP00000220676:S948R	S	+	3	2	RP1	55701839	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.757000	0.04772	-0.321000	0.08627	0.609000	0.83330	AGC	-	NULL		0.318	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	protein_coding	OTTHUMT00000378532.2	C	NM_006269	-		55539286	+1	no_errors	ENST00000220676	ensembl	human	known	74_37	missense	SNP	0.000	A
DNAH2	146754	genome.wustl.edu	37	17	7727575	7727575	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr17:7727575G>A	ENST00000572933.1	+	76	13075	c.11615G>A	c.(11614-11616)gGc>gAc	p.G3872D	DNAH2_ENST00000389173.2_Missense_Mutation_p.G3872D			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3872	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CTGGGCCAGGGCCAGGCCCCC	0.652																																																	0								ENSG00000183914						38.0	36.0	37.0					17																	7727575		2203	4300	6503	DNAH2	SO:0001583	missense	0			-	HGNC	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.11615G>A	17.37:g.7727575G>A	ENSP00000458355:p.Gly3872Asp	Somatic	0	27	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	11	31.25	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.G3872D	ENST00000572933.1	37	c.11615	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	G	27.6	4.849221	0.91277	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.15139	2.45	4.72	4.72	0.59763	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.55337	0.1914	H	0.95539	3.685	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.992;1.0	T	0.71560	-0.4556	10	0.87932	D	0	.	16.4313	0.83844	0.0:0.0:1.0:0.0	.	3833;3872	Q9P225-2;Q9P225	.;DYH2_HUMAN	D	3833;3872	ENSP00000373825:G3872D	ENSP00000353818:G3833D	G	+	2	0	DNAH2	7668300	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	9.387000	0.97232	2.177000	0.69029	0.407000	0.27541	GGC	-	pfam_Dynein_heavy_dom		0.652	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	protein_coding	OTTHUMT00000440241.1	G	NM_020877	-		7727575	+1	no_errors	ENST00000389173	ensembl	human	known	74_37	missense	SNP	1.000	A
TBCB	1155	genome.wustl.edu	37	19	36606551	36606551	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr19:36606551G>A	ENST00000221855.3	+	1	664	c.89G>A	c.(88-90)cGc>cAc	p.R30H	TBCB_ENST00000586868.1_5'Flank|TBCB_ENST00000589996.1_Missense_Mutation_p.R30H|POLR2I_ENST00000221859.4_5'Flank|TBCB_ENST00000392178.4_3'UTR|TBCB_ENST00000585746.1_5'Flank	NM_001281.2	NP_001272.2	Q99426	TBCB_HUMAN	tubulin folding cofactor B	30					'de novo' posttranslational protein folding (GO:0051084)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CGATACAGCCGCAGCCTCACC	0.667																																																	0								ENSG00000105254						31.0	21.0	25.0					19																	36606551		2202	4299	6501	TBCB	SO:0001583	missense	0			-	HGNC	AF013488	CCDS12488.1, CCDS74344.1	19q13.11-q13.12	2008-02-05	2006-11-22	2006-11-22	ENSG00000105254	ENSG00000105254			1989	protein-coding gene	gene with protein product		601303	"""cytoskeleton-associated protein 1"", ""cytoskeleton associated protein 1"""	CKAP1		8978778	Standard	NM_001281		Approved	CG22, CKAPI	uc002odg.1	Q99426	OTTHUMG00000048143	ENST00000221855.3:c.89G>A	19.37:g.36606551G>A	ENSP00000221855:p.Arg30His	Somatic	0	72	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	17	41.38	O00111|O00674|O14728|Q6FGY5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.R30H	ENST00000221855.3	37	c.89	CCDS12488.1	19	.	.	.	.	.	.	.	.	.	.	G	29.1	4.980985	0.92982	.	.	ENSG00000105254	ENST00000221855;ENST00000392178	D	0.91577	-2.87	5.33	4.3	0.51218	.	0.068324	0.64402	D	0.000001	D	0.87939	0.6304	M	0.74881	2.28	0.80722	D	1	B	0.34313	0.448	B	0.25759	0.063	D	0.86029	0.1512	10	0.41790	T	0.15	-17.774	11.6949	0.51538	0.0866:0.0:0.9134:0.0	.	30	Q99426	TBCB_HUMAN	H	30	ENSP00000221855:R30H	ENSP00000221855:R30H	R	+	2	0	TBCB	41298391	1.000000	0.71417	0.999000	0.59377	0.947000	0.59692	5.962000	0.70364	1.255000	0.44051	0.484000	0.47621	CGC	-	NULL		0.667	TBCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCB	protein_coding	OTTHUMT00000156291.2	G	NM_001281	-		36606551	+1	no_errors	ENST00000221855	ensembl	human	known	74_37	missense	SNP	1.000	A
GRIA1	2890	genome.wustl.edu	37	5	152873493	152873493	+	Missense_Mutation	SNP	T	T	G			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr5:152873493T>G	ENST00000285900.5	+	2	431	c.88T>G	c.(88-90)Tta>Gta	p.L30V	GRIA1_ENST00000340592.5_Missense_Mutation_p.L30V|GRIA1_ENST00000518142.1_Missense_Mutation_p.L30V|GRIA1_ENST00000448073.4_Missense_Mutation_p.L40V|GRIA1_ENST00000518862.1_3'UTR|GRIA1_ENST00000521843.2_De_novo_Start_OutOfFrame|GRIA1_ENST00000518783.1_Missense_Mutation_p.L40V	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	30					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	CATAGGGGGATTATTTCCAAA	0.458																																																	0								ENSG00000155511						113.0	111.0	112.0					5																	152873493		2203	4300	6503	GRIA1	SO:0001583	missense	0			-	HGNC		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.88T>G	5.37:g.152873493T>G	ENSP00000285900:p.Leu30Val	Somatic	0	26	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	44	16.98	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.L40V	ENST00000285900.5	37	c.118	CCDS4322.1	5	.	.	.	.	.	.	.	.	.	.	T	14.16	2.453436	0.43531	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000340592;ENST00000518783;ENST00000448073	T;T;T;T;T	0.51574	1.73;0.7;1.73;2.4;2.4	5.48	4.32	0.51571	.	0.000000	0.64402	D	0.000003	T	0.54111	0.1838	L	0.36672	1.1	0.80722	D	1	D;D;P;D;D;P	0.65815	0.991;0.991;0.956;0.991;0.995;0.467	D;D;P;D;D;B	0.71870	0.944;0.944;0.899;0.944;0.975;0.099	T	0.55159	-0.8184	10	0.87932	D	0	.	7.8105	0.29228	0.0:0.1598:0.0:0.8402	.	40;40;30;40;30;30	E7ESV8;B7Z9G9;B7Z3F6;B7Z2W8;P42261-2;P42261	.;.;.;.;.;GRIA1_HUMAN	V	30;30;30;30;40;40	ENSP00000285900:L30V;ENSP00000427920:L30V;ENSP00000339343:L30V;ENSP00000428994:L40V;ENSP00000415569:L40V	ENSP00000285900:L30V	L	+	1	2	GRIA1	152853686	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.559000	0.53756	0.911000	0.36747	0.533000	0.62120	TTA	-	NULL		0.458	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	protein_coding	OTTHUMT00000252456.3	T		-		152873493	+1	no_errors	ENST00000448073	ensembl	human	known	74_37	missense	SNP	1.000	G
TIMM44	10469	genome.wustl.edu	37	19	7998995	7998995	+	Silent	SNP	C	C	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr19:7998995C>T	ENST00000270538.3	-	5	790	c.522G>A	c.(520-522)gcG>gcA	p.A174A	TIMM44_ENST00000598968.1_5'Flank	NM_006351.3	NP_006342.2	O43615	TIM44_HUMAN	translocase of inner mitochondrial membrane 44 homolog (yeast)	174					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			NS(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	17						CTCTGAAGGCCGCTGTCCTGC	0.682																																																	0								ENSG00000104980						74.0	80.0	78.0					19																	7998995		2203	4300	6503	TIMM44	SO:0001819	synonymous_variant	0			-	HGNC	AF026030	CCDS12192.1	19p13.3-p13.2	2008-07-04				ENSG00000104980			17316	protein-coding gene	gene with protein product		605058				10848612, 10339406	Standard	NM_006351		Approved	TIM44	uc002miz.3	O43615		ENST00000270538.3:c.522G>A	19.37:g.7998995C>T		Somatic	0	68	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	13	50.00	A8K0R9|D6W664|Q8N193	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tim44-like_dom,smart_Tim44-like_dom,pirsf_Tim44,tigrfam_Tim44	p.A174	ENST00000270538.3	37	c.522	CCDS12192.1	19																																																																																			-	pirsf_Tim44,tigrfam_Tim44		0.682	TIMM44-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	TIMM44	protein_coding	OTTHUMT00000461596.3	C		-		7998995	-1	no_errors	ENST00000270538	ensembl	human	known	74_37	silent	SNP	0.004	T
ZNF630	57232	genome.wustl.edu	37	X	47920220	47920220	+	Silent	SNP	G	G	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chrX:47920220G>T	ENST00000409324.3	-	3	346	c.120C>A	c.(118-120)acC>acA	p.T40T	ZNF630_ENST00000276054.4_5'UTR|ZNF630_ENST00000442455.3_Silent_p.T26T|ZNF630-AS1_ENST00000436124.1_RNA	NM_001037735.2	NP_001032824.2	Q2M218	ZN630_HUMAN	zinc finger protein 630	40	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(6)|lung(11)|ovary(1)	19						GGTGATTATAGGTCTCCAGCA	0.493																																																	0								ENSG00000221994						79.0	60.0	66.0					X																	47920220		1557	3570	5127	ZNF630	SO:0001819	synonymous_variant	0			-	HGNC	AK000580	CCDS35237.2, CCDS75971.1	Xp11.3-p11.1	2013-01-08			ENSG00000221994	ENSG00000221994		"""Zinc fingers, C2H2-type"", ""-"""	28855	protein-coding gene	gene with protein product		300819					Standard	NM_001037735		Approved	BC037316, dJ54B20.2, FLJ20573, MGC138344	uc004div.4	Q2M218	OTTHUMG00000021463	ENST00000409324.3:c.120C>A	X.37:g.47920220G>T		Somatic	0	43	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	34	37.04	F8WAG4|Q5H8Z5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T40	ENST00000409324.3	37	c.120	CCDS35237.2	X																																																																																			-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.493	ZNF630-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF630	protein_coding	OTTHUMT00000327254.1	G	NM_001037735	-		47920220	-1	no_errors	ENST00000409324	ensembl	human	known	74_37	silent	SNP	0.052	T
AMPD1	270	genome.wustl.edu	37	1	115215870	115215870	+	Silent	SNP	G	G	A			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr1:115215870G>A	ENST00000520113.2	-	16	2223	c.2208C>T	c.(2206-2208)gaC>gaT	p.D736D	AMPD1_ENST00000369538.3_Silent_p.D732D|AMPD1_ENST00000353928.6_Silent_p.D703D			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	736					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	CAAGGTAATTGTCGCCCAGAA	0.418																																																	0								ENSG00000116748						76.0	74.0	74.0					1																	115215870		2203	4300	6503	AMPD1	SO:0001819	synonymous_variant	0			-	HGNC	M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.2208C>T	1.37:g.115215870G>A		Somatic	0	72	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	75	8.54	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	p.D736	ENST00000520113.2	37	c.2208	CCDS876.2	1																																																																																			-	pirsf_AMP_deaminase,tigrfam_AMP_deaminase		0.418	AMPD1-001	KNOWN	basic|CCDS	protein_coding	AMPD1	protein_coding	OTTHUMT00000032860.4	G		-		115215870	-1	no_errors	ENST00000520113	ensembl	human	known	74_37	silent	SNP	0.000	A
OBFC1	79991	genome.wustl.edu	37	10	105642449	105642449	+	Missense_Mutation	SNP	G	G	A	rs140449924		TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr10:105642449G>A	ENST00000224950.3	-	10	1267	c.1100C>T	c.(1099-1101)gCg>gTg	p.A367V	RP11-541N10.3_ENST00000568017.1_RNA|OBFC1_ENST00000466828.1_5'UTR|OBFC1_ENST00000369764.1_Missense_Mutation_p.A367V	NM_024928.4	NP_079204.2	Q9H668	STN1_HUMAN	oligonucleotide/oligosaccharide-binding fold containing 1	367	Winged helix-turn-helix (wHTH) 2.				positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromosome, telomeric region (GO:0000784)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)|single-stranded telomeric DNA binding (GO:0043047)			large_intestine(3)|lung(7)|ovary(1)|pancreas(2)	13		Colorectal(252;0.178)		Epithelial(162;3.39e-10)|all cancers(201;1.32e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0151)		TGCTCAGAACGCTGTGTAGTA	0.567																																																	0								ENSG00000107960	G	VAL/ALA	0,4406		0,0,2203	95.0	89.0	91.0		1100	4.5	0.0	10	dbSNP_134	91	4,8596	3.7+/-12.6	0,4,4296	yes	missense	OBFC1	NM_024928.4	64	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	benign	367/369	105642449	4,13002	2203	4300	6503	OBFC1	SO:0001583	missense	0			-	HGNC	BC017400	CCDS7552.1	10q25.1	2011-06-14				ENSG00000107960			26200	protein-coding gene	gene with protein product		613128				12477932	Standard	NM_024928		Approved	FLJ22559, bA541N10.2	uc001kxm.3	Q9H668		ENST00000224950.3:c.1100C>T	10.37:g.105642449G>A	ENSP00000224950:p.Ala367Val	Somatic	0	28	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	D3DR99|Q5TCZ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CST_STN1_C,pfam_NA-bd_OB_tRNA,superfamily_NA-bd_OB-fold,pirsf_CST_STN1	p.A367V	ENST00000224950.3	37	c.1100	CCDS7552.1	10	.	.	.	.	.	.	.	.	.	.	G	16.52	3.145397	0.57044	0.0	4.65E-4	ENSG00000107960	ENST00000224950;ENST00000369764	T;T	0.35973	1.28;1.28	5.43	4.51	0.55191	.	0.348407	0.33272	N	0.005088	T	0.28830	0.0715	L	0.58101	1.795	0.25950	N	0.982762	P	0.41475	0.751	B	0.25140	0.058	T	0.19943	-1.0290	10	0.32370	T	0.25	-9.2702	14.1698	0.65503	0.0:0.1512:0.8488:0.0	.	367	Q9H668	STN1_HUMAN	V	367	ENSP00000224950:A367V;ENSP00000358779:A367V	ENSP00000224950:A367V	A	-	2	0	OBFC1	105632439	0.989000	0.36119	0.045000	0.18777	0.360000	0.29518	4.013000	0.57138	1.387000	0.46486	0.491000	0.48974	GCG	-	pirsf_CST_STN1		0.567	OBFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OBFC1	protein_coding	OTTHUMT00000050174.1	G	NM_024928	rs140449924		105642449	-1	no_errors	ENST00000224950	ensembl	human	known	74_37	missense	SNP	0.452	A
WIF1	11197	genome.wustl.edu	37	12	65471568	65471568	+	Missense_Mutation	SNP	C	C	T	rs575603863		TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr12:65471568C>T	ENST00000286574.4	-	3	729	c.355G>A	c.(355-357)Gtc>Atc	p.V119I		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	119	WIF. {ECO:0000255|PROSITE- ProRule:PRU00222}.				multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)				cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		GGGACATTGACGGTTGGATCT	0.453			T	HMGA2	pleomorphic salivary gland adenoma								C|||	1	0.000199681	0.0008	0.0	5008	,	,		19849	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(148;1595 1816 48559 49439 49664)			Dom	yes		12	12q14.3	11197	WNT inhibitory factor 1		E	0								ENSG00000156076						123.0	104.0	111.0					12																	65471568		2203	4300	6503	WIF1	SO:0001583	missense	0			-	HGNC	AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.355G>A	12.37:g.65471568C>T	ENSP00000286574:p.Val119Ile	Somatic	0	16	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	37	43.94	Q6UXI1|Q8WVG4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WIF,pfam_EGF_extracell,smart_WIF,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_WIF,prints_Wnt-inh	p.V119I	ENST00000286574.4	37	c.355	CCDS8971.1	12	.	.	.	.	.	.	.	.	.	.	C	10.84	1.464130	0.26335	.	.	ENSG00000156076	ENST00000286574;ENST00000546001	T;T	0.42513	0.97;0.97	5.35	3.5	0.40072	WIF domain (4);	0.072136	0.53938	D	0.000051	T	0.23649	0.0572	N	0.14661	0.345	0.47407	D	0.999417	B	0.17268	0.021	B	0.12837	0.008	T	0.05386	-1.0888	9	.	.	.	.	11.0158	0.47687	0.0:0.7941:0.0:0.2059	.	119	Q9Y5W5	WIF1_HUMAN	I	119;57	ENSP00000286574:V119I;ENSP00000442063:V57I	.	V	-	1	0	WIF1	63757835	0.547000	0.26465	0.884000	0.34674	0.831000	0.47069	1.008000	0.29872	1.410000	0.46936	0.650000	0.86243	GTC	-	pfam_WIF,smart_WIF,pfscan_WIF,prints_Wnt-inh		0.453	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WIF1	protein_coding	OTTHUMT00000401258.2	C		-		65471568	-1	no_errors	ENST00000286574	ensembl	human	known	74_37	missense	SNP	0.956	T
OC90	729330	genome.wustl.edu	37	8	133045354	133045354	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr8:133045354G>A	ENST00000443356.2	-	12	925	c.839C>T	c.(838-840)gCt>gTt	p.A280V	OC90_ENST00000262283.5_Missense_Mutation_p.A476V|OC90_ENST00000603859.1_Missense_Mutation_p.A264V|OC90_ENST00000254627.3_Missense_Mutation_p.A264V			Q02509	OC90_HUMAN	otoconin 90	280					lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(23)|ovary(2)|prostate(1)|skin(1)	37	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			TTTAATGCCAGCAGGGACAAG	0.453																																																	0								ENSG00000258417						61.0	64.0	63.0					8																	133045354		1900	4124	6024	OC90	SO:0001583	missense	0			-	Uniprot_gn	Z14310	CCDS47919.1	8q24.22	2011-03-01			ENSG00000253117	ENSG00000253117			8100	protein-coding gene	gene with protein product		601658		PLA2L		10329003, 9860971	Standard	NM_001080399		Approved		uc011lix.1	Q02509	OTTHUMG00000164672	ENST00000443356.2:c.839C>T	8.37:g.133045354G>A	ENSP00000390050:p.Ala280Val	Somatic	0	16	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	17	45.16	B4DNG8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PLipase_A2_dom,superfamily_PLipase_A2_dom,smart_PLipase_A2_dom,prints_PLipase_A2	p.A280V	ENST00000443356.2	37	c.839		8	.	.	.	.	.	.	.	.	.	.	G	12.29	1.893423	0.33442	.	.	ENSG00000253117;ENSG00000253117;ENSG00000258417	ENST00000254627;ENST00000443356;ENST00000262283	T;T;T	0.37058	1.44;1.27;1.22	4.58	2.79	0.32731	.	0.554792	0.18314	N	0.145006	T	0.24967	0.0606	L	0.32530	0.975	0.09310	N	1	B;B	0.25772	0.134;0.048	B;B	0.23275	0.045;0.02	T	0.19031	-1.0318	10	0.62326	D	0.03	-1.1284	6.9768	0.24679	0.2026:0.0:0.7974:0.0	.	264;280	Q02509-2;Q02509	.;OC90_HUMAN	V	264;280;476	ENSP00000254627:A264V;ENSP00000390050:A280V;ENSP00000262283:A476V	ENSP00000254627:A264V	A	-	2	0	RP11-240B13.2;OC90	133114536	0.000000	0.05858	0.001000	0.08648	0.024000	0.10985	0.369000	0.20416	0.865000	0.35603	-0.218000	0.12543	GCT	-	NULL		0.453	OC90-201	KNOWN	basic	protein_coding	OC90	protein_coding		G	NM_001080399	-		133045354	-1	no_errors	ENST00000443356	ensembl	human	known	74_37	missense	SNP	0.001	A
ZNF48	197407	genome.wustl.edu	37	16	30410334	30410339	+	In_Frame_Del	DEL	AGCACC	AGCACC	-			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	AGCACC	AGCACC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr16:30410334_30410339delAGCACC	ENST00000320159.2	+	2	2139_2144	c.1763_1768delAGCACC	c.(1762-1770)aagcaccag>aag	p.HQ589del		NM_001214906.1|NM_001214907.1|NM_001214909.1|NM_152652.2	NP_001201835.1|NP_001201836.1|NP_001201838.1|NP_689865.2	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	589					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)|pancreas(1)|skin(1)	21						GCCCGCATCAAGCACCAGCGTGGGCA	0.592																																																	0								ENSG00000180035																																			ZNF48	SO:0001651	inframe_deletion	0				HGNC	M88358, AK056313	CCDS10679.1, CCDS73868.1	16p11.2	2013-01-08			ENSG00000180035	ENSG00000180035		"""Zinc fingers, C2H2-type"""	13114	protein-coding gene	gene with protein product			"""zinc finger protein 553"""	ZNF553		1505991	Standard	NM_152652		Approved	DKFZp762K013, FLJ31751, MGC43952	uc021tgi.1	Q96MX3	OTTHUMG00000048195	ENST00000320159.2:c.1763_1768delAGCACC	16.37:g.30410334_30410339delAGCACC	ENSP00000324056:p.His589_Gln590del	Somatic	NA	NA	NA		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q15920|Q4G0R3|Q69YP3|Q96IL9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.HQ589in_frame_del	ENST00000320159.2	37	c.1763_1768	CCDS10679.1	16																																																																																			-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.592	ZNF48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF48	protein_coding	OTTHUMT00000255549.2	AGCACC	NM_152652			30410339	+1	no_errors	ENST00000320159	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000	-
ANKLE1	126549	genome.wustl.edu	37	19	17397483	17397483	+	3'UTR	SNP	G	G	T	rs367668712|rs60338123		TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr19:17397483G>T	ENST00000394458.3	+	0	2246				ANKLE1_ENST00000404085.1_3'UTR|ANKLE1_ENST00000598347.1_Missense_Mutation_p.V585L|ANKLE1_ENST00000594072.1_3'UTR	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1											large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						gtgtgtgtgtgtgtgtgtgtg	0.537																																																	0								ENSG00000160117																																			ANKLE1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.*122G>T	19.37:g.17397483G>T		Somatic	0	12	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	5	50.00	A8VU82|Q8N8J8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Lactate_DH/Glyco_Ohase_4_C,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V585L	ENST00000394458.3	37	c.1753	CCDS12354.2	19	.	.	.	.	.	.	.	.	.	.	g	7.620	0.676724	0.14841	.	.	ENSG00000160117	ENST00000438921	.	.	.	2.24	-0.708	0.11241	.	.	.	.	.	T	0.27098	0.0664	.	.	.	0.80722	D	1	B	0.31548	0.328	B	0.19148	0.024	T	0.07770	-1.0755	6	.	.	.	.	2.9012	0.05706	0.2004:0.2982:0.5014:0.0	.	585	E7ETZ9	.	L	585	.	.	V	+	1	0	ANKLE1	17258483	0.206000	0.23470	0.415000	0.26534	0.134000	0.20937	0.998000	0.29744	0.226000	0.20979	0.460000	0.39030	GTG	-	NULL		0.537	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKLE1	protein_coding	OTTHUMT00000325392.2	G	NM_152363	-		17397483	+1	no_errors	ENST00000598347	ensembl	human	putative	74_37	missense	SNP	0.927	T
ZFX	7543	genome.wustl.edu	37	X	24227114	24227114	+	Missense_Mutation	SNP	A	A	C			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chrX:24227114A>C	ENST00000379177.1	+	10	1618	c.1191A>C	c.(1189-1191)aaA>aaC	p.K397N	ZFX_ENST00000379188.3_Missense_Mutation_p.K397N|ZFX_ENST00000304543.5_Missense_Mutation_p.K397N|ZFX_ENST00000539115.1_Missense_Mutation_p.K168N|ZFX_ENST00000459724.1_3'UTR|ZFX_ENST00000540034.1_Missense_Mutation_p.K436N|ZFX_ENST00000338565.3_Missense_Mutation_p.K347N	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	397					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						CTAAACAAAAACCAAAGAAAA	0.507																																					Esophageal Squamous(20;306 562 7346 32868 37983)												0								ENSG00000005889						107.0	87.0	94.0					X																	24227114		2203	4300	6503	ZFX	SO:0001583	missense	0			-	HGNC		CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.1191A>C	X.37:g.24227114A>C	ENSP00000368475:p.Lys397Asn	Somatic	0	80	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	46	47.73	B9EG97|O43668|Q8WYJ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transcrp_activ_Zfx/Zfy-dom,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K436N	ENST00000379177.1	37	c.1308	CCDS14211.1	X	.	.	.	.	.	.	.	.	.	.	A	16.40	3.112252	0.56398	.	.	ENSG00000005889	ENST00000539115;ENST00000379188;ENST00000536464;ENST00000379177;ENST00000304543;ENST00000540034;ENST00000338565	T;T;T;T;T;T	0.60548	0.18;0.18;0.18;0.18;0.18;0.18	5.21	5.21	0.72293	Transcriptional activator, Zfx / Zfy domain (1);	0.000000	0.64402	D	0.000001	T	0.72898	0.3518	M	0.75777	2.31	0.39040	D	0.960115	D;D;D;D	0.89917	1.0;0.998;0.997;1.0	D;D;D;D	0.91635	0.999;0.943;0.994;0.999	T	0.76780	-0.2833	10	0.59425	D	0.04	0.0156	9.4497	0.38719	0.9161:0.0:0.0839:0.0	.	436;248;397;401	B9EG97;F5H6Z8;P17010;Q59EB9	.;.;ZFX_HUMAN;.	N	168;397;248;397;397;436;347	ENSP00000438233:K168N;ENSP00000368486:K397N;ENSP00000368475:K397N;ENSP00000304985:K397N;ENSP00000441382:K436N;ENSP00000343384:K347N	ENSP00000304985:K397N	K	+	3	2	ZFX	24137035	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.688000	0.54699	1.717000	0.51406	0.345000	0.21793	AAA	-	pfam_Transcrp_activ_Zfx/Zfy-dom		0.507	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFX	protein_coding	OTTHUMT00000056084.1	A	NM_003410	-		24227114	+1	no_errors	ENST00000540034	ensembl	human	known	74_37	missense	SNP	1.000	C
FCRL2	79368	genome.wustl.edu	37	1	157738333	157738333	+	Missense_Mutation	SNP	T	T	A			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr1:157738333T>A	ENST00000361516.3	-	5	802	c.754A>T	c.(754-756)Acc>Tcc	p.T252S	FCRL2_ENST00000469986.1_5'Flank|FCRL2_ENST00000368181.4_Intron|FCRL2_ENST00000392274.3_Missense_Mutation_p.T252S	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	252	Ig-like C2-type 3.				cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GAACGCTGGGTTTTCTTTCCC	0.517																																																	0								ENSG00000132704						182.0	180.0	181.0					1																	157738333		2203	4300	6503	FCRL2	SO:0001583	missense	0			-	HGNC	AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.754A>T	1.37:g.157738333T>A	ENSP00000355157:p.Thr252Ser	Somatic	0	43	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	24	44.19	A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T252S	ENST00000361516.3	37	c.754	CCDS1168.1	1	.	.	.	.	.	.	.	.	.	.	T	13.04	2.117018	0.37339	.	.	ENSG00000132704	ENST00000361516;ENST00000392274	T;T	0.11712	2.75;2.75	3.83	2.67	0.31697	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.590193	0.14008	N	0.347683	T	0.01730	0.0055	N	0.13140	0.3	0.09310	N	1	B;P	0.37207	0.169;0.587	B;B	0.37091	0.124;0.241	T	0.45469	-0.9259	10	0.20519	T	0.43	.	6.5246	0.22295	0.2144:0.0:0.0:0.7856	.	252;252	B4DVJ9;Q96LA5	.;FCRL2_HUMAN	S	252	ENSP00000355157:T252S;ENSP00000376100:T252S	ENSP00000355157:T252S	T	-	1	0	FCRL2	156004957	0.000000	0.05858	0.001000	0.08648	0.139000	0.21198	0.228000	0.17814	0.612000	0.30071	0.533000	0.62120	ACC	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.517	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRL2	protein_coding	OTTHUMT00000051408.2	T	NM_030764	-		157738333	-1	no_errors	ENST00000361516	ensembl	human	known	74_37	missense	SNP	0.002	A
FOXN3	1112	genome.wustl.edu	37	14	89878531	89878531	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr14:89878531G>A	ENST00000345097.4	-	2	406	c.290C>T	c.(289-291)tCc>tTc	p.S97F	FOXN3_ENST00000261302.5_Missense_Mutation_p.S97F|RP11-33N16.2_ENST00000556383.1_RNA|FOXN3_ENST00000557258.1_Missense_Mutation_p.S97F|FOXN3_ENST00000555353.1_Missense_Mutation_p.S97F|RP11-33N16.3_ENST00000555070.1_RNA	NM_001085471.1	NP_001078940.1	O00409	FOXN3_HUMAN	forkhead box N3	97					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GTGGGCAGGGGATGGGGGGGT	0.587																																																	0								ENSG00000053254						56.0	54.0	55.0					14																	89878531		2203	4300	6503	FOXN3	SO:0001583	missense	0			-	HGNC		CCDS32138.1, CCDS41977.1	14q32.11	2012-04-17	2007-05-02	2007-05-02	ENSG00000053254	ENSG00000053254		"""Forkhead boxes"""	1928	protein-coding gene	gene with protein product		602628	"""chromosome 14 open reading frame 116"", ""checkpoint suppressor 1"""	C14orf116, CHES1		9154802	Standard	NM_005197		Approved		uc001xxo.4	O00409	OTTHUMG00000170898	ENST00000345097.4:c.290C>T	14.37:g.89878531G>A	ENSP00000343288:p.Ser97Phe	Somatic	0	25	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	2	77.78	Q96II7|Q9UIE7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.S97F	ENST00000345097.4	37	c.290	CCDS41977.1	14	.	.	.	.	.	.	.	.	.	.	G	15.00	2.702017	0.48307	.	.	ENSG00000053254	ENST00000345097;ENST00000261302;ENST00000557258;ENST00000555353;ENST00000555855	D;D;D;D;D	0.95885	-3.73;-3.73;-3.54;-3.54;-3.84	5.15	4.25	0.50352	.	0.000000	0.85682	D	0.000000	D	0.95623	0.8577	M	0.71581	2.175	0.80722	D	1	P;P	0.52692	0.835;0.955	P;P	0.49708	0.62;0.466	D	0.95965	0.8965	10	0.87932	D	0	.	14.0311	0.64615	0.0744:0.0:0.9256:0.0	.	97;97	O00409;O00409-2	FOXN3_HUMAN;.	F	97	ENSP00000343288:S97F;ENSP00000261302:S97F;ENSP00000452005:S97F;ENSP00000452227:S97F;ENSP00000451135:S97F	ENSP00000261302:S97F	S	-	2	0	FOXN3	88948284	1.000000	0.71417	0.399000	0.26333	0.126000	0.20510	6.792000	0.75125	2.416000	0.81992	0.555000	0.69702	TCC	-	NULL		0.587	FOXN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXN3	protein_coding	OTTHUMT00000410902.2	G	NM_005197	-		89878531	-1	no_errors	ENST00000261302	ensembl	human	known	74_37	missense	SNP	0.998	A
ADAD1	132612	genome.wustl.edu	37	4	123336640	123336643	+	Frame_Shift_Del	DEL	TCAT	TCAT	-	rs370284014		TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	TCAT	TCAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr4:123336640_123336643delTCAT	ENST00000296513.2	+	11	1541_1544	c.1356_1359delTCAT	c.(1354-1359)cctcatfs	p.PH452fs	ADAD1_ENST00000388724.2_Frame_Shift_Del_p.PH441fs|ADAD1_ENST00000388725.2_Frame_Shift_Del_p.PH434fs	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	452	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						TCAACAGACCTCATATTAGTTTAG	0.387																																																	0								ENSG00000164113																																			ADAD1	SO:0001589	frameshift_variant	0				HGNC	AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.1356_1359delTCAT	4.37:g.123336640_123336643delTCAT	ENSP00000296513:p.Pro452fs	Somatic	0	62	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	40	41.18	A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_A_deamin,pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_A_deamin	p.H453fs	ENST00000296513.2	37	c.1356_1359	CCDS34058.1	4																																																																																			-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin		0.387	ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAD1	protein_coding	OTTHUMT00000316452.1	TCAT	NM_139243			123336643	+1	no_errors	ENST00000296513	ensembl	human	known	74_37	frame_shift_del	DEL	0.990:0.786:0.774:0.473	-
RP11-764K9.1	0	genome.wustl.edu	37	9	68400453	68400453	+	lincRNA	SNP	G	G	C			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr9:68400453G>C	ENST00000417843.2	-	0	1366																											AGCTCAGGTGGGCGATGCACC	0.502																																																	0								ENSG00000225411																																			RP11-764K9.1			0			-	Clone_based_vega_gene																													9.37:g.68400453G>C		Somatic	0	11	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	7	41.67		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			-	-		0.502	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	lincRNA	OTTHUMT00000129817.2	G		-		68400453	-1	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	SNP	0.035	C
PSMC6	5706	genome.wustl.edu	37	14	53176455	53176455	+	Intron	DEL	T	T	-	rs200184712		TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr14:53176455delT	ENST00000606149.1	+	4	274				PSMC6_ENST00000445930.2_Intron	NM_002806.3	NP_002797.3	P62333	PRS10_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 6						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein binding, bridging (GO:0030674)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	19	Breast(41;0.176)					agattttggcttttttttttt	0.303																																																	0								ENSG00000100519																																			PSMC6	SO:0001627	intron_variant	0				HGNC		CCDS9710.2	14q22.1	2010-04-21			ENSG00000100519	ENSG00000100519		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9553	protein-coding gene	gene with protein product		602708				8674546, 9473509	Standard	NM_002806		Approved	p42	uc010tqx.2	P62333	OTTHUMG00000152333	ENST00000606149.1:c.258+921T>-	14.37:g.53176455delT		Somatic	0	11	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	7	30.00	B2R975|P49719|Q6IBU3|Q92524	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000606149.1	37	NULL		14																																																																																			-	-		0.303	PSMC6-018	KNOWN	basic|appris_candidate	protein_coding	PSMC6	protein_coding	OTTHUMT00000470741.1	T	NM_002806			53176455	+1	no_errors	ENST00000554952	ensembl	human	known	74_37	rna	DEL	0.141	-
CYP4Z2P	163720	genome.wustl.edu	37	1	47366091	47366091	+	RNA	SNP	G	G	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr1:47366091G>T	ENST00000505841.1	-	0	18					NR_002788.2		Q8N1L4	CP4Z2_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 2, pseudogene							integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)										AGTTCCTGAAGCCAGGAGGGC	0.537																																																	0								ENSG00000154198																																			CYP4Z2P			0			-	HGNC	AY262057		1p33	2013-07-25	2013-05-03		ENSG00000154198	ENSG00000154198		"""Cytochrome P450s"""	24426	pseudogene	pseudogene						15059886	Standard	NR_002788		Approved	FLJ40054	uc031pmm.1	Q8N1L4	OTTHUMG00000008024		1.37:g.47366091G>T		Somatic	0	30	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	64	12.33	Q66ZJ5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000505841.1	37	NULL		1																																																																																			-	-		0.537	CYP4Z2P-002	KNOWN	basic	processed_transcript	CYP4Z2P	pseudogene	OTTHUMT00000361094.1	G	NR_002788	-		47366091	-1	no_errors	ENST00000505841	ensembl	human	known	74_37	rna	SNP	0.015	T
SDK1	221935	genome.wustl.edu	37	7	3681652	3681652	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr7:3681652C>A	ENST00000404826.2	+	4	767	c.628C>A	c.(628-630)Cta>Ata	p.L210I	AC011284.3_ENST00000427920.1_RNA|SDK1_ENST00000389531.3_Missense_Mutation_p.L210I	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	210	Ig-like C2-type 2.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TGCAGCGATTCTAAACCTGCT	0.443																																																	0								ENSG00000146555						117.0	105.0	109.0					7																	3681652		2203	4300	6503	SDK1	SO:0001583	missense	0			-	HGNC	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.628C>A	7.37:g.3681652C>A	ENSP00000385899:p.Leu210Ile	Somatic	0	89	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	60	17.81	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.L210I	ENST00000404826.2	37	c.628	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	C	6.841	0.524416	0.13066	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	D;D	0.85411	-1.98;-1.98	5.73	4.85	0.62838	Immunoglobulin subtype (1);Immunoglobulin I-set (1);	0.000000	0.35235	N	0.003349	T	0.80491	0.4633	L	0.35854	1.095	0.41300	D	0.987035	P	0.36199	0.543	B	0.39660	0.306	T	0.78507	-0.2177	10	0.33940	T	0.23	.	13.0231	0.58800	0.0:0.9257:0.0:0.0743	.	210	Q7Z5N4	SDK1_HUMAN	I	210	ENSP00000385899:L210I;ENSP00000374182:L210I	ENSP00000374182:L210I	L	+	1	2	SDK1	3648178	0.999000	0.42202	0.024000	0.17045	0.228000	0.25075	4.180000	0.58296	1.431000	0.47355	-0.142000	0.14014	CTA	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2		0.443	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	protein_coding	OTTHUMT00000323702.1	C	NM_152744	-		3681652	+1	no_errors	ENST00000404826	ensembl	human	known	74_37	missense	SNP	0.967	A
KIAA1161	57462	genome.wustl.edu	37	9	34372601	34372601	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr9:34372601G>A	ENST00000297625.7	-	2	464	c.239C>T	c.(238-240)gCc>gTc	p.A80V		NM_020702.3	NP_065753.2	Q6NSJ0	K1161_HUMAN	KIAA1161	114					carbohydrate metabolic process (GO:0005975)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of protein kinase B signaling (GO:0051897)|skeletal muscle fiber development (GO:0048741)	integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.126)		GGAGCGGAAGGCCAGGCGGAA	0.677																																																	0								ENSG00000164976						17.0	28.0	24.0					9																	34372601		2141	4237	6378	KIAA1161	SO:0001583	missense	0			-	HGNC	AB032987		9p11.2	2009-11-06			ENSG00000164976	ENSG00000164976			19918	protein-coding gene	gene with protein product						10574461	Standard	XM_006716808		Approved	NET37	uc003zue.4	Q6NSJ0	OTTHUMG00000019816	ENST00000297625.7:c.239C>T	9.37:g.34372601G>A	ENSP00000297625:p.Ala80Val	Somatic	0	30	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	Q5T587|Q5T588|Q9ULQ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	p.A80V	ENST00000297625.7	37	c.239		9	.	.	.	.	.	.	.	.	.	.	G	14.84	2.655323	0.47467	.	.	ENSG00000164976	ENST00000297625	T	0.69561	-0.41	5.82	5.82	0.92795	.	0.055234	0.64402	D	0.000001	T	0.59059	0.2166	L	0.38175	1.15	0.40712	D	0.982583	B	0.14805	0.011	B	0.08055	0.003	T	0.52601	-0.8554	10	0.25751	T	0.34	-18.4366	18.6531	0.91439	0.0:0.0:1.0:0.0	.	114	Q6NSJ0	K1161_HUMAN	V	80	ENSP00000297625:A80V	ENSP00000297625:A80V	A	-	2	0	KIAA1161	34362601	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.939000	0.63526	2.761000	0.94854	0.655000	0.94253	GCC	-	NULL		0.677	KIAA1161-001	KNOWN	basic|appris_principal	protein_coding	KIAA1161	protein_coding	OTTHUMT00000052158.1	G	XM_351807	-		34372601	-1	no_errors	ENST00000297625	ensembl	human	known	74_37	missense	SNP	1.000	A
ASPN	54829	genome.wustl.edu	37	9	95237014	95237014	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr9:95237014G>A	ENST00000375544.3	-	2	409	c.166C>T	c.(166-168)Ctt>Ttt	p.L56F	ASPN_ENST00000375543.1_Missense_Mutation_p.L56F|ASPN_ENST00000450139.2_Missense_Mutation_p.L28F|ASPN_ENST00000395538.3_Missense_Mutation_p.L56F|CENPP_ENST00000375587.3_Intron	NM_017680.4	NP_060150	Q9BXN1	ASPN_HUMAN	asporin	56					bone mineralization (GO:0030282)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9						GTTGGAAAAAGAGAGTTGTCC	0.393																																																	0								ENSG00000106819						110.0	104.0	106.0					9																	95237014		2203	4300	6503	ASPN	SO:0001583	missense	0			-	HGNC	AF316824		9q22.31	2008-05-14	2007-02-15		ENSG00000106819	ENSG00000106819		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	14872	protein-coding gene	gene with protein product	"""asporin proteoglycan"""	608135	"""asporin (LRR class 1)"""				Standard	NM_017680		Approved	FLJ20129, SLRR1C, PLAP1	uc004ase.2	Q9BXN1	OTTHUMG00000020227	ENST00000375544.3:c.166C>T	9.37:g.95237014G>A	ENSP00000364694:p.Leu56Phe	Somatic	0	30	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	18	45.45	Q5TBF3|Q96K79|Q96LD0|Q9NXP3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,pirsf_SLRP_I_decor/aspor/byglycan	p.L56F	ENST00000375544.3	37	c.166		9	.	.	.	.	.	.	.	.	.	.	G	15.91	2.972367	0.53614	.	.	ENSG00000106819	ENST00000375544;ENST00000375543;ENST00000395538;ENST00000450139	T;T;T	0.56941	0.43;0.51;0.44	5.02	4.11	0.48088	.	0.515829	0.21242	N	0.077795	T	0.45357	0.1338	L	0.54323	1.7	0.29670	N	0.842568	B;B	0.28783	0.222;0.017	B;B	0.29785	0.107;0.005	T	0.42378	-0.9455	10	0.27785	T	0.31	.	8.9769	0.35941	0.079:0.164:0.7569:0.0	.	56;56	Q5TBF2;Q9BXN1	.;ASPN_HUMAN	F	56;56;56;28	ENSP00000364694:L56F;ENSP00000364693:L56F;ENSP00000378909:L56F	ENSP00000364693:L56F	L	-	1	0	ASPN	94276835	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.554000	0.36266	1.227000	0.43598	0.655000	0.94253	CTT	-	pirsf_SLRP_I_decor/aspor/byglycan		0.393	ASPN-001	KNOWN	basic|appris_principal	protein_coding	ASPN	protein_coding	OTTHUMT00000053094.1	G	NM_017680	-		95237014	-1	no_errors	ENST00000375544	ensembl	human	known	74_37	missense	SNP	1.000	A
UBE3C	9690	genome.wustl.edu	37	7	157000591	157000591	+	Missense_Mutation	SNP	A	A	C			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr7:157000591A>C	ENST00000348165.5	+	13	2131	c.1771A>C	c.(1771-1773)Ata>Cta	p.I591L		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	591					protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		GCAACAATGCATACAGATGGA	0.328																																																	0								ENSG00000009335						95.0	99.0	97.0					7																	157000591		2203	4300	6503	UBE3C	SO:0001583	missense	0			-	HGNC	AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.1771A>C	7.37:g.157000591A>C	ENSP00000309198:p.Ile591Leu	Somatic	0	17	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	11	35.29	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HECT,superfamily_HECT,superfamily_DHFR-like_dom,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.I591L	ENST00000348165.5	37	c.1771	CCDS34789.1	7	.	.	.	.	.	.	.	.	.	.	A	15.39	2.819987	0.50633	.	.	ENSG00000009335	ENST00000348165	T	0.40476	1.03	5.34	4.14	0.48551	.	0.000000	0.85682	D	0.000000	T	0.37100	0.0991	M	0.63428	1.95	0.80722	D	1	B;B	0.29805	0.067;0.257	B;B	0.28553	0.024;0.091	T	0.15065	-1.0450	10	0.16896	T	0.51	.	11.6493	0.51279	0.8675:0.0:0.0:0.1325	.	591;591	Q15386;Q15386-2	UBE3C_HUMAN;.	L	591	ENSP00000309198:I591L	ENSP00000309198:I591L	I	+	1	0	UBE3C	156693352	1.000000	0.71417	0.997000	0.53966	0.806000	0.45545	5.421000	0.66447	2.022000	0.59522	0.528000	0.53228	ATA	-	NULL		0.328	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3C	protein_coding	OTTHUMT00000348108.1	A	NM_014671	-		157000591	+1	no_errors	ENST00000348165	ensembl	human	known	74_37	missense	SNP	1.000	C
LPCAT4	254531	genome.wustl.edu	37	15	34651374	34651374	+	Missense_Mutation	SNP	G	G	T	rs150950234	byFrequency	TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr15:34651374G>T	ENST00000314891.6	-	14	1706	c.1529C>A	c.(1528-1530)gCt>gAt	p.A510D		NM_153613.2	NP_705841.2	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4	510					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphoethanolamine O-acyltransferase activity (GO:0047166)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)|lysophospholipid acyltransferase activity (GO:0071617)			NS(1)|breast(1)|large_intestine(2)|lung(5)|prostate(1)	10						ATTGGCCAGAGCAGTGGGGTT	0.627													G|||	3	0.000599042	0.0023	0.0	5008	,	,		11249	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000176454	G	ASP/ALA	20,4382	26.2+/-53.5	0,20,2181	76.0	69.0	72.0		1529	5.7	0.8	15	dbSNP_134	72	0,8596		0,0,4298	yes	missense	LPCAT4	NM_153613.2	126	0,20,6479	TT,TG,GG		0.0,0.4543,0.1539	benign	510/525	34651374	20,12978	2201	4298	6499	LPCAT4	SO:0001583	missense	0			-	HGNC	AF542964	CCDS32191.1	15q14	2008-07-02	2008-06-24	2008-06-24		ENSG00000176454			30059	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 2"""	612039	"""acyltransferase like 3"", ""1-acylglycerol-3-phosphate O-acyltransferase 7 (lysophosphatidic acid acyltransferase, eta)"""	AYTL3, AGPAT7		8619474, 9110174, 16243729, 18458083	Standard	XR_243087		Approved	FLJ10257, LPAAT-eta, LPEAT2	uc001zig.3	Q643R3		ENST00000314891.6:c.1529C>A	15.37:g.34651374G>T	ENSP00000317300:p.Ala510Asp	Somatic	0	9	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	9	47.06	A8K2K8|O43412|Q7Z4P4|Q8IUL7|Q8TB38	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	p.A510D	ENST00000314891.6	37	c.1529	CCDS32191.1	15	.	.	.	.	.	.	.	.	.	.	G	13.18	2.159864	0.38119	0.004543	0.0	ENSG00000176454	ENST00000314891	D	0.81659	-1.52	5.66	5.66	0.87406	.	0.673372	0.15231	N	0.273422	T	0.70718	0.3256	L	0.36672	1.1	0.09310	N	0.999997	B	0.16166	0.016	B	0.12156	0.007	T	0.53760	-0.8393	10	0.12103	T	0.63	-2.9558	12.2436	0.54558	0.0:0.0:0.8303:0.1697	.	510	Q643R3	LPCT4_HUMAN	D	510	ENSP00000317300:A510D	ENSP00000317300:A510D	A	-	2	0	LPCAT4	32438666	0.955000	0.32602	0.770000	0.31555	0.645000	0.38454	2.914000	0.48797	2.666000	0.90696	0.491000	0.48974	GCT	-	NULL		0.627	LPCAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT4	protein_coding	OTTHUMT00000418028.2	G	NM_153613	rs150950234		34651374	-1	no_errors	ENST00000314891	ensembl	human	known	74_37	missense	SNP	0.196	T
TBC1D9B	23061	genome.wustl.edu	37	5	179305451	179305451	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr5:179305451C>T	ENST00000356834.3	-	10	1677	c.1640G>A	c.(1639-1641)aGc>aAc	p.S547N	TBC1D9B_ENST00000355235.3_Missense_Mutation_p.S547N	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	547	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGTGGCCAGGCTGTACTTCCC	0.647																																																	0								ENSG00000197226						72.0	51.0	58.0					5																	179305451		2203	4300	6503	TBC1D9B	SO:0001583	missense	0			-	HGNC	AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.1640G>A	5.37:g.179305451C>T	ENSP00000349291:p.Ser547Asn	Somatic	0	51	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_hand_dom,pfscan_Rab-GTPase-TBC_dom	p.S547N	ENST00000356834.3	37	c.1640	CCDS43408.1	5	.	.	.	.	.	.	.	.	.	.	C	6.661	0.490523	0.12702	.	.	ENSG00000197226	ENST00000356834;ENST00000355235	T;T	0.11821	2.74;2.74	5.39	3.6	0.41247	Rab-GAP/TBC domain (4);	0.193211	0.44902	D	0.000419	T	0.09069	0.0224	L	0.28740	0.885	0.80722	D	1	B;B;B	0.16603	0.002;0.001;0.018	B;B;B	0.22880	0.019;0.011;0.042	T	0.18650	-1.0330	10	0.16896	T	0.51	-22.1386	7.5282	0.27668	0.0:0.6813:0.0:0.3187	.	547;547;547	A1L3A9;Q66K14-2;Q66K14	.;.;TBC9B_HUMAN	N	547	ENSP00000349291:S547N;ENSP00000347375:S547N	ENSP00000347375:S547N	S	-	2	0	TBC1D9B	179238057	0.996000	0.38824	1.000000	0.80357	0.194000	0.23727	0.585000	0.23879	1.264000	0.44198	0.561000	0.74099	AGC	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom		0.647	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D9B	protein_coding	OTTHUMT00000253501.3	C	NM_015043	-		179305451	-1	no_errors	ENST00000356834	ensembl	human	known	74_37	missense	SNP	0.988	T
USH1C	10083	genome.wustl.edu	37	11	17538062	17538062	+	Intron	SNP	G	G	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr11:17538062G>T	ENST00000318024.4	-	15	1393				USH1C_ENST00000005226.7_Intron|USH1C_ENST00000527720.1_Intron|USH1C_ENST00000527020.1_Intron|USH1C_ENST00000529563.1_5'UTR	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)						auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						CGGTTCCCAGGCCCTGGGTCA	0.547																																																	0								ENSG00000006611																																			USH1C	SO:0001627	intron_variant	0			-	HGNC	AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1284+885C>A	11.37:g.17538062G>T		Somatic	0	17	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000318024.4	37	NULL	CCDS31438.1	11																																																																																			-	-		0.547	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	USH1C	protein_coding	OTTHUMT00000389146.1	G	NM_005709	-		17538062	-1	no_errors	ENST00000529563	ensembl	human	known	74_37	rna	SNP	0.038	T
TBC1D5	9779	genome.wustl.edu	37	3	17208291	17208291	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr3:17208291G>T	ENST00000253692.7	-	21	3726	c.2062C>A	c.(2062-2064)Cag>Aag	p.Q688K	TBC1D5_ENST00000429383.4_Missense_Mutation_p.Q688K|TBC1D5_ENST00000414318.2_5'UTR|TBC1D5_ENST00000446818.2_Missense_Mutation_p.Q710K	NM_014744.2	NP_055559.1	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5	688						retromer complex (GO:0030904)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	36						TGAACGCTCTGGCCTTGGCCT	0.507																																																	0								ENSG00000131374						106.0	96.0	100.0					3																	17208291		2203	4300	6503	TBC1D5	SO:0001583	missense	0			-	HGNC	D86965	CCDS33714.1, CCDS46770.1	3p24.3	2013-07-09			ENSG00000131374	ENSG00000131374			19166	protein-coding gene	gene with protein product		615740				19531583	Standard	NM_014744		Approved	KIAA0210	uc003cbe.3	Q92609	OTTHUMG00000155488	ENST00000253692.7:c.2062C>A	3.37:g.17208291G>T	ENSP00000253692:p.Gln688Lys	Somatic	0	59	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	51	17.74	A6NP25|C9JP52	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.Q688K	ENST00000253692.7	37	c.2062	CCDS33714.1	3	.	.	.	.	.	.	.	.	.	.	G	0.033	-1.320938	0.01320	.	.	ENSG00000131374	ENST00000253692;ENST00000429383;ENST00000446818	T;T;T	0.36340	1.26;1.26;1.26	2.59	-0.183	0.13284	.	0.675008	0.12651	U	0.450458	T	0.15869	0.0382	N	0.14661	0.345	0.09310	N	1	B;B;B	0.23806	0.0;0.091;0.091	B;B;B	0.16289	0.002;0.015;0.015	T	0.30208	-0.9986	10	0.06757	T	0.87	4.6128	8.231	0.31597	0.0:0.614:0.386:0.0	.	710;688;688	C9JP52;B9A6K1;Q92609	.;.;TBCD5_HUMAN	K	688;688;710	ENSP00000253692:Q688K;ENSP00000398127:Q688K;ENSP00000402935:Q710K	ENSP00000253692:Q688K	Q	-	1	0	TBC1D5	17183295	0.570000	0.26651	0.006000	0.13384	0.053000	0.15095	1.583000	0.36579	0.183000	0.20059	0.313000	0.20887	CAG	-	NULL		0.507	TBC1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D5	protein_coding	OTTHUMT00000340301.3	G	NM_014744	-		17208291	-1	no_errors	ENST00000253692	ensembl	human	known	74_37	missense	SNP	0.001	T
TP53	7157	genome.wustl.edu	37	17	7578268	7578268	+	Missense_Mutation	SNP	A	A	C			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr17:7578268A>C	ENST00000269305.4	-	6	770	c.581T>G	c.(580-582)cTt>cGt	p.L194R	TP53_ENST00000413465.2_Missense_Mutation_p.L194R|TP53_ENST00000445888.2_Missense_Mutation_p.L194R|TP53_ENST00000359597.4_Missense_Mutation_p.L194R|TP53_ENST00000420246.2_Missense_Mutation_p.L194R|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.L194R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	194	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		L -> F (in sporadic cancers; somatic mutation).|L -> H (in sporadic cancers; somatic mutation).|L -> I (in sporadic cancers; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763}.|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L194R(47)|p.L194P(8)|p.L194H(8)|p.0?(8)|p.?(6)|p.L101R(5)|p.L62R(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.P191fs*53(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.L194fs*15(1)|p.L194fs*14(1)|p.L101H(1)|p.L194fs*52(1)|p.P98_E105>Q(1)|p.A189fs*53(1)|p.L62H(1)|p.I195fs*52(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACTCGGATAAGATGCTGAGG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	108	Substitution - Missense(75)|Whole gene deletion(8)|Deletion - Frameshift(6)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Insertion - Frameshift(1)|Complex - frameshift(1)	breast(19)|lung(14)|ovary(14)|large_intestine(11)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(6)|oesophagus(6)|biliary_tract(5)|skin(5)|bone(4)|upper_aerodigestive_tract(3)|stomach(3)|central_nervous_system(2)|pancreas(2)|liver(2)|soft_tissue(1)|prostate(1)						ENSG00000141510						97.0	87.0	90.0					17																	7578268		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.581T>G	17.37:g.7578268A>C	ENSP00000269305:p.Leu194Arg	Somatic	0	89	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	43	46.25	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.L194R	ENST00000269305.4	37	c.581	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	16.11	3.029856	0.54790	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99856	-7.21;-7.21;-7.21;-7.21;-7.21;-7.21;-7.21;-7.21	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	M	0.90425	3.115	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.984;1.0;1.0;1.0;1.0	D	0.96375	0.9277	10	0.87932	D	0	-29.6709	13.709	0.62656	1.0:0.0:0.0:0.0	.	155;194;194;101;194;194;194	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	194;194;194;194;194;194;183;101;62;101;62	ENSP00000410739:L194R;ENSP00000352610:L194R;ENSP00000269305:L194R;ENSP00000398846:L194R;ENSP00000391127:L194R;ENSP00000391478:L194R;ENSP00000425104:L62R;ENSP00000423862:L101R	ENSP00000269305:L194R	L	-	2	0	TP53	7518993	1.000000	0.71417	0.300000	0.25030	0.031000	0.12232	9.287000	0.95975	2.183000	0.69458	0.533000	0.62120	CTT	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	A	NM_000546	-		7578268	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	0.996	C
ZNFX1	57169	genome.wustl.edu	37	20	47895195	47895195	+	5'Flank	SNP	G	G	T	rs528248721		TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr20:47895195G>T	ENST00000396105.1	-	0	0				ZFAS1_ENST00000428008.1_RNA|ZFAS1_ENST00000458653.1_RNA|SNORD12_ENST00000391002.1_RNA|ZFAS1_ENST00000417721.1_RNA|ZNFX1_ENST00000371752.1_5'Flank|ZFAS1_ENST00000441722.1_RNA|SNORD12C_ENST00000386307.1_RNA|SNORD12B_ENST00000410433.1_RNA|ZNFX1_ENST00000371754.4_5'Flank|ZFAS1_ENST00000450535.1_RNA|ZFAS1_ENST00000326677.5_RNA|ZFAS1_ENST00000371743.3_RNA	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1								metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			CGTCTGCGGTGCCCGGAGTGT	0.527													G|||	1	0.000199681	0.0	0.0	5008	,	,		19192	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000177410																																			ZFAS1	SO:0001631	upstream_gene_variant	0			-	HGNC	AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696		20.37:g.47895195G>T	Exception_encountered	Somatic	0	57	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	26	39.53	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000396105.1	37	NULL	CCDS13417.1	20																																																																																			-	-		0.527	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAS1	protein_coding	OTTHUMT00000079647.2	G	NM_021035	-		47895195	+1	no_errors	ENST00000326677	ensembl	human	known	74_37	rna	SNP	0.000	T
RUFY3	22902	genome.wustl.edu	37	4	71668776	71668776	+	Intron	SNP	G	G	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr4:71668776G>T	ENST00000381006.3	+	16	2229				RUFY3_ENST00000512331.1_Intron|RUFY3_ENST00000502653.1_Intron	NM_001037442.2	NP_001032519.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3						negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)				endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			CAGCAAATAAGGTAGCATGGG	0.453																																																	0								ENSG00000018189						95.0	82.0	86.0					4																	71668776		692	1591	2283	RUFY3	SO:0001627	intron_variant	0			-	HGNC	AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910	ENST00000381006.3:c.1650+76G>T	4.37:g.71668776G>T		Somatic	0	27	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B3KM25|B4DYW7|D9N163|O94948|Q9UI00	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000381006.3	37	NULL	CCDS34001.1	4																																																																																			-	-		0.453	RUFY3-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	RUFY3	protein_coding	OTTHUMT00000252162.1	G	NM_014961	-		71668776	+1	no_errors	ENST00000513593	ensembl	human	known	74_37	rna	SNP	0.000	T
NTRK1	4914	genome.wustl.edu	37	1	156843634	156843634	+	Missense_Mutation	SNP	G	G	A	rs201035170	byFrequency	TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr1:156843634G>A	ENST00000524377.1	+	8	1101	c.1060G>A	c.(1060-1062)Gtc>Atc	p.V354I	NTRK1_ENST00000368196.3_Missense_Mutation_p.V354I|NTRK1_ENST00000358660.3_Missense_Mutation_p.V354I|NTRK1_ENST00000392302.2_Missense_Mutation_p.V324I	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	354	Ig-like C2-type 2.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	GCCCACCCACGTCAACAACGG	0.612			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)			G|||	2	0.000399361	0.0008	0.0	5008	,	,		19377	0.001		0.0	False		,,,				2504	0.0							Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	0								ENSG00000198400						76.0	49.0	58.0					1																	156843634		2203	4299	6502	NTRK1	SO:0001583	missense	0			GMAF=0	HGNC	Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.1060G>A	1.37:g.156843634G>A	ENSP00000431418:p.Val354Ile	Somatic	0	144	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	33	44.07	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Cys-rich_flank_reg_C,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_neurotrophic_rcpt_1,prints_Tyr_kinase_NGF_rcpt	p.V354I	ENST00000524377.1	37	c.1060	CCDS1161.1	1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	12.79	2.043891	0.36085	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	6.17	5.26	0.73747	Immunoglobulin-like fold (1);	0.110622	0.40222	N	0.001155	T	0.11110	0.0271	L	0.36672	1.1	0.45528	D	0.998488	B;B;B;B	0.30511	0.054;0.282;0.273;0.066	B;B;B;B	0.17098	0.017;0.007;0.013;0.011	T	0.05468	-1.0883	10	0.23302	T	0.38	.	14.328	0.66532	0.0711:0.0:0.9289:0.0	.	354;354;354;324	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	I	324;354;354;354	ENSP00000376120:V324I;ENSP00000357179:V354I;ENSP00000431418:V354I;ENSP00000351486:V354I	ENSP00000351486:V354I	V	+	1	0	NTRK1	155110258	0.993000	0.37304	1.000000	0.80357	0.995000	0.86356	2.069000	0.41481	1.627000	0.50400	0.655000	0.94253	GTC	-	prints_Tyr_kinase_NGF_rcpt		0.612	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTRK1	protein_coding	OTTHUMT00000392279.1	G	NM_002529	rs201035170		156843634	+1	no_errors	ENST00000524377	ensembl	human	known	74_37	missense	SNP	1.000	A
MYT1	4661	genome.wustl.edu	37	20	62848497	62848497	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr20:62848497G>T	ENST00000328439.1	+	11	2073	c.1709G>T	c.(1708-1710)aGg>aTg	p.R570M	MYT1_ENST00000536311.1_Missense_Mutation_p.R570M|MYT1_ENST00000360149.4_Missense_Mutation_p.R272M	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					GCCACACCCAGGGCCAACTTG	0.587																																					GBM(59;481 1041 20555 21139 33705)												0								ENSG00000196132						83.0	82.0	82.0					20																	62848497		2203	4300	6503	MYT1	SO:0001583	missense	0			-	HGNC	M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.1709G>T	20.37:g.62848497G>T	ENSP00000327465:p.Arg570Met	Somatic	0	51	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myelin_TF,pfam_Znf_C2HC	p.R570M	ENST00000328439.1	37	c.1709	CCDS13558.1	20	.	.	.	.	.	.	.	.	.	.	G	20.9	4.072278	0.76415	.	.	ENSG00000196132	ENST00000360149;ENST00000328439;ENST00000536311	T;T;T	0.61040	0.14;0.14;0.14	5.67	5.67	0.87782	Myelin transcription factor 1 (1);	0.000000	0.85682	D	0.000000	T	0.77089	0.4079	M	0.71206	2.165	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.994;0.999	T	0.78453	-0.2198	10	0.87932	D	0	-34.8498	19.773	0.96379	0.0:0.0:1.0:0.0	.	570;570;272	F5H7M8;Q01538;Q6P6D5	.;MYT1_HUMAN;.	M	272;570;570	ENSP00000353269:R272M;ENSP00000327465:R570M;ENSP00000442412:R570M	ENSP00000327465:R570M	R	+	2	0	MYT1	62318941	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.725000	0.98778	2.677000	0.91161	0.655000	0.94253	AGG	-	pfam_Myelin_TF		0.587	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYT1	protein_coding	OTTHUMT00000080297.1	G	NM_004535	-		62848497	+1	no_errors	ENST00000536311	ensembl	human	known	74_37	missense	SNP	1.000	T
HIST1H1C	3006	genome.wustl.edu	37	6	26056568	26056568	+	Frame_Shift_Del	DEL	C	C	-	rs41266789	byFrequency	TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr6:26056568delC	ENST00000343677.2	-	1	131	c.89delG	c.(88-90)ggtfs	p.G30fs		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	30					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						ACGAGGCGTACCCCCAGCCTT	0.607																																																	0								ENSG00000187837						40.0	47.0	44.0					6																	26056568		2203	4300	6503	HIST1H1C	SO:0001589	frameshift_variant	0				HGNC	X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.89delG	6.37:g.26056568delC	ENSP00000339566:p.Gly30fs	Somatic	0	108	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	49	59	45.37	A8K4I2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	p.G30fs	ENST00000343677.2	37	c.89	CCDS4577.1	6																																																																																			-	prints_Histone_H5		0.607	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1C	protein_coding	OTTHUMT00000043372.1	C	NM_005319			26056568	-1	no_errors	ENST00000343677	ensembl	human	known	74_37	frame_shift_del	DEL	0.993	-
SHISA3	152573	genome.wustl.edu	37	4	42403180	42403180	+	Silent	SNP	A	A	C			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr4:42403180A>C	ENST00000319234.4	+	2	647	c.429A>C	c.(427-429)acA>acC	p.T143T		NM_001080505.1	NP_001073974.1	A0PJX4	SHSA3_HUMAN	shisa family member 3	143					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	12						GCTATCAGACAGAGACCCTGC	0.612																																																	0								ENSG00000178343						166.0	177.0	173.0					4																	42403180		2203	4300	6503	SHISA3	SO:0001819	synonymous_variant	0			-	HGNC	BC012029	CCDS33979.1	4p13	2013-07-31	2013-07-31		ENSG00000178343	ENSG00000178343		"""Shisa homologs"""	25159	protein-coding gene	gene with protein product			"""shisa homolog 3 (Xenopus laevis)"""				Standard	NM_001080505		Approved	hShisa3	uc003gwp.3	A0PJX4	OTTHUMG00000161043	ENST00000319234.4:c.429A>C	4.37:g.42403180A>C		Somatic	0	50	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	38	13.64	A0PJX3|Q96EQ5	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T143	ENST00000319234.4	37	c.429	CCDS33979.1	4																																																																																			-	NULL		0.612	SHISA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHISA3	protein_coding	OTTHUMT00000363539.1	A	NM_001080505	-		42403180	+1	no_errors	ENST00000319234	ensembl	human	known	74_37	silent	SNP	0.574	C
ERAS	3266	genome.wustl.edu	37	X	48687960	48687960	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chrX:48687960G>T	ENST00000338270.1	+	1	678	c.427G>T	c.(427-429)Gcc>Tcc	p.A143S	PCSK1N_ENST00000478242.1_5'Flank	NM_181532.2	NP_853510.1	Q7Z444	RASE_HUMAN	ES cell expressed Ras	143					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(2)|large_intestine(1)|lung(9)|prostate(1)|urinary_tract(1)	14						CCCTCACCCCGCCCAGCCCCT	0.647																																																	0								ENSG00000187682						37.0	33.0	34.0					X																	48687960		2203	4300	6503	ERAS	SO:0001583	missense	0			-	HGNC	X00419	CCDS35246.1	Xp11.23	2014-05-09	2003-07-14	2003-07-16	ENSG00000187682	ENSG00000187682			5174	protein-coding gene	gene with protein product		300437	"""v-Ha-ras Harvey rat sarcoma viral oncogene homolog pseudogene"""	HRAS2, HRASP		12774123	Standard	NM_181532		Approved		uc031tjl.1	Q7Z444	OTTHUMG00000059533	ENST00000338270.1:c.427G>T	X.37:g.48687960G>T	ENSP00000339136:p.Ala143Ser	Somatic	0	60	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	23	17.86		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.A143S	ENST00000338270.1	37	c.427	CCDS35246.1	X	.	.	.	.	.	.	.	.	.	.	g	0.010	-1.755632	0.00663	.	.	ENSG00000187682	ENST00000338270	T	0.68765	-0.35	4.13	0.374	0.16183	Small GTP-binding protein domain (1);	1.195120	0.06337	N	0.707232	T	0.39733	0.1089	N	0.03238	-0.38	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.20438	-1.0275	10	0.33940	T	0.23	.	3.7754	0.08657	0.4508:0.2017:0.3474:0.0	.	143	Q7Z444	RASE_HUMAN	S	143	ENSP00000339136:A143S	ENSP00000339136:A143S	A	+	1	0	ERAS	48572904	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	0.088000	0.14979	-0.037000	0.13646	-0.347000	0.07816	GCC	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.647	ERAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERAS	protein_coding	OTTHUMT00000132402.1	G	NM_181532	-		48687960	+1	no_errors	ENST00000338270	ensembl	human	known	74_37	missense	SNP	0.001	T
ACSF3	197322	genome.wustl.edu	37	16	89187269	89187269	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr16:89187269G>A	ENST00000317447.4	+	7	1564	c.1187G>A	c.(1186-1188)aGg>aAg	p.R396K	ACSF3_ENST00000406948.3_Missense_Mutation_p.R396K|ACSF3_ENST00000378345.4_Missense_Mutation_p.R131K	NM_001127214.2|NM_001243279.1|NM_001284316.1|NM_174917.3	NP_001120686.1|NP_001230208.1|NP_001271245.1|NP_777577.2	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3	396					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|malonate catabolic process (GO:0090410)	mitochondrion (GO:0005739)	acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)|malonyl-CoA synthetase activity (GO:0090409)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(9)|prostate(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(80;0.0281)		AACCCACAGAGGGAAGCCTGC	0.602																																																	0								ENSG00000176715						158.0	155.0	156.0					16																	89187269		2198	4300	6498	ACSF3	SO:0001583	missense	0			-	HGNC	AK075499	CCDS10974.1, CCDS73926.1	16q24.3	2013-01-15			ENSG00000176715	ENSG00000176715		"""Acyl-CoA synthetase family"""	27288	protein-coding gene	gene with protein product	"""malonyl-CoA synthetase"""	614245				17762044, 21846720	Standard	XM_005256293		Approved		uc010cig.2	Q4G176	OTTHUMG00000138044	ENST00000317447.4:c.1187G>A	16.37:g.89187269G>A	ENSP00000320646:p.Arg396Lys	Somatic	0	90	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	33	38.89	A8K4J8|C9JQL6|Q6INA0|Q8N2F7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig	p.R396K	ENST00000317447.4	37	c.1187	CCDS10974.1	16	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.414960	0.00191	.	.	ENSG00000176715	ENST00000317447;ENST00000540697;ENST00000406948;ENST00000378345;ENST00000544543	T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04	4.18	-0.892	0.10570	AMP-dependent synthetase/ligase (1);	0.715654	0.12748	N	0.442459	T	0.13884	0.0336	N	0.01729	-0.75	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.31586	-0.9938	10	0.02654	T	1	-14.6076	11.1145	0.48252	0.5426:0.0:0.4574:0.0	.	396	Q4G176	ACSF3_HUMAN	K	396;131;396;131;131	ENSP00000320646:R396K;ENSP00000445397:R131K;ENSP00000384627:R396K;ENSP00000367596:R131K;ENSP00000442781:R131K	ENSP00000320646:R396K	R	+	2	0	ACSF3	87714770	0.020000	0.18652	0.100000	0.21137	0.002000	0.02628	0.423000	0.21313	-0.548000	0.06199	-1.080000	0.02220	AGG	-	pfam_AMP-dep_Synth/Lig		0.602	ACSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSF3	protein_coding	OTTHUMT00000269919.1	G	NM_174917	-		89187269	+1	no_errors	ENST00000317447	ensembl	human	known	74_37	missense	SNP	0.004	A
CFAP46	54777	genome.wustl.edu	37	10	134660691	134660691	+	Splice_Site	SNP	C	C	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr10:134660691C>T	ENST00000368586.5	-	42	6187	c.6087G>A	c.(6085-6087)aaG>aaA	p.K2029K	TTC40_ENST00000263170.5_Splice_Site_p.K190K	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GCAGCCGCACCTTCAGGTCCT	0.687																																																	0								ENSG00000171811						34.0	40.0	38.0					10																	134660691		2203	4299	6502	TTC40	SO:0001630	splice_region_variant	0			-	HGNC																												ENST00000368586.5:c.6087+1G>A	10.37:g.134660691C>T		Somatic	0	95	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	39	13.33		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K190	ENST00000368586.5	37	c.570	CCDS58101.1	10																																																																																			-	NULL		0.687	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	protein_coding	OTTHUMT00000051095.3	C		-	Silent	134660691	-1	no_errors	ENST00000263170	ensembl	human	known	74_37	silent	SNP	0.997	T
TTC30B	150737	genome.wustl.edu	37	2	178417356	178417356	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr2:178417356C>T	ENST00000408939.3	-	1	386	c.136G>A	c.(136-138)Gcc>Acc	p.A46T		NM_152517.2	NP_689730.2	Q8N4P2	TT30B_HUMAN	tetratricopeptide repeat domain 30B	46					cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)	cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)				cervix(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.00151)|Epithelial(96;0.00931)|all cancers(119;0.0362)			GACAGGCCGGCGCGGCTCCTA	0.682																																																	0								ENSG00000196659						5.0	6.0	6.0					2																	178417356		2110	4177	6287	TTC30B	SO:0001583	missense	0			-	HGNC	AK055552	CCDS42784.1	2q31.2	2014-02-21			ENSG00000196659	ENSG00000196659		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	26425	protein-coding gene	gene with protein product						12477932	Standard	NM_152517		Approved	FLJ30990, fleer, IFT70	uc002uln.3	Q8N4P2	OTTHUMG00000154166	ENST00000408939.3:c.136G>A	2.37:g.178417356C>T	ENSP00000386181:p.Ala46Thr	Somatic	0	104	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	32	47.54	Q63HQ1|Q96NE6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_TPR_repeat,pfscan_TPR-contain_dom	p.A46T	ENST00000408939.3	37	c.136	CCDS42784.1	2	.	.	.	.	.	.	.	.	.	.	C	15.72	2.917398	0.52546	.	.	ENSG00000196659	ENST00000408939	T	0.78364	-1.17	4.6	3.71	0.42584	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.049900	0.85682	D	0.000000	D	0.88325	0.6406	M	0.87758	2.905	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	D	0.89024	0.3437	10	0.42905	T	0.14	.	14.3878	0.66958	0.1491:0.8509:0.0:0.0	.	46	Q8N4P2	TT30B_HUMAN	T	46	ENSP00000386181:A46T	ENSP00000386181:A46T	A	-	1	0	TTC30B	178125602	1.000000	0.71417	1.000000	0.80357	0.340000	0.28889	5.150000	0.64869	1.265000	0.44215	-0.182000	0.12963	GCC	-	smart_TPR_repeat,pfscan_TPR-contain_dom		0.682	TTC30B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC30B	protein_coding	OTTHUMT00000334193.2	C	NM_152517	-		178417356	-1	no_errors	ENST00000408939	ensembl	human	known	74_37	missense	SNP	1.000	T
CKS2	1164	genome.wustl.edu	37	9	91931306	91931306	+	Missense_Mutation	SNP	T	T	G			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr9:91931306T>G	ENST00000314355.6	+	3	301	c.206T>G	c.(205-207)tTt>tGt	p.F69C	SECISBP2_ENST00000534113.2_5'Flank|SECISBP2_ENST00000339901.4_5'Flank|SECISBP2_ENST00000375807.3_5'Flank	NM_001827.1	NP_001818.1	P33552	CKS2_HUMAN	CDC28 protein kinase regulatory subunit 2	69					cell proliferation (GO:0008283)|meiosis I (GO:0007127)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)		cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			kidney(1)|large_intestine(1)	2						ATTCTTCTCTTTAGACGACCT	0.289																																																	0								ENSG00000123975						36.0	34.0	35.0					9																	91931306		2198	4288	6486	CKS2	SO:0001583	missense	0			-	HGNC	X54942	CCDS6682.1	9q22	2008-02-05	2002-10-07		ENSG00000123975	ENSG00000123975			2000	protein-coding gene	gene with protein product		116901	"""CDC28 protein kinase 2"""			2227411, 8697818	Standard	NM_001827		Approved		uc004aqh.3	P33552	OTTHUMG00000020180	ENST00000314355.6:c.206T>G	9.37:g.91931306T>G	ENSP00000364976:p.Phe69Cys	Somatic	0	89	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	34	12.82	Q6FGI9|Q6LET5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyclin-dep_kinase_reg-sub,superfamily_Cyclin-dep_kinase_reg-sub,prints_Cyclin-dep_kinase_reg-sub	p.F69C	ENST00000314355.6	37	c.206	CCDS6682.1	9	.	.	.	.	.	.	.	.	.	.	T	19.37	3.814938	0.70912	.	.	ENSG00000123975	ENST00000314355	.	.	.	4.97	4.97	0.65823	.	0.131845	0.52532	D	0.000074	T	0.77725	0.4173	.	.	.	0.80722	D	1	D	0.63880	0.993	D	0.64321	0.924	T	0.81387	-0.0956	8	0.87932	D	0	-7.6323	15.156	0.72743	0.0:0.0:0.0:1.0	.	69	P33552	CKS2_HUMAN	C	69	.	ENSP00000364976:F69C	F	+	2	0	CKS2	91121126	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.326000	0.79133	2.223000	0.72356	0.456000	0.33151	TTT	-	pfam_Cyclin-dep_kinase_reg-sub,superfamily_Cyclin-dep_kinase_reg-sub,prints_Cyclin-dep_kinase_reg-sub		0.289	CKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKS2	protein_coding	OTTHUMT00000052988.1	T	NM_001827	-		91931306	+1	no_errors	ENST00000314355	ensembl	human	known	74_37	missense	SNP	1.000	G
TP53	7157	genome.wustl.edu	37	17	7578177	7578177	+	Splice_Site	SNP	C	C	A	rs267605076		TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr17:7578177C>A	ENST00000269305.4	-	6	861	c.672G>T	c.(670-672)gaG>gaT	p.E224D	TP53_ENST00000413465.2_Splice_Site_p.E224D|TP53_ENST00000445888.2_Splice_Site_p.E224D|TP53_ENST00000359597.4_Splice_Site_p.E224D|TP53_ENST00000420246.2_Splice_Site_p.E224D|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Splice_Site_p.E224D	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	224	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E224D(20)|p.?(13)|p.E224E(12)|p.0?(8)|p.E131D(3)|p.E131E(2)|p.V218_E224delVPYEPPE(1)|p.V225fs*24(1)|p.E224_V225insXX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAACCAGACCTCAGGCGGCT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	61	Substitution - Missense(23)|Substitution - coding silent(14)|Unknown(13)|Whole gene deletion(8)|Deletion - In frame(1)|Insertion - Frameshift(1)|Insertion - In frame(1)	lung(23)|large_intestine(7)|bone(6)|biliary_tract(5)|endometrium(5)|oesophagus(3)|breast(3)|stomach(2)|central_nervous_system(2)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|ovary(1)|liver(1)						ENSG00000141510						81.0	76.0	78.0					17																	7578177		2203	4300	6503	TP53	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.672+1G>T	17.37:g.7578177C>A		Somatic	0	93	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	56	39.78	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.E224D	ENST00000269305.4	37	c.672	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	18.11	3.551846	0.65311	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99760	-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66	5.28	4.31	0.51392	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.057313	0.64402	D	0.000001	D	0.99230	0.9732	L	0.59436	1.845	0.51233	D	0.999915	B;B;B;B;B;B;B	0.28636	0.005;0.001;0.218;0.001;0.001;0.001;0.002	B;B;B;B;B;B;B	0.37346	0.015;0.017;0.247;0.002;0.03;0.037;0.006	D	0.99917	1.1232	10	0.87932	D	0	-13.9223	12.1312	0.53944	0.0:0.9158:0.0:0.0842	.	185;224;224;131;224;224;224	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	D	224;224;224;224;224;224;213;131;92;131	ENSP00000410739:E224D;ENSP00000352610:E224D;ENSP00000269305:E224D;ENSP00000398846:E224D;ENSP00000391127:E224D;ENSP00000391478:E224D;ENSP00000425104:E92D;ENSP00000423862:E131D	ENSP00000269305:E224D	E	-	3	2	TP53	7518902	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	6.040000	0.70980	1.362000	0.46000	0.563000	0.77884	GAG	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	-	Missense_Mutation	7578177	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	A
CRELD2	79174	genome.wustl.edu	37	22	50315953	50315953	+	Intron	SNP	G	G	A	rs377640443|rs386822607|rs386822606|rs368043307|rs71805922|rs386822608		TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr22:50315953G>A	ENST00000328268.4	+	6	666				CRELD2_ENST00000407217.3_Intron|CRELD2_ENST00000444954.1_Intron|CRELD2_ENST00000403427.3_Intron|CRELD2_ENST00000404488.3_Missense_Mutation_p.G201S	NM_024324.3	NP_077300.3	Q6UXH1	CREL2_HUMAN	cysteine-rich with EGF-like domains 2							endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|stomach(3)	9		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.198)|LUAD - Lung adenocarcinoma(64;0.247)		AGTCAGGACCGGCCTCTCCGA	0.637																																																	0								ENSG00000184164	G	SER/GLY,	0,3084		0,0,1542	25.0	29.0	28.0		601,	-1.8	0.0	22		28	1,7149		0,1,3574	no	missense,intron	CRELD2	NM_001135101.1,NM_024324.3	56,	0,1,5116	AA,AG,GG		0.014,0.0,0.0098	probably-damaging,	201/403,	50315953	1,10233	1542	3575	5117	CRELD2	SO:0001627	intron_variant	0			-	HGNC	BC050675	CCDS14082.1, CCDS46730.1, CCDS63515.1, CCDS63516.1	22q13.33	2005-12-08			ENSG00000184164	ENSG00000184164			28150	protein-coding gene	gene with protein product		607171				12137942	Standard	XM_005261737		Approved	MGC11256	uc010hal.2	Q6UXH1	OTTHUMG00000150292	ENST00000328268.4:c.593-307G>A	22.37:g.50315953G>A		Somatic	0	71	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	51	27.14	A5GZA2|A5GZA3|A5GZA4|A5GZA5|A5GZA6|Q4W0V0|Q86UC0|Q9BU47	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3456,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_Furin_repeat,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.G201S	ENST00000328268.4	37	c.601	CCDS14082.1	22	.	.	.	.	.	.	.	.	.	.	G	10.07	1.249614	0.22880	0.0	1.4E-4	ENSG00000184164	ENST00000404488	T	0.52754	0.65	1.5	-1.81	0.07882	.	.	.	.	.	T	0.26521	0.0648	.	.	.	0.09310	N	1	B	0.22080	0.064	B	0.08055	0.003	T	0.15723	-1.0427	8	0.42905	T	0.14	.	1.7098	0.02890	0.292:0.0:0.3994:0.3086	.	201	Q6UXH1-5	.	S	201	ENSP00000383938:G201S	ENSP00000383938:G201S	G	+	1	0	CRELD2	48701957	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.082000	0.01365	-0.417000	0.07461	0.563000	0.77884	GGC	-	superfamily_Growth_fac_rcpt_N_dom		0.637	CRELD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CRELD2	protein_coding	OTTHUMT00000317409.1	G	NM_024324	-		50315953	+1	no_errors	ENST00000404488	ensembl	human	known	74_37	missense	SNP	0.000	A
UGT3A1	133688	genome.wustl.edu	37	5	35957294	35957294	+	Silent	SNP	G	G	C			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr5:35957294G>C	ENST00000274278.3	-	5	1428	c.1071C>G	c.(1069-1071)ctC>ctG	p.L357L	UGT3A1_ENST00000507113.1_Silent_p.L323L|UGT3A1_ENST00000503189.1_Silent_p.L357L|UGT3A1_ENST00000513233.1_5'UTR	NM_152404.3	NP_689617.3	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	357						integral component of membrane (GO:0016021)|UDP-N-acetylglucosamine transferase complex (GO:0043541)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|skin(4)	46	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CCTTACCCAGGAGGTCACTCT	0.488																																																	0								ENSG00000145626						90.0	77.0	82.0					5																	35957294		2203	4300	6503	UGT3A1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS3913.1, CCDS54841.1	5p13.2	2014-05-20			ENSG00000145626	ENSG00000145626		"""UDP glucuronosyltransferases"""	26625	protein-coding gene	gene with protein product							Standard	NM_152404		Approved	FLJ34658	uc003jjv.2	Q6NUS8	OTTHUMG00000131107	ENST00000274278.3:c.1071C>G	5.37:g.35957294G>C		Somatic	0	48	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	32	36.00	G5E961|Q8IYS9|Q8NAW4|Q96DM6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.L357	ENST00000274278.3	37	c.1071	CCDS3913.1	5																																																																																			-	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C		0.488	UGT3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT3A1	protein_coding	OTTHUMT00000253770.2	G	NM_152404	-		35957294	-1	no_errors	ENST00000274278	ensembl	human	known	74_37	silent	SNP	0.917	C
SH3RF1	57630	genome.wustl.edu	37	4	170057480	170057480	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr4:170057480C>T	ENST00000284637.9	-	5	1398	c.1057G>A	c.(1057-1059)Gcc>Acc	p.A353T	SH3RF1_ENST00000508685.1_5'UTR	NM_020870.3	NP_065921.2	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	353					negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|protein ubiquitination (GO:0016567)|regulation of JNK cascade (GO:0046328)	cell projection (GO:0042995)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		TGAGAAGGGGCACTGCAGGAG	0.512																																																	0								ENSG00000154447						171.0	187.0	182.0					4																	170057480		2203	4300	6503	SH3RF1	SO:0001583	missense	0			-	HGNC	BC033203	CCDS34099.1	4q32.3	2013-01-09	2006-02-13	2006-02-13	ENSG00000154447	ENSG00000154447		"""RING-type (C3HC4) zinc fingers"""	17650	protein-coding gene	gene with protein product	"""plenty of SH3 domains"""		"""SH3 multiple domains 2"""	SH3MD2		9482736	Standard	NM_020870		Approved	POSH, RNF142, KIAA1494	uc003isa.1	Q7Z6J0	OTTHUMG00000161010	ENST00000284637.9:c.1057G>A	4.37:g.170057480C>T	ENSP00000284637:p.Ala353Thr	Somatic	0	27	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q05BT2|Q8IW46|Q9HAM2|Q9P234	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_domain,pfam_SH3_2,pfam_Znf_C3HC4_RING-type,superfamily_SH3_domain,smart_Znf_RING,smart_SH3_domain,pfscan_SH3_domain,pfscan_Znf_RING,prints_p67phox,prints_SH3_domain	p.A353T	ENST00000284637.9	37	c.1057	CCDS34099.1	4	.	.	.	.	.	.	.	.	.	.	C	24.2	4.500643	0.85176	.	.	ENSG00000154447	ENST00000284637	T	0.15487	2.42	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.20129	0.0484	L	0.58583	1.82	0.80722	D	1	P	0.36909	0.573	B	0.33690	0.168	T	0.03957	-1.0989	10	0.16420	T	0.52	-29.5704	20.0542	0.97645	0.0:1.0:0.0:0.0	.	353	Q7Z6J0	SH3R1_HUMAN	T	353	ENSP00000284637:A353T	ENSP00000284637:A353T	A	-	1	0	SH3RF1	170294055	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.487000	0.81328	2.743000	0.94032	0.655000	0.94253	GCC	-	NULL		0.512	SH3RF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3RF1	protein_coding	OTTHUMT00000363382.3	C	NM_020870	-		170057480	-1	no_errors	ENST00000284637	ensembl	human	known	74_37	missense	SNP	1.000	T
TIAM1	7074	genome.wustl.edu	37	21	32638611	32638611	+	Missense_Mutation	SNP	A	A	C			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr21:32638611A>C	ENST00000286827.3	-	5	1149	c.678T>G	c.(676-678)tgT>tgG	p.C226W	TIAM1_ENST00000541036.1_Missense_Mutation_p.C226W|TIAM1_ENST00000469412.1_Intron	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	226					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						TGGCTCTCTGACAGGTGCTGA	0.562																																																	0								ENSG00000156299						62.0	67.0	65.0					21																	32638611		2203	4300	6503	TIAM1	SO:0001583	missense	0			-	HGNC		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.678T>G	21.37:g.32638611A>C	ENSP00000286827:p.Cys226Trp	Somatic	0	20	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	12	29.41	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Raf-like_ras-bd,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.C226W	ENST00000286827.3	37	c.678	CCDS13609.1	21	.	.	.	.	.	.	.	.	.	.	A	16.65	3.183119	0.57800	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.41065	1.02;1.01	5.41	1.77	0.24775	.	0.453195	0.28203	N	0.016210	T	0.39489	0.1080	L	0.36672	1.1	0.54753	D	0.999988	D;D;D	0.59767	0.986;0.975;0.975	P;P;P	0.52554	0.702;0.506;0.602	T	0.21552	-1.0242	10	0.72032	D	0.01	.	7.3886	0.26897	0.5998:0.0:0.4002:0.0	.	226;226;226	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	W	226;67;226	ENSP00000286827:C226W;ENSP00000441570:C226W	ENSP00000286827:C226W	C	-	3	2	TIAM1	31560482	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	1.451000	0.35145	0.498000	0.27948	0.482000	0.46254	TGT	-	NULL		0.562	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAM1	protein_coding	OTTHUMT00000192552.1	A	NM_003253	-		32638611	-1	no_errors	ENST00000286827	ensembl	human	known	74_37	missense	SNP	0.997	C
MUC16	94025	genome.wustl.edu	37	19	9084380	9084397	+	In_Frame_Del	DEL	CCATGGTGCTGAAAGTTC	CCATGGTGCTGAAAGTTC	-			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	CCATGGTGCTGAAAGTTC	CCATGGTGCTGAAAGTTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr19:9084380_9084397delCCATGGTGCTGAAAGTTC	ENST00000397910.4	-	1	7621_7638	c.7418_7435delGAACTTTCAGCACCATGG	c.(7417-7437)agaactttcagcaccatggtc>atc	p.2473_2479RTFSTMV>I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2473	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.M2478V(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCAGTGCTGACCATGGTGCTGAAAGTTCTTACTGGTCT	0.523											OREG0006611	type=TRANSCRIPTION FACTOR BINDING SITE|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																																					2	Substitution - Missense(2)	lung(2)						ENSG00000181143																																			MUC16	SO:0001651	inframe_deletion	0				HGNC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.7418_7435delGAACTTTCAGCACCATGG	19.37:g.9084380_9084397delCCATGGTGCTGAAAGTTC	ENSP00000381008:p.Arg2473_Val2479delinsIle	Somatic	NA	NA	NA	654	0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6ZQW5|Q96RK2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.RTFSTMV2473in_frame_delI	ENST00000397910.4	37	c.7435_7418	CCDS54212.1	19																																																																																			-	NULL		0.523	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	CCATGGTGCTGAAAGTTC	NM_024690			9084397	-1	no_errors	ENST00000397910	ensembl	human	known	74_37	in_frame_del	DEL	0.086:0.087:0.086:0.095:0.103:0.108:0.112:0.114:0.114:0.112:0.109:0.104:0.098:0.089:0.079:0.066:0.051:0.033	-
PAX4	5078	genome.wustl.edu	37	7	127251732	127251733	+	Splice_Site	INS	-	-	A	rs35434068|rs375404897|rs386411245		TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr7:127251732_127251733insA	ENST00000341640.2	-	8	953		c.e8-2		PAX4_ENST00000378740.2_Splice_Site|PAX4_ENST00000463946.1_Splice_Site|PAX4_ENST00000338516.3_Splice_Site	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4						cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						AGGGGACTGCTAAAAAAAAAAA	0.569																																					Ovarian(113;737 1605 7858 27720 34092)												0								ENSG00000106331																																			PAX4	SO:0001630	splice_region_variant	0				HGNC		CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.748-2->T	7.37:g.127251743_127251743dupA		Somatic	0	10	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	20	9.09	O95161|Q6B0H0	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e8-2	ENST00000341640.2	37	c.748-3_748-2	CCDS5797.1	7																																																																																			-	-		0.569	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAX4	protein_coding	OTTHUMT00000349165.1	-			Intron	127251733	-1	no_errors	ENST00000341640	ensembl	human	known	74_37	splice_site_ins	INS	0.745:0.624	A
AP3B2	8120	genome.wustl.edu	37	15	83349336	83349336	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr15:83349336T>C	ENST00000261722.3	-	8	1150	c.943A>G	c.(943-945)Agc>Ggc	p.S315G	RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535348.1_Missense_Mutation_p.S283G|AP3B2_ENST00000535359.1_Missense_Mutation_p.S315G	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	315					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			GCGCTGCGGCTCTGCAGCAGG	0.706																																																	0								ENSG00000103723						6.0	7.0	7.0					15																	83349336		1732	3849	5581	AP3B2	SO:0001583	missense	0			-	HGNC	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.943A>G	15.37:g.83349336T>C	ENSP00000261722:p.Ser315Gly	Somatic	0	41	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,superfamily_Coatomer/clathrin_app_Ig-like,pirsf_AP3_beta	p.S315G	ENST00000261722.3	37	c.943	CCDS45331.1	15	.	.	.	.	.	.	.	.	.	.	T	34	5.304343	0.95601	.	.	ENSG00000103723	ENST00000261722;ENST00000535348;ENST00000535359	T;T;T	0.15952	2.38;2.38;2.38	4.9	4.9	0.64082	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.55386	0.1917	H	0.96460	3.825	0.80722	D	1	B;D;D	0.89917	0.426;1.0;1.0	B;D;D	0.91635	0.308;0.998;0.999	T	0.71094	-0.4692	10	0.72032	D	0.01	-23.2658	14.6797	0.69006	0.0:0.0:0.0:1.0	.	283;315;315	B7ZKR7;B7ZKS0;Q13367	.;.;AP3B2_HUMAN	G	315;283;315	ENSP00000261722:S315G;ENSP00000438721:S283G;ENSP00000440984:S315G	ENSP00000261722:S315G	S	-	1	0	AP3B2	81146390	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	7.690000	0.84178	2.055000	0.61198	0.533000	0.62120	AGC	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_beta		0.706	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3B2	protein_coding	OTTHUMT00000397463.1	T		-		83349336	-1	no_errors	ENST00000261722	ensembl	human	known	74_37	missense	SNP	1.000	C
CKMT2	1160	genome.wustl.edu	37	5	80548599	80548599	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr5:80548599G>T	ENST00000424301.2	+	4	476	c.238G>T	c.(238-240)Gtg>Ttg	p.V80L	CKMT2_ENST00000254035.4_Missense_Mutation_p.V80L|CKMT2-AS1_ENST00000512287.1_RNA|CKMT2_ENST00000437669.1_Missense_Mutation_p.V80L|CKMT2-AS1_ENST00000500148.2_RNA|CKMT2-AS1_ENST00000511495.1_RNA|CKMT2-AS1_ENST00000505295.1_RNA|CKMT2-AS1_ENST00000502041.2_RNA|CKMT2-AS1_ENST00000501927.2_RNA|CKMT2-AS1_ENST00000503483.2_RNA	NM_001825.2	NP_001816.2	P17540	KCRS_HUMAN	creatine kinase, mitochondrial 2 (sarcomeric)	80	Phosphagen kinase N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00842}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(4)|urinary_tract(1)	17		Lung NSC(167;0.00475)|all_lung(232;0.00502)|Ovarian(174;0.0336)		OV - Ovarian serous cystadenocarcinoma(54;2.29e-44)|Epithelial(54;1.05e-38)|all cancers(79;4.15e-34)	Creatine(DB00148)	TCGCAACAAGGTGACACCCAA	0.597																																																	0								ENSG00000131730						125.0	105.0	112.0					5																	80548599		2203	4300	6503	CKMT2	SO:0001583	missense	0			-	HGNC		CCDS4053.1	5q14.1	2013-09-20			ENSG00000131730	ENSG00000131730	2.7.3.2		1996	protein-coding gene	gene with protein product		123295				2324105	Standard	NM_001825		Approved	SMTCK	uc003khd.4	P17540	OTTHUMG00000119013	ENST00000424301.2:c.238G>T	5.37:g.80548599G>T	ENSP00000404203:p.Val80Leu	Somatic	0	37	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	Q6ICS8|Q8N1E1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATP-guanido_PTrfase_cat,pfam_ATP-guanido_PTrfase_N,superfamily_ATP-guanido_PTrfase_N	p.V80L	ENST00000424301.2	37	c.238	CCDS4053.1	5	.	.	.	.	.	.	.	.	.	.	G	12.92	2.081203	0.36758	.	.	ENSG00000131730	ENST00000254035;ENST00000511719;ENST00000437669;ENST00000424301;ENST00000505060	T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06	6.04	0.604	0.17547	ATP:guanido phosphotransferase, N-terminal (4);	0.652897	0.16544	N	0.209794	T	0.52757	0.1754	M	0.64170	1.965	0.32009	N	0.602398	B	0.02656	0.0	B	0.04013	0.001	T	0.51733	-0.8668	10	0.37606	T	0.19	-9.7058	6.664	0.23031	0.5306:0.127:0.3425:0.0	.	80	P17540	KCRS_HUMAN	L	80	ENSP00000254035:V80L;ENSP00000423264:V80L;ENSP00000410289:V80L;ENSP00000404203:V80L;ENSP00000427635:V80L	ENSP00000254035:V80L	V	+	1	0	CKMT2	80584355	0.001000	0.12720	0.996000	0.52242	0.934000	0.57294	-0.082000	0.11304	0.142000	0.18901	0.561000	0.74099	GTG	-	pfam_ATP-guanido_PTrfase_N,superfamily_ATP-guanido_PTrfase_N		0.597	CKMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CKMT2	protein_coding	OTTHUMT00000369600.1	G	NM_001825	-		80548599	+1	no_errors	ENST00000254035	ensembl	human	known	74_37	missense	SNP	0.594	T
PCDHB4	56131	genome.wustl.edu	37	5	140502400	140502400	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr5:140502400G>T	ENST00000194152.1	+	1	820	c.820G>T	c.(820-822)Ggg>Tgg	p.G274W	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	274	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGAAACTTCGGGAGTGTTTC	0.403																																																	0								ENSG00000081818						101.0	115.0	111.0					5																	140502400		2202	4300	6502	PCDHB4	SO:0001583	missense	0			-	HGNC	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.820G>T	5.37:g.140502400G>T	ENSP00000194152:p.Gly274Trp	Somatic	0	76	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q4V761	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G274W	ENST00000194152.1	37	c.820	CCDS4246.1	5	.	.	.	.	.	.	.	.	.	.	G	16.06	3.014631	0.54468	.	.	ENSG00000081818	ENST00000194152	T	0.53423	0.62	4.41	4.41	0.53225	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.82250	0.4996	H	0.99143	4.445	0.41203	D	0.986382	D	0.89917	1.0	D	0.97110	1.0	D	0.90610	0.4551	9	0.87932	D	0	.	17.5536	0.87884	0.0:0.0:1.0:0.0	.	274	Q9Y5E5	PCDB4_HUMAN	W	274	ENSP00000194152:G274W	ENSP00000194152:G274W	G	+	1	0	PCDHB4	140482584	0.977000	0.34250	0.990000	0.47175	0.800000	0.45204	2.592000	0.46171	2.449000	0.82847	0.650000	0.86243	GGG	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.403	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB4	protein_coding	OTTHUMT00000251812.2	G	NM_018938	-		140502400	+1	no_errors	ENST00000194152	ensembl	human	known	74_37	missense	SNP	0.881	T
C14orf119	55017	genome.wustl.edu	37	14	23567055	23567055	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr14:23567055C>G	ENST00000319074.4	+	2	1044	c.188C>G	c.(187-189)gCt>gGt	p.A63G	ACIN1_ENST00000605057.1_5'Flank|ACIN1_ENST00000555053.1_5'Flank|C14orf119_ENST00000554203.1_Missense_Mutation_p.A63G|ACIN1_ENST00000457657.1_5'Flank|ACIN1_ENST00000262710.1_5'Flank	NM_017924.3	NP_060394.1	Q9NWQ9	CN119_HUMAN	chromosome 14 open reading frame 119	63						mitochondrion (GO:0005739)				central_nervous_system(1)|endometrium(1)|lung(1)	3	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00649)		GACCTGGTAGCTAAGGCAGTG	0.502																																																	0								ENSG00000179933						133.0	119.0	124.0					14																	23567055		2203	4300	6503	C14orf119	SO:0001583	missense	0			-	HGNC		CCDS9588.1	14q11.2	2012-09-25			ENSG00000179933	ENSG00000179933			20270	protein-coding gene	gene with protein product							Standard	NM_017924		Approved	FLJ20671	uc001wiu.3	Q9NWQ9	OTTHUMG00000028717	ENST00000319074.4:c.188C>G	14.37:g.23567055C>G	ENSP00000322238:p.Ala63Gly	Somatic	0	22	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	23	53.06	Q6IAA7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A63G	ENST00000319074.4	37	c.188	CCDS9588.1	14	.	.	.	.	.	.	.	.	.	.	C	11.79	1.743293	0.30865	.	.	ENSG00000179933	ENST00000319074;ENST00000554203	T;T	0.46451	0.87;0.87	5.99	5.09	0.68999	.	0.368782	0.30277	N	0.009990	T	0.30166	0.0756	L	0.36672	1.1	0.27287	N	0.957935	B	0.06786	0.001	B	0.08055	0.003	T	0.17137	-1.0379	10	0.18276	T	0.48	.	9.546	0.39282	0.285:0.5771:0.1379:0.0	.	63	Q9NWQ9	CN119_HUMAN	G	63	ENSP00000322238:A63G;ENSP00000450861:A63G	ENSP00000322238:A63G	A	+	2	0	C14orf119	22636895	0.998000	0.40836	0.999000	0.59377	0.989000	0.77384	2.479000	0.45197	1.520000	0.48965	-0.181000	0.13052	GCT	-	NULL		0.502	C14orf119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf119	protein_coding	OTTHUMT00000071713.3	C	NM_017924	-		23567055	+1	no_errors	ENST00000319074	ensembl	human	known	74_37	missense	SNP	0.937	G
GSTM5	2949	genome.wustl.edu	37	1	110257473	110257488	+	Intron	DEL	GCCTGTGGCCAGCCTG	GCCTGTGGCCAGCCTG	-			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	GCCTGTGGCCAGCCTG	GCCTGTGGCCAGCCTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr1:110257473_110257488delGCCTGTGGCCAGCCTG	ENST00000256593.3	+	6	418				GSTM5_ENST00000369813.1_Intron|GSTM5_ENST00000492718.1_3'UTR|GSTM5_ENST00000369812.5_Intron	NM_000851.3	NP_000842.2	P46439	GSTM5_HUMAN	glutathione S-transferase mu 5						glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)			NS(1)|central_nervous_system(6)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	21		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Colorectal(144;0.0131)|all cancers(265;0.0252)|Epithelial(280;0.0265)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.0474)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)	ATGGCTGCTTGCCTGTGGCCAGCCTGGGCCATCTAC	0.542																																																	0								ENSG00000134201																																			GSTM5	SO:0001627	intron_variant	0				HGNC	L02321	CCDS811.1	1p13.3	2012-06-21	2008-11-26		ENSG00000134201	ENSG00000134201	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4637	protein-coding gene	gene with protein product		138385	"""glutathione S-transferase M5"""			8473333	Standard	NM_000851		Approved		uc001dyn.3	P46439	OTTHUMG00000011644	ENST00000256593.3:c.361-81GCCTGTGGCCAGCCTG>-	1.37:g.110257473_110257488delGCCTGTGGCCAGCCTG		Somatic	NA	NA	NA		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K0V8|Q6PD78	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000256593.3	37	NULL	CCDS811.1	1																																																																																			-	-		0.542	GSTM5-001	KNOWN	basic|CCDS	protein_coding	GSTM5	protein_coding	OTTHUMT00000032200.1	GCCTGTGGCCAGCCTG	NM_000851			110257488	+1	no_errors	ENST00000483153	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.003:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001	-
ALOX12	239	genome.wustl.edu	37	17	6913399	6913399	+	Missense_Mutation	SNP	T	T	A			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr17:6913399T>A	ENST00000251535.6	+	13	1819	c.1766T>A	c.(1765-1767)cTt>cAt	p.L589H	AC027763.2_ENST00000575727.1_Intron|AC027763.2_ENST00000574377.1_Missense_Mutation_p.E6D|RNASEK_ENST00000548577.1_5'Flank|RP11-589P10.7_ENST00000572547.1_RNA|AC027763.2_ENST00000573939.1_Intron|AC027763.2_ENST00000399541.2_Intron|AC027763.2_ENST00000399540.2_Intron|RNASEK_ENST00000402093.1_5'Flank	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	589	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						CAGGCCTGTCTTCAAATGGCC	0.562																																																	0								ENSG00000108839						70.0	59.0	63.0					17																	6913399		2203	4300	6503	ALOX12	SO:0001583	missense	0			-	HGNC	M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.1766T>A	17.37:g.6913399T>A	ENSP00000251535:p.Leu589His	Somatic	0	30	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	14	48.15	O95569|Q6ISF8|Q9UQM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,prints_LipOase_mml,prints_LipOase_C	p.L589H	ENST00000251535.6	37	c.1766	CCDS11084.1	17	.	.	.	.	.	.	.	.	.	.	T	21.8	4.208887	0.79240	.	.	ENSG00000108839	ENST00000251535;ENST00000406228	T	0.80393	-1.37	4.96	4.96	0.65561	Lipoxygenase, C-terminal (3);	0.299613	0.32314	N	0.006277	D	0.85911	0.5807	M	0.62266	1.93	0.45837	D	0.998707	D	0.89917	1.0	D	0.72982	0.979	D	0.83865	0.0270	10	0.28530	T	0.3	.	10.9542	0.47347	0.0:0.0:0.0:1.0	.	589	P18054	LOX12_HUMAN	H	589;59	ENSP00000251535:L589H	ENSP00000251535:L589H	L	+	2	0	ALOX12	6854123	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.577000	0.60922	2.092000	0.63282	0.377000	0.23210	CTT	-	pfam_LipOase_C,superfamily_LipOase_C,prints_LipOase_mml		0.562	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX12	protein_coding	OTTHUMT00000219922.2	T		-		6913399	+1	no_errors	ENST00000251535	ensembl	human	known	74_37	missense	SNP	1.000	A
DMBT1P1	375940	genome.wustl.edu	37	10	124558336	124558336	+	RNA	SNP	G	G	A	rs181772888		TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr10:124558336G>A	ENST00000439464.2	+	0	3743					NR_003570.1																						CTGGGACTGCGGCTGGTGAAC	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		20360	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000176584																																			RP11-318C4.2			0			GMAF=0.0005	Clone_based_vega_gene																													10.37:g.124558336G>A		Somatic	0	44	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	39	18.75		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000439464.2	37	NULL		10																																																																																			-	-		0.547	RP11-318C4.2-001	KNOWN	basic	processed_transcript	FLJ46361	pseudogene	OTTHUMT00000471298.1	G		rs181772888		124558336	+1	no_errors	ENST00000605982	ensembl	human	known	74_37	rna	SNP	0.982	A
TTC12	54970	genome.wustl.edu	37	11	113239146	113239146	+	IGR	SNP	G	G	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr11:113239146G>T	ENST00000529221.1	+	0	2315				TTC12_ENST00000393020.1_Splice_Site|RP11-159N11.4_ENST00000602900.1_RNA	NM_017868.3	NP_060338.3	Q9H892	TTC12_HUMAN	tetratricopeptide repeat domain 12											breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		all_cancers(61;2.73e-16)|all_epithelial(67;8.64e-10)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.183)|Renal(330;0.187)		BRCA - Breast invasive adenocarcinoma(274;5.3e-06)|Epithelial(105;8.37e-05)|all cancers(92;0.000694)		CCACTTGCCAGGAGCCCCGAC	0.517																																																	0								ENSG00000149292																																			TTC12	SO:0001628	intergenic_variant	0			-	HGNC	AK000542	CCDS8360.2	11q23.2	2013-01-10			ENSG00000149292	ENSG00000149292		"""Tetratricopeptide (TTC) repeat domain containing"""	23700	protein-coding gene	gene with protein product		610732				12964006	Standard	XM_005271607		Approved	FLJ13859, FLJ20535, TPARM	uc001pnu.3	Q9H892	OTTHUMG00000142832		11.37:g.113239146G>T		Somatic	0	19	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	Q8N5H9|Q9NWY3	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e20-1	ENST00000529221.1	37	c.1817-1	CCDS8360.2	11	.	.	.	.	.	.	.	.	.	.	G	5.353	0.250506	0.10130	.	.	ENSG00000149292	ENST00000393020	.	.	.	3.27	0.167	0.15006	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	1.9098	0.03284	0.1199:0.2018:0.4711:0.2073	.	.	.	.	.	-1	.	.	.	+	.	.	TTC12	112744356	0.004000	0.15560	0.000000	0.03702	0.090000	0.18270	0.424000	0.21330	0.046000	0.15833	0.655000	0.94253	.	-	-		0.517	TTC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC12	protein_coding	OTTHUMT00000286455.2	G	NM_017868	-		113239146	+1	no_errors	ENST00000393020	ensembl	human	novel	74_37	splice_site	SNP	0.000	T
GPR111	222611	genome.wustl.edu	37	6	47650127	47650127	+	Missense_Mutation	SNP	C	C	A	rs199531842		TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr6:47650127C>A	ENST00000296862.1	+	6	1832	c.1832C>A	c.(1831-1833)gCt>gAt	p.A611D	GPR111_ENST00000507065.1_Missense_Mutation_p.A543D|GPR111_ENST00000398742.2_Missense_Mutation_p.A543D			Q8IZF7	GP111_HUMAN	G protein-coupled receptor 111	611					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(15)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						GTGATCCCAGCTTTGGCCATC	0.537																																																	0								ENSG00000164393						58.0	58.0	58.0					6																	47650127		2050	4204	6254	GPR111	SO:0001583	missense	0			-	HGNC	AB065684		6p12.3	2014-08-08			ENSG00000164393	ENSG00000164393		"""-"", ""GPCR / Class B : Orphans"""	18991	protein-coding gene	gene with protein product						12435584	Standard	NM_153839		Approved	hGPCR35, PGR20	uc003oyy.3	Q8IZF7	OTTHUMG00000046168	ENST00000296862.1:c.1832C>A	6.37:g.47650127C>A	ENSP00000296862:p.Ala611Asp	Somatic	0	14	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	33	17.50	Q2PNZ1|Q86SL6|Q8NGU5|Q8TDT5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.A611D	ENST00000296862.1	37	c.1832		6	.	.	.	.	.	.	.	.	.	.	C	21.8	4.199726	0.79015	.	.	ENSG00000164393	ENST00000507065;ENST00000296862;ENST00000398742	T;T;T	0.35048	1.33;1.33;1.33	5.64	4.76	0.60689	GPCR, family 2-like (1);	0.189043	0.37136	N	0.002229	T	0.60183	0.2249	M	0.90977	3.165	0.47065	D	0.999305	D;D	0.69078	0.989;0.997	D;D	0.72075	0.932;0.976	T	0.72757	-0.4197	10	0.87932	D	0	.	15.1564	0.72746	0.1419:0.8581:0.0:0.0	.	543;611	Q8IZF7-2;Q8IZF7	.;GP111_HUMAN	D	543;611;543	ENSP00000422934:A543D;ENSP00000296862:A611D;ENSP00000381727:A543D	ENSP00000296862:A611D	A	+	2	0	GPR111	47758086	1.000000	0.71417	0.994000	0.49952	0.901000	0.52897	6.049000	0.71053	1.369000	0.46134	0.655000	0.94253	GCT	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.537	GPR111-001	KNOWN	basic	protein_coding	GPR111	protein_coding	OTTHUMT00000106423.2	C	NM_153839	rs199531842		47650127	+1	no_errors	ENST00000296862	ensembl	human	known	74_37	missense	SNP	1.000	A
SDK1	221935	genome.wustl.edu	37	7	3681632	3681632	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr7:3681632C>T	ENST00000404826.2	+	4	747	c.608C>T	c.(607-609)tCt>tTt	p.S203F	AC011284.3_ENST00000427920.1_RNA|SDK1_ENST00000389531.3_Missense_Mutation_p.S203F	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	203	Ig-like C2-type 2.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AAAACAGTTTCTCAAGGACGT	0.463																																																	0								ENSG00000146555						111.0	102.0	105.0					7																	3681632		2203	4300	6503	SDK1	SO:0001583	missense	0			-	HGNC	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.608C>T	7.37:g.3681632C>T	ENSP00000385899:p.Ser203Phe	Somatic	0	86	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	57	21.92	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S203F	ENST00000404826.2	37	c.608	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	C	11.32	1.604361	0.28534	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.47869	0.83;0.83	5.91	4.86	0.63082	Immunoglobulin subtype (1);Immunoglobulin I-set (1);	1.207570	0.06169	N	0.677267	T	0.46889	0.1416	L	0.43646	1.37	0.25847	N	0.983986	B	0.06786	0.001	B	0.12156	0.007	T	0.30707	-0.9969	10	0.54805	T	0.06	.	14.2321	0.65901	0.0:0.9196:0.0:0.0804	.	203	Q7Z5N4	SDK1_HUMAN	F	203	ENSP00000385899:S203F;ENSP00000374182:S203F	ENSP00000374182:S203F	S	+	2	0	SDK1	3648158	0.369000	0.25039	0.008000	0.14137	0.299000	0.27559	5.141000	0.64814	2.804000	0.96469	0.650000	0.86243	TCT	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2		0.463	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	protein_coding	OTTHUMT00000323702.1	C	NM_152744	-		3681632	+1	no_errors	ENST00000404826	ensembl	human	known	74_37	missense	SNP	0.613	T
ADAM7	8756	genome.wustl.edu	37	8	24339813	24339813	+	Silent	SNP	T	T	C			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr8:24339813T>C	ENST00000175238.6	+	9	947	c.864T>C	c.(862-864)gtT>gtC	p.V288V	RP11-624C23.1_ENST00000523578.1_RNA|ADAM7_ENST00000520720.1_Silent_p.V60V|RP11-624C23.1_ENST00000519689.1_RNA|ADAM7_ENST00000380789.1_Silent_p.V288V	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	288	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		TTGATCATGTTGTATTACTCA	0.269																																																	0								ENSG00000069206						152.0	156.0	155.0					8																	24339813		2203	4299	6502	ADAM7	SO:0001819	synonymous_variant	0			-	HGNC	AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.864T>C	8.37:g.24339813T>C		Somatic	0	61	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	50	4	92.59	A8K8X7|O75959|Q6PEJ6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.V288	ENST00000175238.6	37	c.864	CCDS6045.1	8																																																																																			-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B		0.269	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM7	protein_coding	OTTHUMT00000215150.1	T	NM_003817	-		24339813	+1	no_errors	ENST00000175238	ensembl	human	known	74_37	silent	SNP	0.003	C
SRGAP2B	647135	genome.wustl.edu	37	1	144053567	144053567	+	RNA	SNP	C	C	T	rs202144114		TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr1:144053567C>T	ENST00000467933.1	+	0	1170							P0DMP2	SRG2B_HUMAN	SLIT-ROBO Rho GTPase activating protein 2B						nervous system development (GO:0007399)												CCAGGTGAAGCGGGAAAGCAG	0.428																																																	0								ENSG00000196369																																			SRGAP2B			0			-	HGNC		CCDS72854.1	1q21.1	2014-07-10	2013-02-13	2012-05-08	ENSG00000196369	ENSG00000196369			35237	protein-coding gene	gene with protein product		614703	"""SLIT-ROBO Rho GTPase activating protein 2 pseudogene 2"", ""SLIT-ROBO Rho GTPase activating protein 2B (pseudogene)"""	SRGAP2P2		22559943, 22559944	Standard	NM_001271870		Approved		uc010oxm.1	P0DMP2	OTTHUMG00000041442		1.37:g.144053567C>T		Somatic	0	37	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	44	15.38		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000467933.1	37	NULL		1																																																																																			-	-		0.428	SRGAP2B-002	KNOWN	basic	processed_transcript	SRGAP2B	pseudogene	OTTHUMT00000352915.1	C	NM_001271870	rs202144114		144053567	+1	no_errors	ENST00000467933	ensembl	human	known	74_37	rna	SNP	1.000	T
HLA-V	352962	genome.wustl.edu	37	6	29760667	29760667	+	RNA	SNP	G	G	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr6:29760667G>T	ENST00000457107.1	+	0	353									major histocompatibility complex, class I, V (pseudogene)																		CCCGCAGGTTGGTCCTggcga	0.692																																																	0								ENSG00000181126																																			HLA-V			0			-	HGNC	M96332		6p21.3	2012-10-05	2007-12-12	2007-12-12	ENSG00000181126	ENSG00000181126		"""Histocompatibility complex"""	23482	pseudogene	pseudogene			"""HLA-75 pseudogene"""	HLA-75			Standard	NG_002729		Approved	dJ377H14.4			OTTHUMG00000031277		6.37:g.29760667G>T		Somatic	0	14	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	2	75.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000457107.1	37	NULL		6																																																																																			-	-		0.692	HLA-V-003	KNOWN	basic	processed_transcript	HLA-V	pseudogene	OTTHUMT00000105231.1	G	NG_002729	-		29760667	+1	no_errors	ENST00000446817	ensembl	human	known	74_37	rna	SNP	0.004	T
MAN1B1	11253	genome.wustl.edu	37	9	139998136	139998139	+	Intron	DEL	ACAC	ACAC	-			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	ACAC	ACAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr9:139998136_139998139delACAC	ENST00000371589.4	+	8	1327				MAN1B1_ENST00000474902.1_Intron|MAN1B1_ENST00000540391.1_3'UTR	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1						cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		CGGTGGTGTTACACACATTCACAC	0.564																																																	0								ENSG00000177239																																			MAN1B1	SO:0001627	intron_variant	0				HGNC	AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.1254+2012ACAC>-	9.37:g.139998136_139998139delACAC		Somatic	0	40	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q5VSG3|Q9BRS9|Q9Y5K7	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371589.4	37	NULL	CCDS7029.1	9																																																																																			-	-		0.564	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1B1	protein_coding	OTTHUMT00000055294.2	ACAC	NM_016219			139998139	+1	no_errors	ENST00000540391	ensembl	human	known	74_37	rna	DEL	0.941:0.944:0.949:0.941	-
ICE2	79664	genome.wustl.edu	37	15	60741046	60741046	+	Splice_Site	SNP	C	C	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr15:60741046C>T	ENST00000261520.4	-	10	2354		c.e10+1		NARG2_ENST00000439632.1_Splice_Site	NM_024611.4	NP_078887.2														breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						TATTTACTTACGTCCTTTTGG	0.388																																																	0								ENSG00000128915						38.0	41.0	40.0					15																	60741046		2197	4291	6488	NARG2	SO:0001630	splice_region_variant	0			-	HGNC																												ENST00000261520.4:c.2119+1G>A	15.37:g.60741046C>T		Somatic	0	69	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	47	25.40		Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e9+1	ENST00000261520.4	37	c.2119+1	CCDS10176.1	15	.	.	.	.	.	.	.	.	.	.	C	18.39	3.613167	0.66672	.	.	ENSG00000128915	ENST00000261520;ENST00000439632	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5327	0.75977	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NARG2	58528338	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.384000	0.44362	2.732000	0.93576	0.557000	0.71058	.	-	-		0.388	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARG2	protein_coding	OTTHUMT00000256136.1	C		-	Intron	60741046	-1	no_errors	ENST00000261520	ensembl	human	known	74_37	splice_site	SNP	1.000	T
MUC12	10071	genome.wustl.edu	37	7	100638611	100638611	+	Silent	SNP	A	A	G	rs200598041	byFrequency	TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr7:100638611A>G	ENST00000379442.3	+	5	5196	c.5196A>G	c.(5194-5196)acA>acG	p.T1732T	MUC12_ENST00000536621.1_Silent_p.T1589T			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	1732	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CGCACACAACAGCATTCCCTG	0.582																																																	0								ENSG00000205277						45.0	50.0	48.0					7																	100638611		692	1578	2270	MUC12	SO:0001819	synonymous_variant	0			-	HGNC	AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.5196A>G	7.37:g.100638611A>G		Somatic	0	25	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	35	23.91	A6ND38|F5GWV9|Q9UKN0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom	p.T1589	ENST00000379442.3	37	c.4767		7																																																																																			-	NULL		0.582	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	protein_coding	OTTHUMT00000347234.1	A	XM_379904	rs200598041		100638611	+1	no_errors	ENST00000536621	ensembl	human	known	74_37	silent	SNP	0.001	G
CDH15	1013	genome.wustl.edu	37	16	89246736	89246736	+	Silent	SNP	G	G	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr16:89246736G>T	ENST00000289746.2	+	3	395	c.330G>T	c.(328-330)ctG>ctT	p.L110L	CDH15_ENST00000521087.1_Intron	NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	110	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		ATGCCATGCTGGACCGCGAGA	0.632																																																	0								ENSG00000129910						64.0	50.0	54.0					16																	89246736		2197	4300	6497	CDH15	SO:0001819	synonymous_variant	0			-	HGNC	D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.330G>T	16.37:g.89246736G>T		Somatic	0	34	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L110	ENST00000289746.2	37	c.330	CCDS10976.1	16																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.632	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH15	protein_coding	OTTHUMT00000269920.1	G	NM_004933	-		89246736	+1	no_errors	ENST00000289746	ensembl	human	known	74_37	silent	SNP	1.000	T
JADE1	79960	genome.wustl.edu	37	4	129792885	129792885	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr4:129792885G>A	ENST00000226319.6	+	11	2277	c.1997G>A	c.(1996-1998)tGt>tAt	p.C666Y	PHF17_ENST00000452328.2_Missense_Mutation_p.C654Y|PHF17_ENST00000512960.1_Missense_Mutation_p.C666Y	NM_199320.2	NP_955352.1														NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						CGTTTTCATTGTGATCTCATT	0.423																																																	0								ENSG00000077684						72.0	71.0	71.0					4																	129792885		2203	4300	6503	PHF17	SO:0001583	missense	0			-	HGNC																												ENST00000226319.6:c.1997G>A	4.37:g.129792885G>A	ENSP00000226319:p.Cys666Tyr	Somatic	0	33	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Enhancer_polycomb-like_N,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.C666Y	ENST00000226319.6	37	c.1997	CCDS34062.1	4	.	.	.	.	.	.	.	.	.	.	G	15.09	2.729608	0.48833	.	.	ENSG00000077684	ENST00000226319;ENST00000452328;ENST00000512960;ENST00000535321	T;T;T	0.41065	1.01;1.02;1.01	4.59	4.59	0.56863	.	0.472602	0.25654	N	0.029191	T	0.29093	0.0723	L	0.27053	0.805	0.80722	D	1	P;P	0.44241	0.829;0.77	B;B	0.34652	0.187;0.123	T	0.08953	-1.0697	9	.	.	.	.	17.9869	0.89158	0.0:0.0:1.0:0.0	.	654;666	Q6IE81-2;Q6IE81	.;JADE1_HUMAN	Y	666;654;666;666	ENSP00000226319:C666Y;ENSP00000388015:C654Y;ENSP00000425730:C666Y	.	C	+	2	0	PHF17	130012335	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.198000	0.51035	2.542000	0.85734	0.655000	0.94253	TGT	-	NULL		0.423	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHF17	protein_coding	OTTHUMT00000364280.1	G		-		129792885	+1	no_errors	ENST00000226319	ensembl	human	known	74_37	missense	SNP	1.000	A
ADAM30	11085	genome.wustl.edu	37	1	120437108	120437108	+	Missense_Mutation	SNP	A	A	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr1:120437108A>T	ENST00000369400.1	-	1	2010	c.1852T>A	c.(1852-1854)Tgt>Agt	p.C618S		NM_021794.3	NP_068566.2	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30	618	Cys-rich.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(16)|ovary(2)|skin(2)	38	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		TTTTTAAAACATACCCGGCCT	0.458																																																	0								ENSG00000134249						63.0	64.0	63.0					1																	120437108		2203	4300	6503	ADAM30	SO:0001583	missense	0			-	HGNC	AF171932	CCDS907.1	1p12	2012-05-16	2005-08-18		ENSG00000134249	ENSG00000134249		"""ADAM metallopeptidase domain containing"""	208	protein-coding gene	gene with protein product		604779	"""a disintegrin and metalloproteinase domain 30"""				Standard	NM_021794		Approved	svph4	uc001eij.3	Q9UKF2	OTTHUMG00000012176	ENST00000369400.1:c.1852T>A	1.37:g.120437108A>T	ENSP00000358407:p.Cys618Ser	Somatic	0	37	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	A8K8W8|Q5T3X6|Q9UKF1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.C618S	ENST00000369400.1	37	c.1852	CCDS907.1	1	.	.	.	.	.	.	.	.	.	.	A	16.47	3.132855	0.56828	.	.	ENSG00000134249	ENST00000369400;ENST00000543066	T	0.03124	4.04	5.16	5.16	0.70880	ADAM, cysteine-rich (1);	0.000000	0.51477	D	0.000098	T	0.17577	0.0422	H	0.96889	3.9	0.20638	N	0.999878	D	0.67145	0.996	D	0.76575	0.988	T	0.40813	-0.9543	10	0.87932	D	0	.	11.3219	0.49428	1.0:0.0:0.0:0.0	.	618	Q9UKF2	ADA30_HUMAN	S	618	ENSP00000358407:C618S	ENSP00000358407:C618S	C	-	1	0	ADAM30	120238631	0.926000	0.31397	0.129000	0.21949	0.010000	0.07245	4.058000	0.57463	2.166000	0.68216	0.533000	0.62120	TGT	-	smart_ADAM_Cys-rich		0.458	ADAM30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM30	protein_coding	OTTHUMT00000033678.1	A	NM_021794	-		120437108	-1	no_errors	ENST00000369400	ensembl	human	known	74_37	missense	SNP	0.377	T
PLIN1	5346	genome.wustl.edu	37	15	90208828	90208828	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr15:90208828G>T	ENST00000300055.5	-	9	1720	c.1555C>A	c.(1555-1557)Cgc>Agc	p.R519S	PLIN1_ENST00000430628.2_Missense_Mutation_p.R519S	NM_002666.4	NP_002657.3	O60240	PLIN1_HUMAN	perilipin 1	519					lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|lipid particle (GO:0005811)	lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(2)	13						CTCTTCTTGCGCAGCTGGCTG	0.672																																																	0								ENSG00000166819						2.0	2.0	2.0					15																	90208828		1377	2518	3895	PLIN1	SO:0001583	missense	0			-	HGNC	AB005293	CCDS10353.1	15q26	2009-08-12	2009-08-12	2009-08-12	ENSG00000166819	ENSG00000166819		"""Perilipins"""	9076	protein-coding gene	gene with protein product		170290	"""perilipin"""	PLIN		9521880, 19638644	Standard	NM_002666		Approved		uc010upx.1	O60240	OTTHUMG00000149813	ENST00000300055.5:c.1555C>A	15.37:g.90208828G>T	ENSP00000300055:p.Arg519Ser	Somatic	0	26	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	7	30.00	Q8N5Y6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Perilipin,pirsf_Perilipin	p.R519S	ENST00000300055.5	37	c.1555	CCDS10353.1	15	.	.	.	.	.	.	.	.	.	.	G	18.83	3.706700	0.68615	.	.	ENSG00000166819	ENST00000300055;ENST00000430628	T;T	0.17213	2.29;2.29	5.11	4.08	0.47627	.	0.542875	0.15904	N	0.238949	T	0.15003	0.0362	L	0.50333	1.59	0.31082	N	0.711861	P	0.42757	0.789	B	0.40101	0.319	T	0.06570	-1.0819	10	0.39692	T	0.17	-23.3134	5.6509	0.17616	0.174:0.0:0.826:0.0	.	519	O60240	PLIN1_HUMAN	S	519	ENSP00000300055:R519S;ENSP00000402167:R519S	ENSP00000300055:R519S	R	-	1	0	PLIN1	88009832	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.030000	0.49720	2.380000	0.81148	0.655000	0.94253	CGC	-	NULL		0.672	PLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLIN1	protein_coding	OTTHUMT00000313424.2	G	NM_002666	-		90208828	-1	no_errors	ENST00000300055	ensembl	human	known	74_37	missense	SNP	1.000	T
COL11A2	1302	genome.wustl.edu	37	6	33145927	33145927	+	Silent	SNP	A	A	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr6:33145927A>T	ENST00000374708.4	-	19	1854	c.1596T>A	c.(1594-1596)ccT>ccA	p.P532P	COL11A2_ENST00000395197.1_Silent_p.P558P|COL11A2_ENST00000374714.1_Silent_p.P592P|COL11A2_ENST00000374713.1_Silent_p.P571P|COL11A2_ENST00000374712.1_Silent_p.P537P|COL11A2_ENST00000341947.2_Silent_p.P618P|COL11A2_ENST00000361917.1_Silent_p.P511P|COL11A2_ENST00000477772.1_5'Flank|COL11A2_ENST00000357486.1_Silent_p.P597P	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	618	Collagen-like 2.|Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						CAGGAATACCAGGTGGGCCTT	0.567																																					Melanoma(1;90 116 3946 5341 17093)												0								ENSG00000204248						86.0	72.0	77.0					6																	33145927		1511	2709	4220	COL11A2	SO:0001819	synonymous_variant	0			-	HGNC	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.1596T>A	6.37:g.33145927A>T		Somatic	0	72	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	49	23.44	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.P618	ENST00000374708.4	37	c.1854	CCDS43452.1	6																																																																																			-	NULL		0.567	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	protein_coding	OTTHUMT00000076032.2	A		-		33145927	-1	no_errors	ENST00000341947	ensembl	human	known	74_37	silent	SNP	1.000	T
PREX1	57580	genome.wustl.edu	37	20	47274767	47274767	+	Splice_Site	SNP	C	C	A			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr20:47274767C>A	ENST00000371941.3	-	17	1904		c.e17-1		PREX1_ENST00000396220.1_Splice_Site	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1						actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GGGGCAGGATCTGGGGGCCCA	0.657											OREG0026010	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000124126						162.0	151.0	155.0					20																	47274767		2203	4300	6503	PREX1	SO:0001630	splice_region_variant	0			-	HGNC	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.1882-1G>T	20.37:g.47274767C>A		Somatic	0	38	0.00	945	0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e17-1	ENST00000371941.3	37	c.1882-1	CCDS13410.1	20	.	.	.	.	.	.	.	.	.	.	C	26.7	4.764894	0.90020	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2743	0.90078	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PREX1	46708174	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	7.303000	0.78871	2.284000	0.76573	0.655000	0.94253	.	-	-		0.657	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PREX1	protein_coding	OTTHUMT00000079623.1	C	NM_020820	-	Intron	47274767	-1	no_errors	ENST00000371941	ensembl	human	known	74_37	splice_site	SNP	1.000	A
TMPRSS3	64699	genome.wustl.edu	37	21	43815556	43815556	+	5'UTR	SNP	G	G	T			TCGA-3B-A9HV-01A-11D-A38Z-09	TCGA-3B-A9HV-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e3a9307-4a27-4bd1-8c70-7dca0b907ebc	c7eb9676-9cbf-4977-8a8e-8eaaf7d01533	g.chr21:43815556G>T	ENST00000291532.3	-	0	926				TMPRSS3_ENST00000380399.1_Missense_Mutation_p.P75T|TMPRSS3_ENST00000433957.2_5'UTR|TMPRSS3_ENST00000398405.1_5'UTR|TMPRSS3_ENST00000398397.3_5'UTR	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3						cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						CTGACATCCGGCTCCGCCTCC	0.488																																																	0								ENSG00000160183						63.0	54.0	57.0					21																	43815556		2203	4300	6503	TMPRSS3	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.-30C>A	21.37:g.43815556G>T		Somatic	0	33	0.00		0.6767502437120905	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	D3DSJ6|Q5USC7|Q6ZMC3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_SRCR,pfam_Peptidase_S1A_nudel,pfam_LDrepeatLR_classA_rpt,superfamily_Trypsin-like_Pept_dom,superfamily_Srcr_rcpt-rel,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_LDrepeatLR_classA_rpt,pfscan_SRCR,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.P75T	ENST00000291532.3	37	c.223	CCDS13686.1	21	.	.	.	.	.	.	.	.	.	.	G	12.29	1.892868	0.33442	.	.	ENSG00000160183	ENST00000380399	D	0.89810	-2.57	5.28	3.31	0.37934	.	0.122767	0.37012	N	0.002298	D	0.88789	0.6532	.	.	.	0.32128	N	0.587195	.	.	.	.	.	.	D	0.88980	0.3407	6	.	.	.	.	12.4453	0.55647	0.0:0.3209:0.6791:0.0	.	.	.	.	T	75	ENSP00000369762:P75T	.	P	-	1	0	TMPRSS3	42688625	0.934000	0.31675	0.971000	0.41717	0.465000	0.32709	0.761000	0.26489	1.312000	0.45043	0.655000	0.94253	CCG	-	NULL		0.488	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMPRSS3	protein_coding	OTTHUMT00000195347.1	G		-		43815556	-1	no_errors	ENST00000380399	ensembl	human	known	74_37	missense	SNP	0.959	T
