#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ABCC6P1	653190	genome.wustl.edu	37	16	18586150	18586150	+	RNA	SNP	A	A	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr16:18586150A>T	ENST00000546162.2	+	0	492					NR_003569.1				ATP-binding cassette, sub-family C, member 6 pseudogene 1 (functional)																		AAAATCCAACAGGGAACGCCT	0.562																																																	0								ENSG00000256340																																			ABCC6P1			0			-	HGNC	BC075833		16p12.3	2014-09-11	2014-05-09		ENSG00000256340	ENSG00000256340		"""-"""	33352	pseudogene	pseudogene			"""ATP-binding cassette, sub-family C, member 6 pseudogene 1"""			18405356, 22873774	Standard	NR_003569		Approved		uc002dfg.3		OTTHUMG00000177192		16.37:g.18586150A>T		Somatic	0	41	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	57	41.24		RNA	SNP	20	0.00	0	19	42.42	14	-	NULL	ENST00000546162.2	37	NULL		16																																																																																			-	-		0.562	ABCC6P1-004	KNOWN	basic	processed_transcript	ABCC6P1	pseudogene	OTTHUMT00000435772.2	A	NR_003569	-		18586150	+1	no_errors	ENST00000546162	ensembl	human	known	74_37	rna	SNP	0.000	T
RPL41	6171	genome.wustl.edu	37	12	56511286	56511286	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr12:56511286A>T	ENST00000546591.1	+	3	258	c.56A>T	c.(55-57)aAg>aTg	p.K19M	RPL41_ENST00000552314.1_3'UTR|RPL41_ENST00000501597.3_Missense_Mutation_p.K19M|ZC3H10_ENST00000257940.2_5'Flank|RP11-603J24.6_ENST00000550840.1_RNA|RP11-603J24.5_ENST00000550947.1_RNA	NM_001035267.1	NP_001030344.1	P62945	RL41_HUMAN	ribosomal protein L41	19					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)							OV - Ovarian serous cystadenocarcinoma(18;0.12)			AAAAGAAGAAAGATGAGGCAG	0.493																																																	0								ENSG00000229117						103.0	95.0	98.0					12																	56511286		1844	4038	5882	RPL41	SO:0001583	missense	0			-	HGNC	AB007186	CCDS44919.1	12q13	2011-04-06			ENSG00000229117	ENSG00000229117		"""L ribosomal proteins"""	10354	protein-coding gene	gene with protein product		613315				1326959, 9582194	Standard	NM_021104		Approved	L41	uc001sjo.3	P62945		ENST00000546591.1:c.56A>T	12.37:g.56511286A>T	ENSP00000449026:p.Lys19Met	Somatic	0	51	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	18	72.73	A6NG21|P28751	Missense_Mutation	SNP	29	0.00	0	8	77.14	27	pfam_Ribosomal_L41	p.K19M	ENST00000546591.1	37	c.56	CCDS44919.1	12	.	.	.	.	.	.	.	.	.	.	A	15.55	2.868102	0.51588	.	.	ENSG00000229117	ENST00000546591;ENST00000501597	.	.	.	4.48	4.48	0.54585	.	.	.	.	.	T	0.69878	0.3160	.	.	.	0.32844	D	0.505762	D	0.55800	0.973	D	0.65323	0.934	T	0.78986	-0.1987	7	0.87932	D	0	.	13.2483	0.60036	1.0:0.0:0.0:0.0	.	19	P62945	RL41_HUMAN	M	19	.	ENSP00000420821:K19M	K	+	2	0	RPL41	54797553	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.454000	0.80714	2.045000	0.60652	0.529000	0.55759	AAG	-	pfam_Ribosomal_L41		0.493	RPL41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPL41	protein_coding	OTTHUMT00000407819.1	A		-		56511286	+1	no_errors	ENST00000501597	ensembl	human	known	74_37	missense	SNP	1.000	T
HIST1H3B	8358	genome.wustl.edu	37	6	26032209	26032209	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr6:26032209C>G	ENST00000244661.2	-	1	79	c.80G>C	c.(79-81)cGc>cCc	p.R27P		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	27					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						CGCGCTCTTGCGAGCAGCCTT	0.612																																																	0								ENSG00000124693						67.0	82.0	77.0					6																	26032209		2161	4211	6372	HIST1H3B	SO:0001583	missense	0			-	HGNC	X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.80G>C	6.37:g.26032209C>G	ENSP00000244661:p.Arg27Pro	Somatic	0	14	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	44	16.98	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	20	0.00	0	45	2.17	1	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.R27P	ENST00000244661.2	37	c.80	CCDS4573.1	6	.	.	.	.	.	.	.	.	.	.	c	11.37	1.619938	0.28801	.	.	ENSG00000124693	ENST00000244661	T	0.41400	1.0	5.19	5.19	0.71726	.	.	.	.	.	T	0.56352	0.1979	.	.	.	0.45528	D	0.998481	.	.	.	.	.	.	T	0.61242	-0.7102	6	0.87932	D	0	.	18.0628	0.89382	0.0:1.0:0.0:0.0	.	.	.	.	P	27	ENSP00000244661:R27P	ENSP00000244661:R27P	R	-	2	0	HIST1H3B	26140188	1.000000	0.71417	0.994000	0.49952	0.013000	0.08279	7.633000	0.83260	2.577000	0.86979	0.561000	0.74099	CGC	-	superfamily_Histone-fold,prints_Histone_H3		0.612	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3B	protein_coding	OTTHUMT00000040077.1	C	NM_003537	-		26032209	-1	no_errors	ENST00000244661	ensembl	human	known	74_37	missense	SNP	1.000	G
AHCTF1	25909	genome.wustl.edu	37	1	247051817	247051817	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr1:247051817C>T	ENST00000391829.2	-	18	2270	c.2147G>A	c.(2146-2148)gGg>gAg	p.G716E	AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000326225.3_Missense_Mutation_p.G725E|AHCTF1_ENST00000366508.1_Missense_Mutation_p.G751E			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	716	Necessary for cytoplasmic localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			ATTCCACTTCCCTCTGCAATC	0.363																																					Colon(145;197 1800 4745 15099 26333)												0								ENSG00000153207						60.0	57.0	58.0					1																	247051817		2203	4300	6503	AHCTF1	SO:0001583	missense	0			-	HGNC		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.2147G>A	1.37:g.247051817C>T	ENSP00000375705:p.Gly716Glu	Somatic	0	29	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	26	18.75	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	46	0.00	0	55	11.29	7	superfamily_Quinonprotein_ADH-like_supfam	p.G725E	ENST00000391829.2	37	c.2174		1	.	.	.	.	.	.	.	.	.	.	C	18.17	3.564126	0.65651	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.34859	1.34;1.34;1.34	5.26	4.35	0.52113	.	0.173268	0.50627	N	0.000112	T	0.58793	0.2147	M	0.70595	2.14	0.49582	D	0.999808	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.987	T	0.63734	-0.6570	10	0.72032	D	0.01	-13.3544	14.1506	0.65381	0.0:0.9274:0.0:0.0726	.	751;716	Q8WYP5-2;Q8WYP5	.;ELYS_HUMAN	E	751;725;716	ENSP00000355464:G751E;ENSP00000355465:G725E;ENSP00000375705:G716E	ENSP00000355465:G725E	G	-	2	0	AHCTF1	245118440	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	4.184000	0.58323	1.365000	0.46057	0.305000	0.20034	GGG	-	NULL		0.363	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	protein_coding		C	NM_015446	-		247051817	-1	no_errors	ENST00000326225	ensembl	human	known	74_37	missense	SNP	1.000	T
SLITRK6	84189	genome.wustl.edu	37	13	86369914	86369914	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr13:86369914C>T	ENST00000400286.2	-	2	1328	c.730G>A	c.(730-732)Gat>Aat	p.D244N		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	244	LRRCT 1.				adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		CAGACAACATCACCAATTATA	0.403																																																	0								ENSG00000184564						77.0	71.0	73.0					13																	86369914		1880	4102	5982	SLITRK6	SO:0001583	missense	0			-	HGNC	AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.730G>A	13.37:g.86369914C>T	ENSP00000383143:p.Asp244Asn	Somatic	0	33	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	SNP	25	0.00	0	33	0.00	0	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.D244N	ENST00000400286.2	37	c.730	CCDS41903.1	13	.	.	.	.	.	.	.	.	.	.	C	15.91	2.971271	0.53614	.	.	ENSG00000184564	ENST00000400286	T	0.54279	0.58	5.96	5.96	0.96718	Cysteine-rich flanking region, C-terminal (1);	0.051316	0.85682	D	0.000000	T	0.41650	0.1168	N	0.22421	0.69	0.80722	D	1	P	0.41366	0.747	B	0.36418	0.224	T	0.37619	-0.9698	10	0.48119	T	0.1	-16.2777	18.9858	0.92769	0.0:1.0:0.0:0.0	.	244	Q9H5Y7	SLIK6_HUMAN	N	244	ENSP00000383143:D244N	ENSP00000383143:D244N	D	-	1	0	SLITRK6	85267915	1.000000	0.71417	0.996000	0.52242	0.231000	0.25187	7.818000	0.86416	2.832000	0.97577	0.655000	0.94253	GAT	-	smart_Cys-rich_flank_reg_C		0.403	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK6	protein_coding	OTTHUMT00000045404.2	C	NM_032229	-		86369914	-1	no_errors	ENST00000400286	ensembl	human	known	74_37	missense	SNP	1.000	T
DIP2B	57609	genome.wustl.edu	37	12	51126229	51126229	+	Silent	SNP	C	C	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr12:51126229C>T	ENST00000301180.5	+	32	3925	c.3891C>T	c.(3889-3891)tcC>tcT	p.S1297S		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	1297						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						TCCAGCAGTCCTTCTCTAAGC	0.552																																																	0								ENSG00000066084						100.0	90.0	93.0					12																	51126229		2203	4300	6503	DIP2B	SO:0001819	synonymous_variant	0			-	HGNC	AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.3891C>T	12.37:g.51126229C>T		Somatic	0	47	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	111	766	12.64	Q6B011|Q8N1L5|Q8NB38	Silent	SNP	33	0.00	0	635	12.89	94	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.S1297	ENST00000301180.5	37	c.3891	CCDS31799.1	12																																																																																			-	pfam_AMP-dep_Synth/Lig		0.552	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2B	protein_coding	OTTHUMT00000404243.1	C	NM_173602	-		51126229	+1	no_errors	ENST00000301180	ensembl	human	known	74_37	silent	SNP	1.000	T
ELN	2006	genome.wustl.edu	37	7	73483018	73483018	+	Silent	SNP	G	G	A			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr7:73483018G>A	ENST00000252034.7	+	33	2562	c.2163G>A	c.(2161-2163)cgG>cgA	p.R721R	ELN_ENST00000357036.5_Silent_p.R708R|ELN_ENST00000380584.4_Silent_p.R655R|ELN_ENST00000380562.4_Silent_p.R727R|ELN_ENST00000380553.4_Silent_p.R567R|ELN_ENST00000320492.7_Silent_p.R640R|ELN_ENST00000320399.6_Silent_p.R754R|ELN_ENST00000380575.4_Silent_p.R674R|ELN_ENST00000380576.5_Silent_p.R702R|ELN_ENST00000429192.1_Silent_p.R689R|ELN_ENST00000458204.1_Silent_p.R711R|ELN_ENST00000358929.4_Silent_p.R789R|ELN_ENST00000445912.1_Silent_p.R703R|ELN_ENST00000414324.1_Silent_p.R697R	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				CTTGTGGCCGGAAGAGAAAAT	0.577			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																																	Dom	yes		7	7q11.23	2006	elastin	yes	L	0								ENSG00000049540						135.0	119.0	125.0					7																	73483018		2203	4300	6503	ELN	SO:0001819	synonymous_variant	0			-	HGNC		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.2163G>A	7.37:g.73483018G>A		Somatic	0	42	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Silent	SNP	29	0.00	0	53	0.00	0	prints_Tropoelastin	p.R789	ENST00000252034.7	37	c.2367	CCDS5562.2	7																																																																																			-	prints_Tropoelastin		0.577	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ELN	protein_coding	OTTHUMT00000316913.1	G	NM_000501	-		73483018	+1	no_errors	ENST00000358929	ensembl	human	known	74_37	silent	SNP	1.000	A
DACH2	117154	genome.wustl.edu	37	X	85769347	85769347	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chrX:85769347C>T	ENST00000373125.4	+	3	593	c.593C>T	c.(592-594)aCc>aTc	p.T198I	DACH2_ENST00000508860.1_Missense_Mutation_p.T31I|DACH2_ENST00000510272.1_5'UTR|DACH2_ENST00000373131.1_Missense_Mutation_p.T185I	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	198					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						CGCCTTCTGACCCATGCAGTC	0.478																																																	0								ENSG00000126733						54.0	45.0	48.0					X																	85769347		2203	4300	6503	DACH2	SO:0001583	missense	0			-	HGNC	AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.593C>T	X.37:g.85769347C>T	ENSP00000362217:p.Thr198Ile	Somatic	0	18	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	5	80.77	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	21	0.00	0	6	83.33	30	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.T198I	ENST00000373125.4	37	c.593	CCDS14455.1	X	.	.	.	.	.	.	.	.	.	.	C	14.65	2.598320	0.46318	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000400297	D;D	0.82711	-1.64;-1.62	4.88	4.88	0.63580	.	0.000000	0.64402	D	0.000003	T	0.70228	0.3200	N	0.08118	0	0.80722	D	1	B;B;B	0.22983	0.078;0.003;0.002	B;B;B	0.21546	0.035;0.003;0.001	T	0.67325	-0.5699	10	0.42905	T	0.14	.	17.2229	0.86962	0.0:1.0:0.0:0.0	.	64;185;198	Q1RMF5;Q96NX9-2;Q96NX9	.;.;DACH2_HUMAN	I	198;185;198;31;31	ENSP00000362223:T185I;ENSP00000362217:T198I	ENSP00000345134:T198I	T	+	2	0	DACH2	85656003	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	5.223000	0.65283	1.988000	0.58038	0.506000	0.49869	ACC	-	NULL		0.478	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACH2	protein_coding	OTTHUMT00000359266.1	C	NM_053281	-		85769347	+1	no_errors	ENST00000373125	ensembl	human	known	74_37	missense	SNP	1.000	T
CEP164	22897	genome.wustl.edu	37	11	117222572	117222572	+	Silent	SNP	A	A	G			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr11:117222572A>G	ENST00000278935.3	+	5	408	c.261A>G	c.(259-261)ccA>ccG	p.P87P		NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	87	Interaction with ATRIP.|WW. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		GGGACCATCCATGTGACGAAC	0.473																																																	0								ENSG00000110274						117.0	104.0	108.0					11																	117222572		2201	4296	6497	CEP164	SO:0001819	synonymous_variant	0			-	HGNC	AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.261A>G	11.37:g.117222572A>G		Somatic	0	43	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Silent	SNP	31	0.00	0	27	0.00	0	superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.P87	ENST00000278935.3	37	c.261	CCDS31683.1	11																																																																																			-	superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom		0.473	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP164	protein_coding	OTTHUMT00000392893.1	A	NM_014956	-		117222572	+1	no_errors	ENST00000278935	ensembl	human	known	74_37	silent	SNP	0.006	G
TMEM150B	284417	genome.wustl.edu	37	19	55824327	55824327	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr19:55824327A>C	ENST00000326652.4	-	8	784	c.602T>G	c.(601-603)gTt>gGt	p.V201G	CTD-2105E13.14_ENST00000596786.1_RNA|TMEM150B_ENST00000438693.1_Missense_Mutation_p.V201G	NM_001282011.1	NP_001268940.1	A6NC51	T150B_HUMAN	transmembrane protein 150B	201						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3						GGAGAAGTCAACGGCTAAGAG	0.677																																																	0								ENSG00000180061						31.0	39.0	36.0					19																	55824327		2162	4267	6429	TMEM150B	SO:0001583	missense	0			-	HGNC	BC020862	CCDS42629.1	19q13.42	2009-06-12	2009-06-12	2009-06-12		ENSG00000180061			34415	protein-coding gene	gene with protein product			"""transmembrane protein 224"""	TMEM224			Standard	XM_005258812		Approved		uc010esw.1	A6NC51		ENST00000326652.4:c.602T>G	19.37:g.55824327A>C	ENSP00000320757:p.Val201Gly	Somatic	0	44	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	60	47.41	B7ZW71	Missense_Mutation	SNP	23	0.00	0	19	42.42	14	pfam_Frag1/DRAM/Sfk1	p.V201G	ENST00000326652.4	37	c.602	CCDS42629.1	19	.	.	.	.	.	.	.	.	.	.	.	13.68	2.310295	0.40895	.	.	ENSG00000180061	ENST00000326652;ENST00000438693	T;T	0.47177	0.85;0.85	4.55	4.55	0.56014	.	0.069055	0.56097	D	0.000026	T	0.63295	0.2499	M	0.75264	2.295	0.58432	D	0.999994	D	0.76494	0.999	D	0.68943	0.961	T	0.61749	-0.6999	10	0.27082	T	0.32	-23.5767	10.837	0.46694	1.0:0.0:0.0:0.0	.	201	A6NC51	T150B_HUMAN	G	201	ENSP00000320757:V201G;ENSP00000412658:V201G	ENSP00000320757:V201G	V	-	2	0	TMEM150B	60516139	0.421000	0.25465	0.595000	0.28798	0.134000	0.20937	3.187000	0.50950	2.001000	0.58596	0.418000	0.28097	GTT	-	pfam_Frag1/DRAM/Sfk1		0.677	TMEM150B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM150B	protein_coding	OTTHUMT00000452685.1	A	NM_001085488	-		55824327	-1	no_errors	ENST00000326652	ensembl	human	known	74_37	missense	SNP	0.808	C
FGF13	2258	genome.wustl.edu	37	X	137717813	137717813	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chrX:137717813G>T	ENST00000315930.6	-	4	1067	c.406C>A	c.(406-408)Ctt>Att	p.L136I	FGF13_ENST00000541469.1_Missense_Mutation_p.L90I|FGF13_ENST00000305414.4_Missense_Mutation_p.L83I|FGF13_ENST00000370603.3_Missense_Mutation_p.L146I|FGF13_ENST00000441825.2_Missense_Mutation_p.L117I	NM_004114.3	NP_004105.1	Q92913	FGF13_HUMAN	fibroblast growth factor 13	136	Mediates interaction with sodium channels.				cell-cell signaling (GO:0007267)|cerebral cortex cell migration (GO:0021795)|establishment of neuroblast polarity (GO:0045200)|hippocampus development (GO:0021766)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|microtubule polymerization (GO:0046785)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of microtubule depolymerization (GO:0007026)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|positive regulation of protein kinase activity (GO:0045860)|protein localization to plasma membrane (GO:0072659)|signal transduction (GO:0007165)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|filopodium (GO:0030175)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|microtubule (GO:0005874)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-tubulin binding (GO:0048487)|growth factor activity (GO:0008083)|ion channel binding (GO:0044325)|microtubule binding (GO:0008017)|protein kinase activator activity (GO:0030295)|sodium channel regulator activity (GO:0017080)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	24	Acute lymphoblastic leukemia(192;0.000127)					GGTGTGAAAAGTTCCTGCAAC	0.353																																																	0								ENSG00000129682						49.0	43.0	45.0					X																	137717813		2203	4300	6503	FGF13	SO:0001583	missense	0			-	HGNC	BC034340	CCDS14664.1, CCDS14665.1, CCDS55511.1	Xq26.3	2008-02-05			ENSG00000129682	ENSG00000129682			3670	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 2"""	300070				8790420	Standard	NM_033642		Approved	FHF2, FGF2	uc011mwj.2	Q92913	OTTHUMG00000022532	ENST00000315930.6:c.406C>A	X.37:g.137717813G>T	ENSP00000322390:p.Leu136Ile	Somatic	0	21	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	6	41.67	B1AK18|B7Z4M7|B7Z8N0|D3DWH4|O95830|Q9NZH9|Q9NZI0	Missense_Mutation	SNP	15	0.00	0	4	77.78	14	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam,prints_Fibroblast_GF_fam	p.L146I	ENST00000315930.6	37	c.436	CCDS14665.1	X	.	.	.	.	.	.	.	.	.	.	G	14.24	2.475001	0.43942	.	.	ENSG00000129682	ENST00000315930;ENST00000305414;ENST00000441825;ENST00000370603;ENST00000541469;ENST00000436198;ENST00000455663	T;T;T;T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47	6.17	6.17	0.99709	.	0.042496	0.85682	D	0.000000	T	0.69851	0.3157	N	0.13327	0.33	0.34665	D	0.723084	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.10450	0.003;0.005;0.002;0.003	T	0.69109	-0.5232	10	0.33141	T	0.24	.	18.5888	0.91200	0.0:0.0:1.0:0.0	.	90;146;83;136	B7Z8N0;B7Z4M7;Q92913-2;Q92913	.;.;.;FGF13_HUMAN	I	136;83;117;146;90;146;152	ENSP00000322390:L136I;ENSP00000303391:L83I;ENSP00000409276:L117I;ENSP00000359635:L146I;ENSP00000437903:L90I;ENSP00000396198:L146I;ENSP00000406916:L152I	ENSP00000303391:L83I	L	-	1	0	FGF13	137545479	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.476000	0.97823	2.618000	0.88619	0.600000	0.82982	CTT	-	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam		0.353	FGF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF13	protein_coding	OTTHUMT00000058534.2	G	NM_004114	-		137717813	-1	no_errors	ENST00000370603	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC6A12	6539	genome.wustl.edu	37	12	308037	308037	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr12:308037C>T	ENST00000428720.1	-	8	1515	c.772G>A	c.(772-774)Gtc>Atc	p.V258I	SLC6A12_ENST00000397296.2_Missense_Mutation_p.V258I|SLC6A12_ENST00000424061.2_Missense_Mutation_p.V258I|SLC6A12_ENST00000538272.1_5'UTR|SLC6A12_ENST00000359674.4_Missense_Mutation_p.V258I|SLC6A12_ENST00000536824.1_Missense_Mutation_p.V258I	NM_001122848.2	NP_001116320.1	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 12	258					amino acid transport (GO:0006865)|cellular hyperosmotic response (GO:0071474)|cellular water homeostasis (GO:0009992)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|response to organic substance (GO:0010033)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			GGAAGGGTGACACCTCTGATC	0.557																																																	0								ENSG00000111181						143.0	118.0	126.0					12																	308037		2203	4300	6503	SLC6A12	SO:0001583	missense	0			-	HGNC	L42300	CCDS8501.1	12p13	2013-07-19	2013-07-19		ENSG00000111181	ENSG00000111181		"""Solute carriers"""	11045	protein-coding gene	gene with protein product	"""betaine/GABA transporter-1"""	603080	"""solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12"""			7589472	Standard	NM_003044		Approved	BGT-1	uc009zdh.2	P48065	OTTHUMG00000090309	ENST00000428720.1:c.772G>A	12.37:g.308037C>T	ENSP00000388184:p.Val258Ile	Somatic	0	35	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	A0AV52|B2R992|D3DUN8	Missense_Mutation	SNP	43	0.00	0	24	0.00	0	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_betaine	p.V258I	ENST00000428720.1	37	c.772	CCDS8501.1	12	.	.	.	.	.	.	.	.	.	.	C	6.803	0.517121	0.13005	.	.	ENSG00000111181	ENST00000359674;ENST00000397296;ENST00000428720;ENST00000424061;ENST00000536824	T;T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99;-0.99	4.44	-0.782	0.10961	.	0.225800	0.35677	N	0.003054	T	0.65719	0.2718	L	0.46567	1.45	0.30256	N	0.793604	B	0.18863	0.031	B	0.31016	0.123	T	0.58624	-0.7604	10	0.36615	T	0.2	.	10.4212	0.44352	0.0:0.7389:0.0:0.2611	.	258	P48065	S6A12_HUMAN	I	258	ENSP00000352702:V258I;ENSP00000380464:V258I;ENSP00000388184:V258I;ENSP00000399136:V258I;ENSP00000444268:V258I	ENSP00000352702:V258I	V	-	1	0	SLC6A12	178298	0.243000	0.23878	0.000000	0.03702	0.005000	0.04900	0.926000	0.28804	-0.428000	0.07339	0.655000	0.94253	GTC	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.557	SLC6A12-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A12	protein_coding	OTTHUMT00000206671.2	C	NM_003044	-		308037	-1	no_errors	ENST00000359674	ensembl	human	known	74_37	missense	SNP	0.168	T
GXYLT1	283464	genome.wustl.edu	37	12	42512817	42512817	+	Silent	SNP	A	A	G	rs201566551		TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr12:42512817A>G	ENST00000398675.3	-	3	703	c.471T>C	c.(469-471)caT>caC	p.H157H	GXYLT1_ENST00000280876.6_Silent_p.H126H	NM_001099650.1|NM_173601.1	NP_001093120.1|NP_775872.1	Q4G148	GXLT1_HUMAN	glucoside xylosyltransferase 1	157					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|O-glycan processing (GO:0016266)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-xylosyltransferase activity (GO:0035252)			kidney(2)|large_intestine(4)|liver(3)|lung(8)	17						CTTTAAAGCTATGATGTAGCT	0.323																																																	0								ENSG00000151233						71.0	64.0	66.0					12																	42512817		1859	4097	5956	GXYLT1	SO:0001819	synonymous_variant	0			-	HGNC	BC015597	CCDS41771.1, CCDS41772.1	12q12	2013-10-11	2009-11-17	2009-11-17	ENSG00000151233	ENSG00000151233		"""Glycosyltransferase family 8 domain containing"""	27482	protein-coding gene	gene with protein product		613321	"""glycosyltransferase 8 domain containing 3"""	GLT8D3		19940119	Standard	NM_001099650		Approved	FLJ43151	uc001rms.4	Q4G148	OTTHUMG00000169379	ENST00000398675.3:c.471T>C	12.37:g.42512817A>G		Somatic	0	50	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	60	13.04	B3KWJ2|Q8IXV1|Q96BH4	Silent	SNP	37	17.78	8	38	24.00	12	pfam_Glyco_trans_8	p.H157	ENST00000398675.3	37	c.471	CCDS41772.1	12																																																																																			-	NULL		0.323	GXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GXYLT1	protein_coding	OTTHUMT00000403778.1	A	XM_290597	rs201566551		42512817	-1	no_errors	ENST00000398675	ensembl	human	known	74_37	silent	SNP	0.063	G
TCEB3	6924	genome.wustl.edu	37	1	24078271	24078271	+	Silent	SNP	G	G	A			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr1:24078271G>A	ENST00000418390.2	+	4	1525	c.1254G>A	c.(1252-1254)gaG>gaA	p.E418E	TCEB3_ENST00000609199.1_Silent_p.E392E	NM_003198.2	NP_003189.2	Q14241	ELOA1_HUMAN	transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)	418					gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		CTAAAGTTGAGGAGACAGATA	0.428											OREG0013232	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000011007						111.0	127.0	122.0					1																	24078271		2203	4300	6503	TCEB3	SO:0001819	synonymous_variant	0			-	HGNC	L47345	CCDS239.2	1p36.1	2010-06-22	2002-08-29		ENSG00000011007	ENSG00000011007			11620	protein-coding gene	gene with protein product		600786	"""transcription elongation factor B (SIII), polypeptide 3 (110kD, elongin A)"""			8586449, 7660129	Standard	NM_003198		Approved	SIII, TCEB3A	uc001bho.3	Q14241	OTTHUMG00000002957	ENST00000418390.2:c.1254G>A	1.37:g.24078271G>A		Somatic	0	24	0.00	768	0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	20	28.57	B2R7Q8|Q8IXH1	Silent	SNP	39	0.00	0	31	29.55	13	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,pfscan_F-box_dom	p.E418	ENST00000418390.2	37	c.1254	CCDS239.2	1																																																																																			-	NULL		0.428	TCEB3-001	KNOWN	basic|CCDS	protein_coding	TCEB3	protein_coding	OTTHUMT00000008230.2	G	NM_003198	-		24078271	+1	no_errors	ENST00000418390	ensembl	human	known	74_37	silent	SNP	0.942	A
TTN	7273	genome.wustl.edu	37	2	179641959	179641959	+	Silent	SNP	G	G	A			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr2:179641959G>A	ENST00000591111.1	-	27	4955	c.4731C>T	c.(4729-4731)gtC>gtT	p.V1577V	RP11-88L24.4_ENST00000582038.2_RNA|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342992.6_Silent_p.V1577V|TTN_ENST00000360870.5_Silent_p.V1577V|TTN_ENST00000342175.6_Silent_p.V1531V|TTN_ENST00000359218.5_Silent_p.V1531V|TTN_ENST00000460472.2_Silent_p.V1531V|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000589042.1_Silent_p.V1577V|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12434	Ig-like 7.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCGTAGCTCTGACTTTCATTT	0.378																																																	0								ENSG00000155657						157.0	151.0	153.0					2																	179641959		2203	4300	6503	TTN	SO:0001819	synonymous_variant	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.4731C>T	2.37:g.179641959G>A		Somatic	0	37	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	37	30.19	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	25	0.00	0	44	24.14	14	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.V1577	ENST00000591111.1	37	c.4731		2																																																																																			-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.378	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	G	NM_133378	-		179641959	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	SNP	1.000	A
OR8K3	219473	genome.wustl.edu	37	11	56085826	56085826	+	Missense_Mutation	SNP	C	C	T	rs149952066	byFrequency	TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr11:56085826C>T	ENST00000312711.1	+	1	44	c.44C>T	c.(43-45)aCg>aTg	p.T15M		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	15						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					TTCATTCTTACGGGAATCACA	0.423																																																	0								ENSG00000181689	C	MET/THR	0,4402		0,0,2201	150.0	136.0	140.0		44	-0.3	0.2	11	dbSNP_134	140	2,8588	2.2+/-6.3	0,2,4293	no	missense	OR8K3	NM_001005202.1	81	0,2,6494	TT,TC,CC		0.0233,0.0,0.0154	benign	15/313	56085826	2,12990	2201	4295	6496	OR8K3	SO:0001583	missense	0			-	HGNC	AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.44C>T	11.37:g.56085826C>T	ENSP00000323555:p.Thr15Met	Somatic	0	34	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	14	56.25	Q6IFC4	Missense_Mutation	SNP	37	0.00	0	7	80.00	28	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T15M	ENST00000312711.1	37	c.44	CCDS31527.1	11	.	.	.	.	.	.	.	.	.	.	C	0	-2.631331	0.00115	0.0	2.33E-4	ENSG00000181689	ENST00000312711	T	0.00421	7.46	4.84	-0.285	0.12866	.	1.071090	0.07145	N	0.848012	T	0.00178	0.0005	N	0.03115	-0.41	0.09310	N	0.999997	B	0.09022	0.002	B	0.06405	0.002	T	0.10245	-1.0638	10	0.11485	T	0.65	.	8.0648	0.30654	0.0:0.2598:0.0:0.7402	.	15	Q8NH51	OR8K3_HUMAN	M	15	ENSP00000323555:T15M	ENSP00000323555:T15M	T	+	2	0	OR8K3	55842402	0.039000	0.19947	0.154000	0.22540	0.012000	0.07955	0.379000	0.20585	0.062000	0.16340	-0.501000	0.04562	ACG	-	NULL		0.423	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K3	protein_coding	OTTHUMT00000391602.1	C	NM_001005202	rs149952066		56085826	+1	no_errors	ENST00000312711	ensembl	human	known	74_37	missense	SNP	0.330	T
OR5H1	26341	genome.wustl.edu	37	3	97852060	97852060	+	Silent	SNP	A	A	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr3:97852060A>T	ENST00000354565.2	+	1	519	c.519A>T	c.(517-519)atA>atT	p.I173I	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						ACTCCAACATAGTACATCACA	0.328																																																	0								ENSG00000231192						26.0	33.0	30.0					3																	97852060		2189	4276	6465	OR5H1	SO:0001819	synonymous_variant	0			-	HGNC	X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.519A>T	3.37:g.97852060A>T		Somatic	0	54	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	36	26.53		Silent	SNP	30	0.00	0	10	52.38	11	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I173	ENST00000354565.2	37	c.519	CCDS33797.1	3																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.328	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H1	protein_coding	OTTHUMT00000359100.2	A	NM_001005338	-		97852060	+1	no_errors	ENST00000354565	ensembl	human	known	74_37	silent	SNP	0.001	T
DCAF8L2	347442	genome.wustl.edu	37	X	27766740	27766740	+	Silent	SNP	C	C	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chrX:27766740C>T	ENST00000451261.2	+	5	2127	c.1728C>T	c.(1726-1728)gaC>gaT	p.D576D		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	576										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						GCCTGTTTGACCAGTACATGC	0.498																																																	0								ENSG00000189186						141.0	100.0	112.0					X																	27766740		692	1591	2283	DCAF8L2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.1728C>T	X.37:g.27766740C>T		Somatic	0	20	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	16	32.00	B2RXH9|J3KT06	Silent	SNP	22	0.00	0	15	51.61	16	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D576	ENST00000451261.2	37	c.1728	CCDS59162.1	X																																																																																			-	NULL		0.498	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L2	protein_coding	OTTHUMT00000056143.4	C	XM_293354	-		27766740	+1	no_errors	ENST00000451261	ensembl	human	known	74_37	silent	SNP	0.031	T
RN7SL319P	106479339	genome.wustl.edu	37	15	76077689	76077690	+	RNA	INS	-	-	G	rs200411336	byFrequency	TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr15:76077689_76077690insG	ENST00000395215.3	+	0	1184				RN7SL319P_ENST00000480656.2_RNA																							agcaagatcttgttcttaaaag	0.515													|||unknown(NO_COVERAGE)	899	0.179513	0.0817	0.255	5008	,	,		17448	0.2599		0.2028	False		,,,				2504	0.1513																0								ENSG00000241807																																			RN7SL319P			0				HGNC																													15.37:g.76077690_76077690dupG		Somatic	0	14	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	23	32.35		RNA	INS	11	15.38	2	24	25.00	8	-	NULL	ENST00000395215.3	37	NULL		15																																																																																			-	-		0.515	RP11-24M17.5-001	KNOWN	basic	processed_transcript	RN7SL319P	pseudogene	OTTHUMT00000420501.1	-				76077690	+1	no_errors	ENST00000480656	ensembl	human	known	74_37	rna	INS	0.981:0.985	G
LRP1B	53353	genome.wustl.edu	37	2	141625271	141625271	+	Silent	SNP	G	G	C			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr2:141625271G>C	ENST00000389484.3	-	27	5438	c.4467C>G	c.(4465-4467)acC>acG	p.T1489T		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1489					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACAATGTGTTGGTCCTCCAGT	0.453										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0								ENSG00000168702						189.0	169.0	176.0					2																	141625271		2203	4300	6503	LRP1B	SO:0001819	synonymous_variant	0			-	HGNC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4467C>G	2.37:g.141625271G>C		Somatic	0	66	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	59	47.32	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	29	0.00	0	26	43.48	20	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.T1489	ENST00000389484.3	37	c.4467	CCDS2182.1	2																																																																																			-	smart_LDLR_classB_rpt		0.453	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	protein_coding	OTTHUMT00000254736.2	G	NM_018557	-		141625271	-1	no_errors	ENST00000389484	ensembl	human	known	74_37	silent	SNP	0.996	C
TNS3	64759	genome.wustl.edu	37	7	47385934	47385934	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr7:47385934delG	ENST00000398879.1	-	18	2668	c.2302delC	c.(2302-2304)ctgfs	p.L768fs	TNS3_ENST00000311160.9_Frame_Shift_Del_p.L768fs|TNS3_ENST00000355730.3_Frame_Shift_Del_p.L528fs			Q68CZ2	TENS3_HUMAN	tensin 3	768					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						CTCCCGCCCAGGGGCTGTTCA	0.607																																																	0								ENSG00000136205						40.0	41.0	41.0					7																	47385934		1913	4117	6030	TNS3	SO:0001589	frameshift_variant	0				HGNC	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.2302delC	7.37:g.47385934delG	ENSP00000381854:p.Leu768fs	Somatic	0	21	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	13	35.00	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Frame_Shift_Del	DEL	27	0.00	0	39	0.00	0	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_dom,smart_Tyr_Pase_cat,smart_SH2,smart_PTB/PI_dom,pfscan_SH2,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.L768fs	ENST00000398879.1	37	c.2302	CCDS5506.2	7																																																																																			-	NULL		0.607	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS3	protein_coding	OTTHUMT00000157253.1	G	NM_022748			47385934	-1	no_errors	ENST00000311160	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
AP3D1	8943	genome.wustl.edu	37	19	2129123	2129123	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr19:2129123T>C	ENST00000345016.5	-	8	1003	c.772A>G	c.(772-774)Aag>Gag	p.K258E	AP3D1_ENST00000350812.6_Intron|AP3D1_ENST00000355272.6_Missense_Mutation_p.K258E|AP3D1_ENST00000356926.4_Splice_Site_p.K167E|AP3D1_ENST00000590683.1_5'UTR	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	258					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGATCAGCTTCTTGCCCAGC	0.682																																																	0								ENSG00000065000						19.0	23.0	22.0					19																	2129123		1972	4158	6130	AP3D1	SO:0001583	missense	0			-	HGNC	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.772A>G	19.37:g.2129123T>C	ENSP00000344055:p.Lys258Glu	Somatic	0	41	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	67	45.08	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Missense_Mutation	SNP	21	0.00	0	25	56.14	32	pfam_BLV_receptor,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_dsu	p.K258E	ENST00000345016.5	37	c.772	CCDS42459.1	19	.	.	.	.	.	.	.	.	.	.	T	17.29	3.352807	0.61293	.	.	ENSG00000065000	ENST00000356926;ENST00000345016;ENST00000355272;ENST00000343722	T;T;T	0.23552	1.9;1.9;1.9	4.33	4.33	0.51752	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.63815	0.2543	H	0.96861	3.895	0.80722	D	1	D;D;D	0.89917	0.998;1.0;0.983	D;D;D	0.91635	0.994;0.999;0.92	T	0.76743	-0.2847	10	0.87932	D	0	-44.1451	13.1092	0.59263	0.0:0.0:0.0:1.0	.	258;258;167	O14617-5;O14617;G5E988	.;AP3D1_HUMAN;.	E	167;258;258;258	ENSP00000349398:K167E;ENSP00000344055:K258E;ENSP00000347416:K258E	ENSP00000341579:K258E	K	-	1	0	AP3D1	2080123	1.000000	0.71417	1.000000	0.80357	0.038000	0.13279	7.454000	0.80714	1.940000	0.56252	0.533000	0.62120	AAG	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_dsu		0.682	AP3D1-002	KNOWN	basic|CCDS	protein_coding	AP3D1	protein_coding	OTTHUMT00000450912.1	T		-		2129123	-1	no_errors	ENST00000355272	ensembl	human	known	74_37	missense	SNP	1.000	C
KRT1	3848	genome.wustl.edu	37	12	53069189	53069190	+	In_Frame_Ins	INS	-	-	GCC			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr12:53069189_53069190insGCC	ENST00000252244.3	-	9	1780_1781	c.1722_1723insGGC	c.(1720-1725)ggccat>ggcGGCcat	p.574_575insG		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	574	Gly/Ser-rich.|Tail.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						tagctgccatggccgccgccgc	0.748																																																	0								ENSG00000167768			21,2759		2,17,1371						-0.6	0.1		dbSNP_130	5	28,5852		1,26,2913	no	coding	KRT1	NM_006121.3		3,43,4284	A1A1,A1R,RR		0.4762,0.7554,0.5658				49,8611				KRT1	SO:0001652	inframe_insertion	0				HGNC	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1720_1722dupGGC	12.37:g.53069196_53069198dupGCC	ENSP00000252244:p.Gly575_Gly576dup	Somatic	0	31	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	243	9.67	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	In_Frame_Ins	INS	19	0.00	0	195	0.00	0	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.574in_frame_insG	ENST00000252244.3	37	c.1723_1722	CCDS8836.1	12																																																																																			-	NULL		0.748	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT1	protein_coding	OTTHUMT00000405706.1	-	NM_006121			53069190	-1	no_errors	ENST00000252244	ensembl	human	known	74_37	in_frame_ins	INS	0.358:0.643	GCC
ANK3	288	genome.wustl.edu	37	10	62021640	62021640	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr10:62021640C>A	ENST00000280772.2	-	7	966	c.775G>T	c.(775-777)Gct>Tct	p.A259S	ANK3_ENST00000373827.2_Missense_Mutation_p.A253S|ANK3_ENST00000503366.1_Missense_Mutation_p.A242S	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	259					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TCCACAGCAGCCGCTCGGTTT	0.433																																																	0								ENSG00000151150						79.0	75.0	76.0					10																	62021640		2203	4300	6503	ANK3	SO:0001583	missense	0			-	HGNC	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.775G>T	10.37:g.62021640C>A	ENSP00000280772:p.Ala259Ser	Somatic	0	35	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	25	24.24	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	37	0.00	0	33	28.26	13	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.A259S	ENST00000280772.2	37	c.775	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	C	28.3	4.909756	0.92107	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000503366;ENST00000395299;ENST00000503925	T;T;T;T	0.27256	1.68;1.68;1.68;1.8	5.51	5.51	0.81932	Ankyrin repeat-containing domain (4);	0.000000	0.41938	D	0.000796	T	0.52500	0.1738	M	0.67625	2.065	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.993;1.0;0.998	T	0.50533	-0.8817	10	0.72032	D	0.01	.	19.6101	0.95602	0.0:1.0:0.0:0.0	.	242;253;259	E9PE32;Q5CZH9;Q12955	.;.;ANK3_HUMAN	S	259;253;242;221;233	ENSP00000280772:A259S;ENSP00000362933:A253S;ENSP00000425236:A242S;ENSP00000426011:A233S	ENSP00000280772:A259S	A	-	1	0	ANK3	61691646	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.651000	0.83577	2.868000	0.98415	0.557000	0.71058	GCT	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.433	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	protein_coding	OTTHUMT00000048201.4	C	NM_020987	-		62021640	-1	no_errors	ENST00000280772	ensembl	human	known	74_37	missense	SNP	1.000	A
WHSC1	7468	genome.wustl.edu	37	4	1976385	1976385	+	Intron	SNP	C	C	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr4:1976385C>T	ENST00000382895.3	+	21	3803				WHSC1_ENST00000508803.1_Intron|WHSC1_ENST00000382892.2_Intron|WHSC1_ENST00000382891.5_Intron|WHSC1_ENST00000482415.2_Intron|WHSC1_ENST00000382888.3_Intron|SCARNA22_ENST00000503991.1_RNA	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1						anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		GCTCGGTCCTCTCCACGTGGT	0.577			T	IGH@	MM																																			Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	0								ENSG00000249784						193.0	174.0	179.0					4																	1976385		876	1991	2867	SCARNA22	SO:0001627	intron_variant	0			-	HGNC	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.3373-205C>T	4.37:g.1976385C>T		Somatic	0	48	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	99	18.85	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	RNA	SNP	18	0.00	0	37	26.00	13	-	NULL	ENST00000382895.3	37	NULL	CCDS33940.1	4																																																																																			-	-		0.577	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	SCARNA22	protein_coding	OTTHUMT00000366269.2	C	NM_133330	-		1976385	+1	no_errors	ENST00000503991	ensembl	human	known	74_37	rna	SNP	0.000	T
FBN3	84467	genome.wustl.edu	37	19	8171060	8171060	+	Missense_Mutation	SNP	G	G	A	rs372444818		TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr19:8171060G>A	ENST00000600128.1	-	38	5159	c.4745C>T	c.(4744-4746)aCg>aTg	p.T1582M	FBN3_ENST00000270509.2_Missense_Mutation_p.T1582M|FBN3_ENST00000601739.1_Missense_Mutation_p.T1582M			Q75N90	FBN3_HUMAN	fibrillin 3	1582	EGF-like 24; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						ACTGCCAAACGTGTTGACGCA	0.577																																																	0								ENSG00000142449	G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	122.0	85.0	98.0		4745	3.2	0.9	19		98	0,8600		0,0,4300	no	missense	FBN3	NM_032447.3	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1582/2810	8171060	1,13005	2203	4300	6503	FBN3	SO:0001583	missense	0			-	HGNC		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.4745C>T	19.37:g.8171060G>A	ENSP00000470498:p.Thr1582Met	Somatic	0	23	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	33	29.79	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	34	0.00	0	51	31.58	24	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.T1582M	ENST00000600128.1	37	c.4745	CCDS12196.1	19	.	.	.	.	.	.	.	.	.	.	G	17.30	3.354845	0.61293	2.27E-4	0.0	ENSG00000142449	ENST00000270509	D	0.93189	-3.18	3.25	3.25	0.37280	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	U	0.000000	D	0.96614	0.8895	M	0.87900	2.915	0.58432	D	0.999999	D	0.89917	1.0	D	0.73708	0.981	D	0.96905	0.9663	10	0.54805	T	0.06	.	14.4308	0.67249	0.0:0.0:1.0:0.0	.	1582	Q75N90	FBN3_HUMAN	M	1582	ENSP00000270509:T1582M	ENSP00000270509:T1582M	T	-	2	0	FBN3	8077060	1.000000	0.71417	0.870000	0.34147	0.416000	0.31233	9.164000	0.94755	1.527000	0.49086	0.561000	0.74099	ACG	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom		0.577	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	protein_coding	OTTHUMT00000461428.2	G	NM_032447	-		8171060	-1	no_errors	ENST00000270509	ensembl	human	known	74_37	missense	SNP	1.000	A
WHSC1	7468	genome.wustl.edu	37	4	1977056	1977056	+	Silent	SNP	C	C	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr4:1977056C>T	ENST00000382895.3	+	22	3981	c.3550C>T	c.(3550-3552)Ctg>Ttg	p.L1184L	WHSC1_ENST00000508803.1_Silent_p.L1184L|WHSC1_ENST00000382892.2_Silent_p.L1184L|WHSC1_ENST00000382891.5_Silent_p.L1184L|WHSC1_ENST00000482415.2_3'UTR|WHSC1_ENST00000382888.3_Silent_p.L532L|SCARNA22_ENST00000503991.1_RNA	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	1184					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		CCTCGATTGTCTGGGCAATGA	0.532			T	IGH@	MM																																			Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	0								ENSG00000109685						94.0	89.0	91.0					4																	1977056		2203	4300	6503	WHSC1	SO:0001819	synonymous_variant	0			-	HGNC	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.3550C>T	4.37:g.1977056C>T		Somatic	0	56	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	84	16.00	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Silent	SNP	35	0.00	0	48	21.31	13	pfam_PWWP_dom,pfam_SET_dom,pfam_Znf_PHD-finger,pfam_HMG_box_dom,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_PWWP_dom,smart_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_HMG_box_dom	p.L1184	ENST00000382895.3	37	c.3550	CCDS33940.1	4																																																																																			-	smart_SET_dom,pfscan_SET_dom		0.532	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	WHSC1	protein_coding	OTTHUMT00000366269.2	C	NM_133330	-		1977056	+1	no_errors	ENST00000382891	ensembl	human	known	74_37	silent	SNP	0.936	T
SYNE1	23345	genome.wustl.edu	37	6	152485354	152485354	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr6:152485354T>C	ENST00000367255.5	-	131	24335	c.23734A>G	c.(23734-23736)Ata>Gta	p.I7912V	SYNE1_ENST00000448038.1_Missense_Mutation_p.I7841V|SYNE1_ENST00000341594.5_Missense_Mutation_p.I7524V|SYNE1_ENST00000265368.4_Missense_Mutation_p.I7912V|SYNE1_ENST00000423061.1_Missense_Mutation_p.I7841V|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000354674.4_Missense_Mutation_p.I67V|SYNE1_ENST00000356820.4_Missense_Mutation_p.I2436V|SYNE1_ENST00000539504.1_Missense_Mutation_p.I67V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7912					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCGTAGACTATTGGCTTGGCC	0.468										HNSCC(10;0.0054)																																							0								ENSG00000131018						123.0	112.0	116.0					6																	152485354		2203	4300	6503	SYNE1	SO:0001583	missense	0			-	HGNC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.23734A>G	6.37:g.152485354T>C	ENSP00000356224:p.Ile7912Val	Somatic	0	51	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	69	24.18	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	34	0.00	0	30	38.78	19	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.I7912V	ENST00000367255.5	37	c.23734	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	T	10.21	1.286277	0.23478	.	.	ENSG00000131018	ENST00000367255;ENST00000539504;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000313630;ENST00000367247;ENST00000367251;ENST00000354674	T;T;T;T;T;T;T;T;T;T	0.48522	0.81;1.47;1.47;0.81;0.81;0.81;0.81;1.47;1.47;1.47	5.26	5.26	0.73747	.	0.000000	0.49916	D	0.000127	T	0.27169	0.0666	N	0.02539	-0.55	0.53688	D	0.99997	P;P;P;P;B	0.50617	0.937;0.937;0.923;0.937;0.001	P;P;P;P;B	0.59948	0.866;0.866;0.79;0.866;0.006	T	0.45833	-0.9234	10	0.29301	T	0.29	.	15.173	0.72891	0.0:0.0:0.0:1.0	.	7912;7912;7841;7841;114	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9;B7Z9Y6	SYNE1_HUMAN;.;.;.;.	V	7912;67;558;7841;7912;7841;7524;2436;74;69;834;67	ENSP00000356224:I7912V;ENSP00000441052:I67V;ENSP00000356226:I558V;ENSP00000396024:I7841V;ENSP00000265368:I7912V;ENSP00000390975:I7841V;ENSP00000341887:I7524V;ENSP00000349276:I2436V;ENSP00000356220:I834V;ENSP00000346701:I67V	ENSP00000265368:I7912V	I	-	1	0	SYNE1	152527047	1.000000	0.71417	0.090000	0.20809	0.956000	0.61745	6.126000	0.71635	1.985000	0.57927	0.477000	0.44152	ATA	-	pfam_Spectrin_repeat,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin		0.468	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	protein_coding	OTTHUMT00000334755.2	T	NM_182961	-		152485354	-1	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	SNP	0.997	C
CLEC1A	51267	genome.wustl.edu	37	12	10228209	10228209	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr12:10228209T>C	ENST00000315330.4	-	4	499	c.437A>G	c.(436-438)gAc>gGc	p.D146G	CLEC1A_ENST00000457018.2_Missense_Mutation_p.D113G|CLEC1A_ENST00000420265.2_Missense_Mutation_p.D54G	NM_016511.2	NP_057595.2	Q8NC01	CLC1A_HUMAN	C-type lectin domain family 1, member A	146	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	23						GTAGCAATTGTCTCCATGCCA	0.393																																																	0								ENSG00000150048						142.0	134.0	137.0					12																	10228209		2203	4300	6503	CLEC1A	SO:0001583	missense	0			-	HGNC	AY358587	CCDS8612.1, CCDS73443.1	12p13.31	2005-02-09				ENSG00000150048		"""C-type lectin domain containing"""	24355	protein-coding gene	gene with protein product		606782				10671229, 11745369	Standard	XM_005253383		Approved	CLEC1, MGC34328	uc001qxb.3	Q8NC01		ENST00000315330.4:c.437A>G	12.37:g.10228209T>C	ENSP00000326407:p.Asp146Gly	Somatic	0	29	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	16	36.00	Q8IUW7|Q9NZH3	Missense_Mutation	SNP	17	0.00	0	15	58.33	21	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.D146G	ENST00000315330.4	37	c.437	CCDS8612.1	12	.	.	.	.	.	.	.	.	.	.	T	13.19	2.164072	0.38217	.	.	ENSG00000150048	ENST00000315330;ENST00000457018;ENST00000420265	T;T;T	0.13538	2.58;2.58;2.58	5.06	3.91	0.45181	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.103311	0.43110	D	0.000613	T	0.11324	0.0276	N	0.24115	0.695	0.32361	N	0.557112	D;P;P	0.56521	0.976;0.884;0.57	P;B;B	0.49922	0.626;0.283;0.101	T	0.07009	-1.0795	10	0.22706	T	0.39	.	6.9437	0.24506	0.0:0.1016:0.0:0.8984	.	54;113;146	E7ESV9;E9PFB4;Q8NC01	.;.;CLC1A_HUMAN	G	146;113;54	ENSP00000326407:D146G;ENSP00000415048:D113G;ENSP00000417010:D54G	ENSP00000326407:D146G	D	-	2	0	CLEC1A	10119476	0.931000	0.31567	0.995000	0.50966	0.544000	0.35116	1.532000	0.36029	2.040000	0.60383	0.533000	0.62120	GAC	-	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.393	CLEC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC1A	protein_coding	OTTHUMT00000399924.1	T	NM_016511	-		10228209	-1	no_errors	ENST00000315330	ensembl	human	known	74_37	missense	SNP	0.978	C
PA2G4	5036	genome.wustl.edu	37	12	56501332	56501332	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr12:56501332G>A	ENST00000303305.6	+	5	840	c.421G>A	c.(421-423)Gat>Aat	p.D141N	PA2G4_ENST00000552766.1_Missense_Mutation_p.D141N|RP11-603J24.17_ENST00000548595.1_RNA|RP11-603J24.9_ENST00000548861.1_Missense_Mutation_p.D122N	NM_006191.2	NP_006182.2	Q9UQ80	PA2G4_HUMAN	proliferation-associated 2G4, 38kDa	141					cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of translation (GO:0006417)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(18;0.0739)			GAGGAAAGCAGATGTTATTAA	0.443																																																	0								ENSG00000170515						122.0	120.0	121.0					12																	56501332		2203	4300	6503	PA2G4	SO:0001583	missense	0			-	HGNC	U59435, BC007561	CCDS8902.1	12q13.2	2008-09-05	2002-08-29		ENSG00000170515	ENSG00000170515			8550	protein-coding gene	gene with protein product		602145	"""proliferation-associated 2G4, 38kD"""			9345902	Standard	NM_006191		Approved		uc001sjm.3	Q9UQ80	OTTHUMG00000170173	ENST00000303305.6:c.421G>A	12.37:g.56501332G>A	ENSP00000302886:p.Asp141Asn	Somatic	0	38	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	69	42	62.16	O43846|Q9UM59	Missense_Mutation	SNP	37	0.00	0	38	65.45	72	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain,tigrfam_Pap_1	p.D141N	ENST00000303305.6	37	c.421	CCDS8902.1	12	.	.	.	.	.	.	.	.	.	.	G	32	5.135088	0.94517	.	.	ENSG00000257411;ENSG00000170515;ENSG00000170515;ENSG00000170515;ENSG00000170515;ENSG00000170515;ENSG00000170515	ENST00000548861;ENST00000303305;ENST00000552766;ENST00000417031;ENST00000546435;ENST00000548711;ENST00000553057	T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06	4.79	4.79	0.61399	Peptidase M24, structural domain (3);	0.000000	0.85682	D	0.000000	D	0.87954	0.6308	M	0.76938	2.355	0.80722	D	1	D;D;D	0.89917	1.0;0.993;0.994	D;D;D	0.91635	0.999;0.968;0.929	D	0.88851	0.3319	10	0.56958	D	0.05	.	16.7759	0.85550	0.0:0.0:1.0:0.0	.	141;141;141	F8VRZ3;F8VTY8;Q9UQ80	.;.;PA2G4_HUMAN	N	122;141;141;170;141;141;130	ENSP00000449770:D122N;ENSP00000302886:D141N;ENSP00000448557:D141N;ENSP00000447615:D130N	ENSP00000302886:D141N	D	+	1	0	PA2G4;RP11-603J24.9	54787599	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.318000	0.96334	2.497000	0.84241	0.655000	0.94253	GAT	-	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain,tigrfam_Pap_1		0.443	PA2G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PA2G4	protein_coding	OTTHUMT00000407767.1	G	NM_006191	-		56501332	+1	no_errors	ENST00000303305	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF443	10224	genome.wustl.edu	37	19	12541977	12541977	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr19:12541977A>G	ENST00000301547.5	-	4	1206	c.1009T>C	c.(1009-1011)Tat>Cat	p.Y337H	CTD-3105H18.16_ENST00000595562.1_Intron	NM_005815.4	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	337					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|pancreas(1)|prostate(1)	28						TGACATGCATAGGGTTTCTCT	0.433																																																	0								ENSG00000180855						211.0	196.0	201.0					19																	12541977		2203	4299	6502	ZNF443	SO:0001583	missense	0			-	HGNC	AB011414	CCDS32918.1	19p13.13	2013-01-08			ENSG00000180855	ENSG00000180855		"""Zinc fingers, C2H2-type"", ""-"""	20878	protein-coding gene	gene with protein product		606697				9731181	Standard	NM_005815		Approved	ZK1	uc002mtu.3	Q9Y2A4	OTTHUMG00000156404	ENST00000301547.5:c.1009T>C	19.37:g.12541977A>G	ENSP00000301547:p.Tyr337His	Somatic	0	84	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	58	185	23.87		Missense_Mutation	SNP	49	0.00	0	104	22.39	30	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y337H	ENST00000301547.5	37	c.1009	CCDS32918.1	19	.	.	.	.	.	.	.	.	.	.	A	14.29	2.492369	0.44352	.	.	ENSG00000180855	ENST00000301547;ENST00000411622	T	0.21734	1.99	1.44	1.44	0.22558	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18341	0.0440	N	0.12422	0.21	0.09310	N	1	P	0.43973	0.823	P	0.51516	0.672	T	0.15321	-1.0441	9	0.66056	D	0.02	.	8.3045	0.32034	1.0:0.0:0.0:0.0	.	337	Q9Y2A4	ZN443_HUMAN	H	337	ENSP00000301547:Y337H	ENSP00000301547:Y337H	Y	-	1	0	ZNF443	12402977	0.017000	0.18338	0.003000	0.11579	0.361000	0.29550	1.534000	0.36051	0.939000	0.37446	0.378000	0.23410	TAT	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.433	ZNF443-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF443	protein_coding	OTTHUMT00000344084.1	A	NM_005815	-		12541977	-1	no_errors	ENST00000301547	ensembl	human	known	74_37	missense	SNP	0.156	G
RXRA	6256	genome.wustl.edu	37	9	137330688	137330689	+	IGR	INS	-	-	GCTGGCTG	rs562342402|rs398069049|rs536748481|rs551052084|rs71933603|rs55645907	byFrequency	TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr9:137330688_137330689insGCTGGCTG	ENST00000481739.1	+	0	1846				RXRA_ENST00000356384.4_3'UTR	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha						camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	TCGTTTCCGGCgctggctggct	0.668																																																	0								ENSG00000186350																																			RXRA	SO:0001628	intergenic_variant	0				HGNC	X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887		9.37:g.137330689_137330696dupGCTGGCTG		Somatic	NA	NA	NA		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KY83|Q2NL52|Q2V504	RNA	INS	20	28.57	8	44	13.73	7	-	NULL	ENST00000481739.1	37	NULL	CCDS35172.1	9																																																																																			-	-		0.668	RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RXRA	protein_coding	OTTHUMT00000054949.1	-	NM_002957			137330689	+1	no_errors	ENST00000356384	ensembl	human	known	74_37	rna	INS	0.007:0.001	GCTGGCTG
MAP1A	4130	genome.wustl.edu	37	15	43815590	43815590	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr15:43815590C>T	ENST00000300231.5	+	4	2369	c.1919C>T	c.(1918-1920)gCc>gTc	p.A640V	MAP1A_ENST00000399453.1_Missense_Mutation_p.A640V|MAP1A_ENST00000382031.1_Missense_Mutation_p.A878V			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	640					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	AGAACAGAAGCCAGAGAGGAA	0.498																																																	0								ENSG00000166963						38.0	38.0	38.0					15																	43815590		1920	4113	6033	MAP1A	SO:0001583	missense	0			-	HGNC	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.1919C>T	15.37:g.43815590C>T	ENSP00000300231:p.Ala640Val	Somatic	0	19	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	13	45.83	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	38	0.00	0	32	38.46	20	NULL	p.A640V	ENST00000300231.5	37	c.1919	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	C	7.199	0.593065	0.13875	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.49432	0.78;0.78;0.78	5.26	2.21	0.28008	.	0.266832	0.20011	N	0.101129	T	0.41880	0.1178	M	0.72118	2.19	0.29009	N	0.886993	P	0.35575	0.51	B	0.34536	0.185	T	0.31641	-0.9936	10	0.33940	T	0.23	-4.8583	7.0206	0.24912	0.442:0.4654:0.0:0.0926	.	640	P78559	MAP1A_HUMAN	V	878;640;640	ENSP00000371462:A878V;ENSP00000382380:A640V;ENSP00000300231:A640V	ENSP00000300231:A640V	A	+	2	0	MAP1A	41602882	0.012000	0.17670	0.861000	0.33841	0.730000	0.41778	0.059000	0.14322	0.297000	0.22615	0.563000	0.77884	GCC	-	NULL		0.498	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	protein_coding	OTTHUMT00000132894.5	C	NM_002373	-		43815590	+1	no_errors	ENST00000399453	ensembl	human	known	74_37	missense	SNP	0.668	T
DOCK2	1794	genome.wustl.edu	37	5	169494557	169494557	+	Missense_Mutation	SNP	C	C	T	rs201320169		TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr5:169494557C>T	ENST00000256935.8	+	45	4591	c.4511C>T	c.(4510-4512)aCg>aTg	p.T1504M	DOCK2_ENST00000520908.1_Missense_Mutation_p.T996M|DOCK2_ENST00000540750.1_Missense_Mutation_p.T565M|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1504	DHR-2.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACCATGTCCACGGCCAATGAG	0.458													C|||	1	0.000199681	0.0	0.0	5008	,	,		20046	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000134516						164.0	148.0	153.0					5																	169494557		2203	4300	6503	DOCK2	SO:0001583	missense	0			GMAF=0.0005	HGNC	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4511C>T	5.37:g.169494557C>T	ENSP00000256935:p.Thr1504Met	Somatic	0	51	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	60	28.57	Q2M3I0|Q96AK7	Missense_Mutation	SNP	40	0.00	0	32	31.91	15	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.T1504M	ENST00000256935.8	37	c.4511	CCDS4371.1	5	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	10.59	1.394078	0.25205	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.17528	2.27;2.27;2.27	4.71	3.83	0.44106	.	0.566561	0.19162	N	0.121141	T	0.09512	0.0234	N	0.12182	0.205	0.09310	N	1	B;B;B	0.24920	0.047;0.114;0.055	B;B;B	0.15870	0.007;0.014;0.008	T	0.22661	-1.0210	10	0.41790	T	0.15	.	10.349	0.43922	0.0:0.7849:0.0:0.2151	.	996;60;1504	E7ERW7;B3KY14;Q92608	.;.;DOCK2_HUMAN	M	1504;996;565	ENSP00000256935:T1504M;ENSP00000429283:T996M;ENSP00000438827:T565M	ENSP00000256935:T1504M	T	+	2	0	DOCK2	169427135	0.000000	0.05858	0.599000	0.28851	0.951000	0.60555	0.318000	0.19504	1.101000	0.41535	0.467000	0.42956	ACG	-	pfam_DOCK_C		0.458	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	protein_coding	OTTHUMT00000252828.2	C	NM_004946	rs201320169		169494557	+1	no_errors	ENST00000256935	ensembl	human	known	74_37	missense	SNP	0.003	T
MYLK3	91807	genome.wustl.edu	37	16	46766264	46766264	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr16:46766264C>A	ENST00000394809.4	-	4	1433	c.1318G>T	c.(1318-1320)Gtt>Ttt	p.V440F	MYLK3_ENST00000536476.1_Missense_Mutation_p.V99F	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	440					cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				AGGGCCCCAACCTCGTGGTCA	0.667																																																	0								ENSG00000140795						66.0	75.0	72.0					16																	46766264		2203	4300	6503	MYLK3	SO:0001583	missense	0			-	HGNC	AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.1318G>T	16.37:g.46766264C>A	ENSP00000378288:p.Val440Phe	Somatic	0	36	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	66	25.00	B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Missense_Mutation	SNP	34	2.86	1	36	30.77	16	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V440F	ENST00000394809.4	37	c.1318	CCDS10723.2	16	.	.	.	.	.	.	.	.	.	.	C	12.35	1.911912	0.33721	.	.	ENSG00000140795	ENST00000394809;ENST00000536476	T;T	0.69040	-0.37;-0.35	5.08	-0.732	0.11147	.	1.264530	0.06160	N	0.675855	T	0.37376	0.1001	N	0.08118	0	0.09310	N	1	P;B	0.38642	0.641;0.229	B;B	0.31614	0.133;0.054	T	0.36016	-0.9765	10	0.59425	D	0.04	.	0.9642	0.01402	0.317:0.3486:0.154:0.1803	.	440;440	B5BUL9;Q32MK0	.;MYLK3_HUMAN	F	440;99	ENSP00000378288:V440F;ENSP00000439297:V99F	ENSP00000378288:V440F	V	-	1	0	MYLK3	45323765	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.417000	0.07088	0.229000	0.21039	-0.254000	0.11334	GTT	-	NULL		0.667	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYLK3	protein_coding	OTTHUMT00000255743.2	C	NM_182493	-		46766264	-1	no_errors	ENST00000394809	ensembl	human	known	74_37	missense	SNP	0.000	A
ANO4	121601	genome.wustl.edu	37	12	101490347	101490347	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr12:101490347G>T	ENST00000392977.3	+	19	1982	c.1772G>T	c.(1771-1773)aGc>aTc	p.S591I	ANO4_ENST00000299222.9_Missense_Mutation_p.S111I|ANO4_ENST00000550015.1_Missense_Mutation_p.S111I|ANO4_ENST00000392979.3_Missense_Mutation_p.S556I			Q32M45	ANO4_HUMAN	anoctamin 4	591					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						TGGGAGAACAGCTTCACCCTG	0.473										HNSCC(74;0.22)																																							0								ENSG00000151572						127.0	114.0	118.0					12																	101490347		2203	4300	6503	ANO4	SO:0001583	missense	0			-	HGNC	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.1772G>T	12.37:g.101490347G>T	ENSP00000376703:p.Ser591Ile	Somatic	0	38	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	25	0.00	0	50	0.00	0	pfam_Anoctamin	p.S591I	ENST00000392977.3	37	c.1772		12	.	.	.	.	.	.	.	.	.	.	G	31	5.084330	0.94100	.	.	ENSG00000151572	ENST00000392979;ENST00000299222;ENST00000392977;ENST00000550015	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.82628	0.5078	M	0.92459	3.31	0.80722	D	1	B;B;B	0.30361	0.18;0.277;0.107	B;B;B	0.43575	0.188;0.424;0.299	D	0.83695	0.0179	10	0.87932	D	0	.	19.5892	0.95501	0.0:0.0:1.0:0.0	.	111;591;556	Q32M45-3;Q32M45;Q32M45-2	.;ANO4_HUMAN;.	I	556;111;591;111	ENSP00000376705:S556I;ENSP00000299222:S111I;ENSP00000376703:S591I;ENSP00000450192:S111I	ENSP00000299222:S111I	S	+	2	0	ANO4	100014478	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.837000	0.99465	2.729000	0.93468	0.557000	0.71058	AGC	-	pfam_Anoctamin		0.473	ANO4-002	KNOWN	basic	protein_coding	ANO4	protein_coding	OTTHUMT00000409295.1	G	NM_178826	-		101490347	+1	no_errors	ENST00000392977	ensembl	human	known	74_37	missense	SNP	1.000	T
NUP188	23511	genome.wustl.edu	37	9	131730948	131730948	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr9:131730948A>G	ENST00000372577.2	+	9	770	c.749A>G	c.(748-750)aAt>aGt	p.N250S		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	250					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						AGGCAGACCAATAGGCACCTG	0.388																																																	0								ENSG00000095319						197.0	179.0	185.0					9																	131730948		2203	4300	6503	NUP188	SO:0001583	missense	0			-	HGNC	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.749A>G	9.37:g.131730948A>G	ENSP00000361658:p.Asn250Ser	Somatic	0	29	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	27	41.30	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	36	0.00	0	38	43.28	29	pfam_Nucleoporin_Nup188,superfamily_ARM-type_fold	p.N250S	ENST00000372577.2	37	c.749	CCDS35156.1	9	.	.	.	.	.	.	.	.	.	.	A	19.04	3.750678	0.69533	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.32515	1.45	5.52	4.34	0.51931	.	0.038682	0.85682	N	0.000000	T	0.39733	0.1089	L	0.32530	0.975	0.47476	D	0.999435	D	0.69078	0.997	D	0.73708	0.981	T	0.07635	-1.0762	10	0.22109	T	0.4	-6.7179	11.2382	0.48953	0.927:0.0:0.073:0.0	.	250	Q5SRE5	NU188_HUMAN	S	139;250	ENSP00000361658:N250S	ENSP00000349125:N139S	N	+	2	0	NUP188	130770769	1.000000	0.71417	0.968000	0.41197	0.993000	0.82548	6.883000	0.75595	0.984000	0.38629	0.455000	0.32223	AAT	-	pfam_Nucleoporin_Nup188		0.388	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP188	protein_coding	OTTHUMT00000054529.2	A		-		131730948	+1	no_errors	ENST00000372577	ensembl	human	known	74_37	missense	SNP	1.000	G
PA2G4	5036	genome.wustl.edu	37	12	56501326	56501327	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr12:56501326_56501327delAA	ENST00000303305.6	+	5	834_835	c.415_416delAA	c.(415-417)aaafs	p.K139fs	PA2G4_ENST00000552766.1_Frame_Shift_Del_p.K139fs|RP11-603J24.17_ENST00000548595.1_RNA|RP11-603J24.9_ENST00000548861.1_Frame_Shift_Del_p.K120fs	NM_006191.2	NP_006182.2	Q9UQ80	PA2G4_HUMAN	proliferation-associated 2G4, 38kDa	139					cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of translation (GO:0006417)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(18;0.0739)			AACAGGGAGGAAAGCAGATGTT	0.455																																																	0								ENSG00000170515																																			PA2G4	SO:0001589	frameshift_variant	0				HGNC	U59435, BC007561	CCDS8902.1	12q13.2	2008-09-05	2002-08-29		ENSG00000170515	ENSG00000170515			8550	protein-coding gene	gene with protein product		602145	"""proliferation-associated 2G4, 38kD"""			9345902	Standard	NM_006191		Approved		uc001sjm.3	Q9UQ80	OTTHUMG00000170173	ENST00000303305.6:c.415_416delAA	12.37:g.56501326_56501327delAA	ENSP00000302886:p.Lys139fs	Somatic	0	37	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	69	64	51.88	O43846|Q9UM59	Frame_Shift_Del	DEL	35	0.00	0	54	0.00	0	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain,tigrfam_Pap_1	p.K139fs	ENST00000303305.6	37	c.415_416	CCDS8902.1	12																																																																																			-	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain,tigrfam_Pap_1		0.455	PA2G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PA2G4	protein_coding	OTTHUMT00000407767.1	AA	NM_006191			56501327	+1	no_errors	ENST00000303305	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
DOCK7	85440	genome.wustl.edu	37	1	62961254	62961254	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr1:62961254G>T	ENST00000340370.5	-	38	4946	c.4929C>A	c.(4927-4929)taC>taA	p.Y1643*	DOCK7_ENST00000251157.5_Nonsense_Mutation_p.Y1665*	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1674					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						AATGCTACCTGTACATTAGAT	0.328																																																	0								ENSG00000116641						84.0	85.0	84.0					1																	62961254		2203	4298	6501	DOCK7	SO:0001587	stop_gained	0			-	HGNC		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.4929C>A	1.37:g.62961254G>T	ENSP00000340742:p.Tyr1643*	Somatic	0	27	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Nonsense_Mutation	SNP	25	0.00	0	38	0.00	0	pfam_DOCK_C,pfam_DOCK_C/D_N,superfamily_ARM-type_fold	p.Y1665*	ENST00000340370.5	37	c.4995	CCDS30734.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	46|46	12.410261|12.410261	0.99665|0.99665	.|.	.|.	ENSG00000116641|ENSG00000116641	ENST00000454575|ENST00000371140;ENST00000251157;ENST00000340370;ENST00000395441	.|.	.|.	.|.	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.50051|.	0.1593|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.38090|.	-0.9677|.	3|.	.|0.02654	.|T	.|1	.|.	20.5373|20.5373	0.99239|0.99239	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	K|X	837|1674;1665;1643;404	.|.	.|ENSP00000251157:Y1665X	Q|Y	-|-	1|3	0|2	DOCK7|DOCK7	62733842|62733842	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	8.023000|8.023000	0.88764|0.88764	2.857000|2.857000	0.98124|0.98124	0.650000|0.650000	0.86243|0.86243	CAG|TAC	-	NULL		0.328	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK7	protein_coding	OTTHUMT00000036806.1	G	NM_033407	-		62961254	-1	no_errors	ENST00000251157	ensembl	human	known	74_37	nonsense	SNP	1.000	T
PDGFD	80310	genome.wustl.edu	37	11	103866875	103866875	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr11:103866875C>T	ENST00000393158.2	-	3	607	c.428G>A	c.(427-429)aGa>aAa	p.R143K	PDGFD_ENST00000302251.5_Missense_Mutation_p.R137K			Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D	143	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cellular response to amino acid stimulus (GO:0071230)|multicellular organismal development (GO:0007275)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		TTGGTTCGTTCTTGATTTTAT	0.373																																																	0								ENSG00000170962						222.0	203.0	210.0					11																	103866875		2202	4299	6501	PDGFD	SO:0001583	missense	0			-	HGNC	AF113216	CCDS8326.1, CCDS41703.1	11q22.3	2008-02-05			ENSG00000170962	ENSG00000170962			30620	protein-coding gene	gene with protein product	"""spinal cord derived growth factor B"""	609673				11162582, 11980634	Standard	NM_033135		Approved	SCDGF-B, MSTP036, IEGF	uc001phq.3	Q9GZP0	OTTHUMG00000165953	ENST00000393158.2:c.428G>A	11.37:g.103866875C>T	ENSP00000376865:p.Arg143Lys	Somatic	0	53	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A8K9T6|Q9BWV5	Missense_Mutation	SNP	24	0.00	0	39	2.50	1	pfam_CUB_dom,pfam_PDGF/VEGF_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_PDGF/VEGF_dom	p.R143K	ENST00000393158.2	37	c.428	CCDS41703.1	11	.	.	.	.	.	.	.	.	.	.	C	11.27	1.590379	0.28357	.	.	ENSG00000170962	ENST00000393158;ENST00000302251;ENST00000529268	T;T;T	0.16597	2.33;2.33;2.33	5.82	4.9	0.64082	CUB (5);	0.231983	0.45126	D	0.000400	T	0.05364	0.0142	N	0.02379	-0.575	0.34568	D	0.713109	B;B	0.12630	0.006;0.005	B;B	0.12156	0.007;0.004	T	0.26155	-1.0111	10	0.02654	T	1	-15.2785	8.8378	0.35123	0.0:0.79:0.0:0.21	.	143;137	Q9GZP0;Q9GZP0-2	PDGFD_HUMAN;.	K	143;137;166	ENSP00000376865:R143K;ENSP00000302193:R137K;ENSP00000432909:R166K	ENSP00000302193:R137K	R	-	2	0	PDGFD	103372085	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.402000	0.44521	2.751000	0.94390	0.655000	0.94253	AGA	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.373	PDGFD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDGFD	protein_coding	OTTHUMT00000387231.2	C	NM_025208	-		103866875	-1	no_errors	ENST00000393158	ensembl	human	known	74_37	missense	SNP	1.000	T
LY75	4065	genome.wustl.edu	37	2	160721358	160721358	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr2:160721358G>A	ENST00000263636.4	-	14	2218	c.2191C>T	c.(2191-2193)Cgt>Tgt	p.R731C	LY75_ENST00000554112.1_Missense_Mutation_p.R731C|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.R731C|LY75_ENST00000553424.1_Missense_Mutation_p.R731C|LY75-CD302_ENST00000505052.1_Missense_Mutation_p.R731C	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	731	C-type lectin 4. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		ACTGGTGTACGATCACTCCAT	0.343																																																	0								ENSG00000054219						147.0	130.0	136.0					2																	160721358		2203	4300	6503	LY75	SO:0001583	missense	0			-	HGNC	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.2191C>T	2.37:g.160721358G>A	ENSP00000263636:p.Arg731Cys	Somatic	0	49	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	63	10.00	O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	42	0.00	0	49	10.91	6	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.R731C	ENST00000263636.4	37	c.2191	CCDS2211.1	2	.	.	.	.	.	.	.	.	.	.	G	15.07	2.723055	0.48728	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.08282	3.11;3.11;3.11;3.11;3.11	5.18	-0.865	0.10662	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	1.615210	0.04043	N	0.303362	T	0.13586	0.0329	M	0.68593	2.085	0.18873	N	0.999982	D;D;D	0.64830	0.971;0.994;0.987	P;P;B	0.49301	0.471;0.606;0.401	T	0.20207	-1.0282	10	0.62326	D	0.03	0.5959	0.7347	0.00963	0.178:0.2212:0.2335:0.3673	.	731;731;731	O60449-3;O60449;O60449-2	.;LY75_HUMAN;.	C	731	ENSP00000451511:R731C;ENSP00000451446:R731C;ENSP00000263636:R731C;ENSP00000423463:R731C;ENSP00000421035:R731C	ENSP00000423463:R731C	R	-	1	0	LY75;LY75-CD302	160429604	0.370000	0.25047	0.065000	0.19835	0.898000	0.52572	0.667000	0.25112	-0.051000	0.13334	0.555000	0.69702	CGT	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.343	LY75-001	KNOWN	basic|CCDS	protein_coding	LY75	protein_coding	OTTHUMT00000255035.1	G		-		160721358	-1	no_errors	ENST00000554112	ensembl	human	known	74_37	missense	SNP	0.019	A
ZC3H12C	85463	genome.wustl.edu	37	11	110035683	110035683	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr11:110035683G>A	ENST00000278590.3	+	6	1924	c.1873G>A	c.(1873-1875)Gac>Aac	p.D625N	ZC3H12C_ENST00000528673.1_Missense_Mutation_p.D626N|ZC3H12C_ENST00000453089.2_Missense_Mutation_p.D594N	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	625							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		CGTAGCTTCTGACTGCAGCAG	0.512																																																	0								ENSG00000149289						47.0	49.0	48.0					11																	110035683		2036	4190	6226	ZC3H12C	SO:0001583	missense	0			-	HGNC		CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.1873G>A	11.37:g.110035683G>A	ENSP00000278590:p.Asp625Asn	Somatic	0	31	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	8	50.00	B4DI65|B4DR47	Missense_Mutation	SNP	28	0.00	0	24	25.00	8	pfam_RNase_Zc3h12	p.D625N	ENST00000278590.3	37	c.1873	CCDS44727.1	11	.	.	.	.	.	.	.	.	.	.	G	14.76	2.631259	0.46944	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.30448	1.53;1.53;1.54	5.84	5.84	0.93424	.	0.051117	0.85682	D	0.000000	T	0.49626	0.1568	L	0.45581	1.43	0.40503	D	0.980663	D;D;D	0.69078	0.996;0.997;0.996	P;D;P	0.77004	0.877;0.989;0.877	T	0.17592	-1.0364	10	0.19147	T	0.46	-26.2487	20.1386	0.98045	0.0:0.0:1.0:0.0	.	626;625;625	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	N	625;626;594	ENSP00000278590:D625N;ENSP00000431821:D626N;ENSP00000413094:D594N	ENSP00000278590:D625N	D	+	1	0	ZC3H12C	109540893	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	9.281000	0.95811	2.767000	0.95098	0.561000	0.74099	GAC	-	NULL		0.512	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	ZC3H12C	protein_coding	OTTHUMT00000390491.1	G	NM_033390	-		110035683	+1	no_errors	ENST00000278590	ensembl	human	known	74_37	missense	SNP	0.995	A
MYO5B	4645	genome.wustl.edu	37	18	47431107	47431107	+	Missense_Mutation	SNP	G	G	A	rs569933953	byFrequency	TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr18:47431107G>A	ENST00000285039.7	-	20	2805	c.2506C>T	c.(2506-2508)Cgc>Tgc	p.R836C	MYO5B_ENST00000324581.6_5'Flank	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	836	Arg-rich.|IQ 3. {ECO:0000255|PROSITE- ProRule:PRU00116}.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		GCAGCTCTGCGGACCCTCTGG	0.642													G|||	4	0.000798722	0.0	0.0	5008	,	,		15762	0.0		0.0	False		,,,				2504	0.0041																0								ENSG00000167306						46.0	53.0	50.0					18																	47431107		1962	4134	6096	MYO5B	SO:0001583	missense	0			-	HGNC	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.2506C>T	18.37:g.47431107G>A	ENSP00000285039:p.Arg836Cys	Somatic	0	67	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	47	46.59	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	20	0.00	0	19	59.57	28	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R836C	ENST00000285039.7	37	c.2506	CCDS42436.1	18	.	.	.	.	.	.	.	.	.	.	G	8.664	0.901294	0.17760	.	.	ENSG00000167306	ENST00000285039	T	0.72725	-0.68	5.26	1.97	0.26223	.	0.267312	0.33875	N	0.004475	T	0.69223	0.3087	M	0.76938	2.355	0.09310	N	0.999999	B	0.17667	0.023	B	0.22753	0.041	T	0.62595	-0.6821	10	0.44086	T	0.13	.	11.8519	0.52415	0.2353:0.0:0.7647:0.0	.	836	Q9ULV0	MYO5B_HUMAN	C	836	ENSP00000285039:R836C	ENSP00000285039:R836C	R	-	1	0	MYO5B	45685105	0.012000	0.17670	0.046000	0.18839	0.107000	0.19398	1.183000	0.32041	0.577000	0.29470	0.655000	0.94253	CGC	-	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS		0.642	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	protein_coding	OTTHUMT00000448515.2	G		-		47431107	-1	no_errors	ENST00000285039	ensembl	human	known	74_37	missense	SNP	0.002	A
FLRT2	23768	genome.wustl.edu	37	14	86089224	86089224	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr14:86089224A>C	ENST00000330753.4	+	2	2133	c.1366A>C	c.(1366-1368)Aaa>Caa	p.K456Q	FLRT2_ENST00000554746.1_Missense_Mutation_p.K456Q	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	456	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		CACATGGGTGAAAATGGGCCA	0.498																																																	0								ENSG00000185070						96.0	86.0	89.0					14																	86089224		2203	4300	6503	FLRT2	SO:0001583	missense	0			-	HGNC	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1366A>C	14.37:g.86089224A>C	ENSP00000332879:p.Lys456Gln	Somatic	0	27	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	9	40.00	A0AV84|B7ZLP3	Missense_Mutation	SNP	30	0.00	0	15	34.78	8	pfam_Leu-rich_rpt,pfam_Fibronectin_type3,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_Fibronectin_type3	p.K456Q	ENST00000330753.4	37	c.1366	CCDS9877.1	14	.	.	.	.	.	.	.	.	.	.	A	19.64	3.866182	0.71949	.	.	ENSG00000185070	ENST00000330753;ENST00000554746;ENST00000535800	T;T	0.56611	0.45;0.45	6.17	6.17	0.99709	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.052776	0.85682	D	0.000000	T	0.65995	0.2745	L	0.41824	1.3	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.66073	-0.6014	10	0.52906	T	0.07	-20.0523	16.8222	0.85835	1.0:0.0:0.0:0.0	.	456	O43155	FLRT2_HUMAN	Q	456;456;109	ENSP00000332879:K456Q;ENSP00000451050:K456Q	ENSP00000332879:K456Q	K	+	1	0	FLRT2	85158977	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.485000	0.81204	2.371000	0.80710	0.533000	0.62120	AAA	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3		0.498	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT2	protein_coding	OTTHUMT00000413193.1	A		-		86089224	+1	no_errors	ENST00000330753	ensembl	human	known	74_37	missense	SNP	1.000	C
PRPF18	8559	genome.wustl.edu	37	10	13642315	13642315	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr10:13642315G>T	ENST00000378572.3	+	3	376	c.216G>T	c.(214-216)gaG>gaT	p.E72D		NM_003675.3	NP_003666.1	Q99633	PRP18_HUMAN	pre-mRNA processing factor 18	72					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	potassium channel inhibitor activity (GO:0019870)			central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(5)|prostate(1)	17						AACTGGCAGAGGAAAAATTAC	0.363																																																	0								ENSG00000165630						92.0	90.0	91.0					10																	13642315		2203	4300	6503	PRPF18	SO:0001583	missense	0			-	HGNC	U51990	CCDS7100.1	10p12.33	2013-06-10	2013-06-10		ENSG00000165630	ENSG00000165630			17351	protein-coding gene	gene with protein product		604993	"""PRP18 pre-mRNA processing factor 18 homolog (yeast)"", ""PRP18 pre-mRNA processing factor 18 homolog (S. cerevisiae)"""			9000057	Standard	XM_005252634		Approved	hPrp18	uc001imp.3	Q99633	OTTHUMG00000017702	ENST00000378572.3:c.216G>T	10.37:g.13642315G>T	ENSP00000367835:p.Glu72Asp	Somatic	0	40	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q5T9P9|Q9BUI9	Missense_Mutation	SNP	28	0.00	0	36	0.00	0	pfam_Prp18,pfam_PRP4-like,superfamily_Prp18,smart_SFM	p.E72D	ENST00000378572.3	37	c.216	CCDS7100.1	10	.	.	.	.	.	.	.	.	.	.	G	11.68	1.711123	0.30322	.	.	ENSG00000165630	ENST00000378572;ENST00000417658;ENST00000320054;ENST00000378544	.	.	.	6.07	-1.13	0.09775	.	0.089300	0.85682	D	0.000000	T	0.38108	0.1028	L	0.29908	0.895	0.47547	D	0.999451	B	0.02656	0.0	B	0.04013	0.001	T	0.19257	-1.0311	9	0.12103	T	0.63	-31.6412	12.1494	0.54042	0.4621:0.0:0.5379:0.0	.	72	Q99633	PRP18_HUMAN	D	72;66;57;66	.	ENSP00000367824:E57D	E	+	3	2	PRPF18	13682321	1.000000	0.71417	0.994000	0.49952	0.957000	0.61999	0.712000	0.25779	-0.026000	0.13895	-0.793000	0.03317	GAG	-	NULL		0.363	PRPF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF18	protein_coding	OTTHUMT00000046879.1	G		-		13642315	+1	no_errors	ENST00000378572	ensembl	human	known	74_37	missense	SNP	0.993	T
FGF13	2258	genome.wustl.edu	37	X	137717812	137717861	+	Splice_Site	DEL	AGTTCCTGCAACAAAAGTAAATAAACAAAAGTTCAGTGTTTATAGCTATG	AGTTCCTGCAACAAAAGTAAATAAACAAAAGTTCAGTGTTTATAGCTATG	-	rs376608023|rs372583629|rs368967455		TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	AGTTCCTGCAACAAAAGTAAATAAACAAAAGTTCAGTGTTTATAGCTATG	AGTTCCTGCAACAAAAGTAAATAAACAAAAGTTCAGTGTTTATAGCTATG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chrX:137717812_137717861delAGTTCCTGCAACAAAAGTAAATAAACAAAAGTTCAGTGTTTATAGCTATG	ENST00000315930.6	-	4	1064_1068	c.403_407delCATAGCTATAAACACTGAACTTTTGTTTATTTACTTTTGTTGCAGGAACT	c.(403-408)catagc>c	p.HS135fs	FGF13_ENST00000541469.1_Splice_Site_p.HS89fs|FGF13_ENST00000305414.4_Splice_Site_p.HS82fs|FGF13_ENST00000370603.3_Splice_Site_p.HS145fs|FGF13_ENST00000441825.2_Splice_Site_p.HS116fs	NM_004114.3	NP_004105.1	Q92913	FGF13_HUMAN	fibroblast growth factor 13	135	Mediates interaction with sodium channels.				cell-cell signaling (GO:0007267)|cerebral cortex cell migration (GO:0021795)|establishment of neuroblast polarity (GO:0045200)|hippocampus development (GO:0021766)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|microtubule polymerization (GO:0046785)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of microtubule depolymerization (GO:0007026)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|positive regulation of protein kinase activity (GO:0045860)|protein localization to plasma membrane (GO:0072659)|signal transduction (GO:0007165)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|filopodium (GO:0030175)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|microtubule (GO:0005874)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-tubulin binding (GO:0048487)|growth factor activity (GO:0008083)|ion channel binding (GO:0044325)|microtubule binding (GO:0008017)|protein kinase activator activity (GO:0030295)|sodium channel regulator activity (GO:0017080)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	24	Acute lymphoblastic leukemia(192;0.000127)					AGGTGTGAAAAGTTCCTGCAACAAAAGTAAATAAACAAAAGTTCAGTGTTTATAGCTATGAATTTCCTGT	0.356																																																	0								ENSG00000129682																																			FGF13	SO:0001630	splice_region_variant	0				HGNC	BC034340	CCDS14664.1, CCDS14665.1, CCDS55511.1	Xq26.3	2008-02-05			ENSG00000129682	ENSG00000129682			3670	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 2"""	300070				8790420	Standard	NM_033642		Approved	FHF2, FGF2	uc011mwj.2	Q92913	OTTHUMG00000022532	ENST00000315930.6:c.403-1CATAGCTATAAACACTGAACTTTTGTTTATTTACTTTTGTTGCAGGAACT>-	X.37:g.137717812_137717861delAGTTCCTGCAACAAAAGTAAATAAACAAAAGTTCAGTGTTTATAGCTATG		Somatic	NA	NA	NA		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B1AK18|B7Z4M7|B7Z8N0|D3DWH4|O95830|Q9NZH9|Q9NZI0	Frame_Shift_Del	DEL	15	0.00	0	18	0.00	0	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam,prints_Fibroblast_GF_fam	p.E145fs	ENST00000315930.6	37	c.437_433	CCDS14665.1	X																																																																																			-	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam		0.356	FGF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF13	protein_coding	OTTHUMT00000058534.2	AGTTCCTGCAACAAAAGTAAATAAACAAAAGTTCAGTGTTTATAGCTATG	NM_004114		Frame_Shift_Del	137717861	-1	no_errors	ENST00000370603	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000	-
U2SURP	23350	genome.wustl.edu	37	3	142720221	142720222	+	5'Flank	INS	-	-	GGACAACGA	rs3832221|rs11282240	byFrequency	TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr3:142720221_142720222insGGACAACGA	ENST00000473835.2	+	0	0				U2SURP_ENST00000397933.2_5'Flank|RP11-91G21.1_ENST00000597953.1_lincRNA|U2SURP_ENST00000493598.2_5'Flank|RP11-372E1.6_ENST00000595774.1_RNA|RP11-372E1.6_ENST00000595248.1_RNA|RP11-372E1.6_ENST00000497652.1_RNA	NM_001080415.1	NP_001073884.1	O15042	SR140_HUMAN	U2 snRNP-associated SURP domain containing						RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	31						CAGCTGGCCCTGATTCTCTGAA	0.515														3604	0.719649	0.8949	0.6988	5008	,	,		19350	0.7212		0.6183	False		,,,				2504	0.6002																0								ENSG00000241570																																			RP11-372E1.6	SO:0001631	upstream_gene_variant	0				Clone_based_vega_gene	BK000564	CCDS46928.1	3q23	2013-02-12			ENSG00000163714	ENSG00000163714		"""RNA binding motif (RRM) containing"""	30855	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein a"", ""Ser/Arg-rich domain protein, 140 kDa"", ""U2 associated SR140 protein"""					9205841, 12234937	Standard	NM_001080415		Approved	fSAPa, SR140	uc003evh.1	O15042	OTTHUMG00000159323		3.37:g.142720221_142720222insGGACAACGA	Exception_encountered	Somatic	NA	NA	NA		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A0PJ60|Q0D2M1|Q2NKQ7|Q9BR70	RNA	INS	19	47.22	17	17	15.00	3	-	NULL	ENST00000473835.2	37	NULL	CCDS46928.1	3																																																																																			-	-		0.515	U2SURP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927832	protein_coding	OTTHUMT00000354603.2	-	NM_001080415			142720222	+1	no_errors	ENST00000595248	ensembl	human	known	74_37	rna	INS	0.005:0.015	GGACAACGA
RBAK	57786	genome.wustl.edu	37	7	5103562	5103562	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr7:5103562A>G	ENST00000353796.3	+	6	799	c.475A>G	c.(475-477)Agg>Ggg	p.R159G	RBAK-RBAKDN_ENST00000407184.1_Intron|RBAK-RBAKDN_ENST00000396904.2_Intron|RBAK_ENST00000396912.1_Missense_Mutation_p.R159G	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	159					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		AAGCTATGCTAGGACAAAACC	0.343																																																	0								ENSG00000146587						82.0	81.0	82.0					7																	5103562		2203	4300	6503	RBAK	SO:0001583	missense	0			-	HGNC	AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.475A>G	7.37:g.5103562A>G	ENSP00000275423:p.Arg159Gly	Somatic	0	41	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	57	14.93	A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	SNP	36	0.00	0	31	29.55	13	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R159G	ENST00000353796.3	37	c.475	CCDS5337.1	7	.	.	.	.	.	.	.	.	.	.	A	0.001	-3.442169	0.00012	.	.	ENSG00000146587	ENST00000353796;ENST00000396912	T;T	0.07688	3.17;3.17	3.38	0.648	0.17801	.	1.121760	0.06763	N	0.782230	T	0.02455	0.0075	N	0.01529	-0.815	0.20703	N	0.99986	B	0.02656	0.0	B	0.01281	0.0	T	0.45527	-0.9255	8	.	.	.	.	0.6574	0.00837	0.4526:0.2165:0.1212:0.2097	.	159	Q9NYW8	RBAK_HUMAN	G	159	ENSP00000275423:R159G;ENSP00000380120:R159G	.	R	+	1	2	RBAK	5070088	0.000000	0.05858	0.010000	0.14722	0.018000	0.09664	0.129000	0.15830	0.120000	0.18254	0.454000	0.30748	AGG	-	NULL		0.343	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBAK	protein_coding	OTTHUMT00000241640.2	A	NM_021163	-		5103562	+1	no_errors	ENST00000353796	ensembl	human	known	74_37	missense	SNP	0.016	G
OCM2	4951	genome.wustl.edu	37	7	97616381	97616381	+	Silent	SNP	T	T	G			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr7:97616381T>G	ENST00000257627.4	-	3	373	c.282A>C	c.(280-282)ggA>ggC	p.G94G	OCM2_ENST00000473987.2_5'UTR	NM_006188.3	NP_006179.2	P0CE71	OCM2_HUMAN	oncomodulin 2	94	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			lung(4)	4						TTTTCCCATCTCCATCATTAT	0.488																																																	0								ENSG00000135175						86.0	75.0	79.0					7																	97616381		2202	4280	6482	OCM2	SO:0001819	synonymous_variant	0			-	HGNC	BC156841	CCDS5653.1	7q21.2	2014-04-01			ENSG00000135175	ENSG00000135175		"""EF-hand domain containing"""	34396	protein-coding gene	gene with protein product							Standard	NM_006188		Approved		uc003upc.3	P0CE71	OTTHUMG00000154162	ENST00000257627.4:c.282A>C	7.37:g.97616381T>G		Somatic	0	73	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	53	36.90	P32930|Q6ISI5|Q75MW0	Silent	SNP	29	0.00	0	34	19.05	8	smart_EF_hand_dom,pfscan_EF_hand_dom	p.G94	ENST00000257627.4	37	c.282	CCDS5653.1	7																																																																																			-	smart_EF_hand_dom,pfscan_EF_hand_dom		0.488	OCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCM2	protein_coding	OTTHUMT00000334188.1	T	NM_006188	-		97616381	-1	no_errors	ENST00000257627	ensembl	human	known	74_37	silent	SNP	0.997	G
MAPK6	5597	genome.wustl.edu	37	15	52356317	52356317	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr15:52356317A>T	ENST00000261845.5	+	6	2093	c.1286A>T	c.(1285-1287)gAt>gTt	p.D429V	CTD-2184D3.5_ENST00000558607.1_RNA	NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	429					cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		CAATACTCAGATCATCATGAA	0.383																																																	0								ENSG00000069956						49.0	48.0	48.0					15																	52356317		2194	4292	6486	MAPK6	SO:0001583	missense	0			-	HGNC	L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.1286A>T	15.37:g.52356317A>T	ENSP00000261845:p.Asp429Val	Somatic	0	53	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	27	62.50	B2R945|B5BU65|Q68DH4|Q8IYN8	Missense_Mutation	SNP	29	0.00	0	24	45.45	20	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_MAPK_ERK3/4	p.D429V	ENST00000261845.5	37	c.1286	CCDS10147.1	15	.	.	.	.	.	.	.	.	.	.	A	24.8	4.569905	0.86542	.	.	ENSG00000069956	ENST00000261845	T	0.48522	0.81	5.2	5.2	0.72013	.	0.042539	0.85682	D	0.000000	T	0.53190	0.1781	L	0.44542	1.39	0.80722	D	1	D	0.58268	0.982	P	0.52758	0.708	T	0.57985	-0.7716	10	0.87932	D	0	-19.857	15.2102	0.73219	1.0:0.0:0.0:0.0	.	429	Q16659	MK06_HUMAN	V	429	ENSP00000261845:D429V	ENSP00000261845:D429V	D	+	2	0	MAPK6	50143609	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.088000	0.94132	2.019000	0.59389	0.519000	0.50382	GAT	-	NULL		0.383	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK6	protein_coding	OTTHUMT00000254841.2	A	NM_002748	-		52356317	+1	no_errors	ENST00000261845	ensembl	human	known	74_37	missense	SNP	1.000	T
PRB3	5544	genome.wustl.edu	37	12	11420585	11420585	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr12:11420585G>A	ENST00000279573.7	-	3	733	c.598C>T	c.(598-600)Cgt>Tgt	p.R200C	PRB3_ENST00000440870.3_Intron|PRB3_ENST00000538488.1_Missense_Mutation_p.R179C|PRB3_ENST00000381842.3_Missense_Mutation_p.R200C			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	200	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.		Missing (in allele S).		defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)		p.R200C(1)|p.R179C(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			TTTCCCGGACGAGGTGGGGGA	0.637																																																	2	Substitution - Missense(2)	endometrium(2)						ENSG00000197870						89.0	121.0	112.0					12																	11420585		1613	3640	5253	PRB3	SO:0001583	missense	0			-	HGNC			12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.598C>T	12.37:g.11420585G>A	ENSP00000279573:p.Arg200Cys	Somatic	0	46	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	64	14.67	Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Missense_Mutation	SNP	26	0.00	0	20	39.39	13	NULL	p.R200C	ENST00000279573.7	37	c.598		12	.	.	.	.	.	.	.	.	.	.	.	4.361	0.066566	0.08388	.	.	ENSG00000197870	ENST00000381842;ENST00000538488	T;T	0.05081	3.5;3.51	0.894	-1.79	0.07932	.	20.095700	0.02208	U	0.062937	T	0.03390	0.0098	.	.	.	0.09310	N	1	P	0.50066	0.931	B	0.31390	0.129	T	0.31971	-0.9924	9	0.59425	D	0.04	.	0.3334	0.00322	0.2084:0.2458:0.2994:0.2464	.	200	Q04118	PRB3_HUMAN	C	200;179	ENSP00000371264:R200C;ENSP00000442626:R179C	ENSP00000279573:R200C	R	-	1	0	PRB3	11311852	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-1.481000	0.02323	-0.639000	0.05502	0.134000	0.15878	CGT	-	NULL		0.637	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	PRB3	protein_coding	OTTHUMT00000402119.5	G	NM_006249	-		11420585	-1	no_errors	ENST00000381842	ensembl	human	known	74_37	missense	SNP	0.000	A
ATR	545	genome.wustl.edu	37	3	142184164	142184164	+	Intron	DEL	A	A	-	rs78538255		TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr3:142184164delA	ENST00000350721.4	-	41	7019				ATR_ENST00000383101.3_Intron|RP11-383G6.3_ENST00000460977.1_RNA	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase						cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						TGAGTTATGTAAAAAAAAAAA	0.244								Other conserved DNA damage response genes																																									0								ENSG00000244327																																			RP11-383G6.3	SO:0001627	intron_variant	0				Clone_based_vega_gene	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.6898-82T>-	3.37:g.142184164delA		Somatic	0	29	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	Q59HB2|Q7KYL3|Q93051|Q9BXK4	RNA	DEL	39	0.00	0	31	6.06	2	-	NULL	ENST00000350721.4	37	NULL	CCDS3124.1	3																																																																																			-	-		0.244	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000244327	protein_coding	OTTHUMT00000353995.2	A	NM_001184			142184164	-1	no_errors	ENST00000460977	ensembl	human	known	74_37	rna	DEL	0.001	-
TMEM57	55219	genome.wustl.edu	37	1	25773365	25773365	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr1:25773365G>T	ENST00000374343.4	+	2	372	c.193G>T	c.(193-195)Gtc>Ttc	p.V65F	TMEM57_ENST00000399766.3_Missense_Mutation_p.V65F|TMEM57_ENST00000399763.3_Intron	NM_018202.4	NP_060672.2	Q8N5G2	MACOI_HUMAN	transmembrane protein 57	65					brain development (GO:0007420)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|synapse (GO:0045202)				breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	27		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)		CATCAGAAGCGTCTATGATTC	0.443																																																	0								ENSG00000204178						154.0	149.0	151.0					1																	25773365		2203	4300	6503	TMEM57	SO:0001583	missense	0			-	HGNC	AK001609	CCDS30638.1, CCDS60034.1	1p36.11	2008-02-05			ENSG00000204178	ENSG00000204178			25572	protein-coding gene	gene with protein product		610301				12459264, 15255972	Standard	XM_005245931		Approved	FLJ10747	uc001bkk.3	Q8N5G2	OTTHUMG00000003473	ENST00000374343.4:c.193G>T	1.37:g.25773365G>T	ENSP00000363463:p.Val65Phe	Somatic	0	47	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	57	21.92	B1AK00|Q2TLX5|Q2TLX6|Q9NVG6	Missense_Mutation	SNP	42	0.00	0	29	29.27	12	pfam_Macoilin,superfamily_Prefoldin	p.V65F	ENST00000374343.4	37	c.193	CCDS30638.1	1	.	.	.	.	.	.	.	.	.	.	G	30	5.050442	0.93740	.	.	ENSG00000204178	ENST00000399766;ENST00000374343	T	0.80393	-1.37	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.90800	0.7111	M	0.82323	2.585	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.81914	0.993;0.995	D	0.91219	0.5005	10	0.87932	D	0	-13.6643	19.3309	0.94288	0.0:0.0:1.0:0.0	.	65;65	Q8N5G2-3;Q8N5G2	.;MACOI_HUMAN	F	65	ENSP00000382668:V65F	ENSP00000363463:V65F	V	+	1	0	TMEM57	25645952	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.420000	0.97426	2.880000	0.98712	0.650000	0.86243	GTC	-	pfam_Macoilin		0.443	TMEM57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM57	protein_coding	OTTHUMT00000009659.2	G	NM_018202	-		25773365	+1	no_errors	ENST00000374343	ensembl	human	known	74_37	missense	SNP	1.000	T
STAB2	55576	genome.wustl.edu	37	12	104099506	104099506	+	Splice_Site	SNP	G	G	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr12:104099506G>T	ENST00000388887.2	+	37	4200		c.e37+1			NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						AACCGTCATTGTGAGTACAAT	0.423																																																	0								ENSG00000136011						118.0	102.0	108.0					12																	104099506		2203	4300	6503	STAB2	SO:0001630	splice_region_variant	0			-	HGNC	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.3996+1G>T	12.37:g.104099506G>T		Somatic	0	46	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53		Splice_Site	SNP	25	0.00	0	46	0.00	0	-	e37+1	ENST00000388887.2	37	c.3996+1	CCDS31888.1	12	.	.	.	.	.	.	.	.	.	.	G	16.11	3.029656	0.54790	.	.	ENSG00000136011	ENST00000388887;ENST00000258495	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9576	0.97228	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STAB2	102623636	1.000000	0.71417	1.000000	0.80357	0.486000	0.33341	7.241000	0.78201	2.736000	0.93811	0.655000	0.94253	.	-	-		0.423	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	protein_coding	OTTHUMT00000407089.1	G		-	Intron	104099506	+1	no_errors	ENST00000388887	ensembl	human	known	74_37	splice_site	SNP	1.000	T
CDH7	1005	genome.wustl.edu	37	18	63489324	63489324	+	Silent	SNP	C	C	A			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr18:63489324C>A	ENST00000397968.2	+	5	1059	c.633C>A	c.(631-633)atC>atA	p.I211I	CDH7_ENST00000536984.2_Silent_p.I211I|CDH7_ENST00000323011.3_Silent_p.I211I	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	211	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				CAGGAGTCATCAAGACTGCCC	0.388																																																	0								ENSG00000081138						93.0	81.0	85.0					18																	63489324		2203	4300	6503	CDH7	SO:0001819	synonymous_variant	0			-	HGNC	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.633C>A	18.37:g.63489324C>A		Somatic	0	35	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	27	27.03	Q9H157	Silent	SNP	40	0.00	0	47	17.54	10	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I211	ENST00000397968.2	37	c.633	CCDS11993.1	18																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.388	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	protein_coding	OTTHUMT00000256217.2	C	NM_033646	-		63489324	+1	no_errors	ENST00000323011	ensembl	human	known	74_37	silent	SNP	1.000	A
TRAK1	22906	genome.wustl.edu	37	3	42265243	42265243	+	3'UTR	SNP	G	G	A			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr3:42265243G>A	ENST00000327628.5	+	0	3276				RNU4-78P_ENST00000410940.1_RNA|TRAK1_ENST00000487159.1_3'UTR|TRAK1_ENST00000396175.1_3'UTR	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1						endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						CTGGAGGGGGGCCGGTTGCCC	0.587																																					GBM(44;195 884 22595 31865 41850)												0								ENSG00000182606						37.0	41.0	40.0					3																	42265243		1965	4141	6106	TRAK1	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.*14G>A	3.37:g.42265243G>A		Somatic	0	11	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	22	33.33	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	RNA	SNP	30	0.00	0	28	44.00	22	-	NULL	ENST00000327628.5	37	NULL	CCDS43072.1	3																																																																																			-	-		0.587	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TRAK1	protein_coding	OTTHUMT00000343413.1	G	NM_014965	-		42265243	+1	no_errors	ENST00000487159	ensembl	human	known	74_37	rna	SNP	0.000	A
GPRIN1	114787	genome.wustl.edu	37	5	176026016	176026016	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr5:176026016C>T	ENST00000303991.4	-	2	997	c.820G>A	c.(820-822)Gct>Act	p.A274T		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	274					neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GATGTAGGAGCGACCTTTTCT	0.512																																																	0								ENSG00000169258						185.0	185.0	185.0					5																	176026016		2203	4300	6503	GPRIN1	SO:0001583	missense	0			-	HGNC	AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.820G>A	5.37:g.176026016C>T	ENSP00000305839:p.Ala274Thr	Somatic	0	63	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	24	61.29	C9JM70|Q8ND74|Q96PZ4	Missense_Mutation	SNP	22	0.00	0	14	58.82	20	NULL	p.A274T	ENST00000303991.4	37	c.820	CCDS4405.1	5	.	.	.	.	.	.	.	.	.	.	C	4.548	0.101823	0.08731	.	.	ENSG00000169258	ENST00000303991;ENST00000335532	T	0.08546	3.08	4.09	1.22	0.21188	.	0.523893	0.14357	N	0.324728	T	0.06005	0.0156	L	0.36672	1.1	0.09310	N	1	B	0.20261	0.043	B	0.16722	0.016	T	0.44682	-0.9312	10	0.14656	T	0.56	-0.1073	6.8727	0.24129	0.0:0.5775:0.0:0.4225	.	274	Q7Z2K8	GRIN1_HUMAN	T	274	ENSP00000305839:A274T	ENSP00000305839:A274T	A	-	1	0	GPRIN1	175958622	0.000000	0.05858	0.005000	0.12908	0.008000	0.06430	-1.722000	0.01868	0.208000	0.20626	-0.448000	0.05591	GCT	-	NULL		0.512	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN1	protein_coding	OTTHUMT00000253149.1	C	NM_052899	-		176026016	-1	no_errors	ENST00000303991	ensembl	human	known	74_37	missense	SNP	0.000	T
PA2G4	5036	genome.wustl.edu	37	12	56501329	56501330	+	Frame_Shift_Ins	INS	-	-	C	rs368713215		TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr12:56501329_56501330insC	ENST00000303305.6	+	5	837_838	c.418_419insC	c.(418-420)gcafs	p.A140fs	PA2G4_ENST00000552766.1_Frame_Shift_Ins_p.A140fs|RP11-603J24.17_ENST00000548595.1_RNA|RP11-603J24.9_ENST00000548861.1_Frame_Shift_Ins_p.A121fs	NM_006191.2	NP_006182.2	Q9UQ80	PA2G4_HUMAN	proliferation-associated 2G4, 38kDa	140					cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of translation (GO:0006417)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(18;0.0739)			AGGGAGGAAAGCAGATGTTATT	0.446																																																	0								ENSG00000170515																																			PA2G4	SO:0001589	frameshift_variant	0				HGNC	U59435, BC007561	CCDS8902.1	12q13.2	2008-09-05	2002-08-29		ENSG00000170515	ENSG00000170515			8550	protein-coding gene	gene with protein product		602145	"""proliferation-associated 2G4, 38kD"""			9345902	Standard	NM_006191		Approved		uc001sjm.3	Q9UQ80	OTTHUMG00000170173	ENST00000303305.6:c.419dupC	12.37:g.56501330_56501330dupC	ENSP00000302886:p.Ala140fs	Somatic	0	35	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	69	45	60.53	O43846|Q9UM59	Frame_Shift_Ins	INS	37	0.00	0	42	63.16	72	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain,tigrfam_Pap_1	p.D141fs	ENST00000303305.6	37	c.418_419	CCDS8902.1	12																																																																																			-	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain,tigrfam_Pap_1		0.446	PA2G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PA2G4	protein_coding	OTTHUMT00000407767.1	-	NM_006191			56501330	+1	no_errors	ENST00000303305	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	C
PRPS1	5631	genome.wustl.edu	37	X	106884290	106884299	+	Intron	DEL	GAAGACTGCA	GAAGACTGCA	-			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	GAAGACTGCA	GAAGACTGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chrX:106884290_106884299delGAAGACTGCA	ENST00000372435.4	+	3	527				PRPS1_ENST00000372428.4_Intron|PRPS1_ENST00000372419.3_Frame_Shift_Del_p.LKTA155fs|PRPS1_ENST00000543248.1_Intron|PRPS1_ENST00000372418.1_Intron	NM_002764.3	NP_002755.1	P60891	PRPS1_HUMAN	phosphoribosyl pyrophosphate synthetase 1						5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|hypoxanthine biosynthetic process (GO:0046101)|nervous system development (GO:0007399)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|pyrimidine nucleotide biosynthetic process (GO:0006221)|ribonucleoside monophosphate biosynthetic process (GO:0009156)|small molecule metabolic process (GO:0044281)|urate biosynthetic process (GO:0034418)	cytosol (GO:0005829)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)			breast(3)|endometrium(2)|kidney(3)|large_intestine(3)|lung(11)|upper_aerodigestive_tract(1)	23						TGATGATGCTGAAGACTGCAGAGAAGCCAA	0.362																																																	0								ENSG00000147224																																			PRPS1	SO:0001627	intron_variant	0				HGNC	X15331	CCDS14529.1, CCDS76007.1	Xq22.3	2014-09-17			ENSG00000147224	ENSG00000147224	2.7.6.1		9462	protein-coding gene	gene with protein product	"""PRS I"", ""ribose-phosphate diphosphokinase 1"""	311850	"""deafness, X-linked 2, perceptive, congenital"""	DFN2		1962753, 20021999	Standard	NM_002764		Approved	CMTX5, DFNX1	uc004ene.4	P60891	OTTHUMG00000022167	ENST00000372435.4:c.405+60GAAGACTGCA>-	X.37:g.106884290_106884299delGAAGACTGCA		Somatic	NA	NA	NA		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B1ALA8|B2R6T7|B4DNL6|D3DUX6|P09329	Frame_Shift_Del	DEL	16	0.00	0	14	0.00	0	tigrfam_Rib-P_diPkinase	p.K156fs	ENST00000372435.4	37	c.465_474	CCDS14529.1	X																																																																																			-	NULL		0.362	PRPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPS1	protein_coding	OTTHUMT00000057840.1	GAAGACTGCA				106884299	+1	no_errors	ENST00000372419	ensembl	human	known	74_37	frame_shift_del	DEL	0.007:0.002:0.001:0.000:0.000:0.000:0.000:0.000:0.080:0.156	-
SFMBT2	57713	genome.wustl.edu	37	10	7326112	7326112	+	Splice_Site	SNP	G	G	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr10:7326112G>T	ENST00000361972.4	-	6	616	c.526C>A	c.(526-528)Cct>Act	p.P176T	SFMBT2_ENST00000397167.1_Splice_Site_p.P176T	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	176					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						CCTCGCAGAGGCTGTTTAAAC	0.378																																																	0								ENSG00000198879						60.0	60.0	60.0					10																	7326112		2202	4297	6499	SFMBT2	SO:0001630	splice_region_variant	0			-	HGNC	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.526-1C>A	10.37:g.7326112G>T		Somatic	0	41	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A7MD09|Q9HCF5	Missense_Mutation	SNP	38	0.00	0	62	0.00	0	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,superfamily_ARM-type_fold,smart_Mbt,smart_SAM,pfscan_Mbt	p.P176T	ENST00000361972.4	37	c.526	CCDS31138.1	10	.	.	.	.	.	.	.	.	.	.	g	9.223	1.033846	0.19590	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.14266	2.52;2.52	4.45	4.45	0.53987	.	0.051236	0.85682	D	0.000000	T	0.32436	0.0829	M	0.62723	1.935	0.80722	D	1	D	0.76494	0.999	D	0.70716	0.97	T	0.05818	-1.0862	10	0.18276	T	0.48	.	17.4436	0.87572	0.0:0.0:1.0:0.0	.	176	Q5VUG0	SMBT2_HUMAN	T	176	ENSP00000355109:P176T;ENSP00000380353:P176T	ENSP00000355109:P176T	P	-	1	0	SFMBT2	7366118	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.239000	0.72356	2.195000	0.70347	0.431000	0.28591	CCT	-	smart_Mbt,pfscan_Mbt		0.378	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT2	protein_coding	OTTHUMT00000046673.1	G	NM_001029880	-	Missense_Mutation	7326112	-1	no_errors	ENST00000361972	ensembl	human	known	74_37	missense	SNP	1.000	T
PDGFD	80310	genome.wustl.edu	37	11	103866883	103866883	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr11:103866883T>C	ENST00000393158.2	-	3	599	c.420A>G	c.(418-420)atA>atG	p.I140M	PDGFD_ENST00000302251.5_Missense_Mutation_p.I134M			Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D	140	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cellular response to amino acid stimulus (GO:0071230)|multicellular organismal development (GO:0007275)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		TTCTTGATTTTATCCTTGGAG	0.368																																																	0								ENSG00000170962						209.0	191.0	197.0					11																	103866883		2202	4299	6501	PDGFD	SO:0001583	missense	0			-	HGNC	AF113216	CCDS8326.1, CCDS41703.1	11q22.3	2008-02-05			ENSG00000170962	ENSG00000170962			30620	protein-coding gene	gene with protein product	"""spinal cord derived growth factor B"""	609673				11162582, 11980634	Standard	NM_033135		Approved	SCDGF-B, MSTP036, IEGF	uc001phq.3	Q9GZP0	OTTHUMG00000165953	ENST00000393158.2:c.420A>G	11.37:g.103866883T>C	ENSP00000376865:p.Ile140Met	Somatic	0	54	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A8K9T6|Q9BWV5	Missense_Mutation	SNP	22	0.00	0	41	0.00	0	pfam_CUB_dom,pfam_PDGF/VEGF_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_PDGF/VEGF_dom	p.I140M	ENST00000393158.2	37	c.420	CCDS41703.1	11	.	.	.	.	.	.	.	.	.	.	T	14.24	2.476513	0.44044	.	.	ENSG00000170962	ENST00000393158;ENST00000302251;ENST00000529268	T;T;T	0.23147	1.92;1.92;1.92	5.82	2.04	0.26737	CUB (5);	0.121353	0.56097	D	0.000028	T	0.27524	0.0676	M	0.72118	2.19	0.40894	D	0.98409	P;P	0.38677	0.642;0.589	B;B	0.42653	0.394;0.273	T	0.03969	-1.0988	10	0.52906	T	0.07	-14.2162	3.6401	0.08163	0.1256:0.0661:0.2631:0.5451	.	140;134	Q9GZP0;Q9GZP0-2	PDGFD_HUMAN;.	M	140;134;163	ENSP00000376865:I140M;ENSP00000302193:I134M;ENSP00000432909:I163M	ENSP00000302193:I134M	I	-	3	3	PDGFD	103372093	1.000000	0.71417	0.999000	0.59377	0.910000	0.53928	0.750000	0.26334	0.082000	0.17018	-1.410000	0.01125	ATA	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.368	PDGFD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDGFD	protein_coding	OTTHUMT00000387231.2	T	NM_025208	-		103866883	-1	no_errors	ENST00000393158	ensembl	human	known	74_37	missense	SNP	1.000	C
PAPD7	11044	genome.wustl.edu	37	5	6753031	6753031	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr5:6753031C>G	ENST00000230859.6	+	12	1444	c.1315C>G	c.(1315-1317)Cct>Gct	p.P439A		NM_001171805.1|NM_001171806.1|NM_006999.4	NP_001165276.1|NP_001165277.1|NP_008930.1	Q5XG87	PAPD7_HUMAN	PAP associated domain containing 7	669	PAP-associated.				double-strand break repair (GO:0006302)|mitotic chromosome condensation (GO:0007076)|response to drug (GO:0042493)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|SMC family protein binding (GO:0043221)			cervix(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						TGCTCCTGTTCCTTGCAGACA	0.542																																					NSCLC(7;212 333 5667 23379 46547)												0								ENSG00000112941						121.0	111.0	114.0					5																	6753031		2203	4300	6503	PAPD7	SO:0001583	missense	0			-	HGNC	AF089896	CCDS3871.1	5p15	2010-11-18	2010-01-19	2010-01-19	ENSG00000112941	ENSG00000112941			16705	protein-coding gene	gene with protein product	"""topoisomerase-related function protein 4-1"", ""polymerase (DNA-directed) sigma"", ""DNA polymerase kappa"", ""TUTase5"""	605198	"""polymerase (DNA directed) sigma"""	POLS		10066793, 10926539	Standard	NM_006999		Approved	POLK, TRF4, LAK-1, TRF4-1	uc003jdx.1	Q5XG87	OTTHUMG00000090457	ENST00000230859.6:c.1315C>G	5.37:g.6753031C>G	ENSP00000230859:p.Pro439Ala	Somatic	0	54	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	98	20.33	A8K1E2|M1JCE6|O43289|Q17RZ1|Q9Y6C1	Missense_Mutation	SNP	36	0.00	0	76	18.28	17	pfam_PAP_assoc,pfam_Nucleotidyltransferase	p.P439A	ENST00000230859.6	37	c.1315	CCDS3871.1	5	.	.	.	.	.	.	.	.	.	.	C	15.38	2.816673	0.50633	.	.	ENSG00000112941	ENST00000230859	T	0.31769	1.48	5.35	4.48	0.54585	.	0.184757	0.47852	N	0.000203	T	0.23846	0.0577	L	0.27053	0.805	0.42572	D	0.993187	B;B	0.10296	0.003;0.003	B;B	0.10450	0.005;0.005	T	0.04307	-1.0961	10	0.66056	D	0.02	-9.3543	13.2058	0.59795	0.0:0.8403:0.1597:0.0	.	439;439	B7ZLL4;Q5XG87	.;PAPD7_HUMAN	A	439	ENSP00000230859:P439A	ENSP00000230859:P439A	P	+	1	0	PAPD7	6806031	0.990000	0.36364	0.804000	0.32291	0.921000	0.55340	2.971000	0.49248	1.245000	0.43885	0.655000	0.94253	CCT	-	NULL		0.542	PAPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPD7	protein_coding	OTTHUMT00000206904.1	C	NM_006999	-		6753031	+1	no_errors	ENST00000230859	ensembl	human	known	74_37	missense	SNP	0.978	G
CP	1356	genome.wustl.edu	37	3	148923962	148923962	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr3:148923962G>T	ENST00000264613.6	-	6	1463	c.1201C>A	c.(1201-1203)Cct>Act	p.P401T		NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	401	F5/8 type A 2.|Plastocyanin-like 3.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	TACCTTCCAGGTGCTGTTAAG	0.373																																																	0								ENSG00000047457						96.0	99.0	98.0					3																	148923962		2203	4300	6503	CP	SO:0001583	missense	0			-	HGNC	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.1201C>A	3.37:g.148923962G>T	ENSP00000264613:p.Pro401Thr	Somatic	0	31	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q14063|Q2PP18|Q9UKS4	Missense_Mutation	SNP	32	0.00	0	37	0.00	0	pfam_Cu-oxidase_2,pfam_Cu-oxidase_3,pfam_Cu-oxidase,superfamily_Cupredoxin	p.P401T	ENST00000264613.6	37	c.1201	CCDS3141.1	3	.	.	.	.	.	.	.	.	.	.	G	11.12	1.546315	0.27652	.	.	ENSG00000047457	ENST00000264613;ENST00000494544	D;D	0.98889	-5.21;-5.21	5.81	5.81	0.92471	Cupredoxin (2);	0.893140	0.09912	N	0.739729	D	0.97420	0.9156	L	0.50333	1.59	0.25775	N	0.984797	B;B;B;B	0.18968	0.032;0.032;0.032;0.032	B;B;B;B	0.23018	0.043;0.043;0.043;0.029	D	0.92365	0.5900	10	0.36615	T	0.2	-11.3105	15.5764	0.76392	0.0:0.0:1.0:0.0	.	401;401;401;401	A5PL27;A8K5A4;P00450;Q1L857	.;.;CERU_HUMAN;.	T	401;184	ENSP00000264613:P401T;ENSP00000420545:P184T	ENSP00000264613:P401T	P	-	1	0	CP	150406652	0.141000	0.22595	0.906000	0.35671	0.983000	0.72400	0.593000	0.23999	2.756000	0.94617	0.655000	0.94253	CCT	-	superfamily_Cupredoxin		0.373	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CP	protein_coding	OTTHUMT00000317498.1	G	NM_000096	-		148923962	-1	no_errors	ENST00000264613	ensembl	human	known	74_37	missense	SNP	0.777	T
DPP6	1804	genome.wustl.edu	37	7	154598776	154598776	+	Silent	SNP	C	C	T	rs369843983		TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr7:154598776C>T	ENST00000377770.3	+	16	1761	c.1620C>T	c.(1618-1620)agC>agT	p.S540S	DPP6_ENST00000404039.1_Silent_p.S476S|DPP6_ENST00000332007.3_Silent_p.S478S|DPP6_ENST00000427557.1_Silent_p.S433S			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	540					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CCTACTTCAGCGCTTCCTTCA	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		16753	0.0		0.001	False		,,,				2504	0.0				NSCLC(125;1384 1783 2490 7422 34254)												0								ENSG00000130226	C	,,	1,4233		0,1,2116	141.0	144.0	143.0		1074,993,993	-7.9	0.1	7		143	0,8460		0,0,4230	no	coding-synonymous,coding-synonymous,coding-synonymous	DPP6	NM_001039350.1,NM_001936.3,NM_130797.2	,,	0,1,6346	TT,TC,CC		0.0,0.0236,0.0079	,,	358/684,331/657,331/657	154598776	1,12693	2117	4230	6347	DPP6	SO:0001819	synonymous_variant	0			-	HGNC	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.1620C>T	7.37:g.154598776C>T		Somatic	0	17	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	23	20.69		Silent	SNP	31	0.00	0	31	31.11	14	pfam_Peptidase_S9B,pfam_Peptidase_S9,pfam_PD40	p.S540	ENST00000377770.3	37	c.1620		7																																																																																			-	pfam_Peptidase_S9B		0.572	DPP6-003	KNOWN	basic|appris_principal	protein_coding	DPP6	protein_coding	OTTHUMT00000322932.1	C	NM_130797	-		154598776	+1	no_errors	ENST00000377770	ensembl	human	known	74_37	silent	SNP	0.841	T
MAX	4149	genome.wustl.edu	37	14	65544060	65544060	+	Intron	SNP	G	G	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr14:65544060G>T	ENST00000358664.4	-	4	426				MAX_ENST00000341653.2_Intron|MAX_ENST00000284165.6_3'UTR|MAX_ENST00000555419.1_Intron|MAX_ENST00000358402.4_Intron|MAX_ENST00000556979.1_3'UTR|MAX_ENST00000557277.1_Splice_Site|MAX_ENST00000555667.1_3'UTR|MAX_ENST00000555932.1_Intron	NM_002382.4	NP_002373.3	P61244	MAX_HUMAN	MYC associated factor X						cellular response to peptide hormone stimulus (GO:0071375)|cellular response to starvation (GO:0009267)|negative regulation of gene expression (GO:0010629)|neuron apoptotic process (GO:0051402)|protein complex assembly (GO:0006461)|response to axon injury (GO:0048678)|response to insulin (GO:0032868)|retina development in camera-type eye (GO:0060041)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)|PML body (GO:0016605)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	17				all cancers(60;0.000776)|OV - Ovarian serous cystadenocarcinoma(108;0.00359)|BRCA - Breast invasive adenocarcinoma(234;0.00999)		GTGGTTACTTGCATTTCCTTT	0.428																																																	0								ENSG00000125952						85.0	70.0	75.0					14																	65544060		692	1591	2283	MAX	SO:0001627	intron_variant	0			-	HGNC		CCDS9770.1, CCDS9771.1, CCDS9772.1, CCDS9774.1, CCDS41965.1	14q23	2014-09-17	2005-02-08		ENSG00000125952	ENSG00000125952		"""Basic helix-loop-helix proteins"""	6913	protein-coding gene	gene with protein product		154950	"""MAX protein"""			1557420	Standard	NM_002382		Approved	bHLHd4, bHLHd5, bHLHd6, bHLHd7, bHLHd8	uc001xif.2	P61244	OTTHUMG00000142809	ENST00000358664.4:c.295+570C>A	14.37:g.65544060G>T		Somatic	0	34	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	A6NH73|A8K265|A8K4G4|A8K824|P25912|P52163|Q14803|Q96CY8	Splice_Site	SNP	33	0.00	0	45	0.00	0	-	e5+2	ENST00000358664.4	37	c.312+2	CCDS9771.1	14	.	.	.	.	.	.	.	.	.	.	G	14.46	2.542921	0.45280	.	.	ENSG00000125952	ENST00000557277	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0921	0.64998	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MAX	64613813	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.235000	0.58666	2.705000	0.92388	0.585000	0.79938	.	-	-		0.428	MAX-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MAX	protein_coding	OTTHUMT00000286386.1	G	NM_197957	-		65544060	-1	no_errors	ENST00000394606	ensembl	human	known	74_37	splice_site	SNP	1.000	T
AFP	174	genome.wustl.edu	37	4	74303891	74303891	+	Splice_Site	SNP	G	G	C			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr4:74303891G>C	ENST00000395792.2	+	3	238	c.138G>C	c.(136-138)ctG>ctC	p.L46L	AFP_ENST00000226359.2_Splice_Site_p.L46L	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein	46	Albumin 1. {ECO:0000255|PROSITE- ProRule:PRU00769}.				ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TTTGTTTCAGGGCTACCATAT	0.358									Alpha-Fetoprotein, Hereditary Persistence of																																								0								ENSG00000081051						143.0	140.0	141.0					4																	74303891		2203	4300	6503	AFP	SO:0001630	splice_region_variant	0	Familial Cancer Database	HPAFP	-	HGNC	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.138-1G>C	4.37:g.74303891G>C		Somatic	0	25	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	37	28.85	B2RBU3	Silent	SNP	41	0.00	0	32	25.58	11	pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,pirsf_Serum_albumin/AFP,prints_Alpha-fetoprotein,prints_ALB/AFP/VDB	p.L46	ENST00000395792.2	37	c.138	CCDS3556.1	4																																																																																			-	pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,pirsf_Serum_albumin/AFP		0.358	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFP	protein_coding	OTTHUMT00000252284.3	G		-	Silent	74303891	+1	no_errors	ENST00000395792	ensembl	human	known	74_37	silent	SNP	1.000	C
ITSN1	6453	genome.wustl.edu	37	21	35195916	35195916	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr21:35195916G>A	ENST00000381318.3	+	25	3430	c.3142G>A	c.(3142-3144)Gga>Aga	p.G1048R	ITSN1_ENST00000399352.1_Missense_Mutation_p.G1043R|ITSN1_ENST00000381291.4_Missense_Mutation_p.G1048R|ITSN1_ENST00000399349.1_Intron|ITSN1_ENST00000381285.4_Missense_Mutation_p.G1048R|ITSN1_ENST00000399353.1_Missense_Mutation_p.G1006R|ITSN1_ENST00000437442.2_Missense_Mutation_p.G1043R|ITSN1_ENST00000399367.3_Missense_Mutation_p.G1043R|ITSN1_ENST00000399355.2_Intron|ITSN1_ENST00000399326.3_Intron|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000379960.5_Intron	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	1048	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						CGACAAGGCCGGAGTCTTCCC	0.473																																																	0								ENSG00000205726						126.0	113.0	118.0					21																	35195916		2203	4300	6503	ITSN1	SO:0001583	missense	0			-	HGNC	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.3142G>A	21.37:g.35195916G>A	ENSP00000370719:p.Gly1048Arg	Somatic	0	69	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	80	37.50	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	34	0.00	0	29	45.28	24	pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,pfam_C2_dom,superfamily_DH-domain,superfamily_C2_dom,superfamily_SH3_domain,superfamily_P-loop_NTPase,smart_EPS15_homology,smart_EF_hand_dom,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_dom,pfscan_EF_hand_dom,pfscan_EPS15_homology,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain,prints_SH3_domain,prints_p67phox	p.G1048R	ENST00000381318.3	37	c.3142	CCDS33545.1	21	.	.	.	.	.	.	.	.	.	.	G	33	5.270152	0.95429	.	.	ENSG00000205726	ENST00000399353;ENST00000381318;ENST00000381291;ENST00000381285;ENST00000381289;ENST00000399367;ENST00000399352;ENST00000437442	D;D;D;D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51;-1.51;-1.51;-1.51	5.92	5.92	0.95590	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.85682	D	0.000000	D	0.93507	0.7928	H	0.96301	3.8	0.80722	D	1	D;P;D;D;D	0.76494	0.999;0.93;0.96;0.985;0.999	P;P;P;P;D	0.72075	0.895;0.718;0.718;0.849;0.976	D	0.94719	0.7899	10	0.87932	D	0	.	20.3081	0.98638	0.0:0.0:1.0:0.0	.	1011;1043;1043;1048;1006	A7XZY7;A8CTY3;A8CTX8;Q15811;E7ERJ0	.;.;.;ITSN1_HUMAN;.	R	1006;1048;1048;1048;1043;1043;1043;1043	ENSP00000382290:G1006R;ENSP00000370719:G1048R;ENSP00000370691:G1048R;ENSP00000370685:G1048R;ENSP00000382301:G1043R;ENSP00000382289:G1043R;ENSP00000387377:G1043R	ENSP00000370685:G1048R	G	+	1	0	ITSN1	34117786	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.795000	0.96236	0.655000	0.94253	GGA	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain		0.473	ITSN1-001	KNOWN	basic|CCDS	protein_coding	ITSN1	protein_coding	OTTHUMT00000140070.4	G	NM_003024	-		35195916	+1	no_errors	ENST00000381285	ensembl	human	known	74_37	missense	SNP	1.000	A
TUBB2B	347733	genome.wustl.edu	37	6	3225580	3225580	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr6:3225580G>A	ENST00000259818.7	-	4	934	c.743C>T	c.(742-744)gCa>gTa	p.A248V	TUBB2B_ENST00000473006.1_5'UTR	NM_178012.4	NP_821080.1	Q9BVA1	TBB2B_HUMAN	tubulin, beta 2B class IIb	248					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|neuron migration (GO:0001764)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			kidney(2)|large_intestine(5)|lung(1)|prostate(1)|skin(1)	10	Ovarian(93;0.0386)	all_hematologic(90;0.108)				GCGCAGGTCTGCGTTCAGCTG	0.677																																																	0								ENSG00000137285						4.0	3.0	3.0					6																	3225580		1333	2690	4023	TUBB2B	SO:0001583	missense	0			-	HGNC	BC001352	CCDS4485.1	6p25.2	2011-10-10	2011-10-10		ENSG00000137285	ENSG00000137285		"""Tubulins"""	30829	protein-coding gene	gene with protein product	"""class IIb beta-tubulin"""	612850	"""tubulin, beta 2B"""			8619474, 9110174	Standard	NM_178012		Approved	MGC8685, DKFZp566F223, bA506K6.1	uc003mvg.3	Q9BVA1	OTTHUMG00000014143	ENST00000259818.7:c.743C>T	6.37:g.3225580G>A	ENSP00000259818:p.Ala248Val	Somatic	0	17	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	28	20.00	A8K068	Missense_Mutation	SNP	5	28.57	2	15	6.25	1	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.A248V	ENST00000259818.7	37	c.743	CCDS4485.1	6	.	.	.	.	.	.	.	.	.	.	G	7.094	0.572680	0.13623	.	.	ENSG00000137285	ENST00000259818	D	0.83163	-1.69	5.06	4.18	0.49190	Tubulin/FtsZ, 2-layer sandwich domain (1);Tubulin/FtsZ, GTPase domain (1);Tubulin/FtsZ, C-terminal (1);	0.000000	0.64402	D	0.000004	T	0.65471	0.2694	L	0.32530	0.975	0.80722	D	1	B;B;B	0.30236	0.274;0.274;0.006	B;B;B	0.27715	0.055;0.082;0.022	T	0.69647	-0.5089	10	0.87932	D	0	.	14.8705	0.70453	0.0:0.0:0.8552:0.1448	.	248;248;248	Q8IZ29;Q8IWP6;Q9BVA1	.;.;TBB2B_HUMAN	V	248	ENSP00000259818:A248V	ENSP00000259818:A248V	A	-	2	0	TUBB2B	3170579	1.000000	0.71417	0.873000	0.34254	0.159000	0.22180	9.506000	0.97992	1.121000	0.41925	-0.248000	0.11899	GCA	-	superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Gamma_tubulin		0.677	TUBB2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB2B	protein_coding	OTTHUMT00000039680.2	G	NM_178012	-		3225580	-1	no_errors	ENST00000259818	ensembl	human	known	74_37	missense	SNP	1.000	A
SYNE1	23345	genome.wustl.edu	37	6	152651745	152651745	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr6:152651745G>T	ENST00000367255.5	-	78	14676	c.14075C>A	c.(14074-14076)gCc>gAc	p.A4692D	SYNE1_ENST00000448038.1_Missense_Mutation_p.A4621D|SYNE1_ENST00000341594.5_Missense_Mutation_p.A4439D|SYNE1_ENST00000265368.4_Missense_Mutation_p.A4692D|SYNE1_ENST00000423061.1_Missense_Mutation_p.A4621D	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4692					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CAAGAATTGGGCTTCAAGTTC	0.498										HNSCC(10;0.0054)																																							0								ENSG00000131018						47.0	50.0	49.0					6																	152651745		2203	4300	6503	SYNE1	SO:0001583	missense	0			-	HGNC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.14075C>A	6.37:g.152651745G>T	ENSP00000356224:p.Ala4692Asp	Somatic	0	8	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	8	33.33	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	32	0.00	0	40	0.00	0	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.A4692D	ENST00000367255.5	37	c.14075	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	10.62	1.401878	0.25291	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67	5.93	4.81	0.61882	.	0.179711	0.38605	N	0.001629	T	0.06005	0.0156	N	0.00583	-1.355	0.80722	D	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.23368	-1.0190	10	0.10636	T	0.68	.	13.0125	0.58739	0.0:0.0:0.1516:0.8484	.	4692;4692;4692;4621	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	D	4692;4621;4692;4621;4439	ENSP00000356224:A4692D;ENSP00000396024:A4621D;ENSP00000265368:A4692D;ENSP00000390975:A4621D;ENSP00000341887:A4439D	ENSP00000265368:A4692D	A	-	2	0	SYNE1	152693438	1.000000	0.71417	0.997000	0.53966	0.860000	0.49131	6.288000	0.72679	1.111000	0.41721	0.591000	0.81541	GCC	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin		0.498	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	protein_coding	OTTHUMT00000334755.2	G	NM_182961	-		152651745	-1	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	SNP	1.000	T
AC079610.2	0	genome.wustl.edu	37	2	214142637	214142638	+	lincRNA	INS	-	-	CTTCACGGCAGCC	rs59159527|rs144537453	byFrequency	TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr2:214142637_214142638insCTTCACGGCAGCC	ENST00000360083.3	-	0	364_365				RP11-105N14.2_ENST00000606960.1_lincRNA																							atgtgagaggtcttcacggcag	0.495														545	0.108826	0.3896	0.0403	5008	,	,		20574	0.0		0.002	False		,,,				2504	0.0																0								ENSG00000196096																																			AC079610.2			0				Clone_based_vega_gene																													2.37:g.214142637_214142638insCTTCACGGCAGCC		Somatic	NA	NA	NA		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	33	21.43	9	45	15.09	8	-	NULL	ENST00000360083.3	37	NULL		2																																																																																			-	-		0.495	AC079610.2-001	KNOWN	basic	lincRNA	ENSG00000196096	lincRNA	OTTHUMT00000337357.1	-				214142638	-1	no_errors	ENST00000360083	ensembl	human	known	74_37	rna	INS	0.005:0.003	CTTCACGGCAGCC
GP6	51206	genome.wustl.edu	37	19	55530046	55530046	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr19:55530046G>C	ENST00000417454.1	-	6	725	c.698C>G	c.(697-699)tCa>tGa	p.S233*	GP6_ENST00000333884.2_Nonsense_Mutation_p.S215*|CTC-550B14.7_ENST00000586845.1_RNA|GP6_ENST00000310373.3_Nonsense_Mutation_p.S233*|CTC-550B14.7_ENST00000593060.1_RNA	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)	233					blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		GTTTGTGAATGAGACGGTCAG	0.463																																																	0								ENSG00000088053						152.0	152.0	152.0					19																	55530046		1956	4144	6100	GP6	SO:0001587	stop_gained	0			-	HGNC	AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.698C>G	19.37:g.55530046G>C	ENSP00000394922:p.Ser233*	Somatic	0	40	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	49	26.87	Q9HCN7|Q9UIF2	Nonsense_Mutation	SNP	33	0.00	0	43	30.65	19	smart_Ig_sub,smart_Ig_sub2	p.S233*	ENST00000417454.1	37	c.698	CCDS46184.1	19	.	.	.	.	.	.	.	.	.	.	g	16.82	3.228548	0.58777	.	.	ENSG00000088053	ENST00000417454;ENST00000310373;ENST00000333884	.	.	.	2.9	-1.66	0.08265	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	6.1104	0.20097	0.5377:0.0:0.4623:0.0	.	.	.	.	X	233;233;215	.	ENSP00000308782:S233X	S	-	2	0	GP6	60221858	0.003000	0.15002	0.000000	0.03702	0.004000	0.04260	-0.143000	0.10296	-0.290000	0.09025	0.655000	0.94253	TCA	-	NULL		0.463	GP6-001	KNOWN	basic|CCDS	protein_coding	GP6	protein_coding	OTTHUMT00000357006.1	G		-		55530046	-1	no_errors	ENST00000310373	ensembl	human	known	74_37	nonsense	SNP	0.000	C
CTD-2311B13.7	0	genome.wustl.edu	37	14	19969052	19969053	+	lincRNA	INS	-	-	T	rs201684221	byFrequency	TCGA-DX-A1KW-01A-22D-A24N-09	TCGA-DX-A1KW-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	63db50d6-5ef2-44d0-9906-26eae74ecf44	02de8a64-bd6d-46da-9fc5-81d2a543e25b	g.chr14:19969052_19969053insT	ENST00000547399.1	-	0	3239_3240																											AAATTTAAATATTTGAAAGTAA	0.322													?|TTT|TTTT|unsure	2476	0.494409	0.525	0.4568	5008	,	,		20938	0.3185		0.6083	False		,,,				2504	0.544																0								ENSG00000257931																																			CTD-2311B13.7			0				Clone_based_vega_gene																													14.37:g.19969055_19969055dupT		Somatic	0	8	0.00		0.5521116370841814	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	5	37.50		RNA	INS	20	44.44	16	19	48.65	18	-	NULL	ENST00000547399.1	37	NULL		14																																																																																			-	-		0.322	CTD-2311B13.7-001	KNOWN	basic	lincRNA	ENSG00000257931	lincRNA	OTTHUMT00000409457.1	-				19969053	-1	no_errors	ENST00000547399	ensembl	human	known	74_37	rna	INS	0.098:0.090	T
