#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
OFCC1	266553	genome.wustl.edu	37	6	9933033	9933033	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr6:9933033A>G	ENST00000316020.6	-	4	429	c.430T>C	c.(430-432)Ttc>Ctc	p.F144L	OFCC1_ENST00000472329.1_5'UTR			Q8IZS5	OFCC1_HUMAN	orofacial cleft 1 candidate 1	76										endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)	11	Ovarian(93;0.0473)|Breast(50;0.201)	all_hematologic(90;0.124)				GGCAGCCTGAATTTTTGTTGG	0.483																																																	0								ENSG00000181355						194.0	185.0	188.0					6																	9933033		2203	4300	6503	OFCC1	SO:0001583	missense	0			-	HGNC	AF548113		6p24.3	2010-11-23			ENSG00000181355	ENSG00000181355			21017	protein-coding gene	gene with protein product		614287					Standard	XM_003119969		Approved	MRDS1	uc003myh.1	Q8IZS5	OTTHUMG00000159104	ENST00000316020.6:c.430T>C	6.37:g.9933033A>G	ENSP00000325053:p.Phe144Leu	Somatic	0	30	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	46	16.36	Q7Z2X5|Q8IUL6|Q8IUM1|Q8IZR9|Q8IZS1|Q8IZS3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.F144L	ENST00000316020.6	37	c.430		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	1.121|1.121	-0.655274|-0.655274	0.03480|0.03480	.|.	.|.	ENSG00000181355|ENSG00000181355	ENST00000460363;ENST00000316020;ENST00000491508|ENST00000492169	T;T|.	0.28255|.	1.63;1.62|.	5.91|5.91	-0.279|-0.279	0.12890|0.12890	.|.	1.116990|.	0.06600|.	N|.	0.753683|.	T|T	0.07593|0.07593	0.0191|0.0191	.|.	.|.	.|.	0.19775|0.19775	N|N	0.999957|0.999957	B;B;B;B;B|.	0.06786|.	0.001;0.0;0.0;0.0;0.0|.	B;B;B;B;B|.	0.06405|.	0.002;0.001;0.001;0.001;0.001|.	T|T	0.37150|0.37150	-0.9718|-0.9718	8|4	.|.	.|.	.|.	6.9522|6.9522	2.2721|2.2721	0.04093|0.04093	0.3878:0.125:0.3634:0.1238|0.3878:0.125:0.3634:0.1238	.|.	76;144;76;76;76|.	B7ZLI9;Q8IZS5-2;E9PHR2;Q8IZS5;Q8IZS5-3|.	.;.;.;OFCC1_HUMAN;.|.	L|T	76;144;144|58	ENSP00000325053:F144L;ENSP00000418251:F144L|.	.|.	F|I	-|-	1|2	0|0	OFCC1|OFCC1	10041019|10041019	0.997000|0.997000	0.39634|0.39634	0.001000|0.001000	0.08648|0.08648	0.981000|0.981000	0.71138|0.71138	0.819000|0.819000	0.27308|0.27308	-0.400000|-0.400000	0.07656|0.07656	0.533000|0.533000	0.62120|0.62120	TTC|ATT	-	NULL		0.483	OFCC1-201	KNOWN	basic|appris_candidate_longest	protein_coding	OFCC1	protein_coding		A	NM_153003	-		9933033	-1	no_errors	ENST00000316020	ensembl	human	known	74_37	missense	SNP	0.831	G
PTPRC	5788	genome.wustl.edu	37	1	198663236	198663236	+	Intron	DEL	C	C	-			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr1:198663236delC	ENST00000367376.2	+	3	265				PTPRC_ENST00000442510.2_Intron|PTPRC_ENST00000348564.6_Intron|PTPRC_ENST00000594404.1_Intron|PTPRC_ENST00000391970.3_Intron|PTPRC_ENST00000352140.3_Intron|PTPRC_ENST00000413409.2_Frame_Shift_Del_p.P64fs	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C						axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						cagttggtggccaaaggcccg	0.522																																																	0								ENSG00000081237																																			PTPRC	SO:0001627	intron_variant	0				HGNC	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.94+1734C>-	1.37:g.198663236delC		Somatic	0	14	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	A8K7W6|Q16614|Q9H0Y6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PTP_recept_N	p.P64fs	ENST00000367376.2	37	c.190		1																																																																																			-	NULL		0.522	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	PTPRC	protein_coding		C				198663236	+1	no_errors	ENST00000413409	ensembl	human	putative	74_37	frame_shift_del	DEL	0.022	-
LRFN5	145581	genome.wustl.edu	37	14	42236163	42236163	+	5'UTR	SNP	C	C	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr14:42236163C>T	ENST00000298119.4	+	0	1100				LRFN5_ENST00000555279.1_3'UTR|LRFN5_ENST00000554171.1_5'UTR|LRFN5_ENST00000554120.1_5'UTR	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5							integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TTCACTCTGTCCGTCTTCTGC	0.488										HNSCC(30;0.082)																																							0								ENSG00000165379																																			LRFN5	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.-90C>T	14.37:g.42236163C>T		Somatic	0	38	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	25	16.67	B3KU78|Q86XL2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000298119.4	37	NULL	CCDS9678.1	14																																																																																			-	-		0.488	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN5	protein_coding	OTTHUMT00000276786.1	C	NM_152447	-		42236163	+1	no_errors	ENST00000555279	ensembl	human	known	74_37	rna	SNP	0.049	T
CAMSAP3	57662	genome.wustl.edu	37	19	7676960	7676960	+	Silent	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr19:7676960G>A	ENST00000160298.4	+	11	1682	c.1581G>A	c.(1579-1581)tcG>tcA	p.S527S	CAMSAP3_ENST00000446248.2_Silent_p.S554S	NM_020902.1	NP_065953.1	Q9P1Y5	CAMP3_HUMAN	calmodulin regulated spectrin-associated protein family, member 3	527	Pro-rich.				epithelial cell-cell adhesion (GO:0090136)|microtubule anchoring (GO:0034453)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of organelle organization (GO:0033043)|zonula adherens maintenance (GO:0045218)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)|zonula adherens (GO:0005915)	microtubule minus-end binding (GO:0051011)			cervix(1)|endometrium(7)|kidney(3)|lung(6)|urinary_tract(2)	19						AGACCCCCTCGAAACCATCTC	0.667																																																	0								ENSG00000076826						49.0	57.0	54.0					19																	7676960		1994	4149	6143	CAMSAP3	SO:0001819	synonymous_variant	0			-	HGNC	AB040976	CCDS42489.1, CCDS45947.1	19p13.3-p13.2	2014-06-12	2011-08-18	2011-08-18		ENSG00000076826			29307	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 80"""	612685	"""KIAA1543"""	KIAA1543		11318610, 10819331, 19041755, 19508979	Standard	NM_001080429		Approved	Nezha, PPP1R80	uc002mgu.4	Q9P1Y5		ENST00000160298.4:c.1581G>A	19.37:g.7676960G>A		Somatic	0	55	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	124	11.43	Q8NDF1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrel-like,superfamily_CH-domain	p.S554	ENST00000160298.4	37	c.1662	CCDS42489.1	19																																																																																			-	NULL		0.667	CAMSAP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CAMSAP3	protein_coding	OTTHUMT00000459300.1	G	XM_048362	-		7676960	+1	no_errors	ENST00000446248	ensembl	human	known	74_37	silent	SNP	0.003	A
DYSF	8291	genome.wustl.edu	37	2	71838463	71838463	+	Missense_Mutation	SNP	G	G	C	rs61742872	byFrequency	TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr2:71838463G>C	ENST00000258104.3	+	37	4269	c.3992G>C	c.(3991-3993)cGt>cCt	p.R1331P	DYSF_ENST00000413539.2_Missense_Mutation_p.R1362P|DYSF_ENST00000429174.2_Missense_Mutation_p.R1331P|DYSF_ENST00000410041.1_Missense_Mutation_p.R1349P|DYSF_ENST00000409762.1_Missense_Mutation_p.R1348P|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000409366.1_Missense_Mutation_p.R1332P|DYSF_ENST00000409744.1_Missense_Mutation_p.R1318P|DYSF_ENST00000394120.2_Missense_Mutation_p.R1332P|DYSF_ENST00000409582.3_Missense_Mutation_p.R1348P|DYSF_ENST00000409651.1_Missense_Mutation_p.R1363P|DYSF_ENST00000410020.3_Missense_Mutation_p.R1349P	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1331			R -> L (in dbSNP:rs61742872). {ECO:0000269|PubMed:14678801, ECO:0000269|PubMed:16010686}.		plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GCGCTCCAGCGTACCGCCATC	0.667																																																	0								ENSG00000135636						54.0	48.0	50.0					2																	71838463		2203	4300	6503	DYSF	SO:0001583	missense	0			-	HGNC	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.3992G>C	2.37:g.71838463G>C	ENSP00000258104:p.Arg1331Pro	Somatic	0	36	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	40	16.67	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_dom,superfamily_MFS_dom_general_subst_transpt,smart_C2_dom,smart_Peroxin/Ferlin,pfscan_C2_dom	p.R1362P	ENST00000258104.3	37	c.4085	CCDS1918.1	2	.	.	.	.	.	.	.	.	.	.	G	22.9	4.349135	0.82132	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	T;T;T;T;T;T;T;T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47	4.66	4.66	0.58398	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.90208	0.6939	M	0.84585	2.705	0.58432	D	0.999999	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.996;1.0;1.0;1.0;1.0;0.999;0.999;0.999;0.999;1.0;0.968;0.999;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;P;D;D;D;D	0.97110	0.947;1.0;1.0;1.0;1.0;0.98;0.971;0.971;0.987;1.0;0.907;0.956;1.0;0.999;0.999	D	0.91583	0.5280	10	0.62326	D	0.03	-12.3962	15.4144	0.74952	0.0:0.0:1.0:0.0	.	74;1363;1349;1332;1318;1349;1318;1348;1317;1362;1348;1331;1317;1332;1331	B7Z8G4;O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	P	1362;1348;1348;1331;1331;1363;1332;1318;1332;1349;1349	ENSP00000407046:R1362P;ENSP00000387137:R1348P;ENSP00000386547:R1348P;ENSP00000398305:R1331P;ENSP00000258104:R1331P;ENSP00000386683:R1363P;ENSP00000377678:R1332P;ENSP00000386285:R1318P;ENSP00000386512:R1332P;ENSP00000386881:R1349P;ENSP00000386617:R1349P	ENSP00000258104:R1331P	R	+	2	0	DYSF	71691971	1.000000	0.71417	0.912000	0.35992	0.911000	0.54048	3.882000	0.56160	2.324000	0.78689	0.561000	0.74099	CGT	-	superfamily_C2_dom		0.667	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYSF	protein_coding	OTTHUMT00000251970.3	G	NM_003494	-		71838463	+1	no_errors	ENST00000413539	ensembl	human	known	74_37	missense	SNP	1.000	C
RAB17	64284	genome.wustl.edu	37	2	238494745	238494745	+	Missense_Mutation	SNP	C	C	T	rs371995454		TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr2:238494745C>T	ENST00000264601.3	-	2	682	c.53G>A	c.(52-54)cGt>cAt	p.R18H	RAB17_ENST00000409576.1_Intron|RAB17_ENST00000416106.1_5'UTR|RAB17_ENST00000538644.1_De_novo_Start_InFrame|RAB17_ENST00000409822.1_Intron	NM_022449.3	NP_071894.1	Q9H0T7	RAB17_HUMAN	RAB17, member RAS oncogene family	18					cilium assembly (GO:0042384)|endocytic recycling (GO:0032456)|establishment of melanosome localization (GO:0032401)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|melanosome transport (GO:0032402)|protein transport (GO:0015031)|regulation of dendrite development (GO:0050773)|regulation of filopodium assembly (GO:0051489)|regulation of synapse assembly (GO:0051963)|small GTPase mediated signal transduction (GO:0007264)|transcytosis (GO:0045056)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|melanosome (GO:0042470)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(1)	4		Renal(207;0.00272)|Breast(86;0.00297)|all_hematologic(139;0.182)|Ovarian(221;0.221)		Epithelial(121;9.36e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.26e-10)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000354)|Lung(119;0.011)|LUSC - Lung squamous cell carcinoma(224;0.026)		CTTGAACACACGGGGCTGGCT	0.597																																					Colon(56;987 1029 6466 13943 27336)												0								ENSG00000124839	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	52.0	54.0	54.0		53	-9.4	0.0	2		54	1,8599	1.2+/-3.3	0,1,4299	no	missense	RAB17	NM_022449.3	29	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign	18/213	238494745	2,13004	2203	4300	6503	RAB17	SO:0001583	missense	0			-	HGNC	AK022600	CCDS2520.1	2q37.3	2008-05-23			ENSG00000124839	ENSG00000124839		"""RAB, member RAS oncogene"""	16523	protein-coding gene	gene with protein product		602206				9624171	Standard	NM_022449		Approved		uc002vwz.2	Q9H0T7	OTTHUMG00000133299	ENST00000264601.3:c.53G>A	2.37:g.238494745C>T	ENSP00000264601:p.Arg18His	Somatic	0	40	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	45	31.82	Q53QV6|Q6IA73|Q6PJZ0|Q9BVU1|Q9H9U9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R18H	ENST00000264601.3	37	c.53	CCDS2520.1	2	.	.	.	.	.	.	.	.	.	.	C	8.789	0.930036	0.18131	2.27E-4	1.16E-4	ENSG00000124839	ENST00000264601;ENST00000411462	T;T	0.80304	-1.36;-1.36	4.69	-9.38	0.00623	.	2.308260	0.01793	N	0.032400	T	0.53965	0.1829	N	0.11064	0.09	0.09310	N	0.999994	B	0.12013	0.005	B	0.04013	0.001	T	0.50491	-0.8822	10	0.21014	T	0.42	-7.2837	0.947	0.01368	0.2981:0.2465:0.2649:0.1905	.	18	Q9H0T7	RAB17_HUMAN	H	18	ENSP00000264601:R18H;ENSP00000400240:R18H	ENSP00000264601:R18H	R	-	2	0	RAB17	238159484	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	-0.960000	0.03849	-2.167000	0.00779	-0.282000	0.10007	CGT	-	pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras		0.597	RAB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB17	protein_coding	OTTHUMT00000257084.2	C		-		238494745	-1	no_errors	ENST00000264601	ensembl	human	known	74_37	missense	SNP	0.000	T
PMEL	6490	genome.wustl.edu	37	12	56355454	56355454	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr12:56355454G>A	ENST00000548747.1	-	2	801	c.139C>T	c.(139-141)Cag>Tag	p.Q47*	PMEL_ENST00000550447.1_Intron|PMEL_ENST00000550464.1_Intron|PMEL_ENST00000548689.1_5'UTR|PMEL_ENST00000539511.1_Intron|PMEL_ENST00000552882.1_Nonsense_Mutation_p.Q47*|PMEL_ENST00000548493.1_Nonsense_Mutation_p.Q47*|PMEL_ENST00000449260.2_Nonsense_Mutation_p.Q47*|PMEL_ENST00000536427.1_Nonsense_Mutation_p.Q47*|PMEL_ENST00000360714.4_Nonsense_Mutation_p.Q47*			P40967	PMEL_HUMAN	premelanosome protein	47					melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GGATACAGCTGCCTGTTCCAG	0.532																																																	0								ENSG00000185664						121.0	120.0	120.0					12																	56355454		2203	4300	6503	PMEL	SO:0001587	stop_gained	0			-	HGNC	AK092881	CCDS8897.1, CCDS55833.1, CCDS55834.1	12q13-q14	2010-12-17	2010-12-17	2010-12-17	ENSG00000185664	ENSG00000185664			10880	protein-coding gene	gene with protein product		155550	"""silver (mouse homolog) like"", ""silver homolog (mouse)"""	SIL, SILV		8739560	Standard	NM_001200053		Approved	D12S53E, SI, Pmel17, gp100	uc001siq.3	P40967		ENST00000548747.1:c.139C>T	12.37:g.56355454G>A	ENSP00000448828:p.Gln47*	Somatic	0	38	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	30	26.83	B3KS57|B7Z6D7|Q12763|Q14448|Q14817|Q16565	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PKD_dom,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_PKD_dom	p.Q47*	ENST00000548747.1	37	c.139	CCDS8897.1	12	.	.	.	.	.	.	.	.	.	.	g	15.76	2.929063	0.52759	.	.	ENSG00000185664	ENST00000449260;ENST00000552882;ENST00000548747;ENST00000548493;ENST00000360714;ENST00000536427;ENST00000548803;ENST00000547137;ENST00000546543;ENST00000549418;ENST00000549233	.	.	.	4.74	1.66	0.24008	.	0.135086	0.34676	N	0.003762	.	.	.	.	.	.	0.50039	D	0.999845	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.8075	8.7321	0.34505	0.0:0.1439:0.5606:0.2955	.	.	.	.	X	47;47;47;47;47;47;47;47;47;47;50	.	ENSP00000353940:Q47X	Q	-	1	0	PMEL	54641721	0.754000	0.28360	0.630000	0.29268	0.633000	0.38033	0.776000	0.26704	0.695000	0.31675	-0.183000	0.12914	CAG	-	NULL		0.532	PMEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMEL	protein_coding	OTTHUMT00000409626.1	G	NM_006928	-		56355454	-1	no_errors	ENST00000360714	ensembl	human	known	74_37	nonsense	SNP	0.606	A
DDX60	55601	genome.wustl.edu	37	4	169196597	169196597	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr4:169196597G>T	ENST00000393743.3	-	16	2494	c.2203C>A	c.(2203-2205)Cca>Aca	p.P735T		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	735					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		AACCGAGCTGGCCCAATGCCA	0.388																																																	0								ENSG00000137628						100.0	97.0	98.0					4																	169196597		2203	4300	6503	DDX60	SO:0001583	missense	0			-	HGNC	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.2203C>A	4.37:g.169196597G>T	ENSP00000377344:p.Pro735Thr	Somatic	0	44	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	93	16.22	Q6PK35|Q9NVE3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P735T	ENST00000393743.3	37	c.2203	CCDS34097.1	4	.	.	.	.	.	.	.	.	.	.	G	13.05	2.122182	0.37436	.	.	ENSG00000137628	ENST00000393743	T	0.20200	2.09	5.37	4.47	0.54385	.	0.094999	0.47093	D	0.000260	T	0.16085	0.0387	N	0.19112	0.55	0.31686	N	0.642464	P	0.47677	0.899	P	0.46110	0.504	T	0.03493	-1.1031	10	0.56958	D	0.05	.	8.7821	0.34798	0.0788:0.2755:0.6457:0.0	.	735	Q8IY21	DDX60_HUMAN	T	735	ENSP00000377344:P735T	ENSP00000377344:P735T	P	-	1	0	DDX60	169433172	0.973000	0.33851	0.271000	0.24616	0.326000	0.28443	0.608000	0.24223	2.667000	0.90743	0.563000	0.77884	CCA	-	NULL		0.388	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX60	protein_coding	OTTHUMT00000364622.1	G	NM_017631	-		169196597	-1	no_errors	ENST00000393743	ensembl	human	known	74_37	missense	SNP	0.971	T
TF	7018	genome.wustl.edu	37	3	133494415	133494415	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr3:133494415G>A	ENST00000402696.3	+	15	2311	c.1826G>A	c.(1825-1827)cGg>cAg	p.R609Q	TF_ENST00000264998.3_Missense_Mutation_p.R482Q	NM_001063.3	NP_001054	P02787	TRFE_HUMAN	transferrin	609	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				blood coagulation (GO:0007596)|cellular iron ion homeostasis (GO:0006879)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|retina homeostasis (GO:0001895)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|basal plasma membrane (GO:0009925)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|secretory granule lumen (GO:0034774)|vesicle (GO:0031982)	ferric iron binding (GO:0008199)			NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(7)|large_intestine(13)|liver(2)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49					Aluminium(DB01370)|Bismuth Subsalicylate(DB01294)|Gallium nitrate(DB05260)|Iron Dextran(DB00893)	GTGGTCACACGGAAAGATAAG	0.517																																																	0								ENSG00000091513						162.0	156.0	158.0					3																	133494415		2203	4300	6503	TF	SO:0001583	missense	0			-	HGNC		CCDS3080.1	3q21	2012-10-02			ENSG00000091513	ENSG00000091513			11740	protein-coding gene	gene with protein product		190000				6585826	Standard	NM_001063		Approved	PRO1557, PRO2086	uc003epv.2	P02787	OTTHUMG00000150356	ENST00000402696.3:c.1826G>A	3.37:g.133494415G>A	ENSP00000385834:p.Arg609Gln	Somatic	0	51	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	31	29.55	O43890|Q1HBA5|Q9NQB8|Q9UHV0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transferrin_fam,smart_Transferrin_fam,pirsf_Transferrin,prints_Transferrin_fam	p.R609Q	ENST00000402696.3	37	c.1826	CCDS3080.1	3	.	.	.	.	.	.	.	.	.	.	G	15.93	2.977633	0.53720	.	.	ENSG00000091513	ENST00000402696;ENST00000264998	T;T	0.52983	0.64;0.64	5.01	5.01	0.66863	.	0.122605	0.56097	D	0.000024	T	0.72317	0.3445	H	0.94734	3.575	0.29048	N	0.884657	D;D	0.69078	0.997;0.997	P;P	0.59825	0.864;0.864	T	0.74904	-0.3505	10	0.72032	D	0.01	-31.5624	12.3502	0.55144	0.0:0.0:0.8311:0.1689	.	335;609	B4DHZ6;P02787	.;TRFE_HUMAN	Q	609;482	ENSP00000385834:R609Q;ENSP00000264998:R482Q	ENSP00000264998:R482Q	R	+	2	0	TF	134977105	0.979000	0.34478	0.090000	0.20809	0.025000	0.11179	6.284000	0.72652	2.604000	0.88044	0.561000	0.74099	CGG	-	pfam_Transferrin_fam,smart_Transferrin_fam,pirsf_Transferrin		0.517	TF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TF	protein_coding	OTTHUMT00000317775.1	G	NM_001063	-		133494415	+1	no_errors	ENST00000402696	ensembl	human	known	74_37	missense	SNP	0.225	A
TUBB4A	10382	genome.wustl.edu	37	19	6495616	6495616	+	Silent	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr19:6495616G>A	ENST00000264071.2	-	4	1265	c.894C>T	c.(892-894)aaC>aaT	p.N298N	CTD-2396E7.10_ENST00000596027.1_RNA|CTD-2396E7.9_ENST00000599292.1_RNA|TUBB4A_ENST00000540257.1_Silent_p.N298N			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	298					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)										CCGCCATCATGTTCTTGGCAT	0.677																																																	0								ENSG00000104833						62.0	59.0	60.0					19																	6495616		2203	4298	6501	TUBB4A	SO:0001819	synonymous_variant	0			-	HGNC	AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.894C>T	19.37:g.6495616G>A		Somatic	0	82	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	65	111	36.93	B3KQP4|Q969E5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Alpha_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin	p.N298	ENST00000264071.2	37	c.894	CCDS12168.1	19																																																																																			-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom		0.677	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB4A	protein_coding	OTTHUMT00000457841.1	G	NM_006087	-		6495616	-1	no_errors	ENST00000264071	ensembl	human	known	74_37	silent	SNP	1.000	A
MSH3	4437	genome.wustl.edu	37	5	79950742	79950750	+	In_Frame_Del	DEL	CCCCCAGCT	CCCCCAGCT	-	rs144629981|rs3045983|rs557874766|rs1047489	byFrequency	TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	CCCCCAGCT	CCCCCAGCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr5:79950742_79950750delCCCCCAGCT	ENST00000265081.6	+	1	276_284	c.196_204delCCCCCAGCT	c.(196-204)cccccagctdel	p.PPA66del	DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000513048.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000505337.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	66					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		gCCCCCAGCGCCCCCAGCTCCCGCCTTCC	0.732								Mismatch excision repair (MMR)						1174	0.234425	0.2874	0.2061	5008	,	,		7173	0.0565		0.2535	False		,,,				2504	0.3466				Melanoma(88;1010 1399 13793 26548 36275)												0								ENSG00000113318		,	1105,2179		342,421,879					,	4.0	1.0		dbSNP_102	4	1941,4615		567,807,1904	no	coding,utr-5	DHFR,MSH3	NM_002439.3,NM_000791.3	,	909,1228,2783	A1A1,A1R,RR		29.6065,33.648,30.9553	,	,		3046,6794				MSH3	SO:0001651	inframe_deletion	0				HGNC	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.196_204delCCCCCAGCT	5.37:g.79950742_79950750delCCCCCAGCT	ENSP00000265081:p.Pro66_Ala68del	Somatic	NA	NA	NA		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mmatch_repair_MutS_con_dom,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_DNA_mismatch_repair_MutS_N,superfamily_DNA_mmatch_repair_MutS_con_dom,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.PAP67in_frame_del	ENST00000265081.6	37	c.196_204	CCDS34195.1	5																																																																																			-	NULL		0.732	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	MSH3	protein_coding	OTTHUMT00000369471.1	CCCCCAGCT	NM_002439			79950750	+1	no_errors	ENST00000265081	ensembl	human	known	74_37	in_frame_del	DEL	0.890:0.802:0.715:0.628:0.541:0.455:0.369:0.282:0.196	-
FAM174B	400451	genome.wustl.edu	37	15	93198679	93198684	+	In_Frame_Del	DEL	TGGAGC	TGGAGC	-	rs66488707|rs111725167|rs68056278	byFrequency	TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	TGGAGC	TGGAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr15:93198679_93198684delTGGAGC	ENST00000327355.5	-	1	504_509	c.206_211delGCTCCA	c.(205-213)agctccaac>aac	p.SS69del	FAM174B_ENST00000555748.1_5'Flank|FAM174B_ENST00000555696.1_5'Flank	NM_207446.2	NP_997329.2	Q3ZCQ3	F174B_HUMAN	family with sequence similarity 174, member B	69						integral component of membrane (GO:0016021)				endometrium(2)|lung(1)	3						CCACTGCTGTTGGAGCTGGAGCTGCC	0.714														4884	0.97524	0.9092	0.9942	5008	,	,		6551	1.0		1.0	False		,,,				2504	1.0																0								ENSG00000185442			1931,417		927,77,170						2.2	1.0		dbSNP_130	8	5234,70		2614,6,32	no	coding	FAM174B	NM_207446.2		3541,83,202	A1A1,A1R,RR		1.3198,17.7598,6.3643				7165,487				FAM174B	SO:0001651	inframe_deletion	0				HGNC		CCDS45355.1	15q26.1	2012-10-03			ENSG00000185442	ENSG00000185442			34339	protein-coding gene	gene with protein product							Standard	NM_207446		Approved	LOC400451, MGC102891	uc010boe.3	Q3ZCQ3	OTTHUMG00000171744	ENST00000327355.5:c.206_211delGCTCCA	15.37:g.93198685_93198690delTGGAGC	ENSP00000329040:p.Ser69_Ser70del	Somatic	NA	NA	NA		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q3ZCR9|Q8NBH7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DUF1180	p.SS69in_frame_del	ENST00000327355.5	37	c.211_206	CCDS45355.1	15																																																																																			-	pfam_DUF1180		0.714	FAM174B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM174B	protein_coding	OTTHUMT00000414931.1	TGGAGC	NM_207446			93198684	-1	no_errors	ENST00000327355	ensembl	human	known	74_37	in_frame_del	DEL	0.997:0.996:0.995:0.994:0.994:0.995	-
LCN8	138307	genome.wustl.edu	37	9	139650488	139650488	+	5'UTR	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr9:139650488G>A	ENST00000482893.1	-	0	1057				LCN8_ENST00000371688.3_Intron			Q6JVE9	LCN8_HUMAN	lipocalin 8						response to hormone (GO:0009725)|transport (GO:0006810)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)	10	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;5.56e-06)|Epithelial(140;8.32e-05)		aacagcatggggaacagtgca	0.582																																																	0								ENSG00000204001																																			LCN8	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AK124003	CCDS35183.1	9q34.3	2011-10-24	2005-01-11		ENSG00000204001	ENSG00000204001		"""Lipocalins"""	27038	protein-coding gene	gene with protein product		612902	"""chromosome 9 open reading frame 137"", ""lipocalin 5"""	LCN5			Standard	XM_005266058		Approved		uc004cjb.1	Q6JVE9	OTTHUMG00000020942	ENST00000482893.1:c.-1568C>T	9.37:g.139650488G>A		Somatic	0	116	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	77	91	45.83	A1L4A8|A6NMN9|Q5T5R4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000482893.1	37	NULL		9																																																																																			-	-		0.582	LCN8-003	KNOWN	basic	processed_transcript	LCN8	protein_coding	OTTHUMT00000055111.1	G	NM_178469	-		139650488	-1	no_errors	ENST00000482893	ensembl	human	known	74_37	rna	SNP	0.005	A
FMO5	2330	genome.wustl.edu	37	1	146658726	146658726	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr1:146658726A>G	ENST00000254090.4	-	9	1743	c.1355T>C	c.(1354-1356)cTg>cCg	p.L452P	RP11-337C18.8_ENST00000606757.1_RNA|FMO5_ENST00000369272.3_3'UTR|RP11-337C18.10_ENST00000606856.1_RNA|RP11-337C18.8_ENST00000607149.1_RNA|FMO5_ENST00000441068.2_Intron	NM_001461.2	NP_001452.2	P49326	FMO5_HUMAN	flavin containing monooxygenase 5	452						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	25	all_hematologic(923;0.0487)					AGTGAAGGCCAGAGACAGCAG	0.537																																																	0								ENSG00000131781						86.0	81.0	83.0					1																	146658726		2203	4300	6503	FMO5	SO:0001583	missense	0			-	HGNC	Z47553	CCDS926.1, CCDS44209.1, CCDS44210.1	1q21.1	2011-08-04			ENSG00000131781	ENSG00000131781			3773	protein-coding gene	gene with protein product		603957				8786146, 9119381	Standard	NM_001461		Approved		uc001epi.2	P49326	OTTHUMG00000014607	ENST00000254090.4:c.1355T>C	1.37:g.146658726A>G	ENSP00000254090:p.Leu452Pro	Somatic	0	38	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	30	23.08	B2RBG1|C9JJD1|Q8IV22	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_5,prints_Flavin_mOase_2,prints_Flavin_mOase_1	p.L452P	ENST00000254090.4	37	c.1355	CCDS926.1	1	.	.	.	.	.	.	.	.	.	.	.	21.1	4.096346	0.76870	.	.	ENSG00000131781	ENST00000254090	T	0.61742	0.08	5.8	4.67	0.58626	.	0.078821	0.52532	D	0.000071	T	0.76535	0.4001	H	0.95187	3.635	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.82372	-0.0490	10	0.87932	D	0	-2.7964	10.1529	0.42805	0.9212:0.0:0.0788:0.0	.	452	P49326	FMO5_HUMAN	P	452	ENSP00000254090:L452P	ENSP00000254090:L452P	L	-	2	0	FMO5	145125350	1.000000	0.71417	0.967000	0.41034	0.997000	0.91878	8.981000	0.93465	1.011000	0.39340	0.533000	0.62120	CTG	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase_2		0.537	FMO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO5	protein_coding	OTTHUMT00000040373.2	A	NM_001461	-		146658726	-1	no_errors	ENST00000254090	ensembl	human	known	74_37	missense	SNP	0.986	G
AMBRA1	55626	genome.wustl.edu	37	11	46419176	46419176	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr11:46419176G>A	ENST00000458649.2	-	18	4139	c.3721C>T	c.(3721-3723)Cgg>Tgg	p.R1241W	AMBRA1_ENST00000426438.1_Missense_Mutation_p.R1212W|AMBRA1_ENST00000314845.3_Missense_Mutation_p.R1151W|AMBRA1_ENST00000528950.1_Missense_Mutation_p.R1212W|AMBRA1_ENST00000298834.3_Missense_Mutation_p.R1181W|AMBRA1_ENST00000534300.1_Missense_Mutation_p.R1181W|AMBRA1_ENST00000533727.1_Missense_Mutation_p.R1122W			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	1241					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		GTTGGCTCCCGCCCAGGGGTA	0.672																																																	0								ENSG00000110497						53.0	57.0	56.0					11																	46419176		2202	4298	6500	AMBRA1	SO:0001583	missense	0			-	HGNC	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.3721C>T	11.37:g.46419176G>A	ENSP00000415327:p.Arg1241Trp	Somatic	0	47	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	42	25.00	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R1241W	ENST00000458649.2	37	c.3721		11	.	.	.	.	.	.	.	.	.	.	G	12.66	2.003501	0.35320	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000458649;ENST00000526545;ENST00000528950	T;T;T;T;T;T;T	0.72942	-0.54;-0.7;-0.29;-0.42;-0.29;-0.4;-0.42	4.49	1.39	0.22231	.	0.608753	0.15976	N	0.235541	T	0.61677	0.2366	N	0.24115	0.695	0.29365	N	0.864388	D;D;D;D;D;D	0.63880	0.978;0.987;0.993;0.987;0.987;0.987	B;P;P;P;P;P	0.47744	0.353;0.556;0.556;0.556;0.502;0.556	T	0.61926	-0.6962	10	0.87932	D	0	.	12.4494	0.55669	0.0:0.0:0.5464:0.4536	.	1241;1212;1181;1122;1244;1151	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	W	1151;1122;1181;1212;1181;1241;199;1212	ENSP00000318313:R1151W;ENSP00000433372:R1122W;ENSP00000431926:R1181W;ENSP00000410899:R1212W;ENSP00000298834:R1181W;ENSP00000415327:R1241W;ENSP00000433945:R1212W	ENSP00000298834:R1181W	R	-	1	2	AMBRA1	46375752	0.002000	0.14202	0.796000	0.32109	0.217000	0.24651	1.025000	0.30090	0.321000	0.23259	-0.268000	0.10319	CGG	-	NULL		0.672	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	protein_coding	OTTHUMT00000390103.1	G	NM_017749	-		46419176	-1	no_errors	ENST00000458649	ensembl	human	known	74_37	missense	SNP	0.887	A
PDE6B	5158	genome.wustl.edu	37	4	629751	629751	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr4:629751G>A	ENST00000496514.1	+	3	725	c.704G>A	c.(703-705)cGc>cAc	p.R235H	PDE6B_ENST00000255622.6_Missense_Mutation_p.R235H			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	235					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	GAGACGCGCCGCGGCCAGGTA	0.597																																					GBM(71;463 1194 9848 25922 46834)												0								ENSG00000133256						90.0	84.0	86.0					4																	629751		2203	4300	6503	PDE6B	SO:0001583	missense	0			-	HGNC	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.704G>A	4.37:g.629751G>A	ENSP00000420295:p.Arg235His	Somatic	0	28	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	27	27.03	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.R235H	ENST00000496514.1	37	c.704	CCDS33932.1	4	.	.	.	.	.	.	.	.	.	.	G	19.21	3.782663	0.70222	.	.	ENSG00000133256	ENST00000255622;ENST00000496514	T;T	0.71341	-0.56;-0.56	4.25	4.25	0.50352	.	0.055129	0.64402	D	0.000001	D	0.84106	0.5399	M	0.82823	2.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72982	0.953;0.979	D	0.87086	0.2169	10	0.87932	D	0	.	14.4892	0.67639	0.0:0.0:1.0:0.0	.	235;235	P35913;P35913-2	PDE6B_HUMAN;.	H	235	ENSP00000255622:R235H;ENSP00000420295:R235H	ENSP00000255622:R235H	R	+	2	0	PDE6B	619751	1.000000	0.71417	0.995000	0.50966	0.760000	0.43138	3.797000	0.55514	2.085000	0.62840	0.491000	0.48974	CGC	-	NULL		0.597	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE6B	protein_coding	OTTHUMT00000358109.1	G	NM_000283	-		629751	+1	no_errors	ENST00000496514	ensembl	human	known	74_37	missense	SNP	0.997	A
SRP14	6727	genome.wustl.edu	37	15	40328421	40328421	+	3'UTR	SNP	C	C	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr15:40328421C>T	ENST00000267884.6	-	0	595				SRP14_ENST00000558527.1_5'UTR|SRP14_ENST00000558720.1_3'UTR	NM_003134.4	NP_003125.3	P37108	SRP14_HUMAN	signal recognition particle 14kDa (homologous Alu RNA binding protein)						cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|protein targeting to ER (GO:0045047)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intercellular bridge (GO:0045171)|nucleolus (GO:0005730)|nucleus (GO:0005634)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|endoplasmic reticulum signal peptide binding (GO:0030942)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|skin(1)|upper_aerodigestive_tract(1)	3		all_cancers(109;7.56e-18)|all_epithelial(112;4.02e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.84e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0505)		CAAAAGGACCCTAATCTTATG	0.383																																																	0								ENSG00000140319																																			SRP14	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS42017.1	15q22	2008-08-15	2002-08-29		ENSG00000140319	ENSG00000140319			11299	protein-coding gene	gene with protein product		600708	"""signal recognition particle 14kD (homologous Alu RNA-binding protein)"""			8196634	Standard	NM_003134		Approved	ALURBP, MGC14326	uc001zkq.2	P37108		ENST00000267884.6:c.*113G>A	15.37:g.40328421C>T		Somatic	0	92	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	115	8.00	B5BUF5|Q6B0K5|Q96Q14	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000267884.6	37	NULL	CCDS42017.1	15																																																																																			-	-		0.383	SRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP14	protein_coding	OTTHUMT00000418262.2	C	NM_003134	-		40328421	-1	no_errors	ENST00000558527	ensembl	human	known	74_37	rna	SNP	0.010	T
AFF2	2334	genome.wustl.edu	37	X	148048590	148048590	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chrX:148048590A>G	ENST00000370460.2	+	14	3663	c.3184A>G	c.(3184-3186)Aag>Gag	p.K1062E	AFF2_ENST00000342251.3_Missense_Mutation_p.K1029E|AFF2_ENST00000286437.5_Missense_Mutation_p.K703E|AFF2_ENST00000370457.5_Missense_Mutation_p.K1027E	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	1062					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					CCGGAGACCCAAGCTCACTTT	0.522																																																	0								ENSG00000155966						194.0	162.0	173.0					X																	148048590		2203	4300	6503	AFF2	SO:0001583	missense	0			-	HGNC	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.3184A>G	X.37:g.148048590A>G	ENSP00000359489:p.Lys1062Glu	Somatic	0	44	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	60	15.49	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_AF4/FMR2	p.K1062E	ENST00000370460.2	37	c.3184	CCDS14684.1	X	.	.	.	.	.	.	.	.	.	.	A	20.5	3.995151	0.74703	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44	5.57	4.35	0.52113	.	0.226724	0.35349	N	0.003266	T	0.80037	0.4550	M	0.79693	2.465	0.42082	D	0.991251	P;D;P;D;D;D	0.67145	0.953;0.989;0.947;0.995;0.995;0.996	P;D;P;P;P;D	0.66084	0.782;0.941;0.832;0.894;0.894;0.936	T	0.82424	-0.0464	10	0.52906	T	0.07	.	12.663	0.56824	0.8535:0.1465:0.0:0.0	.	703;1027;1027;1023;1052;1062	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	E	1062;1027;1029;703	ENSP00000359489:K1062E;ENSP00000359486:K1027E;ENSP00000345459:K1029E;ENSP00000286437:K703E	ENSP00000286437:K703E	K	+	1	0	AFF2	147856284	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.270000	0.72563	1.860000	0.53959	0.417000	0.27973	AAG	-	pfam_TF_AF4/FMR2		0.522	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	protein_coding	OTTHUMT00000058673.2	A	NM_002025	-		148048590	+1	no_errors	ENST00000370460	ensembl	human	known	74_37	missense	SNP	1.000	G
ARHGAP22	58504	genome.wustl.edu	37	10	49654635	49654635	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr10:49654635T>A	ENST00000249601.4	-	10	2192	c.1896A>T	c.(1894-1896)agA>agT	p.R632S	ARHGAP22_ENST00000417247.2_Missense_Mutation_p.R542S|ARHGAP22_ENST00000435790.2_Missense_Mutation_p.R638S|ARHGAP22_ENST00000417912.2_Missense_Mutation_p.R648S|ARHGAP22_ENST00000477708.2_Missense_Mutation_p.R465S|ARHGAP22_ENST00000374172.1_Missense_Mutation_p.R523S|ARHGAP22_ENST00000374170.1_Missense_Mutation_p.R473S	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	632					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						ACATTCGTTTTCTCAGGTCAG	0.488																																																	0								ENSG00000128805						110.0	101.0	104.0					10																	49654635		2203	4300	6503	ARHGAP22	SO:0001583	missense	0			-	HGNC	AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.1896A>T	10.37:g.49654635T>A	ENSP00000249601:p.Arg632Ser	Somatic	0	35	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	40	13.04	A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.R648S	ENST00000249601.4	37	c.1944	CCDS7227.1	10	.	.	.	.	.	.	.	.	.	.	T	6.399	0.441816	0.12164	.	.	ENSG00000128805	ENST00000249601;ENST00000374172;ENST00000374170;ENST00000477708;ENST00000417247;ENST00000435790;ENST00000417912	T;T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94;0.94	4.42	1.77	0.24775	.	0.338459	0.32134	N	0.006523	T	0.45816	0.1361	L	0.57536	1.79	0.09310	N	1	P;P;P;P;P;D	0.60575	0.842;0.651;0.952;0.842;0.763;0.988	B;B;P;B;B;P	0.56216	0.257;0.165;0.523;0.165;0.242;0.794	T	0.38542	-0.9656	10	0.16420	T	0.52	.	8.3312	0.32187	0.0:0.8377:0.0:0.1623	.	638;632;648;632;542;465	B4DED8;A6NDI7;Q7Z5H3-2;Q7Z5H3;Q7Z5H3-3;D6R9V6	.;.;.;RHG22_HUMAN;.;.	S	632;523;473;465;542;638;648	ENSP00000249601:R632S;ENSP00000363287:R523S;ENSP00000363285:R473S;ENSP00000422868:R465S;ENSP00000410054:R542S;ENSP00000416701:R638S;ENSP00000412461:R648S	ENSP00000249601:R632S	R	-	3	2	ARHGAP22	49324641	0.001000	0.12720	0.016000	0.15963	0.009000	0.06853	1.192000	0.32150	0.054000	0.16065	-0.441000	0.05720	AGA	-	NULL		0.488	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGAP22	protein_coding	OTTHUMT00000358767.1	T	NM_021226	-		49654635	-1	no_errors	ENST00000417912	ensembl	human	known	74_37	missense	SNP	0.032	A
ARAP3	64411	genome.wustl.edu	37	5	141036319	141036319	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr5:141036319delT	ENST00000239440.4	-	26	3686	c.3621delA	c.(3619-3621)aaafs	p.K1207fs	ARAP3_ENST00000512390.1_5'UTR|ARAP3_ENST00000513878.1_Frame_Shift_Del_p.K869fs|ARAP3_ENST00000508305.1_Frame_Shift_Del_p.K1038fs	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	1207	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						CCAGGGGGACTTTTTTCAAGA	0.587																																																	0								ENSG00000120318						37.0	38.0	38.0					5																	141036319		2203	4300	6503	ARAP3	SO:0001589	frameshift_variant	0				HGNC	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.3621delA	5.37:g.141036319delT	ENSP00000239440:p.Lys1207fs	Somatic	0	33	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	46	20.69	B4DIT1|D3DQE3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ras-assoc,pfam_SAM_2,pfam_SAM_type1,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.V1208fs	ENST00000239440.4	37	c.3621	CCDS4266.1	5																																																																																			-	pfscan_Ras-assoc		0.587	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP3	protein_coding	OTTHUMT00000251805.1	T	NM_022481			141036319	-1	no_errors	ENST00000239440	ensembl	human	known	74_37	frame_shift_del	DEL	0.993	-
ADAM2	2515	genome.wustl.edu	37	8	39606929	39606929	+	Missense_Mutation	SNP	T	T	C	rs113117613	byFrequency	TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr8:39606929T>C	ENST00000265708.4	-	18	2019	c.1916A>G	c.(1915-1917)tAt>tGt	p.Y639C	ADAM2_ENST00000379853.2_Missense_Mutation_p.Y483C|ADAM2_ENST00000347580.4_Missense_Mutation_p.Y620C|ADAM2_ENST00000521880.1_Missense_Mutation_p.Y576C	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	639	EGF-like.				adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		TGGAGGTAAATATGAAGCACT	0.393													.|||	3	0.000599042	0.0	0.0	5008	,	,		15763	0.0		0.003	False		,,,				2504	0.0																0								ENSG00000104755	T	CYS/TYR	5,4401	9.9+/-24.2	0,5,2198	111.0	110.0	111.0		1916	-5.4	0.0	8	dbSNP_132	111	40,8560	26.3+/-74.7	0,40,4260	yes	missense	ADAM2	NM_001464.3	194	0,45,6458	CC,CT,TT		0.4651,0.1135,0.346	probably-damaging	639/736	39606929	45,12961	2203	4300	6503	ADAM2	SO:0001583	missense	0			GMAF=0.0005	HGNC	U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.1916A>G	8.37:g.39606929T>C	ENSP00000265708:p.Tyr639Cys	Somatic	0	41	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34	P78326|Q9UQQ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.Y639C	ENST00000265708.4	37	c.1916	CCDS34884.1	8	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	T	12.96	2.094542	0.36952	0.001135	0.004651	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	D;D;D;D	0.97710	-4.5;-4.5;-4.5;-4.5	4.31	-5.42	0.02640	.	.	.	.	.	D	0.98308	0.9439	M	0.90759	3.145	0.09310	N	1	D;D;D;D	0.89917	0.999;0.996;1.0;0.999	D;P;D;D	0.76071	0.98;0.819;0.987;0.971	D	0.95590	0.8654	9	0.87932	D	0	.	7.1106	0.25388	0.7051:0.0894:0.0:0.2056	.	576;483;620;639	B4DWY7;Q6P2G0;Q99965-2;Q99965	.;.;.;ADAM2_HUMAN	C	620;483;639;576	ENSP00000343854:Y620C;ENSP00000369182:Y483C;ENSP00000265708:Y639C;ENSP00000429352:Y576C	ENSP00000265708:Y639C	Y	-	2	0	ADAM2	39726086	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	-0.336000	0.07863	-0.833000	0.04245	-0.327000	0.08410	TAT	-	NULL		0.393	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM2	protein_coding	OTTHUMT00000376926.1	T	NM_001464	rs113117613		39606929	-1	no_errors	ENST00000265708	ensembl	human	known	74_37	missense	SNP	0.000	C
UNC13B	10497	genome.wustl.edu	37	9	35403170	35403170	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr9:35403170G>T	ENST00000378495.3	+	37	4466	c.4244G>T	c.(4243-4245)gGt>gTt	p.G1415V	UNC13B_ENST00000396787.1_Missense_Mutation_p.G1446V|UNC13B_ENST00000378496.4_Missense_Mutation_p.G1434V	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	1415					apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			TCAGGGTCTGGTGTGGACGAT	0.517																																																	0								ENSG00000198722						136.0	108.0	117.0					9																	35403170		2203	4300	6503	UNC13B	SO:0001583	missense	0			-	HGNC	AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.4244G>T	9.37:g.35403170G>T	ENSP00000367756:p.Gly1415Val	Somatic	0	62	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	34	56.41	Q5VYM8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.G1434V	ENST00000378495.3	37	c.4301	CCDS6579.1	9	.	.	.	.	.	.	.	.	.	.	G	19.96	3.923696	0.73213	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	D;D;D	0.84800	-1.77;-1.64;-1.9	5.11	5.11	0.69529	C2 calcium/lipid-binding domain, CaLB (1);	0.050089	0.85682	D	0.000000	D	0.89174	0.6640	M	0.73598	2.24	0.80722	D	1	D;P	0.58620	0.983;0.788	P;B	0.51016	0.656;0.256	D	0.88976	0.3404	10	0.45353	T	0.12	-19.8499	19.0942	0.93242	0.0:0.0:1.0:0.0	.	1434;1415	F8W8M9;O14795	.;UN13B_HUMAN	V	1446;1415;1434;1021	ENSP00000380006:G1446V;ENSP00000367756:G1415V;ENSP00000367757:G1434V	ENSP00000367756:G1415V	G	+	2	0	UNC13B	35393170	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.566000	0.82347	2.816000	0.96949	0.563000	0.77884	GGT	-	superfamily_C2_dom		0.517	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13B	protein_coding	OTTHUMT00000052296.1	G	NM_006377	-		35403170	+1	no_errors	ENST00000378496	ensembl	human	known	74_37	missense	SNP	1.000	T
STK32C	282974	genome.wustl.edu	37	10	134036442	134036442	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr10:134036442G>T	ENST00000368622.1	-	9	1072	c.691C>A	c.(691-693)Cag>Aag	p.Q231K	STK32C_ENST00000368625.4_Missense_Mutation_p.Q361K					serine/threonine kinase 32C											breast(1)|endometrium(2)|large_intestine(2)|lung(15)|ovary(2)|skin(1)	23		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)		GGGGCTGCCTGCACGTCCTGG	0.692																																																	0								ENSG00000165752						13.0	16.0	15.0					10																	134036442		2168	4249	6417	STK32C	SO:0001583	missense	0			-	HGNC	AK057849	CCDS7666.1	10q26.3	2004-07-22			ENSG00000165752	ENSG00000165752			21332	protein-coding gene	gene with protein product							Standard	NM_173575		Approved	PKE, MGC23665, YANK3	uc001lle.1	Q86UX6	OTTHUMG00000019285	ENST00000368622.1:c.691C>A	10.37:g.134036442G>T	ENSP00000357611:p.Gln231Lys	Somatic	0	43	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q361K	ENST00000368622.1	37	c.1081		10	.	.	.	.	.	.	.	.	.	.	G	6.222	0.409017	0.11812	.	.	ENSG00000165752	ENST00000368622;ENST00000298630;ENST00000368625	T;T;T	0.22539	1.95;1.95;1.95	3.89	2.96	0.34315	Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.198270	0.33110	U	0.005271	T	0.08935	0.0221	N	0.03050	-0.425	0.43175	D	0.994986	B;B;B	0.23806	0.091;0.0;0.0	B;B;B	0.33121	0.158;0.006;0.001	T	0.19192	-1.0313	10	0.02654	T	1	.	12.7296	0.57191	0.0:0.0:0.8341:0.1659	.	361;348;231	B7Z7J1;Q86UX6;Q86UX6-2	.;ST32C_HUMAN;.	K	231;348;361	ENSP00000357611:Q231K;ENSP00000298630:Q348K;ENSP00000357614:Q361K	ENSP00000298630:Q348K	Q	-	1	0	STK32C	133886432	1.000000	0.71417	0.995000	0.50966	0.131000	0.20780	6.661000	0.74422	0.840000	0.34995	0.479000	0.44913	CAG	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.692	STK32C-001	KNOWN	basic	protein_coding	STK32C	protein_coding	OTTHUMT00000051068.2	G	NM_173575	-		134036442	-1	no_errors	ENST00000368625	ensembl	human	known	74_37	missense	SNP	1.000	T
FAM221B	392307	genome.wustl.edu	37	9	35818940	35818940	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr9:35818940T>C	ENST00000423537.2	-	6	1387	c.1118A>G	c.(1117-1119)cAc>cGc	p.H373R	TMEM8B_ENST00000377996.1_Intron	NM_001012446.3	NP_001012448.2	A6H8Z2	F221B_HUMAN	family with sequence similarity 221, member B	373										endometrium(2)|kidney(1)|lung(4)	7						GAAAGTCTCGTGTTCCTCCCA	0.577																																																	0								ENSG00000204930						59.0	60.0	60.0					9																	35818940		692	1591	2283	FAM221B	SO:0001583	missense	0			-	HGNC	BX648702	CCDS43799.1, CCDS43799.2	9p13.3	2012-04-02	2012-04-02	2012-04-02	ENSG00000204930	ENSG00000204930			30762	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 128"""	C9orf128			Standard	NM_001012446		Approved		uc010mlc.2	A6H8Z2	OTTHUMG00000019880	ENST00000423537.2:c.1118A>G	9.37:g.35818940T>C	ENSP00000415299:p.His373Arg	Somatic	0	67	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	143	10.06	Q5TCW2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.H373R	ENST00000423537.2	37	c.1118	CCDS43799.2	9	.	.	.	.	.	.	.	.	.	.	T	16.32	3.091353	0.55968	.	.	ENSG00000204930	ENST00000423537	T	0.32753	1.44	5.42	5.42	0.78866	.	.	.	.	.	T	0.59088	0.2168	M	0.85945	2.785	0.30313	N	0.7883	D	0.89917	1.0	D	0.91635	0.999	T	0.64807	-0.6320	9	0.87932	D	0	-7.4838	11.9076	0.52721	0.0:0.0:0.0:1.0	.	373	A6H8Z2	CI128_HUMAN	R	373	ENSP00000415299:H373R	ENSP00000415299:H373R	H	-	2	0	C9orf128	35808940	0.997000	0.39634	0.998000	0.56505	0.168000	0.22595	3.192000	0.50989	2.071000	0.62044	0.456000	0.33151	CAC	-	NULL		0.577	FAM221B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM221B	protein_coding	OTTHUMT00000355861.1	T	NM_001012446	-		35818940	-1	no_errors	ENST00000423537	ensembl	human	known	74_37	missense	SNP	0.999	C
OR2V2	285659	genome.wustl.edu	37	5	180582588	180582588	+	Missense_Mutation	SNP	G	G	A	rs528232543		TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr5:180582588G>A	ENST00000328275.1	+	1	646	c.646G>A	c.(646-648)Gtg>Atg	p.V216M		NM_206880.1	NP_996763.1	Q96R30	OR2V2_HUMAN	olfactory receptor, family 2, subfamily V, member 2	216						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTCCATCATCGTGGCCTCCTA	0.522													g|||	1	0.000199681	0.0	0.0	5008	,	,		23622	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000182613						270.0	256.0	261.0					5																	180582588		2203	4300	6503	OR2V2	SO:0001583	missense	0			-	HGNC	AL161615	CCDS4461.1	5q35.3	2012-08-09			ENSG00000182613	ENSG00000182613		"""GPCR / Class A : Olfactory receptors"""	15341	protein-coding gene	gene with protein product				OR2V3			Standard	NM_206880		Approved	OST713	uc011dhj.2	Q96R30	OTTHUMG00000130933	ENST00000328275.1:c.646G>A	5.37:g.180582588G>A	ENSP00000332185:p.Val216Met	Somatic	1	126	0.79		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	150	26.47	Q6IFL6|Q8NGV1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V216M	ENST00000328275.1	37	c.646	CCDS4461.1	5	.	.	.	.	.	.	.	.	.	.	.	1.653	-0.513416	0.04200	.	.	ENSG00000182613	ENST00000328275	T	0.00282	8.31	3.26	-0.0587	0.13796	GPCR, rhodopsin-like superfamily (1);	0.520048	0.14343	N	0.325617	T	0.00144	0.0004	L	0.32530	0.975	0.09310	N	1	P	0.39862	0.692	B	0.34180	0.177	T	0.29549	-1.0008	10	0.48119	T	0.1	.	1.4747	0.02423	0.1195:0.1793:0.3362:0.365	.	216	Q96R30	OR2V2_HUMAN	M	216	ENSP00000332185:V216M	ENSP00000332185:V216M	V	+	1	0	OR2V2	180515194	0.000000	0.05858	0.475000	0.27278	0.246000	0.25737	-1.950000	0.01530	0.186000	0.20125	-0.704000	0.03662	GTG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.522	OR2V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2V2	protein_coding	OTTHUMT00000253529.1	G		-		180582588	+1	no_errors	ENST00000328275	ensembl	human	known	74_37	missense	SNP	0.052	A
STK17B	9262	genome.wustl.edu	37	2	197021263	197021263	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr2:197021263G>T	ENST00000263955.4	-	3	521	c.235C>A	c.(235-237)Cac>Aac	p.H79N	STK17B_ENST00000409228.1_Missense_Mutation_p.H79N|RP11-347P5.1_ENST00000606818.1_RNA	NM_004226.3	NP_004217.1	O94768	ST17B_HUMAN	serine/threonine kinase 17b	79	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(10)	15			OV - Ovarian serous cystadenocarcinoma(117;0.141)			GCAATCTCGTGTAAAATTTCT	0.348																																																	0								ENSG00000081320						96.0	89.0	92.0					2																	197021263		2203	4300	6503	STK17B	SO:0001583	missense	0			-	HGNC	AB011421	CCDS2315.1	2q33.1	2008-02-05	2007-02-12		ENSG00000081320	ENSG00000081320			11396	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 2"""	604727	"""serine/threonine kinase 17b (apoptosis-inducing)"""			9786912	Standard	NM_004226		Approved	DRAK2	uc002utk.3	O94768	OTTHUMG00000132735	ENST00000263955.4:c.235C>A	2.37:g.197021263G>T	ENSP00000263955:p.His79Asn	Somatic	0	45	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	50	9.09		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.H79N	ENST00000263955.4	37	c.235	CCDS2315.1	2	.	.	.	.	.	.	.	.	.	.	G	16.30	3.085871	0.55861	.	.	ENSG00000081320	ENST00000263955;ENST00000409228	T;T	0.47177	0.85;0.85	5.1	5.1	0.69264	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.51477	D	0.000085	T	0.43831	0.1265	N	0.04787	-0.16	0.58432	D	0.999997	P	0.49862	0.929	P	0.55011	0.766	T	0.51529	-0.8694	10	0.42905	T	0.14	.	18.7644	0.91866	0.0:0.0:1.0:0.0	.	79	O94768	ST17B_HUMAN	N	79	ENSP00000263955:H79N;ENSP00000386853:H79N	ENSP00000263955:H79N	H	-	1	0	STK17B	196729508	1.000000	0.71417	0.913000	0.36048	0.552000	0.35366	5.979000	0.70508	2.658000	0.90341	0.650000	0.86243	CAC	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.348	STK17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK17B	protein_coding	OTTHUMT00000256092.2	G		-		197021263	-1	no_errors	ENST00000263955	ensembl	human	known	74_37	missense	SNP	0.993	T
NPIPB11	728888	genome.wustl.edu	37	16	29394193	29394193	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr16:29394193G>A	ENST00000524087.1	-	8	2134	c.2060C>T	c.(2059-2061)cCg>cTg	p.P687L	SNX29P2_ENST00000398878.3_lincRNA			E5RHQ5	NPB11_HUMAN	nuclear pore complex interacting protein family, member B11	687	Pro-rich.					integral component of membrane (GO:0016021)											GCTGACGCTCGGAAGGTGTCT	0.597																																																	0								ENSG00000254206																																			NPIPB11	SO:0001583	missense	0			-	HGNC			16p11.2	2013-06-11			ENSG00000254206	ENSG00000254206			37453	protein-coding gene	gene with protein product							Standard	XM_006721110		Approved			E5RHQ5	OTTHUMG00000170467	ENST00000524087.1:c.2060C>T	16.37:g.29394193G>A	ENSP00000430853:p.Pro687Leu	Somatic	0	19	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	29	19.44		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P687L	ENST00000524087.1	37	c.2060		16	.	.	.	.	.	.	.	.	.	.	g	9.720	1.159423	0.21454	.	.	ENSG00000254206	ENST00000524087	T	0.29917	1.55	.	.	.	.	.	.	.	.	T	0.19644	0.0472	N	0.19112	0.55	0.09310	N	1	.	.	.	.	.	.	T	0.26018	-1.0115	5	0.48119	T	0.1	.	.	.	.	.	.	.	.	L	687	ENSP00000430853:P687L	ENSP00000430853:P687L	P	-	2	0	RP11-231C14.2	29301694	.	.	0.002000	0.10522	0.002000	0.02628	.	.	0.073000	0.16731	0.074000	0.15403	CCG	-	NULL		0.597	NPIPB11-001	PUTATIVE	not_best_in_genome_evidence|basic|appris_principal	protein_coding	NPIPB11	protein_coding	OTTHUMT00000374094.1	G	XM_002343430	-		29394193	-1	no_errors	ENST00000524087	ensembl	human	putative	74_37	missense	SNP	0.002	A
PCDHB3	56132	genome.wustl.edu	37	5	140481898	140481898	+	Silent	SNP	C	C	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr5:140481898C>T	ENST00000231130.2	+	1	1665	c.1665C>T	c.(1663-1665)aaC>aaT	p.N555N	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	555	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGACGCCAACGACAACTCGC	0.711																																																	0								ENSG00000113205						15.0	17.0	17.0					5																	140481898		2149	4225	6374	PCDHB3	SO:0001819	synonymous_variant	0			-	HGNC	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1665C>T	5.37:g.140481898C>T		Somatic	0	123	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	125	13.79	B2R8P2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N555	ENST00000231130.2	37	c.1665	CCDS4245.1	5																																																																																			-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.711	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB3	protein_coding	OTTHUMT00000251817.2	C	NM_018937	-		140481898	+1	no_errors	ENST00000231130	ensembl	human	known	74_37	silent	SNP	1.000	T
SAG	6295	genome.wustl.edu	37	2	234229408	234229408	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr2:234229408C>A	ENST00000409110.1	+	5	544	c.314C>A	c.(313-315)aCa>aAa	p.T105K	SAG_ENST00000449594.2_5'UTR	NM_000541.4	NP_000532.2	P10523	ARRS_HUMAN	S-antigen; retina and pineal gland (arrestin)	105					cell surface receptor signaling pathway (GO:0007166)|negative regulation of catalytic activity (GO:0043086)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cytosol (GO:0005829)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|kidney(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		AGCACCCCCACAAAACTGCAA	0.612																																																	0								ENSG00000130561						31.0	33.0	32.0					2																	234229408		1921	4127	6048	SAG	SO:0001583	missense	0			-	HGNC		CCDS46545.1	2q37.1	2013-02-14			ENSG00000130561	ENSG00000130561			10521	protein-coding gene	gene with protein product	"""arrestin 1"""	181031				2249983	Standard	NM_000541		Approved	ARRESTIN, RP47	uc002vuh.2	P10523	OTTHUMG00000153213	ENST00000409110.1:c.314C>A	2.37:g.234229408C>A	ENSP00000386444:p.Thr105Lys	Somatic	0	39	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	80	12.09	A0FDN6|Q53SV3|Q99858	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set,prints_Arrestin	p.T105K	ENST00000409110.1	37	c.314	CCDS46545.1	2	.	.	.	.	.	.	.	.	.	.	C	16.70	3.194688	0.58017	.	.	ENSG00000130561	ENST00000252857;ENST00000447536;ENST00000409110	T;T	0.22743	1.94;1.94	4.46	4.46	0.54185	Arrestin, N-terminal (1);Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	0.048719	0.85682	D	0.000000	T	0.35624	0.0938	M	0.90082	3.085	0.80722	D	1	D	0.54047	0.964	B	0.40741	0.339	T	0.58662	-0.7597	10	0.87932	D	0	-20.9552	17.7003	0.88292	0.0:1.0:0.0:0.0	.	105	P10523	ARRS_HUMAN	K	105	ENSP00000408937:T105K;ENSP00000386444:T105K	ENSP00000252857:T105K	T	+	2	0	SAG	233894147	0.866000	0.29940	0.091000	0.20842	0.525000	0.34531	5.108000	0.64609	2.474000	0.83562	0.655000	0.94253	ACA	-	pfam_Arrestin-like_N,superfamily_Ig_E-set		0.612	SAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAG	protein_coding	OTTHUMT00000330126.1	C	NM_000541	-		234229408	+1	no_errors	ENST00000409110	ensembl	human	known	74_37	missense	SNP	0.917	A
SSPO	23145	genome.wustl.edu	37	7	149521663	149521663	+	RNA	SNP	T	T	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr7:149521663T>A	ENST00000378016.2	+	0	13742							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CGGCTCTGTCTGGATCCTGCG	0.692																																																	0								ENSG00000197558						19.0	23.0	22.0					7																	149521663		1996	4154	6150	SSPO			0			-	HGNC	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149521663T>A		Somatic	0	25	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	32	37.25	Q76B61	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			-	-		0.692	SSPO-202	KNOWN	basic	processed_transcript	SSPO	processed_transcript		T		-		149521663	+1	no_errors	ENST00000378016	ensembl	human	known	74_37	rna	SNP	1.000	A
OR5AK2	390181	genome.wustl.edu	37	11	56756609	56756609	+	Missense_Mutation	SNP	C	C	G	rs375461189		TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr11:56756609C>G	ENST00000326855.2	+	1	263	c.221C>G	c.(220-222)aCt>aGt	p.T74S		NM_001005323.1	NP_001005323.1	Q8NH90	O5AK2_HUMAN	olfactory receptor, family 5, subfamily AK, member 2	74						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21						ATCTGTTACACTTCTGCTATC	0.348																																																	0								ENSG00000181273						95.0	88.0	90.0					11																	56756609		2201	4296	6497	OR5AK2	SO:0001583	missense	0			-	HGNC	AB065496	CCDS31538.1	11q11	2012-08-09			ENSG00000181273	ENSG00000181273		"""GPCR / Class A : Olfactory receptors"""	15251	protein-coding gene	gene with protein product							Standard	NM_001005323		Approved		uc010rjp.2	Q8NH90	OTTHUMG00000167019	ENST00000326855.2:c.221C>G	11.37:g.56756609C>G	ENSP00000322784:p.Thr74Ser	Somatic	0	94	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	71	29.70	B2RNZ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T74S	ENST00000326855.2	37	c.221	CCDS31538.1	11	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.408551	0.00193	.	.	ENSG00000181273	ENST00000326855	T	0.00014	9.2	3.85	2.84	0.33178	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39615	U	0.001316	T	0.00073	0.0002	N	0.16478	0.41	0.09310	N	1	B	0.25719	0.132	B	0.28305	0.088	T	0.16689	-1.0394	10	0.02654	T	1	-18.9326	11.6306	0.51173	0.0:0.7046:0.2954:0.0	.	74	Q8NH90	O5AK2_HUMAN	S	74	ENSP00000322784:T74S	ENSP00000322784:T74S	T	+	2	0	OR5AK2	56513185	0.000000	0.05858	0.389000	0.26208	0.256000	0.26092	0.505000	0.22642	2.142000	0.66516	0.194000	0.17425	ACT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.348	OR5AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AK2	protein_coding	OTTHUMT00000392446.1	C	NM_001005323	-		56756609	+1	no_errors	ENST00000326855	ensembl	human	known	74_37	missense	SNP	0.003	G
PGC	5225	genome.wustl.edu	37	6	41708334	41708334	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr6:41708334C>G	ENST00000373025.3	-	6	724	c.662G>C	c.(661-663)aGc>aCc	p.S221T		NM_002630.3	NP_002621.1	P20142	PEPC_HUMAN	progastricsin (pepsinogen C)	221					digestion (GO:0007586)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|skin(1)	16	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			CGCTCCCCCGCTGGAGCCCTG	0.587																																																	0								ENSG00000096088						78.0	83.0	82.0					6																	41708334		2203	4300	6503	PGC	SO:0001583	missense	0			-	HGNC		CCDS4859.1, CCDS55000.1	6p21.1	2012-10-02			ENSG00000096088	ENSG00000096088	3.4.23.3		8890	protein-coding gene	gene with protein product		169740					Standard	NM_002630		Approved		uc003ora.2	P20142	OTTHUMG00000014683	ENST00000373025.3:c.662G>C	6.37:g.41708334C>G	ENSP00000362116:p.Ser221Thr	Somatic	0	42	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	17	68.52	B4DVZ3|Q5T3D7|Q5T3D8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aspartic_peptidase,pfam_Aspartic_peptidase_N,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase	p.S221T	ENST00000373025.3	37	c.662	CCDS4859.1	6	.	.	.	.	.	.	.	.	.	.	C	2.189	-0.385815	0.04966	.	.	ENSG00000096088	ENST00000373025	T	0.57752	0.38	5.35	4.21	0.49690	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	2.821640	0.00754	N	0.001081	T	0.18299	0.0439	N	0.17564	0.495	0.22571	N	0.998971	B	0.06786	0.001	B	0.11329	0.006	T	0.12889	-1.0530	10	0.24483	T	0.36	.	8.3301	0.32180	0.0:0.0923:0.0:0.9077	.	221	P20142	PEPC_HUMAN	T	221	ENSP00000362116:S221T	ENSP00000362116:S221T	S	-	2	0	PGC	41816312	0.009000	0.17119	0.018000	0.16275	0.001000	0.01503	1.184000	0.32053	1.071000	0.40834	-0.367000	0.07326	AGC	-	pfam_Aspartic_peptidase,superfamily_Peptidase_aspartic_dom		0.587	PGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGC	protein_coding	OTTHUMT00000040521.2	C		-		41708334	-1	no_errors	ENST00000373025	ensembl	human	known	74_37	missense	SNP	0.047	G
TRDN	10345	genome.wustl.edu	37	6	123580784	123580784	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr6:123580784C>T	ENST00000398178.3	-	35	1876	c.1855G>A	c.(1855-1857)Gaa>Aaa	p.E619K	TRDN_ENST00000334268.4_Missense_Mutation_p.E619K	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	619					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		CTTTCTTTTTCAGATATTTCA	0.264																																																	0								ENSG00000186439						81.0	72.0	75.0					6																	123580784		1576	3530	5106	TRDN	SO:0001583	missense	0			-	HGNC	U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.1855G>A	6.37:g.123580784C>T	ENSP00000381240:p.Glu619Lys	Somatic	0	70	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	79	12.09	A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Asp-B-hydro/Triadin_dom	p.E619K	ENST00000398178.3	37	c.1855	CCDS55053.1	6	.	.	.	.	.	.	.	.	.	.	C	11.60	1.687663	0.29962	.	.	ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268	T;T	0.22945	2.09;1.93	4.16	4.16	0.48862	.	0.196250	0.31010	N	0.008423	T	0.18509	0.0444	L	0.27053	0.805	0.80722	D	1	D	0.63880	0.993	D	0.72625	0.978	T	0.02860	-1.1101	10	0.07644	T	0.81	-16.7403	12.1614	0.54105	0.0:1.0:0.0:0.0	.	619	Q13061	TRDN_HUMAN	K	619;621;619	ENSP00000381240:E619K;ENSP00000333984:E619K	ENSP00000333984:E619K	E	-	1	0	TRDN	123622483	1.000000	0.71417	1.000000	0.80357	0.192000	0.23643	1.792000	0.38754	2.309000	0.77851	0.650000	0.86243	GAA	-	NULL		0.264	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRDN	protein_coding		C		-		123580784	-1	no_errors	ENST00000398178	ensembl	human	known	74_37	missense	SNP	1.000	T
ASB2	51676	genome.wustl.edu	37	14	94404161	94404161	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr14:94404161A>T	ENST00000315988.4	-	7	1998	c.1510T>A	c.(1510-1512)Tgg>Agg	p.W504R	ASB2_ENST00000555019.1_Missense_Mutation_p.W552R|ASB2_ENST00000556337.1_5'Flank|RP11-131H24.4_ENST00000557646.1_5'Flank	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	504					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		GGCCCCGCCCAGCGGCTCACC	0.602																																																	0								ENSG00000100628						53.0	48.0	50.0					14																	94404161		2203	4300	6503	ASB2	SO:0001583	missense	0			-	HGNC	AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.1510T>A	14.37:g.94404161A>T	ENSP00000320675:p.Trp504Arg	Somatic	0	39	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	52	13.33	B2RDP9|B4E166|Q9NSU5|Q9Y567	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.W504R	ENST00000315988.4	37	c.1510	CCDS9915.1	14	.	.	.	.	.	.	.	.	.	.	A	21.1	4.102426	0.76983	.	.	ENSG00000100628	ENST00000555019;ENST00000434324;ENST00000315988;ENST00000543546;ENST00000555507	T;T;T	0.68903	-0.36;-0.26;-0.24	5.13	3.94	0.45596	.	0.058445	0.64402	D	0.000001	T	0.76933	0.4057	M	0.70595	2.14	0.58432	D	0.999993	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.949;0.997;0.926	T	0.73257	-0.4040	10	0.13108	T	0.6	-5.3798	11.8327	0.52305	0.8531:0.1469:0.0:0.0	.	520;552;504	B3KPZ6;B4E166;Q96Q27	.;.;ASB2_HUMAN	R	552;520;504;450;450	ENSP00000451575:W552R;ENSP00000320675:W504R;ENSP00000450940:W450R	ENSP00000320675:W504R	W	-	1	0	ASB2	93473914	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.128000	0.64733	0.756000	0.33013	0.379000	0.24179	TGG	-	NULL		0.602	ASB2-001	KNOWN	basic|CCDS	protein_coding	ASB2	protein_coding	OTTHUMT00000412845.1	A		-		94404161	-1	no_errors	ENST00000315988	ensembl	human	known	74_37	missense	SNP	1.000	T
UPP2	151531	genome.wustl.edu	37	2	158977927	158977927	+	Missense_Mutation	SNP	C	C	T	rs372476628		TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr2:158977927C>T	ENST00000005756.4	+	5	655	c.461C>T	c.(460-462)gCa>gTa	p.A154V	UPP2_ENST00000460456.1_Intron|UPP2_ENST00000605860.1_Missense_Mutation_p.A211V|UPP2_ENST00000409859.4_Missense_Mutation_p.A211V	NM_173355.3	NP_775491.1	O95045	UPP2_HUMAN	uridine phosphorylase 2	154					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)|type III intermediate filament (GO:0045098)	uridine phosphorylase activity (GO:0004850)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31					Fluorouracil(DB00544)	GCAGGGATTGCACCAGGGACT	0.383																																																	0								ENSG00000007001	C	VAL/ALA,VAL/ALA	0,4406		0,0,2203	199.0	205.0	203.0		461,632	-0.0	0.0	2		203	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense	UPP2	NM_173355.3,NM_001135098.1	64,64	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	154/318,211/375	158977927	1,13003	2203	4299	6502	UPP2	SO:0001583	missense	0			-	HGNC	AY225131	CCDS2207.1, CCDS46435.1	2q24.2	2008-02-05			ENSG00000007001	ENSG00000007001			23061	protein-coding gene	gene with protein product						12849978	Standard	NM_173355		Approved	UPASE2, UP2, UDRPASE2	uc002tzo.3	O95045	OTTHUMG00000131969	ENST00000005756.4:c.461C>T	2.37:g.158977927C>T	ENSP00000005756:p.Ala154Val	Somatic	0	70	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	52	25.71	B3KV87	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucleoside_phosphorylase_d,tigrfam_Uridine_phosphorylase_euk	p.A211V	ENST00000005756.4	37	c.632	CCDS2207.1	2	.	.	.	.	.	.	.	.	.	.	C	8.504	0.864880	0.17250	0.0	1.16E-4	ENSG00000007001	ENST00000409859;ENST00000005756	D;D	0.87729	-2.29;-2.29	5.66	-0.043	0.13861	Nucleoside phosphorylase domain (1);	0.797470	0.11538	N	0.554006	T	0.81442	0.4823	L	0.58101	1.795	0.29963	N	0.819192	B	0.25206	0.12	B	0.17433	0.018	T	0.73591	-0.3934	10	0.72032	D	0.01	.	5.2068	0.15295	0.3388:0.4249:0.0:0.2363	.	154	O95045	UPP2_HUMAN	V	211;154	ENSP00000387230:A211V;ENSP00000005756:A154V	ENSP00000005756:A154V	A	+	2	0	UPP2	158686173	0.579000	0.26725	0.005000	0.12908	0.259000	0.26198	1.205000	0.32308	0.058000	0.16222	-0.140000	0.14226	GCA	-	pfam_Nucleoside_phosphorylase_d,tigrfam_Uridine_phosphorylase_euk		0.383	UPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPP2	protein_coding	OTTHUMT00000254929.2	C	NM_173355	-		158977927	+1	no_errors	ENST00000409859	ensembl	human	known	74_37	missense	SNP	0.233	T
SLC47A1	55244	genome.wustl.edu	37	17	19451359	19451359	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr17:19451359T>A	ENST00000270570.4	+	4	454	c.368T>A	c.(367-369)cTg>cAg	p.L123Q	SLC47A1_ENST00000457293.1_Missense_Mutation_p.L123Q|SLC47A1_ENST00000395585.1_Missense_Mutation_p.L123Q|SLC47A1_ENST00000436810.2_Missense_Mutation_p.L100Q|SLC47A1_ENST00000571335.1_5'UTR|SLC47A1_ENST00000575023.1_Missense_Mutation_p.L123Q|SLC47A1_ENST00000584348.1_3'UTR|SLC47A1_ENST00000542886.1_Missense_Mutation_p.L123Q	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1	123					organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	GCGCTCGTCCTGCTCCTCTGC	0.597																																																	0								ENSG00000142494						139.0	114.0	123.0					17																	19451359		2203	4300	6503	SLC47A1	SO:0001583	missense	0			-	HGNC		CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.368T>A	17.37:g.19451359T>A	ENSP00000270570:p.Leu123Gln	Somatic	0	57	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	73	17.05	Q53HF5|Q6PD77|Q86VL4|Q9NVA3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MATE,tigrfam_MATE	p.L123Q	ENST00000270570.4	37	c.368	CCDS11209.1	17	.	.	.	.	.	.	.	.	.	.	T	18.20	3.571918	0.65765	.	.	ENSG00000142494	ENST00000436810;ENST00000270570;ENST00000457293;ENST00000542886;ENST00000395585	T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.73575	0.3604	H	0.97806	4.08	0.53688	D	0.999971	D;D;D;D	0.89917	1.0;1.0;0.997;0.999	D;D;D;D	0.91635	0.999;0.997;0.985;0.985	D	0.83977	0.0330	10	0.87932	D	0	-13.1593	13.8392	0.63428	0.0:0.0:0.0:1.0	.	100;123;123;123	E7EX57;B4DYV3;Q96FL8;Q96FL8-3	.;.;S47A1_HUMAN;.	Q	100;123;123;123;123	ENSP00000407155:L100Q;ENSP00000270570:L123Q;ENSP00000415586:L123Q;ENSP00000440435:L123Q;ENSP00000378951:L123Q	ENSP00000270570:L123Q	L	+	2	0	SLC47A1	19391951	1.000000	0.71417	0.977000	0.42913	0.261000	0.26267	7.403000	0.79983	1.879000	0.54435	0.379000	0.24179	CTG	-	pfam_MATE,tigrfam_MATE		0.597	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC47A1	protein_coding	OTTHUMT00000132250.1	T	NM_018242	-		19451359	+1	no_errors	ENST00000395585	ensembl	human	known	74_37	missense	SNP	1.000	A
FES	2242	genome.wustl.edu	37	15	91430557	91430557	+	Missense_Mutation	SNP	C	C	A	rs545069439		TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr15:91430557C>A	ENST00000328850.3	+	5	767	c.625C>A	c.(625-627)Ctg>Atg	p.L209M	FES_ENST00000414248.2_Missense_Mutation_p.L151M|FES_ENST00000394302.1_Missense_Mutation_p.L151M|FES_ENST00000394300.3_Missense_Mutation_p.L151M|FES_ENST00000450438.2_Missense_Mutation_p.L151M|FES_ENST00000444422.2_Missense_Mutation_p.L209M	NM_002005.3	NP_001996.1	P07332	FES_HUMAN	FES proto-oncogene, tyrosine kinase	209	Important for interaction with membranes containing phosphoinositides.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of mast cell degranulation (GO:0043304)|regulation of vesicle-mediated transport (GO:0060627)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule cytoskeleton (GO:0015630)	ATP binding (GO:0005524)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol binding (GO:0035091)|protein tyrosine kinase activity (GO:0004713)			lung(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GCCCGGCCTGCTGCGGTCACT	0.667																																																	0								ENSG00000182511						33.0	35.0	34.0					15																	91430557		2198	4296	6494	FES	SO:0001583	missense	0			-	HGNC	X52192	CCDS10365.1, CCDS45349.1, CCDS45350.1, CCDS45351.1	15q26.1	2014-06-26	2014-06-26		ENSG00000182511	ENSG00000182511	2.7.10.1	"""SH2 domain containing"""	3657	protein-coding gene	gene with protein product	"""Oncogene FES, feline sarcoma virus"", ""c-fes/fps protein"""	190030	"""feline sarcoma (Snyder-Theilen) viral (v-fes)/Fujinami avian sarcoma (PRCII) viral (v-fps) oncogene homolog"", ""feline sarcoma oncogene"""			1870997	Standard	NM_002005		Approved	FPS	uc002bpv.3	P07332	OTTHUMG00000044456	ENST00000328850.3:c.625C>A	15.37:g.91430557C>A	ENSP00000331504:p.Leu209Met	Somatic	0	51	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	56	20.00	B2R6E6|B4DUD0|E9PC94|E9PC95|Q2VXS7|Q2VXS8|Q2VXT0|Q6GTU5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_non-rcpt_Fes_subgr,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_FCH_dom,superfamily_Kinase-like_dom,superfamily_t-SNARE,smart_FCH_dom,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,pfscan_FCH_dom,pfscan_SH2,pfscan_Prot_kinase_dom	p.L209M	ENST00000328850.3	37	c.625	CCDS10365.1	15	.	.	.	.	.	.	.	.	.	.	C	12.56	1.975590	0.34848	.	.	ENSG00000182511	ENST00000328850;ENST00000414248;ENST00000394302;ENST00000444422;ENST00000394300;ENST00000450438	T;T;T;T;T;T	0.16597	2.33;2.33;2.33;2.33;2.33;2.33	3.98	2.05	0.26809	.	0.288673	0.33753	N	0.004596	T	0.34193	0.0889	M	0.68317	2.08	0.34018	D	0.652346	P;D;D;D;D;P	0.71674	0.84;0.998;0.998;0.976;0.998;0.84	P;P;P;P;D;P	0.65443	0.613;0.904;0.896;0.784;0.935;0.613	T	0.49698	-0.8912	10	0.72032	D	0.01	-14.3199	10.4486	0.44509	0.0:0.8371:0.0:0.1629	.	191;151;151;151;209;209	B4DUD9;P07332-2;E7ENM8;P07332-3;P07332-4;P07332	.;.;.;.;.;FES_HUMAN	M	209;151;151;209;151;151	ENSP00000331504:L209M;ENSP00000414629:L151M;ENSP00000377839:L151M;ENSP00000400868:L209M;ENSP00000377837:L151M;ENSP00000409915:L151M	ENSP00000331504:L209M	L	+	1	2	FES	89231561	1.000000	0.71417	0.086000	0.20670	0.046000	0.14306	3.522000	0.53480	0.459000	0.27016	-0.263000	0.10527	CTG	-	pirsf_Tyr_kinase_non-rcpt_Fes_subgr		0.667	FES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FES	protein_coding	OTTHUMT00000313497.1	C	NM_002005	-		91430557	+1	no_errors	ENST00000328850	ensembl	human	known	74_37	missense	SNP	1.000	A
WASH6P	653440	genome.wustl.edu	37	X	155254016	155254016	+	RNA	SNP	T	T	C			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chrX:155254016T>C	ENST00000461007.1	+	0	2932				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										GTCCACTGGGTGCTTTCTGCC	0.677																																																	0								ENSG00000182484																																			WASH6P			0			-	HGNC	AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155254016T>C		Somatic	0	8	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	11	42.11	A6NGF1|Q8N305	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			-	-		0.677	WASH6P-016	KNOWN	basic	processed_transcript	WASH6P	pseudogene	OTTHUMT00000058840.1	T	NG_008380	-		155254016	+1	no_errors	ENST00000461007	ensembl	human	known	74_37	rna	SNP	0.002	C
ALDH1A2	8854	genome.wustl.edu	37	15	58357739	58357739	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr15:58357739T>C	ENST00000249750.4	-	1	877	c.110A>G	c.(109-111)tAc>tGc	p.Y37C	ALDH1A2_ENST00000558231.1_Intron|ALDH1A2_ENST00000347587.3_Missense_Mutation_p.Y37C|ALDH1A2_ENST00000537372.1_5'UTR|CTD-2330J20.2_ENST00000559684.1_RNA	NM_003888.3	NP_003879.2	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1 family, member A2	37					9-cis-retinoic acid biosynthetic process (GO:0042904)|anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|cardiac muscle tissue development (GO:0048738)|cellular response to retinoic acid (GO:0071300)|determination of bilateral symmetry (GO:0009855)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract development (GO:0048566)|embryonic forelimb morphogenesis (GO:0035115)|face development (GO:0060324)|heart morphogenesis (GO:0003007)|hindbrain development (GO:0030902)|kidney development (GO:0001822)|liver development (GO:0001889)|lung development (GO:0030324)|midgut development (GO:0007494)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|neural crest cell development (GO:0014032)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|proximal/distal pattern formation (GO:0009954)|regulation of endothelial cell proliferation (GO:0001936)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to vitamin A (GO:0033189)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)|retinoic acid receptor signaling pathway (GO:0048384)|retinol metabolic process (GO:0042572)|ureter maturation (GO:0035799)|vitamin A metabolic process (GO:0006776)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|retinal binding (GO:0016918)|retinal dehydrogenase activity (GO:0001758)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	Tretinoin(DB00755)|Vitamin A(DB00162)	TACCTTGGTGTACTTAATTTC	0.637																																																	0								ENSG00000128918						37.0	41.0	40.0					15																	58357739		2192	4292	6484	ALDH1A2	SO:0001583	missense	0			-	HGNC	AB015228	CCDS10163.1, CCDS10164.1, CCDS45266.1, CCDS55968.1	15q21.2	2011-02-18			ENSG00000128918	ENSG00000128918		"""Aldehyde dehydrogenases"""	15472	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 2"""	603687				9819382	Standard	NM_003888		Approved	RALDH2	uc002aex.3	O94788	OTTHUMG00000132624	ENST00000249750.4:c.110A>G	15.37:g.58357739T>C	ENSP00000249750:p.Tyr37Cys	Somatic	0	81	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	97	19.17	B3KY52|B4DZR2|F5H2Y9|H0YM00|Q2PJS6|Q8NHQ4|Q9UBR8|Q9UFY0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.Y37C	ENST00000249750.4	37	c.110	CCDS10163.1	15	.	.	.	.	.	.	.	.	.	.	T	21.1	4.097212	0.76870	.	.	ENSG00000128918	ENST00000249750;ENST00000347587	T;T	0.15952	2.38;2.38	3.71	1.23	0.21249	Aldehyde/histidinol dehydrogenase (1);	0.137279	0.50627	D	0.000107	T	0.13756	0.0333	N	0.11560	0.145	0.80722	D	1	D;D	0.67145	0.98;0.996	P;P	0.58266	0.729;0.836	T	0.15037	-1.0451	10	0.31617	T	0.26	.	6.0759	0.19915	0.162:0.0:0.1691:0.6689	.	37;37	O94788-2;O94788	.;AL1A2_HUMAN	C	37	ENSP00000249750:Y37C;ENSP00000309623:Y37C	ENSP00000249750:Y37C	Y	-	2	0	ALDH1A2	56145031	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	5.181000	0.65054	0.053000	0.16036	0.456000	0.33151	TAC	-	superfamily_Ald_DH/histidinol_DH		0.637	ALDH1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A2	protein_coding	OTTHUMT00000255869.1	T		-		58357739	-1	no_errors	ENST00000249750	ensembl	human	known	74_37	missense	SNP	1.000	C
ABHD15	116236	genome.wustl.edu	37	17	27889778	27889778	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr17:27889778C>T	ENST00000307201.4	-	2	1378	c.1208G>A	c.(1207-1209)tGg>tAg	p.W403*	RP11-68I3.2_ENST00000581474.1_RNA	NM_198147.2	NP_937790.2	Q6UXT9	ABH15_HUMAN	abhydrolase domain containing 15	403						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	10						CTCATGGCTCCAGGCTGGCAA	0.582																																																	0								ENSG00000168792						52.0	55.0	54.0					17																	27889778		2203	4300	6503	ABHD15	SO:0001587	stop_gained	0			-	HGNC	AK056717	CCDS32602.1	17q11.2	2009-11-20			ENSG00000168792	ENSG00000168792		"""Abhydrolase domain containing"""	26971	protein-coding gene	gene with protein product						12975309	Standard	NM_198147		Approved		uc002hed.2	Q6UXT9		ENST00000307201.4:c.1208G>A	17.37:g.27889778C>T	ENSP00000302657:p.Trp403*	Somatic	0	34	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	30	23.08	Q96EC5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_AB-Hydro_YheT	p.W403*	ENST00000307201.4	37	c.1208	CCDS32602.1	17	.	.	.	.	.	.	.	.	.	.	C	37	6.566870	0.97671	.	.	ENSG00000168792	ENST00000307201	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.5261	18.716	0.91675	0.0:1.0:0.0:0.0	.	.	.	.	X	403	.	ENSP00000302657:W403X	W	-	2	0	ABHD15	24913904	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.052000	0.76634	2.779000	0.95612	0.655000	0.94253	TGG	-	pirsf_AB-Hydro_YheT		0.582	ABHD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD15	protein_coding	OTTHUMT00000447796.2	C	NM_198147	-		27889778	-1	no_errors	ENST00000307201	ensembl	human	known	74_37	nonsense	SNP	1.000	T
LOC403323	403323	genome.wustl.edu	37	9	66513513	66513513	+	IGR	SNP	C	C	A	rs201075544		TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr9:66513513C>A								RP11-262H14.1 (44203 upstream) : RP11-262H14.7 (3692 downstream)																							CGAACACTGCCTTAAGAACTT	0.498																																																	0								ENSG00000234665																																			RP11-262H14.3	SO:0001628	intergenic_variant	0			-	Clone_based_vega_gene																													9.37:g.66513513C>A		Somatic	0	85	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	125	11.35		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		9																																																																																			-	-	0	0.498					FLJ20444			C		rs201075544		66513513	-1	no_errors	ENST00000586625	ensembl	human	known	74_37	rna	SNP	1.000	A
CD200R1L	344807	genome.wustl.edu	37	3	112545911	112545911	+	Frame_Shift_Del	DEL	T	T	-	rs58161637|rs200703227	byFrequency	TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr3:112545911delT	ENST00000398214.1	-	4	833	c.608delA	c.(607-609)cacfs	p.H203fs	CD200R1L_ENST00000448932.1_Frame_Shift_Del_p.H182fs|CD200R1L_ENST00000488794.1_Frame_Shift_Del_p.H182fs	NM_001008784.2	NP_001008784.2	Q6Q8B3	MO2R2_HUMAN	CD200 receptor 1-like	203	Ig-like C2-type.					integral component of membrane (GO:0016021)		p.H203P(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(2)	19						AGTAGACTTGTGGCCCTCCCA	0.493													T|T|-|deletion	841	0.167931	0.0953	0.2133	5008	,	,		17526	0.0625		0.3231	False		,,,				2504	0.183																1	Substitution - Missense(1)	lung(1)						ENSG00000206531		,	560,3704		37,486,1609	55.0	49.0	51.0		,	1.4	0.0	3	dbSNP_129	64	2613,5641		429,1755,1943	yes	frameshift,frameshift	CD200R1L	NM_001199215.1,NM_001008784.2	,	466,2241,3552	A1A1,A1R,RR		31.6574,13.1332,25.3475	,	,	112545911	3173,9345	2175	4016	6191	CD200R1L	SO:0001589	frameshift_variant	0				HGNC	AY284976	CCDS43131.1, CCDS56267.1	3q13.2	2014-05-15	2008-10-08		ENSG00000206531	ENSG00000206531		"""Immunoglobulin superfamily / C2-set domain containing"""	24665	protein-coding gene	gene with protein product	"""CD200 receptor 2"""						Standard	NM_001008784		Approved	CD200RLa, CD200R2	uc003dzi.1	Q6Q8B3	OTTHUMG00000159283	ENST00000398214.1:c.608delA	3.37:g.112545911delT	ENSP00000381272:p.His203fs	Somatic	0	65	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	Q6WHB7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_CD80_C2-set,pfscan_Ig-like_dom	p.H203fs	ENST00000398214.1	37	c.608	CCDS43131.1	3																																																																																			-	pfam_CD80_C2-set,pfscan_Ig-like_dom		0.493	CD200R1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD200R1L	protein_coding	OTTHUMT00000354365.1	T	NM_001008784			112545911	-1	no_errors	ENST00000398214	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
SSPO	23145	genome.wustl.edu	37	7	149506494	149506494	+	RNA	SNP	T	T	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr7:149506494T>A	ENST00000378016.2	+	0	9268							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCCTGGCATGTGTCCCAGGGA	0.642																																																	0								ENSG00000197558						13.0	17.0	15.0					7																	149506494		1972	4111	6083	SSPO			0			-	HGNC	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149506494T>A		Somatic	0	87	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	97	27.07	Q76B61	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			-	-		0.642	SSPO-202	KNOWN	basic	processed_transcript	SSPO	processed_transcript		T		-		149506494	+1	no_errors	ENST00000378016	ensembl	human	known	74_37	rna	SNP	1.000	A
ANXA8L1	728113	genome.wustl.edu	37	10	47756669	47756669	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr10:47756669delG	ENST00000374277.5	+	8	705	c.583delG	c.(583-585)gggfs	p.G195fs	ANXA8L2_ENST00000340243.6_Frame_Shift_Del_p.G176fs|ANXA8L2_ENST00000538825.1_Frame_Shift_Del_p.G133fs|AL603965.1_ENST00000335083.5_Intron|ANXA8L2_ENST00000449464.2_3'UTR	NM_001630.2	NP_001621.2														endometrium(1)|pancreas(1)	2						GAATATTCGTGGGACTGATGA	0.602																																																	0								ENSG00000186807						65.0	39.0	48.0					10																	47756669		1981	3769	5750	ANXA8L2	SO:0001589	frameshift_variant	0				HGNC																												ENST00000374277.5:c.583delG	10.37:g.47756669delG	ENSP00000363395:p.Gly195fs	Somatic	0	82	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	56	12.50		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinVIII,prints_AnnexinIII	p.T196fs	ENST00000374277.5	37	c.583	CCDS7216.1	10																																																																																			-	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin		0.602	ANXA8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA8L2	protein_coding	OTTHUMT00000047866.1	G				47756669	+1	no_errors	ENST00000374277	ensembl	human	known	74_37	frame_shift_del	DEL	0.827	-
CCDC144NL-AS1	440416	genome.wustl.edu	37	17	20841832	20841833	+	RNA	INS	-	-	CGATGA	rs11282828|rs375875297	byFrequency	TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr17:20841832_20841833insCGATGA	ENST00000580278.1	+	0	819_820				RP11-344E13.3_ENST00000439794.2_RNA|RP11-344E13.3_ENST00000437829.1_RNA|RP11-344E13.3_ENST00000580056.1_RNA|RP11-381P6.1_ENST00000582583.1_RNA|RP11-344E13.3_ENST00000433763.2_RNA|RP11-344E13.3_ENST00000423473.2_RNA|RP11-344E13.3_ENST00000583481.1_RNA|RP11-344E13.3_ENST00000577968.1_RNA																							TAGTTCAGAAGCGACCGGGAGC	0.515														2914	0.581869	0.7564	0.5346	5008	,	,		20140	0.6091		0.5249	False		,,,				2504	0.41																0								ENSG00000233098																																			RP11-344E13.3			0				Clone_based_vega_gene																													17.37:g.20841832_20841833insCGATGA		Somatic	NA	NA	NA		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000580278.1	37	NULL		17																																																																																			-	-		0.515	RP11-344E13.3-016	KNOWN	basic	antisense	LOC440416	antisense	OTTHUMT00000444301.1	-				20841833	+1	no_errors	ENST00000577968	ensembl	human	known	74_37	rna	INS	0.003:0.002	CGATGA
BCL2L15	440603	genome.wustl.edu	37	1	114429916	114429916	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr1:114429916G>T	ENST00000393316.3	-	1	253	c.82C>A	c.(82-84)Cag>Aag	p.Q28K	AP4B1-AS1_ENST00000419536.1_RNA|BCL2L15_ENST00000471267.1_Missense_Mutation_p.Q28K|BCL2L15_ENST00000393320.3_Missense_Mutation_p.Q28K|BCL2L15_ENST00000488450.1_5'UTR	NM_001010922.2	NP_001010922.1	Q5TBC7	B2L15_HUMAN	BCL2-like 15	28					apoptotic process (GO:0006915)	cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(3)|ovary(1)	9	Lung SC(450;0.184)	all_cancers(81;3.95e-08)|all_epithelial(167;9.95e-08)|all_lung(203;1.31e-05)|Lung NSC(69;2.46e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGGCAACCTGCAATGTTGGG	0.453																																																	0								ENSG00000188761						193.0	169.0	177.0					1																	114429916		2203	4300	6503	BCL2L15	SO:0001583	missense	0			-	HGNC		CCDS30809.1	1p13.2	2014-03-07			ENSG00000188761	ENSG00000188761			33624	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 178"""	C1orf178		12700646, 15961081, 16690252, 17412810	Standard	NM_001010922		Approved	Bfk, FLJ22588	uc001edw.3	Q5TBC7	OTTHUMG00000011940	ENST00000393316.3:c.82C>A	1.37:g.114429916G>T	ENSP00000376992:p.Gln28Lys	Somatic	0	36	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A0PJY6|A8K074|I6LA82	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q28K	ENST00000393316.3	37	c.82	CCDS30809.1	1	.	.	.	.	.	.	.	.	.	.	G	11.24	1.580923	0.28180	.	.	ENSG00000188761	ENST00000393316;ENST00000393320;ENST00000471267	T;T	0.04317	3.65;3.65	5.35	-0.328	0.12690	.	1.651600	0.02767	N	0.119220	T	0.01222	0.0040	L	0.43152	1.355	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.09377	0.003;0.004	T	0.45366	-0.9266	10	0.02654	T	1	.	9.5684	0.39414	0.0:0.1272:0.2948:0.5779	.	28;28	Q68DJ4;Q5TBC7	.;B2L15_HUMAN	K	28	ENSP00000376992:Q28K;ENSP00000417458:Q28K	ENSP00000376992:Q28K	Q	-	1	0	BCL2L15	114231439	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.569000	0.05902	-0.119000	0.11830	-0.169000	0.13324	CAG	-	NULL		0.453	BCL2L15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL2L15	protein_coding	OTTHUMT00000033026.2	G	NM_001010922	-		114429916	-1	no_errors	ENST00000393316	ensembl	human	known	74_37	missense	SNP	0.000	T
SRP14	6727	genome.wustl.edu	37	15	40328420	40328420	+	3'UTR	SNP	C	C	G			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr15:40328420C>G	ENST00000267884.6	-	0	596				SRP14_ENST00000558527.1_5'UTR|SRP14_ENST00000558720.1_3'UTR	NM_003134.4	NP_003125.3	P37108	SRP14_HUMAN	signal recognition particle 14kDa (homologous Alu RNA binding protein)						cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|protein targeting to ER (GO:0045047)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intercellular bridge (GO:0045171)|nucleolus (GO:0005730)|nucleus (GO:0005634)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|endoplasmic reticulum signal peptide binding (GO:0030942)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|skin(1)|upper_aerodigestive_tract(1)	3		all_cancers(109;7.56e-18)|all_epithelial(112;4.02e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.84e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0505)		CCAAAAGGACCCTAATCTTAT	0.383																																																	0								ENSG00000140319																																			SRP14	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS42017.1	15q22	2008-08-15	2002-08-29		ENSG00000140319	ENSG00000140319			11299	protein-coding gene	gene with protein product		600708	"""signal recognition particle 14kD (homologous Alu RNA-binding protein)"""			8196634	Standard	NM_003134		Approved	ALURBP, MGC14326	uc001zkq.2	P37108		ENST00000267884.6:c.*114G>C	15.37:g.40328420C>G		Somatic	0	91	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	114	8.06	B5BUF5|Q6B0K5|Q96Q14	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000267884.6	37	NULL	CCDS42017.1	15																																																																																			-	-		0.383	SRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP14	protein_coding	OTTHUMT00000418262.2	C	NM_003134	-		40328420	-1	no_errors	ENST00000558527	ensembl	human	known	74_37	rna	SNP	0.015	G
ACSM5	54988	genome.wustl.edu	37	16	20442633	20442633	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr16:20442633A>G	ENST00000331849.4	+	10	1445	c.1298A>G	c.(1297-1299)aAt>aGt	p.N433S		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	433					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						TGTTTCTTCAATTGCTATTTG	0.478																																																	0								ENSG00000183549						134.0	119.0	124.0					16																	20442633		2203	4300	6503	ACSM5	SO:0001583	missense	0			-	HGNC		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1298A>G	16.37:g.20442633A>G	ENSP00000327916:p.Asn433Ser	Somatic	0	79	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	21	69.12	Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig	p.N433S	ENST00000331849.4	37	c.1298	CCDS10585.1	16	.	.	.	.	.	.	.	.	.	.	A	1.397	-0.579286	0.03854	.	.	ENSG00000183549	ENST00000331849	T	0.37915	1.17	4.37	-3.93	0.04143	AMP-dependent synthetase/ligase (1);	0.407810	0.20205	N	0.097009	T	0.09024	0.0223	N	0.02315	-0.6	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.35276	-0.9795	10	0.02654	T	1	-3.3706	6.5177	0.22256	0.4053:0.3535:0.2412:0.0	.	433	Q6NUN0	ACSM5_HUMAN	S	433	ENSP00000327916:N433S	ENSP00000327916:N433S	N	+	2	0	ACSM5	20350134	0.000000	0.05858	0.242000	0.24170	0.984000	0.73092	0.087000	0.14958	-0.404000	0.07610	0.528000	0.53228	AAT	-	pfam_AMP-dep_Synth/Lig		0.478	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM5	protein_coding	OTTHUMT00000254413.1	A	NM_017888	-		20442633	+1	no_errors	ENST00000331849	ensembl	human	known	74_37	missense	SNP	0.010	G
UNC93B1	81622	genome.wustl.edu	37	11	67759287	67759287	+	Silent	SNP	C	C	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr11:67759287C>A	ENST00000227471.2	-	12	1600	c.1521G>T	c.(1519-1521)gcG>gcT	p.A507A	UNC93B1_ENST00000530331.1_5'UTR	NM_030930.2	NP_112192.2	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1 (C. elegans)	508					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	early phagosome (GO:0032009)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.A507A(1)									GGTAGGAGACCGCGGCCGCCA	0.741																																																	1	Substitution - coding silent(1)	prostate(1)						ENSG00000110057						2.0	2.0	2.0					11																	67759287		721	1664	2385	UNC93B1	SO:0001819	synonymous_variant	0			-	HGNC	AJ271326	CCDS73334.1	11q13.2	2014-09-17	2001-11-28		ENSG00000110057	ENSG00000110057			13481	protein-coding gene	gene with protein product		608204	"""unc93 (C. elegans) homolog B1"""			11867227	Standard	NM_030930		Approved	UNC93	uc001omw.1	Q9H1C4	OTTHUMG00000167472	ENST00000227471.2:c.1521G>T	11.37:g.67759287C>A		Somatic	0	17	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	16	33.33	O95764|Q569H6|Q710D4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_channel_UNC-93,superfamily_MFS_dom_general_subst_transpt	p.A507	ENST00000227471.2	37	c.1521		11																																																																																			-	NULL		0.741	UNC93B1-201	KNOWN	basic|appris_principal	protein_coding	UNC93B1	protein_coding		C	NM_030930	-		67759287	-1	no_errors	ENST00000227471	ensembl	human	known	74_37	silent	SNP	0.000	A
LAMP5	24141	genome.wustl.edu	37	20	9498740	9498740	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr20:9498740G>A	ENST00000246070.2	+	5	1021	c.529G>A	c.(529-531)Ggg>Agg	p.G177R	LAMP5_ENST00000427562.2_Missense_Mutation_p.G133R	NM_012261.3	NP_036393.1	Q9UJQ1	LAMP5_HUMAN	lysosomal-associated membrane protein family, member 5	177						cytoplasmic vesicle membrane (GO:0030659)|dendrite membrane (GO:0032590)|early endosome membrane (GO:0031901)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|endosome membrane (GO:0010008)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)											CACCCCCGCTGGGAAGTCCTA	0.537																																																	0								ENSG00000125869						115.0	91.0	99.0					20																	9498740		2203	4300	6503	LAMP5	SO:0001583	missense	0			-	HGNC	AL121740	CCDS13106.1, CCDS56177.1	20p12	2013-03-14	2011-11-25	2011-11-25	ENSG00000125869	ENSG00000125869			16097	protein-coding gene	gene with protein product	"""brain and dendritic cell associated LAMP"""	614641	"""chromosome 20 open reading frame 103"""	C20orf103		11780052, 21642595	Standard	NM_012261		Approved	dJ1119D9.3, BAD-LAMP, UNC-43	uc002wni.2	Q9UJQ1	OTTHUMG00000031851	ENST00000246070.2:c.529G>A	20.37:g.9498740G>A	ENSP00000246070:p.Gly177Arg	Somatic	0	67	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	110	24	82.09	B4DHZ7|B7Z9Z9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lysosome-assoc_membr_glycop	p.G177R	ENST00000246070.2	37	c.529	CCDS13106.1	20	.	.	.	.	.	.	.	.	.	.	G	34	5.334388	0.95758	.	.	ENSG00000125869	ENST00000246070;ENST00000427562	T;T	0.40756	1.02;1.02	5.93	5.93	0.95920	.	0.145167	0.64402	N	0.000008	T	0.54967	0.1891	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	0.994;1.0	P;D	0.79108	0.817;0.992	T	0.44787	-0.9305	9	.	.	.	-19.3476	20.3539	0.98825	0.0:0.0:1.0:0.0	.	133;177	Q9UJQ1-2;Q9UJQ1	.;CT103_HUMAN	R	177;133	ENSP00000246070:G177R;ENSP00000406360:G133R	.	G	+	1	0	C20orf103	9446740	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.308000	0.96247	2.826000	0.97356	0.655000	0.94253	GGG	-	pfam_Lysosome-assoc_membr_glycop		0.537	LAMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMP5	protein_coding	OTTHUMT00000077946.2	G	NM_012261	-		9498740	+1	no_errors	ENST00000246070	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC8A3	6547	genome.wustl.edu	37	14	70634623	70634623	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr14:70634623T>C	ENST00000381269.2	-	2	1270	c.517A>G	c.(517-519)Agt>Ggt	p.S173G	SLC8A3_ENST00000534137.1_Missense_Mutation_p.S173G|SLC8A3_ENST00000356921.2_Missense_Mutation_p.S173G|SLC8A3_ENST00000357887.3_Missense_Mutation_p.S173G|SLC8A3_ENST00000528359.1_Missense_Mutation_p.S173G	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	173					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		AAGGCTGCACTCCCTACAATG	0.498																																																	0								ENSG00000100678						97.0	86.0	90.0					14																	70634623		2203	4300	6503	SLC8A3	SO:0001583	missense	0			-	HGNC	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.517A>G	14.37:g.70634623T>C	ENSP00000370669:p.Ser173Gly	Somatic	0	60	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	55	11.29	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NaCa_Exmemb,pfam_Calx_beta,smart_Calx_beta,prints_Na_Ca_Ex,tigrfam_Na_Ca_Ex	p.S173G	ENST00000381269.2	37	c.517	CCDS35498.1	14	.	.	.	.	.	.	.	.	.	.	T	17.73	3.462500	0.63513	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85;-0.85	5.59	5.59	0.84812	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	D	0.90926	0.7148	H	0.97158	3.95	0.80722	D	1	D;D;D;D	0.62365	0.987;0.989;0.991;0.991	D;D;D;D	0.83275	0.992;0.996;0.989;0.989	D	0.93874	0.7165	10	0.87932	D	0	.	15.7625	0.78096	0.0:0.0:0.0:1.0	.	173;173;173;173	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	G	173	ENSP00000349392:S173G;ENSP00000370669:S173G;ENSP00000350560:S173G;ENSP00000436688:S173G;ENSP00000433531:S173G	ENSP00000349392:S173G	S	-	1	0	SLC8A3	69704376	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.033000	0.88852	2.117000	0.64856	0.454000	0.30748	AGT	-	pfam_NaCa_Exmemb,tigrfam_Na_Ca_Ex		0.498	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC8A3	protein_coding	OTTHUMT00000390736.1	T		-		70634623	-1	no_errors	ENST00000381269	ensembl	human	known	74_37	missense	SNP	1.000	C
PCSK2	5126	genome.wustl.edu	37	20	17462530	17462530	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr20:17462530G>A	ENST00000262545.2	+	12	2047	c.1732G>A	c.(1732-1734)Gcc>Acc	p.A578T	PCSK2_ENST00000377899.1_Missense_Mutation_p.A559T|PCSK2_ENST00000536609.1_Missense_Mutation_p.A543T|PCSK2_ENST00000459871.1_3'UTR	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	578					cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TGTCGGCAGCGCCCCGCAGAA	0.617																																																	0								ENSG00000125851						34.0	35.0	35.0					20																	17462530		2203	4300	6503	PCSK2	SO:0001583	missense	0			-	HGNC	AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.1732G>A	20.37:g.17462530G>A	ENSP00000262545:p.Ala578Thr	Somatic	0	27	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	66	20.48	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.A578T	ENST00000262545.2	37	c.1732	CCDS13125.1	20	.	.	.	.	.	.	.	.	.	.	G	7.674	0.687581	0.14973	.	.	ENSG00000125851	ENST00000377899;ENST00000262545;ENST00000536609	T;T;T	0.76709	-1.04;-1.04;-1.04	5.63	-3.21	0.05140	Proprotein convertase, P (1);Galactose-binding domain-like (1);	0.588945	0.20101	N	0.099225	T	0.48502	0.1503	N	0.11845	0.185	0.09310	N	1	B;B;B	0.12630	0.006;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.36504	-0.9745	10	0.12103	T	0.63	-3.3723	4.5817	0.12262	0.4339:0.0:0.3302:0.2359	.	543;559;578	B4DFQ3;B1ANH9;P16519	.;.;NEC2_HUMAN	T	559;578;543	ENSP00000367131:A559T;ENSP00000262545:A578T;ENSP00000437458:A543T	ENSP00000262545:A578T	A	+	1	0	PCSK2	17410530	0.000000	0.05858	0.005000	0.12908	0.699000	0.40488	-0.309000	0.08145	-0.366000	0.08064	-0.224000	0.12420	GCC	-	pfam_PrprotnconvertsP,superfamily_Galactose-bd-like		0.617	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK2	protein_coding	OTTHUMT00000078120.2	G	NM_002594	-		17462530	+1	no_errors	ENST00000262545	ensembl	human	known	74_37	missense	SNP	0.001	A
CYP4X1	260293	genome.wustl.edu	37	1	47505383	47505383	+	Intron	DEL	A	A	-	rs569346471|rs56165440|rs397696407|rs3073870|rs199797568	byFrequency	TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr1:47505383delA	ENST00000371901.3	+	8	1323				CYP4X1_ENST00000538609.1_Intron|CYP4X1_ENST00000466294.1_3'UTR	NM_178033.1	NP_828847.1	Q8N118	CP4X1_HUMAN	cytochrome P450, family 4, subfamily X, polypeptide 1							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	17						GTCTTTCAGGAAAAAAAAAAA	0.338																																																	0								ENSG00000186377																																			CYP4X1	SO:0001627	intron_variant	0				HGNC	AK091806	CCDS544.1	1p33	2008-02-05			ENSG00000186377	ENSG00000186377		"""Cytochrome P450s"""	20244	protein-coding gene	gene with protein product		614999				12176035	Standard	NM_178033		Approved	MGC40051	uc001cqt.3	Q8N118	OTTHUMG00000008017	ENST00000371901.3:c.1073+179A>-	1.37:g.47505383delA		Somatic	0	15	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	G3V1U1|Q5VVE5|Q6ZN67|Q8NAZ3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371901.3	37	NULL	CCDS544.1	1																																																																																			-	-		0.338	CYP4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4X1	protein_coding	OTTHUMT00000022017.1	A	NM_178033			47505383	+1	no_errors	ENST00000466294	ensembl	human	known	74_37	rna	DEL	0.100	-
REPIN1	29803	genome.wustl.edu	37	7	150069396	150069407	+	In_Frame_Del	DEL	CCGCCAGGGGCC	CCGCCAGGGGCC	-	rs3832490	byFrequency	TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	CCGCCAGGGGCC	CCGCCAGGGGCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr7:150069396_150069407delCCGCCAGGGGCC	ENST00000425389.2	+	1	1144_1155	c.1066_1077delCCGCCAGGGGCC	c.(1066-1077)ccgccaggggccdel	p.PPGA356del	REPIN1_ENST00000444957.1_In_Frame_Del_p.PPGA356del|REPIN1_ENST00000540729.1_In_Frame_Del_p.PPGA356del|REPIN1_ENST00000489432.2_In_Frame_Del_p.PPGA413del|REPIN1_ENST00000479668.1_3'UTR|REPIN1_ENST00000397281.2_In_Frame_Del_p.PPGA356del|RP4-584D14.5_ENST00000488310.1_RNA	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	356	Pro-rich.				DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.P356_A359delPPGA(1)		cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			CCAGGAGCCGCCGCCAGGGGCCCCGCCAGAGC	0.783														714	0.142572	0.3207	0.0533	5008	,	,		8637	0.0724		0.0348	False		,,,				2504	0.1483																1	Deletion - In frame(1)	prostate(1)						ENSG00000214022		,,,	481,1369		176,129,620					,,,	-7.4	0.0		dbSNP_107	1	202,4558		64,74,2242	no	coding,coding,coding,coding	REPIN1	NM_014374.3,NM_013400.3,NM_001099696.2,NM_001099695.1	,,,	240,203,2862	A1A1,A1R,RR		4.2437,26.0,10.3328	,,,	,,,		683,5927				REPIN1	SO:0001651	inframe_deletion	0				HGNC	AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.1066_1077delCCGCCAGGGGCC	7.37:g.150069396_150069407delCCGCCAGGGGCC	ENSP00000388287:p.Pro356_Ala359del	Somatic	NA	NA	NA		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.GAPP415in_frame_del	ENST00000425389.2	37	c.1237_1248	CCDS43677.1	7																																																																																			-	NULL		0.783	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	REPIN1	protein_coding	OTTHUMT00000376940.1	CCGCCAGGGGCC	NM_014374			150069407	+1	no_errors	ENST00000489432	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001	-
PRKAA1	5562	genome.wustl.edu	37	5	40765100	40765100	+	Silent	SNP	C	C	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr5:40765100C>T	ENST00000397128.2	-	7	1070	c.1062G>A	c.(1060-1062)gcG>gcA	p.A354A	PRKAA1_ENST00000354209.3_Silent_p.A369A	NM_006251.5|NM_206907.3	NP_006242.5|NP_996790.3	Q13131	AAPK1_HUMAN	protein kinase, AMP-activated, alpha 1 catalytic subunit	354	AIS.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to glucose starvation (GO:0042149)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|cold acclimation (GO:0009631)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|fatty acid oxidation (GO:0019395)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of glucosylceramide biosynthetic process (GO:0046318)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of gene expression (GO:0010628)|positive regulation of glycolytic process (GO:0045821)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of transcription, DNA-templated (GO:0006355)|regulation of vesicle-mediated transport (GO:0060627)|response to activity (GO:0014823)|response to caffeine (GO:0031000)|response to camptothecin (GO:1901563)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	AMP-activated protein kinase complex (GO:0031588)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|tau-protein kinase activity (GO:0050321)			breast(1)	1					Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Phenformin(DB00914)	GTGGGCTTGTCGCCAAATAGA	0.438																																																	0								ENSG00000132356						96.0	95.0	95.0					5																	40765100		1971	4149	6120	PRKAA1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS3932.2, CCDS3933.2	5p13.1	2012-10-03			ENSG00000132356	ENSG00000132356			9376	protein-coding gene	gene with protein product	"""AMPK, alpha, 1"""	602739				8557660	Standard	XM_006714481		Approved	AMPKa1	uc003jmb.3	Q13131	OTTHUMG00000162269	ENST00000397128.2:c.1062G>A	5.37:g.40765100C>T		Somatic	0	50	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	61	33.70	A8MTQ6|B2R7E1|O00286|Q5D0E1|Q86VS1|Q9UNQ4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A369	ENST00000397128.2	37	c.1107	CCDS3932.2	5																																																																																			-	NULL		0.438	PRKAA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAA1	protein_coding	OTTHUMT00000253833.2	C	NM_006251	-		40765100	-1	no_errors	ENST00000354209	ensembl	human	known	74_37	silent	SNP	0.250	T
PIGC	5279	genome.wustl.edu	37	1	172413160	172413160	+	5'UTR	SNP	C	C	T	rs565412413		TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr1:172413160C>T	ENST00000367728.1	-	0	66				PIGC_ENST00000484368.1_5'UTR|PIGC_ENST00000258324.1_5'UTR|PIGC_ENST00000344529.4_5'UTR|C1orf105_ENST00000367727.4_Intron			Q92535	PIGC_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class C						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			breast(1)|endometrium(1)|kidney(1)|lung(1)	4						AGCTGGGGGACGGCGGCACCC	0.667											OREG0013986	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000135845																																			PIGC	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BC006539	CCDS1302.1	1q23-q25	2013-02-26	2006-06-28		ENSG00000135845	ENSG00000135845	2.4.1.198	"""Phosphatidylinositol glycan anchor biosynthesis"""	8960	protein-coding gene	gene with protein product	"""phosphatidylinositol N-acetylglucosaminyltransferase"""	601730	"""phosphatidylinositol glycan, class C"""			8806613, 9325057	Standard	NM_153747		Approved		uc001gio.3	Q92535	OTTHUMG00000034751	ENST00000367728.1:c.-1398G>A	1.37:g.172413160C>T		Somatic	0	37	0.00	1900	0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	38	24.00	O14491	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000367728.1	37	NULL	CCDS1302.1	1																																																																																			-	-		0.667	PIGC-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PIGC	protein_coding	OTTHUMT00000084068.1	C	NM_153747	-		172413160	-1	no_errors	ENST00000484368	ensembl	human	known	74_37	rna	SNP	0.000	T
GLI2	2736	genome.wustl.edu	37	2	121745876	121745876	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr2:121745876G>A	ENST00000452319.1	+	14	2446	c.2386G>A	c.(2386-2388)Gtg>Atg	p.V796M	GLI2_ENST00000314490.11_Missense_Mutation_p.V468M|GLI2_ENST00000361492.4_Missense_Mutation_p.V796M					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CGCGAGCGAGGTGACCATGCT	0.711																																																	0								ENSG00000074047						5.0	7.0	7.0					2																	121745876		2109	4163	6272	GLI2	SO:0001583	missense	0			-	HGNC		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.2386G>A	2.37:g.121745876G>A	ENSP00000390436:p.Val796Met	Somatic	0	14	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	6	73.91		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V796M	ENST00000452319.1	37	c.2386	CCDS33283.1	2	.	.	.	.	.	.	.	.	.	.	G	14.51	2.557368	0.45590	.	.	ENSG00000074047	ENST00000452319;ENST00000361492;ENST00000314490	D;D;D	0.90900	-2.75;-2.75;-2.75	4.58	4.58	0.56647	.	0.280979	0.34314	N	0.004070	D	0.92945	0.7755	L	0.45051	1.395	0.33554	D	0.596484	P;P;P;D	0.76494	0.826;0.802;0.753;0.999	B;B;B;D	0.71656	0.292;0.337;0.381;0.974	D	0.94471	0.7685	10	0.42905	T	0.14	.	17.5869	0.87984	0.0:0.0:1.0:0.0	.	796;451;451;468	P10070;P10070-2;P10070-4;P10070-3	GLI2_HUMAN;.;.;.	M	796;796;468	ENSP00000390436:V796M;ENSP00000354586:V796M;ENSP00000312694:V468M	ENSP00000312694:V468M	V	+	1	0	GLI2	121462346	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	2.761000	0.47589	2.366000	0.80165	0.561000	0.74099	GTG	-	NULL		0.711	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	GLI2	protein_coding	OTTHUMT00000332293.3	G	NM_005270	-		121745876	+1	no_errors	ENST00000361492	ensembl	human	known	74_37	missense	SNP	1.000	A
FCRL3	115352	genome.wustl.edu	37	1	157668317	157668317	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr1:157668317G>T	ENST00000368184.3	-	4	446	c.155C>A	c.(154-156)gCc>gAc	p.A52D	FCRL3_ENST00000473231.1_5'Flank|FCRL3_ENST00000368186.5_Missense_Mutation_p.A52D|RP11-367J7.3_ENST00000453692.1_RNA	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	52	Ig-like C2-type 1.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					GTCTCCCTGGGCTAGGGAATG	0.443																																																	0								ENSG00000160856						179.0	160.0	166.0					1																	157668317		2203	4300	6503	FCRL3	SO:0001583	missense	0			-	HGNC	AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.155C>A	1.37:g.157668317G>T	ENSP00000357167:p.Ala52Asp	Somatic	0	39	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A52D	ENST00000368184.3	37	c.155	CCDS1167.1	1	.	.	.	.	.	.	.	.	.	.	G	13.23	2.174368	0.38413	.	.	ENSG00000160856	ENST00000368186;ENST00000368184;ENST00000292392	T;T	0.12569	2.67;2.67	5.46	-6.63	0.01807	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.069620	0.07457	N	0.900024	T	0.09949	0.0244	M	0.68952	2.095	0.09310	N	1	D;D	0.59357	0.985;0.981	P;P	0.61477	0.889;0.823	T	0.22243	-1.0222	10	0.56958	D	0.05	.	0.1203	0.00064	0.2717:0.1892:0.2516:0.2875	.	52;52	Q96P31;Q96P31-6	FCRL3_HUMAN;.	D	52	ENSP00000357169:A52D;ENSP00000357167:A52D	ENSP00000292392:A52D	A	-	2	0	FCRL3	155934941	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.220000	0.17660	-0.558000	0.06118	-0.282000	0.10007	GCC	-	smart_Ig_sub,pfscan_Ig-like_dom		0.443	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	FCRL3	protein_coding	OTTHUMT00000051419.2	G	NM_052939	-		157668317	-1	no_errors	ENST00000492769	ensembl	human	known	74_37	missense	SNP	0.000	T
PHC1	1911	genome.wustl.edu	37	12	9085405	9085405	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr12:9085405C>A	ENST00000543824.1	+	9	1684	c.1352C>A	c.(1351-1353)cCa>cAa	p.P451Q	PHC1_ENST00000536844.1_Missense_Mutation_p.P230Q|PHC1_ENST00000544916.1_Missense_Mutation_p.P451Q|PHC1_ENST00000433083.2_Missense_Mutation_p.P406Q|PHC1_ENST00000433847.2_3'UTR			P78364	PHC1_HUMAN	polyhomeotic homolog 1 (Drosophila)	451					cellular response to retinoic acid (GO:0071300)|histone ubiquitination (GO:0016574)|multicellular organismal development (GO:0007275)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|large_intestine(8)|liver(2)|lung(3)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	27						CCTCAGCCACCACAGGTCCCA	0.607																																																	0								ENSG00000111752																																			PHC1	SO:0001583	missense	0			-	HGNC	U89277	CCDS8597.1	12p13	2013-01-10	2006-09-12	2002-11-15	ENSG00000111752	ENSG00000111752		"""Sterile alpha motif (SAM) domain containing"""	3182	protein-coding gene	gene with protein product		602978	"""early development regulator 1 (homolog of polyhomeotic 1)"", ""polyhomeotic-like 1 (Drosophila)"""	EDR1		9121482	Standard	XM_005253334		Approved	HPH1, RAE28	uc001qvd.3	P78364	OTTHUMG00000168275	ENST00000543824.1:c.1352C>A	12.37:g.9085405C>A	ENSP00000440674:p.Pro451Gln	Somatic	0	96	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	101	20.47	D3DUV4|Q8WVM3|Q9BU63	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SAM_type1,pfam_SAM_2,pfam_Znf_MYM,superfamily_SAM/pointed,smart_SAM,pfscan_SAM,pfscan_Znf_FCS	p.P451Q	ENST00000543824.1	37	c.1352	CCDS8597.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.25|11.25	1.583704|1.583704	0.28268|0.28268	.|.	.|.	ENSG00000111752|ENSG00000111752	ENST00000537610|ENST00000543824;ENST00000251757;ENST00000433083;ENST00000544916;ENST00000536844	.|T;T;T;T;D	.|0.88354	.|0.78;0.78;0.78;0.78;-2.37	4.27|4.27	4.27|4.27	0.50696|0.50696	.|.	.|0.162146	.|0.42682	.|D	.|0.000663	T|T	0.78541|0.78541	0.4299|0.4299	N|N	0.08118|0.08118	0|0	0.20821|0.20821	N|N	0.999847|0.999847	.|P;B;B	.|0.35208	.|0.49;0.392;0.18	.|B;B;B	.|0.39904	.|0.313;0.106;0.023	T|T	0.67476|0.67476	-0.5661|-0.5661	5|10	.|0.19147	.|T	.|0.46	-7.904|-7.904	12.5052|12.5052	0.55977|0.55977	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|451;451;451	.|B4DF21;P78364;B2RXH1	.|.;PHC1_HUMAN;.	N|Q	87|451;451;406;451;230	.|ENSP00000440674:P451Q;ENSP00000251757:P451Q;ENSP00000399194:P406Q;ENSP00000437659:P451Q;ENSP00000440488:P230Q	.|ENSP00000251757:P451Q	H|P	+|+	1|2	0|0	PHC1|PHC1	8976672|8976672	0.732000|0.732000	0.28121|0.28121	0.986000|0.986000	0.45419|0.45419	0.970000|0.970000	0.65996|0.65996	2.659000|2.659000	0.46741|0.46741	2.652000|2.652000	0.90054|0.90054	0.650000|0.650000	0.86243|0.86243	CAC|CCA	-	NULL		0.607	PHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHC1	protein_coding	OTTHUMT00000399115.1	C	NM_004426	-		9085405	+1	no_errors	ENST00000543824	ensembl	human	known	74_37	missense	SNP	0.996	A
ADH7	131	genome.wustl.edu	37	4	100349113	100349113	+	Silent	SNP	G	G	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr4:100349113G>T	ENST00000209665.4	-	5	657	c.417C>A	c.(415-417)acC>acA	p.T139T	ADH7_ENST00000476959.1_Silent_p.T147T|ADH7_ENST00000482593.1_Silent_p.T70T|ADH7_ENST00000437033.2_Silent_p.T127T	NM_000673.4	NP_000664.2	P40394	ADH7_HUMAN	alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide	139					ethanol catabolic process (GO:0006068)|ethanol oxidation (GO:0006069)|extracellular negative regulation of signal transduction (GO:1900116)|fatty acid omega-oxidation (GO:0010430)|oxidation-reduction process (GO:0055114)|response to bacterium (GO:0009617)|response to ethanol (GO:0045471)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular region (GO:0005576)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|aldehyde oxidase activity (GO:0004031)|ethanol binding (GO:0035276)|receptor antagonist activity (GO:0048019)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)	19				OV - Ovarian serous cystadenocarcinoma(123;1.75e-08)		TAAATCTGGTGGTGCCATCAG	0.383																																																	0								ENSG00000196344						257.0	197.0	217.0					4																	100349113		2203	4300	6503	ADH7	SO:0001819	synonymous_variant	0			-	HGNC	X76342	CCDS34034.1, CCDS54781.1	4q23-q24	2008-02-05			ENSG00000196344	ENSG00000196344	1.1.1.1	"""Alcohol dehydrogenases"""	256	protein-coding gene	gene with protein product		600086				8195208	Standard	NM_000673		Approved	ADH-4	uc021xqj.1	P40394	OTTHUMG00000159318	ENST00000209665.4:c.417C>A	4.37:g.100349113G>T		Somatic	0	42	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	32	15.79	A2RRB6|A8MVN9|B2R760|B4DWV6|Q13713	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like	p.T139	ENST00000209665.4	37	c.417	CCDS34034.1	4																																																																																			-	pfam_ADH_GroES-like,superfamily_GroES-like		0.383	ADH7-201	KNOWN	basic|CCDS	protein_coding	ADH7	protein_coding		G	NM_000673	-		100349113	-1	no_errors	ENST00000209665	ensembl	human	known	74_37	silent	SNP	0.141	T
CHP2	63928	genome.wustl.edu	37	16	23768606	23768606	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr16:23768606G>T	ENST00000300113.2	+	6	922	c.499G>T	c.(499-501)Gat>Tat	p.D167Y		NM_022097.2	NP_071380.1	O43745	CHP2_HUMAN	calcineurin-like EF-hand protein 2	167	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cellular response to calcium ion (GO:0071277)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(2)|stomach(1)	9				GBM - Glioblastoma multiforme(48;0.0144)		GGCTGATGAAGATGGGGATGG	0.567																																																	0								ENSG00000166869						95.0	83.0	87.0					16																	23768606		2197	4300	6497	CHP2	SO:0001583	missense	0			-	HGNC		CCDS10617.1	16p12.2	2013-01-11	2013-01-11		ENSG00000166869	ENSG00000166869		"""EF-hand domain containing"""	24927	protein-coding gene	gene with protein product						12226101	Standard	NM_022097		Approved		uc002dmb.1	O43745	OTTHUMG00000131611	ENST00000300113.2:c.499G>T	16.37:g.23768606G>T	ENSP00000300113:p.Asp167Tyr	Somatic	0	65	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	53	18.46	A8K2I8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.D167Y	ENST00000300113.2	37	c.499	CCDS10617.1	16	.	.	.	.	.	.	.	.	.	.	G	19.60	3.857504	0.71834	.	.	ENSG00000166869	ENST00000300113	T	0.40225	1.04	5.21	4.25	0.50352	EF-hand-like domain (1);	0.139399	0.43747	D	0.000521	T	0.76219	0.3957	H	0.98682	4.3	0.53688	D	0.999971	D	0.89917	1.0	D	0.68039	0.955	D	0.85964	0.1472	10	0.87932	D	0	-20.7131	13.948	0.64099	0.0:0.1531:0.8469:0.0	.	167	O43745	CHP2_HUMAN	Y	167	ENSP00000300113:D167Y	ENSP00000300113:D167Y	D	+	1	0	AC130454.2	23676107	1.000000	0.71417	0.835000	0.33067	0.988000	0.76386	4.294000	0.59043	1.562000	0.49601	0.655000	0.94253	GAT	-	smart_EF_hand_dom,pfscan_EF_hand_dom		0.567	CHP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHP2	protein_coding	OTTHUMT00000254498.1	G	NM_022097	-		23768606	+1	no_errors	ENST00000300113	ensembl	human	known	74_37	missense	SNP	0.985	T
TMEM38B	55151	genome.wustl.edu	37	9	108456972	108456972	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr9:108456972G>A	ENST00000374692.3	+	1	148	c.31G>A	c.(31-33)Gcc>Acc	p.A11T		NM_018112.1	NP_060582.1	Q9NVV0	TM38B_HUMAN	transmembrane protein 38B	11						integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	13						GTTGGCTCTGGCCTTCTCCCG	0.627																																																	0								ENSG00000095209						118.0	95.0	103.0					9																	108456972		2203	4300	6503	TMEM38B	SO:0001583	missense	0			-	HGNC	BC031938	CCDS6768.1	9q31.3	2013-05-23	2004-12-21	2004-12-22	ENSG00000095209	ENSG00000095209			25535	protein-coding gene	gene with protein product		611236	"""chromosome 9 open reading frame 87"""	C9orf87		17611541, 23316006	Standard	NM_018112		Approved	FLJ10493, bA219P18.1, D4Ertd89e, TRIC-B	uc004bcu.2	Q9NVV0	OTTHUMG00000020429	ENST00000374692.3:c.31G>A	9.37:g.108456972G>A	ENSP00000363824:p.Ala11Thr	Somatic	0	62	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	60	34.07	Q5JR63|Q5SVN5|Q5SVN6|Q5VTE2|Q6IA97	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TRIC_channel	p.A11T	ENST00000374692.3	37	c.31	CCDS6768.1	9	.	.	.	.	.	.	.	.	.	.	G	4.700	0.130146	0.08981	.	.	ENSG00000095209	ENST00000374692	T	0.43688	0.94	5.36	0.14	0.14804	.	0.590460	0.18286	N	0.145884	T	0.15392	0.0371	N	0.08118	0	0.42120	D	0.991429	B	0.02656	0.0	B	0.01281	0.0	T	0.11542	-1.0583	10	0.09843	T	0.71	-3.1721	3.5193	0.07736	0.2382:0.0:0.4495:0.3123	.	11	Q9NVV0	TM38B_HUMAN	T	11	ENSP00000363824:A11T	ENSP00000363824:A11T	A	+	1	0	TMEM38B	107496793	0.008000	0.16893	0.677000	0.29947	0.025000	0.11179	-0.586000	0.05787	0.210000	0.20664	-0.149000	0.13747	GCC	-	NULL		0.627	TMEM38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM38B	protein_coding	OTTHUMT00000053517.1	G	NM_018112	-		108456972	+1	no_errors	ENST00000374692	ensembl	human	known	74_37	missense	SNP	0.218	A
PRDM9	56979	genome.wustl.edu	37	5	23523455	23523455	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr5:23523455C>G	ENST00000296682.3	+	9	1120	c.938C>G	c.(937-939)gCc>gGc	p.A313G		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	313	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AAATCCTGGGCCAACTGGATG	0.433										HNSCC(3;0.000094)																																							0								ENSG00000164256						126.0	121.0	123.0					5																	23523455		2203	4300	6503	PRDM9	SO:0001583	missense	0			-	HGNC	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.938C>G	5.37:g.23523455C>G	ENSP00000296682:p.Ala313Gly	Somatic	0	59	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	98	16.95	B4DX22|Q27Q50	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.A313G	ENST00000296682.3	37	c.938	CCDS43307.1	5	.	.	.	.	.	.	.	.	.	.	C	10.53	1.377324	0.24944	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.68479	-0.33	3.72	2.82	0.32997	SET domain (2);	0.452222	0.16407	N	0.215768	T	0.48732	0.1516	N	0.20807	0.61	0.35623	D	0.809613	P	0.37525	0.598	B	0.34824	0.19	T	0.59085	-0.7520	10	0.72032	D	0.01	-14.9603	9.7078	0.40227	0.0:0.7858:0.2141:0.0	.	313	Q9NQV7	PRDM9_HUMAN	G	313;107	ENSP00000296682:A313G	ENSP00000253473:A107G	A	+	2	0	PRDM9	23559212	0.998000	0.40836	0.953000	0.39169	0.211000	0.24417	1.363000	0.34159	0.824000	0.34613	-0.256000	0.11100	GCC	-	pfscan_SET_dom		0.433	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	protein_coding	OTTHUMT00000366375.1	C	NM_020227	-		23523455	+1	no_errors	ENST00000296682	ensembl	human	known	74_37	missense	SNP	1.000	G
DNM1P51	0	genome.wustl.edu	37	15	84953090	84953090	+	RNA	DEL	G	G	-	rs201426788		TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr15:84953090delG	ENST00000558801.1	-	0	8675									DNM1 pseudogene 51																		ATTTTCCTTAGAAATCTTTGG	0.517																																																	0								ENSG00000235370																																			DNM1P51			0				HGNC			15q25.2	2013-05-16			ENSG00000259297	ENSG00000235370			48500	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000172438		15.37:g.84953090delG		Somatic	0	11	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	7	46.15		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000558801.1	37	NULL		15																																																																																			-	-		0.517	DNM1P51-001	KNOWN	basic	processed_transcript	DNM1P51	pseudogene	OTTHUMT00000471721.1	G				84953090	-1	no_errors	ENST00000558801	ensembl	human	known	74_37	rna	DEL	0.402	-
POLL	27343	genome.wustl.edu	37	10	103339146	103339146	+	3'UTR	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr10:103339146G>A	ENST00000370162.3	-	0	2286				POLL_ENST00000456836.2_3'UTR|POLL_ENST00000299206.4_3'UTR|DPCD_ENST00000470165.1_Intron|DPCD_ENST00000416979.2_Intron|POLL_ENST00000463515.1_5'UTR|POLL_ENST00000339310.3_3'UTR|POLL_ENST00000370158.3_3'UTR|POLL_ENST00000370172.1_3'UTR|POLL_ENST00000370169.1_3'UTR|POLL_ENST00000370168.3_3'UTR	NM_001174084.1|NM_001174085.1|NM_013274.3	NP_001167555.1|NP_001167556.1|NP_037406.1	Q9UGP5	DPOLL_HUMAN	polymerase (DNA directed), lambda						DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|nucleotide-excision repair (GO:0006289)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|lyase activity (GO:0016829)|metal ion binding (GO:0046872)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(2)	19		Colorectal(252;0.234)		Epithelial(162;1.55e-08)|all cancers(201;6.64e-07)		GCTGGAGGGAGTACTGGGTGG	0.677								DNA polymerases (catalytic subunits)																																									0								ENSG00000166169																																			POLL	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF161019	CCDS7513.1	10q23	2012-05-18			ENSG00000166169	ENSG00000166169		"""DNA polymerases"""	9184	protein-coding gene	gene with protein product		606343				17686665	Standard	NM_001174084		Approved		uc001kti.2	Q9UGP5	OTTHUMG00000018933	ENST00000370162.3:c.*64C>T	10.37:g.103339146G>A		Somatic	0	88	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	56	25.33	D3DR76|Q5JQP5|Q6NUM2|Q9BTN8|Q9HA10|Q9HB35	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370162.3	37	NULL	CCDS7513.1	10																																																																																			-	-		0.677	POLL-202	KNOWN	basic|appris_principal|CCDS	protein_coding	POLL	protein_coding	OTTHUMT00000049946.1	G	NM_013274	-		103339146	-1	no_errors	ENST00000463515	ensembl	human	known	74_37	rna	SNP	0.000	A
LMNTD1	160492	genome.wustl.edu	37	12	25801455	25801455	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr12:25801455C>T	ENST00000445693.1	-	1	33	c.31G>A	c.(31-33)Ggt>Agt	p.G11S		NM_001145727.2	NP_001139199.1	Q8N9Z9	LMTD1_HUMAN		0					cell proliferation (GO:0008283)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|nuclear envelope (GO:0005635)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22	all_lung(3;2.75e-22)|Lung NSC(3;1.77e-21)|all_hematologic(7;0.00656)|Colorectal(261;0.0847)					CTGGAAACACCGATGTCTCCT	0.478																																																	0								ENSG00000152936						247.0	218.0	227.0					12																	25801455		692	1591	2283	IFLTD1	SO:0001583	missense	0			-	HGNC																												ENST00000445693.1:c.31G>A	12.37:g.25801455C>T	ENSP00000407043:p.Gly11Ser	Somatic	0	55	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	49	24.62	B4DL27|B4DY70|Q8IY38	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lamin_tail_dom	p.G11S	ENST00000445693.1	37	c.31	CCDS44847.1	12	.	.	.	.	.	.	.	.	.	.	C	11.80	1.745636	0.30955	.	.	ENSG00000152936	ENST00000445693	T	0.13901	2.55	3.95	2.03	0.26663	.	.	.	.	.	T	0.05640	0.0148	.	.	.	0.09310	N	0.999992	D	0.61080	0.989	B	0.44044	0.439	T	0.06463	-1.0825	8	0.02654	T	1	.	4.8409	0.13489	0.2108:0.6744:0.0:0.1148	.	11	Q8N9Z9-3	.	S	11	ENSP00000407043:G11S	ENSP00000407043:G11S	G	-	1	0	IFLTD1	25692722	0.001000	0.12720	0.008000	0.14137	0.003000	0.03518	1.143000	0.31553	0.840000	0.34995	0.650000	0.86243	GGT	-	NULL		0.478	IFLTD1-003	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	IFLTD1	protein_coding	OTTHUMT00000402280.1	C		-		25801455	-1	no_errors	ENST00000445693	ensembl	human	putative	74_37	missense	SNP	0.001	T
CBR3	874	genome.wustl.edu	37	21	37518520	37518520	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr21:37518520G>T	ENST00000290354.5	+	3	825	c.544G>T	c.(544-546)Gag>Tag	p.E182*	CBR3-AS1_ENST00000427491.1_RNA|CBR3-AS1_ENST00000608690.1_RNA|CBR3-AS1_ENST00000608632.1_RNA|CBR3-AS1_ENST00000608641.1_RNA|CBR3-AS1_ENST00000453159.1_RNA|CBR3-AS1_ENST00000413862.1_RNA|CBR3-AS1_ENST00000608622.1_RNA	NM_001236.3	NP_001227.1	O75828	CBR3_HUMAN	carbonyl reductase 3	182					cognition (GO:0050890)|phylloquinone catabolic process (GO:0042376)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	3-keto sterol reductase activity (GO:0000253)|carbonyl reductase (NADPH) activity (GO:0004090)|NADPH binding (GO:0070402)			kidney(1)|large_intestine(1)|lung(1)	3					Doxorubicin(DB00997)	CACAAAAAATGAGGTGCATGA	0.512																																																	0								ENSG00000159231						94.0	83.0	87.0					21																	37518520		2203	4300	6503	CBR3	SO:0001587	stop_gained	0			-	HGNC	AB004854	CCDS13642.1	21q22.2	2011-09-14			ENSG00000159231	ENSG00000159231	1.1.1.184	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	1549	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 21C, member 2"""	603608				9740676, 19027726	Standard	NM_001236		Approved	SDR21C2	uc002yve.3	O75828	OTTHUMG00000086617	ENST00000290354.5:c.544G>T	21.37:g.37518520G>T	ENSP00000290354:p.Glu182*	Somatic	0	52	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	41	21.15	Q6FHP2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.E182*	ENST00000290354.5	37	c.544	CCDS13642.1	21	.	.	.	.	.	.	.	.	.	.	G	37	6.589675	0.97688	.	.	ENSG00000159231	ENST00000290354	.	.	.	4.77	4.77	0.60923	.	0.203451	0.51477	D	0.000099	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	2.0E-4	11.8845	0.52594	0.0914:0.0:0.9086:0.0	.	.	.	.	X	182	.	ENSP00000290354:E182X	E	+	1	0	CBR3	36440390	1.000000	0.71417	0.569000	0.28460	0.996000	0.88848	5.048000	0.64238	2.490000	0.84030	0.561000	0.74099	GAG	-	NULL		0.512	CBR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBR3	protein_coding	OTTHUMT00000194632.1	G		-		37518520	+1	no_errors	ENST00000290354	ensembl	human	known	74_37	nonsense	SNP	0.994	T
SCAF11	9169	genome.wustl.edu	37	12	46325318	46325318	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr12:46325318G>A	ENST00000369367.3	-	10	1045	c.812C>T	c.(811-813)cCa>cTa	p.P271L	SCAF11_ENST00000465950.1_5'Flank|SCAF11_ENST00000549162.1_Missense_Mutation_p.P79L|SCAF11_ENST00000419565.2_Missense_Mutation_p.P271L	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	271					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						GGTACTTGTTGGAAAAATAGT	0.279																																																	0								ENSG00000139218						66.0	60.0	62.0					12																	46325318		1802	4065	5867	SCAF11	SO:0001583	missense	0			-	HGNC	Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.812C>T	12.37:g.46325318G>A	ENSP00000358374:p.Pro271Leu	Somatic	0	48	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	89	9.18	A6NEU9|A6NLW5|Q8IW59	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_RING,pfscan_Znf_RING	p.P271L	ENST00000369367.3	37	c.812	CCDS8748.2	12	.	.	.	.	.	.	.	.	.	.	G	27.4	4.831739	0.91036	.	.	ENSG00000139218	ENST00000369367;ENST00000549162;ENST00000419565;ENST00000547018	T;T;T;T	0.43294	0.95;1.46;0.95;0.95	6.17	6.17	0.99709	.	0.159443	0.29185	U	0.012891	T	0.56321	0.1977	L	0.34521	1.04	0.50171	D	0.999859	D;D	0.76494	0.999;0.998	D;D	0.71656	0.974;0.941	T	0.55270	-0.8167	10	0.87932	D	0	-12.0345	19.0599	0.93085	0.0:0.0:1.0:0.0	.	79;271	F8VXG7;Q99590	.;SCAFB_HUMAN	L	271;79;271;211	ENSP00000358374:P271L;ENSP00000448864:P79L;ENSP00000413036:P271L;ENSP00000446746:P211L	ENSP00000358374:P271L	P	-	2	0	SCAF11	44611585	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.554000	0.60760	2.941000	0.99782	0.655000	0.94253	CCA	-	NULL		0.279	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAF11	protein_coding	OTTHUMT00000313992.2	G	NM_004719	-		46325318	-1	no_errors	ENST00000369367	ensembl	human	known	74_37	missense	SNP	1.000	A
MUM1L1	139221	genome.wustl.edu	37	X	105450724	105450724	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chrX:105450724G>T	ENST00000357175.2	+	4	1948	c.1299G>T	c.(1297-1299)aaG>aaT	p.K433N	MUM1L1_ENST00000337685.2_Missense_Mutation_p.K433N|MUM1L1_ENST00000372552.1_Missense_Mutation_p.K433N	NM_001171020.1	NP_001164491.1	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	433	PWWP.					extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						ATTCTGAAAAGAAGGGCATTA	0.348																																																	0								ENSG00000157502						43.0	39.0	40.0					X																	105450724		1816	4068	5884	MUM1L1	SO:0001583	missense	0			-	HGNC	AK090835	CCDS55469.1	Xq22.3	2008-02-05			ENSG00000157502	ENSG00000157502			26583	protein-coding gene	gene with protein product							Standard	NM_152423		Approved	FLJ33516	uc004emf.2	Q5H9M0	OTTHUMG00000022146	ENST00000357175.2:c.1299G>T	X.37:g.105450724G>T	ENSP00000349699:p.Lys433Asn	Somatic	0	55	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	13	48.00	D3DUX2|Q49AS5|Q8N2C0|Q96MT6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_PyrdxlP-dep_Trfase	p.K433N	ENST00000357175.2	37	c.1299	CCDS55469.1	X	.	.	.	.	.	.	.	.	.	.	G	12.20	1.866471	0.32977	.	.	ENSG00000157502	ENST00000357175;ENST00000337685;ENST00000372552	T;T;T	0.69435	-0.4;-0.4;-0.4	4.31	1.5	0.22942	.	0.224250	0.30969	N	0.008505	T	0.53433	0.1796	L	0.47716	1.5	0.34370	D	0.691927	B	0.25272	0.122	B	0.29663	0.105	T	0.52503	-0.8567	10	0.45353	T	0.12	-8.6411	3.7717	0.08645	0.2322:0.2:0.5677:0.0	.	433	Q5H9M0	MUML1_HUMAN	N	433	ENSP00000349699:K433N;ENSP00000338641:K433N;ENSP00000361632:K433N	ENSP00000338641:K433N	K	+	3	2	MUM1L1	105337380	0.998000	0.40836	0.995000	0.50966	0.930000	0.56654	0.386000	0.20702	0.179000	0.19938	0.529000	0.55759	AAG	-	NULL		0.348	MUM1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MUM1L1	protein_coding	OTTHUMT00000057795.1	G	NM_152423	-		105450724	+1	no_errors	ENST00000337685	ensembl	human	known	74_37	missense	SNP	0.994	T
CTPS1	1503	genome.wustl.edu	37	1	41467863	41467863	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr1:41467863C>T	ENST00000372621.4	+	11	1634	c.1126C>T	c.(1126-1128)Cga>Tga	p.R376*	CTPS1_ENST00000372616.1_Nonsense_Mutation_p.R376*|CTPS1_ENST00000541520.1_Nonsense_Mutation_p.R145*	NM_001905.2	NP_001896.2			CTP synthase 1									p.R376*(2)		endometrium(3)|lung(10)	13						ATTTGGTGTTCGAGGAACAGA	0.453																																																	2	Substitution - Nonsense(2)	endometrium(2)						ENSG00000171793						218.0	206.0	211.0					1																	41467863		2203	4300	6503	CTPS1	SO:0001587	stop_gained	0			-	HGNC	BC009408	CCDS459.1	1p34.1	2012-05-02	2012-05-02	2012-05-02	ENSG00000171793	ENSG00000171793	6.3.4.2		2519	protein-coding gene	gene with protein product		123860	"""CTP synthase"""	CTPS		1783378	Standard	XM_005270536		Approved		uc001cgk.4	P17812	OTTHUMG00000005712	ENST00000372621.4:c.1126C>T	1.37:g.41467863C>T	ENSP00000361704:p.Arg376*	Somatic	0	133	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	125	17.22		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CTP_synthase_N,pfam_GATASE,pfam_Peptidase_C26,superfamily_P-loop_NTPase,tigrfam_CTP_synthase	p.R376*	ENST00000372621.4	37	c.1126	CCDS459.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.366320	0.97507	.	.	ENSG00000171793	ENST00000372621;ENST00000541520;ENST00000372616	.	.	.	5.92	5.01	0.66863	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.9196	0.58224	0.0:0.9217:0.0:0.0783	.	.	.	.	X	376;145;376	.	ENSP00000361699:R376X	R	+	1	2	CTPS	41240450	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.320000	0.59203	1.504000	0.48704	-0.145000	0.13849	CGA	-	pfam_GATASE,tigrfam_CTP_synthase		0.453	CTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTPS1	protein_coding	OTTHUMT00000015629.1	C	NM_001905	-		41467863	+1	no_errors	ENST00000372616	ensembl	human	known	74_37	nonsense	SNP	1.000	T
GRIK5	2901	genome.wustl.edu	37	19	42510901	42510901	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr19:42510901C>T	ENST00000262895.3	-	15	1932	c.1933G>A	c.(1933-1935)Gtg>Atg	p.V645M	GRIK5_ENST00000301218.4_Missense_Mutation_p.V645M|GRIK5_ENST00000593562.1_Missense_Mutation_p.V645M	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	645					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.V645M(2)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				ATGCGCTGCACGGTGAGGAAG	0.617																																																	2	Substitution - Missense(2)	endometrium(2)						ENSG00000105737						71.0	56.0	61.0					19																	42510901		2203	4300	6503	GRIK5	SO:0001583	missense	0			-	HGNC		CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.1933G>A	19.37:g.42510901C>T	ENSP00000262895:p.Val645Met	Somatic	0	82	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	112	13.85	Q8WWG8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.V645M	ENST00000262895.3	37	c.1933	CCDS12595.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.4|26.4	4.735270|4.735270	0.89482|0.89482	.|.	.|.	ENSG00000105737|ENSG00000105737	ENST00000454993|ENST00000262895;ENST00000301218	.|T;T	.|0.58940	.|0.3;0.3	5.18|5.18	5.18|5.18	0.71444|0.71444	.|Ionotropic glutamate receptor (2);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.80454|0.80454	0.4626|0.4626	M|M	0.89030|0.89030	3|3	0.58432|0.58432	D|D	0.999999|0.999999	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.84592|0.84592	0.0667|0.0667	5|10	.|0.87932	.|D	.|0	.|.	17.4594|17.4594	0.87616|0.87616	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|645	.|Q16478	.|GRIK5_HUMAN	H|M	21|645	.|ENSP00000262895:V645M;ENSP00000301218:V645M	.|ENSP00000262895:V645M	R|V	-|-	2|1	0|0	GRIK5|GRIK5	47202741|47202741	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.805000|7.805000	0.86005|0.86005	2.419000|2.419000	0.82065|0.82065	0.563000|0.563000	0.77884|0.77884	CGT|GTG	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,prints_NMDA_rcpt		0.617	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK5	protein_coding	OTTHUMT00000463453.1	C		-		42510901	-1	no_errors	ENST00000301218	ensembl	human	known	74_37	missense	SNP	1.000	T
GPR98	84059	genome.wustl.edu	37	5	90077371	90077371	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr5:90077371G>C	ENST00000405460.2	+	65	13303	c.13207G>C	c.(13207-13209)Gac>Cac	p.D4403H	GPR98_ENST00000425867.2_Missense_Mutation_p.D64H	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	4403	Calx-beta 30. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CATTGAATTTGACCCAAAGTA	0.363																																																	0								ENSG00000164199						60.0	56.0	57.0					5																	90077371		1872	4102	5974	GPR98	SO:0001583	missense	0			-	HGNC	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.13207G>C	5.37:g.90077371G>C	ENSP00000384582:p.Asp4403His	Somatic	0	39	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	54	11.48	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.D4403H	ENST00000405460.2	37	c.13207	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	G	18.46	3.628446	0.67015	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.32515	1.45;1.45	5.8	5.8	0.92144	Na-Ca exchanger/integrin-beta4 (2);	0.249082	0.43110	D	0.000602	T	0.62085	0.2399	M	0.84846	2.72	0.32131	N	0.586817	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.979;0.988	T	0.67757	-0.5588	10	0.42905	T	0.14	.	19.649	0.95793	0.0:0.0:1.0:0.0	.	64;4403;64	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	H	4403;4403;64	ENSP00000384582:D4403H;ENSP00000392618:D64H	ENSP00000296619:D4403H	D	+	1	0	GPR98	90113127	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	3.453000	0.52978	2.740000	0.93945	0.650000	0.86243	GAC	-	pfam_Calx_beta,smart_Calx_beta		0.363	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	protein_coding	OTTHUMT00000369993.2	G	NM_032119	-		90077371	+1	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7578534	7578541	+	Frame_Shift_Del	DEL	CTTGTTGA	CTTGTTGA	-	rs587782160		TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	CTTGTTGA	CTTGTTGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr17:7578534_7578541delCTTGTTGA	ENST00000269305.4	-	5	578_585	c.389_396delTCAACAAG	c.(388-396)ctcaacaagfs	p.LNK130fs	TP53_ENST00000359597.4_Frame_Shift_Del_p.LNK130fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Frame_Shift_Del_p.LNK130fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.LNK130fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.LNK130fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.LNK130fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	130	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		L -> F (in sporadic cancers; somatic mutation).|L -> H (in sporadic cancers; somatic mutation).|L -> I (in a sporadic cancer; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K132N(49)|p.K132R(42)|p.K132E(20)|p.K132Q(13)|p.N131del(11)|p.K132M(10)|p.N131Y(8)|p.0?(8)|p.L130R(7)|p.N131I(7)|p.K132T(7)|p.Y126_K132delYSPALNK(6)|p.N131fs*39(5)|p.L130L(4)|p.K132*(3)|p.L130H(3)|p.K39R(3)|p.N131S(3)|p.Y126_N131delYSPALN(3)|p.N131H(2)|p.L130fs*41(2)|p.K39N(2)|p.N131fs*27(2)|p.N131K(2)|p.K132fs*38(2)|p.Y126fs*11(1)|p.N38fs*39(1)|p.S127_Q136del10(1)|p.A129_N131delALN(1)|p.M133fs*16(1)|p.L130P(1)|p.V73fs*9(1)|p.Y126fs*18(1)|p.L130fs*39(1)|p.L130fs*16(1)|p.A129_K132delALNK(1)|p.K39E(1)|p.L130_M133delLNKM(1)|p.N131N(1)|p.N38I(1)|p.N131T(1)|p.M133fs*37(1)|p.K39T(1)|p.K132_A138delKMFCQLA(1)|p.S127fs*36(1)|p.L130del(1)|p.K132K(1)|p.K132W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCAAAACATCTTGTTGAGGGCAGGGGA	0.553		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	247	Substitution - Missense(184)|Deletion - In frame(26)|Deletion - Frameshift(17)|Whole gene deletion(8)|Substitution - coding silent(6)|Substitution - Nonsense(3)|Insertion - Frameshift(2)|Complex - frameshift(1)	breast(31)|lung(30)|large_intestine(25)|urinary_tract(25)|ovary(25)|upper_aerodigestive_tract(22)|haematopoietic_and_lymphoid_tissue(18)|central_nervous_system(14)|oesophagus(12)|liver(8)|biliary_tract(7)|pancreas(5)|bone(5)|prostate(4)|skin(3)|stomach(3)|adrenal_gland(3)|endometrium(2)|kidney(2)|cervix(1)|soft_tissue(1)|penis(1)	GRCh37	CM086989|CM973641	TP53	M		ENSG00000141510																																			TP53	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.389_396delTCAACAAG	17.37:g.7578534_7578541delCTTGTTGA	ENSP00000269305:p.Leu130fs	Somatic	NA	NA	NA		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.L130fs	ENST00000269305.4	37	c.396_389	CCDS11118.1	17																																																																																			-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.553	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	CTTGTTGA	NM_000546			7578541	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:0.961:0.992	-
PCGF2	7703	genome.wustl.edu	37	17	36890780	36890781	+	3'UTR	INS	-	-	AA	rs386386025|rs5820265|rs3066488|rs33995757	byFrequency	TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr17:36890780_36890781insAA	ENST00000580830.1	-	0	2431_2432				PCGF2_ENST00000581345.1_3'UTR|PCGF2_ENST00000360797.2_3'UTR|CISD3_ENST00000578573.1_3'UTR|RNA5SP440_ENST00000363245.1_RNA|CISD3_ENST00000439660.2_3'UTR			P35227	PCGF2_HUMAN	polycomb group ring finger 2						anterior/posterior pattern specification (GO:0009952)|cellular response to hydrogen peroxide (GO:0070301)|embryonic skeletal system morphogenesis (GO:0048704)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10	Breast(7;9.07e-22)					ACACACACAGGAAAAAAAAAAA	0.47														1040	0.207668	0.0764	0.2493	5008	,	,		20215	0.2123		0.3062	False		,,,				2504	0.2495																0								ENSG00000230055																																			CISD3	SO:0001624	3_prime_UTR_variant	0				HGNC	D13969	CCDS32638.1	17q12	2013-01-09	2005-01-17	2005-01-19		ENSG00000277258		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	12929	protein-coding gene	gene with protein product		600346	"""ring finger protein 110"""	ZNF144, RNF110		8325509	Standard	NM_007144		Approved	MEL-18	uc002hqp.1	P35227		ENST00000580830.1:c.*696->TT	17.37:g.36890789_36890790dupAA		Somatic	0	10	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	13	35.00	A6NGD8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000580830.1	37	NULL	CCDS32638.1	17																																																																																			-	-		0.470	PCGF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CISD3	protein_coding	OTTHUMT00000442246.2	-	NM_007144			36890781	+1	no_errors	ENST00000578573	ensembl	human	known	74_37	rna	INS	0.000:0.000	AA
GABRA5	2558	genome.wustl.edu	37	15	27184483	27184483	+	Intron	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr15:27184483G>A	ENST00000335625.5	+	9	1612				GABRB3_ENST00000541819.2_Missense_Mutation_p.A34V|GABRA5_ENST00000355395.5_Intron|GABRA5_ENST00000400081.3_Intron	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5						associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	CTGGGGCATCGCCAATGAAAT	0.577																																																	0								ENSG00000166206						133.0	113.0	119.0					15																	27184483		876	1991	2867	GABRB3	SO:0001627	intron_variant	0			-	HGNC		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.725-589G>A	15.37:g.27184483G>A		Somatic	0	34	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	6	88.24	A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAb_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.A34V	ENST00000335625.5	37	c.101	CCDS45194.1	15	.	.	.	.	.	.	.	.	.	.	G	13.37	2.216446	0.39201	.	.	ENSG00000166206	ENST00000541819	T	0.81163	-1.46	5.17	-3.71	0.04424	.	4.876480	0.00520	N	0.000192	T	0.56645	0.1999	.	.	.	0.09310	N	0.999999	B	0.13594	0.008	B	0.06405	0.002	T	0.47837	-0.9086	9	0.12766	T	0.61	.	0.8385	0.01145	0.3246:0.0988:0.2142:0.3623	.	34	F5H7N0	.	V	34	ENSP00000442408:A34V	ENSP00000442408:A34V	A	-	2	0	GABRB3	24767229	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	0.187000	0.16998	-0.285000	0.09089	-0.224000	0.12420	GCG	-	NULL		0.577	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRB3	protein_coding	OTTHUMT00000415234.1	G		-		27184483	-1	no_errors	ENST00000541819	ensembl	human	putative	74_37	missense	SNP	0.000	A
OTOGL	283310	genome.wustl.edu	37	12	80672018	80672018	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr12:80672018C>T	ENST00000547103.1	+	24	2731	c.2725C>T	c.(2725-2727)Ctc>Ttc	p.L909F	OTOGL_ENST00000458043.2_Missense_Mutation_p.L909F			Q3ZCN5	OTOGL_HUMAN	otogelin-like	909					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TTGGGAGTATCTCTCAGGAGA	0.363																																																	0								ENSG00000165899																																			OTOGL	SO:0001583	missense	0			-	HGNC	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.2725C>T	12.37:g.80672018C>T	ENSP00000447211:p.Leu909Phe	Somatic	0	47	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	39	15.22	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.L909F	ENST00000547103.1	37	c.2725		12	.	.	.	.	.	.	.	.	.	.	C	4.001	-0.002498	0.07819	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.15718	2.4;2.4	5.26	1.2	0.21068	.	.	.	.	.	T	0.15869	0.0382	L	0.41961	1.31	0.35006	D	0.756453	.	.	.	.	.	.	T	0.18713	-1.0328	7	0.08837	T	0.75	.	10.8652	0.46851	0.2365:0.4198:0.3438:0.0	.	.	.	.	F	909	ENSP00000447211:L909F;ENSP00000400895:L909F	ENSP00000400895:L909F	L	+	1	0	OTOGL	79196149	0.930000	0.31532	0.739000	0.30968	0.987000	0.75469	0.599000	0.24089	0.017000	0.15025	0.591000	0.81541	CTC	-	NULL		0.363	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	protein_coding	OTTHUMT00000407438.1	C	NM_173591	-		80672018	+1	no_errors	ENST00000458043	ensembl	human	known	74_37	missense	SNP	0.965	T
DIEXF	27042	genome.wustl.edu	37	1	210010164	210010164	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr1:210010164C>G	ENST00000491415.2	+	6	727	c.670C>G	c.(670-672)Ctt>Gtt	p.L224V		NM_014388.6	NP_055203.4	Q68CQ4	DIEXF_HUMAN	digestive organ expansion factor homolog (zebrafish)	224					multicellular organismal development (GO:0007275)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(15)|large_intestine(7)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(2)	53						TCTGGGCCAGCTTTTCTTTTC	0.378																																																	0								ENSG00000117597						74.0	83.0	80.0					1																	210010164		2196	4299	6495	DIEXF	SO:0001583	missense	0			-	HGNC	BC022964	CCDS1493.1	1q32.2	2011-08-12	2011-02-16	2011-02-16	ENSG00000117597	ENSG00000117597			28440	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 107"""	C1orf107		16322560	Standard	NM_014388		Approved	MGC29875, DEF, UTP25	uc001hhr.2	Q68CQ4	OTTHUMG00000036654	ENST00000491415.2:c.670C>G	1.37:g.210010164C>G	ENSP00000419005:p.Leu224Val	Somatic	0	59	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	13	65.79	O75992|Q4VY00|Q63HL9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Digest_organ_expansion_fac-prd,superfamily_P-loop_NTPase	p.L224V	ENST00000491415.2	37	c.670	CCDS1493.1	1	.	.	.	.	.	.	.	.	.	.	C	12.14	1.849411	0.32699	.	.	ENSG00000117597	ENST00000491415	T	0.48201	0.82	5.91	1.74	0.24563	.	0.254499	0.39834	N	0.001245	T	0.40570	0.1122	M	0.66939	2.045	0.49798	D	0.99982	B	0.10296	0.003	B	0.09377	0.004	T	0.16660	-1.0395	10	0.21540	T	0.41	-4.4867	8.5232	0.33289	0.11:0.4026:0.427:0.0603	.	224	Q68CQ4	DIEXF_HUMAN	V	224	ENSP00000419005:L224V	ENSP00000419005:L224V	L	+	1	0	DIEXF	208076787	0.733000	0.28132	0.998000	0.56505	0.969000	0.65631	-0.025000	0.12413	0.066000	0.16515	0.655000	0.94253	CTT	-	NULL		0.378	DIEXF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIEXF	protein_coding	OTTHUMT00000089127.2	C	NM_014388	-		210010164	+1	no_errors	ENST00000491415	ensembl	human	known	74_37	missense	SNP	0.932	G
KRTAP5-5	439915	genome.wustl.edu	37	11	1651203	1651210	+	Frame_Shift_Del	DEL	TGTGGGGG	TGTGGGGG	-			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	TGTGGGGG	TGTGGGGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr11:1651203_1651210delTGTGGGGG	ENST00000399676.2	+	1	171_178	c.133_140delTGTGGGGG	c.(133-141)tgtgggggcfs	p.CGG45fs		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	45						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ctgtggaggctgtgggggctgtggctcc	0.702																																																	0								ENSG00000185940																																			KRTAP5-5	SO:0001589	frameshift_variant	0				HGNC	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.133_140delTGTGGGGG	11.37:g.1651203_1651210delTGTGGGGG	ENSP00000382584:p.Cys45fs	Somatic	NA	NA	NA		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8MWN2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.C45fs	ENST00000399676.2	37	c.133_140	CCDS41592.1	11																																																																																			-	NULL		0.702	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	protein_coding	OTTHUMT00000127919.1	TGTGGGGG				1651210	+1	no_errors	ENST00000399676	ensembl	human	known	74_37	frame_shift_del	DEL	0.207:0.218:0.194:0.182:0.193:0.208:0.406:0.818	-
SYCP2	10388	genome.wustl.edu	37	20	58467461	58467461	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr20:58467461G>A	ENST00000357552.3	-	24	2173	c.1948C>T	c.(1948-1950)Ctt>Ttt	p.L650F	SYCP2_ENST00000371001.2_Missense_Mutation_p.L650F			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	650					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TGTTTAGTAAGTTTTTTATTT	0.229																																																	0								ENSG00000196074						30.0	31.0	31.0					20																	58467461		2194	4274	6468	SYCP2	SO:0001583	missense	0			-	HGNC	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.1948C>T	20.37:g.58467461G>A	ENSP00000350162:p.Leu650Phe	Somatic	0	45	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	78	9.20	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L650F	ENST00000357552.3	37	c.1948	CCDS13482.1	20	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.785857	0.00628	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834	T;T;T	0.19250	2.42;2.42;2.16	5.23	-2.4	0.06583	.	1.353670	0.04566	N	0.392378	T	0.14830	0.0358	L	0.40543	1.245	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.28839	-1.0031	10	0.17832	T	0.49	0.4566	4.9738	0.14129	0.3475:0.36:0.2925:0.0	.	650	Q9BX26	SYCP2_HUMAN	F	650	ENSP00000360040:L650F;ENSP00000350162:L650F;ENSP00000402456:L650F	ENSP00000350162:L650F	L	-	1	0	SYCP2	57900856	0.000000	0.05858	0.001000	0.08648	0.176000	0.22953	-0.182000	0.09726	-0.119000	0.11830	-0.274000	0.10170	CTT	-	NULL		0.229	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	protein_coding	OTTHUMT00000079930.3	G	NM_014258	-		58467461	-1	no_errors	ENST00000357552	ensembl	human	known	74_37	missense	SNP	0.000	A
EXOSC3	51010	genome.wustl.edu	37	9	37784919	37784919	+	Silent	SNP	G	G	A	rs147510873	byFrequency	TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr9:37784919G>A	ENST00000327304.5	-	1	135	c.123C>T	c.(121-123)gaC>gaT	p.D41D	RP11-613M10.9_ENST00000540557.1_Intron|EXOSC3_ENST00000396521.3_Silent_p.D41D|EXOSC3_ENST00000490516.1_5'Flank	NM_016042.3	NP_057126.2	Q9NQT5	EXOS3_HUMAN	exosome component 3	41					CUT catabolic process (GO:0071034)|DNA deamination (GO:0045006)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|isotype switching (GO:0045190)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of isotype switching (GO:0045830)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytoplasmic exosome (RNase complex) (GO:0000177)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5'-exoribonuclease activity (GO:0000175)|RNA binding (GO:0003723)			breast(2)|endometrium(1)|kidney(1)	4				GBM - Glioblastoma multiforme(29;0.00771)|Lung(182;0.221)		GGCCTTCCGCGTCCTCCTGTT	0.687													G|||	3	0.000599042	0.0023	0.0	5008	,	,		16107	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000107371	G	,	4,4396		0,4,2196	33.0	29.0	30.0		123,123	0.6	0.1	9	dbSNP_134	30	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	EXOSC3	NM_001002269.1,NM_016042.2	,	0,4,6496	AA,AG,GG		0.0,0.0909,0.0308	,	41/165,41/276	37784919	4,12996	2200	4300	6500	EXOSC3	SO:0001819	synonymous_variant	0			-	HGNC	BC002437	CCDS35016.1, CCDS43805.1	9p11	2009-01-20			ENSG00000107371	ENSG00000107371			17944	protein-coding gene	gene with protein product	"""exosome component Rrp40"", ""CGI-102 protein"""	606489				10810093, 11110791	Standard	NM_016042		Approved	hRrp40p, Rrp40p, RRP40, CGI-102, p10, hRrp-40	uc004aal.3	Q9NQT5	OTTHUMG00000019932	ENST00000327304.5:c.123C>T	9.37:g.37784919G>A		Somatic	0	67	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	75	13.79	A8K0K6|Q5QP85|Q9Y3A8	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D41	ENST00000327304.5	37	c.123	CCDS35016.1	9																																																																																			-	NULL		0.687	EXOSC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOSC3	protein_coding	OTTHUMT00000052478.3	G	NM_016042	rs147510873		37784919	-1	no_errors	ENST00000327304	ensembl	human	known	74_37	silent	SNP	0.400	A
RCN1	5954	genome.wustl.edu	37	11	32125935	32125935	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr11:32125935A>T	ENST00000054950.3	+	6	1206	c.913A>T	c.(913-915)Ata>Tta	p.I305L	RP1-65P5.3_ENST00000533009.1_RNA|RCN1_ENST00000532942.1_Missense_Mutation_p.I254L	NM_002901.2	NP_002892.1	Q15293	RCN1_HUMAN	reticulocalbin 1, EF-hand calcium binding domain	305	EF-hand 6. {ECO:0000255|PROSITE- ProRule:PRU00448}.				camera-type eye development (GO:0043010)|in utero embryonic development (GO:0001701)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(6)	17	Lung SC(675;0.225)					TAAAGAGGAAATATTGGAGAA	0.393																																																	0								ENSG00000049449						91.0	80.0	84.0					11																	32125935		2202	4299	6501	RCN1	SO:0001583	missense	0			-	HGNC	D42073	CCDS7876.1	11p13	2013-01-10			ENSG00000049449	ENSG00000049449		"""EF-hand domain containing"""	9934	protein-coding gene	gene with protein product	"""proliferation-inducing gene 20"""	602735		RCN		9192846, 8586628	Standard	NM_002901		Approved	Rcal, PIG20, FLJ37041	uc010reb.2	Q15293		ENST00000054950.3:c.913A>T	11.37:g.32125935A>T	ENSP00000054950:p.Ile305Leu	Somatic	0	41	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	28	34.88	B7Z1M1|D3DR00	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_EF_hand_dom,pfscan_EF_hand_dom	p.I305L	ENST00000054950.3	37	c.913	CCDS7876.1	11	.	.	.	.	.	.	.	.	.	.	a	12.98	2.100664	0.37048	.	.	ENSG00000049449	ENST00000532942;ENST00000054950;ENST00000528630	T;T	0.55930	0.62;0.49	5.82	4.7	0.59300	EF-hand-like domain (1);	0.083194	0.85682	D	0.000000	T	0.62024	0.2394	M	0.85462	2.755	0.58432	D	0.999993	P;P	0.50819	0.939;0.776	P;B	0.49140	0.601;0.4	T	0.65772	-0.6087	10	0.62326	D	0.03	-15.884	7.905	0.29757	0.7691:0.0:0.2309:0.0	.	305;254	Q15293;B7Z1M1	RCN1_HUMAN;.	L	254;305;2	ENSP00000436422:I254L;ENSP00000054950:I305L	ENSP00000054950:I305L	I	+	1	0	RCN1	32082511	1.000000	0.71417	0.976000	0.42696	0.429000	0.31625	4.622000	0.61240	1.041000	0.40125	-0.250000	0.11733	ATA	-	NULL		0.393	RCN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RCN1	protein_coding	OTTHUMT00000388510.1	A	NM_002901	-		32125935	+1	no_errors	ENST00000054950	ensembl	human	known	74_37	missense	SNP	1.000	T
TUBA4A	7277	genome.wustl.edu	37	2	220118076	220118077	+	Intron	INS	-	-	G	rs60456844|rs371311421		TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr2:220118076_220118077insG	ENST00000248437.4	-	1	177				TUBA4B_ENST00000490341.1_RNA|TUBA4A_ENST00000392088.2_Intron|TUBA4A_ENST00000498660.1_Intron	NM_006000.2	NP_005991.1	P68366	TBA4A_HUMAN	tubulin, alpha 4a						'de novo' posttranslational protein folding (GO:0051084)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Cabazitaxel(DB06772)|Podofilox(DB01179)|Vincristine(DB00541)	TGCTGAGTCACGGGGGGGGGGT	0.644																																																	0								ENSG00000243910																																			TUBA4B	SO:0001627	intron_variant	0				HGNC	AK054731	CCDS2438.1, CCDS63131.1	2q36.1	2012-10-02	2007-02-12	2007-02-12	ENSG00000127824	ENSG00000127824		"""Tubulins"""	12407	protein-coding gene	gene with protein product		191110	"""tubulin, alpha 1 (testis specific)"", ""tubulin, alpha 1"""	TUBA1		3785200	Standard	NM_006000		Approved	FLJ30169, H2-ALPHA	uc002vkt.1	P68366	OTTHUMG00000133126	ENST00000248437.4:c.3+500->C	2.37:g.220118086_220118086dupG		Somatic	0	14	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	A8MUB1|B3KNQ6|P05215	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000248437.4	37	NULL	CCDS2438.1	2																																																																																			-	-		0.644	TUBA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA4B	protein_coding	OTTHUMT00000256816.3	-	NM_006000			220118077	+1	no_errors	ENST00000473885	ensembl	human	known	74_37	rna	INS	0.812:0.000	G
DCLRE1C	64421	genome.wustl.edu	37	10	14950956	14950956	+	Silent	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr10:14950956G>A	ENST00000378278.2	-	14	1567	c.1530C>T	c.(1528-1530)tcC>tcT	p.S510S	DCLRE1C_ENST00000396817.2_Silent_p.S390S|DCLRE1C_ENST00000378254.1_Silent_p.S390S|DCLRE1C_ENST00000378249.1_Silent_p.S395S|DCLRE1C_ENST00000492201.1_5'UTR|DCLRE1C_ENST00000378255.1_Silent_p.S390S|DCLRE1C_ENST00000378246.2_Silent_p.S395S|DCLRE1C_ENST00000357717.2_Silent_p.S395S|DCLRE1C_ENST00000378289.4_Intron|DCLRE1C_ENST00000378258.1_Silent_p.S390S|DCLRE1C_ENST00000453695.2_Silent_p.S390S|DCLRE1C_ENST00000378242.1_Silent_p.S163S			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	510					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						CTGCCACTGTGGAGGAAGGGA	0.448								Non-homologous end-joining																																									0								ENSG00000152457						45.0	46.0	46.0					10																	14950956		2203	4300	6503	DCLRE1C	SO:0001819	synonymous_variant	0			-	HGNC	BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.1530C>T	10.37:g.14950956G>A		Somatic	0	33	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	39	13.33	D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DRMBL	p.S510	ENST00000378278.2	37	c.1530	CCDS31149.1	10																																																																																			-	NULL		0.448	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLRE1C	protein_coding	OTTHUMT00000046934.1	G	NM_022487	-		14950956	-1	no_errors	ENST00000378278	ensembl	human	known	74_37	silent	SNP	0.941	A
ABCB5	340273	genome.wustl.edu	37	7	20689758	20689758	+	Silent	SNP	G	G	A	rs548564211		TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr7:20689758G>A	ENST00000404938.2	+	12	1972	c.1320G>A	c.(1318-1320)ccG>ccA	p.P440P	ABCB5_ENST00000477094.1_3'UTR|ABCB5_ENST00000406935.1_5'UTR|ABCB5_ENST00000443026.2_5'UTR|ABCB5_ENST00000258738.6_5'UTR	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	440	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						TATATGATCCGGATGATGGCT	0.483													G|||	1	0.000199681	0.0	0.0	5008	,	,		16852	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000004846						95.0	86.0	88.0					7																	20689758		1568	3582	5150	ABCB5	SO:0001819	synonymous_variant	0			-	HGNC	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.1320G>A	7.37:g.20689758G>A		Somatic	0	36	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	64	11.11	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.P440	ENST00000404938.2	37	c.1320	CCDS55090.1	7																																																																																			-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.483	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	ABCB5	protein_coding	OTTHUMT00000326736.2	G	NM_178559	-		20689758	+1	no_errors	ENST00000404938	ensembl	human	putative	74_37	silent	SNP	0.000	A
NLRP8	126205	genome.wustl.edu	37	19	56466706	56466706	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr19:56466706G>A	ENST00000291971.3	+	3	1353	c.1282G>A	c.(1282-1284)Gtc>Atc	p.V428I	NLRP8_ENST00000590542.1_Missense_Mutation_p.V428I	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	428	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.V428I(1)		breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		CTCTGTGTTCGTCCGGTATAT	0.498																																																	1	Substitution - Missense(1)	kidney(1)						ENSG00000179709						88.0	90.0	90.0					19																	56466706		2203	4300	6503	NLRP8	SO:0001583	missense	0			-	HGNC	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.1282G>A	19.37:g.56466706G>A	ENSP00000291971:p.Val428Ile	Somatic	0	30	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	40	23.08	Q7RTR4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.V428I	ENST00000291971.3	37	c.1282	CCDS12937.1	19	.	.	.	.	.	.	.	.	.	.	G	2.360	-0.346884	0.05208	.	.	ENSG00000179709	ENST00000291971	D	0.83419	-1.72	1.78	-1.96	0.07525	.	.	.	.	.	T	0.63628	0.2527	L	0.27053	0.805	0.09310	N	1	P;P	0.47762	0.9;0.573	B;B	0.35278	0.199;0.177	T	0.56553	-0.7960	9	0.29301	T	0.29	.	5.2449	0.15490	0.6082:0.0:0.3918:0.0	.	428;428	Q86W28-2;Q86W28	.;NALP8_HUMAN	I	428	ENSP00000291971:V428I	ENSP00000291971:V428I	V	+	1	0	NLRP8	61158518	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.089000	0.15002	-0.472000	0.06881	-0.346000	0.07831	GTC	-	NULL		0.498	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP8	protein_coding	OTTHUMT00000457462.1	G	NM_176811	-		56466706	+1	no_errors	ENST00000291971	ensembl	human	known	74_37	missense	SNP	0.037	A
CYP11B1	1584	genome.wustl.edu	37	8	143958162	143958162	+	Silent	SNP	A	A	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr8:143958162A>T	ENST00000292427.4	-	4	767	c.735T>A	c.(733-735)tcT>tcA	p.S245S	CYP11B1_ENST00000517471.1_Silent_p.S245S|CYP11B1_ENST00000377675.3_Silent_p.S316S	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	245					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	TGGTCCAGCGAGACAGGCTCC	0.607									Familial Hyperaldosteronism type I																																								0								ENSG00000160882						47.0	43.0	44.0					8																	143958162		2203	4300	6503	CYP11B1	SO:0001819	synonymous_variant	0	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	-	HGNC	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.735T>A	8.37:g.143958162A>T		Somatic	0	63	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	55	8.33	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_mitochondrial,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B,prints_Cyt_P450	p.S245	ENST00000292427.4	37	c.735	CCDS6392.1	8																																																																																			-	pfam_Cyt_P450,superfamily_Cyt_P450		0.607	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B1	protein_coding	OTTHUMT00000379475.2	A		-		143958162	-1	no_errors	ENST00000292427	ensembl	human	known	74_37	silent	SNP	0.024	T
C19orf45	374877	genome.wustl.edu	37	19	7570241	7570241	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr19:7570241C>A	ENST00000361664.2	+	5	955	c.814C>A	c.(814-816)Cac>Aac	p.H272N	CTD-2207O23.12_ENST00000599312.1_5'Flank	NM_198534.2	NP_940936.2	Q8NA69	CS045_HUMAN	chromosome 19 open reading frame 45	272										endometrium(1)|kidney(1)|liver(1)|lung(2)|ovary(2)|stomach(1)	8						AGCCCACATCCACTGTGTAAA	0.572																																																	0								ENSG00000198723						98.0	93.0	95.0					19																	7570241		2203	4300	6503	C19orf45	SO:0001583	missense	0			-	HGNC	BC029824	CCDS12179.2	19p13.2	2008-02-05			ENSG00000198723	ENSG00000198723			24745	protein-coding gene	gene with protein product						12477932	Standard	NM_198534		Approved	FLJ35784	uc002mgm.2	Q8NA69	OTTHUMG00000157183	ENST00000361664.2:c.814C>A	19.37:g.7570241C>A	ENSP00000355241:p.His272Asn	Somatic	0	54	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	86	8.51	Q8N115	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.H272N	ENST00000361664.2	37	c.814	CCDS12179.2	19	.	.	.	.	.	.	.	.	.	.	C	12.70	2.015662	0.35606	.	.	ENSG00000198723	ENST00000361664	T	0.15603	2.41	3.78	1.64	0.23874	.	0.586949	0.17172	N	0.184233	T	0.22003	0.0530	L	0.59436	1.845	0.22511	N	0.999037	D	0.54047	0.964	P	0.51135	0.66	T	0.05699	-1.0869	10	0.44086	T	0.13	-24.2028	6.1281	0.20189	0.0:0.7664:0.0:0.2336	.	272	Q8NA69	CS045_HUMAN	N	272	ENSP00000355241:H272N	ENSP00000355241:H272N	H	+	1	0	C19orf45	7476241	0.003000	0.15002	0.523000	0.27875	0.790000	0.44656	0.080000	0.14802	0.567000	0.29293	0.456000	0.33151	CAC	-	NULL		0.572	C19orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf45	protein_coding	OTTHUMT00000347808.1	C	NM_198534	-		7570241	+1	no_errors	ENST00000361664	ensembl	human	known	74_37	missense	SNP	0.635	A
TFAP2D	83741	genome.wustl.edu	37	6	50683222	50683222	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr6:50683222C>G	ENST00000008391.3	+	2	661	c.433C>G	c.(433-435)Ctg>Gtg	p.L145V		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					CCGCCATGACCTGTCCCTCAT	0.637																																																	0								ENSG00000008197						60.0	63.0	62.0					6																	50683222		2203	4300	6503	TFAP2D	SO:0001583	missense	0			-	HGNC	AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.433C>G	6.37:g.50683222C>G	ENSP00000008391:p.Leu145Val	Somatic	0	78	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	80	15.79		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_AP2_C,prints_TF_AP2_C	p.L145V	ENST00000008391.3	37	c.433	CCDS4933.1	6	.	.	.	.	.	.	.	.	.	.	C	1.807	-0.475529	0.04414	.	.	ENSG00000008197	ENST00000008391	D	0.97256	-4.31	5.06	5.06	0.68205	.	0.164825	0.40222	N	0.001148	D	0.86167	0.5868	N	0.08118	0	0.58432	D	0.999995	B	0.32101	0.356	B	0.25759	0.063	D	0.86425	0.1757	10	0.27785	T	0.31	-11.1335	12.2055	0.54350	0.0:0.9214:0.0:0.0786	.	145	Q7Z6R9	AP2D_HUMAN	V	145	ENSP00000008391:L145V	ENSP00000008391:L145V	L	+	1	2	TFAP2D	50791181	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.698000	0.37794	2.509000	0.84616	0.655000	0.94253	CTG	-	NULL		0.637	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2D	protein_coding	OTTHUMT00000040881.1	C	NM_172238	-		50683222	+1	no_errors	ENST00000008391	ensembl	human	known	74_37	missense	SNP	1.000	G
FABP7	2173	genome.wustl.edu	37	6	123100984	123100984	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr6:123100984G>T	ENST00000368444.3	+	1	365	c.45G>T	c.(43-45)caG>caT	p.Q15H	FABP7_ENST00000356535.4_Missense_Mutation_p.Q15H	NM_001446.3	NP_001437.1	O15540	FABP7_HUMAN	fatty acid binding protein 7, brain	15					cell proliferation in forebrain (GO:0021846)|epithelial cell proliferation (GO:0050673)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|prepulse inhibition (GO:0060134)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			kidney(1)|large_intestine(1)|lung(2)|stomach(1)	5				GBM - Glioblastoma multiforme(226;0.226)	Alpha-Linolenic Acid(DB00132)|Dihomo-gamma-linolenic acid(DB00154)|Icosapent(DB00159)	CCAACAGTCAGAACTTTGATG	0.468																																																	0								ENSG00000164434						98.0	77.0	84.0					6																	123100984		2203	4300	6503	FABP7	SO:0001583	missense	0			-	HGNC	D88648	CCDS5127.1	6q22-q23	2013-03-01			ENSG00000164434	ENSG00000164434		"""Fatty acid binding protein family"""	3562	protein-coding gene	gene with protein product	"""brain lipid binding protein"""	602965				9375786	Standard	NM_001446		Approved	B-FABP, BLBP	uc003pzf.3	O15540	OTTHUMG00000015489	ENST00000368444.3:c.45G>T	6.37:g.123100984G>T	ENSP00000357429:p.Gln15His	Somatic	0	64	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	82	13.68	B2R4L1|O14951|Q6IAU7|Q9H047	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	p.Q15H	ENST00000368444.3	37	c.45	CCDS5127.1	6	.	.	.	.	.	.	.	.	.	.	G	11.82	1.751286	0.31046	.	.	ENSG00000164434	ENST00000368444;ENST00000356535	T;T	0.41758	0.99;3.15	5.1	2.18	0.27775	Calycin-like (1);Cytosolic fatty-acid binding (2);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.236774	0.43919	D	0.000514	T	0.12305	0.0299	L	0.28556	0.865	0.45580	D	0.998523	B;B;B	0.12013	0.0;0.005;0.002	B;B;B	0.17979	0.002;0.02;0.019	T	0.07849	-1.0751	10	0.56958	D	0.05	.	2.8337	0.05507	0.2281:0.1309:0.5206:0.1205	.	15;21;15	O15540;Q59HE4;Q9H047	FABP7_HUMAN;.;.	H	15	ENSP00000357429:Q15H;ENSP00000348931:Q15H	ENSP00000348931:Q15H	Q	+	3	2	FABP7	123142683	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	0.907000	0.28531	0.852000	0.35287	0.563000	0.77884	CAG	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd		0.468	FABP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FABP7	protein_coding	OTTHUMT00000042037.1	G	NM_001446	-		123100984	+1	no_errors	ENST00000356535	ensembl	human	known	74_37	missense	SNP	0.994	T
AP4B1	10717	genome.wustl.edu	37	1	114438086	114438086	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr1:114438086C>A	ENST00000369569.1	-	10	2101	c.1821G>T	c.(1819-1821)gaG>gaT	p.E607D	AP4B1_ENST00000256658.4_Missense_Mutation_p.E607D|AP4B1_ENST00000462591.1_5'UTR|AP4B1_ENST00000369567.1_Missense_Mutation_p.E439D|AP4B1-AS1_ENST00000419536.1_RNA	NM_001253852.1	NP_001240781.1	Q9Y6B7	AP4B1_HUMAN	adaptor-related protein complex 4, beta 1 subunit	607					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|trans-Golgi network (GO:0005802)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|prostate(3)	25	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.1e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTTGTACCCTCTCCTTGTTCT	0.418																																																	0								ENSG00000134262						68.0	71.0	70.0					1																	114438086		2203	4300	6503	AP4B1	SO:0001583	missense	0			-	HGNC	AF092094	CCDS865.1	1p13.2	2012-03-30			ENSG00000134262	ENSG00000134262			572	protein-coding gene	gene with protein product	"""beta 4 subunit of AP-4"""	607245	"""spastic paraplegia 47"""	SPG47		10066790	Standard	NM_006594		Approved	BETA-4	uc001eeb.3	Q9Y6B7	OTTHUMG00000011943	ENST00000369569.1:c.1821G>T	1.37:g.114438086C>A	ENSP00000358582:p.Glu607Asp	Somatic	0	35	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	37	11.90	B7Z4X3|Q59EJ4|Q96CL6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Clathrin/coatomer_adapt-like_N,pfam_B-adaptin_app_sub_C,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,pirsf_AP_complex_bsu_1_2_4	p.E607D	ENST00000369569.1	37	c.1821	CCDS865.1	1	.	.	.	.	.	.	.	.	.	.	C	2.636	-0.285192	0.05605	.	.	ENSG00000134262	ENST00000369567;ENST00000369569;ENST00000256658	T;T;T	0.65364	-0.15;-0.13;-0.13	5.83	1.86	0.25419	.	0.299407	0.37393	N	0.002115	T	0.23806	0.0576	L	0.29908	0.895	0.39970	D	0.974776	B;B	0.28713	0.139;0.22	B;B	0.21360	0.034;0.033	T	0.04991	-1.0913	10	0.17832	T	0.49	.	8.5753	0.33595	0.0:0.6262:0.0:0.3738	.	439;607	B1ALD0;Q9Y6B7	.;AP4B1_HUMAN	D	439;607;607	ENSP00000358580:E439D;ENSP00000358582:E607D;ENSP00000256658:E607D	ENSP00000256658:E607D	E	-	3	2	AP4B1	114239609	0.050000	0.20438	0.707000	0.30419	0.120000	0.20174	0.101000	0.15251	0.791000	0.33826	0.563000	0.77884	GAG	-	pirsf_AP_complex_bsu_1_2_4		0.418	AP4B1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AP4B1	protein_coding	OTTHUMT00000033037.1	C	NM_006594	-		114438086	-1	no_errors	ENST00000256658	ensembl	human	known	74_37	missense	SNP	0.234	A
MAP4K1	11184	genome.wustl.edu	37	19	39100635	39100635	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr19:39100635G>A	ENST00000591517.1	-	12	869	c.841C>T	c.(841-843)Cga>Tga	p.R281*	MAP4K1_ENST00000396857.2_Nonsense_Mutation_p.R281*|MAP4K1_ENST00000589130.1_Nonsense_Mutation_p.R277*|MAP4K1_ENST00000423454.2_5'UTR|MAP4K1_ENST00000589002.1_5'UTR|MAP4K1_ENST00000586296.1_Nonsense_Mutation_p.R281*	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	281					activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.R281R(2)|p.R281*(2)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			ATCAGGCCTCGATTCAGCCCA	0.577																																																	4	Substitution - Nonsense(2)|Substitution - coding silent(2)	lung(2)|breast(2)						ENSG00000104814						61.0	61.0	61.0					19																	39100635		1931	4140	6071	MAP4K1	SO:0001587	stop_gained	0			-	HGNC	U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.841C>T	19.37:g.39100635G>A	ENSP00000465039:p.Arg281*	Somatic	0	56	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	44	48.84		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R281*	ENST00000591517.1	37	c.841	CCDS59385.1	19	.	.	.	.	.	.	.	.	.	.	.	33	5.227114	0.95173	.	.	ENSG00000104814	ENST00000396857;ENST00000221409	.	.	.	4.19	0.503	0.16940	.	0.228677	0.34025	N	0.004336	.	.	.	.	.	.	0.22888	N	0.998607	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.8264	0.29318	0.0:0.0978:0.6025:0.2997	.	.	.	.	X	281	.	ENSP00000221409:R281X	R	-	1	2	MAP4K1	43792475	0.000000	0.05858	0.902000	0.35471	0.934000	0.57294	-0.213000	0.09305	0.245000	0.21373	-0.397000	0.06425	CGA	-	superfamily_Kinase-like_dom		0.577	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	MAP4K1	protein_coding	OTTHUMT00000453390.1	G	NM_001042600	-		39100635	-1	no_errors	ENST00000591517	ensembl	human	known	74_37	nonsense	SNP	0.005	A
CUEDC1	404093	genome.wustl.edu	37	17	55940324	55940324	+	3'UTR	DEL	T	T	-	rs559186385|rs59475396|rs545426418	byFrequency	TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr17:55940324delT	ENST00000577830.1	-	0	1900				CUEDC1_ENST00000578357.1_5'UTR|CUEDC1_ENST00000407144.2_3'UTR	NM_001271875.1	NP_001258804.1	Q9NWM3	CUED1_HUMAN	CUE domain containing 1											endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(3)	12						GCTTTCTGGATTTTTTTTTTT	0.483																																																	0								ENSG00000180891																																			CUEDC1	SO:0001624	3_prime_UTR_variant	0				HGNC	AK000746	CCDS11599.1	17q23.2	2004-03-16				ENSG00000180891			31350	protein-coding gene	gene with protein product							Standard	NM_001271875		Approved		uc002ive.2	Q9NWM3		ENST00000577830.1:c.*326A>-	17.37:g.55940324delT		Somatic	0	16	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	D3DTZ2|Q9NWD0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000577830.1	37	NULL	CCDS11599.1	17																																																																																			-	-		0.483	CUEDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUEDC1	protein_coding	OTTHUMT00000443305.1	T	NM_017949			55940324	-1	no_errors	ENST00000577422	ensembl	human	known	74_37	rna	DEL	0.000	-
LRP2	4036	genome.wustl.edu	37	2	170134297	170134297	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr2:170134297C>T	ENST00000263816.3	-	13	2015	c.1730G>A	c.(1729-1731)cGg>cAg	p.R577Q	LRP2_ENST00000443831.1_Intron	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	577					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GTAATCAAACCGAGAGTCAAC	0.398																																																	0								ENSG00000081479						125.0	122.0	123.0					2																	170134297		2203	4300	6503	LRP2	SO:0001583	missense	0			-	HGNC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.1730G>A	2.37:g.170134297C>T	ENSP00000263816:p.Arg577Gln	Somatic	0	60	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	29	53.97	O00711|Q16215	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.R577Q	ENST00000263816.3	37	c.1730	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	18.53	3.643757	0.67244	.	.	ENSG00000081479	ENST00000263816	D	0.93547	-3.24	5.7	5.7	0.88788	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.95661	0.8589	L	0.55213	1.73	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.93659	0.6980	10	0.25106	T	0.35	.	19.8176	0.96576	0.0:1.0:0.0:0.0	.	577	P98164	LRP2_HUMAN	Q	577	ENSP00000263816:R577Q	ENSP00000263816:R577Q	R	-	2	0	LRP2	169842543	1.000000	0.71417	0.166000	0.22797	0.358000	0.29455	5.886000	0.69743	2.680000	0.91292	0.555000	0.69702	CGG	-	smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.398	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	protein_coding	OTTHUMT00000255231.2	C	NM_004525	-		170134297	-1	no_errors	ENST00000263816	ensembl	human	known	74_37	missense	SNP	1.000	T
ZSCAN5B	342933	genome.wustl.edu	37	19	56703353	56703353	+	Missense_Mutation	SNP	C	C	T	rs201505305		TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr19:56703353C>T	ENST00000586855.2	-	3	767	c.454G>A	c.(454-456)Gcc>Acc	p.A152T	ZSCAN5B_ENST00000358992.3_Missense_Mutation_p.A152T			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	152					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.A152T(1)		breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CTGACACTGGCGGGGGCTTCA	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		14105	0.001		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	stomach(1)						ENSG00000197213																																			ZSCAN5B	SO:0001583	missense	0			GMAF=0.0005	HGNC		CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.454G>A	19.37:g.56703353C>T	ENSP00000466072:p.Ala152Thr	Somatic	0	54	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	117	12.69		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.A152T	ENST00000586855.2	37	c.454	CCDS46203.1	19	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	5.580	0.291800	0.10567	.	.	ENSG00000197213	ENST00000358992	T	0.05580	3.42	1.28	0.197	0.15164	.	.	.	.	.	T	0.05410	0.0143	L	0.49126	1.545	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.45629	-0.9248	9	0.17832	T	0.49	.	3.3799	0.07251	0.0:0.7172:0.0:0.2828	.	152	A6NJL1	ZSA5B_HUMAN	T	152	ENSP00000351883:A152T	ENSP00000351883:A152T	A	-	1	0	ZSCAN5B	61395165	0.001000	0.12720	0.000000	0.03702	0.111000	0.19643	0.527000	0.22987	0.116000	0.18110	0.306000	0.20318	GCC	-	NULL		0.532	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN5B	protein_coding	OTTHUMT00000457834.2	C	NM_001080456	rs201505305		56703353	-1	no_errors	ENST00000358992	ensembl	human	known	74_37	missense	SNP	0.001	T
GPR55	9290	genome.wustl.edu	37	2	231775043	231775043	+	Missense_Mutation	SNP	C	C	T	rs146701433		TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr2:231775043C>T	ENST00000392040.1	-	2	827	c.635G>A	c.(634-636)cGa>cAa	p.R212Q	AC012507.4_ENST00000454890.1_RNA|GPR55_ENST00000392039.2_Missense_Mutation_p.R212Q	NM_005683.3	NP_005674.2	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	212					activation of phospholipase C activity (GO:0007202)|bone resorption (GO:0045453)|cannabinoid signaling pathway (GO:0038171)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho protein signal transduction (GO:0035025)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		GGTGTGGTCTCGGCGGCCCAG	0.622													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19539	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000135898	C	GLN/ARG	0,4406		0,0,2203	71.0	77.0	75.0		635	0.1	0.0	2	dbSNP_134	75	3,8597	3.0+/-9.4	0,3,4297	no	missense	GPR55	NM_005683.3	43	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	possibly-damaging	212/320	231775043	3,13003	2203	4300	6503	GPR55	SO:0001583	missense	0			GMAF=0.0005	HGNC	AF096786	CCDS2480.1	2q37	2012-08-21			ENSG00000135898	ENSG00000135898		"""GPCR / Class A : Orphans"""	4511	protein-coding gene	gene with protein product		604107				9931487	Standard	NM_005683		Approved		uc002vrg.3	Q9Y2T6	OTTHUMG00000133224	ENST00000392040.1:c.635G>A	2.37:g.231775043C>T	ENSP00000375894:p.Arg212Gln	Somatic	0	33	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	59	9.23	Q8N580	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.R212Q	ENST00000392040.1	37	c.635	CCDS2480.1	2	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	9.971	1.225516	0.22457	0.0	3.49E-4	ENSG00000135898	ENST00000392040;ENST00000392039;ENST00000438398	T;T;T	0.37915	1.17;1.17;1.17	5.29	0.0827	0.14430	GPCR, rhodopsin-like superfamily (1);	1.075400	0.07380	N	0.887346	T	0.22627	0.0546	L	0.33485	1.01	0.09310	N	1	B	0.25169	0.119	B	0.13407	0.009	T	0.24512	-1.0158	10	0.19590	T	0.45	-6.82	5.1205	0.14858	0.0:0.4474:0.3056:0.247	.	212	Q9Y2T6	GPR55_HUMAN	Q	212	ENSP00000375894:R212Q;ENSP00000375893:R212Q;ENSP00000412768:R212Q	ENSP00000375893:R212Q	R	-	2	0	GPR55	231483287	0.000000	0.05858	0.000000	0.03702	0.899000	0.52679	-1.232000	0.02936	0.449000	0.26747	0.561000	0.74099	CGA	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.622	GPR55-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR55	protein_coding	OTTHUMT00000332618.1	C	NM_005683	rs146701433		231775043	-1	no_errors	ENST00000392039	ensembl	human	known	74_37	missense	SNP	0.000	T
PCF11	51585	genome.wustl.edu	37	11	82879708	82879708	+	Silent	SNP	C	C	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr11:82879708C>T	ENST00000298281.4	+	8	2783	c.2331C>T	c.(2329-2331)agC>agT	p.S777S		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	777	Gly-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						ATAAATTAAGCCCTCGAATTG	0.493																																																	0								ENSG00000165494						100.0	96.0	97.0					11																	82879708		1885	4112	5997	PCF11	SO:0001819	synonymous_variant	0			-	HGNC	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.2331C>T	11.37:g.82879708C>T		Somatic	0	27	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	25	29.73	A6H8W7|O43671|Q6P0X8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_CID_dom	p.S777	ENST00000298281.4	37	c.2331	CCDS44689.1	11																																																																																			-	NULL		0.493	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCF11	protein_coding	OTTHUMT00000392548.2	C	NM_015885	-		82879708	+1	no_errors	ENST00000298281	ensembl	human	known	74_37	silent	SNP	1.000	T
SNORD3B-1	26851	genome.wustl.edu	37	17	18967436	18967436	+	lincRNA	SNP	G	G	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr17:18967436G>T	ENST00000363359.1	+	0	432				SNORD3B-2_ENST00000364880.1_lincRNA					small nucleolar RNA, C/D box 3B-1																		aatgatccctgaaagtatagt	0.468																																																	0								ENSG00000262074																																			SNORD3B-2			0			-	HGNC	AF020534, AF020533, AF020532		17p11.2	2013-09-05	2006-11-28	2006-11-28	ENSG00000200229	ENSG00000265185			10168	non-coding RNA	RNA, small nucleolar			"""RNA, U3A1 small nucleolar, RNA, U3A1 small nucleolar"""	RNU3A1		9365252	Standard	NR_003271		Approved	U3a, U3b1, U3b2					17.37:g.18967436G>T		Somatic	0	11	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	15	42.31		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000363359.1	37	NULL		17																																																																																			-	-		0.468	SNORD3B-1-201	KNOWN	basic	snoRNA	SNORD3B-2	lincRNA		G	NR_003271	-		18967436	-1	no_errors	ENST00000364880	ensembl	human	known	74_37	rna	SNP	0.210	T
SIGLEC8	27181	genome.wustl.edu	37	19	51958862	51958862	+	Missense_Mutation	SNP	G	G	C	rs370819359		TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr19:51958862G>C	ENST00000321424.3	-	4	927	c.861C>G	c.(859-861)agC>agG	p.S287R	SIGLEC8_ENST00000597352.1_5'UTR|SIGLEC8_ENST00000430817.1_Missense_Mutation_p.S178R|SIGLEC8_ENST00000340550.5_Missense_Mutation_p.S194R	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	287	Ig-like C2-type 2.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CAGGGGGATTGCTGTTGACAG	0.622																																																	0								ENSG00000105366						67.0	66.0	67.0					19																	51958862		2203	4300	6503	SIGLEC8	SO:0001583	missense	0			-	HGNC	AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.861C>G	19.37:g.51958862G>C	ENSP00000321077:p.Ser287Arg	Somatic	0	46	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	52	13.33	Q7Z728	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S287R	ENST00000321424.3	37	c.861	CCDS33086.1	19	.	.	.	.	.	.	.	.	.	.	.	14.49	2.549573	0.45383	.	.	ENSG00000105366	ENST00000430817;ENST00000321424;ENST00000340550	T;T;T	0.24151	1.87;1.87;1.87	2.19	1.11	0.20524	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.45126	D	0.000390	T	0.54902	0.1887	H	0.95328	3.655	0.22787	N	0.998734	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.996	T	0.45145	-0.9281	10	0.87932	D	0	.	4.9785	0.14153	0.1818:0.0:0.8182:0.0	.	178;194;287	C9JT30;Q9NYZ4-2;Q9NYZ4	.;.;SIGL8_HUMAN	R	178;287;194	ENSP00000389142:S178R;ENSP00000321077:S287R;ENSP00000339448:S194R	ENSP00000321077:S287R	S	-	3	2	SIGLEC8	56650674	0.993000	0.37304	0.474000	0.27266	0.241000	0.25554	1.366000	0.34193	0.473000	0.27368	0.502000	0.49764	AGC	-	pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.622	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC8	protein_coding	OTTHUMT00000463648.2	G	NM_014442	-		51958862	-1	no_errors	ENST00000321424	ensembl	human	known	74_37	missense	SNP	0.583	C
SERTAD2	9792	genome.wustl.edu	37	2	64863598	64863598	+	Silent	SNP	G	G	C			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr2:64863598G>C	ENST00000313349.3	-	2	705	c.408C>G	c.(406-408)ctC>ctG	p.L136L	SERTAD2_ENST00000476805.2_5'Flank	NM_014755.2	NP_055570.1	Q14140	SRTD2_HUMAN	SERTA domain containing 2	136					negative regulation of cell growth (GO:0030308)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|skin(1)	12						CGTCGTCCTCGAGCAGTGAGG	0.662																																																	0								ENSG00000179833						53.0	56.0	55.0					2																	64863598		2203	4300	6503	SERTAD2	SO:0001819	synonymous_variant	0			-	HGNC	D50917	CCDS33210.1	2p15	2007-05-01			ENSG00000179833	ENSG00000179833			30784	protein-coding gene	gene with protein product	"""transcriptional regulator interacting with the PHS-bromodomain 2"""					8590280, 11331592	Standard	NM_014755		Approved	TRIP-Br2, KIAA0127, Sei-2	uc002sde.2	Q14140	OTTHUMG00000152678	ENST00000313349.3:c.408C>G	2.37:g.64863598G>C		Somatic	0	43	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	49	9.26	Q53TS2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SERTA,pfscan_SERTA	p.L136	ENST00000313349.3	37	c.408	CCDS33210.1	2																																																																																			-	NULL		0.662	SERTAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERTAD2	protein_coding	OTTHUMT00000327322.2	G	NM_014755	-		64863598	-1	no_errors	ENST00000313349	ensembl	human	known	74_37	silent	SNP	0.997	C
ZBTB21	49854	genome.wustl.edu	37	21	43412114	43412114	+	Silent	SNP	G	G	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr21:43412114G>T	ENST00000310826.5	-	3	2274	c.2091C>A	c.(2089-2091)ccC>ccA	p.P697P	ZBTB21_ENST00000398511.3_Silent_p.P697P|ZBTB21_ENST00000398505.3_Intron|ZBTB21_ENST00000398499.1_Silent_p.P697P|ZBTB21_ENST00000465968.1_Intron	NM_001098402.1	NP_001091872.1	Q9ULJ3	ZBT21_HUMAN	zinc finger and BTB domain containing 21	697					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)										TTACTCCAAGGGGTTTTTCTC	0.433																																																	0								ENSG00000173276						133.0	156.0	148.0					21																	43412114		2203	4300	6503	ZBTB21	SO:0001819	synonymous_variant	0			-	HGNC	AB033053	CCDS13678.1, CCDS42934.1	21q22.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000173276	ENSG00000173276		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13083	protein-coding gene	gene with protein product			"""zinc finger protein 295"""	ZNF295			Standard	NM_020727		Approved	KIAA1227	uc002yzy.4	Q9ULJ3	OTTHUMG00000086789	ENST00000310826.5:c.2091C>A	21.37:g.43412114G>T		Somatic	0	53	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	Q5R2W1|Q5R2W2|Q6P4R0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.P697	ENST00000310826.5	37	c.2091	CCDS13678.1	21																																																																																			-	pfscan_Znf_C2H2		0.433	ZBTB21-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZBTB21	protein_coding	OTTHUMT00000195308.1	G	NM_020727	-		43412114	-1	no_errors	ENST00000310826	ensembl	human	known	74_37	silent	SNP	0.019	T
SKIDA1	387640	genome.wustl.edu	37	10	21805466	21805467	+	In_Frame_Ins	INS	-	-	CCTCCT	rs112207161	byFrequency	TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr10:21805466_21805467insCCTCCT	ENST00000449193.2	-	4	3537_3538	c.1285_1286insAGGAGG	c.(1285-1287)ggg>gAGGAGGgg	p.428_429insEE	SKIDA1_ENST00000444772.3_In_Frame_Ins_p.349_350insEE|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	347						nucleus (GO:0005634)		p.E428_G429insEE(2)									CCCGCTGCccccctcctcctcc	0.619														2708	0.540735	0.916	0.4063	5008	,	,		10303	0.3244		0.5408	False		,,,				2504	0.3517																2	Insertion - In frame(2)	soft_tissue(2)						ENSG00000180592			3173,56,18,597		1435,46,11,246,5,0,0,3,1,175						3.0	1.0		dbSNP_132	7	4189,51,27,3619		1322,36,14,1495,1,0,13,2,9,1051	no	codingComplex	C10orf140	NM_207371.3		2757,82,25,1741,6,0,13,5,10,1226	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		46.8805,17.4558,37.2379				7362,107,45,4216				SKIDA1	SO:0001652	inframe_insertion	0				HGNC	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1280_1285dupAGGAGG	10.37:g.21805467_21805472dupCCTCCT	ENSP00000410041:p.Glu427_Glu428dup	Somatic	NA	NA	NA		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B1ANA5|Q6ZMX4|Q8N3C3	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.429in_frame_insEE	ENST00000449193.2	37	c.1286_1285	CCDS44363.1	10																																																																																			-	NULL		0.619	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIDA1	protein_coding	OTTHUMT00000286950.2	-	NM_207371			21805467	-1	no_errors	ENST00000449193	ensembl	human	known	74_37	in_frame_ins	INS	0.998:1.000	CCTCCT
FAT3	120114	genome.wustl.edu	37	11	92086926	92086926	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr11:92086926T>A	ENST00000298047.6	+	1	1665	c.1648T>A	c.(1648-1650)Tct>Act	p.S550T	FAT3_ENST00000525166.1_Missense_Mutation_p.S400T|FAT3_ENST00000409404.2_Missense_Mutation_p.S550T|FAT3_ENST00000541502.1_Missense_Mutation_p.S550T			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	550	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGTTAGAGCCTCTGACTGGGG	0.408										TCGA Ovarian(4;0.039)																																							0								ENSG00000165323						78.0	82.0	81.0					11																	92086926		1838	4087	5925	FAT3	SO:0001583	missense	0			-	HGNC	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.1648T>A	11.37:g.92086926T>A	ENSP00000298047:p.Ser550Thr	Somatic	0	27	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	27	15.62	B5MDB0|Q96AU6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S550T	ENST00000298047.6	37	c.1648		11	.	.	.	.	.	.	.	.	.	.	T	18.82	3.705375	0.68615	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	5.82	5.82	0.92795	.	.	.	.	.	T	0.51092	0.1654	N	0.12920	0.275	0.54753	D	0.999988	D	0.76494	0.999	D	0.83275	0.996	T	0.50389	-0.8834	9	0.24483	T	0.36	.	15.3554	0.74423	0.0:0.0:0.0:1.0	.	550	Q8TDW7-3	.	T	550;550;550;400	ENSP00000298047:S550T;ENSP00000387040:S550T;ENSP00000443786:S550T;ENSP00000432586:S400T	ENSP00000298047:S550T	S	+	1	0	FAT3	91726574	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.975000	0.88055	2.223000	0.72356	0.482000	0.46254	TCT	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.408	FAT3-201	KNOWN	basic	protein_coding	FAT3	protein_coding		T	NM_001008781	-		92086926	+1	no_errors	ENST00000298047	ensembl	human	known	74_37	missense	SNP	1.000	A
EP300	2033	genome.wustl.edu	37	22	41513219	41513219	+	Silent	SNP	C	C	T			TCGA-DX-A1KX-01A-22D-A24N-09	TCGA-DX-A1KX-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61cbe535-6a91-4fb0-b28b-ef53c6973ad3	8801eb57-9164-4a96-bdfb-86f9fb5ec828	g.chr22:41513219C>T	ENST00000263253.7	+	2	1342	c.123C>T	c.(121-123)caC>caT	p.H41H		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	41	Interaction with ALX1.|Interaction with RORA.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						ACTTGGAGCACGACTTACCAG	0.368			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																															Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	0								ENSG00000100393						72.0	72.0	72.0					22																	41513219		2203	4300	6503	EP300	SO:0001819	synonymous_variant	0	Familial Cancer Database	Broad Thumb-Hallux syndrome	-	HGNC	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.123C>T	22.37:g.41513219C>T		Somatic	0	24	0.00		0.6629684926903064	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	36	18.18	B1AKC2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX_dom,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX_dom,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX_dom,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.H41	ENST00000263253.7	37	c.123	CCDS14010.1	22																																																																																			-	NULL		0.368	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	protein_coding	OTTHUMT00000320600.1	C	NM_001429	-		41513219	+1	no_errors	ENST00000263253	ensembl	human	known	74_37	silent	SNP	0.905	T
