#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
MOV10	4343	genome.wustl.edu	37	1	113229666	113229666	+	Intron	SNP	G	G	A			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr1:113229666G>A	ENST00000413052.2	+	3	527				MOV10_ENST00000468624.1_Intron|MOV10_ENST00000369644.1_5'UTR|MOV10_ENST00000357443.2_Intron|MOV10_ENST00000369645.1_Intron	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase						epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		ccactcccctgcttaaaaccc	0.473																																																	0								ENSG00000155363																																			MOV10	SO:0001627	intron_variant	0			-	HGNC	AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.138-1891G>A	1.37:g.113229666G>A		Somatic	0	57	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	55	37.50	Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000413052.2	37	NULL	CCDS853.1	1																																																																																			-	-		0.473	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOV10	protein_coding	OTTHUMT00000032906.1	G	NM_020963	-		113229666	+1	no_errors	ENST00000465579	ensembl	human	known	74_37	rna	SNP	1.000	A
KIAA1919	91749	genome.wustl.edu	37	6	111588190	111588190	+	Silent	SNP	G	G	A			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr6:111588190G>A	ENST00000368847.4	+	4	1778	c.1425G>A	c.(1423-1425)ctG>ctA	p.L475L		NM_153369.2	NP_699200.2	Q5TF39	NAGT1_HUMAN	KIAA1919	475					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			large_intestine(3)|lung(2)|ovary(4)|skin(3)	12		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)		GAAGTAGTCTGACGGAGCCCA	0.398																																																	0								ENSG00000173214						112.0	115.0	114.0					6																	111588190		2203	4300	6503	KIAA1919	SO:0001819	synonymous_variant	0			-	HGNC	BC036115	CCDS5090.1	6q22	2013-10-02			ENSG00000173214	ENSG00000173214			21053	protein-coding gene	gene with protein product							Standard	NM_153369		Approved	MGC33953, MFSD4B	uc003puv.4	Q5TF39	OTTHUMG00000015372	ENST00000368847.4:c.1425G>A	6.37:g.111588190G>A		Somatic	0	70	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	49	22.22	A8K9M0|Q8IYB6|Q96PW9|Q9P0D6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.L475	ENST00000368847.4	37	c.1425	CCDS5090.1	6																																																																																			-	NULL		0.398	KIAA1919-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1919	protein_coding	OTTHUMT00000041827.1	G	NM_153369	-		111588190	+1	no_errors	ENST00000368847	ensembl	human	known	74_37	silent	SNP	0.000	A
GOLGA8I	283796	genome.wustl.edu	37	15	23263805	23263805	+	Intron	SNP	G	G	A			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr15:23263805G>A	ENST00000450802.3	+	14	1374				RN7SL495P_ENST00000461817.2_RNA|AC091565.1_ENST00000459619.1_RNA	NM_001282468.1|NM_001282472.1|NM_001282484.1|NM_001282490.1|NM_001282493.1|NM_001282494.1	NP_001269397.1|NP_001269401.1|NP_001269413.1|NP_001269419.1|NP_001269422.1|NP_001269423.1	A6NC78	GOG8I_HUMAN	golgin A8 family, member I							Golgi apparatus (GO:0005794)|membrane (GO:0016020)											actaagttgggcatcagtgtg	0.557																																																	0								ENSG00000244736																																			RN7SL495P	SO:0001627	intron_variant	0			-	HGNC	AK093104		15q11.2	2013-01-17	2012-10-05	2012-10-05	ENSG00000153666	ENSG00000277561			26660	other	unknown	"""FLJ35785"""		"""golgi autoantigen, golgin subfamily a, 9 pseudogene"", ""golgin A9, pseudogene"", ""golgin A8 family, member I, pseudogene"""	GOLGA9P, GOLGA8IP			Standard	NR_024074		Approved	FLJ35785	uc001yvh.1	A6NC78	OTTHUMG00000129149	ENST00000450802.3:c.1276+138G>A	15.37:g.23263805G>A		Somatic	0	53	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	66	25.84		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000450802.3	37	NULL		15																																																																																			-	-		0.557	GOLGA8I-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	RN7SL495P	protein_coding	OTTHUMT00000251213.2	G	NR_024074	-		23263805	+1	no_errors	ENST00000461817	ensembl	human	known	74_37	rna	SNP	0.404	A
LRRC4	64101	genome.wustl.edu	37	7	127668846	127668846	+	Silent	SNP	G	G	T			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr7:127668846G>T	ENST00000249363.3	-	2	2105	c.1848C>A	c.(1846-1848)gcC>gcA	p.A616A	SND1_ENST00000354725.3_Intron	NM_022143.4	NP_071426.1	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4	616					postsynaptic density protein 95 clustering (GO:0097119)|regulation of synapse organization (GO:0050807)|synapse organization (GO:0050808)	cell junction (GO:0030054)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(4)|pancreas(1)|skin(2)	26				Lung(243;0.124)		CTGTCCAGTGGGCCCCATGTG	0.512																																																	0								ENSG00000128594						129.0	130.0	129.0					7																	127668846		2203	4300	6503	LRRC4	SO:0001819	synonymous_variant	0			-	HGNC	AF196976	CCDS5799.1	7q31	2013-01-14	2003-11-19		ENSG00000128594	ENSG00000128594		"""Immunoglobulin superfamily / I-set domain containing"""	15586	protein-coding gene	gene with protein product		610486	"""leucine-rich repeat-containing 4"""			12969517	Standard	NM_022143		Approved	NAG14	uc003vmk.3	Q9HBW1	OTTHUMG00000157563	ENST00000249363.3:c.1848C>A	7.37:g.127668846G>T		Somatic	0	49	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	34	32.00	A4D0Y9|Q14DU9|Q6ZMI8|Q96A85	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A616	ENST00000249363.3	37	c.1848	CCDS5799.1	7																																																																																			-	NULL		0.512	LRRC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC4	protein_coding	OTTHUMT00000349170.1	G	NM_022143	-		127668846	-1	no_errors	ENST00000249363	ensembl	human	known	74_37	silent	SNP	1.000	T
TMEM101	84336	genome.wustl.edu	37	17	42089353	42089353	+	Silent	SNP	G	G	T			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr17:42089353G>T	ENST00000589334.1	-	5	1032	c.717C>A	c.(715-717)ctC>ctA	p.L239L	TMEM101_ENST00000206380.3_Silent_p.L239L|TMEM101_ENST00000542039.1_Silent_p.L181L			Q96IK0	TM101_HUMAN	transmembrane protein 101	239					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		Breast(137;0.0264)|Prostate(33;0.0861)		BRCA - Breast invasive adenocarcinoma(366;0.113)		TCTCTCCAAGGAGCTTCATCT	0.552																																																	0								ENSG00000091947						100.0	87.0	91.0					17																	42089353		2203	4300	6503	TMEM101	SO:0001819	synonymous_variant	0			-	HGNC	AK172826	CCDS11474.1	17q21.31	2005-12-16							28653	protein-coding gene	gene with protein product						12761501	Standard	NM_032376		Approved	MGC4251, FLJ23987	uc002ieu.3	Q96IK0		ENST00000589334.1:c.717C>A	17.37:g.42089353G>T		Somatic	0	31	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	B2R9N6	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L239	ENST00000589334.1	37	c.717	CCDS11474.1	17																																																																																			-	NULL		0.552	TMEM101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM101	protein_coding	OTTHUMT00000457665.1	G	NM_032376	-		42089353	-1	no_errors	ENST00000206380	ensembl	human	known	74_37	silent	SNP	1.000	T
DIS3L2	129563	genome.wustl.edu	37	2	232995570	232995570	+	3'UTR	DEL	A	A	-			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr2:232995570delA	ENST00000409401.3	+	0	1018				DIS3L2_ENST00000409307.1_Intron|DIS3L2_ENST00000470087.1_3'UTR|DIS3L2_ENST00000273009.6_Intron|DIS3L2_ENST00000360410.4_Intron|DIS3L2_ENST00000325385.7_Intron	NM_001257282.1	NP_001244211.1			DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		aaagtgaattaaaaaaaaaaa	0.353																																																	0								ENSG00000144535																																			DIS3L2	SO:0001624	3_prime_UTR_variant	0				HGNC	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409401.3:c.*93A>-	2.37:g.232995570delA		Somatic	0	27	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000409401.3	37	NULL	CCDS58753.1	2																																																																																			-	-		0.353	DIS3L2-003	KNOWN	basic|CCDS	protein_coding	DIS3L2	protein_coding	OTTHUMT00000330976.1	A	NM_152383			232995570	+1	no_errors	ENST00000470087	ensembl	human	known	74_37	rna	DEL	0.000	-
RP11-402P6.11	0	genome.wustl.edu	37	X	70979276	70979276	+	lincRNA	SNP	A	A	G	rs67643106|rs199772875		TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chrX:70979276A>G	ENST00000439926.1	-	0	440				BX276092.1_ENST00000408757.1_RNA																							gcgcgcgcgcacacacacaca	0.557													.|||	200	0.0529801	0.0454	0.0562	3775	,	,		12359	0.0188		0.0557	False		,,,				2504	0.0266																0								ENSG00000221684																																			BX276092.1			0			-	Clone_based_ensembl_gene																													X.37:g.70979276A>G		Somatic	0	39	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	39	13.33		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000439926.1	37	NULL		X																																																																																			-	-		0.557	RP11-402P6.11-001	KNOWN	basic	lincRNA	ENSG00000221684	lincRNA	OTTHUMT00000057168.1	A		rs67643106		70979276	-1	no_errors	ENST00000408757	ensembl	human	novel	74_37	rna	SNP	0.001	G
ADAM21P1	145241	genome.wustl.edu	37	14	70714087	70714087	+	RNA	SNP	T	T	G	rs79122905		TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr14:70714087T>G	ENST00000530196.1	-	0	431					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		CCTCCAGGAGTGCACGCTCAT	0.507																																																	0								ENSG00000235812																																			ADAM21P1			0			-	HGNC			14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70714087T>G		Somatic	0	47	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	52	14.75		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			-	-		0.507	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	pseudogene	OTTHUMT00000390451.1	T	NG_002467	rs79122905		70714087	-1	no_errors	ENST00000530196	ensembl	human	known	74_37	rna	SNP	0.001	G
LRRC4	64101	genome.wustl.edu	37	7	127668847	127668847	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr7:127668847G>A	ENST00000249363.3	-	2	2104	c.1847C>T	c.(1846-1848)gCc>gTc	p.A616V	SND1_ENST00000354725.3_Intron	NM_022143.4	NP_071426.1	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4	616					postsynaptic density protein 95 clustering (GO:0097119)|regulation of synapse organization (GO:0050807)|synapse organization (GO:0050808)	cell junction (GO:0030054)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(4)|pancreas(1)|skin(2)	26				Lung(243;0.124)		TGTCCAGTGGGCCCCATGTGC	0.512																																																	0								ENSG00000128594						130.0	130.0	130.0					7																	127668847		2203	4300	6503	LRRC4	SO:0001583	missense	0			-	HGNC	AF196976	CCDS5799.1	7q31	2013-01-14	2003-11-19		ENSG00000128594	ENSG00000128594		"""Immunoglobulin superfamily / I-set domain containing"""	15586	protein-coding gene	gene with protein product		610486	"""leucine-rich repeat-containing 4"""			12969517	Standard	NM_022143		Approved	NAG14	uc003vmk.3	Q9HBW1	OTTHUMG00000157563	ENST00000249363.3:c.1847C>T	7.37:g.127668847G>A	ENSP00000249363:p.Ala616Val	Somatic	0	47	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	33	34.00	A4D0Y9|Q14DU9|Q6ZMI8|Q96A85	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A616V	ENST00000249363.3	37	c.1847	CCDS5799.1	7	.	.	.	.	.	.	.	.	.	.	G	14.36	2.512786	0.44660	.	.	ENSG00000128594	ENST00000249363	T	0.40756	1.02	3.85	3.85	0.44370	.	0.000000	0.64402	U	0.000003	T	0.44222	0.1283	L	0.55481	1.735	0.58432	D	0.999999	P	0.45594	0.862	P	0.46850	0.529	T	0.34329	-0.9833	10	0.31617	T	0.26	.	13.6461	0.62281	0.0:0.0:1.0:0.0	.	616	Q9HBW1	LRRC4_HUMAN	V	616	ENSP00000249363:A616V	ENSP00000249363:A616V	A	-	2	0	LRRC4	127456083	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.909000	0.48758	2.140000	0.66376	0.561000	0.74099	GCC	-	NULL		0.512	LRRC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC4	protein_coding	OTTHUMT00000349170.1	G	NM_022143	-		127668847	-1	no_errors	ENST00000249363	ensembl	human	known	74_37	missense	SNP	1.000	A
ATR	545	genome.wustl.edu	37	3	142277619	142277619	+	Splice_Site	SNP	C	C	T			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr3:142277619C>T	ENST00000350721.4	-	8	1854		c.e8-1		ATR_ENST00000383101.3_Splice_Site	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase						cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						GAACTGTTTACTACAGAAGCA	0.289								Other conserved DNA damage response genes																																									0								ENSG00000175054						117.0	127.0	124.0					3																	142277619		2203	4300	6503	ATR	SO:0001630	splice_region_variant	0			-	HGNC	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.1733-1G>A	3.37:g.142277619C>T		Somatic	0	113	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	87	33.83	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e8-1	ENST00000350721.4	37	c.1733-1	CCDS3124.1	3	.	.	.	.	.	.	.	.	.	.	C	20.2	3.957983	0.73902	.	.	ENSG00000175054	ENST00000350721;ENST00000383101;ENST00000515149	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.973	0.97292	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATR	143760309	1.000000	0.71417	0.993000	0.49108	0.929000	0.56500	4.043000	0.57354	2.885000	0.99019	0.655000	0.94253	.	-	-		0.289	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATR	protein_coding	OTTHUMT00000353995.2	C	NM_001184	-	Intron	142277619	-1	no_errors	ENST00000350721	ensembl	human	known	74_37	splice_site	SNP	1.000	T
SEMG1	6406	genome.wustl.edu	37	20	43836987	43836987	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr20:43836987C>G	ENST00000372781.3	+	2	1106	c.1049C>G	c.(1048-1050)tCt>tGt	p.S350C	SEMG1_ENST00000244069.6_Missense_Mutation_p.S290C	NM_003007.3	NP_002998.1	P04279	SEMG1_HUMAN	semenogelin I	350	2 X 60 AA tandem repeats, type 1.|Repeat-rich region. {ECO:0000250}.				insemination (GO:0007320)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.0122)				TCATACCAATCTTCAAGTACG	0.398																																																	0								ENSG00000124233						82.0	75.0	78.0					20																	43836987		2203	4300	6503	SEMG1	SO:0001583	missense	0			-	HGNC		CCDS13345.1	20q12-q13.2	2009-08-06			ENSG00000124233	ENSG00000124233			10742	protein-coding gene	gene with protein product	"""semen coagulating protein"", ""cancer/testis antigen 103"""	182140		SEMG		2912989, 15563730	Standard	NM_003007		Approved	CT103		P04279	OTTHUMG00000032565	ENST00000372781.3:c.1049C>G	20.37:g.43836987C>G	ENSP00000361867:p.Ser350Cys	Somatic	0	48	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	53	26.39	Q53ZV0|Q53ZV1|Q53ZV2|Q6X4I9|Q6Y809|Q6Y822|Q6Y823|Q86U64|Q96QM3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Semenogelin	p.S350C	ENST00000372781.3	37	c.1049	CCDS13345.1	20	.	.	.	.	.	.	.	.	.	.	C	0.156	-1.085945	0.01873	.	.	ENSG00000124233	ENST00000244069;ENST00000372781	T;T	0.11821	2.86;2.74	1.13	-2.26	0.06867	.	.	.	.	.	T	0.23965	0.0580	L	0.58302	1.8	0.09310	N	1	B;D	0.76494	0.002;0.999	B;D	0.79784	0.004;0.993	T	0.10042	-1.0647	9	0.36615	T	0.2	.	3.4631	0.07540	0.3423:0.4393:0.2184:0.0	.	290;350	P04279-2;P04279	.;SEMG1_HUMAN	C	290;350	ENSP00000244069:S290C;ENSP00000361867:S350C	ENSP00000244069:S290C	S	+	2	0	SEMG1	43270401	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	-0.482000	0.06544	-1.714000	0.01390	-0.714000	0.03626	TCT	-	pfam_Semenogelin		0.398	SEMG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEMG1	protein_coding	OTTHUMT00000079416.3	C	NM_003007	-		43836987	+1	no_errors	ENST00000372781	ensembl	human	known	74_37	missense	SNP	0.000	G
PRKAG2	51422	genome.wustl.edu	37	7	151504030	151504031	+	Intron	INS	-	-	A			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr7:151504030_151504031insA	ENST00000287878.4	-	2	619				PRKAG2_ENST00000392801.2_Intron|RP13-452N2.1_ENST00000462083.2_RNA	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit						ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	ccagcctgggGAAAAAAAAAAG	0.495																																																	0								ENSG00000242048																																			RP13-452N2.1	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.115-20403->T	7.37:g.151504040_151504040dupA		Somatic	0	27	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34	Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000287878.4	37	NULL	CCDS5928.1	7																																																																																			-	-		0.495	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000242048	protein_coding	OTTHUMT00000348440.2	-	NM_016203			151504031	+1	no_errors	ENST00000462083	ensembl	human	known	74_37	rna	INS	0.000:0.004	A
VPS13A	23230	genome.wustl.edu	37	9	79999548	79999550	+	Intron	DEL	TGA	TGA	-	rs142234061|rs373635958		TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	TGA	TGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr9:79999548_79999550delTGA	ENST00000360280.3	+	68	9449				VPS13A_ENST00000376636.3_Intron|VPS13A_ENST00000357409.5_In_Frame_Del_p.D3089del	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)						cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GTAGCAGTAGtgatgatgatgat	0.33																																																	0								ENSG00000197969																																			VPS13A	SO:0001627	intron_variant	0				HGNC	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.9189+2545TGA>-	9.37:g.79999557_79999559delTGA		Somatic	0	22	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.D3083in_frame_del	ENST00000360280.3	37	c.9237_9239	CCDS6655.1	9																																																																																			-	NULL		0.330	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	protein_coding	OTTHUMT00000052753.2	TGA	NM_015186			79999550	+1	no_errors	ENST00000357409	ensembl	human	known	74_37	in_frame_del	DEL	0.999:0.998:0.997	-
NOA1	84273	genome.wustl.edu	37	4	57843743	57843743	+	Silent	SNP	G	G	C			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr4:57843743G>C	ENST00000264230.4	-	1	1246	c.9C>G	c.(7-9)ccC>ccG	p.P3P	POLR2B_ENST00000441246.2_5'Flank|POLR2B_ENST00000314595.5_5'Flank|POLR2B_ENST00000431623.2_5'Flank|POLR2B_ENST00000381227.1_5'Flank	NM_032313.2	NP_115689.1	Q8NC60	NOA1_HUMAN	nitric oxide associated 1	3					apoptotic process (GO:0006915)|GTP catabolic process (GO:0006184)|mitochondrial translation (GO:0032543)|regulation of cell death (GO:0010941)|regulation of cellular respiration (GO:0043457)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)										GTAGGCGAGCGGGCAGCATGA	0.677																																																	0								ENSG00000084092						6.0	6.0	6.0					4																	57843743		2109	4098	6207	NOA1	SO:0001819	synonymous_variant	0			-	HGNC	AK098215	CCDS3510.1	4q12	2013-05-24	2011-10-19	2011-10-19	ENSG00000084092	ENSG00000084092			28473	protein-coding gene	gene with protein product	"""nitric oxide synthase, mitochondrial (putative)"", ""mitochondrial GTPase 3 homolog (S. cerevisiae)"""	614919	"""chromosome 4 open reading frame 14"""	C4orf14		16380119, 2118999, 21771794, 22447445	Standard	NM_032313		Approved	MGC3232, hAtNOS1, hNOA1, MTG3	uc003hck.3	Q8NC60	OTTHUMG00000128773	ENST00000264230.4:c.9C>G	4.37:g.57843743G>C		Somatic	0	45	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	32	25.58	Q8N7L6|Q9BSQ9	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase	p.P3	ENST00000264230.4	37	c.9	CCDS3510.1	4																																																																																			-	NULL		0.677	NOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOA1	protein_coding	OTTHUMT00000250694.2	G	NM_032313	-		57843743	-1	no_errors	ENST00000264230	ensembl	human	known	74_37	silent	SNP	0.000	C
OR5L1	219437	genome.wustl.edu	37	11	55579182	55579182	+	Silent	SNP	A	A	G	rs139708815	byFrequency	TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr11:55579182A>G	ENST00000333973.2	+	1	329	c.240A>G	c.(238-240)aaA>aaG	p.K80K		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	80						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K80K(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				TTGTGCCAAAAATGTTGGCTA	0.458																																																	1	Substitution - coding silent(1)	pancreas(1)						ENSG00000186117						234.0	216.0	222.0					11																	55579182		2200	4296	6496	OR5L1	SO:0001819	synonymous_variant	0			-	HGNC	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.240A>G	11.37:g.55579182A>G		Somatic	0	82	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	99	9.17	B2RNK6|Q6IFD0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K80	ENST00000333973.2	37	c.240	CCDS31509.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.458	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L1	protein_coding	OTTHUMT00000391514.1	A	NM_001004738	rs139708815		55579182	+1	no_errors	ENST00000333973	ensembl	human	known	74_37	silent	SNP	0.000	G
RFX7	64864	genome.wustl.edu	37	15	56535479	56535479	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr15:56535479G>A	ENST00000423270.1	-	1	4	c.5C>T	c.(4-6)gCa>gTa	p.A2V	RFX7_ENST00000559447.2_5'Flank|RFX7_ENST00000422057.1_5'UTR|RFX7_ENST00000317318.6_Missense_Mutation_p.A2V	NM_022841.5	NP_073752.5	Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	0					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						TTGTTCCTCTGCCATCGCTGC	0.692																																																	0								ENSG00000181827						9.0	11.0	10.0					15																	56535479		1822	3966	5788	RFX7	SO:0001583	missense	0			-	HGNC			15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000423270.1:c.5C>T	15.37:g.56535479G>A	ENSP00000397644:p.Ala2Val	Somatic	0	48	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	49	25.76	Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA-bd_RFX	p.A2V	ENST00000423270.1	37	c.5		15	.	.	.	.	.	.	.	.	.	.	G	18.75	3.689689	0.68271	.	.	ENSG00000181827	ENST00000317318;ENST00000423270	T;T	0.56103	0.48;0.49	2.86	2.86	0.33363	.	.	.	.	.	T	0.62636	0.2444	.	.	.	0.41956	D	0.990686	.	.	.	.	.	.	T	0.68112	-0.5495	6	0.87932	D	0	.	11.4803	0.50322	0.0:0.0:1.0:0.0	.	.	.	.	V	2	ENSP00000313299:A2V;ENSP00000397644:A2V	ENSP00000313299:A2V	A	-	2	0	RFX7	54322771	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.682000	0.61671	1.610000	0.50200	0.460000	0.39030	GCA	-	NULL		0.692	RFX7-203	KNOWN	basic|appris_principal	protein_coding	RFX7	protein_coding		G	NM_022841	-		56535479	-1	no_errors	ENST00000423270	ensembl	human	known	74_37	missense	SNP	1.000	A
KRT1	3848	genome.wustl.edu	37	12	53069223	53069243	+	In_Frame_Del	DEL	ACCTCCGGAGCCGTAGCTGCT	ACCTCCGGAGCCGTAGCTGCT	-	rs77846840|rs540699806|rs11170232|rs370799361|rs267607656	byFrequency	TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	ACCTCCGGAGCCGTAGCTGCT	ACCTCCGGAGCCGTAGCTGCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr12:53069223_53069243delACCTCCGGAGCCGTAGCTGCT	ENST00000252244.3	-	9	1727_1747	c.1669_1689delAGCAGCTACGGCTCCGGAGGT	c.(1669-1689)agcagctacggctccggaggtdel	p.SSYGSGG557del		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	557	Gly/Ser-rich.|Tail.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)	p.S557_G563delSSYGSGG(3)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						catagctgccacctccggagccgtagctgctacctccggag	0.697														1779	0.355232	0.4372	0.3905	5008	,	,		11351	0.1349		0.3459	False		,,,				2504	0.456																3	Deletion - In frame(3)	prostate(2)|central_nervous_system(1)						ENSG00000167768			1255,1949		405,445,752						0.8	0.1		dbSNP_130	5	2781,3759		866,1049,1355	no	coding	KRT1	NM_006121.3		1271,1494,2107	A1A1,A1R,RR		42.5229,39.1698,41.4204				4036,5708				KRT1	SO:0001651	inframe_deletion	0				HGNC	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1669_1689delAGCAGCTACGGCTCCGGAGGT	12.37:g.53069223_53069243delACCTCCGGAGCCGTAGCTGCT	ENSP00000252244:p.Ser557_Gly563del	Somatic	NA	NA	NA		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.SSYGSGG557in_frame_del	ENST00000252244.3	37	c.1689_1669	CCDS8836.1	12																																																																																			-	NULL		0.697	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT1	protein_coding	OTTHUMT00000405706.1	ACCTCCGGAGCCGTAGCTGCT	NM_006121			53069243	-1	no_errors	ENST00000252244	ensembl	human	known	74_37	in_frame_del	DEL	0.630:0.649:0.647:0.620:0.134:0.123:0.092:0.297:0.354:0.356:0.356:0.216:0.007:0.001:0.003:0.006:0.057:0.050:0.289:0.318:0.300	-
CEP192	55125	genome.wustl.edu	37	18	13056253	13056253	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr18:13056253G>A	ENST00000325971.8	+	17	3469	c.1876G>A	c.(1876-1878)Gaa>Aaa	p.E626K	CEP192_ENST00000506447.1_Missense_Mutation_p.E1222K|CEP192_ENST00000430049.2_Missense_Mutation_p.E747K			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	626					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GACCACCTCTGAAAACCAGTG	0.502																																																	0								ENSG00000101639						64.0	61.0	62.0					18																	13056253		2203	4300	6503	CEP192	SO:0001583	missense	0			-	HGNC	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.1876G>A	18.37:g.13056253G>A	ENSP00000317156:p.Glu626Lys	Somatic	0	20	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	14	39.13	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E1222K	ENST00000325971.8	37	c.3664		18	.	.	.	.	.	.	.	.	.	.	G	11.52	1.664458	0.29604	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.05580	3.42;3.42;3.42	5.11	-0.336	0.12658	.	1.131130	0.06761	N	0.781855	T	0.02929	0.0087	N	0.08118	0	0.09310	N	1	B;B;B	0.22003	0.014;0.063;0.063	B;B;B	0.21917	0.01;0.037;0.023	T	0.47611	-0.9104	10	0.11485	T	0.65	-0.2974	4.3179	0.11002	0.2903:0.0:0.4611:0.2486	.	747;1222;626	C9JT09;E9PF99;Q8TEP8	.;.;CE192_HUMAN	K	1222;626;626;747	ENSP00000427550:E1222K;ENSP00000317156:E626K;ENSP00000389190:E747K	ENSP00000317156:E626K	E	+	1	0	CEP192	13046253	0.002000	0.14202	0.000000	0.03702	0.061000	0.15899	1.152000	0.31663	0.160000	0.19432	0.563000	0.77884	GAA	-	NULL		0.502	CEP192-201	KNOWN	basic	protein_coding	CEP192	protein_coding		G	NM_032142	-		13056253	+1	no_errors	ENST00000506447	ensembl	human	known	74_37	missense	SNP	0.000	A
PVRL2	5819	genome.wustl.edu	37	19	45381598	45381600	+	Intron	DEL	GAG	GAG	-	rs375813744		TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr19:45381598_45381600delGAG	ENST00000252483.5	+	5	1042				PVRL2_ENST00000252485.4_In_Frame_Del_p.R391del	NM_001042724.1	NP_001036189.1	Q92692	PVRL2_HUMAN	poliovirus receptor-related 2 (herpesvirus entry mediator B)						acrosome assembly (GO:0001675)|adherens junction organization (GO:0034332)|adhesion of symbiont to host (GO:0044406)|cell junction assembly (GO:0034329)|cell part morphogenesis (GO:0032990)|cell-cell junction organization (GO:0045216)|cilium organization (GO:0044782)|coreceptor-mediated virion attachment to host cell (GO:0046814)|cytoskeleton organization (GO:0007010)|establishment of mitochondrion localization (GO:0051654)|fertilization (GO:0009566)|fusion of virus membrane with host plasma membrane (GO:0019064)|homophilic cell adhesion (GO:0007156)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|sperm mitochondrion organization (GO:0030382)|spermatid development (GO:0007286)|spermatid nucleus differentiation (GO:0007289)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|large_intestine(6)|lung(5)	13	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		TGCTgagggtgaggaggaggagg	0.665																																																	0								ENSG00000130202		,	4,172,3746		0,0,4,17,138,1802					,	-2.1	1.0			26	34,410,7168		2,1,29,23,363,3388	no	codingComplex,intron	PVRL2	NM_002856.2,NM_001042724.1	,	2,1,33,40,501,5190	A1A1,A1A2,A1R,A2A2,A2R,RR		5.8329,4.4875,5.3754	,	,		38,582,10914				PVRL2	SO:0001627	intron_variant	0				HGNC	X80038	CCDS12645.1, CCDS42576.1	19q13.32	2013-01-29			ENSG00000130202	ENSG00000130202		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9707	protein-coding gene	gene with protein product		600798		HVEB		7622062, 10196354	Standard	NM_001042724		Approved	PVRR2, PRR2, CD112	uc002ozw.1	Q92692	OTTHUMG00000180839	ENST00000252483.5:c.1042+3863GAG>-	19.37:g.45381607_45381609delGAG		Somatic	0	43	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	51	8.93	A8K5L5|O75455|Q6IBI6|Q96J29	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_CD80_C2-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.R391in_frame_del	ENST00000252483.5	37	c.1161_1163	CCDS42576.1	19																																																																																			-	NULL		0.665	PVRL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PVRL2	protein_coding	OTTHUMT00000453231.1	GAG	NM_002856			45381600	+1	no_errors	ENST00000252485	ensembl	human	known	74_37	in_frame_del	DEL	0.999:1.000:1.000	-
C16orf62	57020	genome.wustl.edu	37	16	19663381	19663381	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr16:19663381G>T	ENST00000251143.5	+	26	2202	c.2190G>T	c.(2188-2190)caG>caT	p.Q730H	C16orf62_ENST00000543152.1_Missense_Mutation_p.Q479H|C16orf62_ENST00000448695.1_Missense_Mutation_p.Q580H|C16orf62_ENST00000544275.1_3'UTR|C16orf62_ENST00000438132.3_Missense_Mutation_p.Q819H|C16orf62_ENST00000417362.2_Missense_Mutation_p.Q637H|C16orf62_ENST00000542263.1_Missense_Mutation_p.Q726H			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	730						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						ATTCTGGTCAGGTGGCCTTGG	0.547																																																	0								ENSG00000103544						139.0	100.0	114.0					16																	19663381		2197	4300	6497	C16orf62	SO:0001583	missense	0			-	HGNC		CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.2190G>T	16.37:g.19663381G>T	ENSP00000251143:p.Gln730His	Somatic	0	44	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	29	42.00	A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q819H	ENST00000251143.5	37	c.2457		16	.	.	.	.	.	.	.	.	.	.	G	25.9	4.689429	0.88735	.	.	ENSG00000103544	ENST00000438132;ENST00000542263;ENST00000251143;ENST00000417362;ENST00000448695	T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.69628	0.3132	M	0.74881	2.28	0.80722	D	1	D;D	0.71674	0.994;0.998	D;D	0.80764	0.991;0.994	T	0.67791	-0.5579	9	.	.	.	-29.6481	18.0345	0.89296	0.0:0.0:1.0:0.0	.	726;730	F5H7K1;Q7Z3J2	.;CP062_HUMAN	H	819;726;730;637;580	ENSP00000400815:Q819H;ENSP00000442468:Q726H;ENSP00000251143:Q730H;ENSP00000395973:Q637H;ENSP00000398009:Q580H	.	Q	+	3	2	C16orf62	19570882	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.063000	0.71162	2.865000	0.98341	0.655000	0.94253	CAG	-	NULL		0.547	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	C16orf62	protein_coding		G	NM_020314	-		19663381	+1	no_errors	ENST00000438132	ensembl	human	known	74_37	missense	SNP	1.000	T
ST8SIA4	7903	genome.wustl.edu	37	5	100192092	100192092	+	Missense_Mutation	SNP	A	A	T			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr5:100192092A>T	ENST00000231461.5	-	4	822	c.512T>A	c.(511-513)cTa>cAa	p.L171Q		NM_005668.4	NP_005659.1	Q92187	SIA8D_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4	171					axon guidance (GO:0007411)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	25		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)		COAD - Colon adenocarcinoma(37;0.00402)		CACAGGAGCTAGATTACACCT	0.353																																																	0								ENSG00000113532						51.0	50.0	50.0					5																	100192092		2203	4300	6503	ST8SIA4	SO:0001583	missense	0			-	HGNC	L41680	CCDS4091.1, CCDS47252.1	5q21	2013-03-01	2003-01-14	2005-02-07	ENSG00000113532	ENSG00000113532		"""Sialyltransferases"""	10871	protein-coding gene	gene with protein product	"""ST8Sia IV"""	602547	"""sialyltransferase 8 (alpha-2, 8-polysialytransferase) D"""	SIAT8D		7624364	Standard	NM_005668		Approved	PST, PST1	uc003knk.3	Q92187	OTTHUMG00000128727	ENST00000231461.5:c.512T>A	5.37:g.100192092A>T	ENSP00000231461:p.Leu171Gln	Somatic	0	28	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	27	34.15	A8KA07|G3V104|Q8N1F4|Q92693	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.L171Q	ENST00000231461.5	37	c.512	CCDS4091.1	5	.	.	.	.	.	.	.	.	.	.	A	21.4	4.142296	0.77775	.	.	ENSG00000113532	ENST00000231461	T	0.32753	1.44	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000008	T	0.56673	0.2001	M	0.81179	2.53	0.80722	D	1	D	0.64830	0.994	D	0.69479	0.964	T	0.61178	-0.7115	10	0.56958	D	0.05	.	14.6008	0.68441	1.0:0.0:0.0:0.0	.	171	Q92187	SIA8D_HUMAN	Q	171	ENSP00000231461:L171Q	ENSP00000231461:L171Q	L	-	2	0	ST8SIA4	100219991	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.100000	0.94213	2.220000	0.72140	0.482000	0.46254	CTA	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans		0.353	ST8SIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST8SIA4	protein_coding	OTTHUMT00000250632.3	A	NM_005668	-		100192092	-1	no_errors	ENST00000231461	ensembl	human	known	74_37	missense	SNP	1.000	T
OR4C5	79346	genome.wustl.edu	37	11	48387258	48387258	+	Missense_Mutation	SNP	C	C	T	rs78030134		TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr11:48387258C>T	ENST00000319813.3	-	1	759	c.760G>A	c.(760-762)Gcc>Acc	p.A254T				Q8NGB2	OR4C5_HUMAN	olfactory receptor, family 4, subfamily C, member 5	254						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										ATATGGAAGGCGCAGGTAGAG	0.458																																																	0								ENSG00000176540																																			OR4C5	SO:0001583	missense	0			-	HGNC			11p11.2	2013-03-27	2004-03-04	2004-03-05	ENSG00000176540	ENSG00000176540		"""GPCR / Class A : Olfactory receptors"""	14702	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 5 pseudogene"""	OR4C5P			Standard	NG_002247		Approved	OR4C5Q		Q8NGB2	OTTHUMG00000169462	ENST00000319813.3:c.760G>A	11.37:g.48387258C>T	ENSP00000321338:p.Ala254Thr	Somatic	0	53	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	88	14.42	Q6IFB2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A254T	ENST00000319813.3	37	c.760		11	.	.	.	.	.	.	.	.	.	.	C	9.594	1.126928	0.20959	.	.	ENSG00000176540	ENST00000319813	T	0.36878	1.23	5.45	-1.18	0.09617	.	0.766856	0.11868	N	0.521706	T	0.14270	0.0345	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25117	-1.0141	7	0.12766	T	0.61	.	2.2861	0.04126	0.1182:0.3925:0.116:0.3733	.	.	.	.	T	254	ENSP00000321338:A254T	ENSP00000321338:A254T	A	-	1	0	OR4C5	48343834	0.000000	0.05858	0.549000	0.28204	0.683000	0.39861	-2.926000	0.00691	-0.081000	0.12662	-0.341000	0.08007	GCC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.458	OR4C5-001	KNOWN	basic|appris_principal	protein_coding	OR4C5	protein_coding	OTTHUMT00000404174.1	C	NG_002247	rs78030134		48387258	-1	no_errors	ENST00000319813	ensembl	human	known	74_37	missense	SNP	0.001	T
OR4C5	79346	genome.wustl.edu	37	11	48387279	48387279	+	Missense_Mutation	SNP	G	G	A	rs76306144	byFrequency	TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr11:48387279G>A	ENST00000319813.3	-	1	738	c.739C>T	c.(739-741)Cgg>Tgg	p.R247W				Q8NGB2	OR4C5_HUMAN	olfactory receptor, family 4, subfamily C, member 5	247						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										AGAGCCTTCCGCTGTGAGCAG	0.463													g|||	2	0.000399361	0.0008	0.0014	5008	,	,		20006	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000176540																																			OR4C5	SO:0001583	missense	0			-	HGNC			11p11.2	2013-03-27	2004-03-04	2004-03-05	ENSG00000176540	ENSG00000176540		"""GPCR / Class A : Olfactory receptors"""	14702	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 5 pseudogene"""	OR4C5P			Standard	NG_002247		Approved	OR4C5Q		Q8NGB2	OTTHUMG00000169462	ENST00000319813.3:c.739C>T	11.37:g.48387279G>A	ENSP00000321338:p.Arg247Trp	Somatic	0	55	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	72	13.25	Q6IFB2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R247W	ENST00000319813.3	37	c.739		11	.	.	.	.	.	.	.	.	.	.	G	11.25	1.582118	0.28180	.	.	ENSG00000176540	ENST00000319813	T	0.00164	8.64	5.45	0.313	0.15842	.	1.504080	0.03979	N	0.292964	T	0.00178	0.0005	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23691	-1.0181	7	0.87932	D	0	.	5.2302	0.15418	0.2982:0.0:0.5694:0.1324	.	.	.	.	W	247	ENSP00000321338:R247W	ENSP00000321338:R247W	R	-	1	2	OR4C5	48343855	0.000000	0.05858	0.000000	0.03702	0.711000	0.40976	-1.402000	0.02499	-0.095000	0.12351	-0.262000	0.10625	CGG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.463	OR4C5-001	KNOWN	basic|appris_principal	protein_coding	OR4C5	protein_coding	OTTHUMT00000404174.1	G	NG_002247	rs76306144		48387279	-1	no_errors	ENST00000319813	ensembl	human	known	74_37	missense	SNP	0.000	A
OTOF	9381	genome.wustl.edu	37	2	26750774	26750774	+	Silent	SNP	C	C	T			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr2:26750774C>T	ENST00000272371.2	-	3	279	c.153G>A	c.(151-153)ccG>ccA	p.P51P	OTOF_ENST00000403946.3_Silent_p.P51P	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	51					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCTGGCCACCGGCCACCGAA	0.557																																					GBM(102;732 1451 20652 24062 31372)												0								ENSG00000115155						68.0	69.0	69.0					2																	26750774		2203	4300	6503	OTOF	SO:0001819	synonymous_variant	0			-	HGNC	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.153G>A	2.37:g.26750774C>T		Somatic	0	56	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	33	48.48	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.P51	ENST00000272371.2	37	c.153	CCDS1725.1	2																																																																																			-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom		0.557	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	protein_coding	OTTHUMT00000214047.3	C		-		26750774	-1	no_errors	ENST00000272371	ensembl	human	known	74_37	silent	SNP	0.007	T
LNPEP	4012	genome.wustl.edu	37	5	96271359	96271359	+	5'UTR	SNP	G	G	A			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr5:96271359G>A	ENST00000231368.5	+	0	192				LNPEP_ENST00000395784.1_3'UTR|CTD-2260A17.2_ENST00000501338.1_5'UTR	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		TCGCAGCGGGGCACTGACTTT	0.527																																																	0								ENSG00000247121																																			CTD-2260A17.2	SO:0001623	5_prime_UTR_variant	0			-	Clone_based_vega_gene	D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.-501G>A	5.37:g.96271359G>A		Somatic	0	37	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000231368.5	37	NULL	CCDS4087.1	5																																																																																			-	-		0.527	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000247121	protein_coding	OTTHUMT00000250624.1	G	NM_005575	-		96271359	-1	no_errors	ENST00000501338	ensembl	human	known	74_37	rna	SNP	0.016	A
KIAA1731	85459	genome.wustl.edu	37	11	93463686	93463686	+	IGR	SNP	T	T	G	rs11557555		TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr11:93463686T>G	ENST00000325212.6	+	0	8055				SNORA25_ENST00000384384.1_RNA|SNORA8_ENST00000384574.1_RNA|SNORA18_ENST00000384416.1_RNA|SNORA1_ENST00000384107.1_RNA|TAF1D_ENST00000546088.1_Intron|SNORA32_ENST00000384072.1_RNA|SNORD6_ENST00000365444.1_RNA|SNORD5_ENST00000459342.1_RNA			Q9C0D2	K1731_HUMAN	KIAA1731							centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ACGTTTTATATCTCCTCAGGA	0.383																																																	0								ENSG00000207112						85.0	86.0	86.0					11																	93463686		874	1989	2863	SNORA25	SO:0001628	intergenic_variant	0			-	HGNC	AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449		11.37:g.93463686T>G		Somatic	0	77	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	80	20.00	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000325212.6	37	NULL	CCDS44708.1	11																																																																																			-	-		0.383	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SNORA25	protein_coding	OTTHUMT00000394640.1	T	NM_033395	-		93463686	-1	no_errors	ENST00000384384	ensembl	human	known	74_37	rna	SNP	0.290	G
PTEN	5728	genome.wustl.edu	37	10	89692791	89692791	+	Missense_Mutation	SNP	A	A	T			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr10:89692791A>T	ENST00000371953.3	+	5	1632	c.275A>T	c.(274-276)gAc>gTc	p.D92V		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	92	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(5)|p.R55fs*1(5)|p.D92G(3)|p.D92V(2)|p.Y27fs*1(2)|p.Q87_P96del(1)|p.D92A(1)|p.N82_P95del(1)|p.F56fs*2(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CCTTTTGAAGACCATAACCCA	0.333		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																													yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	58	Whole gene deletion(37)|Deletion - Frameshift(8)|Substitution - Missense(6)|Unknown(5)|Deletion - In frame(2)	prostate(16)|central_nervous_system(12)|lung(6)|skin(6)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|soft_tissue(1)|urinary_tract(1)						ENSG00000171862						111.0	102.0	105.0					10																	89692791		2203	4300	6503	PTEN	SO:0001583	missense	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	-	HGNC	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.275A>T	10.37:g.89692791A>T	ENSP00000361021:p.Asp92Val	Somatic	0	46	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	23	46.67	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_dom,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.D92V	ENST00000371953.3	37	c.275	CCDS31238.1	10	.	.	.	.	.	.	.	.	.	.	A	23.7	4.449189	0.84101	.	.	ENSG00000171862	ENST00000371953	D	0.99470	-5.96	5.07	5.07	0.68467	Phosphatase tensin type (1);Dual specificity phosphatase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99664	0.9875	H	0.95574	3.69	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97487	1.0051	9	.	.	.	-9.7034	14.8406	0.70220	1.0:0.0:0.0:0.0	.	92	P60484	PTEN_HUMAN	V	92	ENSP00000361021:D92V	.	D	+	2	0	PTEN	89682771	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.914000	0.92735	1.880000	0.54463	0.533000	0.62120	GAC	-	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Phosphatase_tensin-typ		0.333	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	protein_coding	OTTHUMT00000049241.1	A	NM_000314	-		89692791	+1	no_errors	ENST00000371953	ensembl	human	known	74_37	missense	SNP	1.000	T
CNOT8	9337	genome.wustl.edu	37	5	154252173	154252173	+	Missense_Mutation	SNP	T	T	G	rs368235746		TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr5:154252173T>G	ENST00000517876.1	+	7	1167	c.691T>G	c.(691-693)Tca>Gca	p.S231A	CNOT8_ENST00000519404.1_Missense_Mutation_p.S177A|CNOT8_ENST00000285896.6_Missense_Mutation_p.S231A|CNOT8_ENST00000523698.1_Missense_Mutation_p.S125A|CNOT8_ENST00000520671.1_Missense_Mutation_p.S125A|CNOT8_ENST00000521450.1_Missense_Mutation_p.S125A|CNOT8_ENST00000521583.1_Missense_Mutation_p.S125A|CNOT8_ENST00000403027.2_Missense_Mutation_p.S231A|CNOT8_ENST00000524105.1_Missense_Mutation_p.S67A			Q9UFF9	CNOT8_HUMAN	CCR4-NOT transcription complex, subunit 8	231					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|gene silencing by miRNA (GO:0035195)|mRNA metabolic process (GO:0016071)|negative regulation of cell proliferation (GO:0008285)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	10	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AGGCTCAGACTCACTGCTGAC	0.483																																					NSCLC(140;1804 1895 27149 29895 35312)												0								ENSG00000155508						117.0	110.0	113.0					5																	154252173		2203	4300	6503	CNOT8	SO:0001583	missense	0			-	HGNC	AF053318	CCDS4329.1, CCDS75361.1	5q31-q33	2008-07-18			ENSG00000155508	ENSG00000155508			9207	protein-coding gene	gene with protein product	"""PGK promoter directed over production"""	603731		POP2		10036195, 10637334	Standard	XM_005268527		Approved	CAF1, hCAF1, CALIF	uc003lvw.3	Q9UFF9	OTTHUMG00000130192	ENST00000517876.1:c.691T>G	5.37:g.154252173T>G	ENSP00000430493:p.Ser231Ala	Somatic	0	79	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	73	24.74	B0AZS3|B2RAR8|B7Z8R1|D3DQI8|O95709|Q7Z521|Q9H6Y1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNase_CAF1,superfamily_RNaseH-like_dom	p.S231A	ENST00000517876.1	37	c.691	CCDS4329.1	5	.	.	.	.	.	.	.	.	.	.	T	17.87	3.493858	0.64186	.	.	ENSG00000155508	ENST00000523698;ENST00000517876;ENST00000521450;ENST00000403027;ENST00000524105;ENST00000285896;ENST00000542339;ENST00000520671;ENST00000521583;ENST00000519404;ENST00000518775	T;T;T;T;T;T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51	5.95	5.95	0.96441	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.41119	0.1145	L	0.47016	1.485	0.80722	D	1	P;B	0.35107	0.484;0.376	B;P	0.46320	0.268;0.512	T	0.16897	-1.0387	10	0.44086	T	0.13	-9.3232	16.4237	0.83790	0.0:0.0:0.0:1.0	.	177;231	B7Z8R1;Q9UFF9	.;CNOT8_HUMAN	A	125;231;125;231;67;231;208;125;125;177;177	ENSP00000428565:S125A;ENSP00000430493:S231A;ENSP00000431034:S125A;ENSP00000384747:S231A;ENSP00000429576:S67A;ENSP00000285896:S231A;ENSP00000428305:S125A;ENSP00000429882:S125A;ENSP00000430833:S177A;ENSP00000429394:S177A	ENSP00000285896:S231A	S	+	1	0	CNOT8	154232366	1.000000	0.71417	0.998000	0.56505	0.540000	0.34992	7.417000	0.80156	2.279000	0.76181	0.533000	0.62120	TCA	-	pfam_RNase_CAF1,superfamily_RNaseH-like_dom		0.483	CNOT8-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CNOT8	protein_coding	OTTHUMT00000377449.1	T	NM_004779	-		154252173	+1	no_errors	ENST00000285896	ensembl	human	known	74_37	missense	SNP	1.000	G
ANAPC2	29882	genome.wustl.edu	37	9	140080800	140080800	+	Missense_Mutation	SNP	A	A	C			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr9:140080800A>C	ENST00000323927.2	-	3	753	c.749T>G	c.(748-750)cTc>cGc	p.L250R	SSNA1_ENST00000322310.5_5'Flank	NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2	250					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		CAGCAGACTGAGCCTGTGTCT	0.672																																																	0								ENSG00000176248						31.0	26.0	27.0					9																	140080800		2199	4297	6496	ANAPC2	SO:0001583	missense	0			-	HGNC	AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.749T>G	9.37:g.140080800A>C	ENSP00000314004:p.Leu250Arg	Somatic	0	70	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	40	41.18	Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cullin_N,pfam_APC_su2_C,superfamily_Cullin_homology,smart_Cullin_homology,pfscan_Cullin_homology	p.L250R	ENST00000323927.2	37	c.749	CCDS7033.1	9	.	.	.	.	.	.	.	.	.	.	A	19.66	3.868556	0.72065	.	.	ENSG00000176248	ENST00000323927	T	0.03065	4.06	3.85	3.85	0.44370	.	0.069486	0.64402	D	0.000012	T	0.08088	0.0202	L	0.52364	1.645	0.80722	D	1	D;D	0.56521	0.959;0.976	P;P	0.52217	0.496;0.693	T	0.06144	-1.0843	10	0.87932	D	0	-25.292	10.9369	0.47251	1.0:0.0:0.0:0.0	.	250;250	Q9UJX6;Q9UJX6-2	ANC2_HUMAN;.	R	250	ENSP00000314004:L250R	ENSP00000314004:L250R	L	-	2	0	ANAPC2	139200621	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.334000	0.90028	1.750000	0.51863	0.459000	0.35465	CTC	-	NULL		0.672	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC2	protein_coding	OTTHUMT00000055315.1	A	NM_013366	-		140080800	-1	no_errors	ENST00000323927	ensembl	human	known	74_37	missense	SNP	1.000	C
AC026369.1	0	genome.wustl.edu	37	12	148078	148078	+	IGR	SNP	G	G	A	rs8181620		TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr12:148078G>A	ENST00000594563.1	+	0	129				FAM138D_ENST00000320165.5_lincRNA																							cacaattgccgtgctccttgg	0.537																																																	0								ENSG00000206114																																			FAM138D	SO:0001628	intergenic_variant	0			-	HGNC																													12.37:g.148078G>A		Somatic	0	13	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	4	50.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000594563.1	37	NULL		12																																																																																			-	-		0.537	AC026369.1-201	NOVEL	basic|appris_principal	protein_coding	FAM138D	protein_coding		G		rs8181620		148078	-1	no_errors	ENST00000320165	ensembl	human	known	74_37	rna	SNP	0.000	A
USP31	57478	genome.wustl.edu	37	16	23119385	23119387	+	In_Frame_Del	DEL	ACT	ACT	-	rs551845061		TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	ACT	ACT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr16:23119385_23119387delACT	ENST00000219689.7	-	2	750_752	c.751_753delAGT	c.(751-753)agtdel	p.S251del		NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	201	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		GAGGCTGGCCACTCTGCTTCACT	0.527																																																	0								ENSG00000103404																																			USP31	SO:0001651	inframe_deletion	0				HGNC	AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.751_753delAGT	16.37:g.23119385_23119387delACT	ENSP00000219689:p.Ser251del	Somatic	0	52	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	60	20.00	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.S251in_frame_del	ENST00000219689.7	37	c.753_751	CCDS10607.1	16																																																																																			-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.527	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP31	protein_coding	OTTHUMT00000211607.1	ACT	NM_020718			23119387	-1	no_errors	ENST00000219689	ensembl	human	known	74_37	in_frame_del	DEL	0.614:0.991:0.997	-
RPGRIP1L	23322	genome.wustl.edu	37	16	53691422	53691422	+	Silent	SNP	C	C	T			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr16:53691422C>T	ENST00000379925.3	-	13	1574	c.1524G>A	c.(1522-1524)gaG>gaA	p.E508E	RPGRIP1L_ENST00000262135.4_Silent_p.E508E|RPGRIP1L_ENST00000564374.1_Silent_p.E508E|RPGRIP1L_ENST00000563746.1_Silent_p.E508E	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	508					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				TCTTTTCCAGCTCTTGCACCG	0.333																																																	0								ENSG00000103494						94.0	86.0	88.0					16																	53691422		2196	4300	6496	RPGRIP1L	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.1524G>A	16.37:g.53691422C>T		Somatic	0	73	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	37	47.89	A0PJ88|Q9Y2K8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3250,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.E508	ENST00000379925.3	37	c.1524	CCDS32447.1	16																																																																																			-	NULL		0.333	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	RPGRIP1L	protein_coding	OTTHUMT00000422187.1	C	NM_015272	-		53691422	-1	no_errors	ENST00000379925	ensembl	human	known	74_37	silent	SNP	1.000	T
MON1A	84315	genome.wustl.edu	37	3	49967152	49967152	+	Silent	SNP	G	G	A			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr3:49967152G>A	ENST00000296473.3	-	1	426	c.168C>T	c.(166-168)cgC>cgT	p.R56R	MON1A_ENST00000455683.2_Silent_p.R56R|MON1A_ENST00000417270.1_5'UTR|MON1A_ENST00000483022.1_5'UTR	NM_032355.3	NP_115731.2	Q86VX9	MON1A_HUMAN	MON1 secretory trafficking family member A	0										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GCACAGCTTCGCGGGGCCCCG	0.716																																																	0								ENSG00000164077						10.0	11.0	11.0					3																	49967152		692	1590	2282	MON1A	SO:0001819	synonymous_variant	0			-	HGNC	AK074404	CCDS2808.2, CCDS46830.1	3p21.31	2013-08-21	2013-08-21		ENSG00000164077	ENSG00000164077			28207	protein-coding gene	gene with protein product		611464	"""MON1 homolog A (yeast)"""			12477932	Standard	NM_032355		Approved	MGC13272, SAND1	uc003cxz.3	Q86VX9	OTTHUMG00000156737	ENST00000296473.3:c.168C>T	3.37:g.49967152G>A		Somatic	0	21	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	14	41.67	B2RDQ1|G5E9N1|Q8NAV7|Q9BRF3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Vacuolar_fusion_protein_MON1,superfamily_Longin-like_dom,prints_Vacuolar_fusion_protein_MON1	p.R56	ENST00000296473.3	37	c.168	CCDS2808.2	3																																																																																			-	NULL		0.716	MON1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON1A	protein_coding	OTTHUMT00000345534.2	G	NM_032355	-		49967152	-1	no_errors	ENST00000296473	ensembl	human	known	74_37	silent	SNP	0.002	A
RP11-531A24.5	0	genome.wustl.edu	37	8	73965434	73965435	+	RNA	INS	-	-	GTTTTGTTTTGTTTT	rs373359905|rs141422515|rs7826991		TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr8:73965434_73965435insGTTTTGTTTTGTTTT	ENST00000517664.1	+	0	1022_1023																											tgttttttttggttttgttttg	0.436																																																	0								ENSG00000253636																																			RP11-531A24.5			0				Clone_based_vega_gene																													8.37:g.73965434_73965435insGTTTTGTTTTGTTTT		Somatic	NA	NA	NA		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000517664.1	37	NULL		8																																																																																			-	-		0.436	RP11-531A24.5-001	KNOWN	basic	antisense	ENSG00000253636	antisense	OTTHUMT00000379313.1	-				73965435	+1	no_errors	ENST00000517664	ensembl	human	known	74_37	rna	INS	0.004:0.007	GTTTTGTTTTGTTTT
MFSD12	126321	genome.wustl.edu	37	19	3557210	3557212	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr19:3557210_3557212delCAG	ENST00000355415.2	-	1	359_361	c.190_192delCTG	c.(190-192)ctgdel	p.L64del	MFSD12_ENST00000398558.4_In_Frame_Del_p.L64del|MFSD12_ENST00000591878.1_Intron|MFSD12_ENST00000389395.3_In_Frame_Del_p.L64del|AC005786.7_ENST00000589360.1_RNA|AC005786.5_ENST00000592368.1_lincRNA	NM_174983.3	NP_778148.2	Q6NUT3	MFS12_HUMAN	major facilitator superfamily domain containing 12	64					transport (GO:0006810)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				cervix(1)|endometrium(2)|lung(4)|urinary_tract(2)	9						CCACCTGGCCCAGCAGCAGCAGC	0.729																																																	0								ENSG00000161091		,,	218,3538		76,66,1736					,,	3.8	1.0			13	721,7105		240,241,3432	no	coding,coding,coding	C19orf28	NM_174983.3,NM_021731.2,NM_001042680.1	,,	316,307,5168	A1A1,A1R,RR		9.2129,5.804,8.1074	,,	,,		939,10643				MFSD12	SO:0001651	inframe_deletion	0				HGNC	AF218008	CCDS42465.1, CCDS74256.1	19p13.3	2012-03-09	2011-11-24	2011-11-24	ENSG00000161091	ENSG00000161091			28299	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 28"""	C19orf28		12477932	Standard	NM_174983		Approved	MGC20700, PP3501	uc002lxw.3	Q6NUT3		ENST00000355415.2:c.190_192delCTG	19.37:g.3557219_3557221delCAG	ENSP00000347583:p.Leu64del	Somatic	0	22	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	A8MXP7|D6W615|E9PAJ8|Q8N459	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.L64in_frame_del	ENST00000355415.2	37	c.192_190	CCDS42465.1	19																																																																																			-	superfamily_MFS_dom_general_subst_transpt		0.729	MFSD12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MFSD12	protein_coding	OTTHUMT00000452949.2	CAG	NM_174983			3557212	-1	no_errors	ENST00000398558	ensembl	human	known	74_37	in_frame_del	DEL	0.647:0.925:0.999	-
ADCYAP1R1	117	genome.wustl.edu	37	7	31120238	31120238	+	Silent	SNP	C	C	T			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr7:31120238C>T	ENST00000304166.4	+	5	565	c.276C>T	c.(274-276)acC>acT	p.T92T	ADCYAP1R1_ENST00000409363.1_Intron|ADCYAP1R1_ENST00000409489.1_Silent_p.T92T|ADCYAP1R1_ENST00000396211.2_Silent_p.T92T	NM_001118.4|NM_001199635.1|NM_001199636.1	NP_001109.2|NP_001186564.1|NP_001186565.1	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary) receptor type I	92					activation of adenylate cyclase activity (GO:0007190)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(1)|large_intestine(4)|liver(2)|lung(24)|ovary(1)|skin(2)|stomach(1)	35						TCTGGGAGACCGAAACCATTG	0.557																																					Ovarian(44;225 1186 2158 11092)												0								ENSG00000078549						75.0	75.0	75.0					7																	31120238		2203	4300	6503	ADCYAP1R1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS5433.1, CCDS56480.1, CCDS56481.1	7p14.3	2012-09-20			ENSG00000078549	ENSG00000078549		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	242	protein-coding gene	gene with protein product	"""PACAP receptor 1"""	102981				7902709	Standard	NM_001199635		Approved	PAC1, PACAPR, PAC1R	uc003tcg.3	P41586	OTTHUMG00000023884	ENST00000304166.4:c.276C>T	7.37:g.31120238C>T		Somatic	0	23	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	19	44.12	A8K1Y1|B7ZLA7|B8ZZK3|Q17S10	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_PACAP_1_rcpt,prints_GPCR_2_secretin-like	p.T92	ENST00000304166.4	37	c.276	CCDS5433.1	7																																																																																			-	pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,prints_GPCR_2_PACAP_1_rcpt		0.557	ADCYAP1R1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADCYAP1R1	protein_coding	OTTHUMT00000215041.3	C	NM_001118	-		31120238	+1	no_errors	ENST00000304166	ensembl	human	known	74_37	silent	SNP	0.009	T
LRP2	4036	genome.wustl.edu	37	2	170065981	170065981	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr2:170065981C>A	ENST00000263816.3	-	38	6736	c.6451G>T	c.(6451-6453)Gca>Tca	p.A2151S		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2151					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CAATCCACTGCAATACCCCGG	0.393																																																	0								ENSG00000081479						180.0	176.0	177.0					2																	170065981		2203	4300	6503	LRP2	SO:0001583	missense	0			-	HGNC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.6451G>T	2.37:g.170065981C>A	ENSP00000263816:p.Ala2151Ser	Somatic	0	59	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	58	26.58	O00711|Q16215	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.A2151S	ENST00000263816.3	37	c.6451	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	26.6	4.752320	0.89753	.	.	ENSG00000081479	ENST00000263816	D	0.94232	-3.38	5.82	4.95	0.65309	Six-bladed beta-propeller, TolB-like (1);	0.047468	0.85682	D	0.000000	D	0.96719	0.8929	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.96722	0.9533	10	0.49607	T	0.09	.	15.0205	0.71627	0.0:0.9318:0.0:0.0682	.	2151	P98164	LRP2_HUMAN	S	2151	ENSP00000263816:A2151S	ENSP00000263816:A2151S	A	-	1	0	LRP2	169774227	1.000000	0.71417	0.999000	0.59377	0.949000	0.60115	7.770000	0.85390	1.462000	0.47948	0.655000	0.94253	GCA	-	smart_LDLR_classB_rpt		0.393	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	protein_coding	OTTHUMT00000255231.2	C	NM_004525	-		170065981	-1	no_errors	ENST00000263816	ensembl	human	known	74_37	missense	SNP	1.000	A
CD163	9332	genome.wustl.edu	37	12	7636086	7636086	+	Nonsense_Mutation	SNP	C	C	A			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr12:7636086C>A	ENST00000359156.4	-	12	3167	c.2965G>T	c.(2965-2967)Gga>Tga	p.G989*	CD163_ENST00000541972.1_Nonsense_Mutation_p.G977*|CD163_ENST00000396620.3_Nonsense_Mutation_p.G1022*|CD163_ENST00000539632.1_5'UTR|CD163_ENST00000432237.2_Nonsense_Mutation_p.G989*	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	989	SRCR 9. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	CATATCGGTCCAGTCCCCTGA	0.517																																																	0								ENSG00000177575						163.0	132.0	142.0					12																	7636086		2203	4300	6503	CD163	SO:0001587	stop_gained	0			-	HGNC	Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.2965G>T	12.37:g.7636086C>A	ENSP00000352071:p.Gly989*	Somatic	0	19	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	22	28.12	C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_SRCR,pfscan_SRCR	p.G989*	ENST00000359156.4	37	c.2965	CCDS8578.1	12	.	.	.	.	.	.	.	.	.	.	C	42	9.521248	0.99193	.	.	ENSG00000177575	ENST00000359156;ENST00000542280;ENST00000541972;ENST00000396620;ENST00000432237	.	.	.	5.4	4.51	0.55191	.	0.169230	0.42053	D	0.000778	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.6796	0.62476	0.1556:0.8444:0.0:0.0	.	.	.	.	X	989;29;977;1022;989	.	ENSP00000352071:G989X	G	-	1	0	CD163	7527353	1.000000	0.71417	0.361000	0.25849	0.992000	0.81027	7.782000	0.85680	1.413000	0.46997	0.555000	0.69702	GGA	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR		0.517	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD163	protein_coding	OTTHUMT00000399396.2	C	NM_004244, NM_203416	-		7636086	-1	no_errors	ENST00000359156	ensembl	human	known	74_37	nonsense	SNP	0.948	A
THBS2	7058	genome.wustl.edu	37	6	169646212	169646213	+	Intron	DEL	AC	AC	-	rs560251241	byFrequency	TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr6:169646212_169646213delAC	ENST00000366787.3	-	5	944					NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2						cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		Gcacacacatacacacacacac	0.386																																					Esophageal Squamous(91;219 1934 18562 44706)												0								ENSG00000186340																																			THBS2	SO:0001627	intron_variant	0				HGNC		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.694+78GT>-	6.37:g.169646222_169646223delAC		Somatic	0	34	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A6H8N1|A7E232|Q5RI52	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366787.3	37	NULL	CCDS34574.1	6																																																																																			-	-		0.386	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS2	protein_coding	OTTHUMT00000105439.1	AC	NM_003247			169646213	-1	no_errors	ENST00000472733	ensembl	human	known	74_37	rna	DEL	0.001:0.000	-
ATF4	468	genome.wustl.edu	37	22	39917546	39917546	+	Silent	SNP	T	T	G			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr22:39917546T>G	ENST00000337304.2	+	1	978	c.96T>G	c.(94-96)ggT>ggG	p.G32G	ATF4_ENST00000404241.2_Silent_p.G32G|ATF4_ENST00000396680.1_Silent_p.G32G	NM_001675.2	NP_001666.2	P18848	ATF4_HUMAN	activating transcription factor 4	32					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular amino acid metabolic process (GO:0006520)|cellular protein metabolic process (GO:0044267)|circadian regulation of gene expression (GO:0032922)|endoplasmic reticulum unfolded protein response (GO:0030968)|gamma-aminobutyric acid signaling pathway (GO:0007214)|gluconeogenesis (GO:0006094)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990440)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to endoplasmic reticulum stress (GO:0034976)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|Lewy body core (GO:1990037)|neuron projection (GO:0043005)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	11	Melanoma(58;0.04)				Pseudoephedrine(DB00852)	AAAGCCTAGGTCTCTTAGATG	0.567																																																	0								ENSG00000128272						64.0	64.0	64.0					22																	39917546		2203	4300	6503	ATF4	SO:0001819	synonymous_variant	0			-	HGNC	D90209	CCDS13996.1	22q13.1	2013-05-23	2013-05-23		ENSG00000128272	ENSG00000128272		"""basic leucine zipper proteins"""	786	protein-coding gene	gene with protein product	"""tax-responsive enhancer element B67"""	604064	"""activating transcription factor 4 (tax-responsive enhancer element B67)"""	TXREB		1847461, 1534408	Standard	NM_182810		Approved	TAXREB67, CREB-2	uc003axz.3	P18848	OTTHUMG00000151099	ENST00000337304.2:c.96T>G	22.37:g.39917546T>G		Somatic	0	75	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	64	18.99	Q9UH31	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_bZIP,smart_bZIP,pfscan_bZIP	p.G32	ENST00000337304.2	37	c.96	CCDS13996.1	22																																																																																			-	NULL		0.567	ATF4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ATF4	protein_coding	OTTHUMT00000321305.1	T	NM_001675	-		39917546	+1	no_errors	ENST00000337304	ensembl	human	known	74_37	silent	SNP	1.000	G
PFKFB4	5210	genome.wustl.edu	37	3	48587370	48587370	+	Missense_Mutation	SNP	G	G	A	rs201114950		TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr3:48587370G>A	ENST00000232375.3	-	3	350	c.238C>T	c.(238-240)Cgg>Tgg	p.R80W	PFKFB4_ENST00000383734.2_Missense_Mutation_p.R80W|PFKFB4_ENST00000416568.1_Missense_Mutation_p.R80W|PFKFB4_ENST00000490115.1_5'UTR|PFKFB4_ENST00000541519.1_Missense_Mutation_p.R46W|PFKFB4_ENST00000545984.1_Missense_Mutation_p.R80W|PFKFB4_ENST00000536104.1_Missense_Mutation_p.R69W	NM_004567.2	NP_004558.1	Q16877	F264_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4	80	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		ACCACGTCCCGGCGATACTGG	0.517																																																	0								ENSG00000114268						89.0	91.0	90.0					3																	48587370		2203	4300	6503	PFKFB4	SO:0001583	missense	0			-	HGNC	BC010269	CCDS2771.1	3p22-p21	2004-03-02			ENSG00000114268	ENSG00000114268			8875	protein-coding gene	gene with protein product		605320				8830046, 10095107	Standard	NM_004567		Approved		uc003ctv.3	Q16877	OTTHUMG00000133528	ENST00000232375.3:c.238C>T	3.37:g.48587370G>A	ENSP00000232375:p.Arg80Trp	Somatic	0	70	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	68	37.61	Q5S3G5|Q5XLC2|Q64EX5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_6Phosfructo_kin,pfam_His_Pase_superF_clade-1,superfamily_P-loop_NTPase,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	p.R80W	ENST00000232375.3	37	c.238	CCDS2771.1	3	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735870	0.69189	.	.	ENSG00000114268	ENST00000232375;ENST00000536104;ENST00000416568;ENST00000383734;ENST00000541519;ENST00000545984;ENST00000452531;ENST00000412035;ENST00000422701	.	.	.	5.03	5.03	0.67393	6-phosphofructo-2-kinase (1);	0.000000	0.85682	D	0.000000	D	0.91188	0.7224	H	0.99525	4.61	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;1.0;1.0	D	0.94675	0.7860	9	0.87932	D	0	-0.7257	15.9094	0.79461	0.0:0.0:1.0:0.0	.	69;80;80;80	B7Z5C3;Q5XLC2;Q66S35;Q16877	.;.;.;F264_HUMAN	W	80;69;80;80;46;80;69;46;83	.	ENSP00000232375:R80W	R	-	1	2	PFKFB4	48562374	1.000000	0.71417	1.000000	0.80357	0.492000	0.33523	4.701000	0.61810	2.613000	0.88420	0.655000	0.94253	CGG	-	pfam_6Phosfructo_kin,superfamily_P-loop_NTPase,pirsf_Bifunct_6PFK/fruc_bisP_Ptase		0.517	PFKFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKFB4	protein_coding	OTTHUMT00000257503.2	G	NM_004567	rs201114950		48587370	-1	no_errors	ENST00000232375	ensembl	human	known	74_37	missense	SNP	1.000	A
NUMA1	4926	genome.wustl.edu	37	11	71746965	71746965	+	Frame_Shift_Del	DEL	C	C	-			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr11:71746965delC	ENST00000393695.3	-	3	356	c.25delG	c.(25-27)gctfs	p.A10fs	NUMA1_ENST00000351960.6_Frame_Shift_Del_p.A10fs|NUMA1_ENST00000358965.6_Frame_Shift_Del_p.A10fs	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1											central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						AGGAGTGCAGCCCCCCGGGTG	0.502			T	RARA	APL																																			Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	0								ENSG00000137497						93.0	94.0	93.0					11																	71746965		2200	4293	6493	NUMA1	SO:0001589	frameshift_variant	0				HGNC	Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.25delG	11.37:g.71746965delC	ENSP00000377298:p.Ala10fs	Somatic	0	37	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin	p.A9fs	ENST00000393695.3	37	c.25	CCDS31633.1	11																																																																																			-	NULL		0.502	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMA1	protein_coding	OTTHUMT00000395769.1	C				71746965	-1	no_errors	ENST00000393695	ensembl	human	known	74_37	frame_shift_del	DEL	0.393	-
PER2	8864	genome.wustl.edu	37	2	239170424	239170424	+	Silent	SNP	G	G	C			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr2:239170424G>C	ENST00000254657.3	-	12	1641	c.1362C>G	c.(1360-1362)gcC>gcG	p.A454A	PER2_ENST00000440245.1_Silent_p.A454A|PER2_ENST00000254658.3_3'UTR	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	454					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TGGGGTGCAGGGCCTTCTCCT	0.597																																																	0								ENSG00000132326						50.0	47.0	48.0					2																	239170424		2199	4293	6492	PER2	SO:0001819	synonymous_variant	0			-	HGNC	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.1362C>G	2.37:g.239170424G>C		Somatic	0	42	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	39	36.07	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,superfamily_PAS,smart_PAS,pfscan_PAS	p.A454	ENST00000254657.3	37	c.1362	CCDS2528.1	2																																																																																			-	NULL		0.597	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER2	protein_coding	OTTHUMT00000257167.1	G	NM_022817	-		239170424	-1	no_errors	ENST00000254657	ensembl	human	known	74_37	silent	SNP	0.354	C
CFH	3075	genome.wustl.edu	37	1	196654214	196654214	+	Missense_Mutation	SNP	T	T	A			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr1:196654214T>A	ENST00000359637.2	+	6	681	c.619T>A	c.(619-621)Tat>Aat	p.Y207N	CFH_ENST00000439155.2_Missense_Mutation_p.Y271N|CFH_ENST00000367429.4_Missense_Mutation_p.Y271N			P08603	CFAH_HUMAN	complement factor H	271	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						TGATAATCCTTATATTCCAAA	0.318																																																	0								ENSG00000000971						70.0	69.0	69.0					1																	196654214		2203	4299	6502	CFH	SO:0001583	missense	0			-	HGNC	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000359637.2:c.619T>A	1.37:g.196654214T>A	ENSP00000352658:p.Tyr207Asn	Somatic	0	77	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	69	36.70	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.Y271N	ENST00000359637.2	37	c.811		1	.	.	.	.	.	.	.	.	.	.	T	10.96	1.498018	0.26861	.	.	ENSG00000000971	ENST00000367429;ENST00000439155;ENST00000391986;ENST00000359637	T;T;T	0.62788	0.0;0.0;0.0	5.11	-10.2	0.00374	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.57902	0.2085	L	0.35341	1.055	0.09310	N	1	D;B;B;B	0.71674	0.998;0.208;0.027;0.224	D;B;B;B	0.87578	0.998;0.072;0.011;0.046	T	0.56019	-0.8048	9	0.18276	T	0.48	.	7.4891	0.27452	0.2112:0.4877:0.0:0.3012	.	207;271;271;271	Q5TFM2;P08603-2;P08603;F8WDX4	.;.;CFAH_HUMAN;.	N	271;271;271;207	ENSP00000356399:Y271N;ENSP00000402656:Y271N;ENSP00000352658:Y207N	ENSP00000352658:Y207N	Y	+	1	0	CFH	194920837	0.000000	0.05858	0.153000	0.22517	0.280000	0.26924	-2.158000	0.01281	-2.130000	0.00816	-0.356000	0.07607	TAT	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.318	CFH-002	PUTATIVE	basic|exp_conf	protein_coding	CFH	protein_coding	OTTHUMT00000087502.1	T	NM_000186	-		196654214	+1	no_errors	ENST00000367429	ensembl	human	known	74_37	missense	SNP	0.008	A
KIAA1919	91749	genome.wustl.edu	37	6	111588128	111588128	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr6:111588128G>A	ENST00000368847.4	+	4	1716	c.1363G>A	c.(1363-1365)Gaa>Aaa	p.E455K		NM_153369.2	NP_699200.2	Q5TF39	NAGT1_HUMAN	KIAA1919	455					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			large_intestine(3)|lung(2)|ovary(4)|skin(3)	12		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)		AATGGATTTTGAAATGATTGA	0.408																																																	0								ENSG00000173214						100.0	104.0	102.0					6																	111588128		2203	4300	6503	KIAA1919	SO:0001583	missense	0			-	HGNC	BC036115	CCDS5090.1	6q22	2013-10-02			ENSG00000173214	ENSG00000173214			21053	protein-coding gene	gene with protein product							Standard	NM_153369		Approved	MGC33953, MFSD4B	uc003puv.4	Q5TF39	OTTHUMG00000015372	ENST00000368847.4:c.1363G>A	6.37:g.111588128G>A	ENSP00000357840:p.Glu455Lys	Somatic	0	56	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	41	26.79	A8K9M0|Q8IYB6|Q96PW9|Q9P0D6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.E455K	ENST00000368847.4	37	c.1363	CCDS5090.1	6	.	.	.	.	.	.	.	.	.	.	G	25.2	4.616592	0.87359	.	.	ENSG00000173214	ENST00000368847	T	0.61859	0.07	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.72112	0.3420	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.71836	-0.4472	10	0.72032	D	0.01	-11.1356	20.6032	0.99464	0.0:0.0:1.0:0.0	.	455	Q5TF39	NAGT1_HUMAN	K	455	ENSP00000357840:E455K	ENSP00000357840:E455K	E	+	1	0	KIAA1919	111694821	1.000000	0.71417	1.000000	0.80357	0.465000	0.32709	7.160000	0.77495	2.875000	0.98604	0.643000	0.83706	GAA	-	NULL		0.408	KIAA1919-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1919	protein_coding	OTTHUMT00000041827.1	G	NM_153369	-		111588128	+1	no_errors	ENST00000368847	ensembl	human	known	74_37	missense	SNP	1.000	A
CARM1	10498	genome.wustl.edu	37	19	11031206	11031206	+	Frame_Shift_Del	DEL	G	G	-			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr19:11031206delG	ENST00000327064.4	+	11	1481	c.1291delG	c.(1291-1293)gggfs	p.G431fs	CARM1_ENST00000344150.4_Frame_Shift_Del_p.G431fs	NM_199141.1	NP_954592.1	Q86X55	CARM1_HUMAN	coactivator-associated arginine methyltransferase 1	431	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cellular lipid metabolic process (GO:0044255)|endochondral bone morphogenesis (GO:0060350)|histone H3-R17 methylation (GO:0034971)|histone H3-R2 methylation (GO:0034970)|histone methylation (GO:0016571)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of protein binding (GO:0032091)|pathogenesis (GO:0009405)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-R17 specific) (GO:0035642)|histone-arginine N-methyltransferase activity (GO:0008469)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|lysine-acetylated histone binding (GO:0070577)|protein methyltransferase activity (GO:0008276)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	13						CGCCAAGGCAGGGGACACGCT	0.627																																																	0								ENSG00000142453						113.0	96.0	102.0					19																	11031206		2203	4300	6503	CARM1	SO:0001589	frameshift_variant	0				HGNC	AF055027	CCDS12250.1	19p13.2	2010-10-11			ENSG00000142453	ENSG00000142453		"""Protein arginine methyltransferases"""	23393	protein-coding gene	gene with protein product		603934				10381882, 11724789	Standard	NM_199141		Approved	PRMT4	uc002mpz.3	Q86X55		ENST00000327064.4:c.1291delG	19.37:g.11031206delG	ENSP00000325690:p.Gly431fs	Somatic	0	50	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	33	8.33	A6NN38	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Histone-Arg_MeTrfase_N,pfam_Arg_MeTrfase,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Small_mtfrase_dom,pfam_mo5U34_MeTrfas-like,pfam_Methyltransf_11	p.D432fs	ENST00000327064.4	37	c.1291	CCDS12250.1	19																																																																																			-	pfam_Arg_MeTrfase		0.627	CARM1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CARM1	protein_coding	OTTHUMT00000452625.1	G	XM_032719			11031206	+1	no_errors	ENST00000327064	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
KCP	375616	genome.wustl.edu	37	7	128526723	128526723	+	RNA	SNP	A	A	T			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr7:128526723A>T	ENST00000476647.2	-	0	2800							Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						CAGCGACACCACTCACAGCTG	0.662																																																	0								ENSG00000135253						94.0	91.0	92.0					7																	128526723		692	1591	2283	KCP			0			-	HGNC	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128526723A>T		Somatic	0	44	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	28	30.95	Q8NBE0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000476647.2	37	NULL		7																																																																																			-	-		0.662	KCP-006	KNOWN	basic	processed_transcript	KCP	processed_transcript	OTTHUMT00000403051.1	A	NM_199349	-		128526723	-1	no_errors	ENST00000297801	ensembl	human	known	74_37	rna	SNP	0.002	T
NMNAT1	64802	genome.wustl.edu	37	1	10042481	10042481	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr1:10042481C>T	ENST00000377205.1	+	5	706	c.562C>T	c.(562-564)Cgg>Tgg	p.R188W	RP11-807G9.2_ENST00000413148.1_RNA	NM_022787.3	NP_073624.2	Q9HAN9	NMNA1_HUMAN	nicotinamide nucleotide adenylyltransferase 1	188					NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)			large_intestine(2)|lung(2)|stomach(1)	5		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.31e-08)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(185;0.00028)|BRCA - Breast invasive adenocarcinoma(304;0.00032)|KIRC - Kidney renal clear cell carcinoma(229;0.00101)|STAD - Stomach adenocarcinoma(132;0.00908)|READ - Rectum adenocarcinoma(331;0.0419)		ATGTGTTACTCGGGCTGGAAA	0.458																																																	0								ENSG00000173614						144.0	137.0	140.0					1																	10042481		2203	4300	6503	NMNAT1	SO:0001583	missense	0			-	HGNC	AF312734	CCDS108.1, CCDS72698.1	1p36.22	2014-01-28	2003-04-30	2003-05-02	ENSG00000173614	ENSG00000173614	2.7.7.1		17877	protein-coding gene	gene with protein product		608700	"""nicotinamide nucleotide adenylyltransferase"", ""Leber congenital amaurosis 9"", ""Leber's congenital amaurosis 9"""	LCA9		11248244, 11027696, 22842227	Standard	XR_244792		Approved	NMNAT, PNAT1	uc001aqp.3	Q9HAN9	OTTHUMG00000001799	ENST00000377205.1:c.562C>T	1.37:g.10042481C>T	ENSP00000366410:p.Arg188Trp	Somatic	0	38	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	51	16.39	B1AN63|Q8TAE9|Q9H247|Q9H6B6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_trans-like,tigrfam_NAMN_adtrnsfrase	p.R188W	ENST00000377205.1	37	c.562	CCDS108.1	1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.432432	0.62844	.	.	ENSG00000173614	ENST00000377205	D	0.98876	-5.2	5.46	4.54	0.55810	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	D	0.99281	0.9749	H	0.96015	3.755	0.58432	D	0.999992	D	0.89917	1.0	D	0.83275	0.996	D	0.98951	1.0794	10	0.87932	D	0	0.7063	8.8296	0.35076	0.2387:0.6862:0.0:0.0751	.	188	Q9HAN9	NMNA1_HUMAN	W	188	ENSP00000366410:R188W	ENSP00000366410:R188W	R	+	1	2	NMNAT1	9965068	0.997000	0.39634	0.984000	0.44739	0.515000	0.34225	2.703000	0.47110	2.553000	0.86117	0.462000	0.41574	CGG	-	pfam_Cyt_trans-like,tigrfam_NAMN_adtrnsfrase		0.458	NMNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMNAT1	protein_coding	OTTHUMT00000005029.1	C		-		10042481	+1	no_errors	ENST00000377205	ensembl	human	known	74_37	missense	SNP	0.999	T
PAMR1	25891	genome.wustl.edu	37	11	35513631	35513631	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr11:35513631G>A	ENST00000378880.2	-	3	786	c.341C>T	c.(340-342)gCa>gTa	p.A114V	PAMR1_ENST00000278360.3_Missense_Mutation_p.A114V|PAMR1_ENST00000378878.3_Missense_Mutation_p.A114V|PAMR1_ENST00000532848.1_Missense_Mutation_p.A74V|PAMR1_ENST00000534803.1_5'UTR	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	114						extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						TCGGCACTCTGCACAGTAGAA	0.493																																																	0								ENSG00000149090						194.0	184.0	188.0					11																	35513631		2202	4298	6500	PAMR1	SO:0001583	missense	0			-	HGNC		CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.341C>T	11.37:g.35513631G>A	ENSP00000368158:p.Ala114Val	Somatic	0	31	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_CUB_dom,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_EG-like_dom,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_Sushi_SCR_CCP,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1	p.A114V	ENST00000378880.2	37	c.341	CCDS31460.1	11	.	.	.	.	.	.	.	.	.	.	G	15.54	2.863447	0.51482	.	.	ENSG00000149090	ENST00000278360;ENST00000378880;ENST00000378878;ENST00000532848;ENST00000527605;ENST00000529303	D;D;D;D;D;D	0.90676	-2.27;-2.3;-2.52;-2.27;-2.27;-2.71	5.38	5.38	0.77491	Epidermal growth factor-like (1);	0.118955	0.56097	D	0.000031	D	0.87418	0.6172	N	0.19112	0.55	0.27604	N	0.948876	P;P;P	0.52463	0.822;0.953;0.787	P;B;B	0.46172	0.506;0.411;0.372	D	0.83839	0.0256	10	0.87932	D	0	.	19.1285	0.93396	0.0:0.0:1.0:0.0	.	114;114;114	A8MQ58;Q6UXH9;Q6UXH9-2	.;PAMR1_HUMAN;.	V	114;114;114;74;74;114	ENSP00000278360:A114V;ENSP00000368158:A114V;ENSP00000368156:A114V;ENSP00000433868:A74V;ENSP00000432591:A74V;ENSP00000433024:A114V	ENSP00000278360:A114V	A	-	2	0	PAMR1	35470207	1.000000	0.71417	0.849000	0.33467	0.026000	0.11368	7.805000	0.86005	2.530000	0.85305	0.591000	0.81541	GCA	-	smart_EG-like_dom		0.493	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAMR1	protein_coding	OTTHUMT00000389177.1	G	NM_015430	-		35513631	-1	no_errors	ENST00000278360	ensembl	human	known	74_37	missense	SNP	0.993	A
TP53	7157	genome.wustl.edu	37	17	7577114	7577114	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr17:7577114C>T	ENST00000269305.4	-	8	1013	c.824G>A	c.(823-825)tGt>tAt	p.C275Y	TP53_ENST00000420246.2_Missense_Mutation_p.C275Y|TP53_ENST00000359597.4_Missense_Mutation_p.C275Y|TP53_ENST00000455263.2_Missense_Mutation_p.C275Y|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.C275Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	275	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7887414}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C275Y(53)|p.C275F(37)|p.0?(8)|p.C275fs*70(3)|p.?(2)|p.C275S(2)|p.C275fs*20(1)|p.L265_K305del41(1)|p.R273_C275delRVC(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.A276fs*29(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGACAGGCACAAACACGCAC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	115	Substitution - Missense(92)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(2)	lung(14)|large_intestine(13)|breast(13)|upper_aerodigestive_tract(12)|central_nervous_system(10)|haematopoietic_and_lymphoid_tissue(10)|ovary(7)|urinary_tract(6)|stomach(5)|oesophagus(5)|bone(5)|liver(5)|skin(3)|pancreas(2)|NS(2)|prostate(2)|biliary_tract(1)	GRCh37	CM076568|CM951234	TP53	M		ENSG00000141510						71.0	61.0	64.0					17																	7577114		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.824G>A	17.37:g.7577114C>T	ENSP00000269305:p.Cys275Tyr	Somatic	0	37	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	17	48.48	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C275Y	ENST00000269305.4	37	c.824	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	25.1	4.605675	0.87157	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99874	-7.39;-7.39;-7.39;-7.39;-7.39;-7.39	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99883	0.9944	M	0.92738	3.34	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;0.997;0.997	D	0.96317	0.9233	10	0.87932	D	0	-17.2181	15.662	0.77193	0.0:1.0:0.0:0.0	.	275;275;275;275	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	Y	275;275;275;275;275;264;143	ENSP00000352610:C275Y;ENSP00000269305:C275Y;ENSP00000398846:C275Y;ENSP00000391127:C275Y;ENSP00000391478:C275Y;ENSP00000425104:C143Y	ENSP00000269305:C275Y	C	-	2	0	TP53	7517839	1.000000	0.71417	0.999000	0.59377	0.904000	0.53231	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	TGT	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	-		7577114	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	T
CCDC105	126402	genome.wustl.edu	37	19	15132444	15132444	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr19:15132444C>T	ENST00000292574.3	+	5	1140	c.1058C>T	c.(1057-1059)aCg>aTg	p.T353M		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	353						extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						TTAAATATGACGTTAGGACTG	0.592																																																	0								ENSG00000160994						78.0	78.0	78.0					19																	15132444		2203	4300	6503	CCDC105	SO:0001583	missense	0			-	HGNC	AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1058C>T	19.37:g.15132444C>T	ENSP00000292574:p.Thr353Met	Somatic	0	113	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	81	31.93	Q8N7T5|Q8NDL5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tektin	p.T353M	ENST00000292574.3	37	c.1058	CCDS12322.1	19	.	.	.	.	.	.	.	.	.	.	C	2.274	-0.366303	0.05069	.	.	ENSG00000160994	ENST00000292574	T	0.02552	4.25	3.91	1.58	0.23477	.	0.399455	0.20332	N	0.094408	T	0.02304	0.0071	L	0.46157	1.445	0.21878	N	0.999492	P	0.34977	0.478	B	0.25614	0.062	T	0.44483	-0.9325	10	0.42905	T	0.14	-14.287	4.1428	0.10201	0.0:0.5727:0.2831:0.1442	.	353	Q8IYK2	CC105_HUMAN	M	353	ENSP00000292574:T353M	ENSP00000292574:T353M	T	+	2	0	CCDC105	14993444	0.110000	0.22057	0.677000	0.29947	0.002000	0.02628	0.304000	0.19228	0.846000	0.35142	-0.332000	0.08345	ACG	-	pfam_Tektin		0.592	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC105	protein_coding	OTTHUMT00000466293.1	C	NM_173482	-		15132444	+1	no_errors	ENST00000292574	ensembl	human	known	74_37	missense	SNP	0.484	T
LOC101927016	101927016	genome.wustl.edu	37	13	64320995	64321054	+	In_Frame_Del	DEL	GCTCTGGTTATGGCTATGGCTATGGCTCCAGCTATGGCTGTGGCTATGGAACTGGCTACA	GCTCTGGTTATGGCTATGGCTATGGCTCCAGCTATGGCTGTGGCTATGGAACTGGCTACA	-	rs559210526|rs2810821|rs190060383|rs534427328	byFrequency	TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	GCTCTGGTTATGGCTATGGCTATGGCTCCAGCTATGGCTGTGGCTATGGAACTGGCTACA	GCTCTGGTTATGGCTATGGCTATGGCTCCAGCTATGGCTGTGGCTATGGAACTGGCTACA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr13:64320995_64321054delGCTCTGGTTATGGCTATGGCTATGGCTCCAGCTATGGCTGTGGCTATGGAACTGGCTACA	ENST00000453638.2	+	1	62_121	c.62_121delGCTCTGGTTATGGCTATGGCTATGGCTCCAGCTATGGCTGTGGCTATGGAACTGGCTACA	c.(61-123)ggctctggttatggctatggctatggctccagctatggctgtggctatggaactggctacagc>ggc	p.SGYGYGYGSSYGCGYGTGYS22del	RP11-473M10.3_ENST00000418943.1_lincRNA																endometrium(2)|lung(1)|urinary_tract(1)	4						tgtggctatggctctggttatggctatggctatggctccagctatggctgtggctatggaactggctacagctgtggcta	0.527																																																	0								ENSG00000226974																																			AL445989.1	SO:0001651	inframe_deletion	0				Clone_based_ensembl_gene																												ENST00000453638.2:c.62_121delGCTCTGGTTATGGCTATGGCTATGGCTCCAGCTATGGCTGTGGCTATGGAACTGGCTACA	13.37:g.64320995_64321054delGCTCTGGTTATGGCTATGGCTATGGCTCCAGCTATGGCTGTGGCTATGGAACTGGCTACA	ENSP00000443634:p.Ser22_Ser41del	Somatic	NA	NA	NA		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.SGYGYGYGSSYGCGYGTGYS22in_frame_del	ENST00000453638.2	37	c.62_121		13																																																																																			-	NULL		0.527	AL445989.1-201	KNOWN	basic|appris_principal	protein_coding	LOC101927016	protein_coding		GCTCTGGTTATGGCTATGGCTATGGCTCCAGCTATGGCTGTGGCTATGGAACTGGCTACA				64321054	+1	no_errors	ENST00000453638	ensembl	human	known	74_37	in_frame_del	DEL	0.012:0.004:0.001:0.000:0.000:0.002:0.009:0.013:0.029:0.032:0.093:0.111:0.111:0.092:0.071:0.001:0.001:0.009:0.016:0.021:0.025:0.023:0.041:0.045:0.040:0.012:0.006:0.000:0.000:0.003:0.032:0.058:0.371:0.475:0.657:0.749:0.788:0.811:0.826:0.827:0.810:0.797:0.742:0.540:0.524:0.464:0.447:0.424:0.384:0.151:0.044:0.012:0.001:0.001:0.000:0.000:0.002:0.002:0.002:0.002	-
ADAMTSL4	54507	genome.wustl.edu	37	1	150523487	150523487	+	Intron	SNP	G	G	T			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr1:150523487G>T	ENST00000271643.4	+	2	152				ADAMTSL4_ENST00000369041.5_Intron|ADAMTSL4_ENST00000369038.2_5'Flank|MIR4257_ENST00000581735.1_RNA|ADAMTSL4_ENST00000369039.5_Intron|AL356356.1_ENST00000538795.1_Missense_Mutation_p.S139I|ADAMTSL4_ENST00000483335.1_3'UTR|RP11-54A4.2_ENST00000442435.2_RNA	NM_019032.4	NP_061905.2	Q6UY14	ATL4_HUMAN	ADAMTS-like 4						apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			TTCCTGGAAAGCAGAACTAAG	0.557																																																	0								ENSG00000225996																																			AL356356.1	SO:0001627	intron_variant	0			-	Clone_based_ensembl_gene	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000271643.4:c.-85+1116G>T	1.37:g.150523487G>T		Somatic	0	23	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27	B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S139I	ENST00000271643.4	37	c.416	CCDS955.1	1	.	.	.	.	.	.	.	.	.	.	G	11.69	1.714017	0.30413	.	.	ENSG00000225996	ENST00000538795	.	.	.	4.46	3.55	0.40652	.	.	.	.	.	T	0.53029	0.1771	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59467	-0.7449	5	0.87932	D	0	.	8.0209	0.30408	0.1099:0.0:0.8901:0.0	.	.	.	.	I	139	.	ENSP00000437481:S139I	S	+	2	0	AL356356.1	148790111	1.000000	0.71417	1.000000	0.80357	0.764000	0.43329	2.693000	0.47027	1.096000	0.41439	0.561000	0.74099	AGC	-	NULL		0.557	ADAMTSL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000225996	protein_coding		G	NM_019032	-		150523487	+1	no_errors	ENST00000538795	ensembl	human	known	74_37	missense	SNP	1.000	T
MEGF10	84466	genome.wustl.edu	37	5	126774171	126774171	+	Silent	SNP	G	G	A	rs200994008		TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr5:126774171G>A	ENST00000274473.6	+	18	2412	c.2145G>A	c.(2143-2145)acG>acA	p.T715T	MEGF10_ENST00000503335.2_Silent_p.T715T	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	715	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		GCATCCACACGTGCAACTGCC	0.517													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21329	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000145794						142.0	122.0	129.0					5																	126774171		2203	4300	6503	MEGF10	SO:0001819	synonymous_variant	0			GMAF=0	HGNC	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.2145G>A	5.37:g.126774171G>A		Somatic	0	56	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	46	32.35	Q68DE5|Q8WUL3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_EGF_extracell,superfamily_Proteinase_amylase_inhib_dom,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.T715	ENST00000274473.6	37	c.2145	CCDS4142.1	5																																																																																			-	smart_EG-like_dom,pfscan_EG-like_dom		0.517	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF10	protein_coding	OTTHUMT00000250973.2	G	NM_032446	rs200994008		126774171	+1	no_errors	ENST00000274473	ensembl	human	known	74_37	silent	SNP	0.000	A
CARD11	84433	genome.wustl.edu	37	7	2959095	2959095	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr7:2959095C>T	ENST00000396946.4	-	18	2824	c.2421G>A	c.(2419-2421)atG>atA	p.M807I		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	807					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TGTCCTGGTACATGGTGTCAC	0.592			Mis		DLBCL																																			Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	0								ENSG00000198286						109.0	78.0	88.0					7																	2959095		2203	4300	6503	CARD11	SO:0001583	missense	0			-	HGNC	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.2421G>A	7.37:g.2959095C>T	ENSP00000380150:p.Met807Ile	Somatic	0	43	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	21	22.22	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CARD,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,superfamily_PDZ,pfscan_CARD	p.M807I	ENST00000396946.4	37	c.2421	CCDS5336.2	7	.	.	.	.	.	.	.	.	.	.	C	12.98	2.100936	0.37048	.	.	ENSG00000198286	ENST00000396946	T	0.35236	1.32	5.03	5.03	0.67393	.	0.046212	0.85682	D	0.000000	T	0.33818	0.0876	L	0.38175	1.15	0.58432	D	0.999998	B	0.21688	0.059	B	0.24701	0.055	T	0.07693	-1.0759	10	0.37606	T	0.19	-41.7544	18.7247	0.91710	0.0:1.0:0.0:0.0	.	807	Q9BXL7	CAR11_HUMAN	I	807	ENSP00000380150:M807I	ENSP00000380150:M807I	M	-	3	0	CARD11	2925621	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.701000	0.61810	2.503000	0.84419	0.561000	0.74099	ATG	-	NULL		0.592	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD11	protein_coding	OTTHUMT00000059344.4	C	NM_032415	-		2959095	-1	no_errors	ENST00000396946	ensembl	human	known	74_37	missense	SNP	1.000	T
DNAH8	1769	genome.wustl.edu	37	6	38835893	38835893	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr6:38835893C>G	ENST00000359357.3	+	46	6352	c.6098C>G	c.(6097-6099)tCt>tGt	p.S2033C	DNAH8_ENST00000449981.2_Missense_Mutation_p.S2250C|DNAH8_ENST00000441566.1_Missense_Mutation_p.S1997C			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2033					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						ACTCTTGGATCTCAAAAAAGA	0.368																																																	0								ENSG00000124721						129.0	126.0	127.0					6																	38835893		2203	4300	6503	DNAH8	SO:0001583	missense	0			-	HGNC	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.6098C>G	6.37:g.38835893C>G	ENSP00000352312:p.Ser2033Cys	Somatic	0	107	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	85	34.11	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.S2033C	ENST00000359357.3	37	c.6098		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.3|29.3	4.990326|4.990326	0.93106|0.93106	.|.	.|.	ENSG00000124721|ENSG00000124721	ENST00000394393|ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	.|T;T;T	.|0.40756	.|2.52;2.52;1.02	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	.|0.360534	.|0.29822	.|N	.|0.011106	T|T	0.53642|0.53642	0.1809|0.1809	M|M	0.78049|0.78049	2.395|2.395	0.49915|0.49915	D|D	0.999836|0.999836	.|P	.|0.40230	.|0.708	.|P	.|0.49637	.|0.617	T|T	0.56583|0.56583	-0.7955|-0.7955	5|10	.|0.87932	.|D	.|0	.|.	20.27|20.27	0.98469|0.98469	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|2033	.|Q96JB1	.|DYH8_HUMAN	V|C	79|2238;2238;2033;1997	.|ENSP00000333363:S2238C;ENSP00000352312:S2033C;ENSP00000402294:S1997C	.|ENSP00000333363:S2238C	L|S	+|+	1|2	0|0	DNAH8|DNAH8	38943871|38943871	0.817000|0.817000	0.29147|0.29147	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	6.014000|6.014000	0.70784|0.70784	2.854000|2.854000	0.98071|0.98071	0.655000|0.655000	0.94253|0.94253	CTC|TCT	-	superfamily_P-loop_NTPase		0.368	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	protein_coding	OTTHUMT00000043574.1	C	NM_001206927	-		38835893	+1	no_errors	ENST00000359357	ensembl	human	known	74_37	missense	SNP	1.000	G
RUNX2	860	genome.wustl.edu	37	6	45514992	45514992	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr6:45514992G>T	ENST00000371438.1	+	8	1874	c.1516G>T	c.(1516-1518)Gtt>Ttt	p.V506F	RUNX2_ENST00000576263.1_Intron|RUNX2_ENST00000371436.6_Missense_Mutation_p.V484F|RUNX2_ENST00000465038.2_Missense_Mutation_p.V506F|RUNX2_ENST00000352853.5_Missense_Mutation_p.V574F|RUNX2_ENST00000359524.5_Missense_Mutation_p.V492F|RUNX2_ENST00000541979.1_Missense_Mutation_p.V552F|RUNX2_ENST00000371432.3_Missense_Mutation_p.V470F	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	506	Pro/Ser/Thr-rich.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						TTCCCCAACTGTTTTGAATTC	0.488																																																	0								ENSG00000124813						89.0	92.0	91.0					6																	45514992		2203	4300	6503	RUNX2	SO:0001583	missense	0			-	HGNC	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.1516G>T	6.37:g.45514992G>T	ENSP00000360493:p.Val506Phe	Somatic	0	28	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	40	21.57	O14614|O14615|O95181	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Runt_dom,pfam_RunxI_C_dom,superfamily_p53-like_TF_DNA-bd,pfscan_Runt_dom,prints_AML1_Runt	p.V574F	ENST00000371438.1	37	c.1720	CCDS43467.2	6	.	.	.	.	.	.	.	.	.	.	G	17.63	3.438094	0.62955	.	.	ENSG00000124813	ENST00000465038;ENST00000352853;ENST00000541979;ENST00000371438;ENST00000371436;ENST00000359524;ENST00000371432	T;T;T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5;1.5;1.5	5.77	5.77	0.91146	Runx inhibition (1);	0.050922	0.85682	D	0.000000	T	0.26919	0.0659	N	0.22421	0.69	0.58432	D	0.999995	P;P;D	0.57899	0.948;0.924;0.981	P;P;P	0.55161	0.66;0.77;0.72	T	0.00847	-1.1542	9	.	.	.	-6.0428	20.3626	0.98863	0.0:0.0:1.0:0.0	.	552;506;492	F6RGB9;Q13950;Q13950-2	.;RUNX2_HUMAN;.	F	506;574;552;506;484;492;470	ENSP00000420707:V506F;ENSP00000319087:V574F;ENSP00000446290:V552F;ENSP00000360493:V506F;ENSP00000360491:V484F;ENSP00000352514:V492F;ENSP00000360486:V470F	.	V	+	1	0	RUNX2	45622970	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.547000	0.82146	2.885000	0.99019	0.655000	0.94253	GTT	-	pfam_RunxI_C_dom,prints_AML1_Runt		0.488	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	RUNX2	protein_coding	OTTHUMT00000040755.2	G	NM_004348	-		45514992	+1	no_errors	ENST00000352853	ensembl	human	known	74_37	missense	SNP	1.000	T
ANKRD44	91526	genome.wustl.edu	37	2	197943383	197943384	+	Frame_Shift_Del	DEL	TG	TG	-	rs139294990		TCGA-3B-A9HZ-01A-11D-A38Z-09	TCGA-3B-A9HZ-10A-01D-A38Z-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22a78893-3edf-442b-ac7b-78d969165f30	fd3defe6-b6ae-4755-85f4-80f2321a7c99	g.chr2:197943383_197943384delTG	ENST00000409153.1	-	16	1875_1876	c.1693_1694delCA	c.(1693-1695)catfs	p.H565fs	ANKRD44_ENST00000450567.1_Intron|ANKRD44_ENST00000282272.8_Intron|ANKRD44_ENST00000539527.1_Frame_Shift_Del_p.H493fs|ANKRD44_ENST00000337207.5_Intron|ANKRD44_ENST00000328737.2_Intron			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	0										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			ATTTGGGGTATGTGTGTGTGTG	0.411																																																	0								ENSG00000065413																																			ANKRD44	SO:0001589	frameshift_variant	0				HGNC	AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000409153.1:c.1693_1694delCA	2.37:g.197943393_197943394delTG	ENSP00000387141:p.His565fs	Somatic	0	36	0.00		0.5910499776499009	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	41	14.58	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.H565fs	ENST00000409153.1	37	c.1694_1693		2																																																																																			-	NULL		0.411	ANKRD44-003	KNOWN	basic	protein_coding	ANKRD44	protein_coding	OTTHUMT00000335114.3	TG	NM_153697			197943384	-1	no_errors	ENST00000409153	ensembl	human	known	74_37	frame_shift_del	DEL	0.001:0.002	-
