#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ALMS1	7840	genome.wustl.edu	37	2	73613032	73613037	+	In_Frame_Del	DEL	GGAGGA	GGAGGA	-	rs61156725|rs70965731|rs72319667|rs3074417	byFrequency	TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	GGAGGA	GGAGGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr2:73613032_73613037delGGAGGA	ENST00000264448.6	+	1	147_152	c.36_41delGGAGGA	c.(34-42)ctggaggag>ctg	p.EE27del	ALMS1_ENST00000409009.1_In_Frame_Del_p.EE27del|ALMS1_ENST00000377715.1_In_Frame_Del_p.EE27del	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	27	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.E27_E28delEE(1)|p.E28_A29insE(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CGGGCGAGCTggaggaggaggaggag	0.694														3836	0.765974	0.9183	0.7176	5008	,	,		6363	0.7024		0.6819	False		,,,				2504	0.7464																2	Insertion - In frame(1)|Deletion - In frame(1)	ovary(1)|breast(1)						ENSG00000116127																																			ALMS1	SO:0001651	inframe_deletion	0				HGNC	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.36_41delGGAGGA	2.37:g.73613038_73613043delGGAGGA	ENSP00000264448:p.Glu27_Glu28del	Somatic	NA	NA	NA		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.EE16in_frame_del	ENST00000264448.6	37	c.36_41	CCDS42697.1	2																																																																																			-	NULL		0.694	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	protein_coding	OTTHUMT00000327776.1	GGAGGA	NM_015120			73613037	+1	no_errors	ENST00000264448	ensembl	human	known	74_37	in_frame_del	DEL	0.989:0.996:1.000:1.000:1.000:1.000	-
LTBP3	4054	genome.wustl.edu	37	11	65325326	65325328	+	In_Frame_Del	DEL	CAG	CAG	-	rs577530923	byFrequency	TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr11:65325326_65325328delCAG	ENST00000301873.5	-	1	371_373	c.103_105delCTG	c.(103-105)ctgdel	p.L35del	LTBP3_ENST00000536982.1_5'Flank|LTBP3_ENST00000322147.4_In_Frame_Del_p.L35del	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	35	Gly-rich.			Missing (in Ref. 2; BAB15767). {ECO:0000305}.	bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						cgcccaggcccagcagcagcagc	0.818																																																	0								ENSG00000168056		,,	2,10,52		1,0,0,5,0,26					,,	2.7	1.0			1	37,32,177		18,0,1,14,4,86	no	codingComplex,utr-5,codingComplex	LTBP3	NM_021070.4,NM_001164266.1,NM_001130144.2	,,	19,0,1,19,4,112	A1A1,A1A2,A1R,A2A2,A2R,RR		28.0488,18.75,26.129	,,	,,		39,42,229				LTBP3	SO:0001651	inframe_deletion	0				HGNC	AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.103_105delCTG	11.37:g.65325335_65325337delCAG	ENSP00000301873:p.Leu35del	Somatic	0	33	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	6	25.00	O15107|Q96HB9|Q9H7K2|Q9UFN4	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.L35in_frame_del	ENST00000301873.5	37	c.105_103	CCDS44647.1	11																																																																																			-	NULL		0.818	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP3	protein_coding	OTTHUMT00000390538.1	CAG	NM_021070			65325328	-1	no_errors	ENST00000301873	ensembl	human	known	74_37	in_frame_del	DEL	0.996:0.996:0.995	-
PSG1	5669	genome.wustl.edu	37	19	43383689	43383689	+	Nonsense_Mutation	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr19:43383689C>T	ENST00000436291.2	-	1	161	c.45G>A	c.(43-45)tgG>tgA	p.W15*	PSG1_ENST00000595356.1_Nonsense_Mutation_p.W15*|PSG1_ENST00000312439.6_Nonsense_Mutation_p.W15*|PSG1_ENST00000244296.2_Nonsense_Mutation_p.W15*|PSG1_ENST00000601073.1_5'UTR|PSG1_ENST00000403380.3_Nonsense_Mutation_p.W15*|PSG1_ENST00000595124.1_Nonsense_Mutation_p.W15*	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	15					female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				GGAGCCCCTTCCATTTGATGC	0.567																																																	0								ENSG00000231924						167.0	148.0	155.0					19																	43383689		1510	2707	4217	PSG1	SO:0001587	stop_gained	0			-	HGNC		CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.45G>A	19.37:g.43383689C>T	ENSP00000413041:p.Trp15*	Somatic	0	81	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	39	48.00	O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.W15*	ENST00000436291.2	37	c.45	CCDS54275.1	19	.	.	.	.	.	.	.	.	.	.	N	17.77	3.470749	0.63625	.	.	ENSG00000231924	ENST00000270059;ENST00000436291;ENST00000403380;ENST00000312439;ENST00000244296	.	.	.	1.64	1.64	0.23874	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.7892	0.23689	0.0:1.0:0.0:0.0	.	.	.	.	X	15	.	ENSP00000244296:W15X	W	-	3	0	PSG1	48075529	0.200000	0.23398	0.024000	0.17045	0.045000	0.14185	1.940000	0.40223	1.249000	0.43950	0.184000	0.17185	TGG	-	NULL		0.567	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PSG1	protein_coding	OTTHUMT00000321426.1	C		-		43383689	-1	no_errors	ENST00000312439	ensembl	human	known	74_37	nonsense	SNP	0.024	T
BEST3	144453	genome.wustl.edu	37	12	70049362	70049362	+	Frame_Shift_Del	DEL	G	G	-			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr12:70049362delG	ENST00000330891.5	-	10	1558	c.1332delC	c.(1330-1332)cccfs	p.P444fs	BEST3_ENST00000488961.1_Frame_Shift_Del_p.P231fs|BEST3_ENST00000553096.1_Frame_Shift_Del_p.P338fs|BEST3_ENST00000331471.4_Intron	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	444					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			GTGAGGCCCTGGGGGGGTTTC	0.592																																																	0								ENSG00000127325						76.0	78.0	78.0					12																	70049362		1929	4152	6081	BEST3	SO:0001589	frameshift_variant	0				HGNC	AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.1332delC	12.37:g.70049362delG	ENSP00000332413:p.Pro444fs	Somatic	0	29	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34	B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Bestrophin/UPF0187	p.R445fs	ENST00000330891.5	37	c.1332	CCDS8992.2	12																																																																																			-	NULL		0.592	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEST3	protein_coding	OTTHUMT00000313908.2	G	NM_152439			70049362	-1	no_errors	ENST00000330891	ensembl	human	known	74_37	frame_shift_del	DEL	0.001	-
OR8B12	219858	genome.wustl.edu	37	11	124413017	124413017	+	Silent	SNP	A	A	G			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr11:124413017A>G	ENST00000306842.2	-	1	558	c.534T>C	c.(532-534)tgT>tgC	p.C178C		NM_001005195.1	NP_001005195.1	Q8NGG6	OR8BC_HUMAN	olfactory receptor, family 8, subfamily B, member 12	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)		GAAGGATGTCACACATGAAAT	0.502																																																	0								ENSG00000170953						158.0	120.0	133.0					11																	124413017		2201	4299	6500	OR8B12	SO:0001819	synonymous_variant	0			-	HGNC		CCDS31711.1	11q24.2	2013-09-24			ENSG00000170953	ENSG00000170953		"""GPCR / Class A : Olfactory receptors"""	15307	protein-coding gene	gene with protein product							Standard	NM_001005195		Approved		uc010sam.2	Q8NGG6	OTTHUMG00000165922	ENST00000306842.2:c.534T>C	11.37:g.124413017A>G		Somatic	0	33	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	24	42.86	B2RNF6|Q6IEW8|Q96RC7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.C178	ENST00000306842.2	37	c.534	CCDS31711.1	11																																																																																			-	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_7TM		0.502	OR8B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B12	protein_coding	OTTHUMT00000387061.1	A		-		124413017	-1	no_errors	ENST00000306842	ensembl	human	known	74_37	silent	SNP	1.000	G
PCDHA4	56144	genome.wustl.edu	37	5	140186934	140186934	+	Silent	SNP	G	G	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr5:140186934G>A	ENST00000530339.1	+	1	162	c.162G>A	c.(160-162)ctG>ctA	p.L54L	PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Silent_p.L54L|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000356878.4_Silent_p.L54L	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	54	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCTGGGACTGGAGCTGGCGG	0.637																																																	0								ENSG00000204967						49.0	57.0	54.0					5																	140186934		2202	4299	6501	PCDHA4	SO:0001819	synonymous_variant	0			-	HGNC	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.162G>A	5.37:g.140186934G>A		Somatic	1	119	0.83		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	49	37.18	O75285|Q2M253	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L54	ENST00000530339.1	37	c.162	CCDS54916.1	5																																																																																			-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.637	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	protein_coding	OTTHUMT00000372864.2	G	NM_018907	-		140186934	+1	no_errors	ENST00000530339	ensembl	human	known	74_37	silent	SNP	1.000	A
MAGEE2	139599	genome.wustl.edu	37	X	75004715	75004715	+	Missense_Mutation	SNP	T	T	G			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chrX:75004715T>G	ENST00000373359.2	-	1	364	c.172A>C	c.(172-174)Act>Cct	p.T58P		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	58										autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GCCTGGGAAGTGTTGACACAC	0.587																																																	0								ENSG00000186675						40.0	36.0	38.0					X																	75004715		2203	4300	6503	MAGEE2	SO:0001583	missense	0			-	HGNC	AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.172A>C	X.37:g.75004715T>G	ENSP00000362457:p.Thr58Pro	Somatic	0	13	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	6	50.00	Q5JSI5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfscan_MAGE	p.T58P	ENST00000373359.2	37	c.172	CCDS14431.1	X	.	.	.	.	.	.	.	.	.	.	T	7.192	0.591740	0.13812	.	.	ENSG00000186675	ENST00000373359	T	0.03920	3.76	2.83	0.969	0.19686	.	.	.	.	.	T	0.02304	0.0071	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47169	-0.9138	9	0.29301	T	0.29	.	3.3221	0.07054	0.0:0.5585:0.2694:0.1721	.	58	Q8TD90	MAGE2_HUMAN	P	58	ENSP00000362457:T58P	ENSP00000362457:T58P	T	-	1	0	MAGEE2	74921440	0.999000	0.42202	0.003000	0.11579	0.005000	0.04900	0.914000	0.28624	0.134000	0.18681	-0.511000	0.04467	ACT	-	NULL		0.587	MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE2	protein_coding	OTTHUMT00000057288.1	T	NM_138703	-		75004715	-1	no_errors	ENST00000373359	ensembl	human	known	74_37	missense	SNP	0.002	G
LILRB5	10990	genome.wustl.edu	37	19	54756818	54756818	+	Frame_Shift_Del	DEL	C	C	-			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr19:54756818delC	ENST00000316219.5	-	9	1494	c.1387delG	c.(1387-1389)gtcfs	p.V463fs	LILRB5_ENST00000345866.6_Frame_Shift_Del_p.V364fs|LILRB5_ENST00000449561.2_Frame_Shift_Del_p.V464fs|CTD-2337J16.1_ENST00000595133.1_lincRNA|LILRB5_ENST00000450632.1_Frame_Shift_Del_p.V455fs	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	463					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GCCACTGAGACCCCAGTCACA	0.587																																																	0								ENSG00000105609						178.0	116.0	137.0					19																	54756818		2203	4300	6503	LILRB5	SO:0001589	frameshift_variant	0				HGNC	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1387delG	19.37:g.54756818delC	ENSP00000320390:p.Val463fs	Somatic	0	18	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	Q8N760	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.V455fs	ENST00000316219.5	37	c.1363	CCDS12885.1	19																																																																																			-	NULL		0.587	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB5	protein_coding	OTTHUMT00000142877.2	C				54756818	-1	no_errors	ENST00000450632	ensembl	human	known	74_37	frame_shift_del	DEL	0.001	-
RB1	5925	genome.wustl.edu	37	13	48955394	48955394	+	Nonsense_Mutation	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr13:48955394C>T	ENST00000267163.4	+	17	1648	c.1510C>T	c.(1510-1512)Cag>Tag	p.Q504*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	504	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)|p.T502fs*22(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AAGTACATCTCAGAATCTTGA	0.284		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	24	Whole gene deletion(15)|Unknown(8)|Complex - frameshift(1)	bone(11)|breast(5)|eye(2)|central_nervous_system(2)|adrenal_gland(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	GRCh37	CM030506	RB1	M		ENSG00000139687						32.0	32.0	32.0					13																	48955394		2201	4299	6500	RB1	SO:0001587	stop_gained	0	Familial Cancer Database		-	HGNC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1510C>T	13.37:g.48955394C>T	ENSP00000267163:p.Gln504*	Somatic	0	35	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	2	90.00	A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.Q504*	ENST00000267163.4	37	c.1510	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	C	38	6.927048	0.97940	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.1	5.1	0.69264	.	0.329098	0.32901	N	0.005510	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	18.4998	0.90877	0.0:1.0:0.0:0.0	.	.	.	.	X	483;504	.	ENSP00000267163:Q504X	Q	+	1	0	RB1	47853395	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.710000	0.61873	2.370000	0.80446	0.650000	0.86243	CAG	-	pfam_RB_A,superfamily_Cyclin-like		0.284	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	C		-		48955394	+1	no_errors	ENST00000267163	ensembl	human	known	74_37	nonsense	SNP	1.000	T
HS3ST5	222537	genome.wustl.edu	37	6	114379226	114379226	+	Missense_Mutation	SNP	T	T	G	rs370563140		TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr6:114379226T>G	ENST00000312719.5	-	5	1424	c.236A>C	c.(235-237)gAg>gCg	p.E79A	HS3ST5_ENST00000411826.1_Missense_Mutation_p.E79A|RP3-399L15.3_ENST00000519104.1_RNA|RP3-399L15.3_ENST00000519270.1_RNA|RP3-399L15.3_ENST00000523087.1_RNA			Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 5	79					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|negative regulation of coagulation (GO:0050819)|protein sulfation (GO:0006477)|regulation of viral entry into host cell (GO:0046596)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(4)|endometrium(2)|kidney(1)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	41		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		GCGAACCTGCTCCTTGGAAGC	0.597																																																	0								ENSG00000249853	T	ALA/GLU	0,4406		0,0,2203	62.0	57.0	59.0		236	5.6	1.0	6		59	1,8599	1.2+/-3.3	0,1,4299	no	missense	HS3ST5	NM_153612.3	107	0,1,6502	GG,GT,TT		0.0116,0.0,0.0077	benign	79/347	114379226	1,13005	2203	4300	6503	HS3ST5	SO:0001583	missense	0			-	HGNC	AF503292	CCDS34517.1	6q21	2011-11-16			ENSG00000249853	ENSG00000249853		"""Sulfotransferases, membrane-bound"""	19419	protein-coding gene	gene with protein product		609407				12138164	Standard	NM_153612		Approved	3-OST-5	uc003pwg.4	Q8IZT8	OTTHUMG00000015412	ENST00000312719.5:c.236A>C	6.37:g.114379226T>G	ENSP00000427888:p.Glu79Ala	Somatic	0	21	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	23	37.84	A8K1J2|Q52LI2|Q8N285	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.E79A	ENST00000312719.5	37	c.236	CCDS34517.1	6	.	.	.	.	.	.	.	.	.	.	T	13.03	2.115604	0.37339	0.0	1.16E-4	ENSG00000249853	ENST00000312719;ENST00000411826	T;T	0.46063	0.88;0.88	5.62	5.62	0.85841	.	0.284356	0.39210	N	0.001425	T	0.19644	0.0472	N	0.25647	0.755	0.53005	D	0.99996	B	0.15141	0.012	B	0.15870	0.014	T	0.03545	-1.1026	10	0.41790	T	0.15	.	16.1189	0.81329	0.0:0.0:0.0:1.0	.	79	Q8IZT8	HS3S5_HUMAN	A	79	ENSP00000427888:E79A;ENSP00000440332:E79A	ENSP00000427888:E79A	E	-	2	0	HS3ST5	114485919	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.008000	0.70739	2.263000	0.75096	0.533000	0.62120	GAG	-	superfamily_P-loop_NTPase		0.597	HS3ST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST5	protein_coding	OTTHUMT00000041911.2	T	NM_153612	-		114379226	-1	no_errors	ENST00000312719	ensembl	human	known	74_37	missense	SNP	1.000	G
WDR18	57418	genome.wustl.edu	37	19	991345	991345	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr19:991345C>T	ENST00000251289.5	+	7	948	c.925C>T	c.(925-927)Ctc>Ttc	p.L309F	WDR18_ENST00000587001.2_Missense_Mutation_p.L309F	NM_024100.3	NP_077005.2	Q9BV38	WDR18_HUMAN	WD repeat domain 18	309					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|lung(2)|skin(2)	7		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACGGTGGCCCTCAAAGGTGG	0.692																																																	0								ENSG00000065268						20.0	17.0	18.0					19																	991345		2126	4194	6320	WDR18	SO:0001583	missense	0			-	HGNC		CCDS12051.1	19p13.3	2013-01-09				ENSG00000065268		"""WD repeat domain containing"""	17956	protein-coding gene	gene with protein product	"""Involved in Processing ITS2 3 homolog (S. cerevisiae)"""					22190735	Standard	NM_024100		Approved	Ipi3	uc002lqm.1	Q9BV38		ENST00000251289.5:c.925C>T	19.37:g.991345C>T	ENSP00000251289:p.Leu309Phe	Somatic	0	26	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	1	88.89	O60390|Q9BWR2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L309F	ENST00000251289.5	37	c.925	CCDS12051.1	19	.	.	.	.	.	.	.	.	.	.	C	11.57	1.677110	0.29783	.	.	ENSG00000065268	ENST00000251289	T	0.18810	2.19	3.83	1.65	0.23941	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.058200	0.64402	D	0.000002	T	0.14227	0.0344	L	0.44542	1.39	0.43021	D	0.994578	P	0.35656	0.514	B	0.32090	0.14	T	0.08146	-1.0736	10	0.33940	T	0.23	.	6.8768	0.24151	0.1745:0.7311:0.0:0.0944	.	309	Q9BV38	WDR18_HUMAN	F	309	ENSP00000251289:L309F	ENSP00000251289:L309F	L	+	1	0	WDR18	942345	1.000000	0.71417	0.547000	0.28179	0.133000	0.20885	5.618000	0.67722	0.289000	0.22422	-0.282000	0.10007	CTC	-	superfamily_WD40_repeat_dom		0.692	WDR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR18	protein_coding	OTTHUMT00000458225.2	C		-		991345	+1	no_errors	ENST00000251289	ensembl	human	known	74_37	missense	SNP	1.000	T
XIST	7503	genome.wustl.edu	37	X	73071846	73071846	+	lincRNA	DEL	A	A	-	rs200290800		TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chrX:73071846delA	ENST00000429829.1	-	0	742					NR_001564.2				X inactive specific transcript (non-protein coding)																		ATGGGCGATGAAAAAAAAAAA	0.413																																																	0								ENSG00000229807						25.0	25.0	25.0					X																	73071846		876	1990	2866	XIST			0				HGNC	M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73071846delA		Somatic	0	78	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	54	11.48		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			-	-		0.413	XIST-001	KNOWN	basic	lincRNA	XIST	lincRNA	OTTHUMT00000057239.1	A	NR_001564			73071846	-1	no_errors	ENST00000429829	ensembl	human	known	74_37	rna	DEL	0.001	-
NHLRC1	378884	genome.wustl.edu	37	6	18121653	18121653	+	Frame_Shift_Del	DEL	C	C	-			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr6:18121653delC	ENST00000340650.3	-	1	1198	c.1185delG	c.(1183-1185)gggfs	p.G395fs		NM_198586.2	NP_940988.2	Q6VVB1	NHLC1_HUMAN	NHL repeat containing E3 ubiquitin protein ligase 1	395					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|positive regulation of protein ubiquitination (GO:0031398)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(2)	11	Ovarian(93;0.016)|Breast(50;0.0245)	all_hematologic(90;0.165)	all cancers(50;0.0451)|Epithelial(50;0.0493)			CAGCCCATCACCCCCAGTCAA	0.458																																																	0								ENSG00000187566			0,4264		0,0,2132	36.0	40.0	39.0			-2.9	0.0	6		39	5,8249		2,1,4124	no	frameshift	NHLRC1	NM_198586.2		2,1,6256	A1A1,A1R,RR		0.0606,0.0,0.0399			18121653	5,12513	2203	4300	6503	NHLRC1	SO:0001589	frameshift_variant	0				HGNC	AY324849	CCDS4542.1	6p22.3	2014-01-28	2013-12-12		ENSG00000187566	ENSG00000187566			21576	protein-coding gene	gene with protein product	"""epilepsy, progressive myoclonus type 2B"""	608072	"""NHL repeat containing 1"""			12958597	Standard	NM_198586		Approved	bA204B7.2, EPM2B, malin	uc003ncl.1	Q6VVB1	OTTHUMG00000014315	ENST00000340650.3:c.1185delG	6.37:g.18121653delC	ENSP00000345464:p.Gly395fs	Somatic	0	55	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	Q3SYB1|Q5VUK7|Q6IMH1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	smart_Znf_RING,pfscan_NHL_repeat_subgr,pfscan_Znf_RING	p.*396fs	ENST00000340650.3	37	c.1185	CCDS4542.1	6																																																																																			-	NULL		0.458	NHLRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHLRC1	protein_coding	OTTHUMT00000039958.1	C				18121653	-1	no_errors	ENST00000340650	ensembl	human	known	74_37	frame_shift_del	DEL	0.009	-
PCDHA4	56144	genome.wustl.edu	37	5	140187742	140187742	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr5:140187742G>C	ENST00000530339.1	+	1	970	c.970G>C	c.(970-972)Gat>Cat	p.D324H	PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.D324H|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.D324H	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	324	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAGGGCATTGATAAGGGACA	0.358																																																	0								ENSG00000204967						115.0	122.0	120.0					5																	140187742		2203	4300	6503	PCDHA4	SO:0001583	missense	0			-	HGNC	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.970G>C	5.37:g.140187742G>C	ENSP00000435300:p.Asp324His	Somatic	0	137	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	31	48.33	O75285|Q2M253	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D324H	ENST00000530339.1	37	c.970	CCDS54916.1	5	.	.	.	.	.	.	.	.	.	.	g	18.66	3.671550	0.67928	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.80824	-1.42;-1.42;-1.42	4.34	4.34	0.51931	Cadherin (4);Cadherin-like (1);	0.000000	0.41823	U	0.000809	D	0.94515	0.8234	H	0.99555	4.625	0.45594	D	0.998539	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97432	1.0016	10	0.87932	D	0	.	17.2044	0.86914	0.0:0.0:1.0:0.0	.	324;324;324	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	H	324	ENSP00000423470:D324H;ENSP00000349344:D324H;ENSP00000435300:D324H	ENSP00000349344:D324H	D	+	1	0	PCDHA4	140167926	1.000000	0.71417	0.681000	0.30009	0.974000	0.67602	9.420000	0.97426	2.137000	0.66172	0.467000	0.42956	GAT	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.358	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	protein_coding	OTTHUMT00000372864.2	G	NM_018907	-		140187742	+1	no_errors	ENST00000530339	ensembl	human	known	74_37	missense	SNP	1.000	C
HS3ST5	222537	genome.wustl.edu	37	6	114379227	114379227	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr6:114379227C>T	ENST00000312719.5	-	5	1423	c.235G>A	c.(235-237)Gag>Aag	p.E79K	HS3ST5_ENST00000411826.1_Missense_Mutation_p.E79K|RP3-399L15.3_ENST00000519104.1_RNA|RP3-399L15.3_ENST00000519270.1_RNA|RP3-399L15.3_ENST00000523087.1_RNA			Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 5	79					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|negative regulation of coagulation (GO:0050819)|protein sulfation (GO:0006477)|regulation of viral entry into host cell (GO:0046596)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(4)|endometrium(2)|kidney(1)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	41		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		CGAACCTGCTCCTTGGAAGCG	0.597																																																	0								ENSG00000249853						62.0	57.0	59.0					6																	114379227		2203	4300	6503	HS3ST5	SO:0001583	missense	0			-	HGNC	AF503292	CCDS34517.1	6q21	2011-11-16			ENSG00000249853	ENSG00000249853		"""Sulfotransferases, membrane-bound"""	19419	protein-coding gene	gene with protein product		609407				12138164	Standard	NM_153612		Approved	3-OST-5	uc003pwg.4	Q8IZT8	OTTHUMG00000015412	ENST00000312719.5:c.235G>A	6.37:g.114379227C>T	ENSP00000427888:p.Glu79Lys	Somatic	0	21	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	21	41.67	A8K1J2|Q52LI2|Q8N285	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.E79K	ENST00000312719.5	37	c.235	CCDS34517.1	6	.	.	.	.	.	.	.	.	.	.	C	13.08	2.129295	0.37630	.	.	ENSG00000249853	ENST00000312719;ENST00000411826	T;T	0.44083	0.93;0.93	5.62	4.76	0.60689	.	0.284356	0.39210	N	0.001425	T	0.23330	0.0564	L	0.46157	1.445	0.49483	D	0.999793	B	0.15141	0.012	B	0.14023	0.01	T	0.06320	-1.0833	10	0.39692	T	0.17	.	15.1642	0.72807	0.0:0.9321:0.0:0.0679	.	79	Q8IZT8	HS3S5_HUMAN	K	79	ENSP00000427888:E79K;ENSP00000440332:E79K	ENSP00000427888:E79K	E	-	1	0	HS3ST5	114485920	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.529000	0.67135	1.525000	0.49052	-0.123000	0.14984	GAG	-	superfamily_P-loop_NTPase		0.597	HS3ST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST5	protein_coding	OTTHUMT00000041911.2	C	NM_153612	-		114379227	-1	no_errors	ENST00000312719	ensembl	human	known	74_37	missense	SNP	1.000	T
WIPF1	7456	genome.wustl.edu	37	2	175439998	175439998	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr2:175439998G>A	ENST00000392547.2	-	4	391	c.292C>T	c.(292-294)Cca>Tca	p.P98S	AC018890.6_ENST00000412835.1_RNA|WIPF1_ENST00000359761.3_Missense_Mutation_p.P98S|WIPF1_ENST00000272746.5_Missense_Mutation_p.P98S|WIPF1_ENST00000410117.1_Missense_Mutation_p.P98S|AC018890.6_ENST00000442996.1_RNA|WIPF1_ENST00000392546.2_Missense_Mutation_p.P98S|AC010894.5_ENST00000454203.1_RNA|WIPF1_ENST00000409891.1_Missense_Mutation_p.P98S|WIPF1_ENST00000409415.3_Missense_Mutation_p.P98S	NM_003387.4	NP_003378.3	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	98					actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)|response to other organism (GO:0051707)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	actin binding (GO:0003779)|profilin binding (GO:0005522)			NS(1)|breast(1)|endometrium(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)	32						CCCAGACCTGGAGGTccgccc	0.607																																																	0								ENSG00000115935						99.0	101.0	100.0					2																	175439998		2203	4300	6503	WIPF1	SO:0001583	missense	0			-	HGNC	AF031588	CCDS2260.1	2q31.2	2014-09-17	2006-10-12	2006-10-12	ENSG00000115935	ENSG00000115935			12736	protein-coding gene	gene with protein product		602357	"""Wiskott-Aldrich syndrome protein interacting protein"""	WASPIP		9405671	Standard	NM_001077269		Approved	WIP	uc002uiz.3	O43516	OTTHUMG00000132334	ENST00000392547.2:c.292C>T	2.37:g.175439998G>A	ENSP00000376330:p.Pro98Ser	Somatic	0	55	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	20	48.72	B8ZZM1|D3DPE4|Q15220|Q53TA9|Q6MZU9|Q9BU37|Q9UNP1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_WH2_dom,pfscan_WH2_dom	p.P98S	ENST00000392547.2	37	c.292	CCDS2260.1	2	.	.	.	.	.	.	.	.	.	.	G	21.9	4.210467	0.79240	.	.	ENSG00000115935	ENST00000392547;ENST00000392548;ENST00000272746;ENST00000359761;ENST00000392546;ENST00000409891;ENST00000409415;ENST00000455428;ENST00000410117;ENST00000436221	T;T;T;T;T;T;T;T	0.80653	-1.4;-1.4;-1.4;-1.4;-1.4;-1.4;2.43;1.62	5.28	5.28	0.74379	.	0.197329	0.44097	D	0.000483	D	0.88749	0.6521	M	0.73962	2.25	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;0.985	D;D;D;P	0.87578	0.998;0.996;0.998;0.842	D	0.85280	0.1061	10	0.15066	T	0.55	.	18.9334	0.92576	0.0:0.0:1.0:0.0	.	98;98;98;98	O43516-3;E9PB87;O43516-2;O43516	.;.;.;WIPF1_HUMAN	S	98;98;98;98;98;98;98;95;98;98	ENSP00000376330:P98S;ENSP00000272746:P98S;ENSP00000352802:P98S;ENSP00000376329:P98S;ENSP00000386431:P98S;ENSP00000387150:P98S;ENSP00000391785:P95S;ENSP00000386757:P98S	ENSP00000272746:P98S	P	-	1	0	WIPF1	175148244	1.000000	0.71417	0.253000	0.24343	0.950000	0.60333	5.024000	0.64090	2.464000	0.83262	0.462000	0.41574	CCA	-	NULL		0.607	WIPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WIPF1	protein_coding	OTTHUMT00000255453.1	G	NM_003387	-		175439998	-1	no_errors	ENST00000272746	ensembl	human	known	74_37	missense	SNP	0.994	A
SLCO1C1	53919	genome.wustl.edu	37	12	20905320	20905320	+	Missense_Mutation	SNP	A	A	C			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr12:20905320A>C	ENST00000266509.2	+	15	2365	c.1997A>C	c.(1996-1998)aAa>aCa	p.K666T	SLCO1C1_ENST00000381552.1_Missense_Mutation_p.E700D|SLCO1C1_ENST00000545102.1_Missense_Mutation_p.E582D|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.E700D|SLCO1C1_ENST00000540354.1_Missense_Mutation_p.K617T	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	666					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	ATTTTAAAGAAAAATTATGTT	0.338																																																	0								ENSG00000139155						51.0	52.0	51.0					12																	20905320		2203	4300	6503	SLCO1C1	SO:0001583	missense	0			-	HGNC	AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.1997A>C	12.37:g.20905320A>C	ENSP00000266509:p.Lys666Thr	Somatic	0	80	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	29	47.27	B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.E700D	ENST00000266509.2	37	c.2100	CCDS8683.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.81|15.81	2.944499|2.944499	0.53079|0.53079	.|.	.|.	ENSG00000139155|ENSG00000139155	ENST00000545604;ENST00000381552;ENST00000545102|ENST00000540354;ENST00000266509	T;T;T|T;T	0.39056|0.60171	1.1;1.1;1.17|0.21;0.21	5.37|5.37	4.22|4.22	0.49857|0.49857	.|Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	2.767390|.	0.01272|.	N|.	0.009483|.	T|T	0.47619|0.47619	0.1455|0.1455	N|N	0.08118|0.08118	0|0	0.23174|0.23174	N|N	0.998176|0.998176	P;P|P;B	0.43094|0.52692	0.799;0.698|0.955;0.451	P;B|P;B	0.44921|0.57620	0.464;0.275|0.824;0.41	T|T	0.26985|0.26985	-1.0087|-1.0087	10|9	0.21540|0.42905	T|T	0.41|0.14	.|.	5.3101|5.3101	0.15825|0.15825	0.8398:0.0:0.1602:0.0|0.8398:0.0:0.1602:0.0	.|.	582;700|617;666	F5GZD6;Q5JPA4|B7Z3Q3;Q9NYB5	.;.|.;SO1C1_HUMAN	D|T	700;700;582|617;666	ENSP00000444149:E700D;ENSP00000370964:E700D;ENSP00000444527:E582D|ENSP00000438665:K617T;ENSP00000266509:K666T	ENSP00000370964:E700D|ENSP00000266509:K666T	E|K	+|+	3|2	2|0	SLCO1C1|SLCO1C1	20796587|20796587	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	2.352000|2.352000	0.44080|0.44080	2.257000|2.257000	0.74773|0.74773	0.533000|0.533000	0.62120|0.62120	GAA|AAA	-	NULL		0.338	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1C1	protein_coding	OTTHUMT00000401765.1	A	NM_017435	-		20905320	+1	no_errors	ENST00000381552	ensembl	human	known	74_37	missense	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7577540	7577540	+	Silent	SNP	G	G	A	rs397516437		TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr17:7577540G>A	ENST00000269305.4	-	7	930	c.741C>T	c.(739-741)aaC>aaT	p.N247N	TP53_ENST00000420246.2_Silent_p.N247N|TP53_ENST00000445888.2_Silent_p.N247N|TP53_ENST00000359597.4_Silent_p.N247N|TP53_ENST00000413465.2_Silent_p.N247N|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Silent_p.N247N	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	247	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		N -> D (in sporadic cancers; somatic mutation).|N -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|N -> I (in sporadic cancers; somatic mutation).|N -> K (in sporadic cancers; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> T (in sporadic cancers; somatic mutation).|N -> Y (in sporadic cancers; somatic mutation).|NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(16)|p.N247N(10)|p.0?(8)|p.?(5)|p.N247K(2)|p.N247_R248delNR(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.N247I(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGGCCTCCGGTTCATGCCGC	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	52	Substitution - Missense(19)|Substitution - coding silent(10)|Whole gene deletion(8)|Deletion - In frame(6)|Unknown(5)|Complex - compound substitution(3)|Deletion - Frameshift(1)	skin(10)|upper_aerodigestive_tract(5)|biliary_tract(5)|lung(4)|breast(4)|bone(4)|stomach(3)|haematopoietic_and_lymphoid_tissue(3)|urinary_tract(2)|central_nervous_system(2)|oesophagus(2)|ovary(2)|peritoneum(1)|soft_tissue(1)|liver(1)|large_intestine(1)|penis(1)|pancreas(1)						ENSG00000141510						152.0	113.0	126.0					17																	7577540		2203	4300	6503	TP53	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.741C>T	17.37:g.7577540G>A		Somatic	0	44	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	7	66.67	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.N247	ENST00000269305.4	37	c.741	CCDS11118.1	17																																																																																			-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546	-		7577540	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	silent	SNP	1.000	A
RP1	6101	genome.wustl.edu	37	8	55540104	55540104	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr8:55540104C>T	ENST00000220676.1	+	4	3810	c.3662C>T	c.(3661-3663)cCt>cTt	p.P1221L		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1221					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CAGAGTGTTCCTAAGTGCAGT	0.448																																					Colon(91;1014 1389 7634 14542 40420)												0								ENSG00000104237						125.0	122.0	123.0					8																	55540104		2203	4300	6503	RP1	SO:0001583	missense	0			-	HGNC	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.3662C>T	8.37:g.55540104C>T	ENSP00000220676:p.Pro1221Leu	Somatic	0	16	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	16	33.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.P1221L	ENST00000220676.1	37	c.3662	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	C	7.143	0.582300	0.13749	.	.	ENSG00000104237	ENST00000220676	T	0.23147	1.92	5.38	3.46	0.39613	.	0.788628	0.11347	N	0.573417	T	0.18759	0.0450	L	0.29908	0.895	0.09310	N	1	B	0.30068	0.267	B	0.28139	0.086	T	0.19063	-1.0317	10	0.87932	D	0	.	7.4285	0.27113	0.3027:0.6172:0.0:0.0801	.	1221	P56715	RP1_HUMAN	L	1221	ENSP00000220676:P1221L	ENSP00000220676:P1221L	P	+	2	0	RP1	55702657	0.000000	0.05858	0.003000	0.11579	0.055000	0.15305	0.001000	0.13038	1.206000	0.43276	0.655000	0.94253	CCT	-	NULL		0.448	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	protein_coding	OTTHUMT00000378532.2	C	NM_006269	-		55540104	+1	no_errors	ENST00000220676	ensembl	human	known	74_37	missense	SNP	0.001	T
RP11-725P16.2	0	genome.wustl.edu	37	2	133103903	133103903	+	lincRNA	SNP	C	C	T	rs6430238	byFrequency	TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr2:133103903C>T	ENST00000608279.1	-	0	967																											ATTCACCGTCCTCCCTGAGTC	0.363																																																	0								ENSG00000272769																																			RP11-725P16.2			0			-	Clone_based_vega_gene																													2.37:g.133103903C>T		Somatic	0	18	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	16	42.86		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000608279.1	37	NULL		2																																																																																			-	-		0.363	RP11-725P16.2-001	KNOWN	basic	lincRNA	ENSG00000272769	lincRNA	OTTHUMT00000472122.1	C		rs6430238		133103903	-1	no_errors	ENST00000608279	ensembl	human	known	74_37	rna	SNP	0.006	T
TFRC	7037	genome.wustl.edu	37	3	195785483	195785483	+	Silent	SNP	C	C	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr3:195785483C>A	ENST00000360110.4	-	15	1726	c.1557G>T	c.(1555-1557)ggG>ggT	p.G519G	TFRC_ENST00000540528.1_3'UTR|TFRC_ENST00000535031.1_Silent_p.G237G|TFRC_ENST00000420415.1_Silent_p.G438G|TFRC_ENST00000392396.3_Silent_p.G519G|TFRC_ENST00000465288.1_5'UTR	NM_001128148.1	NP_001121620.1	P02786	TFR1_HUMAN	transferrin receptor	519					cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|osteoclast differentiation (GO:0030316)|positive regulation of bone resorption (GO:0045780)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transferrin receptor activity (GO:0004998)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)	Gallium nitrate(DB05260)	ATAGAAATTGCCCAGTAACCG	0.348			T	BCL6	NHL																																			Dom	yes		3	3q29	7037	"""transferrin receptor (p90, CD71)"""		L	0								ENSG00000072274						132.0	130.0	131.0					3																	195785483		2203	4300	6503	TFRC	SO:0001819	synonymous_variant	0			-	HGNC	X01060	CCDS3312.1	3q29	2013-09-19	2013-09-19		ENSG00000072274	ENSG00000072274		"""CD molecules"""	11763	protein-coding gene	gene with protein product		190010	"""transferrin receptor (p90, CD71)"""				Standard	NM_003234		Approved	CD71, TFR1, p90	uc003fwa.4	P02786	OTTHUMG00000155714	ENST00000360110.4:c.1557G>T	3.37:g.195785483C>A		Somatic	0	83	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	53	39.08	D3DXB0|Q1HE24|Q59G55|Q9UCN0|Q9UCU5|Q9UDF9|Q9UK21	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.G519	ENST00000360110.4	37	c.1557	CCDS3312.1	3																																																																																			-	pfam_Peptidase_M28		0.348	TFRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFRC	protein_coding	OTTHUMT00000341346.1	C		-		195785483	-1	no_errors	ENST00000360110	ensembl	human	known	74_37	silent	SNP	0.000	A
TMEM60	85025	genome.wustl.edu	37	7	77423460	77423460	+	Frame_Shift_Del	DEL	T	T	-			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr7:77423460delT	ENST00000257663.3	-	2	607	c.231delA	c.(229-231)aaafs	p.K77fs		NM_032936.3	NP_116325.1	Q9H2L4	TMM60_HUMAN	transmembrane protein 60	77						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(2)	4						GGTACCAGGCTTTTTTTTTAA	0.408																																																	0								ENSG00000135211						142.0	141.0	141.0					7																	77423460		2203	4300	6503	TMEM60	SO:0001589	frameshift_variant	0				HGNC	AF260336	CCDS5593.1	7q11.23	2005-07-25	2005-07-25	2005-07-25	ENSG00000135211	ENSG00000135211			21754	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 35"""	C7orf35			Standard	NM_032936		Approved	DC32	uc003ugn.3	Q9H2L4	OTTHUMG00000130689	ENST00000257663.3:c.231delA	7.37:g.77423460delT	ENSP00000257663:p.Lys77fs	Somatic	0	74	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	A4D1C3|Q86UM0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_TM_Fragile-X-F-assoc	p.A78fs	ENST00000257663.3	37	c.231	CCDS5593.1	7																																																																																			-	NULL		0.408	TMEM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM60	protein_coding	OTTHUMT00000253185.2	T	NM_032936			77423460	-1	no_errors	ENST00000257663	ensembl	human	known	74_37	frame_shift_del	DEL	0.998	-
KPNA6	23633	genome.wustl.edu	37	1	32625019	32625019	+	Silent	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr1:32625019C>T	ENST00000373625.3	+	6	538	c.445C>T	c.(445-447)Cta>Tta	p.L149L	KPNA6_ENST00000545542.1_Silent_p.L154L|KPNA6_ENST00000469790.1_3'UTR|KPNA6_ENST00000537234.1_Silent_p.L146L	NM_012316.4	NP_036448.1	O60684	IMA7_HUMAN	karyopherin alpha 6 (importin alpha 7)	149	NLS binding site (major). {ECO:0000250}.				maternal process involved in female pregnancy (GO:0060135)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			large_intestine(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				TGCCTGGGCTCTAACGAATAT	0.453																																																	0								ENSG00000025800						136.0	132.0	134.0					1																	32625019		2203	4300	6503	KPNA6	SO:0001819	synonymous_variant	0			-	HGNC	AF060543	CCDS352.1	1p35.1	2013-02-14			ENSG00000025800	ENSG00000025800		"""Importins"", ""Armadillo repeat containing"""	6399	protein-coding gene	gene with protein product		610563				10523667	Standard	NM_012316		Approved	IPOA7, KPNA7, MGC17918, FLJ11249	uc001bug.3	O60684	OTTHUMG00000004333	ENST00000373625.3:c.445C>T	1.37:g.32625019C>T		Somatic	0	41	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	37	27.45	B2RDC7|D3DPP5|Q5VVU3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.L154	ENST00000373625.3	37	c.460	CCDS352.1	1																																																																																			-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo		0.453	KPNA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KPNA6	protein_coding	OTTHUMT00000012527.4	C	NM_012316	-		32625019	+1	no_errors	ENST00000545542	ensembl	human	known	74_37	silent	SNP	1.000	T
RP11-815J4.6	0	genome.wustl.edu	37	18	12076541	12076542	+	RNA	INS	-	-	CGCCGCCGCCGC	rs553400288	byFrequency	TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr18:12076541_12076542insCGCCGCCGCCGC	ENST00000591780.1	-	0	53_54																											CAGTGCCGCGGcgccgccgccg	0.797																																																	0								ENSG00000256616																																			RP11-815J4.6			0				Clone_based_vega_gene																													18.37:g.12076541_12076542insCGCCGCCGCCGC		Somatic	NA	NA	NA		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000591780.1	37	NULL		18																																																																																			-	-		0.797	RP11-815J4.6-002	KNOWN	basic	processed_transcript	ENSG00000256616	pseudogene	OTTHUMT00000452539.1	-				12076542	-1	no_errors	ENST00000591780	ensembl	human	known	74_37	rna	INS	0.834:0.844	CGCCGCCGCCGC
JAKMIP1	152789	genome.wustl.edu	37	4	6066655	6066655	+	Silent	SNP	T	T	C			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr4:6066655T>C	ENST00000282924.5	-	9	1868	c.1383A>G	c.(1381-1383)acA>acG	p.T461T	JAKMIP1_ENST00000409021.3_Silent_p.T461T|JAKMIP1_ENST00000409371.3_Silent_p.T276T|JAKMIP1_ENST00000410077.2_Silent_p.T296T|JAKMIP1_ENST00000409831.1_Silent_p.T461T|JAKMIP1_ENST00000457227.2_5'UTR	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	461	Mediates interaction with TYK2 and GABBR1.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CTGTCCTGTCTGTGTTGTAGG	0.512																																																	0								ENSG00000152969						191.0	160.0	171.0					4																	6066655		2203	4300	6503	JAKMIP1	SO:0001819	synonymous_variant	0			-	HGNC	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.1383A>G	4.37:g.6066655T>C		Somatic	0	91	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	48	34.25	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T461	ENST00000282924.5	37	c.1383	CCDS3385.1	4																																																																																			-	NULL		0.512	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAKMIP1	protein_coding	OTTHUMT00000246816.2	T	NM_144720	-		6066655	-1	no_errors	ENST00000409021	ensembl	human	known	74_37	silent	SNP	0.107	C
TCEA2	6919	genome.wustl.edu	37	20	62699436	62699436	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr20:62699436G>A	ENST00000343484.5	+	4	447	c.278G>A	c.(277-279)gGc>gAc	p.G93D	TCEA2_ENST00000465111.1_3'UTR|TCEA2_ENST00000395053.3_Missense_Mutation_p.G93D|TCEA2_ENST00000361317.2_Missense_Mutation_p.G66D	NM_003195.4	NP_003186.1	Q15560	TCEA2_HUMAN	transcription elongation factor A (SII), 2	93					DNA-templated transcription, elongation (GO:0006354)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)	centrosome (GO:0005813)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)	12	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)					CGGGGGAGGGGCATGCCTCTG	0.642																																																	0								ENSG00000171703						47.0	43.0	44.0					20																	62699436		2203	4300	6503	TCEA2	SO:0001583	missense	0			-	HGNC	U86749	CCDS13553.1, CCDS13554.1	20q13.33	2011-01-25			ENSG00000171703	ENSG00000171703			11614	protein-coding gene	gene with protein product		604784				9441762, 8566795	Standard	NM_003195		Approved	TFIIS	uc021wgq.1	Q15560	OTTHUMG00000033026	ENST00000343484.5:c.278G>A	20.37:g.62699436G>A	ENSP00000343515:p.Gly93Asp	Somatic	0	47	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	14	39.13	B3KNM1|Q8TD37|Q8TD38	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TFIIS_cen_dom,pfam_TFIIS_N,pfam_Znf_TFIIS,superfamily_TFIIS_cen_dom,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,smart_TFS2M,smart_Znf_TFIIS,pirsf_TF_IIS-rel,pfscan_Znf_TFIIS,tigrfam_TFSII	p.G93D	ENST00000343484.5	37	c.278	CCDS13553.1	20	.	.	.	.	.	.	.	.	.	.	G	8.749	0.920891	0.17982	.	.	ENSG00000171703	ENST00000361317;ENST00000343484;ENST00000395053;ENST00000339217;ENST00000415602;ENST00000440819;ENST00000458442	.	.	.	2.92	0.904	0.19302	Transcription factor IIS, N-terminal (1);	0.631054	0.16276	N	0.221570	T	0.14527	0.0351	N	0.12182	0.205	0.29042	N	0.885064	B;B;B;B	0.13145	0.0;0.0;0.0;0.007	B;B;B;B	0.11329	0.001;0.001;0.001;0.006	T	0.21690	-1.0238	9	0.12103	T	0.63	-11.7768	2.8808	0.05646	0.3223:0.2394:0.4383:0.0	.	93;93;66;93	Q15560;Q6IB64;B3KNM1;Q86VL0	TCEA2_HUMAN;.;.;.	D	66;93;93;66;66;66;66	.	ENSP00000339432:G66D	G	+	2	0	TCEA2	62169880	0.000000	0.05858	0.896000	0.35187	0.698000	0.40448	-0.103000	0.10940	0.286000	0.22352	0.561000	0.74099	GGC	-	superfamily_TFIIS_N,pirsf_TF_IIS-rel,tigrfam_TFSII		0.642	TCEA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEA2	protein_coding	OTTHUMT00000080277.2	G	NM_198723	-		62699436	+1	no_errors	ENST00000343484	ensembl	human	known	74_37	missense	SNP	0.625	A
CENPE	1062	genome.wustl.edu	37	4	104084678	104084678	+	Silent	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr4:104084678C>T	ENST00000265148.3	-	17	1769	c.1680G>A	c.(1678-1680)aaG>aaA	p.K560K	CENPE_ENST00000380026.3_Intron	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	560					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TAACTAAATTCTTTAAGTTCG	0.299																																																	0								ENSG00000138778						64.0	60.0	62.0					4																	104084678		2202	4291	6493	CENPE	SO:0001819	synonymous_variant	0			-	HGNC	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.1680G>A	4.37:g.104084678C>T		Somatic	0	43	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	42	23.64	A6NKY9|A8K2U7|Q4LE75	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.K560	ENST00000265148.3	37	c.1680	CCDS34042.1	4																																																																																			-	NULL		0.299	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	protein_coding		C		-		104084678	-1	no_errors	ENST00000265148	ensembl	human	known	74_37	silent	SNP	1.000	T
LTBP2	4053	genome.wustl.edu	37	14	74995277	74995277	+	Silent	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr14:74995277C>T	ENST00000261978.4	-	12	2663	c.2277G>A	c.(2275-2277)agG>agA	p.R759R	LTBP2_ENST00000556690.1_Silent_p.R759R	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	759					protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		CCCCGCTGCTCCTCTGCCCTT	0.677																																																	0								ENSG00000119681						43.0	45.0	44.0					14																	74995277		2203	4300	6503	LTBP2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.2277G>A	14.37:g.74995277C>T		Somatic	0	47	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	20	55.56	Q99907|Q9NS51	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.R759	ENST00000261978.4	37	c.2277	CCDS9831.1	14																																																																																			-	NULL		0.677	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP2	protein_coding	OTTHUMT00000413595.1	C	NM_000428	-		74995277	-1	no_errors	ENST00000261978	ensembl	human	known	74_37	silent	SNP	0.995	T
KIAA2018	205717	genome.wustl.edu	37	3	113377481	113377482	+	Frame_Shift_Ins	INS	-	-	T	rs78597857		TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr3:113377481_113377482insT	ENST00000478658.1	-	5	3064_3065	c.3047_3048insA	c.(3046-3048)aacfs	p.N1016fs	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Frame_Shift_Ins_p.N1016fs			Q68DE3	K2018_HUMAN	KIAA2018	1016						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.N1016fs*8(1)|p.N1016fs*9(1)|p.N1016fs*23(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						ATTTCTGAGGGTTTTTTTTTTT	0.366																																																	3	Deletion - Frameshift(2)|Insertion - Frameshift(1)	ovary(3)						ENSG00000176542																																			KIAA2018	SO:0001589	frameshift_variant	0				HGNC	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3048dupA	3.37:g.113377492_113377492dupT	ENSP00000420721:p.Asn1016fs	Somatic	0	21	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	33	15.38	Q7Z3L9|Q8IVF3|Q9H8T4	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.N1016fs	ENST00000478658.1	37	c.3048_3047	CCDS43133.1	3																																																																																			-	NULL		0.366	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	protein_coding	OTTHUMT00000354591.1	-	NM_001009899			113377482	-1	no_errors	ENST00000316407	ensembl	human	known	74_37	frame_shift_ins	INS	0.174:0.827	T
PALMD	54873	genome.wustl.edu	37	1	100154947	100154947	+	Silent	SNP	G	G	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr1:100154947G>A	ENST00000263174.4	+	7	1506	c.1131G>A	c.(1129-1131)ggG>ggA	p.G377G	PALMD_ENST00000605497.1_Silent_p.G377G	NM_017734.4	NP_060204.1	Q9NP74	PALMD_HUMAN	palmdelphin	377					regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(6)|pancreas(1)|prostate(2)	31		all_epithelial(167;0.000813)|all_lung(203;0.0214)|Lung NSC(277;0.0216)		Epithelial(280;0.067)|all cancers(265;0.117)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)		CAATATTTGGGAAATCTGAAC	0.448																																																	0								ENSG00000099260						51.0	46.0	48.0					1																	100154947		2203	4300	6503	PALMD	SO:0001819	synonymous_variant	0			-	HGNC	AJ312214	CCDS758.1	1p22-p21	2008-07-18			ENSG00000099260	ENSG00000099260			15846	protein-coding gene	gene with protein product		610182		C1orf11		11478809	Standard	NM_017734		Approved	FLJ20271, PALML	uc001dsg.3	Q9NP74	OTTHUMG00000010764	ENST00000263174.4:c.1131G>A	1.37:g.100154947G>A		Somatic	0	22	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	26	36.59	Q9H7E6|Q9NPM5|Q9NPM6|Q9NPS0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Paralemmin	p.G377	ENST00000263174.4	37	c.1131	CCDS758.1	1																																																																																			-	NULL		0.448	PALMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALMD	protein_coding	OTTHUMT00000029672.1	G	NM_017734	-		100154947	+1	no_errors	ENST00000263174	ensembl	human	known	74_37	silent	SNP	0.074	A
COTL1	23406	genome.wustl.edu	37	16	84651171	84651171	+	Silent	SNP	G	G	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr16:84651171G>A	ENST00000262428.4	-	2	258	c.96C>T	c.(94-96)gaC>gaT	p.D32D	COTL1_ENST00000564057.1_Intron	NM_021149.2	NP_066972.1	Q14019	COTL1_HUMAN	coactosin-like F-actin binding protein 1	32	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				defense response to fungus (GO:0050832)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	actin binding (GO:0003779)|enzyme binding (GO:0019899)			endometrium(1)|large_intestine(1)|liver(1)|lung(2)|skin(1)	6						TGGTGGAGCCGTCATATTTAA	0.612																																																	0								ENSG00000103187						20.0	21.0	21.0					16																	84651171		2182	4264	6446	COTL1	SO:0001819	synonymous_variant	0			-	HGNC	L54057	CCDS10947.1	16q24.1	2014-03-05	2014-03-05	2002-08-01	ENSG00000103187	ENSG00000103187			18304	protein-coding gene	gene with protein product		606748	"""coactosin-like 1 (Dictyostelium)"""			10051563, 9326934, 16924104	Standard	NM_021149		Approved	CLP	uc002fid.3	Q14019	OTTHUMG00000137634	ENST00000262428.4:c.96C>T	16.37:g.84651171G>A		Somatic	0	100	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	B2RDU3|D3DUL9|Q86XM5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	p.D32	ENST00000262428.4	37	c.96	CCDS10947.1	16																																																																																			-	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin		0.612	COTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COTL1	protein_coding	OTTHUMT00000269075.1	G	NM_021149	-		84651171	-1	no_errors	ENST00000262428	ensembl	human	known	74_37	silent	SNP	1.000	A
RSPO1	284654	genome.wustl.edu	37	1	38082190	38082190	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr1:38082190G>T	ENST00000401069.1	-	4	964	c.252C>A	c.(250-252)ttC>ttA	p.F84L	RSPO1_ENST00000356545.2_Missense_Mutation_p.F84L|RSPO1_ENST00000401071.2_Missense_Mutation_p.F84L|RSPO1_ENST00000401070.1_Missense_Mutation_p.F84L|RSPO1_ENST00000373059.1_Missense_Mutation_p.F57L|RSPO1_ENST00000401068.1_Missense_Mutation_p.F84L	NM_001242908.1	NP_001229837.1	Q2MKA7	RSPO1_HUMAN	R-spondin 1	84					canonical Wnt signaling pathway (GO:0060070)|male meiosis (GO:0007140)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of gene expression (GO:0010468)|regulation of male germ cell proliferation (GO:2000254)|regulation of receptor internalization (GO:0002090)	extracellular space (GO:0005615)|nucleus (GO:0005634)	G-protein coupled receptor binding (GO:0001664)|heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.F84F(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TGCGGGCGTCGAAGTATCCAG	0.617																																					GBM(122;680 2230 27822 42821)												1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000169218						54.0	58.0	56.0					1																	38082190		2024	4173	6197	RSPO1	SO:0001583	missense	0			-	HGNC	AK098225	CCDS41304.1, CCDS55590.1, CCDS55591.1	1p34.2	2014-01-30	2011-06-29		ENSG00000169218	ENSG00000169218		"""Endogenous ligands"""	21679	protein-coding gene	gene with protein product		609595	"""R-spondin homolog (Xenopus laevis)"""				Standard	NM_001038633		Approved	FLJ40906, RSPONDIN	uc001cbm.2	Q2MKA7	OTTHUMG00000004321	ENST00000401069.1:c.252C>A	1.37:g.38082190G>T	ENSP00000383847:p.Phe84Leu	Somatic	0	25	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	18	21.74	A2A420|Q0H8S6|Q14C72|Q5T0F2|Q8N7L5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Thrombospondin_1_rpt,smart_Furin_repeat,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.F84L	ENST00000401069.1	37	c.252	CCDS41304.1	1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.550368	0.65311	.	.	ENSG00000169218	ENST00000373059;ENST00000401070;ENST00000356545;ENST00000401071;ENST00000401069;ENST00000401068	T;T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07;-1.07	5.79	-3.98	0.04082	Growth factor, receptor (1);	0.168023	0.53938	D	0.000051	T	0.77778	0.4181	M	0.79123	2.44	0.54753	D	0.999988	P;D;P	0.53312	0.893;0.959;0.883	B;P;B	0.46299	0.406;0.511;0.313	T	0.81387	-0.0956	10	0.72032	D	0.01	.	15.5038	0.75722	0.5999:0.0:0.4001:0.0	.	84;57;84	Q0H8S6;Q2MKA7-2;Q2MKA7	.;.;RSPO1_HUMAN	L	57;84;84;84;84;84	ENSP00000362150:F57L;ENSP00000383848:F84L;ENSP00000348944:F84L;ENSP00000383849:F84L;ENSP00000383847:F84L;ENSP00000383846:F84L	ENSP00000348944:F84L	F	-	3	2	RSPO1	37854777	0.802000	0.28943	0.970000	0.41538	0.990000	0.78478	-0.001000	0.12947	-0.611000	0.05709	0.555000	0.69702	TTC	-	superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat		0.617	RSPO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPO1	protein_coding	OTTHUMT00000012477.2	G	NM_173640	-		38082190	-1	no_errors	ENST00000356545	ensembl	human	known	74_37	missense	SNP	0.928	T
MALAT1	378938	genome.wustl.edu	37	11	65273756	65273766	+	lincRNA	DEL	TGAACTATATA	TGAACTATATA	-	rs370223485	byFrequency	TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	TGAACTATATA	TGAACTATATA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr11:65273756_65273766delTGAACTATATA	ENST00000534336.1	+	0	8524_8534					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		ACAATATCTTTGAACTATATACATCCTTGAT	0.374																																																	0								ENSG00000251562																																			MALAT1			0				HGNC	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65273756_65273766delTGAACTATATA		Somatic	NA	NA	NA		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			-	-		0.374	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	lincRNA	OTTHUMT00000389143.1	TGAACTATATA	NR_002819			65273766	+1	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.001:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-
GTSF1	121355	genome.wustl.edu	37	12	54856510	54856510	+	Splice_Site	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr12:54856510C>T	ENST00000552397.1	-	5	1141		c.e5-1		GTSF1_ENST00000552395.1_Splice_Site|GTSF1_ENST00000305879.5_Splice_Site|RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA			Q8WW33	GTSF1_HUMAN	gametocyte specific factor 1							cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		Myeloproliferative disorder(1001;0.00452)				GTTTGGTTGACTGCAAGACAA	0.478																																																	0								ENSG00000170627						93.0	93.0	93.0					12																	54856510		2203	4300	6503	GTSF1	SO:0001630	splice_region_variant	0			-	HGNC	AK098819	CCDS8881.1	12q13.2	2008-02-04	2007-11-27	2007-11-27		ENSG00000170627			26565	protein-coding gene	gene with protein product			"""family with sequence similarity 112, member B"""	FAM112B		12477932	Standard	NM_144594		Approved	FLJ32942	uc001sgb.3	Q8WW33		ENST00000552397.1:c.245-1G>A	12.37:g.54856510C>T		Somatic	0	50	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B3KQ60|Q0VGM4|Q8N778	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e4-1	ENST00000552397.1	37	c.245-1	CCDS8881.1	12	.	.	.	.	.	.	.	.	.	.	C	11.05	1.523601	0.27299	.	.	ENSG00000170627	ENST00000552397;ENST00000305879	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3801	0.74648	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GTSF1	53142777	1.000000	0.71417	0.999000	0.59377	0.331000	0.28603	4.627000	0.61276	2.703000	0.92315	0.655000	0.94253	.	-	-		0.478	GTSF1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GTSF1	protein_coding	OTTHUMT00000406187.1	C	NM_144594	-	Intron	54856510	-1	no_errors	ENST00000546931	ensembl	human	known	74_37	splice_site	SNP	1.000	T
EPS15L1	58513	genome.wustl.edu	37	19	16539564	16539564	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr19:16539564G>C	ENST00000248070.6	-	8	646	c.507C>G	c.(505-507)gaC>gaG	p.D169E	EPS15L1_ENST00000602009.1_Missense_Mutation_p.D15E|EPS15L1_ENST00000535753.2_Missense_Mutation_p.D169E|EPS15L1_ENST00000594975.1_Missense_Mutation_p.D169E|EPS15L1_ENST00000597937.1_Missense_Mutation_p.D169E|EPS15L1_ENST00000455140.2_Missense_Mutation_p.D169E	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	169	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.|EH 2. {ECO:0000255|PROSITE- ProRule:PRU00077}.|Interaction with DAB2. {ECO:0000250}.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						TGTCACTGAGGTCCCAGACCT	0.572																																																	0								ENSG00000127527						116.0	69.0	85.0					19																	16539564		2203	4300	6503	EPS15L1	SO:0001583	missense	0			-	HGNC	AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.507C>G	19.37:g.16539564G>C	ENSP00000248070:p.Asp169Glu	Somatic	0	54	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	20	41.18	A2RRF3|A5PL29|B4DKA3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin,smart_EPS15_homology,smart_EF_hand_dom,smart_Ubiquitin-int_motif,pfscan_EF_hand_dom,pfscan_EPS15_homology,pfscan_Ubiquitin-int_motif	p.D169E	ENST00000248070.6	37	c.507	CCDS32944.1	19	.	.	.	.	.	.	.	.	.	.	g	2.710	-0.269076	0.05716	.	.	ENSG00000127527	ENST00000455140;ENST00000248070;ENST00000535753	T;T;T	0.28255	1.62;1.62;1.62	4.87	1.06	0.20224	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.056264	0.64402	D	0.000002	T	0.17619	0.0423	N	0.26130	0.795	0.41986	D	0.99082	P;B;B;B;B;B	0.35944	0.529;0.017;0.039;0.325;0.175;0.033	B;B;B;B;B;B	0.42851	0.4;0.075;0.058;0.366;0.162;0.036	T	0.19549	-1.0302	10	0.05351	T	0.99	.	4.6985	0.12815	0.3574:0.165:0.4776:0.0	.	169;169;168;169;169;169	A8K5P4;A5PL29;A5PKY0;A2RRF3;Q9UBC2;G3V0H2	.;.;.;.;EP15R_HUMAN;.	E	169	ENSP00000393313:D169E;ENSP00000248070:D169E;ENSP00000440103:D169E	ENSP00000248070:D169E	D	-	3	2	EPS15L1	16400564	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	1.312000	0.33574	0.488000	0.27723	-0.273000	0.10243	GAC	-	smart_EPS15_homology,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_EPS15_homology		0.572	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	EPS15L1	protein_coding	OTTHUMT00000461040.1	G	NM_021235	-		16539564	-1	no_errors	ENST00000455140	ensembl	human	known	74_37	missense	SNP	0.999	C
PARP4	143	genome.wustl.edu	37	13	25021323	25021323	+	Splice_Site	SNP	A	A	G	rs73172125		TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr13:25021323A>G	ENST00000381989.3	-	26	3221	c.3116T>C	c.(3115-3117)aTa>aCa	p.I1039T		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1039	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.I1039T(2)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		TTGGTCTTCTATCTATTTATA	0.408																																																	2	Substitution - Missense(2)	prostate(1)|stomach(1)						ENSG00000102699						40.0	41.0	41.0					13																	25021323		2203	4300	6503	PARP4	SO:0001630	splice_region_variant	0			-	HGNC	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.3115-1T>C	13.37:g.25021323A>G		Somatic	0	27	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	23	23.33	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_VIT,pfam_VWF_A,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_VIT,smart_VWF_A,pfscan_BRCT_dom,pfscan_VWF_A,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.I1039T	ENST00000381989.3	37	c.3116	CCDS9307.1	13	.	.	.	.	.	.	.	.	.	.	A	17.08	3.297585	0.60086	.	.	ENSG00000102699	ENST00000381989	T	0.23147	1.92	4.69	4.69	0.59074	von Willebrand factor, type A (2);	0.215738	0.48767	D	0.000175	T	0.42177	0.1191	M	0.79475	2.455	0.40246	D	0.978015	P	0.45348	0.856	P	0.51055	0.657	T	0.48222	-0.9054	10	0.72032	D	0.01	-21.476	12.4624	0.55738	1.0:0.0:0.0:0.0	.	1039	Q9UKK3	PARP4_HUMAN	T	1039	ENSP00000371419:I1039T	ENSP00000371419:I1039T	I	-	2	0	PARP4	23919323	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	4.226000	0.58606	2.105000	0.64084	0.514000	0.50259	ATA	-	pfam_VWF_A,pfscan_VWF_A		0.408	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP4	protein_coding	OTTHUMT00000044189.1	A	NM_006437	rs73172125	Missense_Mutation	25021323	-1	no_errors	ENST00000381989	ensembl	human	known	74_37	missense	SNP	1.000	G
LRP12	29967	genome.wustl.edu	37	8	105510059	105510059	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr8:105510059C>T	ENST00000276654.5	-	5	829	c.721G>A	c.(721-723)Ggg>Agg	p.G241R	LRP12_ENST00000518375.1_5'Flank|LRP12_ENST00000424843.2_Missense_Mutation_p.G222R	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	241	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TCAATGTTCCCATCACATTTT	0.413																																																	0								ENSG00000147650						99.0	97.0	97.0					8																	105510059		2203	4300	6503	LRP12	SO:0001583	missense	0			-	HGNC	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.721G>A	8.37:g.105510059C>T	ENSP00000276654:p.Gly241Arg	Somatic	0	31	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	19	48.65	A8K137|B4DRQ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	p.G222R	ENST00000276654.5	37	c.664	CCDS6303.1	8	.	.	.	.	.	.	.	.	.	.	C	24.6	4.549420	0.86127	.	.	ENSG00000147650	ENST00000424843;ENST00000276654	D;D	0.96802	-4.13;-4.13	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.97882	0.9304	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98402	1.0568	10	0.72032	D	0.01	-18.9229	19.7554	0.96287	0.0:1.0:0.0:0.0	.	222;241	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	R	222;241	ENSP00000399148:G222R;ENSP00000276654:G241R	ENSP00000276654:G241R	G	-	1	0	LRP12	105579235	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	5.727000	0.68523	2.665000	0.90641	0.563000	0.77884	GGG	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt		0.413	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	protein_coding	OTTHUMT00000380821.1	C	NM_013437	-		105510059	-1	no_errors	ENST00000424843	ensembl	human	known	74_37	missense	SNP	1.000	T
EFCAB6	64800	genome.wustl.edu	37	22	43972249	43972249	+	Frame_Shift_Del	DEL	T	T	-	rs573721779		TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr22:43972249delT	ENST00000262726.7	-	26	3601	c.3348delA	c.(3346-3348)aaafs	p.K1116fs	EFCAB6_ENST00000396231.2_Frame_Shift_Del_p.K964fs	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	1116					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				GAATTCTTAGTTTCCTCAAAA	0.353																																																	0								ENSG00000186976						56.0	61.0	59.0					22																	43972249		2203	4297	6500	EFCAB6	SO:0001589	frameshift_variant	0				HGNC	Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.3348delA	22.37:g.43972249delT	ENSP00000262726:p.Lys1116fs	Somatic	0	66	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	59	29.76	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_EF_hand_Ca-bd_contain_6,smart_EF_hand_dom,pfscan_EF_hand_dom	p.K1116fs	ENST00000262726.7	37	c.3348	CCDS14049.1	22																																																																																			-	NULL		0.353	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB6	protein_coding	OTTHUMT00000353176.1	T	NM_022785			43972249	-1	no_errors	ENST00000262726	ensembl	human	known	74_37	frame_shift_del	DEL	0.144	-
FFAR3	2865	genome.wustl.edu	37	19	35850190	35850190	+	Missense_Mutation	SNP	G	G	A	rs62109582	byFrequency	TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr19:35850190G>A	ENST00000327809.4	+	2	599	c.398G>A	c.(397-399)gGt>gAt	p.G133D	FFAR3_ENST00000594310.1_Missense_Mutation_p.G133D	NM_005304.3	NP_005295.1	O14843	FFAR3_HUMAN	free fatty acid receptor 3	133					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to fatty acid (GO:0071398)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|mucosal immune response (GO:0002385)|negative regulation of blood pressure (GO:0045776)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|regulation of hormone biosynthetic process (GO:0046885)|regulation of norepinephrine secretion (GO:0014061)|regulation of peptide hormone secretion (GO:0090276)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|stomach(1)	17	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			GGGCAGGCAGGTCTGGTGAGT	0.607																																					Esophageal Squamous(185;1742 2042 21963 24215 27871)												0								ENSG00000185897						9.0	9.0	9.0					19																	35850190		2160	4196	6356	FFAR3	SO:0001583	missense	0			-	HGNC	AF024688	CCDS12459.1	19q13.1	2012-08-08	2006-02-15	2006-02-15	ENSG00000185897	ENSG00000185897		"""GPCR / Class A : Fatty acid receptors"""	4499	protein-coding gene	gene with protein product		603821	"""G protein-coupled receptor 41"""	GPR41		9344866, 22493486	Standard	NM_005304		Approved	FFA3R	uc002nzd.3	O14843	OTTHUMG00000172514	ENST00000327809.4:c.398G>A	19.37:g.35850190G>A	ENSP00000328230:p.Gly133Asp	Somatic	0	16	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	9	40.00	B2RWM8|Q14CM7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_GPR40-rel_orph	p.G133D	ENST00000327809.4	37	c.398	CCDS12459.1	19	.	.	.	.	.	.	.	.	.	.	G	13.08	2.130641	0.37630	.	.	ENSG00000185897	ENST00000327809	T	0.37752	1.18	5.52	-4.09	0.03951	GPCR, rhodopsin-like superfamily (1);	0.544005	0.18613	U	0.136083	T	0.27489	0.0675	L	0.44542	1.39	0.09310	N	1	P	0.45078	0.85	P	0.44772	0.46	T	0.31392	-0.9945	10	0.36615	T	0.2	-0.257	9.0121	0.36148	0.0:0.2225:0.2439:0.5336	.	133	O14843	FFAR3_HUMAN	D	133	ENSP00000328230:G133D	ENSP00000328230:G133D	G	+	2	0	FFAR3	40542030	0.000000	0.05858	0.000000	0.03702	0.156000	0.22039	0.278000	0.18753	-0.058000	0.13177	0.455000	0.32223	GGT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.607	FFAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FFAR3	protein_coding	OTTHUMT00000418873.2	G	NM_005304	rs144435503		35850190	+1	no_errors	ENST00000327809	ensembl	human	known	74_37	missense	SNP	0.000	A
LRTM2	654429	genome.wustl.edu	37	12	1943471	1943471	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr12:1943471G>A	ENST00000543818.1	+	5	1539	c.697G>A	c.(697-699)Gag>Aag	p.E233K	CACNA2D4_ENST00000588077.1_Intron|LRTM2_ENST00000535041.1_Missense_Mutation_p.E233K|CACNA2D4_ENST00000587995.1_Intron|LRTM2_ENST00000543730.1_3'UTR|CACNA2D4_ENST00000585732.1_Intron|CACNA2D4_ENST00000382722.5_Intron|CACNA2D4_ENST00000586184.1_Intron|LRTM2_ENST00000299194.1_Missense_Mutation_p.E233K|CACNA2D4_ENST00000585708.1_Intron	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2	233	LRRCT.					integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	20	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			CCTGCCCAAGGAGCTGAGGGG	0.582																																																	0								ENSG00000166159						56.0	51.0	52.0					12																	1943471		2203	4300	6503	LRTM2	SO:0001583	missense	0			-	HGNC	AK095610	CCDS31726.1	12p13.33	2008-02-05				ENSG00000166159			32443	protein-coding gene	gene with protein product							Standard	NM_001039029		Approved		uc010sdx.1	Q8N967		ENST00000543818.1:c.697G>A	12.37:g.1943471G>A	ENSP00000446278:p.Glu233Lys	Somatic	0	60	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	24	44.19	A7E2U6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.E233K	ENST00000543818.1	37	c.697	CCDS31726.1	12	.	.	.	.	.	.	.	.	.	.	G	17.07	3.295373	0.60086	.	.	ENSG00000166159	ENST00000543818;ENST00000299194;ENST00000535041	T;T;T	0.52754	0.65;0.65;0.65	5.35	5.35	0.76521	Cysteine-rich flanking region, C-terminal (1);	0.050047	0.85682	D	0.000000	T	0.38268	0.1034	L	0.28344	0.845	0.80722	D	1	B	0.33512	0.415	B	0.34301	0.179	T	0.13335	-1.0513	10	0.19147	T	0.46	.	19.0625	0.93099	0.0:0.0:1.0:0.0	.	233	Q8N967	LRTM2_HUMAN	K	233	ENSP00000446278:E233K;ENSP00000299194:E233K;ENSP00000444737:E233K	ENSP00000299194:E233K	E	+	1	0	LRTM2	1813732	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.497000	0.84241	0.563000	0.77884	GAG	-	smart_Cys-rich_flank_reg_C		0.582	LRTM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM2	protein_coding	OTTHUMT00000398055.1	G		-		1943471	+1	no_errors	ENST00000299194	ensembl	human	known	74_37	missense	SNP	1.000	A
ALAS2	212	genome.wustl.edu	37	X	55044015	55044015	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chrX:55044015T>C	ENST00000330807.5	-	7	1044	c.907A>G	c.(907-909)Agg>Ggg	p.R303G	ALAS2_ENST00000396198.3_Missense_Mutation_p.R290G|ALAS2_ENST00000335854.4_Missense_Mutation_p.R266G|ALAS2_ENST00000498636.1_5'UTR	NM_000032.4	NP_000023.2	P22557	HEM0_HUMAN	aminolevulinate, delta-, synthase 2	303					cellular iron ion homeostasis (GO:0006879)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|hemoglobin biosynthetic process (GO:0042541)|oxygen homeostasis (GO:0032364)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5-aminolevulinate synthase activity (GO:0003870)|coenzyme binding (GO:0050662)|glycine binding (GO:0016594)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)	17					Glycine(DB00145)	TCATTGTGCCTGAAGACAAAC	0.473																																																	0								ENSG00000158578						224.0	180.0	195.0					X																	55044015		2203	4300	6503	ALAS2	SO:0001583	missense	0			-	HGNC		CCDS14366.1, CCDS35303.1, CCDS43960.1	Xp11.21	2008-02-05	2008-02-04		ENSG00000158578	ENSG00000158578	2.3.1.37		397	protein-coding gene	gene with protein product	"""sideroblastic/hypochromic anemia"""	301300	"""aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia)"""	ASB		1577484	Standard	NM_000032		Approved		uc004dua.4	P22557	OTTHUMG00000021641	ENST00000330807.5:c.907A>G	X.37:g.55044015T>C	ENSP00000332369:p.Arg303Gly	Somatic	0	38	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A8K3F0|A8K6C4|Q13735|Q5JZF5|Q8N6H3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aminotransferase_I/II,pfam_5aminolev_synth_preseq,pfam_Aminotrans_V/Cys_dSase,pfam_Cys/Met-Metab_PyrdxlP-dep_enz,superfamily_PyrdxlP-dep_Trfase,tigrfam_4pyrrol_synth_NH2levulA_synth	p.R303G	ENST00000330807.5	37	c.907	CCDS14366.1	X	.	.	.	.	.	.	.	.	.	.	T	17.17	3.321418	0.60634	.	.	ENSG00000158578	ENST00000330807;ENST00000396198;ENST00000335854	D;D;D	0.95137	-3.62;-3.62;-3.62	5.24	2.89	0.33648	Aminotransferase, class I/classII (1);Tetrapyrrole biosynthesis, 5-aminolevulinic acid synthase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.046258	0.85682	D	0.000000	D	0.94387	0.8195	M	0.91354	3.2	0.58432	D	0.999998	B;B;B	0.30021	0.052;0.265;0.087	B;B;B	0.25291	0.018;0.059;0.018	D	0.92935	0.6367	10	0.87932	D	0	-20.9564	11.3118	0.49368	0.0:0.0:0.6348:0.3651	.	266;290;303	A8K6C4;Q5JZF5;P22557	.;.;HEM0_HUMAN	G	303;290;266	ENSP00000332369:R303G;ENSP00000379501:R290G;ENSP00000337131:R266G	ENSP00000332369:R303G	R	-	1	2	ALAS2	55060740	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.235000	0.65348	0.766000	0.33244	0.417000	0.27973	AGG	-	pfam_Aminotransferase_I/II,pfam_Aminotrans_V/Cys_dSase,pfam_Cys/Met-Metab_PyrdxlP-dep_enz,superfamily_PyrdxlP-dep_Trfase,tigrfam_4pyrrol_synth_NH2levulA_synth		0.473	ALAS2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	ALAS2	protein_coding	OTTHUMT00000056843.3	T	NM_000032	-		55044015	-1	no_errors	ENST00000330807	ensembl	human	known	74_37	missense	SNP	1.000	C
TTK	7272	genome.wustl.edu	37	6	80751896	80751897	+	Frame_Shift_Ins	INS	-	-	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr6:80751896_80751897insA	ENST00000369798.2	+	22	2662_2663	c.2551_2552insA	c.(2551-2553)gaafs	p.E851fs	TTK_ENST00000230510.3_Frame_Shift_Ins_p.E850fs|TTK_ENST00000509894.1_Frame_Shift_Ins_p.E850fs	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	851					chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.R838fs*4(3)|p.R838fs*>4(2)|p.R838fs*>5(1)		endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		CAAGACTTTTGAAAAAAAAAGG	0.302																																																	6	Deletion - Frameshift(5)|Insertion - Frameshift(1)	stomach(2)|ovary(2)|lung(1)|large_intestine(1)						ENSG00000112742																																			TTK	SO:0001589	frameshift_variant	0				HGNC		CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.2560dupA	6.37:g.80751905_80751905dupA	ENSP00000358813:p.Glu851fs	Somatic	0	34	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	57	8.06	A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R854fs	ENST00000369798.2	37	c.2551_2552	CCDS4993.1	6																																																																																			-	NULL		0.302	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTK	protein_coding	OTTHUMT00000041316.2	-				80751897	+1	no_errors	ENST00000369798	ensembl	human	known	74_37	frame_shift_ins	INS	0.178:0.102	A
DIS3L2	129563	genome.wustl.edu	37	2	233127950	233127950	+	Missense_Mutation	SNP	C	C	T	rs376340398		TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr2:233127950C>T	ENST00000409307.1	+	12	1459	c.1459C>T	c.(1459-1461)Cgc>Tgc	p.R487C	DIS3L2_ENST00000273009.6_Missense_Mutation_p.R487C|DIS3L2_ENST00000325385.7_Missense_Mutation_p.R487C					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		GACCATCATCCGCTCCTGCAC	0.478																																																	0								ENSG00000144535	C	CYS/ARG	0,3904		0,0,1952	64.0	66.0	65.0		1459	0.0	1.0	2		65	1,8315		0,1,4157	no	missense	DIS3L2	NM_152383.4	180	0,1,6109	TT,TC,CC		0.012,0.0,0.0082	possibly-damaging	487/886	233127950	1,12219	1952	4158	6110	DIS3L2	SO:0001583	missense	0			-	HGNC	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.1459C>T	2.37:g.233127950C>T	ENSP00000386799:p.Arg487Cys	Somatic	0	34	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	24	41.46		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R487C	ENST00000409307.1	37	c.1459	CCDS42834.1	2	.	.	.	.	.	.	.	.	.	.	C	10.37	1.331605	0.24167	0.0	1.2E-4	ENSG00000144535	ENST00000273009;ENST00000542873;ENST00000325385;ENST00000431466;ENST00000409307;ENST00000424049	T;T;T;T	0.39229	1.09;1.09;1.09;1.09	5.04	0.0283	0.14158	Ribonuclease II/R (2);	0.501057	0.25045	N	0.033564	T	0.37571	0.1008	L	0.50847	1.595	0.80722	D	1	B	0.31153	0.31	B	0.36418	0.224	T	0.23332	-1.0191	10	0.44086	T	0.13	-0.2189	11.7101	0.51620	0.0:0.5891:0.0:0.4109	.	487	Q8IYB7	DI3L2_HUMAN	C	487;487;487;487;487;122	ENSP00000273009:R487C;ENSP00000315569:R487C;ENSP00000386799:R487C;ENSP00000415419:R122C	ENSP00000273009:R487C	R	+	1	0	DIS3L2	232836194	0.889000	0.30405	0.972000	0.41901	0.656000	0.38851	0.076000	0.14712	0.009000	0.14813	-1.929000	0.00512	CGC	-	NULL		0.478	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	DIS3L2	protein_coding	OTTHUMT00000330988.1	C	NM_152383	-		233127950	+1	no_errors	ENST00000325385	ensembl	human	known	74_37	missense	SNP	0.946	T
VSTM4	196740	genome.wustl.edu	37	10	50285292	50285292	+	Silent	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr10:50285292C>T	ENST00000332853.4	-	4	629	c.606G>A	c.(604-606)caG>caA	p.Q202Q		NM_001031746.3	NP_001026916.2	Q8IW00	VSTM4_HUMAN	V-set and transmembrane domain containing 4	202						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|skin(2)	31						TAAACACAGACTGCCAGACGA	0.522																																																	0								ENSG00000165633						137.0	108.0	118.0					10																	50285292		2203	4300	6503	VSTM4	SO:0001819	synonymous_variant	0			-	HGNC	BC041414	CCDS7228.1, CCDS31198.1	10q11.23	2013-01-11	2011-07-01	2011-07-01	ENSG00000165633	ENSG00000165633		"""Immunoglobulin superfamily / V-set domain containing"""	26470	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 72"""	C10orf72			Standard	XR_246075		Approved	FLJ31737	uc001jhf.2	Q8IW00	OTTHUMG00000018184	ENST00000332853.4:c.606G>A	10.37:g.50285292C>T		Somatic	0	26	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.00	B4DNI6|Q96MX7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.Q202	ENST00000332853.4	37	c.606	CCDS31198.1	10																																																																																			-	NULL		0.522	VSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSTM4	protein_coding	OTTHUMT00000047966.2	C	NM_144984	-		50285292	-1	no_errors	ENST00000332853	ensembl	human	known	74_37	silent	SNP	1.000	T
CNTNAP5	129684	genome.wustl.edu	37	2	124999804	124999804	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr2:124999804C>A	ENST00000431078.1	+	3	579	c.215C>A	c.(214-216)tCc>tAc	p.S72Y		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	72	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CCAGCAGATTCCAATGCTCAA	0.493																																																	0								ENSG00000155052						45.0	47.0	46.0					2																	124999804		1976	4156	6132	CNTNAP5	SO:0001583	missense	0			-	HGNC	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.215C>A	2.37:g.124999804C>A	ENSP00000399013:p.Ser72Tyr	Somatic	0	31	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	28	52.54	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.S72Y	ENST00000431078.1	37	c.215	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	C	31	5.083084	0.94050	.	.	ENSG00000155052	ENST00000431078	D	0.97598	-4.45	5.71	5.71	0.89125	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.50627	D	0.000108	D	0.98661	0.9551	M	0.87269	2.87	0.58432	D	0.999997	D	0.76494	0.999	D	0.87578	0.998	D	0.99577	1.0972	10	0.87932	D	0	.	18.8368	0.92165	0.0:1.0:0.0:0.0	.	72	Q8WYK1	CNTP5_HUMAN	Y	72	ENSP00000399013:S72Y	ENSP00000399013:S72Y	S	+	2	0	CNTNAP5	124716274	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.660000	0.83776	2.696000	0.92011	0.650000	0.86243	TCC	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom		0.493	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	protein_coding	OTTHUMT00000330864.3	C		-		124999804	+1	no_errors	ENST00000431078	ensembl	human	known	74_37	missense	SNP	1.000	A
PRPF40B	25766	genome.wustl.edu	37	12	50036074	50036074	+	Silent	SNP	G	G	A	rs148666758		TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr12:50036074G>A	ENST00000380281.1	+	19	1939	c.1875G>A	c.(1873-1875)agG>agA	p.R625R	FMNL3_ENST00000335154.5_3'UTR|PRPF40B_ENST00000548825.2_Silent_p.R647R|PRPF40B_ENST00000261897.1_Silent_p.R612R			Q6NWY9	PR40B_HUMAN	PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)	625	FF 6.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34						AGGCACGCAGGATGCGGCGCA	0.642																																																	0								ENSG00000110844	G	,,,	3,4403	6.2+/-15.9	0,3,2200	104.0	95.0	98.0		1875,1836,,	2.7	1.0	12	dbSNP_134	98	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,utr-3,utr-3	PRPF40B,FMNL3	NM_001031698.1,NM_012272.1,NM_175736.4,NM_198900.2	,,,	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	,,,	625/872,612/859,,	50036074	3,13003	2203	4300	6503	PRPF40B	SO:0001819	synonymous_variant	0			-	HGNC	AF049525	CCDS31796.1, CCDS31796.2	12q13.12	2014-09-17	2006-04-04			ENSG00000110844			25031	protein-coding gene	gene with protein product	"""Huntingtin interacting protein C"""		"""PRP40 pre-mRNA processing factor 40 homolog B (yeast)"""			9700202	Standard	NM_001031698		Approved	HYPC	uc001rus.2	Q6NWY9		ENST00000380281.1:c.1875G>A	12.37:g.50036074G>A		Somatic	0	9	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	9	30.77	O75401|Q6PI09|Q6ZWB3|Q8NCZ1|Q9H5G4|Q9NT95	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_FF_domain,pfam_WW_dom,superfamily_FF_domain,superfamily_WW_dom,smart_WW_dom,smart_FF_domain,pfscan_WW_dom	p.R647	ENST00000380281.1	37	c.1941		12																																																																																			-	NULL		0.642	PRPF40B-001	KNOWN	basic	protein_coding	PRPF40B	protein_coding	OTTHUMT00000404838.1	G	NM_012272	rs148666758		50036074	+1	no_errors	ENST00000548825	ensembl	human	known	74_37	silent	SNP	1.000	A
ACSF2	80221	genome.wustl.edu	37	17	48551285	48551285	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr17:48551285G>A	ENST00000300441.4	+	14	1752	c.1648G>A	c.(1648-1650)Gaa>Aaa	p.E550K	ACSF2_ENST00000506085.1_3'UTR|ACSF2_ENST00000504392.1_Missense_Mutation_p.E507K|ACSF2_ENST00000427954.2_Missense_Mutation_p.E575K|ACSF2_ENST00000502667.1_Missense_Mutation_p.E537K|ACSF2_ENST00000541920.1_Missense_Mutation_p.E390K	NM_025149.4	NP_079425.3	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2	550					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ligase activity (GO:0016874)			endometrium(7)|kidney(3)|large_intestine(1)|lung(1)|stomach(1)	13	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			TCGGATGGGGGAAGAGATTTG	0.542																																																	0								ENSG00000167107						83.0	79.0	80.0					17																	48551285		2203	4300	6503	ACSF2	SO:0001583	missense	0			-	HGNC	AK024573, BC012053	CCDS11567.1, CCDS74103.1, CCDS74104.1, CCDS74105.1	17q21.33	2007-10-17			ENSG00000167107	ENSG00000167107		"""Acyl-CoA synthetase family"""	26101	protein-coding gene	gene with protein product		610465				17762044	Standard	NM_001288968		Approved	FLJ20920, ACSMW	uc002iqu.2	Q96CM8	OTTHUMG00000162128	ENST00000300441.4:c.1648G>A	17.37:g.48551285G>A	ENSP00000300441:p.Glu550Lys	Somatic	0	51	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B4DFQ6|B4DHT5|B4DUF5|Q9H7G2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig	p.E550K	ENST00000300441.4	37	c.1648	CCDS11567.1	17	.	.	.	.	.	.	.	.	.	.	G	32	5.123931	0.94429	.	.	ENSG00000167107	ENST00000300441;ENST00000541920;ENST00000504392;ENST00000427954;ENST00000502667	T;T;T;T;T	0.55413	0.52;0.52;0.52;0.52;0.52	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	D	0.83450	0.5257	H	0.97983	4.12	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.999	D	0.90260	0.4300	10	0.87932	D	0	-28.6065	18.3413	0.90307	0.0:0.0:1.0:0.0	.	537;575;507;550	B4DHT5;B4DFQ6;E9PF16;Q96CM8	.;.;.;ACSF2_HUMAN	K	550;390;507;575;537	ENSP00000300441:E550K;ENSP00000437987:E390K;ENSP00000425964:E507K;ENSP00000401831:E575K;ENSP00000421884:E537K	ENSP00000300441:E550K	E	+	1	0	ACSF2	45906284	1.000000	0.71417	1.000000	0.80357	0.684000	0.39900	9.457000	0.97630	2.332000	0.79248	0.561000	0.74099	GAA	-	NULL		0.542	ACSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSF2	protein_coding	OTTHUMT00000367423.3	G	NM_025149	-		48551285	+1	no_errors	ENST00000300441	ensembl	human	known	74_37	missense	SNP	1.000	A
MALAT1	378938	genome.wustl.edu	37	11	65273750	65273777	+	lincRNA	DEL	TATCTTTGAACTATATACATCCTTGATG	TATCTTTGAACTATATACATCCTTGATG	-	rs370223485|rs543735217	byFrequency	TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	TATCTTTGAACTATATACATCCTTGATG	TATCTTTGAACTATATACATCCTTGATG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr11:65273750_65273777delTATCTTTGAACTATATACATCCTTGATG	ENST00000534336.1	+	0	8518_8545					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		AACAGCACAATATCTTTGAACTATATACATCCTTGATGTATAATTTGT	0.386																																																	0								ENSG00000251562																																			MALAT1			0				HGNC	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65273750_65273777delTATCTTTGAACTATATACATCCTTGATG		Somatic	NA	NA	NA		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			-	-		0.386	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	lincRNA	OTTHUMT00000389143.1	TATCTTTGAACTATATACATCCTTGATG	NR_002819			65273777	+1	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	DEL	0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-
PRPF40B	25766	genome.wustl.edu	37	12	50036073	50036073	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr12:50036073G>A	ENST00000380281.1	+	19	1938	c.1874G>A	c.(1873-1875)aGg>aAg	p.R625K	FMNL3_ENST00000335154.5_3'UTR|PRPF40B_ENST00000548825.2_Missense_Mutation_p.R647K|PRPF40B_ENST00000261897.1_Missense_Mutation_p.R612K			Q6NWY9	PR40B_HUMAN	PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)	625	FF 6.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34						GAGGCACGCAGGATGCGGCGC	0.637																																																	0								ENSG00000110844						104.0	95.0	98.0					12																	50036073		2203	4300	6503	PRPF40B	SO:0001583	missense	0			-	HGNC	AF049525	CCDS31796.1, CCDS31796.2	12q13.12	2014-09-17	2006-04-04			ENSG00000110844			25031	protein-coding gene	gene with protein product	"""Huntingtin interacting protein C"""		"""PRP40 pre-mRNA processing factor 40 homolog B (yeast)"""			9700202	Standard	NM_001031698		Approved	HYPC	uc001rus.2	Q6NWY9		ENST00000380281.1:c.1874G>A	12.37:g.50036073G>A	ENSP00000369634:p.Arg625Lys	Somatic	0	9	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	9	30.77	O75401|Q6PI09|Q6ZWB3|Q8NCZ1|Q9H5G4|Q9NT95	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FF_domain,pfam_WW_dom,superfamily_FF_domain,superfamily_WW_dom,smart_WW_dom,smart_FF_domain,pfscan_WW_dom	p.R647K	ENST00000380281.1	37	c.1940		12	.	.	.	.	.	.	.	.	.	.	G	7.416	0.635807	0.14386	.	.	ENSG00000110844	ENST00000261897;ENST00000380281	T;T	0.20463	2.07;2.08	4.35	4.35	0.52113	FF domain (1);	0.239881	0.26359	N	0.024836	T	0.04452	0.0122	N	0.00483	-1.445	0.80722	D	1	B;B;B	0.22276	0.04;0.067;0.067	B;B;B	0.24155	0.023;0.051;0.051	T	0.36672	-0.9738	10	0.02654	T	1	-18.0568	6.7373	0.23417	0.1945:0.0:0.8055:0.0	.	625;612;625	Q6NWY9;Q6NWY9-2;Q6NWY9-3	PR40B_HUMAN;.;.	K	612;625	ENSP00000261897:R612K;ENSP00000369634:R625K	ENSP00000261897:R612K	R	+	2	0	PRPF40B	48322340	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	5.558000	0.67319	2.438000	0.82558	0.655000	0.94253	AGG	-	NULL		0.637	PRPF40B-001	KNOWN	basic	protein_coding	PRPF40B	protein_coding	OTTHUMT00000404838.1	G	NM_012272	-		50036073	+1	no_errors	ENST00000548825	ensembl	human	known	74_37	missense	SNP	1.000	A
TAF7L	54457	genome.wustl.edu	37	X	100531459	100531461	+	In_Frame_Del	DEL	TCA	TCA	-			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	TCA	TCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chrX:100531459_100531461delTCA	ENST00000372907.3	-	10	1016_1018	c.1005_1007delTGA	c.(1003-1008)gatgag>gag	p.D335del	TAF7L_ENST00000356784.1_In_Frame_Del_p.D249del|TAF7L_ENST00000372905.2_Intron|TAF7L_ENST00000324762.6_Intron	NM_024885.3	NP_079161.3	Q5H9L4	TAF7L_HUMAN	TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa	335					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIID complex (GO:0005669)				NS(1)|breast(4)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						atcctcatcctcatcatcatcat	0.394																																					Ovarian(104;431 1530 3210 15406 18594)												0								ENSG00000102387		,	0,3721		0,0,0,1592,537					,	-5.6	0.0			200	7,6477		0,4,3,2353,1767	no	coding,coding	TAF7L	NM_024885.3,NM_001168474.1	,	0,4,3,3945,2304	A1A1,A1R,A1,RR,R		0.108,0.0,0.0686	,	,		7,10198				TAF7L	SO:0001651	inframe_deletion	0				HGNC	AF285595	CCDS35347.1, CCDS55466.1	Xq22.1	2009-03-25	2002-08-29	2001-12-07	ENSG00000102387	ENSG00000102387			11548	protein-coding gene	gene with protein product	"""cancer/testis antigen 40"""	300314	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, Q"""	TAF2Q		11279525	Standard	NM_024885		Approved	CT40	uc004ehb.3	Q5H9L4	OTTHUMG00000022021	ENST00000372907.3:c.1005_1007delTGA	X.37:g.100531468_100531470delTCA	ENSP00000361998:p.Asp335del	Somatic	0	14	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	22	8.33	Q5H9L6|Q86XI4|Q9BXU5|Q9H5R0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_TAFII55_prot_cons_reg	p.D335in_frame_del	ENST00000372907.3	37	c.1007_1005	CCDS35347.1	X																																																																																			-	NULL		0.394	TAF7L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TAF7L	protein_coding	OTTHUMT00000057526.2	TCA				100531461	-1	no_errors	ENST00000372907	ensembl	human	known	74_37	in_frame_del	DEL	0.009:0.005:0.000	-
KIAA1551	55196	genome.wustl.edu	37	12	32134974	32134974	+	Missense_Mutation	SNP	A	A	C			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr12:32134974A>C	ENST00000312561.4	+	4	1499	c.1085A>C	c.(1084-1086)cAg>cCg	p.Q362P	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	362																	GATGGTGTTCAGACTCTTGCT	0.363																																																	0								ENSG00000174718						75.0	77.0	76.0					12																	32134974		2203	4300	6503	KIAA1551	SO:0001583	missense	0			-	HGNC	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.1085A>C	12.37:g.32134974A>C	ENSP00000310338:p.Gln362Pro	Somatic	0	51	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	44	33.33	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q362P	ENST00000312561.4	37	c.1085	CCDS8725.2	12	.	.	.	.	.	.	.	.	.	.	A	14.73	2.623571	0.46840	.	.	ENSG00000174718	ENST00000312561;ENST00000381054	T;T	0.08546	3.71;3.08	4.93	-0.463	0.12164	.	0.811426	0.10879	N	0.623979	T	0.05547	0.0146	L	0.36672	1.1	0.09310	N	1	B	0.06786	0.001	B	0.14023	0.01	T	0.42899	-0.9424	9	.	.	.	.	2.4012	0.04401	0.4798:0.2932:0.0849:0.1421	.	362	Q9HCM1	CL035_HUMAN	P	362	ENSP00000310338:Q362P;ENSP00000370442:Q362P	.	Q	+	2	0	C12orf35	32026241	0.028000	0.19301	0.281000	0.24762	0.013000	0.08279	0.675000	0.25232	0.319000	0.23209	0.454000	0.30748	CAG	-	NULL		0.363	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1551	protein_coding	OTTHUMT00000250307.2	A	NM_018169	-		32134974	+1	no_errors	ENST00000312561	ensembl	human	known	74_37	missense	SNP	0.000	C
Unknown	0	genome.wustl.edu	37	22	49834816	49834816	+	IGR	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr22:49834816C>T								C22orf34 (15730 upstream) : MIR3667 (102224 downstream)																							gacgttgtctCTGTAAGGCTT	0.587																																																	0								ENSG00000188511																																			C22orf34	SO:0001628	intergenic_variant	0			-	HGNC																													22.37:g.49834816C>T		Somatic	0	47	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	18	45.45		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R34K		37	c.101		22																																																																																			-	NULL	0	0.587					C22orf34			C		-		49834816	-1	no_errors	ENST00000414287	ensembl	human	known	74_37	missense	SNP	0.000	T
MALAT1	378938	genome.wustl.edu	37	11	65273769	65273785	+	lincRNA	DEL	TCCTTGATGTATAATTT	TCCTTGATGTATAATTT	-	rs369197447		TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	TCCTTGATGTATAATTT	TCCTTGATGTATAATTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr11:65273769_65273785delTCCTTGATGTATAATTT	ENST00000534336.1	+	0	8537_8553					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		ACTATATACATCCTTGATGTATAATTTGTCAGGAGCT	0.387																																																	0								ENSG00000251562																																			MALAT1			0				HGNC	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65273769_65273785delTCCTTGATGTATAATTT		Somatic	NA	NA	NA		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			-	-		0.387	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	lincRNA	OTTHUMT00000389143.1	TCCTTGATGTATAATTT	NR_002819			65273785	+1	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	DEL	0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001	-
HRNR	388697	genome.wustl.edu	37	1	152192912	152192912	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr1:152192912G>A	ENST00000368801.2	-	3	1268	c.1193C>T	c.(1192-1194)tCc>tTc	p.S398F	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	398					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACCATAGCTGGAAGACTGACG	0.607																																																	0								ENSG00000197915						156.0	133.0	141.0					1																	152192912		2203	4300	6503	HRNR	SO:0001583	missense	0			-	HGNC	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.1193C>T	1.37:g.152192912G>A	ENSP00000357791:p.Ser398Phe	Somatic	0	30	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	28	30.00	Q5DT20|Q5U1F4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.S398F	ENST00000368801.2	37	c.1193	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	G	6.738	0.504981	0.12822	.	.	ENSG00000197915	ENST00000368801	T	0.11604	2.76	3.63	2.71	0.32032	.	.	.	.	.	T	0.05090	0.0136	N	0.19112	0.55	0.09310	N	1	D	0.59357	0.985	P	0.55055	0.767	T	0.36601	-0.9741	9	0.34782	T	0.22	.	8.8573	0.35236	0.1154:0.0:0.8846:0.0	.	398	Q86YZ3	HORN_HUMAN	F	398	ENSP00000357791:S398F	ENSP00000357791:S398F	S	-	2	0	HRNR	150459536	0.003000	0.15002	0.001000	0.08648	0.001000	0.01503	1.288000	0.33296	0.877000	0.35895	0.644000	0.83932	TCC	-	NULL		0.607	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	protein_coding	OTTHUMT00000034016.1	G	XM_373868	-		152192912	-1	no_errors	ENST00000368801	ensembl	human	known	74_37	missense	SNP	0.002	A
ACAN	176	genome.wustl.edu	37	15	89398253	89398253	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr15:89398253C>T	ENST00000561243.1	+	11	2437	c.2437C>T	c.(2437-2439)Ccc>Tcc	p.P813S	ACAN_ENST00000559004.1_Missense_Mutation_p.P813S|ACAN_ENST00000439576.2_Missense_Mutation_p.P813S|ACAN_ENST00000352105.7_Missense_Mutation_p.P813S			P16112	PGCA_HUMAN	aggrecan	812	12 X 6 AA approximate tandem repeats of E-[GVE]-P-[SFY]-[APT]-[TSP].|KS.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GAGGCCATTCCCCTCAGTGGA	0.607																																																	0								ENSG00000157766						31.0	35.0	34.0					15																	89398253		1957	4151	6108	ACAN	SO:0001583	missense	0			-	HGNC	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.2437C>T	15.37:g.89398253C>T	ENSP00000453342:p.Pro813Ser	Somatic	0	55	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	47	40.51	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.P813S	ENST00000561243.1	37	c.2437	CCDS53970.1	15	.	.	.	.	.	.	.	.	.	.	C	0.371	-0.933823	0.02340	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.02121	4.68;4.44	2.6	1.48	0.22813	.	.	.	.	.	T	0.01287	0.0042	N	0.14661	0.345	0.09310	N	1	B;B	0.33694	0.421;0.421	B;B	0.24701	0.055;0.055	T	0.46428	-0.9192	9	0.11794	T	0.64	.	8.6156	0.33829	0.0:0.7605:0.2395:0.0	.	813;813	E7ENV9;E7EX88	.;.	S	813	ENSP00000387356:P813S;ENSP00000341615:P813S	ENSP00000268134:P813S	P	+	1	0	ACAN	87199257	0.000000	0.05858	0.004000	0.12327	0.007000	0.05969	-1.176000	0.03099	1.388000	0.46506	0.313000	0.20887	CCC	-	NULL		0.607	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	protein_coding	OTTHUMT00000416267.2	C	NM_001135	-		89398253	+1	no_errors	ENST00000439576	ensembl	human	known	74_37	missense	SNP	0.039	T
TRIM27	5987	genome.wustl.edu	37	6	28871977	28871977	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr6:28871977C>T	ENST00000377199.3	-	8	1768	c.1412G>A	c.(1411-1413)cGg>cAg	p.R471Q	TRIM27_ENST00000377194.3_3'UTR	NM_006510.4	NP_006501.1	P14373	TRI27_HUMAN	tripartite motif containing 27	471	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell proliferation (GO:0008283)|innate immune response (GO:0045087)|interferon-gamma secretion (GO:0072643)|negative regulation of adaptive immune response (GO:0002820)|negative regulation of calcium ion import (GO:0090281)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of interleukin-2 secretion (GO:1900041)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						GAAGTAGGGCCGGACAGGCCC	0.502			T	RET	papillary thyroid																																			Dom	yes		6	6p22	5987	tripartite motif-containing 27		E	0								ENSG00000204713						117.0	131.0	126.0					6																	28871977		1511	2709	4220	TRIM27	SO:0001583	missense	0			-	HGNC	Z58939	CCDS4654.1	6p22	2013-01-09	2011-01-25	2006-09-26	ENSG00000204713	ENSG00000204713		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9975	protein-coding gene	gene with protein product		602165	"""ret finger protein"", ""tripartite motif-containing 27"""	RFP		8114113	Standard	NM_006510		Approved	RNF76	uc003nlr.3	P14373	OTTHUMG00000031215	ENST00000377199.3:c.1412G>A	6.37:g.28871977C>T	ENSP00000366404:p.Arg471Gln	Somatic	0	35	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	A2BE15|Q5RJA8|Q5ST26|Q6LA73|Q6NXR9|Q9BZY6|Q9UJL3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin,prints_Znf_B-box_chordata	p.R471Q	ENST00000377199.3	37	c.1412	CCDS4654.1	6	.	.	.	.	.	.	.	.	.	.	C	15.03	2.711555	0.48517	.	.	ENSG00000204713	ENST00000377199	T	0.69306	-0.39	4.89	4.89	0.63831	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.49305	D	0.000157	T	0.69160	0.3080	L	0.61036	1.89	0.80722	D	1	D	0.71674	0.998	D	0.64877	0.93	T	0.66101	-0.6007	10	0.29301	T	0.29	.	12.1025	0.53792	0.0:0.8259:0.1741:0.0	.	471	P14373	TRI27_HUMAN	Q	471	ENSP00000366404:R471Q	ENSP00000366404:R471Q	R	-	2	0	TRIM27	28979956	0.710000	0.27896	1.000000	0.80357	0.998000	0.95712	0.485000	0.22324	2.633000	0.89246	0.655000	0.94253	CGG	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin		0.502	TRIM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM27	protein_coding	OTTHUMT00000076442.2	C	NM_030950	-		28871977	-1	no_errors	ENST00000377199	ensembl	human	known	74_37	missense	SNP	1.000	T
LRP12	29967	genome.wustl.edu	37	8	105510058	105510058	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr8:105510058C>T	ENST00000276654.5	-	5	830	c.722G>A	c.(721-723)gGg>gAg	p.G241E	LRP12_ENST00000518375.1_5'Flank|LRP12_ENST00000424843.2_Missense_Mutation_p.G222E	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	241	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GTCAATGTTCCCATCACATTT	0.413																																																	0								ENSG00000147650						98.0	96.0	97.0					8																	105510058		2203	4300	6503	LRP12	SO:0001583	missense	0			-	HGNC	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.722G>A	8.37:g.105510058C>T	ENSP00000276654:p.Gly241Glu	Somatic	0	32	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	19	47.22	A8K137|B4DRQ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	p.G222E	ENST00000276654.5	37	c.665	CCDS6303.1	8	.	.	.	.	.	.	.	.	.	.	C	23.2	4.385989	0.82902	.	.	ENSG00000147650	ENST00000424843;ENST00000276654	D;D	0.96716	-4.1;-4.1	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.98277	0.9429	M	0.83483	2.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.98834	1.0752	10	0.72032	D	0.01	-18.9229	19.7554	0.96287	0.0:1.0:0.0:0.0	.	222;241	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	E	222;241	ENSP00000399148:G222E;ENSP00000276654:G241E	ENSP00000276654:G241E	G	-	2	0	LRP12	105579234	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	7.456000	0.80751	2.665000	0.90641	0.563000	0.77884	GGG	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt		0.413	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	protein_coding	OTTHUMT00000380821.1	C	NM_013437	-		105510058	-1	no_errors	ENST00000424843	ensembl	human	known	74_37	missense	SNP	1.000	T
KIAA1549L	25758	genome.wustl.edu	37	11	33628349	33628349	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr11:33628349C>T	ENST00000321505.4	+	13	4331	c.4151C>T	c.(4150-4152)tCg>tTg	p.S1384L	KIAA1549L_ENST00000389726.3_Missense_Mutation_p.S1390L			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1384						integral component of membrane (GO:0016021)											CAGGAGTCATCGGCAGTCCTC	0.582																																																	0								ENSG00000110427						23.0	26.0	25.0					11																	33628349		2042	4202	6244	KIAA1549L	SO:0001583	missense	0			-	HGNC	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.4151C>T	11.37:g.33628349C>T	ENSP00000315295:p.Ser1384Leu	Somatic	0	35	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	41	14.58	B0QYU0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S1390L	ENST00000321505.4	37	c.4169	CCDS44565.2	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.73|13.73	2.323354|2.323354	0.41096|0.41096	.|.	.|.	ENSG00000110427|ENSG00000110427	ENST00000526400|ENST00000321505;ENST00000389726;ENST00000536568	.|.	.|.	.|.	5.43|5.43	4.52|4.52	0.55395|0.55395	.|.	.|0.441755	.|0.25192	.|N	.|0.032448	T|T	0.41465|0.41465	0.1160|0.1160	M|M	0.64997|0.64997	1.995|1.995	0.28711|0.28711	N|N	0.903531|0.903531	.|B	.|0.32604	.|0.377	.|B	.|0.21151	.|0.033	T|T	0.48364|0.48364	-0.9042|-0.9042	5|9	.|0.72032	.|D	.|0.01	0.2235|0.2235	10.4633|10.4633	0.44592|0.44592	0.0:0.8511:0.0:0.1489|0.0:0.8511:0.0:0.1489	.|.	.|1390	.|E9PAT2	.|.	W|L	782|1384;1390;1223	.|.	.|ENSP00000315295:S1384L	R|S	+|+	1|2	2|0	C11orf41|C11orf41	33584925|33584925	0.827000|0.827000	0.29292|0.29292	0.138000|0.138000	0.22173|0.22173	0.492000|0.492000	0.33523|0.33523	4.091000|4.091000	0.57700|0.57700	1.294000|1.294000	0.44707|0.44707	0.561000|0.561000	0.74099|0.74099	CGG|TCG	-	NULL		0.582	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1549L	protein_coding	OTTHUMT00000317998.1	C	NM_012194	-		33628349	+1	no_errors	ENST00000389726	ensembl	human	known	74_37	missense	SNP	0.868	T
PLXNB2	23654	genome.wustl.edu	37	22	50717058	50717058	+	Silent	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr22:50717058C>T	ENST00000449103.1	-	29	4754	c.4614G>A	c.(4612-4614)cgG>cgA	p.R1538R	PLXNB2_ENST00000359337.4_Silent_p.R1538R			O15031	PLXB2_HUMAN	plexin B2	1538					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CGCGCTTCCACCGGCCCTCCC	0.677																																																	0								ENSG00000196576						37.0	42.0	40.0					22																	50717058		2095	4206	6301	PLXNB2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.4614G>A	22.37:g.50717058C>T		Somatic	0	66	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	27	43.75	A6QRH0|Q7KZU3|Q9BSU7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.R1538	ENST00000449103.1	37	c.4614	CCDS43035.1	22	.	.	.	.	.	.	.	.	.	.	C	9.274	1.046413	0.19748	.	.	ENSG00000196576	ENST00000399991;ENST00000399964	.	.	.	4.48	-4.85	0.03142	.	.	.	.	.	T	0.48874	0.1524	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51529	-0.8694	5	0.33940	T	0.23	.	5.4536	0.16578	0.0964:0.3461:0.4116:0.146	.	.	.	.	M	10;170	.	ENSP00000382845:V170M	V	-	1	0	PLXNB2	49059185	0.027000	0.19231	0.986000	0.45419	0.707000	0.40811	-0.947000	0.03901	-0.435000	0.07264	-0.258000	0.10820	GTG	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot		0.677	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	protein_coding	OTTHUMT00000316874.3	C	NM_012401	-		50717058	-1	no_errors	ENST00000359337	ensembl	human	known	74_37	silent	SNP	0.909	T
LHX1	3975	genome.wustl.edu	37	17	35299571	35299571	+	Silent	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr17:35299571C>T	ENST00000254457.5	+	4	2161	c.750C>T	c.(748-750)gcC>gcT	p.A250A	RP11-445F12.2_ENST00000607336.1_RNA	NM_005568.3	NP_005559.2	P48742	LHX1_HUMAN	LIM homeobox 1	250					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell signaling (GO:0007267)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|cerebellum development (GO:0021549)|cervix development (GO:0060067)|comma-shaped body morphogenesis (GO:0072049)|dorsal/ventral pattern formation (GO:0009953)|ectoderm formation (GO:0001705)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|embryonic viscerocranium morphogenesis (GO:0048703)|endoderm formation (GO:0001706)|epithelium development (GO:0060429)|forebrain regionalization (GO:0021871)|gastrulation with mouth forming second (GO:0001702)|head development (GO:0060322)|horizontal cell localization (GO:0035852)|kidney development (GO:0001822)|lateral motor column neuron migration (GO:0097477)|mesonephric duct development (GO:0072177)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerulus development (GO:0072224)|metanephric part of ureteric bud development (GO:0035502)|metanephric renal vesicle morphogenesis (GO:0072283)|metanephric S-shaped body morphogenesis (GO:0072284)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct elongation (GO:0035849)|nephric duct morphogenesis (GO:0072178)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|oviduct development (GO:0060066)|oviduct epithelium development (GO:0035846)|paramesonephric duct development (GO:0061205)|pattern specification process (GO:0007389)|positive regulation of anterior head development (GO:2000744)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primitive streak formation (GO:0090009)|pronephros development (GO:0048793)|regulation of gene expression (GO:0010468)|renal vesicle morphogenesis (GO:0072077)|retina layer formation (GO:0010842)|S-shaped body morphogenesis (GO:0072050)|somite rostral/caudal axis specification (GO:0032525)|spinal cord association neuron differentiation (GO:0021527)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)|uterine epithelium development (GO:0035847)|uterus development (GO:0060065)|vagina development (GO:0060068)|ventral spinal cord development (GO:0021517)	nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Breast(25;0.00607)				GGCGCCACGCCTTCTTCCGCA	0.706																																																	0								ENSG00000132130						10.0	13.0	12.0					17																	35299571		2163	4233	6396	LHX1	SO:0001819	synonymous_variant	0			-	HGNC	U14755	CCDS11316.1	17q12	2014-04-11			ENSG00000132130	ENSG00000273706		"""Homeoboxes / LIM class"""	6593	protein-coding gene	gene with protein product		601999				9212161	Standard	NM_005568		Approved	LIM-1, LIM1	uc002hnh.2	P48742	OTTHUMG00000188456	ENST00000254457.5:c.750C>T	17.37:g.35299571C>T		Somatic	0	22	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	5	37.50	Q3MIW0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.A250	ENST00000254457.5	37	c.750	CCDS11316.1	17																																																																																			-	NULL		0.706	LHX1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LHX1	protein_coding	OTTHUMT00000256704.3	C	NM_005568	-		35299571	+1	no_errors	ENST00000254457	ensembl	human	known	74_37	silent	SNP	1.000	T
ANGPT4	51378	genome.wustl.edu	37	20	853735	853735	+	Silent	SNP	T	T	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr20:853735T>A	ENST00000381922.3	-	9	1482	c.1380A>T	c.(1378-1380)tcA>tcT	p.S460S	ANGPT4_ENST00000546022.1_3'UTR	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	460	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						CGTTGAGGTTTGACAGGCCAC	0.622																																					Pancreas(181;481 2077 3259 31286 49856)												0								ENSG00000101280						74.0	67.0	69.0					20																	853735		2203	4300	6503	ANGPT4	SO:0001819	synonymous_variant	0			-	HGNC	AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.1380A>T	20.37:g.853735T>A		Somatic	0	27	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	18	37.93	B4E3J9|Q5TFF4|Q9H4Z4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.S460	ENST00000381922.3	37	c.1380	CCDS13009.1	20																																																																																			-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom		0.622	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPT4	protein_coding	OTTHUMT00000077493.1	T	NM_015985	-		853735	-1	no_errors	ENST00000381922	ensembl	human	known	74_37	silent	SNP	1.000	A
TG	7038	genome.wustl.edu	37	8	133931621	133931621	+	Splice_Site	SNP	T	T	G			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr8:133931621T>G	ENST00000220616.4	+	21	4419	c.4379T>G	c.(4378-4380)gTt>gGt	p.V1460G	TG_ENST00000377869.1_Splice_Site_p.V1460G|TG_ENST00000542445.1_5'Flank	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1460					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TTTTTTCTAGTTAAGTGTCCT	0.418																																																	0								ENSG00000042832						74.0	68.0	70.0					8																	133931621		2203	4300	6503	TG	SO:0001630	splice_region_variant	0			-	HGNC	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4379-1T>G	8.37:g.133931621T>G		Somatic	0	34	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	27	44.90	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.V1460G	ENST00000220616.4	37	c.4379	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	T	13.26	2.184901	0.38609	.	.	ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616	D;D	0.97959	-4.63;-4.45	5.52	4.36	0.52297	.	1.705140	0.03205	N	0.175360	D	0.98554	0.9517	M	0.74881	2.28	0.58432	D	0.999993	D	0.89917	1.0	D	0.69307	0.963	D	0.91991	0.5603	9	.	.	.	.	8.5718	0.33574	0.0:0.0882:0.0:0.9118	.	1460	P01266	THYG_HUMAN	G	1460;266;1460	ENSP00000367100:V1460G;ENSP00000220616:V1460G	.	V	+	2	0	TG	134000803	0.998000	0.40836	0.740000	0.30986	0.213000	0.24496	3.531000	0.53546	1.026000	0.39733	-0.290000	0.09829	GTT	-	pirsf_Thyroglobulin		0.418	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	protein_coding	OTTHUMT00000379606.1	T	NM_003235	-	Missense_Mutation	133931621	+1	no_errors	ENST00000220616	ensembl	human	known	74_37	missense	SNP	0.945	G
PCDHA4	56144	genome.wustl.edu	37	5	140188483	140188483	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr5:140188483G>C	ENST00000530339.1	+	1	1711	c.1711G>C	c.(1711-1713)Ggt>Cgt	p.G571R	PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.G571R|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.G571R	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	571					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCTCGGGCGGGTGGCACTGG	0.672																																																	0								ENSG00000204967						82.0	78.0	80.0					5																	140188483		2202	4298	6500	PCDHA4	SO:0001583	missense	0			-	HGNC	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1711G>C	5.37:g.140188483G>C	ENSP00000435300:p.Gly571Arg	Somatic	0	110	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	34	40.35	O75285|Q2M253	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.G571R	ENST00000530339.1	37	c.1711	CCDS54916.1	5	.	.	.	.	.	.	.	.	.	.	g	2.450	-0.326588	0.05350	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.51817	0.73;0.69;0.7	3.76	1.9	0.25705	Cadherin-like (1);	.	.	.	.	T	0.19685	0.0473	N	0.03903	-0.33	0.09310	N	1	B;B;B	0.17852	0.005;0.003;0.024	B;B;B	0.20577	0.03;0.006;0.027	T	0.22487	-1.0215	9	0.19590	T	0.45	.	2.8694	0.05611	0.1065:0.1792:0.5305:0.1838	.	571;571;571	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	R	571	ENSP00000423470:G571R;ENSP00000349344:G571R;ENSP00000435300:G571R	ENSP00000349344:G571R	G	+	1	0	PCDHA4	140168667	0.000000	0.05858	0.016000	0.15963	0.134000	0.20937	0.225000	0.17757	0.340000	0.23745	0.484000	0.47621	GGT	-	superfamily_Cadherin-like		0.672	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	protein_coding	OTTHUMT00000372864.2	G	NM_018907	-		140188483	+1	no_errors	ENST00000530339	ensembl	human	known	74_37	missense	SNP	0.007	C
DOCK7	85440	genome.wustl.edu	37	1	63113413	63113413	+	Missense_Mutation	SNP	A	A	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr1:63113413A>T	ENST00000340370.5	-	7	784	c.767T>A	c.(766-768)aTa>aAa	p.I256K	DOCK7_ENST00000251157.5_Missense_Mutation_p.I256K|DOCK7_ENST00000404627.2_Missense_Mutation_p.I256K	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	256					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						TTCTTTGGGTATATCAGGAAC	0.303																																																	0								ENSG00000116641						130.0	145.0	140.0					1																	63113413		2203	4296	6499	DOCK7	SO:0001583	missense	0			-	HGNC		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.767T>A	1.37:g.63113413A>T	ENSP00000340742:p.Ile256Lys	Somatic	0	114	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	80	34.96	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_DOCK_C/D_N,superfamily_ARM-type_fold	p.I256K	ENST00000340370.5	37	c.767	CCDS30734.1	1	.	.	.	.	.	.	.	.	.	.	A	16.25	3.070342	0.55539	.	.	ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370;ENST00000404627	T;T;T	0.16324	2.35;2.35;2.35	5.17	4.04	0.47022	.	0.376195	0.29715	N	0.011391	T	0.09024	0.0223	L	0.55213	1.73	0.38609	D	0.950842	B;B;B;B;B	0.25850	0.136;0.039;0.01;0.001;0.0	B;B;B;B;B	0.33121	0.091;0.158;0.071;0.018;0.002	T	0.05194	-1.0900	10	0.32370	T	0.25	.	10.7896	0.46426	0.9259:0.0:0.0741:0.0	.	256;256;256;256;256	Q96NI0;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3	.;.;.;.;.	K	256	ENSP00000251157:I256K;ENSP00000340742:I256K;ENSP00000384446:I256K	ENSP00000251157:I256K	I	-	2	0	DOCK7	62886001	1.000000	0.71417	0.989000	0.46669	0.994000	0.84299	6.107000	0.71517	0.976000	0.38417	0.460000	0.39030	ATA	-	NULL		0.303	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK7	protein_coding	OTTHUMT00000036806.1	A	NM_033407	-		63113413	-1	no_errors	ENST00000251157	ensembl	human	known	74_37	missense	SNP	1.000	T
LOC101927648	101927648	genome.wustl.edu	37	1	143355542	143355542	+	lincRNA	SNP	C	C	A	rs111706506	byFrequency	TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr1:143355542C>A	ENST00000423249.1	-	0	1209				RP11-435B5.3_ENST00000430699.1_lincRNA																							tgaccatcagcctgcctgcct	0.408													.|||	1268	0.253195	0.2436	0.245	5008	,	,		62282	0.2351		0.2594	False		,,,				2504	0.2843																0								ENSG00000185044																																			RP11-435B5.4			0			-	Clone_based_vega_gene																													1.37:g.143355542C>A		Somatic	0	18	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	15	34.78		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000423249.1	37	NULL		1																																																																																			-	-		0.408	RP11-435B5.4-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927648	lincRNA	OTTHUMT00000037552.1	C		rs186013055		143355542	-1	no_errors	ENST00000423249	ensembl	human	known	74_37	rna	SNP	0.001	A
PIWIL2	55124	genome.wustl.edu	37	8	22145080	22145080	+	Silent	SNP	G	G	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr8:22145080G>A	ENST00000454009.2	+	7	1292	c.783G>A	c.(781-783)ttG>ttA	p.L261L	PIWIL2_ENST00000521356.1_Silent_p.L261L|PIWIL2_ENST00000356766.6_Silent_p.L261L	NM_001135721.1	NP_001129193.1	Q8TC59	PIWL2_HUMAN	piwi-like RNA-mediated gene silencing 2	261					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ-line stem cell maintenance (GO:0030718)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|piRNA metabolic process (GO:0034587)|positive regulation of meiosis I (GO:0060903)|positive regulation of translation (GO:0045727)|RNA 5'-end processing (GO:0000966)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(14)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	46				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		TCGGCATGTTGAAGGACCATC	0.443											OREG0018608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000197181						176.0	139.0	152.0					8																	22145080		2203	4300	6503	PIWIL2	SO:0001819	synonymous_variant	0			-	HGNC	AK001213	CCDS6029.1	8p24	2013-02-15	2013-02-15		ENSG00000197181	ENSG00000197181		"""Argonaute/PIWI family"""	17644	protein-coding gene	gene with protein product	"""Hiwi-like"", ""cancer/testis antigen 80"""	610312	"""piwi-like 2 (Drosophila)"""			11279525, 12906857	Standard	NM_018068		Approved	HILI, FLJ10351, Mili, CT80	uc003xbn.2	Q8TC59	OTTHUMG00000097767	ENST00000454009.2:c.783G>A	8.37:g.22145080G>A		Somatic	0	60	0.00	753	0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	32	37.25	A8K4S3|A8K8S5|B0AZN9|B0AZP2|B4DR22|E7ECA4|Q96SW6|Q9NW28	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Piwi,pfam_PAZ_dom,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.L261	ENST00000454009.2	37	c.783	CCDS6029.1	8																																																																																			-	superfamily_PAZ_dom		0.443	PIWIL2-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	PIWIL2	protein_coding	OTTHUMT00000375438.1	G		-		22145080	+1	no_errors	ENST00000356766	ensembl	human	known	74_37	silent	SNP	1.000	A
ZNF552	79818	genome.wustl.edu	37	19	58325967	58325967	+	Intron	SNP	G	G	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr19:58325967G>A	ENST00000391701.1	-	1	203				ZNF586_ENST00000599802.1_Intron|ZNF586_ENST00000598885.1_3'UTR	NM_024762.3	NP_079038.2	Q9H707	ZN552_HUMAN	zinc finger protein 552						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		GCGCCTCAGTGTCCCGACGCC	0.652																																																	0								ENSG00000178935																																			ZNF552	SO:0001627	intron_variant	0			-	HGNC	AK097041	CCDS12963.1	19q13.43	2013-09-20			ENSG00000178935	ENSG00000178935		"""Zinc fingers, C2H2-type"", ""-"""	26135	protein-coding gene	gene with protein product							Standard	XM_005259267		Approved	FLJ21603	uc002qqg.3	Q9H707	OTTHUMG00000183478	ENST00000391701.1:c.33+111C>T	19.37:g.58325967G>A		Somatic	0	61	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	19	24.00	B3KUE9|Q6P5A6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.H49Y	ENST00000391701.1	37	c.145	CCDS12963.1	19																																																																																			-	NULL		0.652	ZNF552-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF552	protein_coding	OTTHUMT00000466829.1	G	NM_024762	-		58325967	-1	no_errors	ENST00000596248	ensembl	human	known	74_37	missense	SNP	0.000	A
DIS3L2	129563	genome.wustl.edu	37	2	233127949	233127949	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr2:233127949C>G	ENST00000409307.1	+	12	1458	c.1458C>G	c.(1456-1458)atC>atG	p.I486M	DIS3L2_ENST00000273009.6_Missense_Mutation_p.I486M|DIS3L2_ENST00000325385.7_Missense_Mutation_p.I486M					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		GGACCATCATCCGCTCCTGCA	0.483																																																	0								ENSG00000144535						63.0	66.0	65.0					2																	233127949		1952	4158	6110	DIS3L2	SO:0001583	missense	0			-	HGNC	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.1458C>G	2.37:g.233127949C>G	ENSP00000386799:p.Ile486Met	Somatic	0	33	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	23	42.50		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I486M	ENST00000409307.1	37	c.1458	CCDS42834.1	2	.	.	.	.	.	.	.	.	.	.	C	15.65	2.894942	0.52121	.	.	ENSG00000144535	ENST00000273009;ENST00000542873;ENST00000325385;ENST00000431466;ENST00000409307;ENST00000424049	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	5.04	-0.172	0.13327	Ribonuclease II/R (2);	0.000000	0.85682	D	0.000000	T	0.66356	0.2781	M	0.69523	2.12	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.66388	-0.5936	10	0.87932	D	0	-15.3324	10.3828	0.44121	0.0:0.6396:0.0:0.3604	.	486	Q8IYB7	DI3L2_HUMAN	M	486;486;486;486;486;121	ENSP00000273009:I486M;ENSP00000315569:I486M;ENSP00000386799:I486M;ENSP00000415419:I121M	ENSP00000273009:I486M	I	+	3	3	DIS3L2	232836193	0.945000	0.32115	0.973000	0.42090	0.724000	0.41520	1.153000	0.31676	-0.023000	0.13963	0.650000	0.86243	ATC	-	NULL		0.483	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	DIS3L2	protein_coding	OTTHUMT00000330988.1	C	NM_152383	-		233127949	+1	no_errors	ENST00000325385	ensembl	human	known	74_37	missense	SNP	0.957	G
PLCE1	51196	genome.wustl.edu	37	10	96014797	96014797	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr10:96014797G>A	ENST00000371380.3	+	10	3780	c.3545G>A	c.(3544-3546)aGc>aAc	p.S1182N	PLCE1_ENST00000371375.1_Missense_Mutation_p.S874N|PLCE1_ENST00000260766.3_Missense_Mutation_p.S1182N|PLCE1_ENST00000371385.3_Missense_Mutation_p.S874N			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	1182					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				TCAAACAAGAGCCCATCCAGG	0.517																																																	0								ENSG00000138193						90.0	88.0	89.0					10																	96014797		1907	4125	6032	PLCE1	SO:0001583	missense	0			-	HGNC		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.3545G>A	10.37:g.96014797G>A	ENSP00000360431:p.Ser1182Asn	Somatic	0	19	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	6	53.85	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_Ras-assoc,pfam_RasGRF_CDC25,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_Ras_GEF_dom,superfamily_C2_dom,smart_RasGRF_CDC25,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,smart_Ras-assoc,pfscan_C2_dom,pfscan_Ras-assoc,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,pfscan_RasGRF_CDC25,prints_Pinositol_PLipase_C	p.S1182N	ENST00000371380.3	37	c.3545	CCDS41552.1	10	.	.	.	.	.	.	.	.	.	.	G	15.67	2.902030	0.52227	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.24538	1.85;1.85;1.86;1.86	5.71	4.81	0.61882	.	0.202557	0.45126	D	0.000393	T	0.19685	0.0473	L	0.36672	1.1	0.24171	N	0.995628	B;B	0.14438	0.01;0.006	B;B	0.13407	0.009;0.005	T	0.07385	-1.0775	10	0.39692	T	0.17	.	9.771	0.40589	0.0731:0.1412:0.7857:0.0	.	874;1182	Q9P212-2;Q9P212	.;PLCE1_HUMAN	N	1182;1182;874;874	ENSP00000260766:S1182N;ENSP00000360431:S1182N;ENSP00000360438:S874N;ENSP00000360426:S874N	ENSP00000260766:S1182N	S	+	2	0	PLCE1	96004787	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.869000	0.39519	2.695000	0.91970	0.650000	0.86243	AGC	-	NULL		0.517	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCE1	protein_coding	OTTHUMT00000049469.3	G	NM_016341	-		96014797	+1	no_errors	ENST00000260766	ensembl	human	known	74_37	missense	SNP	1.000	A
PDLIM2	64236	genome.wustl.edu	37	8	22451416	22451416	+	Missense_Mutation	SNP	G	G	A	rs150050587		TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr8:22451416G>A	ENST00000397760.4	+	10	1452	c.1052G>A	c.(1051-1053)cGg>cAg	p.R351Q	PDLIM2_ENST00000397761.2_Missense_Mutation_p.R351Q|PDLIM2_ENST00000339162.7_3'UTR|PDLIM2_ENST00000448520.1_3'UTR|AC037459.4_ENST00000430850.2_Intron|PDLIM2_ENST00000308354.7_Missense_Mutation_p.R601Q|PDLIM2_ENST00000265810.4_Intron|PDLIM2_ENST00000409417.1_Missense_Mutation_p.R351Q|PDLIM2_ENST00000409141.1_3'UTR			Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 (mystique)	351						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		CTCAGCTCTCGGGCCTGAGCC	0.622													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14934	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000120913						29.0	22.0	25.0					8																	22451416		1323	2303	3626	PDLIM2	SO:0001583	missense	0			GMAF=0.0005	HGNC	AY007729	CCDS34860.1, CCDS6032.1, CCDS34861.1, CCDS6032.2	8p21.3	2012-06-27			ENSG00000120913	ENSG00000120913			13992	protein-coding gene	gene with protein product		609722					Standard	NM_021630		Approved		uc003xby.4	Q96JY6	OTTHUMG00000164270	ENST00000397760.4:c.1052G>A	8.37:g.22451416G>A	ENSP00000380867:p.Arg351Gln	Somatic	0	55	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	22	24.14	D3DSR5|J3KNH4|Q7Z584|Q86WM8|Q8WZ29|Q9H4L9|Q9H7I2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_Znf_LIM,superfamily_PDZ,smart_PDZ,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.R601Q	ENST00000397760.4	37	c.1802		8	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	3.508	-0.100414	0.06967	.	.	ENSG00000120913	ENST00000308354;ENST00000397760;ENST00000397761;ENST00000409417	T;T;T;T	0.13089	3.35;2.62;2.62;2.62	4.43	-2.34	0.06704	.	1.756780	0.03845	N	0.271389	T	0.11537	0.0281	L	0.29908	0.895	0.20563	N	0.999884	B	0.06786	0.001	B	0.01281	0.0	T	0.41752	-0.9491	10	0.59425	D	0.04	.	9.1947	0.37220	0.6717:0.0:0.3283:0.0	.	351	Q96JY6	PDLI2_HUMAN	Q	601;351;351;351	ENSP00000312634:R601Q;ENSP00000380867:R351Q;ENSP00000380868:R351Q;ENSP00000387084:R351Q	ENSP00000312634:R601Q	R	+	2	0	PDLIM2	22507361	0.295000	0.24389	0.070000	0.20053	0.191000	0.23601	0.993000	0.29680	-0.482000	0.06782	0.491000	0.48974	CGG	-	NULL		0.622	PDLIM2-202	KNOWN	basic|appris_principal	protein_coding	PDLIM2	protein_coding	OTTHUMT00000334167.1	G		rs150050587		22451416	+1	no_errors	ENST00000308354	ensembl	human	known	74_37	missense	SNP	0.192	A
MYH8	4626	genome.wustl.edu	37	17	10303854	10303854	+	Silent	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr17:10303854C>T	ENST00000403437.2	-	27	3682	c.3588G>A	c.(3586-3588)cgG>cgA	p.R1196R	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1196					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CGTGCTTCTTCCGAAGAGCAG	0.547									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																																								0								ENSG00000133020						81.0	76.0	78.0					17																	10303854		2203	4300	6503	MYH8	SO:0001819	synonymous_variant	0	Familial Cancer Database	Carney Complex Variant	-	HGNC		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.3588G>A	17.37:g.10303854C>T		Somatic	0	40	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	4	64.29	Q14910	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1196	ENST00000403437.2	37	c.3588	CCDS11153.1	17																																																																																			-	pfam_Myosin_tail		0.547	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	protein_coding	OTTHUMT00000252724.2	C	NM_002472	-		10303854	-1	no_errors	ENST00000403437	ensembl	human	known	74_37	silent	SNP	0.976	T
PAXIP1	22976	genome.wustl.edu	37	7	154760325	154760327	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	TGC	TGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr7:154760325_154760327delTGC	ENST00000404141.1	-	7	1738_1740	c.1584_1586delGCA	c.(1582-1587)cagcaa>caa	p.528_529QQ>Q	PAXIP1_ENST00000473219.1_5'UTR|PAXIP1_ENST00000397192.1_In_Frame_Del_p.528_529QQ>Q			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	528	Gln-rich.			Missing (in Ref. 4; AAB91434). {ECO:0000305}.	adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		aatctgctgttgctgctgctgct	0.611																																																	0								ENSG00000157212																																			PAXIP1	SO:0001651	inframe_deletion	0				HGNC	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1584_1586delGCA	7.37:g.154760334_154760336delTGC	ENSP00000384048:p.Gln531del	Somatic	0	37	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	14	22.22	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.Q531in_frame_del	ENST00000404141.1	37	c.1586_1584	CCDS47753.1	7																																																																																			-	NULL		0.611	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	protein_coding	OTTHUMT00000322223.1	TGC	NM_007349			154760327	-1	no_errors	ENST00000397192	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:0.993	-
NUP153	9972	genome.wustl.edu	37	6	17633077	17633078	+	Splice_Site	INS	-	-	A	rs36027788|rs377304074|rs71002237|rs386406292	byFrequency	TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr6:17633077_17633078insA	ENST00000262077.2	-	17	2464		c.e17-2		NUP153_ENST00000537253.1_Splice_Site	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			CTGAACTTCCTAAAAAAAAAAA	0.406																																																	0								ENSG00000124789																																			NUP153	SO:0001630	splice_region_variant	0				HGNC	Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.2465-2->T	6.37:g.17633088_17633088dupA		Somatic	0	50	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e18-2	ENST00000262077.2	37	c.2558-3_2558-2	CCDS4541.1	6																																																																																			-	-		0.406	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP153	protein_coding	OTTHUMT00000039953.1	-			Intron	17633078	-1	no_errors	ENST00000537253	ensembl	human	known	74_37	splice_site_ins	INS	0.970:0.138	A
PCDHA4	56144	genome.wustl.edu	37	5	140187703	140187703	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr5:140187703G>A	ENST00000530339.1	+	1	931	c.931G>A	c.(931-933)Gaa>Aaa	p.E311K	PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.E311K|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.E311K	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	311	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TATTGACTTTGAAGAAAGCAA	0.343																																																	0								ENSG00000204967						97.0	104.0	102.0					5																	140187703		2203	4300	6503	PCDHA4	SO:0001583	missense	0			-	HGNC	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.931G>A	5.37:g.140187703G>A	ENSP00000435300:p.Glu311Lys	Somatic	0	133	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	31	49.18	O75285|Q2M253	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.E311K	ENST00000530339.1	37	c.931	CCDS54916.1	5	.	.	.	.	.	.	.	.	.	.	g	24.2	4.510268	0.85282	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.72394	-0.65;-0.65;-0.65	4.34	4.34	0.51931	Cadherin (4);Cadherin-like (1);	0.000000	0.41823	U	0.000818	D	0.89494	0.6731	H	0.97051	3.93	0.42720	D	0.993677	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.998;0.999	D	0.93672	0.6991	10	0.87932	D	0	.	17.2044	0.86914	0.0:0.0:1.0:0.0	.	311;311;311	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	K	311	ENSP00000423470:E311K;ENSP00000349344:E311K;ENSP00000435300:E311K	ENSP00000349344:E311K	E	+	1	0	PCDHA4	140167887	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.599000	0.82757	2.137000	0.66172	0.467000	0.42956	GAA	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.343	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	protein_coding	OTTHUMT00000372864.2	G	NM_018907	-		140187703	+1	no_errors	ENST00000530339	ensembl	human	known	74_37	missense	SNP	1.000	A
WWC1	23286	genome.wustl.edu	37	5	167719216	167719216	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr5:167719216G>A	ENST00000265293.4	+	1	561	c.59G>A	c.(58-60)gGc>gAc	p.G20D	WWC1_ENST00000521089.1_Missense_Mutation_p.G20D	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	20	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		GACTTCGACGGCAAGGTCTAC	0.711																																																	0								ENSG00000113645						48.0	37.0	40.0					5																	167719216		2178	4283	6461	WWC1	SO:0001583	missense	0			-	HGNC	AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.59G>A	5.37:g.167719216G>A	ENSP00000265293:p.Gly20Asp	Somatic	0	30	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WW_dom,superfamily_C2_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.G20D	ENST00000265293.4	37	c.59	CCDS4366.1	5	.	.	.	.	.	.	.	.	.	.	G	26.5	4.748510	0.89753	.	.	ENSG00000113645	ENST00000265293;ENST00000521089	D;D	0.94862	-3.54;-3.54	4.09	4.09	0.47781	WW/Rsp5/WWP (6);	0.000000	0.64402	D	0.000003	D	0.97598	0.9213	H	0.94183	3.505	0.80722	D	1	P;D	0.56968	0.675;0.978	B;P	0.59825	0.391;0.864	D	0.99016	1.0816	10	0.87932	D	0	.	16.0937	0.81106	0.0:0.0:1.0:0.0	.	20;20	Q8IX03-2;Q8IX03	.;KIBRA_HUMAN	D	20	ENSP00000265293:G20D;ENSP00000427772:G20D	ENSP00000265293:G20D	G	+	2	0	WWC1	167651794	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.287000	0.89918	2.121000	0.65114	0.491000	0.48974	GGC	-	pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom		0.711	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WWC1	protein_coding	OTTHUMT00000252791.2	G	NM_015238	-		167719216	+1	no_errors	ENST00000265293	ensembl	human	known	74_37	missense	SNP	1.000	A
DNAH8	1769	genome.wustl.edu	37	6	38704933	38704933	+	Missense_Mutation	SNP	G	G	A	rs76249323		TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr6:38704933G>A	ENST00000359357.3	+	4	456	c.202G>A	c.(202-204)Gca>Aca	p.A68T	DNAH8_ENST00000441566.1_Missense_Mutation_p.A68T|DNAH8_ENST00000449981.2_Missense_Mutation_p.A285T			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	68					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						AGCTGTTCTTGCAACAAACAA	0.393																																																	0								ENSG00000124721						100.0	103.0	102.0					6																	38704933		2203	4300	6503	DNAH8	SO:0001583	missense	0			-	HGNC	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.202G>A	6.37:g.38704933G>A	ENSP00000352312:p.Ala68Thr	Somatic	0	49	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.A68T	ENST00000359357.3	37	c.202		6	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124960	0.56613	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.25579	1.81;1.82;1.79	5.2	4.31	0.51392	.	0.145128	0.43260	D	0.000586	T	0.10809	0.0264	L	0.51422	1.61	0.39711	D	0.971336	B	0.10296	0.003	B	0.10450	0.005	T	0.04191	-1.0970	10	0.12103	T	0.63	.	12.9526	0.58409	0.08:0.0:0.92:0.0	.	68	Q96JB1	DYH8_HUMAN	T	273;273;68;68	ENSP00000333363:A273T;ENSP00000352312:A68T;ENSP00000402294:A68T	ENSP00000333363:A273T	A	+	1	0	DNAH8	38812911	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.867000	0.48428	2.565000	0.86533	0.591000	0.81541	GCA	-	NULL		0.393	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	protein_coding	OTTHUMT00000043574.1	G	NM_001206927	-		38704933	+1	no_errors	ENST00000359357	ensembl	human	known	74_37	missense	SNP	1.000	A
TSPYL4	23270	genome.wustl.edu	37	6	116574621	116574621	+	Frame_Shift_Del	DEL	T	T	-			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr6:116574621delT	ENST00000420283.1	-	1	640	c.551delA	c.(550-552)aagfs	p.K184fs	RP3-486I3.7_ENST00000448740.2_lincRNA|DSE_ENST00000540275.1_5'Flank	NM_021648.4	NP_067680.3	Q9UJ04	TSYL4_HUMAN	TSPY-like 4	184					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				endometrium(2)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(2)	11		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.045)|OV - Ovarian serous cystadenocarcinoma(136;0.0666)|GBM - Glioblastoma multiforme(226;0.095)|Epithelial(106;0.125)		tcctgccacctttttttcctt	0.537																																																	0								ENSG00000187189			10,3196		2,6,1595	37.0	37.0	37.0			4.2	0.1	6		38	38,6528		10,18,3255	no	frameshift	TSPYL4	NM_021648.4		12,24,4850	A1A1,A1R,RR		0.5787,0.3119,0.4912			116574621	48,9724	1725	3533	5258	TSPYL4	SO:0001589	frameshift_variant	0				HGNC		CCDS5106.1	6q22.1	2010-05-12			ENSG00000187189	ENSG00000187189			21559	protein-coding gene	gene with protein product							Standard	NM_021648		Approved	dJ486I3.2, KIAA0721	uc003pwn.3	Q9UJ04	OTTHUMG00000015429	ENST00000420283.1:c.551delA	6.37:g.116574621delT	ENSP00000410943:p.Lys184fs	Somatic	0	29	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B4DYQ2|O94828|Q96GW8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_NAP_family	p.K184fs	ENST00000420283.1	37	c.551	CCDS5106.1	6																																																																																			-	NULL		0.537	TSPYL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPYL4	protein_coding	OTTHUMT00000041934.2	T				116574621	-1	no_errors	ENST00000420283	ensembl	human	known	74_37	frame_shift_del	DEL	0.135	-
NT5DC4	284958	genome.wustl.edu	37	2	113479458	113479458	+	Silent	SNP	C	C	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr2:113479458C>T	ENST00000327581.4	+	2	126	c.75C>T	c.(73-75)taC>taT	p.Y25Y				Q86YG4	NT5D4_HUMAN	5'-nucleotidase domain containing 4	25							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)										ACATGGACTACACTCTGGCTG	0.592																																																	0								ENSG00000144130																																			NT5DC4	SO:0001819	synonymous_variant	0			-	HGNC	BC041437		2q13	2012-04-20			ENSG00000144130	ENSG00000144130			27678	protein-coding gene	gene with protein product							Standard	XM_001716359		Approved		uc002tid.3	Q86YG4	OTTHUMG00000153308	ENST00000327581.4:c.75C>T	2.37:g.113479458C>T		Somatic	0	27	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HAD-SF_hydro_IG_5-nucl,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IG_5-nucl	p.Y25	ENST00000327581.4	37	c.75		2																																																																																			-	pfam_HAD-SF_hydro_IG_5-nucl,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IG_5-nucl		0.592	NT5DC4-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	NT5DC4	protein_coding	OTTHUMT00000330647.1	C	XM_001716541	-		113479458	+1	no_errors	ENST00000327581	ensembl	human	novel	74_37	silent	SNP	1.000	T
PCDHA4	56144	genome.wustl.edu	37	5	140187574	140187574	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr5:140187574G>C	ENST00000530339.1	+	1	802	c.802G>C	c.(802-804)Gat>Cat	p.D268H	PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.D268H|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.D268H	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	268	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAACGCCTCAGATTTAGACGA	0.358																																																	0								ENSG00000204967						60.0	64.0	63.0					5																	140187574		2203	4300	6503	PCDHA4	SO:0001583	missense	0			-	HGNC	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.802G>C	5.37:g.140187574G>C	ENSP00000435300:p.Asp268His	Somatic	0	74	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	23	47.73	O75285|Q2M253	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D268H	ENST00000530339.1	37	c.802	CCDS54916.1	5	.	.	.	.	.	.	.	.	.	.	g	19.29	3.798540	0.70567	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.75154	-0.91;-0.91;-0.91	4.34	4.34	0.51931	Cadherin (5);Cadherin-like (1);	0.000000	0.41938	U	0.000793	D	0.92502	0.7619	H	0.99590	4.645	0.48288	D	0.999628	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96175	0.9126	10	0.87932	D	0	.	17.2044	0.86914	0.0:0.0:1.0:0.0	.	268;268;268	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	H	268	ENSP00000423470:D268H;ENSP00000349344:D268H;ENSP00000435300:D268H	ENSP00000349344:D268H	D	+	1	0	PCDHA4	140167758	1.000000	0.71417	0.970000	0.41538	0.990000	0.78478	9.420000	0.97426	2.137000	0.66172	0.467000	0.42956	GAT	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin		0.358	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	protein_coding	OTTHUMT00000372864.2	G	NM_018907	-		140187574	+1	no_errors	ENST00000530339	ensembl	human	known	74_37	missense	SNP	1.000	C
THAP4	51078	genome.wustl.edu	37	2	242573427	242573427	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr2:242573427G>T	ENST00000407315.1	-	2	576	c.145C>A	c.(145-147)Ccc>Acc	p.P49T		NM_015963.5	NP_057047.4	Q8WY91	THAP4_HUMAN	THAP domain containing 4	49							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	9		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;2.3e-33)|all cancers(36;8.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.68e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0844)		TACTTAGTGGGAGTCCAGTTA	0.463																																																	0								ENSG00000176946						90.0	102.0	98.0					2																	242573427		2203	4296	6499	THAP4	SO:0001583	missense	0			-	HGNC	AF258556	CCDS2551.1, CCDS54440.1	2q37.3	2013-01-25			ENSG00000176946	ENSG00000176946		"""THAP (C2CH-type zinc finger) domain containing"""	23187	protein-coding gene	gene with protein product		612533				12575992, 10810093	Standard	NM_015963		Approved	CGI-36	uc002wbt.3	Q8WY91	OTTHUMG00000133410	ENST00000407315.1:c.145C>A	2.37:g.242573427G>T	ENSP00000385006:p.Pro49Thr	Somatic	0	122	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	32	41.82	Q53NU7|Q6GRN0|Q6IPJ3|Q9NW26|Q9Y325	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1794,pfam_Znf_C2CH,superfamily_Calycin-like,smart_Znf_C2CH,pfscan_Znf_C2CH	p.P49T	ENST00000407315.1	37	c.145	CCDS2551.1	2	.	.	.	.	.	.	.	.	.	.	G	19.82	3.898568	0.72639	.	.	ENSG00000176946	ENST00000407315	D	0.96427	-4.01	4.93	4.93	0.64822	Zinc finger, C2CH-type (4);	0.067900	0.56097	D	0.000023	D	0.98523	0.9507	M	0.92649	3.33	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99686	1.1000	10	0.87932	D	0	-32.1135	16.7001	0.85346	0.0:0.0:1.0:0.0	.	49	Q8WY91	THAP4_HUMAN	T	49	ENSP00000385006:P49T	ENSP00000385006:P49T	P	-	1	0	THAP4	242222100	1.000000	0.71417	0.919000	0.36401	0.993000	0.82548	5.668000	0.68074	2.431000	0.82371	0.655000	0.94253	CCC	-	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH		0.463	THAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP4	protein_coding	OTTHUMT00000257267.3	G	NM_015963	-		242573427	-1	no_errors	ENST00000407315	ensembl	human	known	74_37	missense	SNP	0.994	T
TCEA2	6919	genome.wustl.edu	37	20	62699435	62699435	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr20:62699435G>A	ENST00000343484.5	+	4	446	c.277G>A	c.(277-279)Ggc>Agc	p.G93S	TCEA2_ENST00000465111.1_3'UTR|TCEA2_ENST00000395053.3_Missense_Mutation_p.G93S|TCEA2_ENST00000361317.2_Missense_Mutation_p.G66S	NM_003195.4	NP_003186.1	Q15560	TCEA2_HUMAN	transcription elongation factor A (SII), 2	93					DNA-templated transcription, elongation (GO:0006354)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)	centrosome (GO:0005813)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)	12	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)					GCGGGGGAGGGGCATGCCTCT	0.642																																																	0								ENSG00000171703						47.0	43.0	44.0					20																	62699435		2203	4300	6503	TCEA2	SO:0001583	missense	0			-	HGNC	U86749	CCDS13553.1, CCDS13554.1	20q13.33	2011-01-25			ENSG00000171703	ENSG00000171703			11614	protein-coding gene	gene with protein product		604784				9441762, 8566795	Standard	NM_003195		Approved	TFIIS	uc021wgq.1	Q15560	OTTHUMG00000033026	ENST00000343484.5:c.277G>A	20.37:g.62699435G>A	ENSP00000343515:p.Gly93Ser	Somatic	0	48	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	15	34.78	B3KNM1|Q8TD37|Q8TD38	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TFIIS_cen_dom,pfam_TFIIS_N,pfam_Znf_TFIIS,superfamily_TFIIS_cen_dom,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,smart_TFS2M,smart_Znf_TFIIS,pirsf_TF_IIS-rel,pfscan_Znf_TFIIS,tigrfam_TFSII	p.G93S	ENST00000343484.5	37	c.277	CCDS13553.1	20	.	.	.	.	.	.	.	.	.	.	G	2.099	-0.406583	0.04832	.	.	ENSG00000171703	ENST00000361317;ENST00000343484;ENST00000395053;ENST00000339217;ENST00000415602;ENST00000440819;ENST00000458442	.	.	.	2.92	1.97	0.26223	Transcription factor IIS, N-terminal (1);	0.631054	0.16276	N	0.221570	T	0.14570	0.0352	N	0.12182	0.205	0.28067	N	0.93274	B;B;B;B	0.15473	0.0;0.0;0.001;0.013	B;B;B;B	0.14023	0.001;0.001;0.002;0.01	T	0.29336	-1.0015	9	0.06236	T	0.91	-11.7768	4.6702	0.12685	0.3491:0.0:0.6509:0.0	.	93;93;66;93	Q15560;Q6IB64;B3KNM1;Q86VL0	TCEA2_HUMAN;.;.;.	S	66;93;93;66;66;66;66	.	ENSP00000339432:G66S	G	+	1	0	TCEA2	62169879	0.003000	0.15002	0.944000	0.38274	0.733000	0.41908	-0.132000	0.10467	0.819000	0.34492	-0.254000	0.11334	GGC	-	superfamily_TFIIS_N,pirsf_TF_IIS-rel,tigrfam_TFSII		0.642	TCEA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEA2	protein_coding	OTTHUMT00000080277.2	G	NM_198723	-		62699435	+1	no_errors	ENST00000343484	ensembl	human	known	74_37	missense	SNP	0.725	A
OTOF	9381	genome.wustl.edu	37	2	26707374	26707374	+	Missense_Mutation	SNP	C	C	G	rs483353050		TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr2:26707374C>G	ENST00000272371.2	-	12	1299	c.1173G>C	c.(1171-1173)aaG>aaC	p.K391N	OTOF_ENST00000403946.3_Missense_Mutation_p.K391N	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	391					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTCATTGGCCTTGTGGGGCG	0.627																																					GBM(102;732 1451 20652 24062 31372)												0								ENSG00000115155						176.0	138.0	151.0					2																	26707374		2203	4300	6503	OTOF	SO:0001583	missense	0			-	HGNC	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.1173G>C	2.37:g.26707374C>G	ENSP00000272371:p.Lys391Asn	Somatic	0	54	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	4	85.71	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.K391N	ENST00000272371.2	37	c.1173	CCDS1725.1	2	.	.	.	.	.	.	.	.	.	.	C	18.23	3.578979	0.65878	.	.	ENSG00000115155	ENST00000272371;ENST00000403946	T;T	0.81247	-1.47;-1.47	4.84	4.84	0.62591	FerIin domain (1);	0.000000	0.85682	D	0.000000	D	0.89037	0.6601	M	0.88570	2.965	0.51233	D	0.999911	D	0.89917	1.0	D	0.87578	0.998	D	0.88234	0.2905	10	0.37606	T	0.19	-28.1837	7.5876	0.28002	0.0:0.8163:0.0:0.1837	.	391	Q9HC10	OTOF_HUMAN	N	391	ENSP00000272371:K391N;ENSP00000385255:K391N	ENSP00000272371:K391N	K	-	3	2	OTOF	26560878	0.989000	0.36119	1.000000	0.80357	0.958000	0.62258	0.285000	0.18883	2.243000	0.73865	0.462000	0.41574	AAG	-	pfam_FerIin-domain		0.627	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	protein_coding	OTTHUMT00000214047.3	C		-		26707374	-1	no_errors	ENST00000272371	ensembl	human	known	74_37	missense	SNP	1.000	G
KRTAP13-1	140258	genome.wustl.edu	37	21	31768501	31768501	+	Missense_Mutation	SNP	A	A	C			TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr21:31768501A>C	ENST00000355459.2	+	1	110	c.97A>C	c.(97-99)Aac>Cac	p.N33H		NM_181599.2	NP_853630.2	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	33						intermediate filament (GO:0005882)				endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CTACCCCAGCAACCAGGTCTA	0.597																																																	0								ENSG00000198390						121.0	114.0	117.0					21																	31768501		2203	4300	6503	KRTAP13-1	SO:0001583	missense	0			-	HGNC	AJ457066	CCDS13590.2	21q22.11	2013-06-20			ENSG00000198390	ENSG00000198390		"""Keratin associated proteins"""	18924	protein-coding gene	gene with protein product		608718				12359730	Standard	NM_181599		Approved	KAP13.1	uc002yoa.3	Q8IUC0	OTTHUMG00000057800	ENST00000355459.2:c.97A>C	21.37:g.31768501A>C	ENSP00000347635:p.Asn33His	Somatic	0	27	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	23	41.03	Q14D20|Q3LI79	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KRTAP_PMG	p.N33H	ENST00000355459.2	37	c.97	CCDS13590.2	21	.	.	.	.	.	.	.	.	.	.	A	8.341	0.828601	0.16749	.	.	ENSG00000198390	ENST00000355459	T	0.03468	3.92	4.33	0.482	0.16815	.	0.303544	0.22540	N	0.058727	T	0.05410	0.0143	M	0.75447	2.3	0.09310	N	1	P	0.34639	0.461	B	0.38264	0.269	T	0.27088	-1.0084	10	0.59425	D	0.04	.	2.085	0.03644	0.3844:0.3722:0.0951:0.1483	.	33	Q8IUC0	KR131_HUMAN	H	33	ENSP00000347635:N33H	ENSP00000347635:N33H	N	+	1	0	KRTAP13-1	30690372	0.000000	0.05858	0.001000	0.08648	0.039000	0.13416	0.028000	0.13644	0.074000	0.16767	0.528000	0.53228	AAC	-	pfam_KRTAP_PMG		0.597	KRTAP13-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP13-1	protein_coding	OTTHUMT00000128252.3	A		-		31768501	+1	no_errors	ENST00000355459	ensembl	human	known	74_37	missense	SNP	0.004	C
LIPA	3988	genome.wustl.edu	37	10	90988006	90988006	+	Missense_Mutation	SNP	G	G	A	rs140686447		TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr10:90988006G>A	ENST00000336233.5	-	4	701	c.379C>T	c.(379-381)Cgg>Tgg	p.R127W	LIPA_ENST00000456827.1_Missense_Mutation_p.R127W|LIPA_ENST00000371837.1_Missense_Mutation_p.R71W			P38571	LICH_HUMAN	lipase A, lysosomal acid, cholesterol esterase	127					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cytokine production (GO:0001816)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|lung development (GO:0030324)|tissue remodeling (GO:0048771)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	lipase activity (GO:0016298)|sterol esterase activity (GO:0004771)			endometrium(1)|large_intestine(2)|lung(3)	6		Colorectal(252;0.0162)		GBM - Glioblastoma multiforme(2;0.00406)		TTATGTTTCCGAGACCAGGTA	0.438																																																	0								ENSG00000107798	G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	134.0	123.0	127.0		379,379	4.3	1.0	10	dbSNP_134	127	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	LIPA	NM_000235.2,NM_001127605.1	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	127/400,127/400	90988006	1,13005	2203	4300	6503	LIPA	SO:0001583	missense	0			-	HGNC	M74775	CCDS7401.1, CCDS73160.1	10q23.2-q23.3	2012-07-13	2008-08-01		ENSG00000107798	ENSG00000107798	3.1.1.13		6617	protein-coding gene	gene with protein product	"""Wolman disease"""	613497				8432549	Standard	NM_000235		Approved	LAL, CESD	uc009xtq.3	P38571	OTTHUMG00000018716	ENST00000336233.5:c.379C>T	10.37:g.90988006G>A	ENSP00000337354:p.Arg127Trp	Somatic	0	48	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	7	78.79	B2RBH5|D3DR29|Q16529|Q53H21|Q5T074|Q5T771|Q96EJ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AB_hydrolase_1,pfam_AB_hydrolase_lipase	p.R127W	ENST00000336233.5	37	c.379	CCDS7401.1	10	.	.	.	.	.	.	.	.	.	.	G	17.51	3.406683	0.62399	0.0	1.16E-4	ENSG00000107798	ENST00000336233;ENST00000371837;ENST00000371829;ENST00000541980;ENST00000354621;ENST00000456827;ENST00000425287;ENST00000542307;ENST00000428800;ENST00000282673	T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07	4.31	4.31	0.51392	Alpha/beta hydrolase fold-1 (1);	0.122932	0.50627	D	0.000102	D	0.84831	0.5559	H	0.98048	4.135	0.39774	D	0.972201	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.992;0.994;0.995	D	0.88690	0.3208	10	0.87932	D	0	-18.1139	10.2158	0.43168	0.0:0.0:0.6999:0.3001	.	122;71;127	E7EUT7;P38571-2;P38571	.;.;LICH_HUMAN	W	127;71;127;127;85;127;122;127;127;127	ENSP00000337354:R127W;ENSP00000360903:R71W;ENSP00000413019:R127W;ENSP00000388415:R127W;ENSP00000282673:R127W	ENSP00000282673:R127W	R	-	1	2	LIPA	90977986	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	1.698000	0.37794	2.675000	0.91044	0.655000	0.94253	CGG	-	pfam_AB_hydrolase_1		0.438	LIPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPA	protein_coding	OTTHUMT00000049308.1	G	NM_000235	rs140686447		90988006	-1	no_errors	ENST00000336233	ensembl	human	known	74_37	missense	SNP	1.000	A
ALPP	250	genome.wustl.edu	37	2	233243529	233243531	+	In_Frame_Del	DEL	TGC	TGC	-	rs377162921		TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	TGC	TGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr2:233243529_233243531delTGC	ENST00000392027.2	+	1	286_288	c.17_19delTGC	c.(16-21)atgctg>atg	p.L13del	AC068134.8_ENST00000439072.1_RNA|AC068134.8_ENST00000441266.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	13					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		GGGCCCTGCAtgctgctgctgct	0.616																																																	0								ENSG00000163283																																			ALPP	SO:0001651	inframe_deletion	0				HGNC	M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.17_19delTGC	2.37:g.233243538_233243540delTGC	ENSP00000375881:p.Leu13del	Somatic	0	95	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	84	9.68	P05188|P06861|Q53S78|Q96DB7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase,prints_Alkaline_phosphatase	p.L10in_frame_del	ENST00000392027.2	37	c.17_19	CCDS2490.1	2																																																																																			-	NULL		0.616	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPP	protein_coding	OTTHUMT00000257032.3	TGC	NM_001632			233243531	+1	no_errors	ENST00000392027	ensembl	human	known	74_37	in_frame_del	DEL	0.645:0.641:0.627	-
TP53	7157	genome.wustl.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-3B-A9HY-01A-11D-A38Z-09	TCGA-3B-A9HY-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	588bb1bf-5859-4649-b7f2-4b1eb2e85078	0785de42-153c-44f5-8af2-74b38a93a637	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R248W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	GRCh37	CM010465|CM900211	TP53	M	rs121912651	ENSG00000141510						151.0	112.0	125.0					17																	7577539		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	17.37:g.7577539G>A	ENSP00000269305:p.Arg248Trp	Somatic	0	44	0.00		0.7672056477234789	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	5	76.19	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R248W	ENST00000269305.4	37	c.742	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546	rs121912651		7577539	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	A
