#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SHROOM3	57619	genome.wustl.edu	37	4	77357347	77357347	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr4:77357347C>T	ENST00000296043.6	+	1	1095	c.142C>T	c.(142-144)Cac>Tac	p.H48Y		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	48	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			TGGCCTGGAGCACGGAGAACC	0.408																																																	0								ENSG00000138771						195.0	195.0	195.0					4																	77357347		2203	4300	6503	SHROOM3	SO:0001583	missense	0			-	HGNC	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.142C>T	4.37:g.77357347C>T	ENSP00000296043:p.His48Tyr	Somatic	0	32	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	80	12.90	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.H48Y	ENST00000296043.6	37	c.142	CCDS3579.2	4	.	.	.	.	.	.	.	.	.	.	C	14.74	2.624887	0.46840	.	.	ENSG00000138771	ENST00000296043	T	0.27402	1.67	5.44	5.44	0.79542	PDZ/DHR/GLGF (4);	0.669254	0.13401	N	0.390609	T	0.47210	0.1433	L	0.46947	1.48	0.26340	N	0.977379	D	0.69078	0.997	D	0.64776	0.929	T	0.30416	-0.9979	10	0.45353	T	0.12	-5.8736	14.0181	0.64536	0.1511:0.8489:0.0:0.0	.	48	Q8TF72	SHRM3_HUMAN	Y	48	ENSP00000296043:H48Y	ENSP00000296043:H48Y	H	+	1	0	SHROOM3	77576371	0.995000	0.38212	0.976000	0.42696	0.821000	0.46438	2.716000	0.47219	2.937000	0.99478	0.650000	0.86243	CAC	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ		0.408	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM3	protein_coding	OTTHUMT00000252408.2	C	NM_020859	-		77357347	+1	no_errors	ENST00000296043	ensembl	human	known	74_37	missense	SNP	0.982	T
ARHGEF40	55701	genome.wustl.edu	37	14	21554011	21554011	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr14:21554011C>T	ENST00000298694.4	+	19	4251	c.4124C>T	c.(4123-4125)gCa>gTa	p.A1375V	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.A1375V			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	1375						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						TGGAGACAGGCAGCCCACAAC	0.562																																																	0								ENSG00000165801						61.0	54.0	56.0					14																	21554011		2203	4300	6503	ARHGEF40	SO:0001583	missense	0			-	HGNC		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.4124C>T	14.37:g.21554011C>T	ENSP00000298694:p.Ala1375Val	Somatic	0	24	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,superfamily_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.A1375V	ENST00000298694.4	37	c.4124	CCDS32041.1	14	.	.	.	.	.	.	.	.	.	.	C	23.1	4.377776	0.82682	.	.	ENSG00000165801	ENST00000298694;ENST00000298693	T;T	0.11604	2.76;2.76	5.52	5.52	0.82312	Pleckstrin homology-type (1);	0.000000	0.53938	D	0.000058	T	0.40670	0.1126	M	0.92122	3.275	0.44985	D	0.998007	D;P;D	0.67145	0.984;0.94;0.996	D;D;D	0.72982	0.979;0.926;0.914	T	0.45991	-0.9223	10	0.54805	T	0.06	.	12.6455	0.56731	0.0:0.8337:0.1663:0.0	.	1375;1375;661	Q8TER5-4;Q8TER5;Q8TER5-2	.;ARH40_HUMAN;.	V	1375	ENSP00000298694:A1375V;ENSP00000298693:A1375V	ENSP00000298693:A1375V	A	+	2	0	ARHGEF40	20623851	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	4.507000	0.60434	2.586000	0.87340	0.655000	0.94253	GCA	-	NULL		0.562	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF40	protein_coding	OTTHUMT00000413122.1	C		-		21554011	+1	no_errors	ENST00000298694	ensembl	human	known	74_37	missense	SNP	0.998	T
FAT1	2195	genome.wustl.edu	37	4	187630313	187630313	+	Silent	SNP	G	G	T	rs200782651		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr4:187630313G>T	ENST00000441802.2	-	2	878	c.669C>A	c.(667-669)ctC>ctA	p.L223L		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	223	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GGTCCGCAGCGAGGATTTCCA	0.493										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												0								ENSG00000083857						105.0	106.0	106.0					4																	187630313		2153	4273	6426	FAT1	SO:0001819	synonymous_variant	0			-	HGNC	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.669C>A	4.37:g.187630313G>T		Somatic	0	11	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	30	26.83		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.L223	ENST00000441802.2	37	c.669	CCDS47177.1	4																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.493	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	protein_coding	OTTHUMT00000360209.3	G	NM_005245	-		187630313	-1	no_errors	ENST00000441802	ensembl	human	known	74_37	silent	SNP	0.045	T
MUC2	4583	genome.wustl.edu	37	11	1103853	1103853	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr11:1103853G>T	ENST00000441003.2	+	48	8179	c.8152G>T	c.(8152-8154)Gtc>Ttc	p.V2718F		NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	5080					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CACCGTCCCCGTCACCACGGA	0.642																																																	0								ENSG00000198788						21.0	24.0	23.0					11																	1103853		2044	4152	6196	MUC2	SO:0001583	missense	0			-	HGNC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.8152G>T	11.37:g.1103853G>T	ENSP00000415183:p.Val2718Phe	Somatic	0	101	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q14878	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.V2718F	ENST00000441003.2	37	c.8152		11	.	.	.	.	.	.	.	.	.	.	G	8.807	0.934268	0.18206	.	.	ENSG00000198788	ENST00000441003	T	0.13307	2.6	3.46	1.35	0.21983	.	.	.	.	.	T	0.11580	0.0282	L	0.41492	1.28	0.09310	N	1	P	0.51933	0.949	P	0.48454	0.578	T	0.11966	-1.0566	9	0.09843	T	0.71	.	4.2079	0.10497	0.1375:0.2416:0.621:0.0	.	2718	E7EUV1	.	F	2718	ENSP00000415183:V2718F	ENSP00000415183:V2718F	V	+	1	0	MUC2	1093853	0.001000	0.12720	0.003000	0.11579	0.232000	0.25224	0.084000	0.14891	0.805000	0.34159	0.491000	0.48974	GTC	-	smart_Cys_knot_C,pfscan_Cys_knot_C		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	protein_coding	OTTHUMT00000345894.2	G	NM_002457	-		1103853	+1	no_errors	ENST00000441003	ensembl	human	known	74_37	missense	SNP	0.001	T
TNXB	7148	genome.wustl.edu	37	6	32014049	32014049	+	Silent	SNP	G	G	T	rs370330613		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr6:32014049G>T	ENST00000375244.3	-	31	10710	c.10509C>A	c.(10507-10509)acC>acA	p.T3503T	TNXB_ENST00000375247.2_Silent_p.T3501T|TNXB_ENST00000451343.1_5'Flank			P22105	TENX_HUMAN	tenascin XB	3548	Fibronectin type-III 27. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GGTCCTCTACGGTGACTGTGC	0.642																																																	0								ENSG00000168477						36.0	42.0	40.0					6																	32014049		1321	2584	3905	TNXB	SO:0001819	synonymous_variant	0			-	HGNC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.10509C>A	6.37:g.32014049G>T		Somatic	0	121	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	44	46.34	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.T3501	ENST00000375244.3	37	c.10503		6																																																																																			-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.642	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	protein_coding	OTTHUMT00000268927.2	G	NM_019105	-		32014049	-1	no_errors	ENST00000375247	ensembl	human	known	74_37	silent	SNP	0.000	T
WDFY4	57705	genome.wustl.edu	37	10	49951578	49951578	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr10:49951578C>G	ENST00000325239.5	+	11	2471	c.2444C>G	c.(2443-2445)cCa>cGa	p.P815R	WDFY4_ENST00000413659.2_Missense_Mutation_p.P815R	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	815						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						AAGCAGTGGCCAGACCTGGAG	0.552																																																	0								ENSG00000128815						8.0	9.0	9.0					10																	49951578		691	1590	2281	WDFY4	SO:0001583	missense	0			-	HGNC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2444C>G	10.37:g.49951578C>G	ENSP00000320563:p.Pro815Arg	Somatic	0	18	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	10	28.57	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P815R	ENST00000325239.5	37	c.2444	CCDS44385.1	10	.	.	.	.	.	.	.	.	.	.	C	18.72	3.683787	0.68157	.	.	ENSG00000128815	ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659	T;T	0.55930	0.49;1.5	5.26	5.26	0.73747	Armadillo-type fold (1);	.	.	.	.	T	0.58308	0.2113	M	0.61703	1.905	0.30961	N	0.723622	D	0.62365	0.991	P	0.48873	0.593	T	0.64214	-0.6460	8	.	.	.	.	14.3521	0.66711	0.0:1.0:0.0:0.0	.	815	Q6ZS81	WDFY4_HUMAN	R	824;815;815;815	ENSP00000320563:P815R;ENSP00000403789:P815R	.	P	+	2	0	WDFY4	49621584	0.996000	0.38824	1.000000	0.80357	0.809000	0.45718	1.677000	0.37576	2.455000	0.83008	0.563000	0.77884	CCA	-	superfamily_ARM-type_fold		0.552	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	protein_coding		C	XM_033379	-		49951578	+1	no_errors	ENST00000325239	ensembl	human	known	74_37	missense	SNP	1.000	G
CTB-52I2.4	0	genome.wustl.edu	37	19	18142862	18142862	+	RNA	SNP	A	A	C			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr19:18142862A>C	ENST00000594957.3	+	0	1623																											GGGGAAAGTGACTACCAGAAA	0.413																																																	0								ENSG00000268032																																			CTB-52I2.4			0			-	Clone_based_vega_gene																													19.37:g.18142862A>C		Somatic	0	86	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	111	22.92		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000594957.3	37	NULL		19																																																																																			-	-		0.413	CTB-52I2.4-002	KNOWN	basic	processed_transcript	ENSG00000268032	pseudogene	OTTHUMT00000466852.4	A		-		18142862	+1	no_errors	ENST00000594957	ensembl	human	known	74_37	rna	SNP	0.062	C
FAM127B	26071	genome.wustl.edu	37	X	134185397	134185397	+	3'UTR	SNP	G	G	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chrX:134185397G>T	ENST00000370775.2	-	0	808				FAM127B_ENST00000520964.1_5'UTR	NM_001078172.1	NP_001071640.1	Q9BWD3	F127B_HUMAN	family with sequence similarity 127, member B											breast(3)|endometrium(2)|large_intestine(3)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;0.000127)					GGTAGCGTAGGTCTGTGGGCA	0.592											OREG0019941	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000203950						341.0	263.0	287.0					X																	134185397		692	1591	2283	FAM127B	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AL117556	CCDS43998.1	Xq26.3	2014-05-16			ENSG00000203950	ENSG00000203950			24514	protein-coding gene	gene with protein product						9403077, 15716091	Standard	NM_001078172		Approved	DKFZP564B147, MAR8A, CXX1b	uc004eyf.3	Q9BWD3	OTTHUMG00000022466	ENST00000370775.2:c.*400C>A	X.37:g.134185397G>T		Somatic	0	26	0.00	1608	0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	A2A2V9|Q8TBU2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370775.2	37	NULL	CCDS43998.1	X																																																																																			-	-		0.592	FAM127B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM127B	protein_coding	OTTHUMT00000058393.2	G	NM_001078172	-		134185397	-1	no_errors	ENST00000518153	ensembl	human	known	74_37	rna	SNP	0.009	T
PCDHA7	56141	genome.wustl.edu	37	5	140214396	140214396	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr5:140214396C>T	ENST00000525929.1	+	1	428	c.428C>T	c.(427-429)gCg>gTg	p.A143V	PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.A143V|PCDHA3_ENST00000522353.2_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	143	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A143V(2)		NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGTTCATCGCGGAATCCAGG	0.567																																					NSCLC(160;258 2013 5070 22440 28951)												2	Substitution - Missense(2)	large_intestine(2)						ENSG00000204963						72.0	68.0	69.0					5																	140214396		2203	4292	6495	PCDHA7	SO:0001583	missense	0			-	HGNC	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.428C>T	5.37:g.140214396C>T	ENSP00000436426:p.Ala143Val	Somatic	0	162	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	92	17.12	O75282	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A143V	ENST00000525929.1	37	c.428	CCDS54918.1	5	.	.	.	.	.	.	.	.	.	.	C	6.361	0.434793	0.12045	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.52983	0.64;0.64	4.17	1.88	0.25563	Cadherin (3);Cadherin-like (1);	0.708972	0.10662	U	0.648542	T	0.57286	0.2043	M	0.62209	1.925	0.09310	N	1	P;P	0.48016	0.904;0.869	B;P	0.58820	0.361;0.846	T	0.43163	-0.9408	10	0.27785	T	0.31	.	7.9008	0.29734	0.2103:0.6976:0.0:0.0921	.	143;143	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	V	143	ENSP00000436426:A143V;ENSP00000367365:A143V	ENSP00000367365:A143V	A	+	2	0	PCDHA7	140194580	0.000000	0.05858	0.001000	0.08648	0.062000	0.15995	-0.060000	0.11712	0.830000	0.34757	0.455000	0.32223	GCG	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.567	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA7	protein_coding	OTTHUMT00000372887.2	C	NM_018910	-		140214396	+1	no_errors	ENST00000525929	ensembl	human	known	74_37	missense	SNP	0.002	T
IQCF1	132141	genome.wustl.edu	37	3	51929102	51929102	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr3:51929102C>T	ENST00000310914.5	-	4	484	c.422G>A	c.(421-423)cGc>cAc	p.R141H		NM_152397.2	NP_689610.2	Q8N6M8	IQCF1_HUMAN	IQ motif containing F1	141	IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.									central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		ATAGCGTCTGCGGATGCGCCA	0.607																																																	0								ENSG00000173389						93.0	85.0	88.0					3																	51929102		2203	4300	6503	IQCF1	SO:0001583	missense	0			-	HGNC	BC029595	CCDS2836.1	3p21.31	2008-02-05			ENSG00000173389	ENSG00000173389			28607	protein-coding gene	gene with protein product						12477932	Standard	NM_152397		Approved	MGC39725	uc003dbv.3	Q8N6M8	OTTHUMG00000156908	ENST00000310914.5:c.422G>A	3.37:g.51929102C>T	ENSP00000307958:p.Arg141His	Somatic	0	51	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q8N711	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.R141H	ENST00000310914.5	37	c.422	CCDS2836.1	3	.	.	.	.	.	.	.	.	.	.	C	9.778	1.174636	0.21704	.	.	ENSG00000173389	ENST00000310914	T	0.65549	-0.16	4.75	2.96	0.34315	.	0.221444	0.32488	N	0.006039	T	0.47893	0.1470	L	0.39147	1.195	0.09310	N	1	B	0.33379	0.41	B	0.30646	0.118	T	0.40887	-0.9539	10	0.49607	T	0.09	-19.5588	7.7834	0.29078	0.0:0.8196:0.0:0.1804	.	141	Q8N6M8	IQCF1_HUMAN	H	141	ENSP00000307958:R141H	ENSP00000307958:R141H	R	-	2	0	IQCF1	51904142	0.121000	0.22262	0.002000	0.10522	0.429000	0.31625	1.466000	0.35310	0.727000	0.32360	0.549000	0.68633	CGC	-	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS		0.607	IQCF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCF1	protein_coding	OTTHUMT00000346568.1	C	NM_152397	-		51929102	-1	no_errors	ENST00000310914	ensembl	human	known	74_37	missense	SNP	0.003	T
FOXD2	2306	genome.wustl.edu	37	1	47904668	47904669	+	In_Frame_Ins	INS	-	-	CCGCAC	rs113438724|rs3046924|rs71053113	byFrequency	TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:47904668_47904669insCCGCAC	ENST00000334793.5	+	1	2980_2981	c.861_862insCCGCAC	c.(862-864)ccg>CCGCACccg	p.288_288P>PHP		NM_004474.3	NP_004465.3	O60548	FOXD2_HUMAN	forkhead box D2	288	Ala-rich.|Pro-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4				READ - Rectum adenocarcinoma(2;0.0908)		cggccccgcatccgcacccgca	0.787														4830	0.964457	0.9107	0.9827	5008	,	,		7050	0.9881		0.992	False		,,,				2504	0.9714																0								ENSG00000186564			161,17		80,1,8						-2.5	0.2		dbSNP_102	1	364,38		182,0,19	no	coding	FOXD2	NM_004474.3		262,1,27	A1A1,A1R,RR		9.4527,9.5506,9.4828				525,55				FOXD2	SO:0001652	inframe_insertion	0				HGNC	AF042832	CCDS30708.1	1p34-p32	2008-02-05			ENSG00000186564	ENSG00000186564		"""Forkhead boxes"""	3803	protein-coding gene	gene with protein product		602211		FKHL17		9403061, 12621056	Standard	NM_004474		Approved	FREAC9	uc001crm.3	O60548	OTTHUMG00000007950	ENST00000334793.5:c.874_879dupCCGCAC	1.37:g.47904669_47904674dupCCGCAC	ENSP00000335493:p.HisPro292dup	Somatic	NA	NA	NA		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5SVZ3	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.291in_frame_insPH	ENST00000334793.5	37	c.861_862	CCDS30708.1	1																																																																																			-	NULL		0.787	FOXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD2	protein_coding	OTTHUMT00000021831.1	-	NM_004474			47904669	+1	no_errors	ENST00000334793	ensembl	human	known	74_37	in_frame_ins	INS	0.056:0.602	CCGCAC
CACNA1S	779	genome.wustl.edu	37	1	201044742	201044742	+	Splice_Site	SNP	A	A	G			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:201044742A>G	ENST00000362061.3	-	13	2055	c.1829T>C	c.(1828-1830)gTa>gCa	p.V610A	CACNA1S_ENST00000367338.3_Splice_Site_p.V610A	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	610					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCCTGTCAGTACCTGTATGGA	0.542																																																	0								ENSG00000081248						159.0	140.0	146.0					1																	201044742		2203	4300	6503	CACNA1S	SO:0001630	splice_region_variant	0			-	HGNC	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.1828-1T>C	1.37:g.201044742A>G		Somatic	0	28	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	66	12.00	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_VDCC_L_a1ssu	p.V610A	ENST00000362061.3	37	c.1829	CCDS1407.1	1	.	.	.	.	.	.	.	.	.	.	A	18.50	3.637258	0.67130	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.97665	-4.48;-4.48	4.45	4.45	0.53987	Ion transport (1);	0.052902	0.64402	D	0.000001	D	0.96935	0.8999	M	0.67517	2.055	0.40525	D	0.980876	P	0.34977	0.478	P	0.45377	0.478	D	0.98115	1.0422	10	0.87932	D	0	.	14.0254	0.64582	1.0:0.0:0.0:0.0	.	610	Q13698	CAC1S_HUMAN	A	610	ENSP00000355192:V610A;ENSP00000356307:V610A	ENSP00000355192:V610A	V	-	2	0	CACNA1S	199311365	1.000000	0.71417	0.999000	0.59377	0.307000	0.27823	9.238000	0.95380	1.781000	0.52344	0.523000	0.50628	GTA	-	pfam_Ion_trans_dom,prints_VDCCAlpha1		0.542	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1S	protein_coding	OTTHUMT00000087049.1	A	NM_000069	-	Missense_Mutation	201044742	-1	no_errors	ENST00000362061	ensembl	human	known	74_37	missense	SNP	1.000	G
ANKRD36BP2	645784	genome.wustl.edu	37	2	89084354	89084354	+	RNA	SNP	G	G	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr2:89084354G>A	ENST00000393525.3	+	0	722									ankyrin repeat domain 36B pseudogene 2																		AGCCAAGATAGACAAGAACTT	0.393																																																	0								ENSG00000230006																																			ANKRD36BP2			0			-	HGNC			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89084354G>A		Somatic	0	26	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	96	23.81		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000393525.3	37	NULL		2																																																																																			-	-		0.393	ANKRD36BP2-003	KNOWN	basic	processed_transcript	ANKRD36BP2	pseudogene	OTTHUMT00000323523.1	G		-		89084354	+1	no_errors	ENST00000393515	ensembl	human	known	74_37	rna	SNP	0.017	A
ENOSF1	55556	genome.wustl.edu	37	18	690702	690703	+	Intron	INS	-	-	AGCTGTTTCCCCTGGAGAGTCC	rs145372402|rs3217715	byFrequency	TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr18:690702_690703insAGCTGTTTCCCCTGGAGAGTCC	ENST00000251101.7	-	8	624				ENOSF1_ENST00000340116.7_Intron|ENOSF1_ENST00000580982.1_Intron|ENOSF1_ENST00000383578.3_Intron|ENOSF1_ENST00000319815.6_5'Flank|ENOSF1_ENST00000583973.1_5'Flank	NM_017512.5	NP_059982.2	Q7L5Y1	ENOF1_HUMAN	enolase superfamily member 1						cellular amino acid catabolic process (GO:0009063)|cellular carbohydrate catabolic process (GO:0044275)	mitochondrion (GO:0005739)	isomerase activity (GO:0016853)|L-fuconate dehydratase activity (GO:0050023)|magnesium ion binding (GO:0000287)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	10						GCCTGTAGCTAAGCTGTTTCCC	0.52														1644	0.328275	0.2995	0.2305	5008	,	,		24177	0.5704		0.1988	False		,,,				2504	0.32																0								ENSG00000132199																																			ENOSF1	SO:0001627	intron_variant	0				HGNC	X67098	CCDS11822.1, CCDS11823.1, CCDS45821.1	18p11.32	2005-01-26			ENSG00000132199	ENSG00000132199			30365	protein-coding gene	gene with protein product		607427				14508106	Standard	NM_001126123		Approved	HSRTSBETA, rTS, TYMSAS	uc002kku.4	Q7L5Y1	OTTHUMG00000131470	ENST00000251101.7:c.536-71->GGACTCTCCAGGGGAAACAGCT	18.37:g.690702_690703insAGCTGTTTCCCCTGGAGAGTCC		Somatic	NA	NA	NA		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NMP3|A8K9R5|B3KSL6|B3KXE4|D3DUH0|Q15407|Q15594|Q15595|Q6ZS08|Q9HAS5|Q9HAS6	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Mandelate_racemase_N	p.L156fs	ENST00000251101.7	37	c.467_466	CCDS11822.1	18																																																																																			-	NULL		0.520	ENOSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENOSF1	protein_coding	OTTHUMT00000254312.2	-	NM_017512			690703	-1	no_errors	ENST00000581475	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.000	AGCTGTTTCCCCTGGAGAGTCC
DNM3	26052	genome.wustl.edu	37	1	172356396	172356396	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:172356396G>A	ENST00000355305.5	+	19	2357	c.2200G>A	c.(2200-2202)Gca>Aca	p.A734T	DNM3_ENST00000367731.1_Missense_Mutation_p.A724T|DNM3_ENST00000358155.4_Missense_Mutation_p.A728T			Q9UQ16	DYN3_HUMAN	dynamin 3	734	GED. {ECO:0000255|PROSITE- ProRule:PRU00720}.				endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						AATGTATCAAGCACTGAAAGA	0.542																																																	0								ENSG00000197959						64.0	68.0	66.0					1																	172356396		2025	4173	6198	DNM3	SO:0001583	missense	0			-	HGNC	AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.2200G>A	1.37:g.172356396G>A	ENSP00000347457:p.Ala734Thr	Somatic	0	44	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	38	25.49	A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin_SF	p.A728T	ENST00000355305.5	37	c.2182		1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.166978	0.57476	.	.	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000355305;ENST00000367731;ENST00000485254	T;T;T;T	0.56103	0.48;0.48;0.48;0.48	5.43	5.43	0.79202	GTPase effector domain, GED (1);Dynamin GTPase effector (2);	0.119442	0.56097	D	0.000031	T	0.50222	0.1603	M	0.69523	2.12	0.80722	D	1	P;P;P	0.51537	0.946;0.843;0.659	P;P;B	0.50754	0.649;0.596;0.359	T	0.46992	-0.9151	10	0.30078	T	0.28	.	13.1689	0.59587	0.0:0.0:0.8403:0.1596	.	734;724;728	Q9UQ16;Q9UQ16-2;Q9UQ16-3	DYN3_HUMAN;.;.	T	738;728;734;724;97	ENSP00000350876:A728T;ENSP00000347457:A734T;ENSP00000356705:A724T;ENSP00000429165:A97T	ENSP00000347457:A734T	A	+	1	0	DNM3	170623019	1.000000	0.71417	0.936000	0.37596	0.551000	0.35334	6.641000	0.74324	2.717000	0.92951	0.585000	0.79938	GCA	-	pfam_GED,smart_GED		0.542	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	DNM3	protein_coding	OTTHUMT00000084531.1	G	NM_015569	-		172356396	+1	no_errors	ENST00000358155	ensembl	human	known	74_37	missense	SNP	0.996	A
NPVF	64111	genome.wustl.edu	37	7	25267967	25267967	+	Missense_Mutation	SNP	A	A	C			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr7:25267967A>C	ENST00000222674.2	-	1	138	c.92T>G	c.(91-93)gTg>gGg	p.V31G		NM_022150.3	NP_071433	Q9HCQ7	NPVF_HUMAN	neuropeptide VF precursor	31					negative regulation of gonadotropin secretion (GO:0032277)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|urinary_tract(1)	15						ATTGGAGATCACTAATTCATC	0.269																																																	0								ENSG00000105954						65.0	71.0	69.0					7																	25267967		2200	4294	6494	NPVF	SO:0001583	missense	0			-	HGNC	AB040290	CCDS5395.1	7p21-p15	2013-02-28	2006-10-06	2006-10-06	ENSG00000105954	ENSG00000105954		"""Endogenous ligands"""	13782	protein-coding gene	gene with protein product	"""RFamide-related peptide precursor"", ""FMRFamide-related peptide precursor"""		"""chromosome 7 open reading frame 9"""	C7orf9		11951088, 11173868	Standard	NM_022150		Approved	RFRP	uc003sxo.3	Q9HCQ7	OTTHUMG00000128509	ENST00000222674.2:c.92T>G	7.37:g.25267967A>C	ENSP00000222674:p.Val31Gly	Somatic	0	26	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	50	135	26.88	A4D164|Q7LE27|Q96PI9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V31G	ENST00000222674.2	37	c.92	CCDS5395.1	7	.	.	.	.	.	.	.	.	.	.	A	4.916	0.170122	0.09339	.	.	ENSG00000105954	ENST00000222674	T	0.27402	1.67	5.37	-1.62	0.08372	.	0.875003	0.10029	N	0.725020	T	0.16342	0.0393	N	0.19112	0.55	0.09310	N	1	B	0.13594	0.008	B	0.13407	0.009	T	0.26744	-1.0094	10	0.28530	T	0.3	4.2326	6.0141	0.19592	0.4303:0.4191:0.1507:0.0	.	31	Q9HCQ7	RFRP_HUMAN	G	31	ENSP00000222674:V31G	ENSP00000222674:V31G	V	-	2	0	NPVF	25234492	0.000000	0.05858	0.001000	0.08648	0.315000	0.28087	0.383000	0.20651	-0.546000	0.06216	0.528000	0.53228	GTG	-	NULL		0.269	NPVF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPVF	protein_coding	OTTHUMT00000250315.1	A	NM_022150	-		25267967	-1	no_errors	ENST00000222674	ensembl	human	known	74_37	missense	SNP	0.023	C
NELFB	25920	genome.wustl.edu	37	9	140150876	140150876	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr9:140150876C>T	ENST00000343053.4	+	3	699	c.362C>T	c.(361-363)cCc>cTc	p.P121L		NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B	121					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											AAGCACCTGCCCAAGGTAGGG	0.597																																																	0								ENSG00000188986						134.0	108.0	117.0					9																	140150876		2203	4300	6503	NELFB	SO:0001583	missense	0			-	HGNC	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.362C>T	9.37:g.140150876C>T	ENSP00000339495:p.Pro121Leu	Somatic	0	23	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	25	19.35	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_COBRA1	p.P121L	ENST00000343053.4	37	c.362	CCDS7040.1	9	.	.	.	.	.	.	.	.	.	.	C	29.2	4.983649	0.93044	.	.	ENSG00000188986	ENST00000343053	.	.	.	4.93	4.03	0.46877	.	0.000000	0.85682	D	0.000000	T	0.77691	0.4168	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79759	-0.1668	9	0.72032	D	0.01	-34.2851	11.925	0.52814	0.0:0.9145:0.0:0.0855	.	121	Q8WX92	NELFB_HUMAN	L	121	.	ENSP00000339495:P121L	P	+	2	0	COBRA1	139270697	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.501000	0.81600	1.076000	0.40961	0.561000	0.74099	CCC	-	pfam_COBRA1		0.597	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELFB	protein_coding	OTTHUMT00000254710.1	C	NM_015456	-		140150876	+1	no_errors	ENST00000343053	ensembl	human	known	74_37	missense	SNP	1.000	T
TP53BP1	7158	genome.wustl.edu	37	15	43749174	43749174	+	Missense_Mutation	SNP	A	A	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr15:43749174A>T	ENST00000263801.3	-	12	1869	c.1617T>A	c.(1615-1617)gaT>gaA	p.D539E	TP53BP1_ENST00000450115.2_Missense_Mutation_p.D544E|TP53BP1_ENST00000382039.3_Missense_Mutation_p.D544E|TP53BP1_ENST00000382044.4_Missense_Mutation_p.D544E|TP53BP1_ENST00000605155.1_5'Flank	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	539					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		TGTTTTCTCCATCTTCATCAA	0.403								Other conserved DNA damage response genes																																									0								ENSG00000067369						142.0	123.0	129.0					15																	43749174		2201	4298	6499	TP53BP1	SO:0001583	missense	0			-	HGNC	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.1617T>A	15.37:g.43749174A>T	ENSP00000263801:p.Asp539Glu	Somatic	0	34	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	91	9.90	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_53-BP1_Tudor,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.D544E	ENST00000263801.3	37	c.1632	CCDS10096.1	15	.	.	.	.	.	.	.	.	.	.	A	14.05	2.418697	0.42918	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115;ENST00000413546	T;T;T;T;T	0.21191	2.02;2.02;2.02;2.02;2.02	5.04	0.0937	0.14477	.	0.063969	0.64402	D	0.000014	T	0.21387	0.0515	M	0.73598	2.24	0.37885	D	0.930535	P;P;P;P	0.49961	0.858;0.886;0.93;0.93	P;B;P;P	0.45881	0.472;0.301;0.496;0.496	T	0.34254	-0.9836	10	0.12766	T	0.61	-6.4613	5.8147	0.18486	0.4165:0.0:0.4428:0.1407	.	544;539;544;544	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	E	539;544;544;544;544	ENSP00000263801:D539E;ENSP00000371475:D544E;ENSP00000371470:D544E;ENSP00000393497:D544E;ENSP00000388028:D544E	ENSP00000263801:D539E	D	-	3	2	TP53BP1	41536466	0.902000	0.30710	0.998000	0.56505	0.968000	0.65278	0.179000	0.16840	0.043000	0.15746	0.460000	0.39030	GAT	-	NULL		0.403	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TP53BP1	protein_coding	OTTHUMT00000132897.3	A		-		43749174	-1	no_errors	ENST00000382044	ensembl	human	known	74_37	missense	SNP	0.971	T
LHX8	431707	genome.wustl.edu	37	1	75608895	75608895	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:75608895G>A	ENST00000294638.5	+	6	1146	c.482G>A	c.(481-483)tGc>tAc	p.C161Y	LHX8_ENST00000356261.3_Missense_Mutation_p.C151Y	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	161	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						CACTTGGCATGCTTTGCCTGC	0.488																																																	0								ENSG00000162624						120.0	112.0	115.0					1																	75608895		2203	4299	6502	LHX8	SO:0001583	missense	0			-	HGNC	AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.482G>A	1.37:g.75608895G>A	ENSP00000294638:p.Cys161Tyr	Somatic	0	17	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	55	14.06	E9PGE3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.C161Y	ENST00000294638.5	37	c.482	CCDS30756.1	1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366347	0.82463	.	.	ENSG00000162624	ENST00000294638;ENST00000356261	D;D	0.95412	-3.7;-3.7	5.3	5.3	0.74995	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.99115	0.9695	H	0.99783	4.775	0.80722	D	1	D	0.69078	0.997	D	0.83275	0.996	D	0.98920	1.0783	10	0.87932	D	0	.	19.3413	0.94342	0.0:0.0:1.0:0.0	.	161	Q68G74	LHX8_HUMAN	Y	161;151	ENSP00000294638:C161Y;ENSP00000348597:C151Y	ENSP00000294638:C161Y	C	+	2	0	LHX8	75381483	1.000000	0.71417	0.996000	0.52242	0.916000	0.54674	9.476000	0.97823	2.660000	0.90430	0.650000	0.86243	TGC	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM		0.488	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LHX8	protein_coding	OTTHUMT00000026700.1	G	NM_001001933	-		75608895	+1	no_errors	ENST00000294638	ensembl	human	known	74_37	missense	SNP	1.000	A
MRPS5	64969	genome.wustl.edu	37	2	95753147	95753147	+	Silent	SNP	T	T	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr2:95753147T>A	ENST00000272418.2	-	12	1456	c.1248A>T	c.(1246-1248)ggA>ggT	p.G416G		NM_031902.3	NP_114108.1	P82675	RT05_HUMAN	mitochondrial ribosomal protein S5	416					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						AGCGCTTCATTCCCTGTGCAG	0.572																																																	0								ENSG00000144029						103.0	97.0	99.0					2																	95753147		2203	4300	6503	MRPS5	SO:0001819	synonymous_variant	0			-	HGNC	AB049940	CCDS2010.1	2p11.2-q11.2	2012-09-13			ENSG00000144029	ENSG00000144029		"""Mitochondrial ribosomal proteins / small subunits"""	14498	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S5"""	611972					Standard	NM_031902		Approved	MRP-S5, S5mt	uc002sub.3	P82675	OTTHUMG00000130394	ENST00000272418.2:c.1248A>T	2.37:g.95753147T>A		Somatic	0	42	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	43	24.56	Q4ZFY5|Q96LJ6|Q9BWI4|Q9BYC4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ribosomal_S5_C,pfam_Ribosomal_S5_N,superfamily_Ribosomal_S5_D2-typ_fold,pfscan_Ribosomal_S5_N	p.G416	ENST00000272418.2	37	c.1248	CCDS2010.1	2																																																																																			-	NULL		0.572	MRPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS5	protein_coding	OTTHUMT00000252772.1	T	NM_031902	-		95753147	-1	no_errors	ENST00000272418	ensembl	human	known	74_37	silent	SNP	0.009	A
FAM110B	90362	genome.wustl.edu	37	8	59058842	59058842	+	Missense_Mutation	SNP	C	C	T	rs140524173	byFrequency	TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr8:59058842C>T	ENST00000361488.3	+	5	933	c.53C>T	c.(52-54)gCg>gTg	p.A18V	FAM110B_ENST00000520369.1_Intron	NM_147189.2	NP_671722.1	Q8TC76	F110B_HUMAN	family with sequence similarity 110, member B	18						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)	26		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				GTCAGCCCCGCGGGCACCTTC	0.667																																																	0								ENSG00000169122	C	VAL/ALA	0,4406		0,0,2203	32.0	32.0	32.0		53	5.0	1.0	8	dbSNP_134	32	4,8596	3.0+/-9.4	0,4,4296	yes	missense	FAM110B	NM_147189.2	64	0,4,6499	TT,TC,CC		0.0465,0.0,0.0308	benign	18/371	59058842	4,13002	2203	4300	6503	FAM110B	SO:0001583	missense	0			-	HGNC	U79298	CCDS6170.1	8q12.1	2007-06-21	2007-03-21	2007-03-21		ENSG00000169122			28587	protein-coding gene	gene with protein product		611394	"""chromosome 8 open reading frame 72"""	C8orf72		8619474, 9110174, 17499476	Standard	XM_005251324		Approved	MGC39325	uc003xtj.1	Q8TC76		ENST00000361488.3:c.53C>T	8.37:g.59058842C>T	ENSP00000355204:p.Ala18Val	Somatic	0	161	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	67	22.09	Q5BM08|Q9Y4K2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A18V	ENST00000361488.3	37	c.53	CCDS6170.1	8	.	.	.	.	.	.	.	.	.	.	C	16.70	3.195907	0.58126	0.0	4.65E-4	ENSG00000169122	ENST00000361488	T	0.57752	0.38	5.0	5.0	0.66597	.	0.059016	0.64402	D	0.000003	T	0.45296	0.1335	L	0.44542	1.39	0.58432	D	0.999997	P	0.40970	0.734	B	0.35510	0.204	T	0.42616	-0.9441	9	.	.	.	0.428	18.2903	0.90127	0.0:1.0:0.0:0.0	.	18	Q8TC76	F110B_HUMAN	V	18	ENSP00000355204:A18V	.	A	+	2	0	FAM110B	59221396	0.998000	0.40836	1.000000	0.80357	0.931000	0.56810	3.761000	0.55242	2.312000	0.78011	0.313000	0.20887	GCG	-	NULL		0.667	FAM110B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM110B	protein_coding	OTTHUMT00000378095.2	C	NM_147189	rs140524173		59058842	+1	no_errors	ENST00000361488	ensembl	human	known	74_37	missense	SNP	0.999	T
WBSCR17	64409	genome.wustl.edu	37	7	71175901	71175901	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr7:71175901G>T	ENST00000333538.5	+	10	2290	c.1656G>T	c.(1654-1656)tgG>tgT	p.W552C	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	552	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				ACAAGCGCTGGAACTTCATCC	0.612																																																	0								ENSG00000185274						45.0	41.0	42.0					7																	71175901		2203	4300	6503	WBSCR17	SO:0001583	missense	0			-	HGNC	AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1656G>T	7.37:g.71175901G>T	ENSP00000329654:p.Trp552Cys	Somatic	0	40	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q8NFV9|Q9NTA8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.W552C	ENST00000333538.5	37	c.1656	CCDS5540.1	7	.	.	.	.	.	.	.	.	.	.	G	18.11	3.550657	0.65311	.	.	ENSG00000185274	ENST00000333538	T	0.75260	-0.92	5.28	5.28	0.74379	Ricin B-related lectin (1);Ricin B lectin (3);	0.000000	0.85682	D	0.000000	D	0.84397	0.5463	M	0.89414	3.03	0.80722	D	1	P	0.41848	0.763	P	0.48571	0.582	D	0.87209	0.2246	10	0.87932	D	0	.	17.6589	0.88185	0.0:0.0:1.0:0.0	.	552	Q6IS24	GLTL3_HUMAN	C	552	ENSP00000329654:W552C	ENSP00000329654:W552C	W	+	3	0	WBSCR17	70813837	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.309000	0.78937	2.746000	0.94184	0.655000	0.94253	TGG	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin		0.612	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR17	protein_coding	OTTHUMT00000252006.1	G	NM_022479	-		71175901	+1	no_errors	ENST00000333538	ensembl	human	known	74_37	missense	SNP	1.000	T
SNAP25	6616	genome.wustl.edu	37	20	10287451	10287452	+	3'UTR	DEL	AC	AC	-	rs145069282	byFrequency	TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr20:10287451_10287452delAC	ENST00000254976.2	+	0	1438_1439				SNAP25_ENST00000304886.2_3'UTR|SNAP25-AS1_ENST00000421143.2_RNA|SNAP25-AS1_ENST00000453544.1_RNA|SNAP25_ENST00000495883.1_3'UTR	NM_130811.2	NP_570824.1	P60880	SNP25_HUMAN	synaptosomal-associated protein, 25kDa						energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long-term synaptic potentiation (GO:0060291)|neurotransmitter secretion (GO:0007269)|neurotransmitter uptake (GO:0001504)|regulation of establishment of protein localization (GO:0070201)|regulation of insulin secretion (GO:0050796)|regulation of neuron projection development (GO:0010975)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|SNARE complex (GO:0031201)|synaptobrevin 2-SNAP-25-syntaxin-1a-complexin I complex (GO:0070032)|trans-Golgi network (GO:0005802)	calcium-dependent protein binding (GO:0048306)			endometrium(1)|large_intestine(2)|lung(8)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	18					Botulinum Toxin Type A(DB00083)	TGATGAGACAACACACACACAC	0.347														16	0.00319489	0.0053	0.0029	5008	,	,		20483	0.002		0.004	False		,,,				2504	0.001																0								ENSG00000132639																																			SNAP25	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS13109.1, CCDS13110.1	20p12-p11.2	2008-08-01	2002-08-29		ENSG00000132639	ENSG00000132639			11132	protein-coding gene	gene with protein product	"""resistance to inhibitors of cholinesterase 4 homolog"""	600322	"""synaptosomal-associated protein, 25kD"""	SNAP		8661740, 10692432	Standard	NM_003081		Approved	SNAP-25, RIC-4, RIC4, SEC9, bA416N4.2, dJ1068F16.2	uc002wnr.2	P60880	OTTHUMG00000031863	ENST00000254976.2:c.*607AC>-	20.37:g.10287461_10287462delAC		Somatic	0	27	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	63	10.00	B2RAU4|D3DW16|D3DW17|P13795|P36974|P70557|P70558|Q53EM2|Q5U0B5|Q8IXK3|Q96FM2|Q9BR45	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000254976.2	37	NULL	CCDS13110.1	20																																																																																			-	-		0.347	SNAP25-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SNAP25	protein_coding	OTTHUMT00000077976.3	AC	NM_130811			10287452	+1	no_errors	ENST00000495883	ensembl	human	known	74_37	rna	DEL	0.884:0.856	-
THAP2	83591	genome.wustl.edu	37	12	72070506	72070508	+	In_Frame_Del	DEL	GTT	GTT	-	rs140783391	byFrequency	TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	GTT	GTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr12:72070506_72070508delGTT	ENST00000308086.2	+	3	1806_1808	c.305_307delGTT	c.(304-309)agttgt>agt	p.C103del	RP11-293I14.2_ENST00000548802.1_Intron	NM_031435.3	NP_113623.1	Q9H0W7	THAP2_HUMAN	THAP domain containing, apoptosis associated protein 2	103						nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	10						AAAAACAACAGTTGTTCTCCAGC	0.34														202	0.0403355	0.0113	0.0591	5008	,	,		19109	0.003		0.0507	False		,,,				2504	0.0941																0								ENSG00000173451			82,4182		2,78,2052						2.0	1.0		dbSNP_134	46	567,7685		14,539,3573	no	coding	THAP2	NM_031435.3		16,617,5625	A1A1,A1R,RR		6.8711,1.9231,5.1854				649,11867				THAP2	SO:0001651	inframe_deletion	0				HGNC	BC008358	CCDS9001.1	12q21.1	2013-01-25				ENSG00000173451		"""THAP (C2CH-type zinc finger) domain containing"""	20854	protein-coding gene	gene with protein product		612531				12575992	Standard	NM_031435		Approved	DKFZP564I0422	uc001swq.3	Q9H0W7	OTTHUMG00000169556	ENST00000308086.2:c.305_307delGTT	12.37:g.72070509_72070511delGTT	ENSP00000310796:p.Cys103del	Somatic	0	14	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	43	33.85	B2R8P3	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.C103in_frame_del	ENST00000308086.2	37	c.305_307	CCDS9001.1	12																																																																																			-	NULL		0.340	THAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP2	protein_coding	OTTHUMT00000404796.1	GTT	NM_031435			72070508	+1	no_errors	ENST00000308086	ensembl	human	known	74_37	in_frame_del	DEL	0.938:0.991:0.992	-
CRISPLD1	83690	genome.wustl.edu	37	8	75929118	75929118	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr8:75929118C>G	ENST00000262207.4	+	8	1339	c.871C>G	c.(871-873)Caa>Gaa	p.Q291E	CRISPLD1_ENST00000517786.1_Missense_Mutation_p.Q105E|CRISPLD1_ENST00000523524.1_Missense_Mutation_p.Q103E	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	291	LCCL 1. {ECO:0000255|PROSITE- ProRule:PRU00123}.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			CTTTGTAGCCCAAATTGTTTC	0.234																																																	0								ENSG00000121005						23.0	24.0	23.0					8																	75929118		2131	4239	6370	CRISPLD1	SO:0001583	missense	0			-	HGNC	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.871C>G	8.37:g.75929118C>G	ENSP00000262207:p.Gln291Glu	Somatic	0	16	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	79	17.71	B2RA60|B7Z929	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LCCL,pfam_CAP_domain,superfamily_CAP_domain,superfamily_LCCL,smart_Allrgn_V5/Tpx1,smart_LCCL,pfscan_LCCL,prints_Allrgn_V5/Tpx1	p.Q291E	ENST00000262207.4	37	c.871	CCDS6219.1	8	.	.	.	.	.	.	.	.	.	.	C	15.77	2.930786	0.52866	.	.	ENSG00000121005	ENST00000262207;ENST00000523524;ENST00000517786	D;D;D	0.89270	-2.49;-2.49;-2.49	4.97	4.97	0.65823	LCCL (4);	0.000000	0.85682	D	0.000000	D	0.95118	0.8418	M	0.87328	2.875	0.80722	D	1	D;D	0.64830	0.969;0.994	D;D	0.72338	0.93;0.977	D	0.94901	0.8056	10	0.51188	T	0.08	.	18.7915	0.91975	0.0:1.0:0.0:0.0	.	105;291	B7Z929;Q9H336	.;CRLD1_HUMAN	E	291;103;105	ENSP00000262207:Q291E;ENSP00000430105:Q103E;ENSP00000429746:Q105E	ENSP00000262207:Q291E	Q	+	1	0	CRISPLD1	76091673	1.000000	0.71417	1.000000	0.80357	0.230000	0.25150	4.335000	0.59298	2.752000	0.94435	0.650000	0.86243	CAA	-	superfamily_LCCL,smart_LCCL,pfscan_LCCL		0.234	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRISPLD1	protein_coding	OTTHUMT00000379117.1	C	NM_031461	-		75929118	+1	no_errors	ENST00000262207	ensembl	human	known	74_37	missense	SNP	1.000	G
PPIP5K2	23262	genome.wustl.edu	37	5	102486984	102486984	+	Silent	SNP	C	C	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr5:102486984C>A	ENST00000358359.3	+	9	1443	c.934C>A	c.(934-936)Cgg>Agg	p.R312R	PPIP5K2_ENST00000414217.1_Silent_p.R312R|PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000321521.9_Silent_p.R312R	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	312					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TGATTTGTTACGGGCCAATGG	0.318																																																	0								ENSG00000145725						95.0	98.0	97.0					5																	102486984		2202	4300	6502	PPIP5K2	SO:0001819	synonymous_variant	0			-	HGNC	AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.934C>A	5.37:g.102486984C>A		Somatic	0	125	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	70	280	20.00	A1NI53|A6NGS8|Q8TB50	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_His_Pase_superF_clade-2	p.R312	ENST00000358359.3	37	c.934		5																																																																																			-	NULL		0.318	PPIP5K2-003	KNOWN	basic	protein_coding	PPIP5K2	protein_coding	OTTHUMT00000370487.1	C	NM_015216	-		102486984	+1	no_errors	ENST00000358359	ensembl	human	known	74_37	silent	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179569022	179569022	+	Silent	SNP	G	G	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr2:179569022G>T	ENST00000591111.1	-	104	29348	c.29124C>A	c.(29122-29124)ggC>ggA	p.G9708G	TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Silent_p.G8781G|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Silent_p.G10025G|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13786	Ig-like 78.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAAGGATTCTGCCATTTCTGA	0.423																																																	0								ENSG00000155657						198.0	186.0	190.0					2																	179569022		1889	4117	6006	TTN	SO:0001819	synonymous_variant	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.29124C>A	2.37:g.179569022G>T		Somatic	0	16	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	55	12.70	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.G8781	ENST00000591111.1	37	c.26343		2																																																																																			-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.423	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	G	NM_133378	-		179569022	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	SNP	1.000	T
COL20A1	57642	genome.wustl.edu	37	20	61960763	61960764	+	Intron	DEL	TG	TG	-	rs5842416|rs544239880|rs573799946	byFrequency	TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr20:61960763_61960764delTG	ENST00000358894.6	+	35	3881				COL20A1_ENST00000422202.1_Intron|COL20A1_ENST00000326996.6_Intron|COL20A1_ENST00000435874.1_Intron|COL20A1_ENST00000496810.1_3'UTR	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1						extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					AGGAGGCGCCTGTGTGGAGCAC	0.653														2911	0.58127	0.5303	0.5432	5008	,	,		15654	0.5675		0.6441	False		,,,				2504	0.6268																0								ENSG00000101203																																			COL20A1	SO:0001627	intron_variant	0				HGNC	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.3782-173TG>-	20.37:g.61960767_61960768delTG		Somatic	0	9	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	5	58.33	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000358894.6	37	NULL	CCDS46628.1	20																																																																																			-	-		0.653	COL20A1-006	KNOWN	basic|CCDS	protein_coding	COL20A1	protein_coding	OTTHUMT00000144595.2	TG	NM_020882			61960764	+1	no_errors	ENST00000496810	ensembl	human	putative	74_37	rna	DEL	0.000:0.000	-
LRP1B	53353	genome.wustl.edu	37	2	141641542	141641542	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr2:141641542T>C	ENST00000389484.3	-	25	4984	c.4013A>G	c.(4012-4014)gAa>gGa	p.E1338G		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1338					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGTCAGGCCTTCTGGAGTAGC	0.473										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0								ENSG00000168702						136.0	130.0	132.0					2																	141641542		2203	4300	6503	LRP1B	SO:0001583	missense	0			-	HGNC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4013A>G	2.37:g.141641542T>C	ENSP00000374135:p.Glu1338Gly	Somatic	0	18	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	42	20.75	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.E1338G	ENST00000389484.3	37	c.4013	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	T	22.2	4.254309	0.80135	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.96459	-2.79;-4.02	5.63	5.63	0.86233	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.97999	0.9341	M	0.83692	2.655	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.80764	0.964;0.994	D	0.97940	1.0325	10	0.35671	T	0.21	.	16.1381	0.81502	0.0:0.0:0.0:1.0	.	521;1338	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	G	1338;1276;483	ENSP00000374135:E1338G;ENSP00000413239:E483G	ENSP00000374135:E1338G	E	-	2	0	LRP1B	141358012	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	7.926000	0.87569	2.258000	0.74832	0.533000	0.62120	GAA	-	smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.473	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	protein_coding	OTTHUMT00000254736.2	T	NM_018557	-		141641542	-1	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	SNP	1.000	C
TAB1	10454	genome.wustl.edu	37	22	39811644	39811644	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr22:39811644C>T	ENST00000216160.6	+	3	372	c.310C>T	c.(310-312)Cgt>Tgt	p.R104C	TAB1_ENST00000331454.3_Missense_Mutation_p.R104C	NM_006116.2	NP_006107.1	Q15750	TAB1_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 1	104	PP2C-like.				activation of MAPK activity (GO:0000187)|activation of MAPKKK activity (GO:0000185)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart morphogenesis (GO:0003007)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lung development (GO:0030324)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|protein complex (GO:0043234)	catalytic activity (GO:0003824)|enzyme activator activity (GO:0008047)|kinase activator activity (GO:0019209)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|urinary_tract(1)	14						CGATGTGCGGCGTGTGCTGCT	0.647																																																	0								ENSG00000100324						38.0	34.0	36.0					22																	39811644		2203	4299	6502	TAB1	SO:0001583	missense	0			-	HGNC	U49928	CCDS13992.1, CCDS13993.1	22q13.1	2010-02-05	2010-02-05	2010-02-05	ENSG00000100324	ENSG00000100324			18157	protein-coding gene	gene with protein product	"""TAK1-binding protein 1"", ""mitogen-activated protein kinase kinase kinase 7 interacting protein 1"""	602615	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 1"""	MAP3K7IP1		8638164, 10187861	Standard	NM_153497		Approved		uc003axt.3	Q15750	OTTHUMG00000151102	ENST00000216160.6:c.310C>T	22.37:g.39811644C>T	ENSP00000216160:p.Arg104Cys	Somatic	0	133	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	27	22.86	Q2PP09|Q8IZW2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.R104C	ENST00000216160.6	37	c.310	CCDS13993.1	22	.	.	.	.	.	.	.	.	.	.	C	11.53	1.665435	0.29604	.	.	ENSG00000100324	ENST00000216160;ENST00000331454	T;T	0.10192	2.9;2.9	5.23	4.17	0.49024	Protein phosphatase 2C-like (4);	0.129212	0.50627	D	0.000109	T	0.24353	0.0590	L	0.46157	1.445	0.58432	D	0.999992	D;D;D	0.89917	0.998;0.998;1.0	P;P;D	0.81914	0.675;0.734;0.995	T	0.00346	-1.1800	10	0.62326	D	0.03	-24.9071	12.2775	0.54744	0.2998:0.7002:0.0:0.0	.	104;104;248	Q15750-2;Q15750;Q59FT7	.;TAB1_HUMAN;.	C	104	ENSP00000216160:R104C;ENSP00000333049:R104C	ENSP00000216160:R104C	R	+	1	0	TAB1	38141590	0.955000	0.32602	0.981000	0.43875	0.939000	0.58152	1.472000	0.35376	2.450000	0.82876	0.655000	0.94253	CGT	-	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom		0.647	TAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAB1	protein_coding	OTTHUMT00000321313.1	C	NM_153497	-		39811644	+1	no_errors	ENST00000216160	ensembl	human	known	74_37	missense	SNP	0.849	T
ADAM21P1	145241	genome.wustl.edu	37	14	70714144	70714144	+	RNA	SNP	A	A	G	rs111296958		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr14:70714144A>G	ENST00000530196.1	-	0	374					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		AGAGCTTCTTAACCCTCATAT	0.502																																																	0								ENSG00000235812																																			ADAM21P1			0			-	HGNC			14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70714144A>G		Somatic	0	23	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	49	14.04		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			-	-		0.502	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	pseudogene	OTTHUMT00000390451.1	A	NG_002467	rs111296958		70714144	-1	no_errors	ENST00000530196	ensembl	human	known	74_37	rna	SNP	0.121	G
WNT10B	7480	genome.wustl.edu	37	12	49360194	49360194	+	Missense_Mutation	SNP	A	A	T	rs146010731	byFrequency	TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr12:49360194A>T	ENST00000301061.4	-	5	1202	c.854T>A	c.(853-855)aTt>aAt	p.I285N	WNT10B_ENST00000407467.1_3'UTR|WNT10B_ENST00000403957.1_3'UTR	NM_003394.3	NP_003385.2	O00744	WN10B_HUMAN	wingless-type MMTV integration site family, member 10B	285			I -> T. {ECO:0000269|PubMed:16477437}.		bone trabecula formation (GO:0060346)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to cAMP (GO:0071320)|cellular response to hydrostatic pressure (GO:0071464)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fungiform papilla development (GO:0061196)|G2/M transition of mitotic cell cycle (GO:0000086)|hematopoietic stem cell proliferation (GO:0071425)|lipid metabolic process (GO:0006629)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of anagen (GO:0051885)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of skeletal muscle tissue development (GO:0048641)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			central_nervous_system(1)|large_intestine(5)|lung(12)|prostate(1)|skin(4)	23						GTGGGTATCAATGAAGATGGC	0.622																																																	0								ENSG00000169884						39.0	48.0	45.0					12																	49360194		2203	4300	6503	WNT10B	SO:0001583	missense	0			-	HGNC	X97057	CCDS8775.1	12q13	2009-01-02			ENSG00000169884	ENSG00000169884		"""Wingless-type MMTV integration sites"""	12775	protein-coding gene	gene with protein product		601906				9121776, 9284937, 18515319	Standard	NM_003394		Approved	WNT-12, SHFM6	uc001rss.3	O00744	OTTHUMG00000150734	ENST00000301061.4:c.854T>A	12.37:g.49360194A>T	ENSP00000301061:p.Ile285Asn	Somatic	1	349	0.29		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	153	13.56	B2R7A5|O00747|Q4VAJ4|Q4VAJ5|Q8WZ97	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt10	p.I285N	ENST00000301061.4	37	c.854	CCDS8775.1	12	.	.	.	.	.	.	.	.	.	.	A	19.17	3.774820	0.70107	.	.	ENSG00000169884	ENST00000301061	T	0.78003	-1.14	4.43	4.43	0.53597	.	0.072919	0.53938	D	0.000055	D	0.86619	0.5976	M	0.86805	2.84	0.80722	D	1	D	0.63880	0.993	D	0.65323	0.934	D	0.87741	0.2585	10	0.87932	D	0	.	7.902	0.29740	0.9054:0.0:0.0946:0.0	.	285	O00744	WN10B_HUMAN	N	285	ENSP00000301061:I285N	ENSP00000301061:I285N	I	-	2	0	WNT10B	47646461	1.000000	0.71417	0.966000	0.40874	0.974000	0.67602	7.119000	0.77145	2.010000	0.58986	0.459000	0.35465	ATT	-	pfam_Wnt,smart_Wnt		0.622	WNT10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT10B	protein_coding	OTTHUMT00000319864.1	A	NM_003394	-		49360194	-1	no_errors	ENST00000301061	ensembl	human	known	74_37	missense	SNP	0.991	T
CELSR2	1952	genome.wustl.edu	37	1	109813237	109813250	+	Intron	DEL	TCCCAGTCTTGGGG	TCCCAGTCTTGGGG	-	rs184505313|rs189469730|rs181538634|rs200794625|rs111491315|rs79668084	byFrequency	TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	TCCCAGTCTTGGGG	TCCCAGTCTTGGGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:109813237_109813250delTCCCAGTCTTGGGG	ENST00000271332.3	+	24	7544					NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2						cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		TCCCACCCATTCCCAGTCTTGGGGTCCCACATCC	0.617														1905	0.380391	0.1702	0.464	5008	,	,		19795	0.495		0.4791	False		,,,				2504	0.3855				NSCLC(158;1285 2011 34800 34852 42084)												0								ENSG00000143126			839,3425		95,649,1388						-5.7	0.0		dbSNP_132	42	3646,4580		858,1930,1325	no	intron	CELSR2	NM_001408.2		953,2579,2713	A1A1,A1R,RR		44.3229,19.6764,35.9087				4485,8005				CELSR2	SO:0001627	intron_variant	0				HGNC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.7483+15TCCCAGTCTTGGGG>-	1.37:g.109813237_109813250delTCCCAGTCTTGGGG		Somatic	NA	NA	NA		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5T2Y7|Q92566	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000271332.3	37	NULL	CCDS796.1	1																																																																																			-	-		0.617	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	protein_coding	OTTHUMT00000033200.1	TCCCAGTCTTGGGG	NM_001408			109813250	+1	no_errors	ENST00000489018	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.002:0.000:0.000:0.024:0.003:0.001:0.000	-
VANGL1	81839	genome.wustl.edu	37	1	116206547	116206547	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:116206547C>T	ENST00000355485.2	+	4	741	c.470C>T	c.(469-471)gCa>gTa	p.A157V	VANGL1_ENST00000369509.1_Missense_Mutation_p.A157V|VANGL1_ENST00000369510.4_Missense_Mutation_p.A155V|VANGL1_ENST00000310260.3_Missense_Mutation_p.A157V	NM_001172411.1|NM_138959.2	NP_001165882.1|NP_620409.1	Q8TAA9	VANG1_HUMAN	VANGL planar cell polarity protein 1	157					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(13)|urinary_tract(1)	27	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		ATCTCCATGGCATTCAAACTC	0.512																																																	0								ENSG00000173218						116.0	118.0	117.0					1																	116206547		2203	4300	6503	VANGL1	SO:0001583	missense	0			-	HGNC	AB075805	CCDS883.1, CCDS53350.1	1p13.1	2013-03-05	2013-03-05		ENSG00000173218	ENSG00000173218			15512	protein-coding gene	gene with protein product		610132	"""vang (van gogh, Drosophila)-like 1, vang, van gogh-like 1 (Drosophila)"", ""vang-like 1 (van gogh, Drosophila)"""			11956595, 12011995	Standard	NM_001172411		Approved	STB2	uc001efv.1	Q8TAA9	OTTHUMG00000011971	ENST00000355485.2:c.470C>T	1.37:g.116206547C>T	ENSP00000347672:p.Ala157Val	Somatic	0	94	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	95	18.10	Q5T1D3|Q5T1D4|Q86WG8|Q8N559	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Strabismus,pirsf_Strabismus	p.A157V	ENST00000355485.2	37	c.470	CCDS883.1	1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.602908	0.87157	.	.	ENSG00000173218	ENST00000355485;ENST00000369510;ENST00000310260;ENST00000369509	D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79	5.34	5.34	0.76211	.	0.055167	0.64402	D	0.000001	D	0.82747	0.5104	M	0.74467	2.265	0.80722	D	1	P;P	0.44380	0.801;0.834	B;B	0.44133	0.314;0.442	D	0.85338	0.1094	10	0.62326	D	0.03	0.0369	19.4118	0.94677	0.0:1.0:0.0:0.0	.	155;157	Q8TAA9-2;Q8TAA9	.;VANG1_HUMAN	V	157;155;157;157	ENSP00000347672:A157V;ENSP00000358523:A155V;ENSP00000310800:A157V;ENSP00000358522:A157V	ENSP00000310800:A157V	A	+	2	0	VANGL1	116008070	1.000000	0.71417	0.080000	0.20451	0.812000	0.45895	7.487000	0.81328	2.662000	0.90505	0.650000	0.86243	GCA	-	pfam_Strabismus,pirsf_Strabismus		0.512	VANGL1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VANGL1	protein_coding	OTTHUMT00000033096.1	C		-		116206547	+1	no_errors	ENST00000310260	ensembl	human	known	74_37	missense	SNP	0.987	T
MOSPD2	158747	genome.wustl.edu	37	X	14933790	14933790	+	Splice_Site	SNP	G	G	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chrX:14933790G>A	ENST00000380492.3	+	12	1178	c.1090G>A	c.(1090-1092)Gtg>Atg	p.V364M	MOSPD2_ENST00000482354.1_Splice_Site_p.V364M|MOSPD2_ENST00000495110.1_3'UTR	NM_001177475.1|NM_152581.3	NP_001170946.1|NP_689794.1	Q8NHP6	MSPD2_HUMAN	motile sperm domain containing 2	364	MSP. {ECO:0000255|PROSITE- ProRule:PRU00132}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	Hepatocellular(33;0.183)					TTATAAATAGGTGAGAACAAC	0.373																																																	0								ENSG00000130150						98.0	103.0	101.0					X																	14933790		2203	4300	6503	MOSPD2	SO:0001630	splice_region_variant	0			-	HGNC	AL834345	CCDS14162.1	Xp22.31	2006-03-16			ENSG00000130150	ENSG00000130150			28381	protein-coding gene	gene with protein product						15533722	Standard	NM_152581		Approved	MGC26706	uc004cwi.3	Q8NHP6	OTTHUMG00000021170	ENST00000380492.3:c.1090-1G>A	X.37:g.14933790G>A		Somatic	0	19	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	37	47.14	Q8N3H2|Q8NA83	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CRAL-TRIO_dom,pfam_MSP_dom,superfamily_CRAL-TRIO_dom,superfamily_PapD-like,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_MSP_dom	p.V364M	ENST00000380492.3	37	c.1090	CCDS14162.1	X	.	.	.	.	.	.	.	.	.	.	G	27.6	4.848078	0.91277	.	.	ENSG00000130150	ENST00000380492	T	0.80393	-1.37	5.83	5.83	0.93111	PapD-like (2);	0.000000	0.85682	D	0.000000	D	0.91610	0.7349	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92314	0.5860	9	.	.	.	.	18.6997	0.91615	0.0:0.0:1.0:0.0	.	364	Q8NHP6	MSPD2_HUMAN	M	364	ENSP00000369860:V364M	.	V	+	1	0	MOSPD2	14843711	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	9.325000	0.96381	2.460000	0.83146	0.600000	0.82982	GTG	-	pfam_MSP_dom,superfamily_PapD-like,pfscan_MSP_dom		0.373	MOSPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOSPD2	protein_coding	OTTHUMT00000055837.1	G	NM_152581	-	Missense_Mutation	14933790	+1	no_errors	ENST00000380492	ensembl	human	known	74_37	missense	SNP	1.000	A
KANSL1L	151050	genome.wustl.edu	37	2	210892036	210892036	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr2:210892036T>C	ENST00000281772.9	-	12	2698	c.2435A>G	c.(2434-2436)aAt>aGt	p.N812S	KANSL1L_ENST00000418791.1_Missense_Mutation_p.N770S|RP11-260M2.1_ENST00000608095.1_RNA	NM_152519.2	NP_689732.2	A0AUZ9	KAL1L_HUMAN	KAT8 regulatory NSL complex subunit 1-like	812						histone acetyltransferase complex (GO:0000123)											TTTGCCTAAATTATATTCATC	0.323																																																	0								ENSG00000144445						83.0	82.0	82.0					2																	210892036		2203	4298	6501	KANSL1L	SO:0001583	missense	0			-	HGNC	AK074441	CCDS33370.1	2q34	2012-02-20	2012-02-20	2012-02-20	ENSG00000144445	ENSG00000144445			26310	protein-coding gene	gene with protein product	"""KIAA1267-like"""	613833	"""chromosome 2 open reading frame 67"""	C2orf67		12477932	Standard	NM_152519		Approved	FLJ23861, FLJ32349, MSL1v2, KIAA1267L	uc002vds.3	A0AUZ9	OTTHUMG00000154697	ENST00000281772.9:c.2435A>G	2.37:g.210892036T>C	ENSP00000281772:p.Asn812Ser	Somatic	0	48	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	85	13.27	B7ZLN1|I6L9A8|Q53TV8|Q53TW3|Q6IS05|Q8TCI1|Q96MI0|Q9UFC3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.N812S	ENST00000281772.9	37	c.2435	CCDS33370.1	2	.	.	.	.	.	.	.	.	.	.	T	2.663	-0.279282	0.05642	.	.	ENSG00000144445	ENST00000281772;ENST00000418791	T;T	0.39997	1.05;1.05	5.97	2.1	0.27182	.	0.486350	0.18781	N	0.131328	T	0.32823	0.0842	L	0.40543	1.245	0.09310	N	1	B;B	0.23249	0.082;0.082	B;B	0.24394	0.053;0.053	T	0.17806	-1.0357	10	0.25751	T	0.34	.	12.0291	0.53388	0.0:0.0:0.4232:0.5768	.	770;812	A0AUZ9-2;A0AUZ9	.;CB067_HUMAN	S	812;770	ENSP00000281772:N812S;ENSP00000405724:N770S	ENSP00000281772:N812S	N	-	2	0	C2orf67	210600281	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	0.101000	0.15251	0.111000	0.17947	0.528000	0.53228	AAT	-	NULL		0.323	KANSL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANSL1L	protein_coding	OTTHUMT00000336633.3	T	NM_152519	-		210892036	-1	no_errors	ENST00000281772	ensembl	human	known	74_37	missense	SNP	0.002	C
RB1	5925	genome.wustl.edu	37	13	49050980	49050980	+	Splice_Site	SNP	G	G	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr13:49050980G>A	ENST00000267163.4	+	25	2801		c.e25+1		RB1_ENST00000484879.1_Splice_Site	NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(11)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CAGATGGAAGGTAGGAACCAG	0.458		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	26	Whole gene deletion(15)|Unknown(11)	bone(11)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|lung(1)|liver(1)						ENSG00000139687						116.0	112.0	113.0					13																	49050980		2203	4300	6503	RB1	SO:0001630	splice_region_variant	0	Familial Cancer Database		-	HGNC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2663+1G>A	13.37:g.49050980G>A		Somatic	0	32	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	87	19.44	A8K5E3|P78499|Q5VW46|Q8IZL4	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e25+1	ENST00000267163.4	37	c.2663+1	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	G	23.6	4.435521	0.83885	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7343	0.96195	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RB1	47948981	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.724000	0.91462	2.751000	0.94390	0.591000	0.81541	.	-	-		0.458	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	G		-	Intron	49050980	+1	no_errors	ENST00000267163	ensembl	human	known	74_37	splice_site	SNP	1.000	A
TUB	7275	genome.wustl.edu	37	11	8118920	8118920	+	Missense_Mutation	SNP	G	G	A	rs371203227		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr11:8118920G>A	ENST00000299506.2	+	7	982	c.833G>A	c.(832-834)cGg>cAg	p.R278Q	TUB_ENST00000305253.4_Missense_Mutation_p.R333Q|TUB_ENST00000534099.1_Missense_Mutation_p.R284Q	NM_177972.2	NP_813977.1	P50607	TUB_HUMAN	tubby bipartite transcription factor	278					multicellular organismal macromolecule metabolic process (GO:0044259)|phagocytosis (GO:0006909)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|response to hormone (GO:0009725)|retina development in camera-type eye (GO:0060041)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled photoreceptor activity (GO:0008020)|protein complex binding (GO:0032403)			breast(1)|cervix(1)|endometrium(9)|large_intestine(7)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)		GGGATGGACCGGGGCATGTAC	0.552																																																	0								ENSG00000166402	G	GLN/ARG,GLN/ARG	0,4402		0,0,2201	106.0	98.0	101.0		998,833	4.7	1.0	11		101	1,8591	1.2+/-3.3	0,1,4295	no	missense,missense	TUB	NM_003320.4,NM_177972.2	43,43	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	333/562,278/507	8118920	1,12993	2201	4296	6497	TUB	SO:0001583	missense	0			-	HGNC	U54644	CCDS7786.1, CCDS7787.1	11p15.5	2013-08-06	2013-08-06		ENSG00000166402	ENSG00000166402			12406	protein-coding gene	gene with protein product		601197	"""tubby (mouse) homolog"", ""tubby homolog (mouse)"""			8612280	Standard	NM_003320		Approved	rd5	uc001mfy.3	P50607	OTTHUMG00000165690	ENST00000299506.2:c.833G>A	11.37:g.8118920G>A	ENSP00000299506:p.Arg278Gln	Somatic	0	43	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	D3DQU4|O00293|Q6B007	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_N,prints_Tubby_C	p.R333Q	ENST00000299506.2	37	c.998	CCDS7787.1	11	.	.	.	.	.	.	.	.	.	.	G	35	5.448259	0.96205	0.0	1.16E-4	ENSG00000166402	ENST00000534099;ENST00000305253;ENST00000299506	D;D;D	0.96459	-4.02;-4.02;-4.02	4.71	4.71	0.59529	Tubby, C-terminal (3);	0.054291	0.64402	D	0.000001	D	0.96555	0.8876	M	0.85299	2.745	0.80722	D	1	D;D;D	0.56035	0.972;0.974;0.968	B;B;B	0.43916	0.436;0.436;0.431	D	0.97222	0.9878	10	0.59425	D	0.04	-10.2788	18.1957	0.89820	0.0:0.0:1.0:0.0	.	284;278;333	E9PQR4;P50607;P50607-2	.;TUB_HUMAN;.	Q	284;333;278	ENSP00000434400:R284Q;ENSP00000305426:R333Q;ENSP00000299506:R278Q	ENSP00000299506:R278Q	R	+	2	0	TUB	8075496	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.728000	0.84847	2.619000	0.88677	0.585000	0.79938	CGG	-	pfam_Tubby_C,superfamily_Tubby_C-like		0.552	TUB-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TUB	protein_coding	OTTHUMT00000385823.1	G	NM_003320	-		8118920	+1	no_errors	ENST00000305253	ensembl	human	known	74_37	missense	SNP	1.000	A
ANKRD36BP2	645784	genome.wustl.edu	37	2	89084352	89084352	+	RNA	SNP	T	T	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr2:89084352T>A	ENST00000393525.3	+	0	720									ankyrin repeat domain 36B pseudogene 2																		TCAGCCAAGATAGACAAGAAC	0.393																																																	0								ENSG00000230006																																			ANKRD36BP2			0			-	HGNC			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89084352T>A		Somatic	0	26	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	101	22.90		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000393525.3	37	NULL		2																																																																																			-	-		0.393	ANKRD36BP2-003	KNOWN	basic	processed_transcript	ANKRD36BP2	pseudogene	OTTHUMT00000323523.1	T		-		89084352	+1	no_errors	ENST00000393515	ensembl	human	known	74_37	rna	SNP	0.014	A
KIAA1462	57608	genome.wustl.edu	37	10	30317993	30317993	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr10:30317993C>A	ENST00000375377.1	-	3	1185	c.1084G>T	c.(1084-1086)Gtg>Ttg	p.V362L		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	362	Pro-rich.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						TTTATGGGCACCGTGTCTTCC	0.607																																																	0								ENSG00000165757						107.0	109.0	108.0					10																	30317993		2121	4247	6368	KIAA1462	SO:0001583	missense	0			-	HGNC	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.1084G>T	10.37:g.30317993C>A	ENSP00000364526:p.Val362Leu	Somatic	0	36	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	34	12.82	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V362L	ENST00000375377.1	37	c.1084	CCDS41500.1	10	.	.	.	.	.	.	.	.	.	.	C	11.44	1.639898	0.29157	.	.	ENSG00000165757	ENST00000375377	T	0.14144	2.53	4.97	2.07	0.26955	.	0.607273	0.15951	N	0.236735	T	0.11452	0.0279	L	0.38175	1.15	0.09310	N	1	B	0.19073	0.033	B	0.18871	0.023	T	0.22906	-1.0203	10	0.39692	T	0.17	0.0187	10.7689	0.46310	0.0:0.788:0.0:0.212	.	362	Q9P266	K1462_HUMAN	L	362	ENSP00000364526:V362L	ENSP00000364526:V362L	V	-	1	0	KIAA1462	30357999	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.046000	0.14035	0.226000	0.20979	-0.221000	0.12465	GTG	-	NULL		0.607	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1462	protein_coding	OTTHUMT00000047409.1	C	NM_020848	-		30317993	-1	no_errors	ENST00000375377	ensembl	human	known	74_37	missense	SNP	0.000	A
CTSK	1513	genome.wustl.edu	37	1	150772185	150772185	+	Splice_Site	SNP	C	C	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:150772185C>T	ENST00000271651.3	-	6	729	c.619G>A	c.(619-621)Gaa>Aaa	p.E207K		NM_000396.3	NP_000387.1	P43235	CATK_HUMAN	cathepsin K	207					bone resorption (GO:0045453)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|intramembranous ossification (GO:0001957)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|proteoglycan binding (GO:0043394)			cervix(1)|endometrium(1)|lung(4)|skin(1)	7	all_cancers(9;2.32e-51)|all_epithelial(9;3.89e-42)|all_lung(15;4.59e-35)|Lung NSC(24;1.7e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Colorectal(459;0.171)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			CAACTCTCTTCCTGGAAGAAA	0.458																																																	0								ENSG00000143387						117.0	111.0	113.0					1																	150772185		2203	4300	6503	CTSK	SO:0001630	splice_region_variant	0			-	HGNC	BC016058	CCDS969.1	1q21	2008-02-05	2006-12-05		ENSG00000143387	ENSG00000143387		"""Cathepsins"""	2536	protein-coding gene	gene with protein product		601105	"""cathepsin K (pycnodysostosis)"""	CTSO2, CTSO, PYCD		7818555	Standard	NM_000396		Approved	PKND	uc001evp.2	P43235	OTTHUMG00000035008	ENST00000271651.3:c.619-1G>A	1.37:g.150772185C>T		Somatic	0	34	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	56	20.00	Q6FHS6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C1A_C,pfam_Prot_inhib_I29,pfam_Peptidase_C1B,smart_Prot_inhib_I29,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.E207K	ENST00000271651.3	37	c.619	CCDS969.1	1	.	.	.	.	.	.	.	.	.	.	C	19.98	3.926480	0.73327	.	.	ENSG00000143387	ENST00000271651	D	0.97480	-4.4	5.78	5.78	0.91487	Peptidase C1A, papain C-terminal (2);	0.139981	0.64402	D	0.000007	D	0.90861	0.7129	N	0.12746	0.255	0.54753	D	0.999987	B	0.15719	0.014	B	0.19391	0.025	D	0.86910	0.2060	10	0.72032	D	0.01	.	17.5056	0.87745	0.0:1.0:0.0:0.0	.	207	P43235	CATK_HUMAN	K	207	ENSP00000271651:E207K	ENSP00000271651:E207K	E	-	1	0	CTSK	149038809	1.000000	0.71417	1.000000	0.80357	0.567000	0.35839	6.079000	0.71291	2.744000	0.94065	0.563000	0.77884	GAA	-	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C		0.458	CTSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSK	protein_coding	OTTHUMT00000084732.1	C	NM_000396	-	Missense_Mutation	150772185	-1	no_errors	ENST00000271651	ensembl	human	known	74_37	missense	SNP	1.000	T
RASA3	22821	genome.wustl.edu	37	13	114773080	114773080	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr13:114773080G>C	ENST00000334062.7	-	18	1792	c.1671C>G	c.(1669-1671)ttC>ttG	p.F557L	RASA3_ENST00000389544.4_Missense_Mutation_p.F525L	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	557					calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			TCAGATCCAAGAACTAAAGTT	0.542																																																	0								ENSG00000185989						89.0	78.0	81.0					13																	114773080		2202	4299	6501	RASA3	SO:0001583	missense	0			-	HGNC		CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.1671C>G	13.37:g.114773080G>C	ENSP00000335029:p.Phe557Leu	Somatic	0	82	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	29	23.68	A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RasGAP,pfam_C2_dom,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_C2_dom,smart_RasGAP,smart_Pleckstrin_homology,smart_Znf_Btk_motif,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_Znf_Btk_motif,pfscan_RasGAP,prints_Znf_Btk_motif	p.F557L	ENST00000334062.7	37	c.1671	CCDS32016.1	13	.	.	.	.	.	.	.	.	.	.	G	11.27	1.589520	0.28357	.	.	ENSG00000185989	ENST00000334062;ENST00000389544	T;T	0.22743	1.94;1.94	4.58	1.84	0.25277	Rho GTPase activation protein (1);Ras GTPase-activating protein (2);	0.000000	0.85682	D	0.000000	T	0.24236	0.0587	M	0.71206	2.165	0.80722	D	1	B	0.29835	0.258	B	0.35312	0.2	T	0.02721	-1.1119	9	.	.	.	.	9.4201	0.38546	0.2474:0.0:0.7525:0.0	.	557	Q14644	RASA3_HUMAN	L	557;525	ENSP00000335029:F557L;ENSP00000374195:F525L	.	F	-	3	2	RASA3	113791182	1.000000	0.71417	0.352000	0.25734	0.142000	0.21351	0.829000	0.27449	0.113000	0.18004	-0.258000	0.10820	TTC	-	superfamily_Rho_GTPase_activation_prot,smart_RasGAP		0.542	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASA3	protein_coding	OTTHUMT00000045957.2	G	NM_007368	-		114773080	-1	no_errors	ENST00000334062	ensembl	human	known	74_37	missense	SNP	0.997	C
ABCG1	9619	genome.wustl.edu	37	21	43711222	43711222	+	Missense_Mutation	SNP	T	T	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr21:43711222T>A	ENST00000361802.2	+	12	1595	c.1450T>A	c.(1450-1452)Ttt>Att	p.F484I	ABCG1_ENST00000398437.1_Missense_Mutation_p.F630I|ABCG1_ENST00000398457.2_Missense_Mutation_p.F474I|ABCG1_ENST00000340588.4_Missense_Mutation_p.F592I|ABCG1_ENST00000347800.2_Missense_Mutation_p.F469I|ABCG1_ENST00000343687.3_Missense_Mutation_p.F483I|ABCG1_ENST00000398449.3_Missense_Mutation_p.F472I|ABCG1_ENST00000462050.1_3'UTR	NM_004915.3	NP_004906.3	P45844	ABCG1_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 1	484	ABC transmembrane type-2.				amyloid precursor protein catabolic process (GO:0042987)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|detection of hormone stimulus (GO:0009720)|glycoprotein transport (GO:0034436)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of cholesterol efflux (GO:0010875)|regulation of cholesterol esterification (GO:0010872)|regulation of transcription, DNA-templated (GO:0006355)|response to high density lipoprotein particle (GO:0055099)|response to lipid (GO:0033993)|response to organic substance (GO:0010033)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|glycoprotein transporter activity (GO:0034437)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sterol-transporting ATPase activity (GO:0034041)|toxin transporter activity (GO:0019534)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(3)|prostate(2)|stomach(1)	29					Adenosine triphosphate(DB00171)	GATGGGAGTCTTTCTTCGGGA	0.532																																																	0								ENSG00000160179						112.0	87.0	96.0					21																	43711222		2203	4300	6503	ABCG1	SO:0001583	missense	0			-	HGNC	U34919	CCDS13681.1, CCDS13682.1, CCDS13683.1, CCDS42937.1, CCDS42938.1	21q22.3	2012-03-14			ENSG00000160179	ENSG00000160179		"""ATP binding cassette transporters / subfamily G"""	73	protein-coding gene	gene with protein product	"""ATP-binding cassette transporter 8"""	603076				8659545, 16870176	Standard	NM_016818		Approved	ABC8	uc002zaq.3	P45844	OTTHUMG00000086791	ENST00000361802.2:c.1450T>A	21.37:g.43711222T>A	ENSP00000354995:p.Phe484Ile	Somatic	0	74	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	58	18.31	Q86SU8|Q96L76|Q9BXK6|Q9BXK7|Q9BXK8|Q9BXK9|Q9BXL0|Q9BXL1|Q9BXL2|Q9BXL3|Q9BXL4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_2_trans,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Pigment_permease	p.F630I	ENST00000361802.2	37	c.1888	CCDS13682.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.7|20.7	4.031533|4.031533	0.75504|0.75504	.|.	.|.	ENSG00000160179|ENSG00000160179	ENST00000398457;ENST00000347800;ENST00000398449;ENST00000361802;ENST00000343687;ENST00000398437;ENST00000340588|ENST00000489035;ENST00000469119;ENST00000482161	T;T;T;T;T;T;T|.	0.72835|.	-0.69;-0.69;-0.69;-0.69;-0.69;-0.69;-0.69|.	3.97|3.97	3.97|3.97	0.46021|0.46021	ABC-2 type transporter (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71324|0.71324	0.3326|0.3326	M|M	0.70787|0.70787	2.145|2.145	0.80722|0.80722	D|D	1|1	P;D;D;B;P;D|.	0.76494|.	0.587;0.964;0.999;0.357;0.847;0.989|.	B;P;D;B;P;D|.	0.75020|.	0.241;0.835;0.98;0.237;0.73;0.985|.	T|T	0.72154|0.72154	-0.4376|-0.4376	9|5	.|.	.|.	.|.	-17.0863|-17.0863	13.1771|13.1771	0.59633|0.59633	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	495;483;484;472;469;474|.	B4DPT7;P45844-2;P45844;P45844-4;P45844-5;P45844-3|.	.;.;ABCG1_HUMAN;.;.;.|.	I|H	474;469;472;484;483;630;592|219;207;207	ENSP00000381475:F474I;ENSP00000291524:F469I;ENSP00000381467:F472I;ENSP00000354995:F484I;ENSP00000339744:F483I;ENSP00000381464:F630I;ENSP00000343820:F592I|.	.|.	F|L	+|+	1|2	0|0	ABCG1|ABCG1	42584291|42584291	1.000000|1.000000	0.71417|0.71417	0.191000|0.191000	0.23289|0.23289	0.893000|0.893000	0.52053|0.52053	7.654000|7.654000	0.83653|0.83653	1.582000|1.582000	0.49881|0.49881	0.383000|0.383000	0.25322|0.25322	TTT|CTT	-	pfam_ABC_2_trans,tigrfam_Pigment_permease		0.532	ABCG1-006	KNOWN	basic|CCDS	protein_coding	ABCG1	protein_coding	OTTHUMT00000195318.2	T	NM_207174	-		43711222	+1	no_errors	ENST00000398437	ensembl	human	known	74_37	missense	SNP	0.997	A
ABCC1	4363	genome.wustl.edu	37	16	16205244	16205244	+	Missense_Mutation	SNP	G	G	A	rs371105838		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr16:16205244G>A	ENST00000399410.3	+	22	3059	c.2884G>A	c.(2884-2886)Gtg>Atg	p.V962M	ABCC1_ENST00000351154.5_Missense_Mutation_p.V903M|ABCC1_ENST00000345148.5_Missense_Mutation_p.V962M|ABCC1_ENST00000346370.5_Missense_Mutation_p.V906M|ABCC1_ENST00000399408.2_Missense_Mutation_p.V972M|ABCC1_ENST00000349029.5_Missense_Mutation_p.V847M	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	962					arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	CAAGCTTTCCGTGTACTGGGA	0.557																																																	0								ENSG00000103222	G	MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL	1,4243		0,1,2121	179.0	189.0	186.0		2884,2707,2716,2539,2884	4.7	1.0	16		186	0,8470		0,0,4235	no	missense,missense,missense,missense,missense	ABCC1	NM_004996.3,NM_019862.2,NM_019898.2,NM_019899.2,NM_019900.2	21,21,21,21,21	0,1,6356	AA,AG,GG		0.0,0.0236,0.0079	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	962/1532,903/1473,906/1476,847/1417,962/1467	16205244	1,12713	2122	4235	6357	ABCC1	SO:0001583	missense	0			-	HGNC	L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.2884G>A	16.37:g.16205244G>A	ENSP00000382342:p.Val962Met	Somatic	0	48	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	48	11.11	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	p.V972M	ENST00000399410.3	37	c.2914	CCDS42122.1	16	.	.	.	.	.	.	.	.	.	.	G	17.87	3.494921	0.64186	2.36E-4	0.0	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000351154;ENST00000345148;ENST00000349029;ENST00000536381	D;D;D;D;D;D	0.91894	-2.92;-2.93;-2.64;-2.75;-2.88;-2.84	5.66	4.68	0.58851	ABC transporter, transmembrane domain, type 1 (1);	0.187299	0.46758	D	0.000265	D	0.95211	0.8447	M	0.72353	2.195	0.47737	D	0.999507	P;P;D;D;D;D	0.71674	0.758;0.531;0.996;0.994;0.993;0.998	B;B;D;P;P;D	0.70487	0.358;0.092;0.922;0.869;0.872;0.969	D	0.94777	0.7950	10	0.44086	T	0.13	-28.972	15.5785	0.76414	0.0:0.138:0.862:0.0	.	847;962;906;903;962;972	P33527-5;P33527-4;P33527-3;P33527-2;P33527;P33527-9	.;.;.;.;MRP1_HUMAN;.	M	962;972;906;903;962;847;646	ENSP00000382342:V962M;ENSP00000382340:V972M;ENSP00000263019:V906M;ENSP00000263017:V903M;ENSP00000263014:V962M;ENSP00000263016:V847M	ENSP00000263014:V962M	V	+	1	0	ABCC1	16112745	1.000000	0.71417	0.964000	0.40570	0.741000	0.42261	5.708000	0.68377	1.358000	0.45922	0.650000	0.86243	GTG	-	superfamily_ABC1_TM_dom,tigrfam_Multidrug-R_assoc		0.557	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC1	protein_coding	OTTHUMT00000109701.1	G	NM_004996	-		16205244	+1	no_errors	ENST00000399408	ensembl	human	known	74_37	missense	SNP	0.997	A
FREM2	341640	genome.wustl.edu	37	13	39265091	39265091	+	Missense_Mutation	SNP	A	A	C			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr13:39265091A>C	ENST00000280481.7	+	1	3826	c.3610A>C	c.(3610-3612)Atg>Ctg	p.M1204L		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1204					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GATGGAAGGCATGAGTCTGGT	0.413																																																	0								ENSG00000150893						272.0	257.0	262.0					13																	39265091		2203	4300	6503	FREM2	SO:0001583	missense	0			-	HGNC	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.3610A>C	13.37:g.39265091A>C	ENSP00000280481:p.Met1204Leu	Somatic	0	19	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	33	35.29	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.M1204L	ENST00000280481.7	37	c.3610	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	A	16.45	3.126807	0.56721	.	.	ENSG00000150893	ENST00000280481	T	0.50277	0.75	6.08	4.91	0.64330	.	0.075314	0.85682	D	0.000000	T	0.58250	0.2109	M	0.89214	3.015	0.58432	D	0.999999	P	0.42483	0.781	P	0.44732	0.459	T	0.60347	-0.7281	10	0.27082	T	0.32	.	12.0888	0.53713	0.9334:0.0:0.0666:0.0	.	1204	Q5SZK8	FREM2_HUMAN	L	1204	ENSP00000280481:M1204L	ENSP00000280481:M1204L	M	+	1	0	FREM2	38163091	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.526000	0.81920	1.131000	0.42111	0.533000	0.62120	ATG	-	superfamily_Cadherin-like		0.413	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	protein_coding	OTTHUMT00000044599.2	A	NM_207361	-		39265091	+1	no_errors	ENST00000280481	ensembl	human	known	74_37	missense	SNP	1.000	C
RAD21L1	642636	genome.wustl.edu	37	20	1212265	1212265	+	Splice_Site	SNP	T	T	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr20:1212265T>A	ENST00000409241.1	+	4	461		c.e4+2		RAD21L1_ENST00000402452.1_Splice_Site|RAD21L1_ENST00000477283.1_Splice_Site|RAD21L1_ENST00000381882.2_Splice_Site	NM_001136566.2	NP_001130038.2	Q9H4I0	RD21L_HUMAN	RAD21-like 1 (S. pombe)						attachment of telomeric heterochromatin to nuclear envelope (GO:0070197)|chromosome segregation (GO:0007059)|double-strand break repair via homologous recombination (GO:0000724)|fertilization (GO:0009566)|linear element assembly (GO:0030999)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleus (GO:0005634)				NS(1)|breast(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	7						AAATATGAAGTAAAATATTTT	0.279																																																	0								ENSG00000244588						31.0	24.0	26.0					20																	1212265		692	1580	2272	RAD21L1	SO:0001630	splice_region_variant	0			-	HGNC	AL031665	CCDS46568.1	20p13	2011-08-12			ENSG00000244588	ENSG00000244588			16271	protein-coding gene	gene with protein product							Standard	NM_001136566		Approved	dJ545L17.2, RAD21L	uc010gab.1	Q9H4I0	OTTHUMG00000031664	ENST00000409241.1:c.368+2T>A	20.37:g.1212265T>A		Somatic	0	8	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	30	16.67	B2RXL0|B7ZBB1|B7ZW76|Q5W0X5	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e3+2	ENST00000409241.1	37	c.368+2	CCDS46568.1	20	.	.	.	.	.	.	.	.	.	.	T	15.48	2.847281	0.51164	.	.	ENSG00000244588	ENST00000402452;ENST00000409241;ENST00000381882	.	.	.	4.78	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9845	0.58583	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	RAD21L1	1160265	1.000000	0.71417	1.000000	0.80357	0.644000	0.38419	5.821000	0.69257	2.126000	0.65437	0.533000	0.62120	.	-	-		0.279	RAD21L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD21L1	protein_coding	OTTHUMT00000334022.1	T		-	Intron	1212265	+1	no_errors	ENST00000409241	ensembl	human	known	74_37	splice_site	SNP	1.000	A
LOXHD1	125336	genome.wustl.edu	37	18	44173692	44173692	+	Silent	SNP	G	G	A	rs377086603		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr18:44173692G>A	ENST00000398722.4	-	3	467	c.468C>T	c.(466-468)acC>acT	p.T156T	LOXHD1_ENST00000536736.1_Silent_p.T434T|LOXHD1_ENST00000441551.2_Silent_p.T434T			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	156	PLAT 2. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						TCTTTAGGTCGGTTGTCCAGA	0.463																																																	0								ENSG00000167210						87.0	75.0	78.0					18																	44173692		692	1591	2283	LOXHD1	SO:0001819	synonymous_variant	0			-	HGNC	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.468C>T	18.37:g.44173692G>A		Somatic	0	15	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	74	17.58	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.T434	ENST00000398722.4	37	c.1302		18	.	.	.	.	.	.	.	.	.	.	g	7.408	0.634235	0.14322	.	.	ENSG00000167210	ENST00000441551	.	.	.	5.95	-4.8	0.03190	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.9579	0.09398	0.3605:0.1164:0.4104:0.1126	.	.	.	.	X	415	.	.	R	-	1	2	LOXHD1	42427690	0.365000	0.25006	0.553000	0.28255	0.748000	0.42578	-0.152000	0.10159	-1.160000	0.02804	-0.404000	0.06349	CGA	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom		0.463	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	protein_coding		G	NM_144612	-		44173692	-1	no_errors	ENST00000536736	ensembl	human	known	74_37	silent	SNP	0.452	A
PKNOX2	63876	genome.wustl.edu	37	11	125221274	125221274	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr11:125221274C>A	ENST00000298282.9	+	4	344	c.73C>A	c.(73-75)Cag>Aag	p.Q25K	PKNOX2_ENST00000542175.1_Silent_p.T7T|PKNOX2_ENST00000530517.1_Intron	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	25					regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		CCCACCCTACCAGGACAGCCC	0.652																																																	0								ENSG00000165495						27.0	31.0	30.0					11																	125221274		2086	4202	6288	PKNOX2	SO:0001583	missense	0			-	HGNC	AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.73C>A	11.37:g.125221274C>A	ENSP00000298282:p.Gln25Lys	Somatic	0	31	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	13	27.78	B7Z5I5|F5GZ15|Q63HL6|Q86XD1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.Q25K	ENST00000298282.9	37	c.73	CCDS41730.1	11	.	.	.	.	.	.	.	.	.	.	c	16.11	3.031156	0.54790	.	.	ENSG00000165495	ENST00000298282;ENST00000527238;ENST00000531212;ENST00000535518	T	0.29142	1.58	5.61	5.61	0.85477	.	0.067689	0.64402	D	0.000012	T	0.20373	0.0490	L	0.38175	1.15	0.80722	D	1	P	0.38535	0.635	B	0.27887	0.084	T	0.08207	-1.0733	10	0.05959	T	0.93	-8.6851	18.4197	0.90586	0.0:1.0:0.0:0.0	.	25	Q96KN3	PKNX2_HUMAN	K	25;25;25;13	ENSP00000298282:Q25K	ENSP00000298282:Q25K	Q	+	1	0	PKNOX2	124726484	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.937000	0.75898	2.622000	0.88805	0.651000	0.88453	CAG	-	NULL		0.652	PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKNOX2	protein_coding	OTTHUMT00000386866.3	C		-		125221274	+1	no_errors	ENST00000298282	ensembl	human	known	74_37	missense	SNP	1.000	A
MYO5B	4645	genome.wustl.edu	37	18	47455929	47455929	+	Silent	SNP	G	G	A	rs2969930	byFrequency	TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr18:47455929G>A	ENST00000285039.7	-	17	2342	c.2043C>T	c.(2041-2043)tgC>tgT	p.C681C		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	681	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		CCAACACCCCGCAGGCTCTGA	0.527													G|||	2	0.000399361	0.0	0.0	5008	,	,		14977	0.0		0.001	False		,,,				2504	0.001																0								ENSG00000167306	G		0,3850		0,0,1925	29.0	30.0	29.0		2043	-10.2	0.1	18	dbSNP_101	29	3,8261		0,3,4129	no	coding-synonymous	MYO5B	NM_001080467.2		0,3,6054	AA,AG,GG		0.0363,0.0,0.0248		681/1849	47455929	3,12111	1925	4132	6057	MYO5B	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.2043C>T	18.37:g.47455929G>A		Somatic	0	49	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	82	18.81	B0I1R3|Q0P656|Q9H6Y6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.C681	ENST00000285039.7	37	c.2043	CCDS42436.1	18																																																																																			-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.527	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	protein_coding	OTTHUMT00000448515.2	G		rs2969930		47455929	-1	no_errors	ENST00000285039	ensembl	human	known	74_37	silent	SNP	0.110	A
SKIDA1	387640	genome.wustl.edu	37	10	21805466	21805467	+	In_Frame_Ins	INS	-	-	CCTCCT	rs112207161	byFrequency	TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr10:21805466_21805467insCCTCCT	ENST00000449193.2	-	4	3537_3538	c.1285_1286insAGGAGG	c.(1285-1287)ggg>gAGGAGGgg	p.428_429insEE	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_In_Frame_Ins_p.349_350insEE	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	347						nucleus (GO:0005634)		p.E428_G429insEE(2)									CCCGCTGCccccctcctcctcc	0.619														2708	0.540735	0.916	0.4063	5008	,	,		10303	0.3244		0.5408	False		,,,				2504	0.3517																2	Insertion - In frame(2)	soft_tissue(2)						ENSG00000180592			3173,56,18,597		1435,46,11,246,5,0,0,3,1,175						3.0	1.0		dbSNP_132	7	4189,51,27,3619		1322,36,14,1495,1,0,13,2,9,1051	no	codingComplex	C10orf140	NM_207371.3		2757,82,25,1741,6,0,13,5,10,1226	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		46.8805,17.4558,37.2379				7362,107,45,4216				SKIDA1	SO:0001652	inframe_insertion	0				HGNC	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1280_1285dupAGGAGG	10.37:g.21805467_21805472dupCCTCCT	ENSP00000410041:p.Glu427_Glu428dup	Somatic	NA	NA	NA		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B1ANA5|Q6ZMX4|Q8N3C3	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.429in_frame_insEE	ENST00000449193.2	37	c.1286_1285	CCDS44363.1	10																																																																																			-	NULL		0.619	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIDA1	protein_coding	OTTHUMT00000286950.2	-	NM_207371			21805467	-1	no_errors	ENST00000449193	ensembl	human	known	74_37	in_frame_ins	INS	0.998:1.000	CCTCCT
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578	ENSG00000141510						50.0	50.0	50.0					17																	7578406		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His	Somatic	0	63	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	19	26.92	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	rs28934578		7578406	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	T
CDHR1	92211	genome.wustl.edu	37	10	85978986	85978986	+	IGR	SNP	T	T	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr10:85978986T>A	ENST00000372117.3	+	0	5428				CDHR1_ENST00000332904.3_Missense_Mutation_p.V731E	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1						cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						CTGAGTAATGTGAATCTGTAC	0.413																																																	0								ENSG00000148600																																			CDHR1	SO:0001628	intergenic_variant	0			-	HGNC	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634		10.37:g.85978986T>A		Somatic	0	67	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	75	22.68	Q69YZ8|Q8IXY5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V731E	ENST00000372117.3	37	c.2192	CCDS7372.1	10	.	.	.	.	.	.	.	.	.	.	T	8.407	0.843195	0.16963	.	.	ENSG00000148600	ENST00000332904	T	0.57907	0.37	2.61	-1.7	0.08159	.	.	.	.	.	T	0.35711	0.0941	.	.	.	0.09310	N	1	B	0.12630	0.006	B	0.20955	0.032	T	0.25882	-1.0119	8	0.41790	T	0.15	.	6.0946	0.20013	0.0:0.4829:0.0:0.5171	.	731	Q96JP9-2	.	E	731	ENSP00000331063:V731E	ENSP00000331063:V731E	V	+	2	0	CDHR1	85968966	0.000000	0.05858	0.001000	0.08648	0.039000	0.13416	-1.434000	0.02425	-0.354000	0.08212	0.533000	0.62120	GTG	-	NULL		0.413	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR1	protein_coding	OTTHUMT00000049111.1	T	NM_033100	-		85978986	+1	no_errors	ENST00000332904	ensembl	human	known	74_37	missense	SNP	0.001	A
ARHGEF11	9826	genome.wustl.edu	37	1	156909248	156909248	+	Intron	SNP	G	G	A	rs368977976|rs112685506	byFrequency	TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:156909248G>A	ENST00000361409.2	-	36	4719				ARHGEF11_ENST00000315174.8_Intron|ARHGEF11_ENST00000368194.3_Intron|ARHGEF11_ENST00000487682.1_5'UTR	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11						actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CGGTACCCAGGGGGAGTATAG	0.517																																																	0								ENSG00000132694																																			ARHGEF11	SO:0001627	intron_variant	0			-	HGNC	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.3976+91C>T	1.37:g.156909248G>A		Somatic	0	28	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	29	27.50	D3DVD0|Q5VY40|Q6PFW2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361409.2	37	NULL	CCDS1162.1	1																																																																																			-	-		0.517	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF11	protein_coding	OTTHUMT00000098931.1	G	NM_198236	-		156909248	-1	no_errors	ENST00000487682	ensembl	human	known	74_37	rna	SNP	0.000	A
TICAM1	148022	genome.wustl.edu	37	19	4816340	4816340	+	Missense_Mutation	SNP	C	C	T	rs376421303		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr19:4816340C>T	ENST00000248244.5	-	2	2279	c.2050G>A	c.(2050-2052)Gca>Aca	p.A684T		NM_182919.3	NP_891549.1	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	684	Sufficient to induce apoptosis.				apoptotic signaling pathway (GO:0097190)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of protein homodimerization activity (GO:0043496)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|ripoptosome (GO:0097342)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		ACCATCTGTGCGTGGTGGATA	0.632																																																	0								ENSG00000127666	C	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	82.0	76.0	78.0		2050	4.7	0.6	19		78	0,8600		0,0,4300	no	missense	TICAM1	NM_182919.2	58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	684/713	4816340	1,13005	2203	4300	6503	TICAM1	SO:0001583	missense	0			-	HGNC	AB086380	CCDS12136.1	19p13.3	2014-09-17				ENSG00000127666			18348	protein-coding gene	gene with protein product		607601				12539043, 12471095	Standard	NM_182919		Approved	TRIF, TICAM-1, MGC35334, PRVTIRB	uc002mbi.4	Q8IUC6		ENST00000248244.5:c.2050G>A	19.37:g.4816340C>T	ENSP00000248244:p.Ala684Thr	Somatic	0	64	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	58	14.71	B3Y691|O75532|Q86XP8|Q96GA0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_TIR_dom,pirsf_TICAM1	p.A684T	ENST00000248244.5	37	c.2050	CCDS12136.1	19	.	.	.	.	.	.	.	.	.	.	C	19.15	3.771422	0.69992	2.27E-4	0.0	ENSG00000127666	ENST00000248244	T	0.54479	0.57	4.68	4.68	0.58851	.	0.000000	0.34906	U	0.003584	T	0.62270	0.2414	L	0.32530	0.975	0.31593	N	0.6537	D	0.89917	1.0	D	0.97110	1.0	T	0.68228	-0.5464	10	0.87932	D	0	-22.2173	14.6713	0.68945	0.0:1.0:0.0:0.0	.	684	Q8IUC6	TCAM1_HUMAN	T	684	ENSP00000248244:A684T	ENSP00000248244:A684T	A	-	1	0	TICAM1	4767340	0.989000	0.36119	0.629000	0.29254	0.403000	0.30841	4.195000	0.58400	2.293000	0.77203	0.561000	0.74099	GCA	-	pirsf_TICAM1		0.632	TICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TICAM1	protein_coding	OTTHUMT00000450435.1	C	NM_014261	-		4816340	-1	no_errors	ENST00000248244	ensembl	human	known	74_37	missense	SNP	0.704	T
EHBP1	23301	genome.wustl.edu	37	2	63220800	63220800	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr2:63220800C>G	ENST00000263991.5	+	19	3564	c.3082C>G	c.(3082-3084)Cca>Gca	p.P1028A	EHBP1_ENST00000354487.3_Missense_Mutation_p.P993A|EHBP1_ENST00000496857.1_3'UTR|EHBP1_ENST00000405015.3_Missense_Mutation_p.P957A|EHBP1_ENST00000431489.1_Missense_Mutation_p.P957A|EHBP1_ENST00000405289.1_Missense_Mutation_p.P993A	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	1028						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			TGAGAATAGACCAGGTAGAAC	0.264																																																	0								ENSG00000115504						51.0	50.0	50.0					2																	63220800		2203	4298	6501	EHBP1	SO:0001583	missense	0			-	HGNC	AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.3082C>G	2.37:g.63220800C>G	ENSP00000263991:p.Pro1028Ala	Somatic	0	14	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	35	28.57	O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.P1028A	ENST00000263991.5	37	c.3082	CCDS1872.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.52|15.52	2.857258|2.857258	0.51376|0.51376	.|.	.|.	ENSG00000115504|ENSG00000115504	ENST00000405015;ENST00000431489;ENST00000263991;ENST00000354487;ENST00000405289|ENST00000422032	T;T;T;T;T|.	0.75050|.	-0.81;-0.81;-0.88;-0.9;-0.9|.	5.92|5.92	5.92|5.92	0.95590|0.95590	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.70474|0.70474	0.3228|0.3228	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.997;0.997|.	T|T	0.64437|0.64437	-0.6408|-0.6408	10|5	0.07990|.	T|.	0.79|.	.|.	20.3172|20.3172	0.98658|0.98658	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	993;957;1028|.	Q8NDI1-2;Q8NDI1-3;Q8NDI1|.	.;.;EHBP1_HUMAN|.	A|S	957;957;1028;993;993|187	ENSP00000384143:P957A;ENSP00000403783:P957A;ENSP00000263991:P1028A;ENSP00000346482:P993A;ENSP00000385524:P993A|.	ENSP00000263991:P1028A|.	P|T	+|+	1|2	0|0	EHBP1|EHBP1	63074304|63074304	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	7.709000|7.709000	0.84645|0.84645	2.801000|2.801000	0.96364|0.96364	0.650000|0.650000	0.86243|0.86243	CCA|ACC	-	NULL		0.264	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1	protein_coding	OTTHUMT00000251616.1	C	NM_015252	-		63220800	+1	no_errors	ENST00000263991	ensembl	human	known	74_37	missense	SNP	1.000	G
WDR73	84942	genome.wustl.edu	37	15	85186877	85186894	+	In_Frame_Del	DEL	CTTGGCTCCGTGTTCCAT	CTTGGCTCCGTGTTCCAT	-	rs370347033|rs373448317|rs11267906|rs372798651|rs199676984	byFrequency	TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	CTTGGCTCCGTGTTCCAT	CTTGGCTCCGTGTTCCAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr15:85186877_85186894delCTTGGCTCCGTGTTCCAT	ENST00000434634.2	-	8	1004_1021	c.944_961delATGGAACACGGAGCCAAG	c.(943-963)gatggaacacggagccaagta>gta	p.DGTRSQ315del	SCAND2P_ENST00000348993.5_RNA|WDR73_ENST00000398528.3_5'UTR	NM_032856.2	NP_116245.2	Q6P4I2	WDR73_HUMAN	WD repeat domain 73	315										cervix(1)|large_intestine(1)|lung(1)	3						AGAGGTTCTACTTGGCTCCGTGTTCCATCTTGGCTCCG	0.509														794	0.158546	0.1399	0.1383	5008	,	,		21272	0.0843		0.2038	False		,,,				2504	0.228																0								ENSG00000177082			344,3500		48,248,1626						-0.4	0.0		dbSNP_120	111	1220,6750		177,866,2942	no	coding	WDR73	NM_032856.2		225,1114,4568	A1A1,A1R,RR		15.3074,8.949,13.2385				1564,10250				WDR73	SO:0001651	inframe_deletion	0				HGNC	AK027200	CCDS45339.1	15q25.2	2013-01-09				ENSG00000177082		"""WD repeat domain containing"""	25928	protein-coding gene	gene with protein product						12477932	Standard	NM_032856		Approved	FLJ14888, HSPC264	uc002bkw.2	Q6P4I2		ENST00000434634.2:c.944_961delATGGAACACGGAGCCAAG	15.37:g.85186877_85186894delCTTGGCTCCGTGTTCCAT	ENSP00000387982:p.Asp315_Gln320del	Somatic	NA	NA	NA		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q96JZ1|Q9P0B7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.DGTRSQ315in_frame_del	ENST00000434634.2	37	c.961_944	CCDS45339.1	15																																																																																			-	superfamily_WD40_repeat_dom		0.509	WDR73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR73	protein_coding	OTTHUMT00000418195.1	CTTGGCTCCGTGTTCCAT	NM_032856			85186894	-1	no_errors	ENST00000434634	ensembl	human	known	74_37	in_frame_del	DEL	0.001:0.001:0.001:0.001:0.001:0.001:0.002:0.005:0.007:0.007:0.010:0.012:0.012:0.011:0.010:0.009:0.007:0.005	-
RASSF6	166824	genome.wustl.edu	37	4	74481640	74481640	+	Intron	SNP	A	A	G			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr4:74481640A>G	ENST00000342081.3	-	2	193				RASSF6_ENST00000512591.1_Intron|RASSF6_ENST00000395777.2_Intron|RASSF6_ENST00000335049.5_Missense_Mutation_p.S26P|RASSF6_ENST00000307439.5_Intron	NM_201431.2	NP_958834.1	Q6ZTQ3	RASF6_HUMAN	Ras association (RalGDS/AF-6) domain family member 6						apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)					breast(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|pancreas(2)|skin(2)	17	Breast(15;0.00102)		all cancers(17;0.00104)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			AGGCCAGAGGACAGGAAGTGA	0.438																																																	0								ENSG00000169435																																			RASSF6	SO:0001627	intron_variant	0			-	HGNC	AY217664	CCDS3558.1, CCDS3559.1, CCDS58904.1, CCDS58905.1	4q21.1	2008-02-22	2008-02-22		ENSG00000169435	ENSG00000169435			20796	protein-coding gene	gene with protein product		612620					Standard	NM_177532		Approved		uc003hhd.2	Q6ZTQ3	OTTHUMG00000130007	ENST00000342081.3:c.63-4094T>C	4.37:g.74481640A>G		Somatic	0	36	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	78	27.10	Q68DT2|Q6PDA6|Q86WG9|Q86WH0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SARAH_dom	p.S26P	ENST00000342081.3	37	c.76	CCDS3558.1	4	.	.	.	.	.	.	.	.	.	.	A	8.796	0.931852	0.18131	.	.	ENSG00000169435	ENST00000335049	T	0.23754	1.89	2.24	0.985	0.19779	.	.	.	.	.	T	0.22936	0.0554	.	.	.	0.09310	N	1	P	0.38148	0.62	B	0.42062	0.374	T	0.18903	-1.0322	8	0.72032	D	0.01	.	5.1895	0.15203	0.6937:0.3063:0.0:0.0	.	26	Q6ZTQ3-3	.	P	26	ENSP00000335582:S26P	ENSP00000335582:S26P	S	-	1	0	RASSF6	74700504	0.000000	0.05858	0.001000	0.08648	0.360000	0.29518	0.233000	0.17911	0.289000	0.22422	-0.666000	0.03841	TCC	-	NULL		0.438	RASSF6-002	KNOWN	basic|CCDS	protein_coding	RASSF6	protein_coding	OTTHUMT00000252279.1	A	NM_177532	-		74481640	-1	no_errors	ENST00000335049	ensembl	human	known	74_37	missense	SNP	0.001	G
S100A7	6278	genome.wustl.edu	37	1	153430303	153430303	+	Silent	SNP	G	G	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:153430303G>A	ENST00000368723.3	-	3	395	c.285C>T	c.(283-285)ccC>ccT	p.P95P	S100A7_ENST00000368722.1_Silent_p.P95P	NM_002963.3	NP_002954.2	P31151	S10A7_HUMAN	S100 calcium binding protein A7	95					angiogenesis (GO:0001525)|defense response to Gram-negative bacterium (GO:0050829)|epidermis development (GO:0008544)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of granulocyte chemotaxis (GO:0071624)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of T cell chemotaxis (GO:0010820)|response to lipopolysaccharide (GO:0032496)|response to reactive oxygen species (GO:0000302)|sequestering of metal ion (GO:0051238)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|RAGE receptor binding (GO:0050786)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(2)|lung(5)|skin(2)	10	all_lung(78;2.4e-33)|Lung NSC(65;8.13e-32)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCCCGGAACAGGGCGCTGCTC	0.517																																																	0								ENSG00000143556						65.0	64.0	64.0					1																	153430303		2203	4300	6503	S100A7	SO:0001819	synonymous_variant	0			-	HGNC	BC034687	CCDS1039.1	1q21	2013-01-10	2006-09-11		ENSG00000143556	ENSG00000143556		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10497	protein-coding gene	gene with protein product		600353	"""S100 calcium-binding protein A7 (psoriasin 1)"", ""S100 calcium binding protein A7 (psoriasin 1)"""	PSOR1		1940442	Standard	NM_002963		Approved	S100A7c	uc001fbv.1	P31151	OTTHUMG00000013123	ENST00000368723.3:c.285C>T	1.37:g.153430303G>A		Somatic	0	43	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	49	10.71	Q5SY67|Q6FGE3|Q9H1E2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.P95	ENST00000368723.3	37	c.285	CCDS1039.1	1																																																																																			-	NULL		0.517	S100A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A7	protein_coding	OTTHUMT00000036789.1	G	NM_002963	-		153430303	-1	no_errors	ENST00000368722	ensembl	human	known	74_37	silent	SNP	0.000	A
ZC3H3	23144	genome.wustl.edu	37	8	144621417	144621417	+	Silent	SNP	C	C	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr8:144621417C>T	ENST00000262577.5	-	2	151	c.120G>A	c.(118-120)caG>caA	p.Q40Q	RP11-661A12.5_ENST00000530600.1_RNA|7SK_ENST00000517300.1_RNA	NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	40					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			AAGTGGGTGGCTGCCACCCAG	0.602																																																	0								ENSG00000014164						40.0	39.0	39.0					8																	144621417		2202	4292	6494	ZC3H3	SO:0001819	synonymous_variant	0			-	HGNC	D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.120G>A	8.37:g.144621417C>T		Somatic	0	80	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	45	28.57	Q14163|Q8N4E2|Q9BUS4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_CCCH,smart_Znf_CCCH	p.Q40	ENST00000262577.5	37	c.120	CCDS6402.1	8																																																																																			-	NULL		0.602	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H3	protein_coding	OTTHUMT00000382011.2	C	NM_015117	-		144621417	-1	no_errors	ENST00000262577	ensembl	human	known	74_37	silent	SNP	0.994	T
PPP1R16A	84988	genome.wustl.edu	37	8	145725733	145725733	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr8:145725733G>A	ENST00000292539.4	+	6	1581	c.664G>A	c.(664-666)Ggg>Agg	p.G222R	CTD-2517M22.14_ENST00000532766.1_RNA|CTD-2517M14.5_ENST00000569326.1_RNA|PPP1R16A_ENST00000435887.1_Missense_Mutation_p.G222R|GPT_ENST00000528431.1_5'Flank			Q96I34	PP16A_HUMAN	protein phosphatase 1, regulatory subunit 16A	222						plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GCTGCAGGCCGGGGCAGACCT	0.736																																																	0								ENSG00000160972						4.0	7.0	6.0					8																	145725733		1850	3712	5562	PPP1R16A	SO:0001583	missense	0			-	HGNC		CCDS6429.1	8q24.3	2013-01-10	2011-10-04		ENSG00000160972	ENSG00000160972		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14941	protein-coding gene	gene with protein product		609172	"""protein phosphatase 1, regulatory (inhibitor) subunit 16A"""			11948623	Standard	NM_032902		Approved	MGC14333, MYPT3	uc003zdf.3	Q96I34	OTTHUMG00000165173	ENST00000292539.4:c.664G>A	8.37:g.145725733G>A	ENSP00000292539:p.Gly222Arg	Somatic	0	25	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	13	33.33	D3DWM5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Ankyrin_rpt,pirsf_Pase-1_reg_su_16AB_euk,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.G222R	ENST00000292539.4	37	c.664	CCDS6429.1	8	.	.	.	.	.	.	.	.	.	.	g	18.07	3.542532	0.65198	.	.	ENSG00000160972	ENST00000292539;ENST00000435887	T;T	0.62364	0.03;0.03	5.44	4.55	0.56014	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.75989	0.3925	M	0.72353	2.195	0.80722	D	1	D	0.76494	0.999	D	0.67900	0.954	T	0.78725	-0.2092	10	0.72032	D	0.01	.	13.1958	0.59738	0.0:0.0:0.8391:0.1609	.	222	Q96I34	PP16A_HUMAN	R	222	ENSP00000292539:G222R;ENSP00000391126:G222R	ENSP00000292539:G222R	G	+	1	0	PPP1R16A	145696541	1.000000	0.71417	0.768000	0.31515	0.040000	0.13550	2.698000	0.47068	1.269000	0.44280	0.556000	0.70494	GGG	-	superfamily_Ankyrin_rpt-contain_dom,pirsf_Pase-1_reg_su_16AB_euk,pfscan_Ankyrin_rpt-contain_dom		0.736	PPP1R16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R16A	protein_coding	OTTHUMT00000382459.1	G	NM_032902	-		145725733	+1	no_errors	ENST00000292539	ensembl	human	known	74_37	missense	SNP	0.998	A
ZNF407	55628	genome.wustl.edu	37	18	72776361	72776361	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr18:72776361G>T	ENST00000299687.5	+	8	6684	c.6684G>T	c.(6682-6684)gaG>gaT	p.E2228D		NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	2228					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		ACACCCAGGAGGGCTCCTCGG	0.657																																																	0								ENSG00000215421						5.0	7.0	6.0					18																	72776361		2002	4126	6128	ZNF407	SO:0001583	missense	0			-	HGNC	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.6684G>T	18.37:g.72776361G>T	ENSP00000299687:p.Glu2228Asp	Somatic	0	187	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	72	12.20	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_U1,pfscan_Znf_C2H2	p.E2228D	ENST00000299687.5	37	c.6684	CCDS45885.1	18	.	.	.	.	.	.	.	.	.	.	G	7.862	0.726288	0.15439	.	.	ENSG00000215421	ENST00000299687	T	0.08370	3.1	4.78	-8.53	0.00916	.	.	.	.	.	T	0.02230	0.0069	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.56583	-0.7955	9	0.05351	T	0.99	.	5.0388	0.14449	0.0753:0.3381:0.1058:0.4807	.	2228	Q9C0G0	ZN407_HUMAN	D	2228	ENSP00000299687:E2228D	ENSP00000299687:E2228D	E	+	3	2	ZNF407	70905349	0.019000	0.18553	0.209000	0.23619	0.785000	0.44390	-1.636000	0.02016	0.963000	0.38082	0.462000	0.41574	GAG	-	NULL		0.657	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	protein_coding	OTTHUMT00000444903.1	G	NM_017757	-		72776361	+1	no_errors	ENST00000299687	ensembl	human	known	74_37	missense	SNP	0.956	T
KIF1B	23095	genome.wustl.edu	37	1	10423402	10423402	+	Splice_Site	SNP	G	G	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:10423402G>A	ENST00000377086.1	+	41	4568	c.4366G>A	c.(4366-4368)Ggt>Agt	p.G1456S	KIF1B_ENST00000377081.1_Splice_Site_p.G1456S|KIF1B_ENST00000263934.6_Splice_Site_p.G1410S			O60333	KIF1B_HUMAN	kinesin family member 1B	1456					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		AGGTAGTCCAGGTAAGCTCTT	0.403																																																	0								ENSG00000054523						180.0	174.0	176.0					1																	10423402		2203	4300	6503	KIF1B	SO:0001630	splice_region_variant	0			-	HGNC	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.4366+1G>A	1.37:g.10423402G>A		Somatic	0	61	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	82	17.17	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G1410S	ENST00000377086.1	37	c.4228		1	.	.	.	.	.	.	.	.	.	.	G	36	5.728432	0.96856	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.74209	-0.75;-0.82;-0.82	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.85826	0.5787	M	0.64404	1.975	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;0.994;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.977;0.965;0.938;0.999;0.952;0.994	D	0.84920	0.0853	10	0.59425	D	0.04	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	1442;1416;1456;1430;1456;1410	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	S	1456;1410;1456;1456	ENSP00000263934:G1410S;ENSP00000366290:G1456S;ENSP00000366284:G1456S	ENSP00000263934:G1410S	G	+	1	0	KIF1B	10345989	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.386000	0.97228	2.882000	0.98803	0.655000	0.94253	GGT	-	NULL		0.403	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	protein_coding	OTTHUMT00000005102.1	G		-	Missense_Mutation	10423402	+1	no_errors	ENST00000263934	ensembl	human	known	74_37	missense	SNP	1.000	A
OR5H6	79295	genome.wustl.edu	37	3	97983488	97983496	+	In_Frame_Del	DEL	TGTAACCAC	TGTAACCAC	-	rs145155372|rs149984587|rs369030566|rs398062605|rs74203917|rs372483864	byFrequency	TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	TGTAACCAC	TGTAACCAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr3:97983488_97983496delTGTAACCAC	ENST00000383696.2	+	1	401_409	c.360_368delTGTAACCAC	c.(358-369)cttgtaaccact>ctt	p.VTT124del	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005479.1	NP_001005479.1	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H, member 6 (gene/pseudogene)	124						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(2)|endometrium(1)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						TTTTTTCCCTTGTAACCACTGTAACCACA	0.383														1588	0.317093	0.2141	0.3372	5008	,	,		24385	0.1319		0.5616	False		,,,				2504	0.3814																0								ENSG00000230301			1036,3228		131,774,1227						2.2	0.0		dbSNP_134	100	4355,3849		1213,1929,960	no	coding	OR5H6	NM_001005479.1		1344,2703,2187	A1A1,A1R,RR		46.9161,24.2964,43.2387				5391,7077				OR5H6	SO:0001651	inframe_deletion	0				HGNC	BK004374	CCDS33800.1	3q12.1	2013-10-10	2013-10-10		ENSG00000230301	ENSG00000230301		"""GPCR / Class A : Olfactory receptors"""	14767	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily H, member 6"""				Standard	NM_001005479		Approved		uc003dsi.1	Q8NGV6	OTTHUMG00000160078	ENST00000383696.2:c.360_368delTGTAACCAC	3.37:g.97983497_97983505delTGTAACCAC	ENSP00000373196:p.Val124_Thr126del	Somatic	NA	NA	NA		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6IF88	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.VTT124in_frame_del	ENST00000383696.2	37	c.360_368	CCDS33800.1	3																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.383	OR5H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H6	protein_coding	OTTHUMT00000359111.2	TGTAACCAC				97983496	+1	no_errors	ENST00000383696	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-
REG1P	5969	genome.wustl.edu	37	2	79364441	79364441	+	RNA	SNP	T	T	C			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr2:79364441T>C	ENST00000444841.1	-	0	193									regenerating islet-derived 1 pseudogene																		GATCTGGGCCTTGGGCAACTC	0.507																																																	0								ENSG00000204787																																			REG1P			0			-	HGNC			2p12	2008-06-04	2008-06-04	2008-06-04	ENSG00000204787	ENSG00000204787			9953	pseudogene	pseudogene			"""rat regenerating islet-derived-like, human homolog (pancreatic stone protein-like, pancreatic thread protein-like)"", ""regenerating islet-derived-like, pancreatic stone protein-like, pancreatic thread protein-like (rat)"""	REGL		8333731	Standard	NR_002714		Approved	RS	uc002soc.1		OTTHUMG00000152978		2.37:g.79364441T>C		Somatic	0	35	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	57	24.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000444841.1	37	NULL		2																																																																																			-	-		0.507	REG1P-002	KNOWN	basic	processed_transcript	REG1P	pseudogene	OTTHUMT00000328851.1	T	NR_002714	-		79364441	-1	no_errors	ENST00000377435	ensembl	human	known	74_37	rna	SNP	0.000	C
C9orf78	51759	genome.wustl.edu	37	9	132597501	132597501	+	5'UTR	SNP	G	G	C	rs199979480		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr9:132597501G>C	ENST00000372447.3	-	0	53				USP20_ENST00000372429.3_5'Flank|C9orf78_ENST00000461762.1_5'Flank|USP20_ENST00000358355.1_5'Flank|USP20_ENST00000315480.4_5'Flank	NM_016520.2	NP_057604.1	Q9NZ63	CI078_HUMAN	chromosome 9 open reading frame 78							cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)	13		Ovarian(14;0.00556)				CGACCGGCATGGTGACAACGG	0.701																																																	0								ENSG00000136819																																			C9orf78	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BC017570	CCDS6931.1	9q34.2	2012-03-16			ENSG00000136819	ENSG00000136819			24932	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 59"""					11042152, 12097419	Standard	NM_016520		Approved	HSPC220, HCA59	uc004byp.3	Q9NZ63	OTTHUMG00000020796	ENST00000372447.3:c.-1C>G	9.37:g.132597501G>C		Somatic	0	83	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	23	35.14	B3KPX8|Q8WVU6|Q9NT39	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372447.3	37	NULL	CCDS6931.1	9																																																																																			-	-		0.701	C9orf78-007	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf78	protein_coding	OTTHUMT00000054625.1	G	NM_016520	-		132597501	-1	no_errors	ENST00000461349	ensembl	human	known	74_37	rna	SNP	0.001	C
CCDC127	133957	genome.wustl.edu	37	5	216901	216901	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr5:216901C>T	ENST00000296824.3	-	2	196	c.64G>A	c.(64-66)Gat>Aat	p.D22N	CTD-2083E4.4_ENST00000565521.1_RNA|SDHA_ENST00000264932.6_5'Flank|SDHA_ENST00000510361.1_5'Flank|SDHA_ENST00000504309.1_5'Flank	NM_145265.2	NP_660308.1	Q96BQ5	CC127_HUMAN	coiled-coil domain containing 127	22										breast(1)|endometrium(4)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12			all cancers(22;0.0236)|Lung(60;0.113)			CTGCTTCCATCACCACCATCC	0.423																																																	0								ENSG00000164366						27.0	24.0	25.0					5																	216901		2200	4274	6474	CCDC127	SO:0001583	missense	0			-	HGNC	AK098567	CCDS3852.1	5p15.33	2008-02-05			ENSG00000164366	ENSG00000164366			30520	protein-coding gene	gene with protein product						12477932	Standard	NM_145265		Approved	FLJ25701	uc003jam.1	Q96BQ5	OTTHUMG00000161586	ENST00000296824.3:c.64G>A	5.37:g.216901C>T	ENSP00000296824:p.Asp22Asn	Somatic	0	107	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	82	18.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D22N	ENST00000296824.3	37	c.64	CCDS3852.1	5	.	.	.	.	.	.	.	.	.	.	C	19.99	3.928533	0.73327	.	.	ENSG00000164366	ENST00000296824;ENST00000441693	T;T	0.47869	0.83;0.83	5.48	5.48	0.80851	.	0.092974	0.64402	D	0.000001	T	0.61311	0.2337	L	0.44542	1.39	0.58432	D	0.999997	D	0.76494	0.999	D	0.68943	0.961	T	0.60120	-0.7325	10	0.52906	T	0.07	-41.1068	17.2004	0.86904	0.0:1.0:0.0:0.0	.	22	Q96BQ5	CC127_HUMAN	N	22	ENSP00000296824:D22N;ENSP00000411206:D22N	ENSP00000296824:D22N	D	-	1	0	CCDC127	269901	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.110000	0.57831	2.736000	0.93811	0.650000	0.86243	GAT	-	NULL		0.423	CCDC127-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC127	protein_coding	OTTHUMT00000365459.2	C	NM_145265	-		216901	-1	no_errors	ENST00000296824	ensembl	human	known	74_37	missense	SNP	1.000	T
AC026700.1	0	genome.wustl.edu	37	5	84823865	84823870	+	RNA	DEL	TGTGTG	TGTGTG	-	rs3101111|rs201146846|rs145369997		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	TGTGTG	TGTGTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr5:84823865_84823870delTGTGTG	ENST00000401134.1	-	0	82_87																											TATAtgtatatgtgtgtgtgtgtgtg	0.345																																																	0								ENSG00000215953																																			AC026700.1			0				Clone_based_ensembl_gene																													5.37:g.84823871_84823876delTGTGTG		Somatic	NA	NA	NA		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401134.1	37	NULL		5																																																																																			-	-		0.345	AC026700.1-201	NOVEL	basic	miRNA	ENSG00000215953	miRNA		TGTGTG				84823870	-1	no_errors	ENST00000401134	ensembl	human	novel	74_37	rna	DEL	0.004:0.002:0.002:0.001:0.001:0.001	-
STXBP3	6814	genome.wustl.edu	37	1	109322344	109322345	+	Intron	INS	-	-	ATATTT	rs66596961|rs10637771|rs200042192|rs142753375		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:109322344_109322345insATATTT	ENST00000370008.3	+	9	859				STXBP3_ENST00000485167.1_3'UTR	NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3						blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		GGCTCACTATCATTGAAGGAGA	0.322														5007	0.9998	0.9992	1.0	5008	,	,		17316	1.0		1.0	False		,,,				2504	1.0																0								ENSG00000116266																																			STXBP3	SO:0001627	intron_variant	0				HGNC	D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.809+312->ATATTT	1.37:g.109322344_109322345insATATTT		Somatic	NA	NA	NA		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370008.3	37	NULL	CCDS790.1	1																																																																																			-	-		0.322	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP3	protein_coding	OTTHUMT00000030591.1	-	NM_007269			109322345	+1	no_errors	ENST00000485167	ensembl	human	known	74_37	rna	INS	0.001:0.000	ATATTT
MAML2	84441	genome.wustl.edu	37	11	95825372	95825374	+	In_Frame_Del	DEL	TGT	TGT	-	rs60727839|rs543548810|rs112603485|rs141671766	byFrequency	TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	TGT	TGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr11:95825372_95825374delTGT	ENST00000524717.1	-	2	3105_3107	c.1821_1823delACA	c.(1819-1824)caacag>cag	p.607_608QQ>Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	607					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q607Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				ctgctgctgctgttgctgctgct	0.532			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																			Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	1	Substitution - coding silent(1)	endometrium(1)						ENSG00000184384																																			MAML2	SO:0001651	inframe_deletion	0				HGNC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1821_1823delACA	11.37:g.95825372_95825374delTGT	ENSP00000434552:p.Gln621del	Somatic	0	33	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	38	11.63	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Neuroggenic_mastermind-like_N	p.Q611in_frame_del	ENST00000524717.1	37	c.1823_1821	CCDS44714.1	11																																																																																			-	NULL		0.532	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML2	protein_coding	OTTHUMT00000395540.1	TGT				95825374	-1	no_errors	ENST00000524717	ensembl	human	known	74_37	in_frame_del	DEL	0.003:0.003:0.003	-
PCDH15	65217	genome.wustl.edu	37	10	55568823	55568823	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr10:55568823T>C	ENST00000395445.1	-	36	5381	c.4987A>G	c.(4987-4989)Aga>Gga	p.R1663G	PCDH15_ENST00000395446.1_Missense_Mutation_p.R859G|PCDH15_ENST00000395442.1_Missense_Mutation_p.R528G|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395438.1_3'UTR|PCDH15_ENST00000409834.1_3'UTR|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000395440.1_Missense_Mutation_p.R597G	NM_001142769.1	NP_001136241.1	Q96QU1	PCD15_HUMAN	protocadherin-related 15	0					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GGCCTTCTTCTTGCAAGCACA	0.468										HNSCC(58;0.16)																																							0								ENSG00000150275						100.0	76.0	84.0					10																	55568823		1568	3582	5150	PCDH15	SO:0001583	missense	0			-	HGNC	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000395445.1:c.4987A>G	10.37:g.55568823T>C	ENSP00000378832:p.Arg1663Gly	Somatic	0	10	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	23	17.24	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R1663G	ENST00000395445.1	37	c.4987		10	.	.	.	.	.	.	.	.	.	.	T	10.65	1.409924	0.25465	.	.	ENSG00000150275	ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440	T;D;D;D	0.97161	2.1;-4.27;-4.27;-4.27	5.55	2.99	0.34606	.	.	.	.	.	D	0.92427	0.7596	N	0.14661	0.345	0.58432	D	0.999992	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.003	D	0.88369	0.2993	9	0.72032	D	0.01	.	13.2557	0.60076	0.0:0.0:0.2616:0.7384	.	1661;1663	C6ZEF5;A2A3E2	.;.	G	1663;859;528;597	ENSP00000378832:R1663G;ENSP00000378833:R859G;ENSP00000378829:R528G;ENSP00000378827:R597G	ENSP00000378827:R597G	R	-	1	2	PCDH15	55238829	0.625000	0.27111	0.816000	0.32577	0.226000	0.24999	1.122000	0.31295	0.905000	0.36596	0.533000	0.62120	AGA	-	NULL		0.468	PCDH15-007	NOVEL	not_organism_supported|basic	protein_coding	PCDH15	protein_coding	OTTHUMT00000291335.1	T	NM_033056	-		55568823	-1	no_errors	ENST00000395445	ensembl	human	novel	74_37	missense	SNP	0.701	C
BCAT1	586	genome.wustl.edu	37	12	25055837	25055837	+	Intron	SNP	G	G	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr12:25055837G>T	ENST00000261192.7	-	2	533				BCAT1_ENST00000539282.1_Intron|AC026310.1_ENST00000599478.1_Missense_Mutation_p.G105V|BCAT1_ENST00000342945.5_Intron|BCAT1_ENST00000539780.1_Intron|BCAT1_ENST00000538118.1_5'Flank|BCAT1_ENST00000544418.1_5'Flank	NM_001178091.1|NM_005504.6	NP_001171562.1|NP_005495.2	P54687	BCAT1_HUMAN	branched chain amino-acid transaminase 1, cytosolic						branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cell proliferation (GO:0008283)|cellular nitrogen compound metabolic process (GO:0034641)|G1/S transition of mitotic cell cycle (GO:0000082)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			breast(1)|large_intestine(1)|lung(3)|prostate(2)	7	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Ovarian(17;0.107)|Colorectal(261;0.196)				Gabapentin(DB00996)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Valine(DB00161)	CGAGACCCGGGTTCCAATCCT	0.716																																																	0								ENSG00000268865																																			AC026310.1	SO:0001627	intron_variant	0			-	Clone_based_ensembl_gene		CCDS44845.1, CCDS53760.1, CCDS53761.1, CCDS53762.1, CCDS53763.1	12p12.1	2012-10-02	2010-05-07		ENSG00000060982	ENSG00000060982	2.6.1.42		976	protein-coding gene	gene with protein product		113520	"""branched chain aminotransferase 1, cytosolic"""	BCT1		9165094	Standard	NM_005504		Approved		uc010six.2	P54687	OTTHUMG00000169053	ENST00000261192.7:c.7-1018C>A	12.37:g.25055837G>T		Somatic	0	57	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	B3KY27|B7Z2M5|B7Z5L0|F5H5E4|Q68DQ7|Q96MY9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G105V	ENST00000261192.7	37	c.314	CCDS44845.1	12																																																																																			-	NULL		0.716	BCAT1-001	KNOWN	upstream_uORF|basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000268865	protein_coding	OTTHUMT00000402080.1	G	NM_005504	-		25055837	+1	no_errors	ENST00000599478	ensembl	human	novel	74_37	missense	SNP	0.001	T
UNKL	64718	genome.wustl.edu	37	16	1444442	1444442	+	Intron	SNP	C	C	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr16:1444442C>A	ENST00000389221.4	-	7	852				UNKL_ENST00000397462.1_Nonsense_Mutation_p.G462*|UNKL_ENST00000508903.2_Intron	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				GGGGCCATTCCCGCAGCATCT	0.582																																																	0								ENSG00000059145																																			UNKL	SO:0001627	intron_variant	0			-	HGNC	BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.853-235G>T	16.37:g.1444442C>A		Somatic	0	65	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	23	25.81	B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_CCCH,smart_Znf_CCCH	p.G462*	ENST00000389221.4	37	c.1384	CCDS53981.1	16	.	.	.	.	.	.	.	.	.	.	C	12.36	1.915013	0.33815	.	.	ENSG00000059145	ENST00000397462	.	.	.	1.76	0.737	0.18314	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	5.2209	0.15368	0.3417:0.6583:0.0:0.0	.	.	.	.	X	462	.	ENSP00000380604:G462X	G	-	1	0	UNKL	1384443	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.490000	0.22403	0.287000	0.22375	-0.399000	0.06403	GGA	-	NULL		0.582	UNKL-201	KNOWN	basic|CCDS	protein_coding	UNKL	protein_coding		C	NM_001037125	-		1444442	-1	no_errors	ENST00000397462	ensembl	human	known	74_37	nonsense	SNP	0.001	A
MATN4	8785	genome.wustl.edu	37	20	43926658	43926658	+	Silent	SNP	G	G	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr20:43926658G>A	ENST00000372754.1	-	8	1610	c.1602C>T	c.(1600-1602)cgC>cgT	p.R534R	MATN4_ENST00000360607.6_Silent_p.R452R|MATN4_ENST00000342716.4_Silent_p.R493R|MATN4_ENST00000372756.1_Silent_p.R493R|MATN4_ENST00000537548.1_Silent_p.R493R|MATN4_ENST00000372751.4_Silent_p.R344R|MATN4_ENST00000353917.5_Silent_p.R411R			O95460	MATN4_HUMAN	matrilin 4	534	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				AGGCGATCTCGCGCAGCTCCG	0.672																																																	0								ENSG00000124159																																			MATN4	SO:0001819	synonymous_variant	0			-	HGNC	AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.1602C>T	20.37:g.43926658G>A		Somatic	0	68	0.00		0.5452504581000118	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	34	23.91	A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_A,pfam_EGF-like_Ca-bd_dom,pfam_Matrilin_coiled-coil_trimer,smart_VWF_A,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_VWF_A	p.R534	ENST00000372754.1	37	c.1602		20																																																																																			-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.672	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	MATN4	protein_coding	OTTHUMT00000080335.1	G		-		43926658	-1	no_errors	ENST00000372754	ensembl	human	known	74_37	silent	SNP	0.003	A
