#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
AC136188.1	0	genome.wustl.edu	37	12	74293700	74293707	+	RNA	DEL	ACACACAC	ACACACAC	-	rs146159159|rs61932867|rs375254855|rs61932865|rs61932866|rs199815745|rs142009105|rs71437008	byFrequency	TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	ACACACAC	ACACACAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr12:74293700_74293707delACACACAC	ENST00000606199.1	+	0	51_58																											atatacacatacacacacacacacacac	0.298														1587	0.316893	0.4592	0.2622	5008	,	,		14557	0.1409		0.3579	False		,,,				2504	0.3027																0								ENSG00000272231																																			AC136188.1			0				Clone_based_ensembl_gene																													12.37:g.74293708_74293715delACACACAC		Somatic	NA	NA	NA		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000606199.1	37	NULL		12																																																																																			-	-		0.298	AC136188.1-201	NOVEL	basic	miRNA	ENSG00000272231	miRNA		ACACACAC				74293707	+1	no_errors	ENST00000606199	ensembl	human	novel	74_37	rna	DEL	0.011:0.011:0.017:0.021:0.026:0.029:0.033:0.036	-
FOXE1	2304	genome.wustl.edu	37	9	100616701	100616706	+	In_Frame_Del	DEL	GCCGCC	GCCGCC	-	rs371516340|rs565664344|rs71369530	byFrequency	TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	GCCGCC	GCCGCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr9:100616701_100616706delGCCGCC	ENST00000375123.3	+	1	1166_1171	c.505_510delGCCGCC	c.(505-510)gccgccdel	p.AA177del		NM_004473.3	NP_004464.2	O00358	FOXE1_HUMAN	forkhead box E1 (thyroid transcription factor 2)	177	Ala-rich.|Poly-Ala.				anatomical structure morphogenesis (GO:0009653)|cell migration (GO:0016477)|embryonic organ morphogenesis (GO:0048562)|hair follicle morphogenesis (GO:0031069)|hard palate development (GO:0060022)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pharynx development (GO:0060465)|positive regulation of transcription, DNA-templated (GO:0045893)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	5		Acute lymphoblastic leukemia(62;0.158)				Ggctgccgcagccgccgccgccgccg	0.767																																																	0								ENSG00000178919																																			FOXE1	SO:0001651	inframe_deletion	0				HGNC	U89995	CCDS35078.1	9q22	2008-09-05			ENSG00000178919	ENSG00000178919		"""Forkhead boxes"""	3806	protein-coding gene	gene with protein product		602617	"""forkhead box E2"""	FKHL15, TITF2, FOXE2		9169137, 9697705	Standard	NM_004473		Approved	TTF-2, HFKH4	uc004axu.3	O00358	OTTHUMG00000020333	ENST00000375123.3:c.505_510delGCCGCC	9.37:g.100616707_100616712delGCCGCC	ENSP00000364265:p.Ala177_Ala178del	Somatic	NA	NA	NA		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O75765|Q5T109|Q99526	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.AA172in_frame_del	ENST00000375123.3	37	c.505_510	CCDS35078.1	9																																																																																			-	NULL		0.767	FOXE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXE1	protein_coding	OTTHUMT00000053341.1	GCCGCC				100616706	+1	no_errors	ENST00000375123	ensembl	human	known	74_37	in_frame_del	DEL	0.602:0.620:0.614:0.750:0.779:0.753	-
RP11-423O2.5	0	genome.wustl.edu	37	1	142803240	142803240	+	lincRNA	SNP	G	G	A	rs76010818	byFrequency	TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr1:142803240G>A	ENST00000423385.1	-	0	1725																											GTAACAAAGCGTCAGTCTTAT	0.348																																																	0								ENSG00000234978																																			RP11-423O2.5			0			-	Clone_based_vega_gene																													1.37:g.142803240G>A		Somatic	0	46	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	68	15.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000423385.1	37	NULL		1																																																																																			-	-		0.348	RP11-423O2.5-001	KNOWN	basic	lincRNA	ENSG00000234978	lincRNA	OTTHUMT00000193203.1	G		rs76010818		142803240	-1	no_errors	ENST00000423385	ensembl	human	known	74_37	rna	SNP	0.014	A
AXIN2	8313	genome.wustl.edu	37	17	63533733	63533735	+	In_Frame_Del	DEL	TGG	TGG	-			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	TGG	TGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr17:63533733_63533735delTGG	ENST00000375702.5	-	5	1527_1529	c.1419_1421delCCA	c.(1417-1422)caccat>cat	p.473_474HH>H	AXIN2_ENST00000307078.5_In_Frame_Del_p.473_474HH>H			Q9Y2T1	AXIN2_HUMAN	axin 2	473	Interaction with beta-catenin. {ECO:0000250}.|Poly-His.				bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						GTACTGCGAATGGTGGTGGTGGT	0.709									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																																								0								ENSG00000168646																																			AXIN2	SO:0001651	inframe_deletion	0	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome		HGNC	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.1419_1421delCCA	17.37:g.63533742_63533744delTGG	ENSP00000364854:p.His474del	Somatic	0	24	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	Q3MJ88|Q9H3M6|Q9UH84	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DIX,pfam_RGS_dom,pfam_Axin_b-cat-bd,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_DIX,pfscan_DIX,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.H474in_frame_del	ENST00000375702.5	37	c.1421_1419		17																																																																																			-	NULL		0.709	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	AXIN2	protein_coding	OTTHUMT00000445901.1	TGG	NM_004655			63533735	-1	no_errors	ENST00000307078	ensembl	human	known	74_37	in_frame_del	DEL	0.471:0.843:0.868	-
RBPJ	3516	genome.wustl.edu	37	4	26364118	26364118	+	Intron	SNP	G	G	A			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr4:26364118G>A	ENST00000361572.6	+	2	253				RBPJ_ENST00000342320.4_5'UTR|RBPJ_ENST00000355476.3_5'UTR|RBPJ_ENST00000348160.4_Intron|RBPJ_ENST00000342295.1_Intron|RBPJ_ENST00000345843.3_Intron|RBPJ_ENST00000507561.1_Intron|RBPJ_ENST00000504907.1_5'UTR|RBPJ_ENST00000511401.1_3'UTR			Q06330	SUH_HUMAN	recombination signal binding protein for immunoglobulin kappa J region						angiogenesis (GO:0001525)|arterial endothelial cell fate commitment (GO:0060844)|atrioventricular canal development (GO:0036302)|auditory receptor cell fate commitment (GO:0009912)|B cell differentiation (GO:0030183)|blood vessel endothelial cell fate specification (GO:0097101)|blood vessel lumenization (GO:0072554)|blood vessel remodeling (GO:0001974)|cardiac left ventricle morphogenesis (GO:0003214)|Clara cell differentiation (GO:0060486)|defense response to bacterium (GO:0042742)|DNA recombination (GO:0006310)|dorsal aorta morphogenesis (GO:0035912)|endocardium morphogenesis (GO:0003160)|epidermal cell fate specification (GO:0009957)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|gene expression (GO:0010467)|hair follicle maturation (GO:0048820)|humoral immune response (GO:0006959)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|pituitary gland development (GO:0021983)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:1901297)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of ephrin receptor signaling pathway (GO:1901189)|positive regulation of ERBB signaling pathway (GO:1901186)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription of Notch receptor target (GO:0007221)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|sebaceous gland development (GO:0048733)|secondary heart field specification (GO:0003139)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|recombinase activity (GO:0000150)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)	15		Breast(46;0.0503)				TAGTTCTTCGGAACCATTATG	0.348																																																	0								ENSG00000168214																																			RBPJ	SO:0001627	intron_variant	0			-	HGNC	L07872	CCDS3436.1, CCDS3437.1, CCDS33969.1, CCDS43219.1	4p15.2	2013-10-18	2007-02-26	2007-02-26	ENSG00000168214	ENSG00000168214			5724	protein-coding gene	gene with protein product	"""suppressor of hairless homolog (Drosophila)"""	147183	"""recombining binding protein suppressor of hairless (Drosophila)"""	IGKJRB1, RBPSUH		8406481, 9290259	Standard	NM_005349		Approved	SUH, IGKJRB, RBPJK, KBF2, RBP-J, CBF1	uc003gsb.2	Q06330	OTTHUMG00000097793	ENST00000361572.6:c.60-23857G>A	4.37:g.26364118G>A		Somatic	0	39	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	31	53.03	B4DY22|Q5XKH9|Q6P1N3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361572.6	37	NULL	CCDS3437.1	4																																																																																			-	-		0.348	RBPJ-002	KNOWN	basic|CCDS	protein_coding	RBPJ	protein_coding	OTTHUMT00000215046.2	G	NM_015874	-		26364118	+1	no_errors	ENST00000511401	ensembl	human	known	74_37	rna	SNP	1.000	A
POLE	5426	genome.wustl.edu	37	12	133220099	133220100	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr12:133220099_133220100delCA	ENST00000320574.5	-	34	4380_4381	c.4337_4338delTG	c.(4336-4338)gtgfs	p.V1447fs	POLE_ENST00000535270.1_Frame_Shift_Del_p.V1420fs|POLE_ENST00000434528.3_5'Flank	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1447					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GTTTATTGACCACACACACACA	0.604								DNA polymerases (catalytic subunits)																																									0								ENSG00000177084																																			POLE	SO:0001589	frameshift_variant	0				HGNC		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.4337_4338delTG	12.37:g.133220109_133220110delCA	ENSP00000322570:p.Val1447fs	Somatic	0	59	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	Q13533|Q86VH9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DNA_pol_e_suA_C,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	p.V1446fs	ENST00000320574.5	37	c.4338_4337	CCDS9278.1	12																																																																																			-	NULL		0.604	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	protein_coding	OTTHUMT00000397689.2	CA	NM_006231			133220100	-1	no_errors	ENST00000320574	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
PSMC6	5706	genome.wustl.edu	37	14	53176455	53176455	+	Intron	DEL	T	T	-	rs200184712		TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr14:53176455delT	ENST00000606149.1	+	4	274				PSMC6_ENST00000445930.2_Intron	NM_002806.3	NP_002797.3	P62333	PRS10_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 6						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein binding, bridging (GO:0030674)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	19	Breast(41;0.176)					agattttggcttttttttttt	0.303																																																	0								ENSG00000100519																																			PSMC6	SO:0001627	intron_variant	0				HGNC		CCDS9710.2	14q22.1	2010-04-21			ENSG00000100519	ENSG00000100519		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9553	protein-coding gene	gene with protein product		602708				8674546, 9473509	Standard	NM_002806		Approved	p42	uc010tqx.2	P62333	OTTHUMG00000152333	ENST00000606149.1:c.258+921T>-	14.37:g.53176455delT		Somatic	0	11	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	28	20.00	B2R975|P49719|Q6IBU3|Q92524	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000606149.1	37	NULL		14																																																																																			-	-		0.303	PSMC6-018	KNOWN	basic|appris_candidate	protein_coding	PSMC6	protein_coding	OTTHUMT00000470741.1	T	NM_002806			53176455	+1	no_errors	ENST00000554952	ensembl	human	known	74_37	rna	DEL	0.141	-
ATRX	546	genome.wustl.edu	37	X	76938581	76938581	+	Nonsense_Mutation	SNP	C	C	A			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chrX:76938581C>A	ENST00000373344.5	-	9	2381	c.2167G>T	c.(2167-2169)Gag>Tag	p.E723*	ATRX_ENST00000395603.3_Nonsense_Mutation_p.E685*|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	723					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TCCACAGTCTCTGATTGCTTA	0.358			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224						153.0	150.0	151.0					X																	76938581		2203	4296	6499	ATRX	SO:0001587	stop_gained	0			-	HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.2167G>T	X.37:g.76938581C>A	ENSP00000362441:p.Glu723*	Somatic	0	26	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	21	61.11	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E723*	ENST00000373344.5	37	c.2167	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	C	38	7.067470	0.98040	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	.	.	.	5.74	5.74	0.90152	.	0.685030	0.13305	N	0.397945	.	.	.	.	.	.	0.58432	D	0.999994	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-0.7924	11.0229	0.47728	0.1424:0.7229:0.1348:0.0	.	.	.	.	X	723;685;650	.	ENSP00000362441:E723X	E	-	1	0	ATRX	76825237	0.535000	0.26370	0.395000	0.26283	0.675000	0.39556	1.080000	0.30779	2.406000	0.81754	0.513000	0.50165	GAG	-	NULL		0.358	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	C	NM_000489	-		76938581	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	nonsense	SNP	0.125	A
BRAT1	221927	genome.wustl.edu	37	7	2581443	2581443	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr7:2581443G>A	ENST00000340611.4	-	8	1299	c.1043C>T	c.(1042-1044)gCc>gTc	p.A348V	BRAT1_ENST00000473879.1_5'Flank	NM_152743.3	NP_689956.2	Q6PJG6	BRAT1_HUMAN	BRCA1-associated ATM activator 1	348					response to ionizing radiation (GO:0010212)	membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23						CACCGTCGTGGCATCGTCTGC	0.682																																																	0								ENSG00000106009						32.0	40.0	38.0					7																	2581443		2203	4299	6502	BRAT1	SO:0001583	missense	0			-	HGNC	BC015632	CCDS5334.1	7p22.3	2011-03-22	2011-02-28	2011-03-22	ENSG00000106009	ENSG00000106009			21701	protein-coding gene	gene with protein product	"""BRCA1-associated protein required for ATM activation protein 1"""	614506	"""chromosome 7 open reading frame 27"""	C7orf27, BAAT1		16452482	Standard	NM_152743		Approved	MGC22916	uc003smi.3	Q6PJG6	OTTHUMG00000119091	ENST00000340611.4:c.1043C>T	7.37:g.2581443G>A	ENSP00000339637:p.Ala348Val	Somatic	0	104	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	49	22	69.01	A4D200|C9JY24|Q8IW85|Q8IZ43|Q8WVR8|Q96IV9|Q9H7J8|Q9UFA3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HEAT,superfamily_ARM-type_fold	p.A348V	ENST00000340611.4	37	c.1043	CCDS5334.1	7	.	.	.	.	.	.	.	.	.	.	G	12.09	1.833648	0.32421	.	.	ENSG00000106009	ENST00000340611	D	0.90004	-2.6	5.0	3.16	0.36331	Armadillo-type fold (1);	0.711869	0.14355	N	0.324810	T	0.76688	0.4022	N	0.14661	0.345	0.09310	N	1	B	0.30068	0.267	B	0.22386	0.039	T	0.62329	-0.6877	10	0.26408	T	0.33	-5.366	9.2887	0.37773	0.1713:0.0:0.8287:0.0	.	348	Q6PJG6	BRAT1_HUMAN	V	348	ENSP00000339637:A348V	ENSP00000339637:A348V	A	-	2	0	BRAT1	2547969	0.010000	0.17322	0.000000	0.03702	0.001000	0.01503	1.790000	0.38734	0.604000	0.29930	0.462000	0.41574	GCC	-	superfamily_ARM-type_fold		0.682	BRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRAT1	protein_coding	OTTHUMT00000239305.2	G	NM_152743	-		2581443	-1	no_errors	ENST00000340611	ensembl	human	known	74_37	missense	SNP	0.002	A
IGF1R	3480	genome.wustl.edu	37	15	99456289	99456289	+	Missense_Mutation	SNP	A	A	G			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr15:99456289A>G	ENST00000268035.6	+	8	2217	c.1606A>G	c.(1606-1608)Aca>Gca	p.T536A	IGF1R_ENST00000558762.1_Missense_Mutation_p.T536A	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	536	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	TAAGAATGTCACAGAGTATGA	0.522																																																	0								ENSG00000140443						48.0	47.0	47.0					15																	99456289		2197	4297	6494	IGF1R	SO:0001583	missense	0			-	HGNC	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.1606A>G	15.37:g.99456289A>G	ENSP00000268035:p.Thr536Ala	Somatic	0	35	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	26	49.02	B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_Fibronectin_type3,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom	p.T536A	ENST00000268035.6	37	c.1606	CCDS10378.1	15	.	.	.	.	.	.	.	.	.	.	A	16.64	3.179434	0.57800	.	.	ENSG00000140443	ENST00000268035	T	0.70869	-0.52	4.64	4.64	0.57946	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000018	T	0.72566	0.3476	M	0.74546	2.27	0.80722	D	1	P;P	0.44877	0.845;0.84	B;B	0.42653	0.226;0.394	T	0.78720	-0.2094	10	0.87932	D	0	.	14.5204	0.67847	1.0:0.0:0.0:0.0	.	536;536	C9J5X1;P08069	.;IGF1R_HUMAN	A	536	ENSP00000268035:T536A	ENSP00000268035:T536A	T	+	1	0	IGF1R	97273812	1.000000	0.71417	0.712000	0.30502	0.967000	0.64934	9.068000	0.93961	2.084000	0.62774	0.383000	0.25322	ACA	-	pirsf_Tyr_kinase_insulin-like_rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3		0.522	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	IGF1R	protein_coding	OTTHUMT00000313537.2	A	NM_000875	-		99456289	+1	no_errors	ENST00000268035	ensembl	human	known	74_37	missense	SNP	1.000	G
POU2F1	5451	genome.wustl.edu	37	1	167385485	167385485	+	IGR	DEL	A	A	-			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr1:167385485delA	ENST00000541643.3	+	0	2664				POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000367866.2_3'UTR|POU2F1_ENST00000367862.5_3'UTR			P14859	PO2F1_HUMAN	POU class 2 homeobox 1						gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						TTTTTTTCTTAAAAAAAAAAA	0.328																																																	0								ENSG00000143190																																			POU2F1	SO:0001628	intergenic_variant	0				HGNC	BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436		1.37:g.167385485delA		Somatic	0	13	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000541643.3	37	NULL		1																																																																																			-	-		0.328	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	POU2F1	protein_coding		A	NM_002697			167385485	+1	no_errors	ENST00000367865	ensembl	human	known	74_37	rna	DEL	0.980	-
MYH11	4629	genome.wustl.edu	37	16	15797882	15797882	+	Missense_Mutation	SNP	T	T	C	rs112999816	byFrequency	TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr16:15797882T>C	ENST00000300036.5	-	41	5994	c.5885A>G	c.(5884-5886)gAc>gGc	p.D1962G	NDE1_ENST00000396354.1_Intron|NDE1_ENST00000342673.5_Intron|MYH11_ENST00000573908.1_5'UTR|MYH11_ENST00000576790.2_3'UTR|NDE1_ENST00000396355.1_Intron|MYH11_ENST00000396324.3_Missense_Mutation_p.D1969G|MYH11_ENST00000452625.2_3'UTR	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1962	C-terminal.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GAAGTCTGCGTCTCGAGTGTC	0.438			T	CBFB	AML																																			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0								ENSG00000133392						229.0	223.0	225.0					16																	15797882		2197	4300	6497	MYH11	SO:0001583	missense	0			-	HGNC	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.5885A>G	16.37:g.15797882T>C	ENSP00000300036:p.Asp1962Gly	Somatic	0	68	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	79	47	62.70	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.D1969G	ENST00000300036.5	37	c.5906	CCDS10565.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.31|12.31	1.898263|1.898263	0.33535|0.33535	.|.	.|.	ENSG00000133392|ENSG00000133392	ENST00000300036;ENST00000396324|ENST00000396320	D;D|.	0.85484|.	-1.99;-1.99|.	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	0.000000|.	0.53938|.	D|.	0.000057|.	T|T	0.45756|0.45756	0.1358|0.1358	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	B;B|.	0.06786|.	0.001;0.001|.	B;B|.	0.04013|.	0.001;0.001|.	T|T	0.52631|0.52631	-0.8550|-0.8550	10|6	0.28530|0.66056	T|D	0.3|0.02	.|.	12.8502|12.8502	0.57852|0.57852	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1962;1969|.	P35749;Q3MNF1|.	MYH11_HUMAN;.|.	G|A	1962;1969|1982	ENSP00000300036:D1962G;ENSP00000379616:D1969G|.	ENSP00000300036:D1962G|ENSP00000379613:T1982A	D|T	-|-	2|1	0|0	MYH11|MYH11	15705383|15705383	0.997000|0.997000	0.39634|0.39634	0.127000|0.127000	0.21898|0.21898	0.705000|0.705000	0.40729|0.40729	4.740000|4.740000	0.62087|0.62087	2.053000|2.053000	0.61076|0.61076	0.459000|0.459000	0.35465|0.35465	GAC|ACG	-	NULL		0.438	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	protein_coding	OTTHUMT00000252192.2	T	NM_001040113	rs112999816		15797882	-1	no_errors	ENST00000396324	ensembl	human	known	74_37	missense	SNP	0.817	C
FAM65A	79567	genome.wustl.edu	37	16	67575479	67575479	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr16:67575479G>A	ENST00000379312.3	+	11	1081	c.960G>A	c.(958-960)tgG>tgA	p.W320*	FAM65A_ENST00000422602.2_Nonsense_Mutation_p.W336*|FAM65A_ENST00000428437.2_Nonsense_Mutation_p.W330*|CTD-2012K14.2_ENST00000567122.1_RNA|CTD-2012K14.3_ENST00000563083.1_RNA|CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000042381.4_Nonsense_Mutation_p.W316*|FAM65A_ENST00000540839.3_Nonsense_Mutation_p.W336*	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	320						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		AAGTCACATGGAGGTTGGTGG	0.602																																																	0								ENSG00000039523						96.0	90.0	92.0					16																	67575479		2198	4300	6498	FAM65A	SO:0001587	stop_gained	0			-	HGNC	AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.960G>A	16.37:g.67575479G>A	ENSP00000368614:p.Trp320*	Somatic	0	36	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	3	87.50	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold,superfamily_HR1_rho-bd	p.W336*	ENST00000379312.3	37	c.1008	CCDS54028.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.7|22.7	4.323615|4.323615	0.81580|0.81580	.|.	.|.	ENSG00000039523|ENSG00000039523	ENST00000428437|ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839	.|.	.|.	.|.	4.75|4.75	4.75|4.75	0.60458|0.60458	.|.	.|0.061177	.|0.64402	.|D	.|0.000001	T|.	0.45256|.	0.1333|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.42189|.	-0.9466|.	3|.	.|0.02654	.|T	.|1	-8.7265|-8.7265	17.7596|17.7596	0.88461|0.88461	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	K|X	311|320;316;336;330	.|.	.|ENSP00000042381:W316X	E|W	+|+	1|3	0|0	FAM65A|FAM65A	66132980|66132980	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.458000|9.458000	0.97634|0.97634	2.177000|2.177000	0.69029|0.69029	0.555000|0.555000	0.69702|0.69702	GAG|TGG	-	NULL		0.602	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM65A	protein_coding	OTTHUMT00000268866.3	G	NM_024519	-		67575479	+1	no_errors	ENST00000422602	ensembl	human	known	74_37	nonsense	SNP	1.000	A
PLCH1	23007	genome.wustl.edu	37	3	155215120	155215120	+	Missense_Mutation	SNP	A	A	G			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr3:155215120A>G	ENST00000340059.7	-	14	1846	c.1847T>C	c.(1846-1848)aTt>aCt	p.I616T	PLCH1_ENST00000414191.1_Missense_Mutation_p.I598T|PLCH1_ENST00000447496.2_Missense_Mutation_p.I616T|PLCH1_ENST00000334686.6_Missense_Mutation_p.I598T|PLCH1_ENST00000494598.1_Missense_Mutation_p.I616T|PLCH1_ENST00000460012.1_Missense_Mutation_p.I598T	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	616	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			GTCATCCACAATGTCCTGAGC	0.423																																																	0								ENSG00000114805						122.0	113.0	116.0					3																	155215120		2203	4300	6503	PLCH1	SO:0001583	missense	0			-	HGNC	AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.1847T>C	3.37:g.155215120A>G	ENSP00000345988:p.Ile616Thr	Somatic	0	34	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	50	76	39.68	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_EF_hand_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.I616T	ENST00000340059.7	37	c.1847	CCDS46939.1	3	.	.	.	.	.	.	.	.	.	.	A	17.44	3.389043	0.61956	.	.	ENSG00000114805	ENST00000494598;ENST00000460012;ENST00000447496;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T;T;T	0.52983	0.64;0.64;0.64;0.64;0.64;0.64	5.76	5.76	0.90799	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.326488	0.36409	N	0.002616	T	0.56108	0.1963	L	0.28054	0.825	0.42088	D	0.991282	D;D;P	0.71674	0.998;0.987;0.837	D;D;P	0.69142	0.962;0.95;0.535	T	0.59236	-0.7492	10	0.52906	T	0.07	.	16.0843	0.81031	1.0:0.0:0.0:0.0	.	598;616;616	Q4KWH8-2;Q4KWH8;Q4KWH8-3	.;PLCH1_HUMAN;.	T	616;598;616;616;598;598	ENSP00000419100:I616T;ENSP00000417502:I598T;ENSP00000402759:I616T;ENSP00000345988:I616T;ENSP00000335469:I598T;ENSP00000412977:I598T	ENSP00000335469:I598T	I	-	2	0	PLCH1	156697814	1.000000	0.71417	0.982000	0.44146	0.916000	0.54674	5.062000	0.64326	2.191000	0.70037	0.533000	0.62120	ATT	-	pfam_PLipase_C_Pinositol-sp_Y,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_Pinositol-sp_Y,pfscan_PLipase_C_Pinositol-sp_Y		0.423	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCH1	protein_coding	OTTHUMT00000351125.1	A	NM_014996	-		155215120	-1	no_errors	ENST00000340059	ensembl	human	known	74_37	missense	SNP	0.956	G
HLA-DRB6	3128	genome.wustl.edu	37	6	32522507	32522526	+	RNA	DEL	CACTTGGCAGGTGTAAACCT	CACTTGGCAGGTGTAAACCT	-	rs200769911|rs1064611|rs139996300	byFrequency	TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	CACTTGGCAGGTGTAAACCT	CACTTGGCAGGTGTAAACCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr6:32522507_32522526delCACTTGGCAGGTGTAAACCT	ENST00000411500.1	-	0	680_699					NR_001298.1				major histocompatibility complex, class II, DR beta 6 (pseudogene)																		TTGGATGCTCCACTTGGCAGGTGTAAACCTCTCCACTCCG	0.527																																																	0								ENSG00000229391																																			HLA-DRB6			0				HGNC	L76566		6p21.3	2011-07-08			ENSG00000229391	ENSG00000229391		"""Histocompatibility complex"""	4954	pseudogene	pseudogene						1529427, 10436177	Standard	NR_001298		Approved		uc003obn.1		OTTHUMG00000031028		6.37:g.32522507_32522526delCACTTGGCAGGTGTAAACCT		Somatic	NA	NA	NA		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000411500.1	37	NULL		6																																																																																			-	-		0.527	HLA-DRB6-002	KNOWN	basic	processed_transcript	HLA-DRB6	pseudogene	OTTHUMT00000272900.1	CACTTGGCAGGTGTAAACCT	NR_001298			32522526	-1	no_errors	ENST00000411500	ensembl	human	known	74_37	rna	DEL	1.000:1.000:0.995:0.983:0.993:1.000:1.000:1.000:1.000:0.998:0.995:0.995:0.994:0.998:1.000:0.999:1.000:1.000:1.000:1.000	-
SLC38A10	124565	genome.wustl.edu	37	17	79257271	79257271	+	Missense_Mutation	SNP	C	C	T	rs375294715		TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr17:79257271C>T	ENST00000374759.3	-	4	678	c.295G>A	c.(295-297)Gcc>Acc	p.A99T	SLC38A10_ENST00000288439.5_Missense_Mutation_p.A99T|SLC38A10_ENST00000546352.1_5'Flank	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	99					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			ACGTAGAAGGCGATGCAGGTG	0.602																																																	0								ENSG00000157637	C	THR/ALA,THR/ALA	1,4393	2.1+/-5.4	0,1,2196	74.0	53.0	60.0		295,295	3.5	0.6	17		60	0,8594		0,0,4297	no	missense,missense	SLC38A10	NM_001037984.1,NM_138570.2	58,58	0,1,6493	TT,TC,CC		0.0,0.0228,0.0077	benign,benign	99/1120,99/781	79257271	1,12987	2197	4297	6494	SLC38A10	SO:0001583	missense	0			-	HGNC	BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.295G>A	17.37:g.79257271C>T	ENSP00000363891:p.Ala99Thr	Somatic	0	48	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	44	12.00	Q6ZRC5|Q8NA99|Q96C66	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AA_transpt_TM	p.A99T	ENST00000374759.3	37	c.295	CCDS42397.1	17	.	.	.	.	.	.	.	.	.	.	C	15.98	2.992657	0.54041	2.28E-4	0.0	ENSG00000157637	ENST00000374759;ENST00000288439;ENST00000539748	T;T;T	0.02472	4.28;4.28;4.28	4.76	3.48	0.39840	.	0.054931	0.64402	N	0.000001	T	0.07593	0.0191	M	0.62723	1.935	0.51233	D	0.999914	P;D	0.63046	0.956;0.992	P;P	0.53313	0.46;0.723	T	0.14309	-1.0477	10	0.45353	T	0.12	-13.9489	10.9216	0.47167	0.0:0.8827:0.0:0.1173	.	99;99	Q9HBR0-2;Q9HBR0	.;S38AA_HUMAN	T	99;99;51	ENSP00000363891:A99T;ENSP00000288439:A99T;ENSP00000439115:A51T	ENSP00000288439:A99T	A	-	1	0	SLC38A10	76871866	0.999000	0.42202	0.598000	0.28837	0.043000	0.13939	4.332000	0.59279	0.767000	0.33267	0.561000	0.74099	GCC	-	pfam_AA_transpt_TM		0.602	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC38A10	protein_coding	OTTHUMT00000397747.1	C	NM_138570	-		79257271	-1	no_errors	ENST00000374759	ensembl	human	known	74_37	missense	SNP	0.998	T
GPSM2	29899	genome.wustl.edu	37	1	109444543	109444543	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr1:109444543C>T	ENST00000406462.2	+	9	1702	c.929C>T	c.(928-930)gCa>gTa	p.A310V	GPSM2_ENST00000264126.3_Missense_Mutation_p.A310V|AKNAD1_ENST00000357393.4_Intron			P81274	GPSM2_HUMAN	G-protein signaling modulator 2	310					establishment of mitotic spindle orientation (GO:0000132)|G-protein coupled receptor signaling pathway (GO:0007186)|lung epithelial cell differentiation (GO:0060487)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase regulator activity (GO:0030695)|identical protein binding (GO:0042802)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)	14		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		AAGCACTTAGCAATTGCTCAA	0.343																																																	0								ENSG00000121957						81.0	77.0	78.0					1																	109444543		2203	4300	6503	GPSM2	SO:0001583	missense	0			-	HGNC	AY136740	CCDS792.2	1p13.3	2013-10-11	2010-06-24		ENSG00000121957	ENSG00000121957		"""Tetratricopeptide (TTC) repeat domain containing"""	29501	protein-coding gene	gene with protein product		609245	"""G-protein signalling modulator 2 (AGS3-like, C. elegans)"", ""deafness, autosomal recessive 82"""	DFNB82		11832491, 8973305, 19888295, 20602914, 21348867	Standard	NM_013296		Approved	LGN, Pins	uc010ovc.2	P81274	OTTHUMG00000011730	ENST00000406462.2:c.929C>T	1.37:g.109444543C>T	ENSP00000385510:p.Ala310Val	Somatic	0	37	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	27	50.00	Q5T1N8|Q6IBL7|Q8N0Z5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GoLoco_motif,pfam_TPR_1,pfam_TPR-4,smart_TPR_repeat,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A310V	ENST00000406462.2	37	c.929	CCDS792.2	1	.	.	.	.	.	.	.	.	.	.	C	12.10	1.838106	0.32513	.	.	ENSG00000121957	ENST00000406462;ENST00000264126	D;D	0.94793	-3.52;-3.52	5.7	5.7	0.88788	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.355324	0.32640	N	0.005821	D	0.83216	0.5206	N	0.16478	0.41	0.37576	D	0.919609	B	0.02656	0.0	B	0.04013	0.001	T	0.78160	-0.2312	10	0.27785	T	0.31	-6.9177	13.5082	0.61495	0.0:0.9195:0.0:0.0805	.	310	P81274	GPSM2_HUMAN	V	310	ENSP00000385510:A310V;ENSP00000264126:A310V	ENSP00000264126:A310V	A	+	2	0	GPSM2	109246066	1.000000	0.71417	1.000000	0.80357	0.561000	0.35649	3.893000	0.56243	2.687000	0.91594	0.563000	0.77884	GCA	-	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR-contain_dom		0.343	GPSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPSM2	protein_coding	OTTHUMT00000032400.3	C	NM_013296	-		109444543	+1	no_errors	ENST00000264126	ensembl	human	known	74_37	missense	SNP	0.995	T
KRT71	112802	genome.wustl.edu	37	12	52942539	52942539	+	Silent	SNP	G	G	T			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr12:52942539G>T	ENST00000267119.5	-	4	828	c.759C>A	c.(757-759)gcC>gcA	p.A253A		NM_033448.2	NP_258259.1	Q3SY84	K2C71_HUMAN	keratin 71	253	Coil 1B.|Rod.				hair follicle morphogenesis (GO:0031069)|intermediate filament organization (GO:0045109)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.194)		ATTCCACCTTGGCCTGCAGTT	0.542																																																	0								ENSG00000139648						195.0	156.0	169.0					12																	52942539		2203	4300	6503	KRT71	SO:0001819	synonymous_variant	0			-	HGNC	AJ308600	CCDS8831.1	12q13.13	2013-01-16			ENSG00000139648	ENSG00000139648		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28927	protein-coding gene	gene with protein product		608245				11982755, 12648212, 16831889	Standard	NM_033448		Approved	KRT6IRS, KRT6IRS1, K6IRS1	uc001sao.3	Q3SY84	OTTHUMG00000167831	ENST00000267119.5:c.759C>A	12.37:g.52942539G>T		Somatic	0	45	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B3KVC1|Q3SY85|Q96DU2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.A253	ENST00000267119.5	37	c.759	CCDS8831.1	12																																																																																			-	pfam_IF		0.542	KRT71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT71	protein_coding	OTTHUMT00000396487.1	G	NM_033448	-		52942539	-1	no_errors	ENST00000267119	ensembl	human	known	74_37	silent	SNP	1.000	T
HSPBP1	23640	genome.wustl.edu	37	19	55790886	55790887	+	In_Frame_Ins	INS	-	-	GCCGCCGCC	rs199849782|rs10701478|rs3040014		TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr19:55790886_55790887insGCCGCCGCC	ENST00000255631.5	-	3	400_401	c.90_91insGGCGGCGGC	c.(88-93)ggctcc>ggcGGCGGCGGCtcc	p.29_30insGGG	HSPBP1_ENST00000433386.2_In_Frame_Ins_p.29_30insGGG|HSPBP1_ENST00000587922.1_In_Frame_Ins_p.29_30insGGG|BRSK1_ENST00000590333.1_5'Flank|HSPBP1_ENST00000376343.3_In_Frame_Ins_p.29_30insGGG	NM_001130106.1|NM_012267.4	NP_001123578.1|NP_036399.3	Q9NZL4	HPBP1_HUMAN	HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1	29	Gly-rich.				negative regulation of catalytic activity (GO:0043086)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)		enzyme inhibitor activity (GO:0004857)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	8			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CCAGCCGAGGAGCCGCCGCCGC	0.713																																																	0								ENSG00000133265																																			HSPBP1	SO:0001652	inframe_insertion	0				HGNC		CCDS33111.1	19q13.42	2008-12-16			ENSG00000133265	ENSG00000133265			24989	protein-coding gene	gene with protein product	"""hsp70 interacting protein"", ""Hsp70 binding protein 1"""	612939				10786638, 9830037	Standard	NM_001130106		Approved	HspBP1, FES1	uc002qkd.3	Q9NZL4		ENST00000255631.5:c.82_90dupGGCGGCGGC	19.37:g.55790887_55790895dupGCCGCCGCC	ENSP00000255631:p.Gly27_Gly29dup	Somatic	NA	NA	NA		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KQP0|B4DG11|O95351|Q6ZNU5	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.30in_frame_insGGG	ENST00000255631.5	37	c.91_90	CCDS33111.1	19																																																																																			-	NULL		0.713	HSPBP1-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	HSPBP1	protein_coding	OTTHUMT00000452670.1	-	NM_012267			55790887	-1	no_errors	ENST00000255631	ensembl	human	known	74_37	in_frame_ins	INS	0.883:0.989	GCCGCCGCC
MEI1	150365	genome.wustl.edu	37	22	42154406	42154406	+	Silent	SNP	G	G	T			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr22:42154406G>T	ENST00000401548.3	+	18	2029	c.1989G>T	c.(1987-1989)ctG>ctT	p.L663L	MEI1_ENST00000400107.1_Silent_p.L31L|MEI1_ENST00000540880.1_5'UTR|MEI1_ENST00000300398.4_5'UTR|MEI1_ENST00000540833.1_Silent_p.L403L	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						AGCATGGGCTGCCCCAGATAA	0.542																																																	0								ENSG00000167077						51.0	53.0	52.0					22																	42154406		1951	4146	6097	MEI1	SO:0001819	synonymous_variant	0			-	HGNC	AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.1989G>T	22.37:g.42154406G>T		Somatic	0	16	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	8	70.37		Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.L663	ENST00000401548.3	37	c.1989	CCDS46718.1	22																																																																																			-	superfamily_ARM-type_fold		0.542	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MEI1	protein_coding	OTTHUMT00000074937.3	G	NM_152513	-		42154406	+1	no_errors	ENST00000401548	ensembl	human	known	74_37	silent	SNP	1.000	T
OR5P2	120065	genome.wustl.edu	37	11	7818383	7818384	+	In_Frame_Ins	INS	-	-	ATATGGTTACCAGGTAGATGC	rs138967151	byFrequency	TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr11:7818383_7818384insATATGGTTACCAGGTAGATGC	ENST00000329434.2	-	1	136_137	c.106_107insGCATCTACCTGGTAACCATAT	c.(106-108)tct>tGCATCTACCTGGTAACCATATct	p.35_36insCIYLVTI	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153444.1	NP_703145.1	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P, member 2	35						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	22				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GAGATTACCAGATAGGATGATC	0.436														1170	0.233626	0.3404	0.2896	5008	,	,		17899	0.128		0.2763	False		,,,				2504	0.1145																0								ENSG00000183303																																			OR5P2	SO:0001652	inframe_insertion	0				HGNC	AF173006	CCDS7782.1	11p15.4	2012-08-09			ENSG00000183303	ENSG00000183303		"""GPCR / Class A : Olfactory receptors"""	14783	protein-coding gene	gene with protein product							Standard	NM_153444		Approved	JCG3	uc001mfp.1	Q8WZ92	OTTHUMG00000165668	ENST00000329434.2:c.106_107insGCATCTACCTGGTAACCATAT	11.37:g.7818383_7818384insATATGGTTACCAGGTAGATGC	ENSP00000331823:p.Leu35_Ser36insCysIleTyrLeuValThrIle	Somatic	NA	NA	NA		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q3MIS8	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.36in_frame_insCIYLVTI	ENST00000329434.2	37	c.107_106	CCDS7782.1	11																																																																																			-	pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn		0.436	OR5P2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5P2	protein_coding	OTTHUMT00000385696.1	-	NM_153444			7818384	-1	no_errors	ENST00000329434	ensembl	human	known	74_37	in_frame_ins	INS	0.001:0.001	ATATGGTTACCAGGTAGATGC
SPATA31A6	389730	genome.wustl.edu	37	9	43627588	43627588	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr9:43627588C>T	ENST00000332857.6	-	4	1127	c.1099G>A	c.(1099-1101)Gct>Act	p.A367T	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	367					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AATGATTTAGCCAAATTCCCC	0.433																																																	0								ENSG00000185775						1.0	1.0	1.0					9																	43627588		200	552	752	SPATA31A6	SO:0001583	missense	0			-	HGNC		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.1099G>A	9.37:g.43627588C>T	ENSP00000329825:p.Ala367Thr	Somatic	0	222	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	155	15	91.18		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A367T	ENST00000332857.6	37	c.1099	CCDS47973.1	9	.	.	.	.	.	.	.	.	.	.	C	7.925	0.739409	0.15642	.	.	ENSG00000185775	ENST00000332857	T	0.03689	3.84	2.34	-0.153	0.13403	.	3.155640	0.01046	N	0.004381	T	0.02193	0.0068	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.41502	-0.9505	10	0.17369	T	0.5	0.5929	3.05	0.06166	0.5004:0.3286:0.171:0.0	.	367	Q5VVP1	F75A6_HUMAN	T	367	ENSP00000329825:A367T	ENSP00000329825:A367T	A	-	1	0	FAM75A6	43567584	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.866000	0.04245	-0.043000	0.13513	0.449000	0.29647	GCT	-	NULL		0.433	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31A6	protein_coding	OTTHUMT00000036987.1	C	NM_001145196	-		43627588	-1	no_errors	ENST00000332857	ensembl	human	known	74_37	missense	SNP	0.001	T
NCAN	1463	genome.wustl.edu	37	19	19338775	19338775	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr19:19338775G>T	ENST00000252575.6	+	8	2445	c.2346G>T	c.(2344-2346)tgG>tgT	p.W782C	NCAN_ENST00000538881.1_Missense_Mutation_p.W233C	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	782					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	AGGACCCCTGGCCCTCAGTGT	0.602																																																	0								ENSG00000130287						49.0	54.0	52.0					19																	19338775		2203	4300	6503	NCAN	SO:0001583	missense	0			-	HGNC	AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.2346G>T	19.37:g.19338775G>T	ENSP00000252575:p.Trp782Cys	Somatic	0	50	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q9UPK6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Link,pfam_C-type_lectin,pfam_Sushi_SCR_CCP,pfam_Ig_V-set,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Link,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link,prints_AntifreezeII	p.W782C	ENST00000252575.6	37	c.2346	CCDS12397.1	19	.	.	.	.	.	.	.	.	.	.	G	9.000	0.979937	0.18812	.	.	ENSG00000130287	ENST00000539499;ENST00000252575;ENST00000538881	D;D	0.88124	-1.87;-2.34	2.64	1.56	0.23342	.	0.563746	0.13584	N	0.377105	T	0.81683	0.4874	L	0.29908	0.895	0.18873	N	0.999984	D;D	0.63046	0.992;0.983	P;P	0.49561	0.615;0.536	T	0.70666	-0.4809	10	0.38643	T	0.18	.	7.3813	0.26858	0.0:0.2722:0.7278:0.0	.	796;782	Q4LE67;O14594	.;NCAN_HUMAN	C	796;782;233	ENSP00000252575:W782C;ENSP00000442202:W233C	ENSP00000252575:W782C	W	+	3	0	NCAN	19199775	0.002000	0.14202	0.004000	0.12327	0.018000	0.09664	0.853000	0.27777	0.681000	0.31386	0.561000	0.74099	TGG	-	NULL		0.602	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAN	protein_coding	OTTHUMT00000460111.2	G	NM_004386	-		19338775	+1	no_errors	ENST00000252575	ensembl	human	known	74_37	missense	SNP	0.003	T
PHRF1	57661	genome.wustl.edu	37	11	605246	605246	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr11:605246G>T	ENST00000264555.5	+	11	1408	c.1280G>T	c.(1279-1281)gGa>gTa	p.G427V	PHRF1_ENST00000416188.2_Missense_Mutation_p.G427V|PHRF1_ENST00000533464.1_Missense_Mutation_p.G423V|PHRF1_ENST00000413872.2_Missense_Mutation_p.G426V	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	427					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						GCGGATATTGGAGCTGCCTCT	0.612																																																	0								ENSG00000070047						70.0	78.0	76.0					11																	605246		2039	4190	6229	PHRF1	SO:0001583	missense	0			-	HGNC	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.1280G>T	11.37:g.605246G>T	ENSP00000264555:p.Gly427Val	Somatic	0	32	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	9	50.00	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,pfam_Znf_C3HC4_RING-type,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_PHD,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.G427V	ENST00000264555.5	37	c.1280		11	.	.	.	.	.	.	.	.	.	.	G	16.82	3.227735	0.58668	.	.	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	D;D;D;D	0.87029	-2.14;-2.2;-2.16;-2.16	4.65	4.65	0.58169	.	0.000000	0.37393	N	0.002119	D	0.89989	0.6875	L	0.32530	0.975	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;0.999	D	0.90259	0.4299	10	0.46703	T	0.11	-24.7097	17.7029	0.88300	0.0:0.0:1.0:0.0	.	423;426;427;427	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	V	427;426;427;423	ENSP00000264555:G427V;ENSP00000388589:G426V;ENSP00000410626:G427V;ENSP00000431870:G423V	ENSP00000264555:G427V	G	+	2	0	PHRF1	595246	1.000000	0.71417	0.762000	0.31397	0.116000	0.19942	8.911000	0.92721	2.398000	0.81561	0.563000	0.77884	GGA	-	NULL		0.612	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	PHRF1	protein_coding	OTTHUMT00000382133.1	G	NM_020901	-		605246	+1	no_errors	ENST00000264555	ensembl	human	known	74_37	missense	SNP	1.000	T
CCDC162P	221262	genome.wustl.edu	37	6	109630754	109630754	+	RNA	SNP	A	A	C			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr6:109630754A>C	ENST00000422819.1	+	0	854							A2VCL2	CC162_HUMAN	coiled-coil domain containing 162, pseudogene																		GCTCATGGAGAACTGGTGGGT	0.463																																																	0								ENSG00000203799																																			CCDC162P			0			-	HGNC			6q21	2011-04-28	2011-04-28	2011-04-28	ENSG00000203799	ENSG00000203799			21565	pseudogene	pseudogene			"""chromosome 6 open reading frame 184"", ""chromosome 6 open reading frame 185"""	C6orf184, C6orf185, CCDC162			Standard	NR_028595		Approved	bA425D10.7, bA425D10.3	uc003ptb.1	A2VCL2	OTTHUMG00000015342		6.37:g.109630754A>C		Somatic	0	32	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	23	61.67	A1A4V1|A4QMU0|Q5JSU0|Q5JSU7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000422819.1	37	NULL		6																																																																																			-	-		0.463	CCDC162P-002	KNOWN	basic	processed_transcript	CCDC162P	pseudogene	OTTHUMT00000365631.1	A	NR_028595	-		109630754	+1	no_errors	ENST00000506861	ensembl	human	known	74_37	rna	SNP	1.000	C
HP	3240	genome.wustl.edu	37	16	72093094	72093095	+	Intron	INS	-	-	CTGAGCA	rs573073579	byFrequency	TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr16:72093094_72093095insCTGAGCA	ENST00000355906.5	+	6	500				HP_ENST00000565574.1_Intron|HPR_ENST00000356967.5_Intron|HP_ENST00000569639.1_Frame_Shift_Ins_p.-92fs|HP_ENST00000562526.1_Intron|HP_ENST00000570083.1_Intron|HP_ENST00000398131.2_Intron|HP_ENST00000357763.4_Intron	NM_005143.3	NP_005134.1	P00738	HPT_HUMAN	haptoglobin						acute-phase response (GO:0006953)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|immune system process (GO:0002376)|negative regulation of hydrogen peroxide catabolic process (GO:2000296)|negative regulation of oxidoreductase activity (GO:0051354)|positive regulation of cell death (GO:0010942)|response to hydrogen peroxide (GO:0042542)	blood microparticle (GO:0072562)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|haptoglobin-hemoglobin complex (GO:0031838)	antioxidant activity (GO:0016209)|hemoglobin binding (GO:0030492)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|urinary_tract(1)	7		Renal(780;9.67e-05)|Ovarian(137;0.00327)|Hepatocellular(780;0.114)		BRCA - Breast invasive adenocarcinoma(221;0.00015)|Kidney(780;0.000529)		GCAGGTGGGTGCTGAGCACTTA	0.52														169	0.033746	0.0908	0.0159	5008	,	,		18348	0.003		0.0338	False		,,,				2504	0.001																0								ENSG00000257017		,	115,3291		54,7,1642					,	1.1	0.0		dbSNP_130	111	55,7727		21,13,3857	no	intron,intron	HP	NM_005143.3,NM_001126102.1	,	75,20,5499	A1A1,A1R,RR		0.7068,3.3764,1.5195	,	,		170,11018				HP	SO:0001627	intron_variant	0				HGNC		CCDS45524.1, CCDS45525.1	16q22.2	2012-10-02			ENSG00000257017	ENSG00000257017			5141	protein-coding gene	gene with protein product		140100				11109501, 9352226	Standard	NM_005143		Approved		uc002fbr.4	P00738		ENST00000355906.5:c.442+7->CTGAGCA	16.37:g.72093095_72093101dupCTGAGCA		Somatic	NA	NA	NA		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B0AZL5|P00737|Q0VAC4|Q0VAC5|Q2PP15|Q3B7J0|Q6LBY9|Q9UC67	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	superfamily_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.*93fs	ENST00000355906.5	37	c.272_273	CCDS45524.1	16																																																																																			-	NULL		0.520	HP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HP	protein_coding	OTTHUMT00000421680.1	-	NM_005143			72093095	+1	no_errors	ENST00000569639	ensembl	human	putative	74_37	frame_shift_ins	INS	0.001:0.000	CTGAGCA
NLRC5	84166	genome.wustl.edu	37	16	57057759	57057759	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr16:57057759C>A	ENST00000262510.6	+	5	643	c.418C>A	c.(418-420)Cag>Aag	p.Q140K	NLRC5_ENST00000539144.1_Missense_Mutation_p.Q140K|NLRC5_ENST00000436936.1_Missense_Mutation_p.Q140K|NLRC5_ENST00000308149.7_Missense_Mutation_p.Q140K	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	140					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CAAGAAGCAGCAGCTAGGTGG	0.607																																																	0								ENSG00000140853						33.0	29.0	30.0					16																	57057759		2198	4300	6498	NLRC5	SO:0001583	missense	0			-	HGNC	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.418C>A	16.37:g.57057759C>A	ENSP00000262510:p.Gln140Lys	Somatic	0	43	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_NACHT_NTPase	p.Q140K	ENST00000262510.6	37	c.418	CCDS10773.1	16	.	.	.	.	.	.	.	.	.	.	C	17.76	3.469298	0.63625	.	.	ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000539144	T;T;T;T	0.73258	-0.53;-0.56;-0.73;-0.56	4.77	3.81	0.43845	.	0.000000	0.32785	N	0.005657	T	0.67924	0.2945	M	0.71581	2.175	0.22918	N	0.998564	P	0.48503	0.911	B	0.43809	0.432	T	0.59526	-0.7438	10	0.20519	T	0.43	.	10.9905	0.47547	0.0:0.812:0.188:0.0	.	140	Q86WI3	NLRC5_HUMAN	K	140	ENSP00000262510:Q140K;ENSP00000308886:Q140K;ENSP00000389739:Q140K;ENSP00000441727:Q140K	ENSP00000262510:Q140K	Q	+	1	0	NLRC5	55615260	0.985000	0.35326	0.951000	0.38953	0.815000	0.46073	1.163000	0.31798	1.232000	0.43678	0.557000	0.71058	CAG	-	NULL		0.607	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	protein_coding	OTTHUMT00000257346.1	C	NM_032206	-		57057759	+1	no_errors	ENST00000262510	ensembl	human	known	74_37	missense	SNP	0.999	A
HNRNPL	3191	genome.wustl.edu	37	19	39336125	39336125	+	Intron	SNP	G	G	C			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr19:39336125G>C	ENST00000221419.5	-	4	1077				HNRNPL_ENST00000600873.1_Intron|AC008982.2_ENST00000600473.1_RNA	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			GATATGCCTGGTCCTTTAACT	0.473																																																	0								ENSG00000269688																																			AC008982.2	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.710+164C>G	19.37:g.39336125G>C		Somatic	0	19	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	14	41.67	A6ND69|A6NIT8|Q9H3P3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000221419.5	37	NULL	CCDS33015.1	19																																																																																			-	-		0.473	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000269688	protein_coding	OTTHUMT00000462670.1	G		-		39336125	-1	no_errors	ENST00000600473	ensembl	human	known	74_37	rna	SNP	0.000	C
CENPV	201161	genome.wustl.edu	37	17	16256372	16256372	+	Nonsense_Mutation	SNP	C	C	A			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr17:16256372C>A	ENST00000299736.4	-	1	441	c.379G>T	c.(379-381)Gag>Tag	p.E127*	CENPV_ENST00000476243.1_5'UTR	NM_181716.2	NP_859067.2	Q7Z7K6	CENPV_HUMAN	centromere protein V	130					ameboidal cell migration (GO:0001667)|centromere complex assembly (GO:0034508)|mitotic nuclear division (GO:0007067)|pericentric heterochromatin assembly (GO:0031508)|positive regulation of cytokinesis (GO:0032467)|regulation of chromosome organization (GO:0033044)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|spindle midzone (GO:0051233)	carbon-sulfur lyase activity (GO:0016846)			endometrium(1)|large_intestine(2)	3						GCGGCACCCTCGGAGGTAAGC	0.726																																																	0								ENSG00000166582						17.0	19.0	18.0					17																	16256372		2198	4290	6488	CENPV	SO:0001587	stop_gained	0			-	HGNC	AF514992	CCDS32575.1	17p11.2	2013-11-05	2008-10-29	2008-10-29	ENSG00000166582	ENSG00000166582			29920	protein-coding gene	gene with protein product		608139	"""proline rich 6"""	PRR6		12196509, 18772885	Standard	NM_181716		Approved	p30, CENP-V	uc002gpw.3	Q7Z7K6	OTTHUMG00000059345	ENST00000299736.4:c.379G>T	17.37:g.16256372C>A	ENSP00000299736:p.Glu127*	Somatic	0	22	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	12	25.00	B2RPK2|Q3L8N5|Q8NFH6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GFA/CENP-V,superfamily_Mss4-like	p.E127*	ENST00000299736.4	37	c.379	CCDS32575.1	17	.	.	.	.	.	.	.	.	.	.	C	16.67	3.187454	0.57909	.	.	ENSG00000166582	ENST00000299736	.	.	.	2.99	0.836	0.18891	.	0.271414	0.26390	N	0.024655	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	6.7305	0.23381	0.2017:0.6025:0.1958:0.0	.	.	.	.	X	127	.	ENSP00000299736:E127X	E	-	1	0	CENPV	16197097	1.000000	0.71417	0.706000	0.30403	0.097000	0.18754	3.931000	0.56529	0.034000	0.15491	-0.195000	0.12781	GAG	-	NULL		0.726	CENPV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPV	protein_coding	OTTHUMT00000131877.1	C	NM_181716	-		16256372	-1	no_errors	ENST00000299736	ensembl	human	known	74_37	nonsense	SNP	0.913	A
LTBP3	4054	genome.wustl.edu	37	11	65325326	65325334	+	In_Frame_Del	DEL	CAGCAGCAG	CAGCAGCAG	-	rs577530923	byFrequency	TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	CAGCAGCAG	CAGCAGCAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr11:65325326_65325334delCAGCAGCAG	ENST00000301873.5	-	1	365_373	c.97_105delCTGCTGCTG	c.(97-105)ctgctgctgdel	p.LLL33del	LTBP3_ENST00000322147.4_In_Frame_Del_p.LLL33del|LTBP3_ENST00000536982.1_5'Flank	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	33	Gly-rich.				bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						cgcccaggcccagcagcagcagcagcagc	0.813														87	0.0173722	0.0635	0.0043	5008	,	,		4999	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000168056																																			LTBP3	SO:0001651	inframe_deletion	0				HGNC	AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.97_105delCTGCTGCTG	11.37:g.65325335_65325343delCAGCAGCAG	ENSP00000301873:p.Leu33_Leu35del	Somatic	NA	NA	NA		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O15107|Q96HB9|Q9H7K2|Q9UFN4	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.LLL33in_frame_del	ENST00000301873.5	37	c.105_97	CCDS44647.1	11																																																																																			-	NULL		0.813	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP3	protein_coding	OTTHUMT00000390538.1	CAGCAGCAG	NM_021070			65325334	-1	no_errors	ENST00000301873	ensembl	human	known	74_37	in_frame_del	DEL	0.996:0.996:0.995:0.995:0.994:0.994:0.993:0.995:0.997	-
KRTAP10-9	386676	genome.wustl.edu	37	21	46047916	46047916	+	Nonsense_Mutation	SNP	C	C	A			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr21:46047916C>A	ENST00000397911.3	+	1	877	c.828C>A	c.(826-828)tgC>tgA	p.C276*	KRTAP10-9_ENST00000484861.1_Intron|TSPEAR_ENST00000323084.4_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9	276						keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						GCCCTGTGTGCTCCCGCCCGG	0.701																																																	0								ENSG00000221837						63.0	78.0	73.0					21																	46047916		2196	4291	6487	KRTAP10-9	SO:0001587	stop_gained	0			-	HGNC	AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.828C>A	21.37:g.46047916C>A	ENSP00000381009:p.Cys276*	Somatic	0	107	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	50	47.37	A2RRG1|A6NIR9|Q70LJ1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C276*	ENST00000397911.3	37	c.828	CCDS42961.1	21	.	.	.	.	.	.	.	.	.	.	c	10.15	1.270110	0.23221	.	.	ENSG00000221837	ENST00000397911	.	.	.	2.97	2.07	0.26955	.	.	.	.	.	.	.	.	.	.	.	0.32240	N	0.572874	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.2898	0.31950	0.0:0.8691:0.0:0.1309	.	.	.	.	X	276	.	.	C	+	3	2	KRTAP10-9	44872344	0.511000	0.26179	0.014000	0.15608	0.003000	0.03518	0.738000	0.26158	0.528000	0.28580	-0.253000	0.11424	TGC	-	NULL		0.701	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-9	protein_coding	OTTHUMT00000128040.1	C		-		46047916	+1	no_errors	ENST00000397911	ensembl	human	known	74_37	nonsense	SNP	0.081	A
TTI1	9675	genome.wustl.edu	37	20	36625225	36625225	+	Nonsense_Mutation	SNP	G	G	T	rs150253333		TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr20:36625225G>T	ENST00000373448.2	-	7	3162	c.2924C>A	c.(2923-2925)tCg>tAg	p.S975*	TTI1_ENST00000373447.3_Nonsense_Mutation_p.S975*|TTI1_ENST00000449821.1_Nonsense_Mutation_p.S975*	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	975					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)		p.S975*(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						CAGCGTGTGCGAGTAAACTGG	0.602																																																	1	Substitution - Nonsense(1)	skin(1)						ENSG00000101407						101.0	105.0	104.0					20																	36625225		2203	4300	6503	TTI1	SO:0001587	stop_gained	0			-	HGNC	BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.2924C>A	20.37:g.36625225G>T	ENSP00000362547:p.Ser975*	Somatic	0	54	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold,pirsf_UCP005250	p.S975*	ENST00000373448.2	37	c.2924	CCDS13300.1	20	.	.	.	.	.	.	.	.	.	.	G	38	6.712543	0.97780	.	.	ENSG00000101407	ENST00000373448;ENST00000373447;ENST00000449821	.	.	.	5.2	3.28	0.37604	.	0.215655	0.46442	D	0.000298	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	-14.1488	6.2548	0.20867	0.0834:0.1173:0.6787:0.1205	.	.	.	.	X	975	.	ENSP00000362546:S975X	S	-	2	0	TTI1	36058639	1.000000	0.71417	0.999000	0.59377	0.746000	0.42486	1.696000	0.37773	0.796000	0.33947	-0.920000	0.02741	TCG	-	superfamily_ARM-type_fold,pirsf_UCP005250		0.602	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTI1	protein_coding	OTTHUMT00000079138.2	G	NM_014657	-		36625225	-1	no_errors	ENST00000373447	ensembl	human	known	74_37	nonsense	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577551	7577551	+	Missense_Mutation	SNP	C	C	T	rs397516437		TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr17:7577551C>T	ENST00000269305.4	-	7	919	c.730G>A	c.(730-732)Ggc>Agc	p.G244S	TP53_ENST00000420246.2_Missense_Mutation_p.G244S|TP53_ENST00000445888.2_Missense_Mutation_p.G244S|TP53_ENST00000359597.4_Missense_Mutation_p.G244S|TP53_ENST00000413465.2_Missense_Mutation_p.G244S|TP53_ENST00000455263.2_Missense_Mutation_p.G244S|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	244	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in sporadic cancers; somatic mutation).|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934572).|G -> E (in a sporadic cancer; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in sporadic cancers; somatic mutation).|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).|MG -> IC (in a sporadic cancer; somatic mutation).|MG -> IS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G244C(45)|p.G244S(38)|p.0?(8)|p.G244R(6)|p.?(5)|p.G244fs*3(4)|p.G151C(4)|p.G244fs*4(3)|p.M243_G244>IC(1)|p.G244fs*19(1)|p.G244fs*17(1)|p.M243fs*18(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.C242_M246>L(1)|p.G244del(1)|p.G151S(1)|p.G151fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.G151R(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCATGCCGCCCATGCAGGAA	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	125	Substitution - Missense(95)|Deletion - Frameshift(8)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(4)|Deletion - In frame(3)|Complex - deletion inframe(1)|Complex - compound substitution(1)	lung(23)|upper_aerodigestive_tract(11)|large_intestine(10)|liver(10)|stomach(9)|endometrium(8)|oesophagus(8)|kidney(7)|breast(7)|biliary_tract(6)|urinary_tract(5)|haematopoietic_and_lymphoid_tissue(4)|ovary(4)|bone(4)|central_nervous_system(3)|skin(2)|adrenal_gland(1)|soft_tissue(1)|pancreas(1)|prostate(1)						ENSG00000141510						147.0	111.0	123.0					17																	7577551		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.730G>A	17.37:g.7577551C>T	ENSP00000269305:p.Gly244Ser	Somatic	0	47	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	4	89.47	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.G244S	ENST00000269305.4	37	c.730	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	33	5.204381	0.95033	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99894	-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99854	0.9932	M	0.73962	2.25	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.995;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.946;1.0;1.0;1.0;1.0	D	0.96039	0.9023	10	0.87932	D	0	-29.0146	15.3618	0.74483	0.0:1.0:0.0:0.0	.	244;244;151;244;244;244	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	244;244;244;244;244;244;233;151;112;151	ENSP00000410739:G244S;ENSP00000352610:G244S;ENSP00000269305:G244S;ENSP00000398846:G244S;ENSP00000391127:G244S;ENSP00000391478:G244S;ENSP00000425104:G112S;ENSP00000423862:G151S	ENSP00000269305:G244S	G	-	1	0	TP53	7518276	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	-		7577551	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	T
KLHL26	55295	genome.wustl.edu	37	19	18775148	18775148	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr19:18775148C>T	ENST00000300976.4	+	2	251	c.161C>T	c.(160-162)gCc>gTc	p.A54V	KLHL26_ENST00000599006.1_Missense_Mutation_p.A54V|KLHL26_ENST00000595182.1_Missense_Mutation_p.A54V|KLHL26_ENST00000596843.1_3'UTR	NM_018316.1	NP_060786.1	Q53HC5	KLH26_HUMAN	kelch-like family member 26	54										breast(1)|central_nervous_system(1)|kidney(1)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						CAGGGCCTGGCCACCCTCCGC	0.647																																																	0								ENSG00000167487						93.0	103.0	99.0					19																	18775148		2203	4300	6503	KLHL26	SO:0001583	missense	0			-	HGNC		CCDS12384.1	19p13.11	2013-10-15	2013-02-22		ENSG00000167487	ENSG00000167487		"""Kelch-like"", ""BTB/POZ domain containing"""	25623	protein-coding gene	gene with protein product			"""kelch-like 26 (Drosophila)"""				Standard	XM_006722785		Approved		uc002njz.1	Q53HC5	OTTHUMG00000183114	ENST00000300976.4:c.161C>T	19.37:g.18775148C>T	ENSP00000300976:p.Ala54Val	Somatic	0	69	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q8TAP0|Q9NUX3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.A54V	ENST00000300976.4	37	c.161	CCDS12384.1	19	.	.	.	.	.	.	.	.	.	.	C	19.60	3.857962	0.71834	.	.	ENSG00000167487	ENST00000431920;ENST00000300976	T	0.71222	-0.55	4.14	4.14	0.48551	BTB/POZ fold (2);	0.066539	0.64402	D	0.000008	T	0.55577	0.1929	N	0.10916	0.065	0.47584	D	0.999464	B	0.29805	0.257	B	0.33121	0.158	T	0.62253	-0.6893	10	0.66056	D	0.02	.	15.7475	0.77958	0.0:1.0:0.0:0.0	.	54	Q53HC5	KLH26_HUMAN	V	54	ENSP00000300976:A54V	ENSP00000300976:A54V	A	+	2	0	KLHL26	18636148	1.000000	0.71417	0.799000	0.32177	0.969000	0.65631	5.544000	0.67231	2.016000	0.59253	0.561000	0.74099	GCC	-	superfamily_BTB/POZ_fold,pirsf_Kelch-like_gigaxonin		0.647	KLHL26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL26	protein_coding	OTTHUMT00000465145.1	C	NM_018316	-		18775148	+1	no_errors	ENST00000300976	ensembl	human	known	74_37	missense	SNP	1.000	T
CEP135	9662	genome.wustl.edu	37	4	56865763	56865763	+	Silent	SNP	T	T	C			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr4:56865763T>C	ENST00000257287.4	+	17	2356	c.2232T>C	c.(2230-2232)gaT>gaC	p.D744D		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	744					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					AGACTGTAGATGAGAAGACAG	0.338																																																	0								ENSG00000174799						71.0	79.0	76.0					4																	56865763		2203	4300	6503	CEP135	SO:0001819	synonymous_variant	0			-	HGNC	AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.2232T>C	4.37:g.56865763T>C		Somatic	0	74	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	102	22.73	B2RMY0|O75130|Q58F25|Q9H8H7	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin,superfamily_EB1_C	p.D744	ENST00000257287.4	37	c.2232	CCDS33986.1	4																																																																																			-	NULL		0.338	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP135	protein_coding	OTTHUMT00000362092.2	T	NM_025009	-		56865763	+1	no_errors	ENST00000257287	ensembl	human	known	74_37	silent	SNP	1.000	C
USP30	84749	genome.wustl.edu	37	12	109490426	109490427	+	5'UTR	INS	-	-	CGGCGG	rs71079516|rs3217401|rs140371213	byFrequency	TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr12:109490426_109490427insCGGCGG	ENST00000257548.5	+	0	36_37				USP30-AS1_ENST00000478808.2_RNA|USP30_ENST00000392784.2_Intron	NM_032663.3	NP_116052.2	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30						mitochondrial fusion (GO:0008053)|mitochondrion degradation (GO:0000422)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(7)|kidney(1)|large_intestine(1)|liver(2)|lung(11)|prostate(1)|skin(3)|stomach(2)	28						ATCCCTCGGTCcggcggcggcg	0.728														2378	0.47484	0.177	0.6398	5008	,	,		14910	0.6944		0.5199	False		,,,				2504	0.4877																0								ENSG00000256262																																			USP30-AS1	SO:0001623	5_prime_UTR_variant	0				HGNC	BC022094	CCDS9123.2	12q23.3	2006-01-20	2005-08-08		ENSG00000135093	ENSG00000135093		"""Ubiquitin-specific peptidases"""	20065	protein-coding gene	gene with protein product		612492	"""ubiquitin specific protease 30"""			12838346	Standard	XM_005253962		Approved	MGC10702, FLJ40511	uc010sxi.2	Q70CQ3	OTTHUMG00000133613	ENST00000257548.5:c.-57->CGGCGG	12.37:g.109490427_109490432dupCGGCGG		Somatic	NA	NA	NA		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q8WTU7|Q96JX4|Q9BSS3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000257548.5	37	NULL	CCDS9123.2	12																																																																																			-	-		0.728	USP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP30-AS1	protein_coding	OTTHUMT00000257733.2	-	NM_032663			109490427	-1	no_errors	ENST00000478808	ensembl	human	known	74_37	rna	INS	0.000:0.000	CGGCGG
BOLL	66037	genome.wustl.edu	37	2	198650830	198650830	+	5'Flank	SNP	C	C	A			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr2:198650830C>A	ENST00000392296.4	-	0	0				BOLL_ENST00000282278.8_5'UTR|BOLL_ENST00000321801.7_5'UTR|BOLL_ENST00000486206.1_5'UTR|BOLL_ENST00000433157.1_5'Flank|BOLL_ENST00000430004.1_5'Flank	NM_033030.5	NP_149019.1	Q8N9W6	BOLL_HUMAN	boule-like RNA-binding protein						cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|positive regulation of translational initiation (GO:0045948)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|translation activator activity (GO:0008494)			central_nervous_system(1)|endometrium(2)|lung(6)|ovary(3)|prostate(1)	13						GCCTGGGACTCTCGCCCCCTG	0.652																																																	0								ENSG00000152430																																			BOLL	SO:0001631	upstream_gene_variant	0			-	HGNC		CCDS2324.1, CCDS2325.1, CCDS63081.1	2q33	2013-10-17	2013-10-17		ENSG00000152430	ENSG00000152430		"""RNA binding motif (RRM) containing"""	14273	protein-coding gene	gene with protein product		606165	"""bol (Drosophila boule homolog)-like"", ""bol, boule-like (Drosophila)"""			11390979, 16001084	Standard	NM_197970		Approved	BOULE	uc002uut.2	Q8N9W6	OTTHUMG00000132747		2.37:g.198650830C>A	Exception_encountered	Somatic	0	48	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	B4DZA4|Q0JW32|Q53T62|Q969U3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392296.4	37	NULL	CCDS2325.1	2																																																																																			-	-		0.652	BOLL-001	KNOWN	basic|CCDS	protein_coding	BOLL	protein_coding	OTTHUMT00000256107.3	C	NM_033030	-		198650830	-1	no_errors	ENST00000486206	ensembl	human	known	74_37	rna	SNP	0.799	A
SSPO	23145	genome.wustl.edu	37	7	149477097	149477097	+	RNA	SNP	G	G	C			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr7:149477097G>C	ENST00000378016.2	+	0	1274							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TACTGCGCAGGGGCCATGGCA	0.637																																																	0								ENSG00000197558						33.0	34.0	34.0					7																	149477097		2023	4177	6200	SSPO			0			-	HGNC	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149477097G>C		Somatic	0	63	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	48	12.73	Q76B61	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			-	-		0.637	SSPO-202	KNOWN	basic	processed_transcript	SSPO	processed_transcript		G		-		149477097	+1	no_errors	ENST00000262089	ensembl	human	known	74_37	rna	SNP	0.034	C
TDRD3	81550	genome.wustl.edu	37	13	61103259	61103260	+	Frame_Shift_Ins	INS	-	-	A			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr13:61103259_61103260insA	ENST00000196169.3	+	11	2409_2410	c.1621_1622insA	c.(1621-1623)gaafs	p.E541fs	TDRD3_ENST00000535286.1_Frame_Shift_Ins_p.E634fs|TDRD3_ENST00000377881.2_Frame_Shift_Ins_p.E541fs|TDRD3_ENST00000377894.2_Frame_Shift_Ins_p.E541fs	NM_001146071.1|NM_030794.2	NP_001139543.1|NP_110421.1	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3	541					chromatin modification (GO:0016568)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	40		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		AATTAAGCCAGAAAAAATACTA	0.401																																					Colon(36;164 906 35820 50723)												0								ENSG00000083544																																			TDRD3	SO:0001589	frameshift_variant	0				HGNC	AK023578	CCDS9441.1, CCDS53872.1	13q14.3	2013-01-23			ENSG00000083544	ENSG00000083544		"""Tudor domain containing"""	20612	protein-coding gene	gene with protein product		614392					Standard	NM_030794		Approved	FLJ21007	uc010aeg.3	Q9H7E2	OTTHUMG00000017007	ENST00000196169.3:c.1627dupA	13.37:g.61103265_61103265dupA	ENSP00000196169:p.Glu541fs	Somatic	0	73	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	108	11.48	B2MWP9|Q53XA6|Q6P992	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_DUF1767,pfam_Tudor,pfam_Survival_motor_neuron,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,smart_Tudor,pfscan_Tudor,pfscan_UBA/transl_elong_EF1B_N_euk	p.I636fs	ENST00000196169.3	37	c.1900_1901	CCDS9441.1	13																																																																																			-	NULL		0.401	TDRD3-201	KNOWN	basic|CCDS	protein_coding	TDRD3	protein_coding	OTTHUMT00000045175.2	-	NM_030794			61103260	+1	no_errors	ENST00000535286	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
SNED1	25992	genome.wustl.edu	37	2	242002240	242002240	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr2:242002240C>A	ENST00000310397.8	+	17	2290	c.2290C>A	c.(2290-2292)Cat>Aat	p.H764N	SNED1_ENST00000405547.3_Missense_Mutation_p.H764N|SNED1_ENST00000342631.6_Missense_Mutation_p.H764N|SNED1_ENST00000401884.1_Missense_Mutation_p.H764N|AC005237.4_ENST00000458377.1_RNA	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	764	EGF-like 11; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		GCCGTGCCTGCATGGGGGCTC	0.572																																																	0								ENSG00000162804						45.0	46.0	46.0					2																	242002240		2039	4191	6230	SNED1	SO:0001583	missense	0			-	HGNC	AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.2290C>A	2.37:g.242002240C>A	ENSP00000308893:p.His764Asn	Somatic	0	68	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EG-like_dom,pfam_Fibronectin_type3,pfam_Nidogen_extracell_dom,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_Fibronectin_type3,superfamily_Sushi_SCR_CCP,smart_Nidogen_extracell_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Sushi_SCR_CCP,smart_Fibronectin_type3,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Sushi_SCR_CCP	p.H764N	ENST00000310397.8	37	c.2290	CCDS46562.1	2	.	.	.	.	.	.	.	.	.	.	C	0.037	-1.302362	0.01353	.	.	ENSG00000162804	ENST00000401884;ENST00000405547;ENST00000310397;ENST00000342631	D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7	4.96	2.9	0.33743	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.636305	0.14019	N	0.346934	T	0.70029	0.3177	N	0.01096	-1.015	0.30534	N	0.767161	B	0.06786	0.001	B	0.06405	0.002	T	0.61252	-0.7100	10	0.02654	T	1	.	11.2391	0.48958	0.6358:0.3641:0.0:0.0	.	764	Q8TER0	SNED1_HUMAN	N	764	ENSP00000384871:H764N;ENSP00000386007:H764N;ENSP00000308893:H764N;ENSP00000342992:H764N	ENSP00000308893:H764N	H	+	1	0	SNED1	241650913	1.000000	0.71417	0.944000	0.38274	0.184000	0.23303	2.621000	0.46418	1.048000	0.40298	0.655000	0.94253	CAT	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.572	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SNED1	protein_coding	OTTHUMT00000323935.2	C	XM_059482	-		242002240	+1	no_errors	ENST00000310397	ensembl	human	known	74_37	missense	SNP	0.998	A
GBA2	57704	genome.wustl.edu	37	9	35740529	35740529	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr9:35740529G>T	ENST00000378103.3	-	6	1646	c.1123C>A	c.(1123-1125)Ccc>Acc	p.P375T	GBA2_ENST00000378094.4_Missense_Mutation_p.P375T|GBA2_ENST00000467252.1_5'UTR|GBA2_ENST00000545786.1_Missense_Mutation_p.P381T|GBA2_ENST00000378088.1_5'Flank	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	375					bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TCACCAGTGGGAGAGTCCAGC	0.582																																																	0								ENSG00000070610						100.0	81.0	88.0					9																	35740529		2203	4300	6503	GBA2	SO:0001583	missense	0			-	HGNC	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.1123C>A	9.37:g.35740529G>T	ENSP00000367343:p.Pro375Thr	Somatic	0	32	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glucosylceramidase,pfam_GBA2_N,superfamily_6-hairpin_glycosidase-like,pirsf_Beta_glucosidase_GBA2-type	p.P381T	ENST00000378103.3	37	c.1141	CCDS6589.1	9	.	.	.	.	.	.	.	.	.	.	G	11.42	1.632282	0.29068	.	.	ENSG00000070610	ENST00000378103;ENST00000378094;ENST00000545786	.	.	.	5.66	4.76	0.60689	Beta-glucosidase, GBA2 type, N-terminal (1);	0.105390	0.64402	D	0.000003	T	0.45518	0.1346	L	0.52573	1.65	0.80722	D	1	P;B;B	0.35575	0.51;0.007;0.092	B;B;B	0.32864	0.154;0.022;0.048	T	0.29610	-1.0006	9	0.15499	T	0.54	-7.2882	9.7741	0.40607	0.075:0.1383:0.7867:0.0	.	381;375;375	F5H7P6;Q9HCG7-2;Q9HCG7	.;.;GBA2_HUMAN	T	375;375;381	.	ENSP00000367334:P375T	P	-	1	0	GBA2	35730529	1.000000	0.71417	0.996000	0.52242	0.977000	0.68977	4.042000	0.57347	2.676000	0.91093	0.655000	0.94253	CCC	-	pfam_GBA2_N,pirsf_Beta_glucosidase_GBA2-type		0.582	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GBA2	protein_coding	OTTHUMT00000055456.1	G	NM_020944	-		35740529	-1	no_errors	ENST00000545786	ensembl	human	known	74_37	missense	SNP	1.000	T
C3orf27	23434	genome.wustl.edu	37	3	128292319	128292320	+	Frame_Shift_Del	DEL	TC	TC	-	rs147519916		TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr3:128292319_128292320delTC	ENST00000356020.2	-	3	1219_1220	c.253_254delGA	c.(253-255)gatfs	p.D86fs		NM_007354.2	NP_031380.1	O15544	GR6_HUMAN	chromosome 3 open reading frame 27	86										large_intestine(2)|lung(5)|prostate(1)	8				GBM - Glioblastoma multiforme(114;0.176)		GAGCTCGTCATCTCTCTCTCTC	0.599																																																	0								ENSG00000198685																																			C3orf27	SO:0001589	frameshift_variant	0				HGNC	AF008192	CCDS3050.1	3q21	2005-12-19			ENSG00000198685	ENSG00000198685			17099	protein-coding gene	gene with protein product						9307271	Standard	NR_125802		Approved	GR6	uc003ekq.3	O15544	OTTHUMG00000159688	ENST00000356020.2:c.253_254delGA	3.37:g.128292329_128292330delTC	ENSP00000348302:p.Asp86fs	Somatic	0	38	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.D85fs	ENST00000356020.2	37	c.254_253	CCDS3050.1	3																																																																																			-	NULL		0.599	C3orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf27	protein_coding	OTTHUMT00000356924.1	TC	NM_007354			128292320	-1	no_errors	ENST00000356020	ensembl	human	known	74_37	frame_shift_del	DEL	0.075:0.076	-
YLPM1	56252	genome.wustl.edu	37	14	75265723	75265723	+	Silent	SNP	C	C	A			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr14:75265723C>A	ENST00000325680.7	+	5	3847	c.3723C>A	c.(3721-3723)ctC>ctA	p.L1241L	YLPM1_ENST00000552421.1_Intron|YLPM1_ENST00000238571.3_Silent_p.L1046L	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	1046					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		CACTAGAGCTCTATAACAGAG	0.483																																																	0								ENSG00000119596						88.0	82.0	84.0					14																	75265723		2018	4174	6192	YLPM1	SO:0001819	synonymous_variant	0			-	HGNC	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.3723C>A	14.37:g.75265723C>A		Somatic	0	37	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	P49752|Q96I64|Q9P1V7	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase	p.L1241	ENST00000325680.7	37	c.3723	CCDS45135.1	14																																																																																			-	NULL		0.483	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YLPM1	protein_coding	OTTHUMT00000404451.1	C	NM_019589	-		75265723	+1	no_errors	ENST00000325680	ensembl	human	known	74_37	silent	SNP	0.858	A
GAN	8139	genome.wustl.edu	37	16	81391444	81391444	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr16:81391444G>T	ENST00000568107.2	+	5	1043	c.881G>T	c.(880-882)tGc>tTc	p.C294F		NM_022041.3	NP_071324.1	Q9H2C0	GAN_HUMAN	gigaxonin	294					cell death (GO:0008219)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)	25		Colorectal(91;0.153)				GCGATGCGATGCATGTGCCCT	0.453																																					GBM(106;1239 1507 7582 9741 33976)												0								ENSG00000261609						191.0	165.0	174.0					16																	81391444		2202	4300	6502	GAN	SO:0001583	missense	0			-	HGNC	AF291673	CCDS10935.1	16q24.1	2014-09-17	2008-08-01		ENSG00000261609	ENSG00000261609		"""Kelch-like"", ""BTB/POZ domain containing"""	4137	protein-coding gene	gene with protein product	"""kelch-like family member 16"""	605379	"""giant axonal neuropathy (gigaxonin)"""			9450783, 11062483	Standard	NM_022041		Approved	GAN1, KLHL16	uc002fgo.3	Q9H2C0	OTTHUMG00000137627	ENST00000568107.2:c.881G>T	16.37:g.81391444G>T	ENSP00000476795:p.Cys294Phe	Somatic	0	27	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.C294F	ENST00000568107.2	37	c.881	CCDS10935.1	16	.	.	.	.	.	.	.	.	.	.	G	19.30	3.800213	0.70567	.	.	ENSG00000127688	ENST00000248272	T	0.65732	-0.17	5.94	5.94	0.96194	Galactose oxidase, beta-propeller (1);	0.085063	0.85682	D	0.000000	T	0.69052	0.3068	N	0.24115	0.695	0.80722	D	1	D	0.67145	0.996	D	0.64687	0.928	T	0.70234	-0.4928	10	0.54805	T	0.06	.	20.3552	0.98837	0.0:0.0:1.0:0.0	.	294	Q9H2C0	GAN_HUMAN	F	294	ENSP00000248272:C294F	ENSP00000248272:C294F	C	+	2	0	GAN	79948945	1.000000	0.71417	0.915000	0.36163	0.959000	0.62525	9.610000	0.98337	2.812000	0.96745	0.557000	0.71058	TGC	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin		0.453	GAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAN	protein_coding	OTTHUMT00000269050.3	G		-		81391444	+1	no_errors	ENST00000568107	ensembl	human	known	74_37	missense	SNP	1.000	T
DCAF17	80067	genome.wustl.edu	37	2	172291384	172291384	+	Intron	SNP	G	G	A			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr2:172291384G>A	ENST00000375255.3	+	1	453				DCAF17_ENST00000539783.1_Intron|METTL8_ENST00000375258.4_5'Flank|DCAF17_ENST00000468592.1_Intron	NM_025000.3	NP_079276.2	Q5H9S7	DCA17_HUMAN	DDB1 and CUL4 associated factor 17						protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)	17						GCCACCAGCTGCTTTTAGTTT	0.478																																																	0								ENSG00000115827																																			DCAF17	SO:0001627	intron_variant	0			-	HGNC	AK023158	CCDS2243.2, CCDS54419.1	2q31.1	2014-01-28	2009-07-17	2009-07-17	ENSG00000115827	ENSG00000115827		"""DDB1 and CUL4 associated factors"""	25784	protein-coding gene	gene with protein product	"""Woodhouse-Sakati syndrome"""	612515	"""chromosome 2 open reading frame 37"""	C2orf37			Standard	NM_001164821		Approved	FLJ13096	uc002ugx.3	Q5H9S7	OTTHUMG00000132259	ENST00000375255.3:c.126+171G>A	2.37:g.172291384G>A		Somatic	0	17	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	8	38.46	B2RTW5|Q53TN3|Q9H908	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000375255.3	37	NULL	CCDS2243.2	2																																																																																			-	-		0.478	DCAF17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCAF17	protein_coding	OTTHUMT00000255342.2	G	NM_025000	-		172291384	+1	no_errors	ENST00000490217	ensembl	human	known	74_37	rna	SNP	0.000	A
MMP3	4314	genome.wustl.edu	37	11	102708089	102708089	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr11:102708089G>C	ENST00000299855.5	-	9	1529	c.1273C>G	c.(1273-1275)Caa>Gaa	p.Q425E	WTAPP1_ENST00000525739.2_RNA	NM_002422.3	NP_002413.1	P08254	MMP3_HUMAN	matrix metallopeptidase 3 (stromelysin 1, progelatinase)	425					cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|positive regulation of oxidative stress-induced cell death (GO:1903209)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)	TCAGCTATTTGCTTGGGAAAG	0.413																																																	0								ENSG00000149968						142.0	145.0	144.0					11																	102708089		2203	4299	6502	MMP3	SO:0001583	missense	0			-	HGNC	X05232	CCDS8323.1	11q22.3	2012-10-02	2005-08-08		ENSG00000149968	ENSG00000149968	3.4.24.17		7173	protein-coding gene	gene with protein product		185250	"""matrix metalloproteinase 3 (stromelysin 1, progelatinase)"""	STMY1, STMY			Standard	NM_002422		Approved		uc001phj.1	P08254	OTTHUMG00000048254	ENST00000299855.5:c.1273C>G	11.37:g.102708089G>C	ENSP00000299855:p.Gln425Glu	Somatic	0	12	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	41	25.45	B2R8B8|Q3B7S0|Q6GRF8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.Q425E	ENST00000299855.5	37	c.1273	CCDS8323.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.654|5.654	0.305265|0.305265	0.10678|0.10678	.|.	.|.	ENSG00000149968|ENSG00000149968	ENST00000299855|ENST00000434103	T|.	0.02395|.	4.31|.	5.17|5.17	-8.1|-8.1	0.01086|0.01086	Hemopexin/matrixin (2);|.	1.424740|.	0.05080|.	N|.	0.483202|.	T|T	0.37183|0.37183	0.0994|0.0994	N|N	0.17723|0.17723	0.515|0.515	0.09310|0.09310	N|N	1|1	B|.	0.10296|.	0.003|.	B|.	0.15870|.	0.014|.	T|T	0.27938|0.27938	-1.0059|-1.0059	10|5	0.07813|.	T|.	0.8|.	.|.	21.4997|21.4997	0.99955|0.99955	0.0:0.0:0.2121:0.7879|0.0:0.0:0.2121:0.7879	.|.	425|.	P08254|.	MMP3_HUMAN|.	E|R	425|68	ENSP00000299855:Q425E|.	ENSP00000299855:Q425E|.	Q|S	-|-	1|3	0|2	MMP3|MMP3	102213299|102213299	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.436000|0.436000	0.31835|0.31835	-0.796000|-0.796000	0.04575|0.04575	-0.938000|-0.938000	0.03714|0.03714	0.655000|0.655000	0.94253|0.94253	CAA|AGC	-	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Hemopexin-like_repeat		0.413	MMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP3	protein_coding	OTTHUMT00000109758.2	G	NM_002422	-		102708089	-1	no_errors	ENST00000299855	ensembl	human	known	74_37	missense	SNP	0.000	C
CCSAP	126731	genome.wustl.edu	37	1	229460176	229460176	+	3'UTR	SNP	T	T	A	rs201639580|rs370670446	byFrequency	TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr1:229460176T>A	ENST00000366687.1	-	0	1670				CCSAP_ENST00000483092.1_5'UTR|CCSAP_ENST00000366686.1_3'UTR|RP4-803J11.2_ENST00000418348.1_RNA|CCSAP_ENST00000284617.2_3'UTR			Q6IQ19	CCSAP_HUMAN	centriole, cilia and spindle-associated protein						multicellular organismal development (GO:0007275)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|regulation of embryonic development (GO:0045995)	axon (GO:0030424)|axoneme (GO:0005930)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cilium (GO:0005929)|spindle (GO:0005819)											ATGTATTCTTTAAAAAAAAAA	0.368													A|||	16	0.00319489	0.0076	0.0	5008	,	,		17071	0.004		0.002	False		,,,				2504	0.0																0								ENSG00000154429																																			CCSAP	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC071609	CCDS1577.1	1q42.13	2012-06-19	2012-06-19	2012-06-19	ENSG00000154429	ENSG00000154429			29578	protein-coding gene	gene with protein product	"""centriole and spindle-associated protein"""		"""chromosome 1 open reading frame 96"""	C1orf96		22493317	Standard	NM_145257		Approved	FLJ41471, CSAP	uc001htl.4	Q6IQ19	OTTHUMG00000037663	ENST00000366687.1:c.*806A>T	1.37:g.229460176T>A		Somatic	0	66	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	70	13.58	A8K5X2|Q6P9G2|Q6ZW85|Q8IXU1|Q96BM2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366687.1	37	NULL	CCDS1577.1	1																																																																																			-	-		0.368	CCSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCSAP	protein_coding	OTTHUMT00000091839.1	T	NM_145257	-		229460176	-1	no_errors	ENST00000483092	ensembl	human	known	74_37	rna	SNP	0.001	A
SEC31B	25956	genome.wustl.edu	37	10	102258919	102258919	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr10:102258919G>C	ENST00000370345.3	-	13	1679	c.1582C>G	c.(1582-1584)Cag>Gag	p.Q528E	SEC31B_ENST00000494350.1_5'UTR	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	528					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		TACCACACCTGGCTGCAGAAG	0.542																																																	0								ENSG00000075826						124.0	95.0	105.0					10																	102258919		2203	4300	6503	SEC31B	SO:0001583	missense	0			-	HGNC	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.1582C>G	10.37:g.102258919G>C	ENSP00000359370:p.Gln528Glu	Somatic	0	19	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	22	42.11	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q528E	ENST00000370345.3	37	c.1582	CCDS7495.1	10	.	.	.	.	.	.	.	.	.	.	G	2.352	-0.348677	0.05208	.	.	ENSG00000075826	ENST00000370345	T	0.50001	0.76	4.89	3.97	0.46021	.	0.466412	0.23953	N	0.042932	T	0.36690	0.0976	L	0.56396	1.775	0.58432	D	0.999999	B;B	0.31790	0.34;0.149	B;B	0.30251	0.113;0.053	T	0.18335	-1.0340	10	0.02654	T	1	-6.379	10.1633	0.42864	0.0:0.0:0.6376:0.3624	.	527;528	Q9NQW1-5;Q9NQW1	.;SC31B_HUMAN	E	528	ENSP00000359370:Q528E	ENSP00000359370:Q528E	Q	-	1	0	SEC31B	102248909	0.933000	0.31639	0.851000	0.33527	0.083000	0.17756	1.332000	0.33805	1.263000	0.44181	0.555000	0.69702	CAG	-	NULL		0.542	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC31B	protein_coding	OTTHUMT00000051198.1	G	NM_015490	-		102258919	-1	no_errors	ENST00000370345	ensembl	human	known	74_37	missense	SNP	0.760	C
ROS1	6098	genome.wustl.edu	37	6	117737431	117737431	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr6:117737431G>C	ENST00000368508.3	-	3	416	c.218C>G	c.(217-219)gCt>gGt	p.A73G	ROS1_ENST00000368507.3_Missense_Mutation_p.A73G|GOPC_ENST00000467125.1_Intron	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	73					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		ACACTTTAAAGCACAGTTTTT	0.343			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																			Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	0								ENSG00000047936						78.0	75.0	76.0					6																	117737431		2203	4300	6503	ROS1	SO:0001583	missense	0			-	HGNC	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.218C>G	6.37:g.117737431G>C	ENSP00000357494:p.Ala73Gly	Somatic	0	29	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	28	51.72	Q15368|Q5TDB5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_LDLR_classB_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A73G	ENST00000368508.3	37	c.218	CCDS5116.1	6	.	.	.	.	.	.	.	.	.	.	G	13.89	2.373247	0.42105	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	T;T	0.71461	-0.55;-0.57	3.59	3.59	0.41128	.	0.407783	0.20808	N	0.085315	T	0.44265	0.1285	L	0.51422	1.61	0.80722	D	1	P	0.34522	0.455	B	0.28784	0.094	T	0.42699	-0.9436	10	0.19147	T	0.46	.	11.0301	0.47767	0.0:0.0:1.0:0.0	.	73	P08922	ROS1_HUMAN	G	73	ENSP00000357494:A73G;ENSP00000357493:A73G	ENSP00000357493:A73G	A	-	2	0	ROS1	117844124	1.000000	0.71417	0.983000	0.44433	0.934000	0.57294	3.108000	0.50337	2.301000	0.77427	0.655000	0.94253	GCT	-	NULL		0.343	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ROS1	protein_coding	OTTHUMT00000043464.1	G		-		117737431	-1	no_errors	ENST00000368508	ensembl	human	known	74_37	missense	SNP	0.990	C
ADAM2	2515	genome.wustl.edu	37	8	39613417	39613417	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr8:39613417C>T	ENST00000265708.4	-	16	1730	c.1627G>A	c.(1627-1629)Gga>Aga	p.G543R	ADAM2_ENST00000347580.4_Missense_Mutation_p.G524R|ADAM2_ENST00000521880.1_Intron|AC136365.1_ENST00000408091.1_RNA|ADAM2_ENST00000379853.2_Intron	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	543	Cys-rich.				adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		ATTAATTTTCCGCACTGCAGA	0.244																																																	0								ENSG00000104755						43.0	47.0	46.0					8																	39613417		2201	4298	6499	ADAM2	SO:0001583	missense	0			-	HGNC	U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.1627G>A	8.37:g.39613417C>T	ENSP00000265708:p.Gly543Arg	Somatic	0	106	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	128	131	49.42	P78326|Q9UQQ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.G543R	ENST00000265708.4	37	c.1627	CCDS34884.1	8	.	.	.	.	.	.	.	.	.	.	C	13.67	2.305988	0.40795	.	.	ENSG00000104755	ENST00000347580;ENST00000265708	T;T	0.68479	-0.33;-0.33	4.8	4.8	0.61643	ADAM, cysteine-rich (2);	.	.	.	.	D	0.85927	0.5811	H	0.94964	3.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.89572	0.3814	8	.	.	.	.	13.7145	0.62689	0.0:1.0:0.0:0.0	.	524;543	Q99965-2;Q99965	.;ADAM2_HUMAN	R	524;543	ENSP00000343854:G524R;ENSP00000265708:G543R	.	G	-	1	0	ADAM2	39732574	1.000000	0.71417	0.981000	0.43875	0.053000	0.15095	3.061000	0.49963	2.356000	0.79943	0.655000	0.94253	GGA	-	pfam_ADAM_Cys-rich,smart_ADAM_Cys-rich		0.244	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM2	protein_coding	OTTHUMT00000376926.1	C	NM_001464	-		39613417	-1	no_errors	ENST00000265708	ensembl	human	known	74_37	missense	SNP	1.000	T
PFKFB4	5210	genome.wustl.edu	37	3	48581056	48581056	+	Missense_Mutation	SNP	C	C	T	rs147704999		TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr3:48581056C>T	ENST00000232375.3	-	4	447	c.335G>A	c.(334-336)cGt>cAt	p.R112H	PFKFB4_ENST00000490115.1_5'UTR|PFKFB4_ENST00000536104.1_Missense_Mutation_p.R101H|PFKFB4_ENST00000541519.1_Missense_Mutation_p.R78H|PFKFB4_ENST00000416568.1_Missense_Mutation_p.R112H|PFKFB4_ENST00000545984.1_Intron|PFKFB4_ENST00000383734.2_Missense_Mutation_p.R112H	NM_004567.2	NP_004558.1	Q16877	F264_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4	112	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		CCGGACGTCACGGAGGGCTGC	0.632													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16979	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000114268	C	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	60.0	47.0	51.0		335	3.0	0.2	3	dbSNP_134	51	0,8600		0,0,4300	yes	missense	PFKFB4	NM_004567.2	29	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	112/470	48581056	2,13004	2203	4300	6503	PFKFB4	SO:0001583	missense	0			-	HGNC	BC010269	CCDS2771.1	3p22-p21	2004-03-02			ENSG00000114268	ENSG00000114268			8875	protein-coding gene	gene with protein product		605320				8830046, 10095107	Standard	NM_004567		Approved		uc003ctv.3	Q16877	OTTHUMG00000133528	ENST00000232375.3:c.335G>A	3.37:g.48581056C>T	ENSP00000232375:p.Arg112His	Somatic	0	25	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	13	59.38	Q5S3G5|Q5XLC2|Q64EX5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_6Phosfructo_kin,pfam_His_Pase_superF_clade-1,superfamily_P-loop_NTPase,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	p.R112H	ENST00000232375.3	37	c.335	CCDS2771.1	3	.	.	.	.	.	.	.	.	.	.	C	9.024	0.985494	0.18889	4.54E-4	0.0	ENSG00000114268	ENST00000232375;ENST00000536104;ENST00000416568;ENST00000383734;ENST00000541519;ENST00000452531;ENST00000412035;ENST00000422701	.	.	.	4.79	2.97	0.34412	6-phosphofructo-2-kinase (1);	0.536304	0.20625	N	0.088692	T	0.42404	0.1201	L	0.48642	1.525	0.37603	D	0.920636	B;B;B;B	0.33266	0.02;0.404;0.234;0.001	B;B;B;B	0.32533	0.031;0.147;0.034;0.001	T	0.45454	-0.9260	9	0.72032	D	0.01	-8.8723	6.8769	0.24151	0.0:0.715:0.0:0.285	.	101;112;112;112	B7Z5C3;Q5XLC2;Q66S35;Q16877	.;.;.;F264_HUMAN	H	112;101;112;112;78;101;78;115	.	ENSP00000232375:R112H	R	-	2	0	PFKFB4	48556060	0.004000	0.15560	0.215000	0.23724	0.099000	0.18886	0.097000	0.15168	0.604000	0.29930	0.563000	0.77884	CGT	-	pfam_6Phosfructo_kin,superfamily_P-loop_NTPase,pirsf_Bifunct_6PFK/fruc_bisP_Ptase		0.632	PFKFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKFB4	protein_coding	OTTHUMT00000257503.2	C	NM_004567	rs147704999		48581056	-1	no_errors	ENST00000232375	ensembl	human	known	74_37	missense	SNP	0.462	T
TMEM25	84866	genome.wustl.edu	37	11	118406329	118406336	+	3'UTR	DEL	AGTGTGGA	AGTGTGGA	-	rs201161451|rs141837942|rs45576832|rs201441880|rs200347751	byFrequency	TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	AGTGTGGA	AGTGTGGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr11:118406329_118406336delAGTGTGGA	ENST00000313236.5	+	0	2188_2195				TMEM25_ENST00000411589.2_3'UTR|TMEM25_ENST00000359862.4_3'UTR|TMEM25_ENST00000354284.4_Intron|TMEM25_ENST00000354064.7_3'UTR|TMEM25_ENST00000533102.1_Frame_Shift_Del_p.VWK378fs|TMEM25_ENST00000524725.1_3'UTR|TMEM25_ENST00000442938.2_Intron	NM_032780.3	NP_116169.2	Q86YD3	TMM25_HUMAN	transmembrane protein 25							extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|stomach(1)	13	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		ATAATTCAACAGTGTGGAAGCTTTAGGG	0.481														1272	0.253994	0.1445	0.0677	5008	,	,		20008	0.5466		0.1352	False		,,,				2504	0.3548																0								ENSG00000149582																																			TMEM25	SO:0001624	3_prime_UTR_variant	0				HGNC	AK075437	CCDS8398.1, CCDS44745.1, CCDS44746.1, CCDS44747.1, CCDS44748.1	11q23.3	2013-01-11			ENSG00000149582	ENSG00000149582		"""Immunoglobulin superfamily / C2-set domain containing"""	25890	protein-coding gene	gene with protein product		613934				15254712, 12975309	Standard	NM_001144034		Approved	FLJ14399	uc010rye.2	Q86YD3	OTTHUMG00000166339	ENST00000313236.5:c.*1041AGTGTGGA>-	11.37:g.118406329_118406336delAGTGTGGA		Somatic	NA	NA	NA		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K8J4|B0YJA6|B0YJA7|B0YJA9|G5E9U4|Q6UW89|Q86UA7|Q8NBL5|Q96KA6|Q96MW9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_CD80_C2-set,pfscan_Ig-like_dom	p.V378fs	ENST00000313236.5	37	c.1131_1138	CCDS8398.1	11																																																																																			-	NULL		0.481	TMEM25-009	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM25	protein_coding	OTTHUMT00000389266.1	AGTGTGGA	NM_032780			118406336	+1	no_errors	ENST00000533102	ensembl	human	known	74_37	frame_shift_del	DEL	0.003:0.003:0.001:0.002:0.000:0.000:0.001:0.000	-
KCNH2	3757	genome.wustl.edu	37	7	150655495	150655503	+	In_Frame_Del	DEL	CGCCCGCGC	CGCCCGCGC	-	rs551056698|rs150817714	byFrequency	TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	CGCCCGCGC	CGCCCGCGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr7:150655495_150655503delCGCCCGCGC	ENST00000262186.5	-	4	961_969	c.560_568delGCGCGGGCG	c.(559-570)ggcgcgggcgcc>gcc	p.GAG187del	KCNH2_ENST00000330883.4_5'Flank|KCNH2_ENST00000430723.3_In_Frame_Del_p.GAG187del|KCNH2_ENST00000392968.2_In_Frame_Del_p.GAG91del	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	187					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	gcccccggggcgcccgcgccgcccgcgcc	0.761														14	0.00279553	0.0091	0.0	5008	,	,		8391	0.0		0.001	False		,,,				2504	0.001				GBM(137;110 1844 13671 20123 45161)												0			GRCh37	CX057283	KCNH2	X		ENSG00000055118		,	13,653		6,1,326					,	3.6	0.6			1	14,1786		7,0,893	no	coding,coding	KCNH2	NM_172056.2,NM_000238.3	,	13,1,1219	A1A1,A1R,RR		0.7778,1.952,1.0949	,	,		27,2439				KCNH2	SO:0001651	inframe_deletion	0				HGNC	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.560_568delGCGCGGGCG	7.37:g.150655504_150655512delCGCCCGCGC	ENSP00000262186:p.Gly187_Gly189del	Somatic	NA	NA	NA		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_cNMP-bd_dom,pfam_PAS_fold,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.GAG187in_frame_del	ENST00000262186.5	37	c.568_560	CCDS5910.1	7																																																																																			-	NULL		0.761	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH2	protein_coding	OTTHUMT00000350741.2	CGCCCGCGC	NM_000238			150655503	-1	no_errors	ENST00000262186	ensembl	human	known	74_37	in_frame_del	DEL	0.728:0.003:0.030:0.030:0.005:0.007:0.000:0.000:0.006	-
JAK3	3718	genome.wustl.edu	37	19	17951086	17951086	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr19:17951086G>A	ENST00000527670.1	-	8	1236	c.1207C>T	c.(1207-1209)Cgc>Tgc	p.R403C	JAK3_ENST00000534444.1_Missense_Mutation_p.R403C|JAK3_ENST00000458235.1_Missense_Mutation_p.R403C|JAK3_ENST00000526008.1_5'UTR			P52333	JAK3_HUMAN	Janus kinase 3	403	SH2; atypical.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	TGGGGGCTGCGGCGGAGAACA	0.597		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																			Dom	yes		19	19p13.1	3718	Janus kinase 3		L	0								ENSG00000105639						50.0	45.0	47.0					19																	17951086		2203	4300	6503	JAK3	SO:0001583	missense	0			-	HGNC	U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.1207C>T	19.37:g.17951086G>A	ENSP00000432511:p.Arg403Cys	Somatic	0	19	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	25	34.21	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_Prot_kinase_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak3,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R403C	ENST00000527670.1	37	c.1207	CCDS12366.1	19	.	.	.	.	.	.	.	.	.	.	G	9.462	1.093374	0.20471	.	.	ENSG00000105639	ENST00000458235;ENST00000428406;ENST00000527670;ENST00000534444	T;T;T	0.61392	0.11;0.11;0.11	4.5	4.5	0.54988	SH2 motif (2);	0.218384	0.41097	D	0.000959	T	0.35335	0.0928	N	0.17082	0.46	0.44302	D	0.997172	B;B;B	0.30211	0.273;0.006;0.108	B;B;B	0.20384	0.029;0.005;0.017	T	0.21724	-1.0237	10	0.31617	T	0.26	-29.7587	8.5391	0.33382	0.1067:0.0:0.8933:0.0	.	403;403;403	B4DK43;P52333-2;P52333	.;.;JAK3_HUMAN	C	403	ENSP00000391676:R403C;ENSP00000432511:R403C;ENSP00000436421:R403C	ENSP00000413248:R403C	R	-	1	0	JAK3	17812086	0.995000	0.38212	1.000000	0.80357	0.856000	0.48823	2.211000	0.42825	2.073000	0.62155	0.557000	0.71058	CGC	-	smart_SH2,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2		0.597	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK3	protein_coding	OTTHUMT00000385549.1	G	NM_000215	-		17951086	-1	no_errors	ENST00000458235	ensembl	human	known	74_37	missense	SNP	0.960	A
RANBP2	5903	genome.wustl.edu	37	2	109384558	109384558	+	Silent	SNP	T	T	A			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr2:109384558T>A	ENST00000283195.6	+	20	7689	c.7563T>A	c.(7561-7563)gtT>gtA	p.V2521V		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	2521					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CAGAGTCTGTTAAAAGCATTT	0.373																																																	0								ENSG00000153201						171.0	193.0	185.0					2																	109384558		2203	4298	6501	RANBP2	SO:0001819	synonymous_variant	0			-	HGNC	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.7563T>A	2.37:g.109384558T>A		Somatic	0	169	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	122	150	44.85	Q13074|Q15280|Q53TE2|Q59FH7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ran_bind_dom,pfam_Znf_RanBP2,pfam_IR1-M,pfam_Cyclophilin-like_PPIase_dom,pfam_TPR_1,superfamily_Cyclophilin-like_PPIase_dom,smart_TPR_repeat,smart_Ran_bind_dom,smart_Znf_RanBP2,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RanBP2,pfscan_Cyclophilin-like_PPIase_dom,pfscan_Ran_bind_dom,prints_Cyclophilin-like_PPIase_dom	p.V2521	ENST00000283195.6	37	c.7563	CCDS2079.1	2																																																																																			-	NULL		0.373	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP2	protein_coding	OTTHUMT00000253594.1	T	NM_006267	-		109384558	+1	no_errors	ENST00000283195	ensembl	human	known	74_37	silent	SNP	0.971	A
KCNH7	90134	genome.wustl.edu	37	2	163279793	163279793	+	Intron	SNP	G	G	A			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr2:163279793G>A	ENST00000332142.5	-	9	2254				KCNH7_ENST00000328032.4_Missense_Mutation_p.A729V	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7						circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	TTCCATTTTGGCTATCACTAT	0.418																																					GBM(196;1492 2208 17507 24132 45496)												0								ENSG00000184611						98.0	102.0	101.0					2																	163279793		2203	4300	6503	KCNH7	SO:0001627	intron_variant	0			-	HGNC	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.2154+52C>T	2.37:g.163279793G>A		Somatic	0	38	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	75	11.76	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold,pfam_PAS_fold_3,superfamily_PAS,superfamily_cNMP-bd-like,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,tigrfam_PAS	p.A729V	ENST00000332142.5	37	c.2186	CCDS2219.1	2	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.631000	0.00813	.	.	ENSG00000184611	ENST00000328032	D	0.99557	-6.16	5.84	1.92	0.25849	.	.	.	.	.	D	0.97773	0.9269	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	D	0.96176	0.9127	8	0.44086	T	0.13	.	4.7663	0.13134	0.3153:0.0:0.5182:0.1666	.	729	Q9NS40-2	.	V	729	ENSP00000333781:A729V	ENSP00000333781:A729V	A	-	2	0	KCNH7	162988039	0.260000	0.24053	0.608000	0.28969	0.189000	0.23516	0.633000	0.24598	0.065000	0.16485	0.655000	0.94253	GCC	-	NULL		0.418	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH7	protein_coding	OTTHUMT00000255093.1	G	NM_033272	-		163279793	-1	no_errors	ENST00000328032	ensembl	human	known	74_37	missense	SNP	0.158	A
BMP8A	353500	genome.wustl.edu	37	1	39990865	39990865	+	Intron	SNP	C	C	A			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr1:39990865C>A	ENST00000331593.5	+	7	1405				RP11-69E11.4_ENST00000450157.1_RNA|RP11-69E11.4_ENST00000458207.1_RNA|RP11-69E11.4_ENST00000431553.1_RNA|RP11-69E11.4_ENST00000440190.1_RNA|RP11-69E11.4_ENST00000331856.2_RNA|RP11-69E11.4_ENST00000417869.1_RNA|RP11-69E11.4_ENST00000441741.1_RNA	NM_181809.3	NP_861525.2	Q7Z5Y6	BMP8A_HUMAN	bone morphogenetic protein 8a						cartilage development (GO:0051216)|cell differentiation (GO:0030154)|diet induced thermogenesis (GO:0002024)|growth (GO:0040007)|negative regulation of insulin secretion (GO:0046676)|ossification (GO:0001503)|regulation of energy homeostasis (GO:2000505)	extracellular space (GO:0005615)				kidney(1)|large_intestine(2)|lung(1)|skin(1)	5	Lung NSC(20;2.08e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;9.69e-19)|Epithelial(16;9.34e-17)|all cancers(16;1.73e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GAGGCCTGGCCTCCCAGAGCC	0.657																																																	0								ENSG00000182109																																			RP11-69E11.4	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AY303954	CCDS437.1	1p35-p32	2014-01-30			ENSG00000183682	ENSG00000183682		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	21650	protein-coding gene	gene with protein product							Standard	NM_181809		Approved		uc001cdi.3	Q7Z5Y6	OTTHUMG00000008394	ENST00000331593.5:c.1060-456C>A	1.37:g.39990865C>A		Somatic	0	73	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	50	39.76	Q5T3A5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000331593.5	37	NULL	CCDS437.1	1																																																																																			-	-		0.657	BMP8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIEL	protein_coding	OTTHUMT00000023079.1	C	NM_181809	-		39990865	-1	no_errors	ENST00000331856	ensembl	human	known	74_37	rna	SNP	0.002	A
TRPA1	8989	genome.wustl.edu	37	8	72935420	72935458	+	Intron	DEL	GCATAGGTTTTAACCTCGGTCCCTTCTGAATGTAGGAAC	GCATAGGTTTTAACCTCGGTCCCTTCTGAATGTAGGAAC	-	rs34076632|rs142191870|rs10089294	byFrequency	TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	GCATAGGTTTTAACCTCGGTCCCTTCTGAATGTAGGAAC	GCATAGGTTTTAACCTCGGTCCCTTCTGAATGTAGGAAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr8:72935420_72935458delGCATAGGTTTTAACCTCGGTCCCTTCTGAATGTAGGAAC	ENST00000262209.4	-	27	3357				RP11-383H13.1_ENST00000457356.4_Intron|RP11-383H13.1_ENST00000537896.1_Intron|RP11-383H13.1_ENST00000524152.1_Intron	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1						calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	ATGTAGGAAGGCATAGGTTTTAACCTCGGTCCCTTCTGAATGTAGGAACGCATAGGTTT	0.372														2411	0.48143	0.4629	0.3617	5008	,	,		25826	0.7579		0.4384	False		,,,				2504	0.3507																0								ENSG00000104321																																			TRPA1	SO:0001627	intron_variant	0				HGNC	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.3150-69GTTCCTACATTCAGAAGGGACCGAGGTTAAAACCTATGC>-	8.37:g.72935420_72935458delGCATAGGTTTTAACCTCGGTCCCTTCTGAATGTAGGAAC		Somatic	NA	NA	NA		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NIN6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000262209.4	37	NULL	CCDS34908.1	8																																																																																			-	-		0.372	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPA1	protein_coding	OTTHUMT00000379079.2	GCATAGGTTTTAACCTCGGTCCCTTCTGAATGTAGGAAC	NM_007332			72935458	-1	no_errors	ENST00000520596	ensembl	human	putative	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.001:0.001:0.001:0.000:0.000:0.000:0.000:0.000:0.002:0.002:0.000:0.000:0.000:0.000:0.000:0.001:0.002:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-
TRIML1	339976	genome.wustl.edu	37	4	189063511	189063511	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr4:189063511G>T	ENST00000332517.3	+	3	750	c.610G>T	c.(610-612)Gag>Tag	p.E204*	RP11-366H4.3_ENST00000501322.2_RNA	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	204					multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		AGAACAGGAAGAGAAAGAGAA	0.433																																					Melanoma(31;213 1036 16579 23968 32372)												0								ENSG00000184108						113.0	113.0	113.0					4																	189063511		2203	4300	6503	TRIML1	SO:0001587	stop_gained	0			-	HGNC	AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.610G>T	4.37:g.189063511G>T	ENSP00000327738:p.Glu204*	Somatic	0	39	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	28	44.00	Q96BE5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.E204*	ENST00000332517.3	37	c.610	CCDS3851.1	4	.	.	.	.	.	.	.	.	.	.	G	19.55	3.847861	0.71603	.	.	ENSG00000184108	ENST00000332517	.	.	.	5.04	5.04	0.67666	.	0.000000	0.50627	D	0.000119	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-25.2673	16.3059	0.82848	0.0:0.0:1.0:0.0	.	.	.	.	X	204	.	ENSP00000327738:E204X	E	+	1	0	TRIML1	189300505	0.980000	0.34600	0.287000	0.24848	0.030000	0.12068	2.254000	0.43214	2.788000	0.95919	0.650000	0.86243	GAG	-	NULL		0.433	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIML1	protein_coding	OTTHUMT00000359813.1	G	NM_178556	-		189063511	+1	no_errors	ENST00000332517	ensembl	human	known	74_37	nonsense	SNP	0.823	T
PAXIP1	22976	genome.wustl.edu	37	7	154760424	154760424	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr7:154760424G>T	ENST00000404141.1	-	7	1641	c.1487C>A	c.(1486-1488)gCc>gAc	p.A496D	PAXIP1_ENST00000397192.1_Missense_Mutation_p.A496D|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	496	Gln-rich.			Missing (in Ref. 4; AAB91434). {ECO:0000305}.	adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		ctgctgcagggcatgctgctg	0.597																																																	0								ENSG00000157212						30.0	35.0	33.0					7																	154760424		1789	3252	5041	PAXIP1	SO:0001583	missense	0			-	HGNC	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1487C>A	7.37:g.154760424G>T	ENSP00000384048:p.Ala496Asp	Somatic	0	34	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.A496D	ENST00000404141.1	37	c.1487	CCDS47753.1	7	.	.	.	.	.	.	.	.	.	.	G	7.128	0.579362	0.13686	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000323199	T;T	0.18502	2.21;2.21	4.77	4.77	0.60923	.	0.364794	0.18868	U	0.128928	T	0.12390	0.0301	L	0.27053	0.805	0.29002	N	0.887429	B;P;P;B	0.40107	0.435;0.703;0.703;0.435	B;B;B;B	0.42692	0.172;0.395;0.395;0.172	T	0.05599	-1.0875	10	0.10377	T	0.69	-6.4785	8.8807	0.35374	0.1703:0.0:0.8297:0.0	.	449;405;462;496	B4DEQ6;Q6ZW49-3;Q6ZW49-1;Q6ZW49	.;.;.;PAXI1_HUMAN	D	496;496;449	ENSP00000384048:A496D;ENSP00000380376:A496D	ENSP00000319149:A449D	A	-	2	0	PAXIP1	154391357	0.915000	0.31059	1.000000	0.80357	0.728000	0.41692	0.648000	0.24828	2.189000	0.69895	0.650000	0.86243	GCC	-	NULL		0.597	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	protein_coding	OTTHUMT00000322223.1	G	NM_007349	-		154760424	-1	no_errors	ENST00000397192	ensembl	human	known	74_37	missense	SNP	0.999	T
CELP	1057	genome.wustl.edu	37	9	135962585	135962586	+	RNA	INS	-	-	GCCCCATCCCCCCTACGGGGGACTCTGGGGCC	rs641386|rs372789499|rs143200085	byFrequency	TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr9:135962585_135962586insGCCCCATCCCCCCTACGGGGGACTCTGGGGCC	ENST00000411440.2	+	0	1092_1093					NR_001275.2				carboxyl ester lipase pseudogene																		ACACTGAGGCTGCCCCTGTGTC	0.629																																																	0								ENSG00000170827																																			CELP			0				HGNC	L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135962585_135962586insGCCCCATCCCCCCTACGGGGGACTCTGGGGCC		Somatic	NA	NA	NA		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000411440.2	37	NULL		9																																																																																			-	-		0.629	CELP-002	KNOWN	basic	processed_transcript	CELP	pseudogene	OTTHUMT00000339837.1	-	NM_001808			135962586	+1	no_errors	ENST00000411440	ensembl	human	known	74_37	rna	INS	0.130:0.000	GCCCCATCCCCCCTACGGGGGACTCTGGGGCC
TLL1	7092	genome.wustl.edu	37	4	166910546	166910546	+	Silent	SNP	C	C	T			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr4:166910546C>T	ENST00000061240.2	+	2	830	c.183C>T	c.(181-183)ggC>ggT	p.G61G	TLL1_ENST00000513213.1_Silent_p.G61G|TLL1_ENST00000507499.1_Silent_p.G61G	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	61					cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TATTTTGGGGCGATATTGCCT	0.318																																																	0								ENSG00000038295						94.0	94.0	94.0					4																	166910546		2203	4300	6503	TLL1	SO:0001819	synonymous_variant	0			-	HGNC	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.183C>T	4.37:g.166910546C>T		Somatic	0	23	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	63	46.15	B2RMU2|Q96AN3|Q9NQS4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,smart_Peptidase_Metallo,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_BMP_1/tolloid-like,pfscan_CUB_dom,pfscan_EG-like_dom,prints_Peptidase_M12A	p.G61	ENST00000061240.2	37	c.183	CCDS3811.1	4																																																																																			-	pirsf_BMP_1/tolloid-like		0.318	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL1	protein_coding	OTTHUMT00000363821.1	C		-		166910546	+1	no_errors	ENST00000061240	ensembl	human	known	74_37	silent	SNP	0.996	T
RUSC1	23623	genome.wustl.edu	37	1	155295207	155295207	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr1:155295207C>T	ENST00000368352.5	+	5	1785	c.1634C>T	c.(1633-1635)cCt>cTt	p.P545L	RUSC1_ENST00000368354.3_Missense_Mutation_p.P545L|RUSC1_ENST00000368347.4_Missense_Mutation_p.P135L|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1_ENST00000368349.4_Missense_Mutation_p.P76L|RUSC1_ENST00000462780.1_3'UTR|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1_ENST00000292254.4_Missense_Mutation_p.P76L	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1	545	Interaction with TRAF6.|RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			GGGCTGAAGCCTTTCCGGAAG	0.711											OREG0013860	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000160753						9.0	11.0	10.0					1																	155295207		2197	4281	6478	RUSC1	SO:0001583	missense	0			-	HGNC	AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.1634C>T	1.37:g.155295207C>T	ENSP00000357336:p.Pro545Leu	Somatic	0	20	0.00	1769	0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	12	52.00	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Run,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Run,smart_SH3_domain,pfscan_Run,pfscan_SH3_domain	p.P545L	ENST00000368352.5	37	c.1634	CCDS41410.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.217232	0.95104	.	.	ENSG00000160753	ENST00000368354;ENST00000368352;ENST00000368347;ENST00000368349;ENST00000292254	T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55	4.72	4.72	0.59763	RUN (2);	0.000000	0.56097	D	0.000030	T	0.45836	0.1362	L	0.57536	1.79	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;0.998;0.998;1.0;0.996	D;D;D;D;D;D	0.80764	0.994;0.994;0.966;0.988;0.99;0.975	T	0.44997	-0.9291	10	0.72032	D	0.01	-16.7772	17.8314	0.88684	0.0:1.0:0.0:0.0	.	43;76;76;135;150;545	B4DQB8;Q9BVN2-2;B3KWM9;Q5T9V0;Q9BT86;Q9BVN2	.;.;.;.;.;RUSC1_HUMAN	L	545;545;135;76;76	ENSP00000357338:P545L;ENSP00000357336:P545L;ENSP00000357331:P135L;ENSP00000357333:P76L;ENSP00000292254:P76L	ENSP00000292254:P76L	P	+	2	0	RUSC1	153561831	1.000000	0.71417	0.999000	0.59377	0.910000	0.53928	5.420000	0.66441	2.602000	0.87976	0.655000	0.94253	CCT	-	pfam_Run,pfscan_Run		0.711	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUSC1	protein_coding	OTTHUMT00000039071.1	C		-		155295207	+1	no_errors	ENST00000368352	ensembl	human	known	74_37	missense	SNP	1.000	T
SSX7	280658	genome.wustl.edu	37	X	52681341	52681341	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chrX:52681341C>T	ENST00000298181.5	-	4	399	c.241G>A	c.(241-243)Ggg>Agg	p.G81R		NM_173358.2	NP_775494.1	Q7RTT5	SSX7_HUMAN	synovial sarcoma, X breakpoint 7	81	KRAB-related. {ECO:0000255|PROSITE- ProRule:PRU00120}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|skin(1)	16	Ovarian(276;0.236)					AAATCATTCCCCTGGAGGTCT	0.493																																																	0								ENSG00000187754						171.0	152.0	159.0					X																	52681341		2203	4300	6503	SSX7	SO:0001583	missense	0			-	HGNC	BK000687	CCDS14343.1	Xp11.23	2011-02-10			ENSG00000187754	ENSG00000187754			19653	protein-coding gene	gene with protein product		300542				12216073	Standard	NM_173358		Approved		uc004dqx.1	Q7RTT5	OTTHUMG00000021572	ENST00000298181.5:c.241G>A	X.37:g.52681341C>T	ENSP00000298181:p.Gly81Arg	Somatic	0	109	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	116	56	67.05		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SSXRD_motif,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.G81R	ENST00000298181.5	37	c.241	CCDS14343.1	X	.	.	.	.	.	.	.	.	.	.	N	0.008	-1.890925	0.00527	.	.	ENSG00000187754	ENST00000298181	T	0.08282	3.11	0.725	-1.45	0.08828	Krueppel-associated box (1);Krueppel-associated box-related (1);	3.676760	0.00597	N	0.000372	T	0.06462	0.0166	L	0.31926	0.97	0.09310	N	1	B	0.21821	0.061	B	0.27170	0.077	T	0.32877	-0.9890	9	0.14656	T	0.56	.	.	.	.	.	81	Q7RTT5	SSX7_HUMAN	R	81	ENSP00000298181:G81R	ENSP00000298181:G81R	G	-	1	0	SSX7	52698066	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.795000	0.04580	-1.963000	0.01013	-1.225000	0.01585	GGG	-	smart_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel		0.493	SSX7-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	SSX7	protein_coding	OTTHUMT00000056671.1	C	NM_173358	-		52681341	-1	no_errors	ENST00000298181	ensembl	human	known	74_37	missense	SNP	0.000	T
NTSR1	4923	genome.wustl.edu	37	20	61340995	61340995	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr20:61340995T>C	ENST00000370501.3	+	1	807	c.436T>C	c.(436-438)Ttc>Ctc	p.F146L		NM_002531.2	NP_002522.2	P30989	NTR1_HUMAN	neurotensin receptor 1 (high affinity)	146					adult locomotory behavior (GO:0008344)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(16)|prostate(1)|skin(3)	27	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			CGGCTACTACTTCCTGCGCGA	0.672																																					GBM(37;400 780 6403 19663 35669)												0								ENSG00000101188						47.0	49.0	49.0					20																	61340995		2202	4298	6500	NTSR1	SO:0001583	missense	0			-	HGNC		CCDS13502.1	20q13	2012-08-08			ENSG00000101188	ENSG00000101188		"""GPCR / Class A : Neurotensin receptors"""	8039	protein-coding gene	gene with protein product		162651				8075503	Standard	NM_002531		Approved	NTR	uc002ydf.3	P30989	OTTHUMG00000032932	ENST00000370501.3:c.436T>C	20.37:g.61340995T>C	ENSP00000359532:p.Phe146Leu	Somatic	0	53	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	25	30.56	Q9H4H1|Q9H4T5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_NT1_rcpt,prints_GPCR_Rhodpsn,prints_NT_rcpt	p.F146L	ENST00000370501.3	37	c.436	CCDS13502.1	20	.	.	.	.	.	.	.	.	.	.	T	27.1	4.796223	0.90453	.	.	ENSG00000101188	ENST00000370501	T	0.44482	0.92	5.15	5.15	0.70609	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.52821	0.1758	L	0.42744	1.35	0.58432	D	0.999998	D	0.67145	0.996	D	0.67548	0.952	T	0.44406	-0.9330	10	0.20519	T	0.43	-45.2992	14.641	0.68726	0.0:0.0:0.0:1.0	.	146	P30989	NTR1_HUMAN	L	146	ENSP00000359532:F146L	ENSP00000359532:F146L	F	+	1	0	NTSR1	60811440	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.136000	0.71703	1.946000	0.56461	0.459000	0.35465	TTC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_NT_rcpt		0.672	NTSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTSR1	protein_coding	OTTHUMT00000080061.1	T		-		61340995	+1	no_errors	ENST00000370501	ensembl	human	known	74_37	missense	SNP	1.000	C
RP1	6101	genome.wustl.edu	37	8	55541768	55541768	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chr8:55541768C>A	ENST00000220676.1	+	4	5474	c.5326C>A	c.(5326-5328)Ctt>Att	p.L1776I		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1776					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GGACACCCTACTTGATAATAA	0.448																																					Colon(91;1014 1389 7634 14542 40420)												0								ENSG00000104237						88.0	86.0	87.0					8																	55541768		2203	4299	6502	RP1	SO:0001583	missense	0			-	HGNC	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.5326C>A	8.37:g.55541768C>A	ENSP00000220676:p.Leu1776Ile	Somatic	0	22	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	25	47.92		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.L1776I	ENST00000220676.1	37	c.5326	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	C	9.998	1.232665	0.22626	.	.	ENSG00000104237	ENST00000220676	T	0.47528	0.84	5.93	4.04	0.47022	.	0.483083	0.17436	N	0.174308	T	0.40423	0.1116	M	0.61703	1.905	0.23550	N	0.997438	B	0.31680	0.335	B	0.26614	0.071	T	0.33292	-0.9874	10	0.42905	T	0.14	.	6.7469	0.23466	0.1382:0.6657:0.1259:0.0703	.	1776	P56715	RP1_HUMAN	I	1776	ENSP00000220676:L1776I	ENSP00000220676:L1776I	L	+	1	0	RP1	55704321	0.300000	0.24435	0.086000	0.20670	0.524000	0.34500	0.931000	0.28871	0.744000	0.32741	0.655000	0.94253	CTT	-	NULL		0.448	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	protein_coding	OTTHUMT00000378532.2	C	NM_006269	-		55541768	+1	no_errors	ENST00000220676	ensembl	human	known	74_37	missense	SNP	0.963	A
SATL1	340562	genome.wustl.edu	37	X	84363261	84363261	+	Silent	SNP	C	C	T			TCGA-3B-A9I1-01A-11D-A38Z-09	TCGA-3B-A9I1-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b3b4785-3d62-4dd2-8051-2ce017c9e248	4843c7f9-2185-4436-b5a9-7526d6aca0c9	g.chrX:84363261C>T	ENST00000395409.3	-	1	713	c.153G>A	c.(151-153)aaG>aaA	p.K51K	SATL1_ENST00000332921.5_Silent_p.K51K|SATL1_ENST00000509231.1_Silent_p.K238K			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	51	Gln-rich.						N-acetyltransferase activity (GO:0008080)			NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						CTGTTTGGTTCTTACATGATT	0.488																																																	0								ENSG00000184788						328.0	241.0	271.0					X																	84363261		2203	4300	6503	SATL1	SO:0001819	synonymous_variant	0			-	HGNC	BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.153G>A	X.37:g.84363261C>T		Somatic	0	22	0.00		0.7100151465886008	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	39	33.90	A0AVK7|E9PB72|Q5H8V9	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_Acyl_CoA_acyltransferase	p.K238	ENST00000395409.3	37	c.714		X																																																																																			-	NULL		0.488	SATL1-202	KNOWN	basic|appris_principal	protein_coding	SATL1	protein_coding		C	XM_291339	-		84363261	-1	no_errors	ENST00000509231	ensembl	human	known	74_37	silent	SNP	0.000	T
