#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
FAM115C	285966	genome.wustl.edu	37	7	143417404	143417405	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr7:143417404_143417405delCT	ENST00000441159.2	+	3	1318_1319	c.1252_1253delCT	c.(1252-1254)ctcfs	p.L418fs	FAM115C_ENST00000425618.2_Frame_Shift_Del_p.L137fs|FAM115C_ENST00000409703.3_Frame_Shift_Del_p.L254fs|FAM115C_ENST00000411497.2_Frame_Shift_Del_p.L137fs|FAM115C_ENST00000357344.4_Frame_Shift_Del_p.L418fs|FAM115C_ENST00000444908.2_Frame_Shift_Del_p.L418fs|FAM115C_ENST00000411935.1_Frame_Shift_Del_p.L254fs			A6NFQ2	F115C_HUMAN	family with sequence similarity 115, member C	418					hematopoietic progenitor cell differentiation (GO:0002244)					endometrium(2)|large_intestine(4)|lung(2)|prostate(1)	9						CCGCAAGGCGCTCTCTCAATTC	0.53																																																	0								ENSG00000170379		,,	39,207		18,3,102					,,	-7.1	0.0			1	22,442		10,2,220	no	frameshift,frameshift,frameshift	FAM115C	NM_173678.2,NM_001130026.2,NM_001130025.1	,,	28,5,322	A1A1,A1R,RR		4.7414,15.8537,8.5915	,,	,,		61,649				FAM115C	SO:0001589	frameshift_variant	0				HGNC	AY167570	CCDS34769.1, CCDS47735.1, CCDS47735.2	7q35	2010-08-03	2008-06-12	2008-06-12	ENSG00000170379	ENSG00000170379			26878	protein-coding gene	gene with protein product			"""family with sequence similarity 139, member A"""	FAM139A			Standard	NM_173678		Approved	FLJ40722	uc003wdf.3	A6NFQ2	OTTHUMG00000153232	ENST00000441159.2:c.1252_1253delCT	7.37:g.143417408_143417409delCT	ENSP00000404265:p.Leu418fs	Somatic	0	15	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	13	40.91	B4DK02|Q14D25|Q17RQ4|Q8IWQ0|Q8NF84	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.Q420fs	ENST00000441159.2	37	c.1252_1253		7																																																																																			-	NULL		0.530	FAM115C-001	KNOWN	basic|appris_principal	protein_coding	FAM115C	protein_coding	OTTHUMT00000330287.1	CT	NM_173678			143417405	+1	no_errors	ENST00000441159	ensembl	human	known	74_37	frame_shift_del	DEL	0.084:0.101	-
MT-ND2	4536	genome.wustl.edu	37	M	2665	2665	+	5'Flank	SNP	T	T	C			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chrM:2665T>C	ENST00000361453.3	+	0	0				MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TQ_ENST00000387372.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						ctgtctcttacttttaaccag	0.468																																																	0								ENSG00000210082																																			MT-RNR2	SO:0001631	upstream_gene_variant	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2665T>C	Exception_encountered	Somatic	0	646	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	356	11.41	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			-	-		0.468	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	protein_coding		T	YP_003024027	-		2665	+1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	SNP	NULL	C
TNPO3	23534	genome.wustl.edu	37	7	128619088	128619088	+	Silent	SNP	A	A	C			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr7:128619088A>C	ENST00000265388.5	-	16	2153	c.2010T>G	c.(2008-2010)gtT>gtG	p.V670V	TNPO3_ENST00000471166.1_Silent_p.V704V|TNPO3_ENST00000393245.1_Silent_p.V704V|TNPO3_ENST00000482320.1_Silent_p.V604V|TNPO3_ENST00000471234.1_Silent_p.V606V			Q9Y5L0	TNPO3_HUMAN	transportin 3	670					splicing factor protein import into nucleus (GO:0035048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(3)	22						CTACACAGCGAACAGCAAAGC	0.483																																					Pancreas(147;583 2585 39696 52331)												0								ENSG00000064419						166.0	155.0	159.0					7																	128619088		2203	4300	6503	TNPO3	SO:0001819	synonymous_variant	0			-	HGNC	AF145029	CCDS5809.1, CCDS55162.1	7q32.2	2014-02-03			ENSG00000064419	ENSG00000064419		"""Importins"""	17103	protein-coding gene	gene with protein product	"""importin 12"""	610032	"""limb girdle muscular dystrophy 1F (autosomal dominant)"""	LGMD1F		10366588, 10713112, 23543484, 23667635	Standard	NM_012470		Approved	TRN-SR, MTR10A, TRN-SR2, IPO12	uc003vol.2	Q9Y5L0	OTTHUMG00000158409	ENST00000265388.5:c.2010T>G	7.37:g.128619088A>C		Somatic	0	41	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	34	12.82	A4D1K9|C9IZM0|Q6NUM1|Q96G71|Q96GU9|Q9Y3R2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold	p.V704	ENST00000265388.5	37	c.2112	CCDS5809.1	7																																																																																			-	superfamily_ARM-type_fold		0.483	TNPO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNPO3	protein_coding	OTTHUMT00000350929.1	A	NM_012470	-		128619088	-1	no_errors	ENST00000393245	ensembl	human	known	74_37	silent	SNP	0.991	C
HYPM	25763	genome.wustl.edu	37	X	37850229	37850229	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chrX:37850229G>T	ENST00000341016.3	+	1	160	c.137G>T	c.(136-138)aGt>aTt	p.S46I	TM4SF2_ENST00000465127.1_Intron	NM_012274.1	NP_036406.1	O75409	HYPM_HUMAN		46										central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(2)	8						CAAAGCCAGAGTTCCTCCACA	0.512																																																	0								ENSG00000187516						100.0	95.0	96.0					X																	37850229		2061	4186	6247	CXorf27	SO:0001583	missense	0			-	HGNC																												ENST00000341016.3:c.137G>T	X.37:g.37850229G>T	ENSP00000339511:p.Ser46Ile	Somatic	0	19	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	71	17.24	A1A4D3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Histone-fold	p.S46I	ENST00000341016.3	37	c.137	CCDS43929.1	X	.	.	.	.	.	.	.	.	.	.	G	8.497	0.863315	0.17250	.	.	ENSG00000187516	ENST00000341016	T	0.55588	0.51	3.7	-1.48	0.08745	Histone-fold (2);	.	.	.	.	T	0.45657	0.1353	L	0.46157	1.445	0.09310	N	1	P	0.48016	0.904	P	0.46253	0.509	T	0.39482	-0.9612	9	0.72032	D	0.01	.	5.5686	0.17184	0.2167:0.4892:0.294:0.0	.	46	O75409	HYPM_HUMAN	I	46	ENSP00000339511:S46I	ENSP00000339511:S46I	S	+	2	0	CXorf27	37735173	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.125000	0.10579	-0.488000	0.06726	-1.361000	0.01213	AGT	-	superfamily_Histone-fold		0.512	CXorf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf27	protein_coding	OTTHUMT00000080888.1	G		-		37850229	+1	no_errors	ENST00000341016	ensembl	human	known	74_37	missense	SNP	0.000	T
AMT	275	genome.wustl.edu	37	3	49459474	49459474	+	Intron	SNP	A	A	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr3:49459474A>T	ENST00000273588.3	-	2	561				NICN1-AS1_ENST00000424915.1_RNA|AMT_ENST00000476226.1_Intron|AMT_ENST00000546031.1_5'UTR|AMT_ENST00000395338.2_Intron|AMT_ENST00000538581.1_Intron|AMT_ENST00000458307.2_Intron|NICN1_ENST00000422593.1_5'Flank	NM_000481.3	NP_000472.2	P48728	GCST_HUMAN	aminomethyltransferase						glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|transaminase activity (GO:0008483)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	Tetrahydrofolic acid(DB00116)	AAAGCCAAGGAGTGGACCACT	0.537																																																	0								ENSG00000145020																																			AMT	SO:0001627	intron_variant	0			-	HGNC	D13811	CCDS2797.1, CCDS54583.1, CCDS54584.1, CCDS54585.1	3p21.2-p21.1	2014-09-17	2006-05-22		ENSG00000145020	ENSG00000145020	2.1.2.10		473	protein-coding gene	gene with protein product	"""glycine cleavage system protein T"""	238310	"""aminomethyltransferase (glycine cleavage system protein T)"""			1993704, 8188235	Standard	NM_000481		Approved	GCST, NKH	uc003cww.3	P48728	OTTHUMG00000156847	ENST00000273588.3:c.258+62T>A	3.37:g.49459474A>T		Somatic	0	51	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	2	88.24	A8K3I5|B4DE61|B4DJQ0|E9PBG1|Q96IG6	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T33	ENST00000273588.3	37	c.99	CCDS2797.1	3																																																																																			-	NULL		0.537	AMT-003	KNOWN	basic|appris_principal|CCDS	protein_coding	AMT	protein_coding	OTTHUMT00000346216.2	A	NM_000481	-		49459474	-1	no_errors	ENST00000399379	ensembl	human	known	74_37	silent	SNP	0.000	T
CD63	967	genome.wustl.edu	37	12	56120701	56120701	+	Silent	SNP	G	G	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr12:56120701G>A	ENST00000549117.1	-	4	739	c.303C>T	c.(301-303)gcC>gcT	p.A101A	CD63_ENST00000552692.1_Silent_p.A101A|CD63_ENST00000550776.1_Silent_p.A19A|CD63_ENST00000548898.1_Silent_p.A8A|CD63_ENST00000546939.1_Silent_p.A19A|CD63_ENST00000552067.1_Silent_p.A8A|CD63_ENST00000552754.1_Silent_p.A78A|CD63_ENST00000548160.1_Silent_p.A8A|RP11-644F5.11_ENST00000552576.1_RNA|CD63_ENST00000257857.4_Silent_p.A101A|CD63_ENST00000420846.3_Silent_p.A101A	NM_001257389.1	NP_001244318.1	P08962	CD63_HUMAN	CD63 molecule	101					blood coagulation (GO:0007596)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular protein localization (GO:0034613)|endosome to melanosome transport (GO:0035646)|pigment granule maturation (GO:0048757)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of receptor internalization (GO:0002092)|protein transport (GO:0015031)|regulation of rubidium ion transport (GO:2000680)|regulation of vascular endothelial growth factor signaling pathway (GO:1900746)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|multivesicular body, internal vesicle (GO:0097487)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)				kidney(1)|large_intestine(3)|lung(2)|ovary(1)	7						AGCCAGCAATGGCTGCGGCCA	0.517																																					Pancreas(123;1459 1747 6717 18841 37380)												0								ENSG00000135404						150.0	163.0	159.0					12																	56120701		2203	4300	6503	CD63	SO:0001819	synonymous_variant	0			-	HGNC	M58485	CCDS8890.1, CCDS58242.1, CCDS58243.1	12q12-q13	2013-02-14	2006-03-28					"""CD molecules"", ""Tetraspanins"""	1692	protein-coding gene	gene with protein product		155740	"""CD63 antigen (melanoma 1 antigen)"""	MLA1			Standard	NM_001780		Approved	ME491, TSPAN30	uc031qhv.1	P08962		ENST00000549117.1:c.303C>T	12.37:g.56120701G>A		Somatic	0	40	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	20	39.39	F8VZE2|Q5TZP3|Q8N6Z9|Q9UCG6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tetraspanin/Peripherin,prints_Tetraspanin	p.P101L	ENST00000549117.1	37	c.302	CCDS8890.1	12																																																																																			-	NULL		0.517	CD63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD63	protein_coding	OTTHUMT00000409234.1	G		-		56120701	-1	no_errors	ENST00000550050	ensembl	human	known	74_37	missense	SNP	1.000	A
GCNT2	2651	genome.wustl.edu	37	6	10529549	10529549	+	Silent	SNP	C	C	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr6:10529549C>A	ENST00000379597.3	+	1	961	c.405C>A	c.(403-405)gcC>gcA	p.A135A	GCNT2_ENST00000495262.1_Silent_p.A135A|GCNT2_ENST00000397423.2_Intron|GCNT2_ENST00000410107.1_Intron			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)	135					maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		CGACGGATGCCTTTAAAGGTG	0.507																																																	0								ENSG00000111846						85.0	78.0	80.0					6																	10529549		2203	4300	6503	GCNT2	SO:0001819	synonymous_variant	0			-	HGNC	L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.405C>A	6.37:g.10529549C>A		Somatic	0	37	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	25	16.67		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_14	p.A135	ENST00000379597.3	37	c.405	CCDS34338.1	6																																																																																			-	pfam_Glyco_trans_14		0.507	GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GCNT2	protein_coding	OTTHUMT00000327912.3	C	NM_145649	-		10529549	+1	no_errors	ENST00000379597	ensembl	human	known	74_37	silent	SNP	0.000	A
CELSR2	1952	genome.wustl.edu	37	1	109804139	109804139	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr1:109804139G>A	ENST00000271332.3	+	4	4247	c.4186G>A	c.(4186-4188)Gcc>Acc	p.A1396T		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1396	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GTTCAGGTTTGCCACAAAGGA	0.602																																					NSCLC(158;1285 2011 34800 34852 42084)												0								ENSG00000143126						114.0	111.0	112.0					1																	109804139		2203	4300	6503	CELSR2	SO:0001583	missense	0			-	HGNC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.4186G>A	1.37:g.109804139G>A	ENSP00000271332:p.Ala1396Thr	Somatic	0	82	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	33	21.43	Q5T2Y7|Q92566	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.A1396T	ENST00000271332.3	37	c.4186	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.886522	0.91814	.	.	ENSG00000143126	ENST00000271332	T	0.79247	-1.25	5.01	5.01	0.66863	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.79263	0.4416	L	0.55990	1.75	0.53005	D	0.999967	P	0.49307	0.922	P	0.58577	0.841	T	0.80504	-0.1353	9	0.56958	D	0.05	.	13.8745	0.63645	0.0754:0.0:0.9246:0.0	.	1396	Q9HCU4	CELR2_HUMAN	T	1396	ENSP00000271332:A1396T	ENSP00000271332:A1396T	A	+	1	0	CELSR2	109605662	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	4.379000	0.59575	2.598000	0.87819	0.462000	0.41574	GCC	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.602	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	protein_coding	OTTHUMT00000033200.1	G	NM_001408	-		109804139	+1	no_errors	ENST00000271332	ensembl	human	known	74_37	missense	SNP	1.000	A
COL11A2	1302	genome.wustl.edu	37	6	33131576	33131576	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr6:33131576A>G	ENST00000374708.4	-	64	5090	c.4832T>C	c.(4831-4833)gTg>gCg	p.V1611A	COL11A2_ENST00000395197.1_Missense_Mutation_p.V1637A|COL11A2_ENST00000374713.1_Missense_Mutation_p.V1650A|COL11A2_ENST00000374714.1_Missense_Mutation_p.V1671A|COL11A2_ENST00000374712.1_Missense_Mutation_p.V1616A|COL11A2_ENST00000477772.1_5'UTR|COL11A2_ENST00000357486.1_Missense_Mutation_p.V1676A|COL11A2_ENST00000361917.1_Missense_Mutation_p.V1590A|COL11A2_ENST00000341947.2_Missense_Mutation_p.V1697A	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	1697	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						CACCTCCAGCACCGTCCGGCC	0.657																																					Melanoma(1;90 116 3946 5341 17093)												0								ENSG00000204248						67.0	58.0	61.0					6																	33131576		1510	2709	4219	COL11A2	SO:0001583	missense	0			-	HGNC	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.4832T>C	6.37:g.33131576A>G	ENSP00000363840:p.Val1611Ala	Somatic	0	91	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	27	36.36	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.V1697A	ENST00000374708.4	37	c.5090	CCDS43452.1	6	.	.	.	.	.	.	.	.	.	.	A	12.83	2.055274	0.36277	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917;ENST00000395196	T;T;T;T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05;-1.05;-1.05;-1.05	5.12	5.12	0.69794	Fibrillar collagen, C-terminal (4);	0.073647	0.53938	D	0.000058	D	0.83848	0.5343	M	0.76433	2.335	0.58432	D	0.999997	D;P;P;P	0.65815	0.995;0.663;0.663;0.711	D;B;B;P	0.71870	0.975;0.343;0.343;0.474	D	0.86390	0.1735	10	0.87932	D	0	.	12.9114	0.58182	1.0:0.0:0.0:0.0	.	293;1590;1611;1697	A2ABA7;P13942-8;P13942-6;P13942	.;.;.;COBA2_HUMAN	A	1611;1697;1676;1671;1650;1637;1616;1590;267	ENSP00000363840:V1611A;ENSP00000339915:V1697A;ENSP00000350079:V1676A;ENSP00000363846:V1671A;ENSP00000363845:V1650A;ENSP00000378623:V1637A;ENSP00000363844:V1616A;ENSP00000355123:V1590A	ENSP00000339915:V1697A	V	-	2	0	COL11A2	33239554	1.000000	0.71417	1.000000	0.80357	0.006000	0.05464	8.139000	0.89615	2.148000	0.66965	0.523000	0.50628	GTG	-	pfam_Fib_collagen_C,smart_Fib_collagen_C		0.657	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	protein_coding	OTTHUMT00000076032.2	A		-		33131576	-1	no_errors	ENST00000341947	ensembl	human	known	74_37	missense	SNP	1.000	G
POLR3C	10623	genome.wustl.edu	37	1	145594902	145594902	+	Intron	SNP	G	G	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr1:145594902G>T	ENST00000334163.3	-	13	1534				POLR3C_ENST00000369294.1_Intron	NM_006468.6	NP_006459.3	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide C (62kD)						defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)			TGAGGCCCTTGATCTTGAAAG	0.443																																																	0								ENSG00000186141						63.0	58.0	60.0					1																	145594902		2203	4300	6503	POLR3C	SO:0001627	intron_variant	0			-	HGNC	AJ238234	CCDS72864.1	1q21	2013-01-21			ENSG00000186141	ENSG00000186141		"""RNA polymerase subunits"""	30076	protein-coding gene	gene with protein product						9171375, 12391170	Standard	NM_006468		Approved	RPC62, RPC3	uc001eoh.3	Q9BUI4	OTTHUMG00000013753	ENST00000334163.3:c.1373+42C>A	1.37:g.145594902G>T		Somatic	0	18	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	52	24.64	O15317|Q9Y3R6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000334163.3	37	NULL	CCDS921.1	1																																																																																			-	-		0.443	POLR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3C	protein_coding	OTTHUMT00000038542.1	G	NM_006468	-		145594902	-1	no_errors	ENST00000489436	ensembl	human	known	74_37	rna	SNP	0.001	T
LINS	55180	genome.wustl.edu	37	15	101113767	101113767	+	Intron	SNP	T	T	G			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr15:101113767T>G	ENST00000314742.8	-	5	1445				LINS_ENST00000560133.1_Nonstop_Mutation_p.*318Y|LINS_ENST00000561308.1_Nonstop_Mutation_p.*437Y|LINS_ENST00000559149.1_Intron	NM_001040616.2	NP_001035706	Q8NG48	LINES_HUMAN	lines homolog (Drosophila)											central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(4)	21						TTACTGGAATTTAAACTAGTC	0.274																																																	0								ENSG00000140471																																			LINS	SO:0001627	intron_variant	0			-	HGNC	AK095448	CCDS10385.1	15q26.3	2010-09-08	2010-09-08	2010-09-08	ENSG00000140471	ENSG00000140471			30922	protein-coding gene	gene with protein product		610350	"""lines homolog 1 (Drosophila)"""	LINS1		12119551, 8889548	Standard	NM_001040616		Approved	WINS1	uc002bwg.3	Q8NG48	OTTHUMG00000149865	ENST00000314742.8:c.1222+88A>C	15.37:g.101113767T>G		Somatic	0	50	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	Q96FW2|Q9NVQ3	Nonstop_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.*437Y	ENST00000314742.8	37	c.1311	CCDS10385.1	15																																																																																			-	NULL		0.274	LINS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINS	protein_coding	OTTHUMT00000313592.1	T	NM_018148	-		101113767	-1	no_errors	ENST00000561308	ensembl	human	known	74_37	nonstop	SNP	0.001	G
HLA-V	352962	genome.wustl.edu	37	6	29765087	29765087	+	RNA	DEL	T	T	-	rs2523414|rs202185286	byFrequency	TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr6:29765087delT	ENST00000457107.1	+	0	4313									major histocompatibility complex, class I, V (pseudogene)																		taagactcactgaagtttcta	0.453													t|T|-|deletion	59	0.0117812	0.0265	0.0187	5008	,	,		18397	0.001		0.0099	False		,,,				2504	0.0																0								ENSG00000181126																																			HLA-V			0				HGNC	M96332		6p21.3	2012-10-05	2007-12-12	2007-12-12	ENSG00000181126	ENSG00000181126		"""Histocompatibility complex"""	23482	pseudogene	pseudogene			"""HLA-75 pseudogene"""	HLA-75			Standard	NG_002729		Approved	dJ377H14.4			OTTHUMG00000031277		6.37:g.29765087delT		Somatic	0	48	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000457107.1	37	NULL		6																																																																																			-	-		0.453	HLA-V-003	KNOWN	basic	processed_transcript	HLA-V	pseudogene	OTTHUMT00000105231.1	T	NG_002729			29765087	+1	no_errors	ENST00000457107	ensembl	human	known	74_37	rna	DEL	0.013	-
SYNE1	23345	genome.wustl.edu	37	6	152466656	152466656	+	Intron	SNP	T	T	C			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr6:152466656T>C	ENST00000367255.5	-	138	25578				SYNE1_ENST00000539504.1_Intron|SYNE1_ENST00000341594.5_Intron|SYNE1_ENST00000265368.4_Intron|SYNE1_ENST00000423061.1_Silent_p.V8266V|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000448038.1_Silent_p.V8266V|SYNE1_ENST00000354674.4_Silent_p.V492V|SYNE1_ENST00000356820.4_Intron	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTGTGAGTTTTACATAGGCCT	0.483										HNSCC(10;0.0054)																																							0								ENSG00000131018						124.0	117.0	119.0					6																	152466656		2203	4300	6503	SYNE1	SO:0001627	intron_variant	0			-	HGNC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.24977-1756A>G	6.37:g.152466656T>C		Somatic	0	72	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	20	33.33	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.V8266	ENST00000367255.5	37	c.24798	CCDS5236.2	6																																																																																			-	NULL		0.483	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	protein_coding	OTTHUMT00000334755.2	T	NM_182961	-		152466656	-1	no_errors	ENST00000423061	ensembl	human	known	74_37	silent	SNP	1.000	C
TP53BP1	7158	genome.wustl.edu	37	15	43739389	43739389	+	Intron	SNP	A	A	G			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr15:43739389A>G	ENST00000263801.3	-	13	3074				TP53BP1_ENST00000450115.2_Intron|TP53BP1_ENST00000382039.3_Intron|TP53BP1_ENST00000382044.4_Intron|TP53BP1_ENST00000605155.1_Intron	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		tcctctctttACCCCTCATCT	0.388								Other conserved DNA damage response genes																																									0								ENSG00000067369																																			TP53BP1	SO:0001627	intron_variant	0			-	HGNC	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.2821+174T>C	15.37:g.43739389A>G		Somatic	0	14	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	9	40.00	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000263801.3	37	NULL	CCDS10096.1	15																																																																																			-	-		0.388	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TP53BP1	protein_coding	OTTHUMT00000132897.3	A		-		43739389	-1	no_errors	ENST00000414758	ensembl	human	known	74_37	rna	SNP	0.002	G
CCDC176	80127	genome.wustl.edu	37	14	74512807	74512808	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr14:74512807_74512808delAG	ENST00000394009.3	+	6	744_745	c.621_622delAG	c.(619-624)gcagagfs	p.E208fs	CCDC176_ENST00000553773.1_Intron|CCDC176_ENST00000489323.1_3'UTR|AC005484.5_ENST00000492026.1_RNA	NM_025057.2	NP_079333.2	Q8ND07	BBOF1_HUMAN	coiled-coil domain containing 176	208					motile cilium assembly (GO:0044458)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)											TAATGCTAGCAGAGAGAGCCCA	0.396																																																	0								ENSG00000119636																																			CCDC176	SO:0001589	frameshift_variant	0				HGNC	BI457605	CCDS32119.2	14q24.3	2013-01-04	2012-09-25	2012-09-25	ENSG00000119636	ENSG00000119636			19855	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 45"""	C14orf45			Standard	NM_025057		Approved		uc010tup.2	Q8ND07	OTTHUMG00000152786	ENST00000394009.3:c.621_622delAG	14.37:g.74512813_74512814delAG	ENSP00000377577:p.Glu208fs	Somatic	0	36	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	21	8.70	Q0P604|Q9H5P8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.R209fs	ENST00000394009.3	37	c.621_622	CCDS32119.2	14																																																																																			-	NULL		0.396	CCDC176-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC176	protein_coding	OTTHUMT00000327863.1	AG	NM_025057			74512808	+1	no_errors	ENST00000394009	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
MROH5	389690	genome.wustl.edu	37	8	142445804	142445804	+	RNA	SNP	C	C	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr8:142445804C>T	ENST00000606664.1	+	0	1160				MROH5_ENST00000430863.1_RNA																							TGCGTGTGCGCAGTGGGGGAG	0.662																																																	0								ENSG00000271959																																			CTD-3064M3.7			0			-	Clone_based_vega_gene																													8.37:g.142445804C>T		Somatic	0	36	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	51	16.39		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000606664.1	37	NULL		8																																																																																			-	-		0.662	CTD-3064M3.7-001	KNOWN	non_canonical_TEC|basic	antisense	ENSG00000271959	antisense	OTTHUMT00000470872.1	C		-		142445804	+1	no_errors	ENST00000606664	ensembl	human	known	74_37	rna	SNP	0.000	T
CTDSP2	10106	genome.wustl.edu	37	12	58223339	58223340	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr12:58223339_58223340delAC	ENST00000398073.2	-	2	407_408	c.104_105delGT	c.(103-105)cgtfs	p.R35fs	CTDSP2_ENST00000548823.1_Frame_Shift_Del_p.R35fs|CTDSP2_ENST00000547701.1_5'UTR	NM_005730.3	NP_005721.3	O14595	CTDS2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2	35					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein dephosphorylation (GO:0006470)	nucleoplasm (GO:0005654)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(1)|prostate(2)	7	all_neural(12;0.00559)|Glioma(12;0.0143)|Melanoma(17;0.122)					TGAAGATGTTACGTCCACGAGG	0.52																																																	0								ENSG00000175215																																			CTDSP2	SO:0001589	frameshift_variant	0				HGNC	AF000152	CCDS41801.1	12q14.1	2012-06-14			ENSG00000175215	ENSG00000175215		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	17077	protein-coding gene	gene with protein product	"""conserved gene amplified in osteosarcoma"", ""nuclear LIM interactor-interacting factor 2"", ""NLI-interacting factor 2"", ""small CTD phosphatase 2"""	608711				9315096, 12721286	Standard	XM_005268556		Approved	OS4, SCP2, PSR2	uc001sqm.3	O14595	OTTHUMG00000170483	ENST00000398073.2:c.104_105delGT	12.37:g.58223339_58223340delAC	ENSP00000381148:p.Arg35fs	Somatic	0	99	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	41	48.10	A8K5H4|Q53ZR2|Q6NZY3|Q9UEX1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_NIF,superfamily_HAD-like_dom,smart_NIF,pfscan_NIF,tigrfam_Dullard_phosphatase	p.R35fs	ENST00000398073.2	37	c.105_104	CCDS41801.1	12																																																																																			-	NULL		0.520	CTDSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDSP2	protein_coding	OTTHUMT00000409353.1	AC	NM_005730			58223340	-1	no_errors	ENST00000398073	ensembl	human	known	74_37	frame_shift_del	DEL	0.992:1.000	-
TP53TG3D	729264	genome.wustl.edu	37	16	32265770	32265770	+	IGR	SNP	C	C	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr16:32265770C>T	ENST00000354614.3	+	0	412				RP11-56L13.7_ENST00000562604.1_RNA|TP53TG3D_ENST00000569631.1_Silent_p.C98C|TP53TG3D_ENST00000564810.1_3'UTR|TP53TG3D_ENST00000398664.3_Intron			Q9ULZ0	T53G3_HUMAN	TP53 target 3D							cytoplasm (GO:0005737)|nucleus (GO:0005634)											GGGCTCGCTGCGTGGTCCATA	0.552																																																	0								ENSG00000205456																																			TP53TG3D	SO:0001628	intergenic_variant	0			-	HGNC		CCDS58456.1	16p11.2	2012-12-11			ENSG00000205456	ENSG00000205456			44657	protein-coding gene	gene with protein product							Standard	NM_001243722		Approved		uc021tgy.1	Q9ULZ0	OTTHUMG00000132469		16.37:g.32265770C>T		Somatic	0	210	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	41	49.38	B2R5K6|Q4KN31|Q9ULY9	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C98	ENST00000354614.3	37	c.294		16																																																																																			-	NULL		0.552	TP53TG3D-201	KNOWN	basic|appris_candidate_longest	protein_coding	TP53TG3D	protein_coding		C	NM_001243722	-		32265770	+1	no_errors	ENST00000563025	ensembl	human	known	74_37	silent	SNP	0.026	T
OR52N5	390075	genome.wustl.edu	37	11	5799652	5799652	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr11:5799652delA	ENST00000317093.2	-	1	245	c.213delT	c.(211-213)tttfs	p.F71fs	TRIM5_ENST00000380027.1_Intron	NM_001001922.2	NP_001001922.2	Q8NH56	O52N5_HUMAN	olfactory receptor, family 52, subfamily N, member 5	71						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F71fs*59(1)		endometrium(2)|large_intestine(3)|liver(1)|lung(17)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		GAGCATGGCCAAAAAAAAAAT	0.428																																																	1	Deletion - Frameshift(1)	ovary(1)						ENSG00000181009			21,37,4048		0,0,21,1,35,1996	123.0	117.0	119.0			2.7	0.6	11		123	37,129,7678		1,0,35,6,117,3763	no	codingComplex	OR52N5	NM_001001922.2		1,0,56,7,152,5759	A1A1,A1A2,A1R,A2A2,A2R,RR		2.1163,1.4126,1.8745			5799652	58,166,11726	2125	4088	6213	OR52N5	SO:0001589	frameshift_variant	0				HGNC	AB065535	CCDS31397.1	11p15.4	2012-08-09			ENSG00000181009	ENSG00000181009		"""GPCR / Class A : Olfactory receptors"""	15231	protein-coding gene	gene with protein product							Standard	NM_001001922		Approved	OR52N5Q	uc010qzn.2	Q8NH56	OTTHUMG00000168799	ENST00000317093.2:c.213delT	11.37:g.5799652delA	ENSP00000322866:p.Phe71fs	Somatic	0	34	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	B9EH12|Q6IFG2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	p.F71fs	ENST00000317093.2	37	c.213	CCDS31397.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.428	OR52N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52N5	protein_coding	OTTHUMT00000401141.1	A	NM_001001922			5799652	-1	no_errors	ENST00000317093	ensembl	human	known	74_37	frame_shift_del	DEL	0.971	-
TCHHL1	126637	genome.wustl.edu	37	1	152059914	152059914	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr1:152059914T>A	ENST00000368806.1	-	3	308	c.244A>T	c.(244-246)Aac>Tac	p.N82Y		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	82	EF-hand.						calcium ion binding (GO:0005509)			breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			TAACAGAGGTTCAACAAGTTG	0.358																																																	0								ENSG00000182898						103.0	95.0	98.0					1																	152059914		2203	4300	6503	TCHHL1	SO:0001583	missense	0			-	HGNC		CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.244A>T	1.37:g.152059914T>A	ENSP00000357796:p.Asn82Tyr	Somatic	0	83	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	134	10.07	B2RPK8|Q5VTJ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub	p.N82Y	ENST00000368806.1	37	c.244	CCDS30857.1	1	.	.	.	.	.	.	.	.	.	.	.	17.50	3.404324	0.62288	.	.	ENSG00000182898	ENST00000368806	T	0.14022	2.54	5.26	5.26	0.73747	EF-hand-like domain (1);	0.000000	0.42548	D	0.000699	T	0.15392	0.0371	L	0.34521	1.04	0.40465	D	0.980289	D	0.89917	1.0	D	0.70227	0.968	T	0.01951	-1.1241	10	0.56958	D	0.05	-8.5497	11.5491	0.50711	0.0:0.0:0.0:1.0	.	82	Q5QJ38	TCHL1_HUMAN	Y	82	ENSP00000357796:N82Y	ENSP00000357796:N82Y	N	-	1	0	TCHHL1	150326538	0.937000	0.31787	0.733000	0.30861	0.770000	0.43624	2.380000	0.44327	1.983000	0.57843	0.247000	0.18012	AAC	-	NULL		0.358	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHHL1	protein_coding	OTTHUMT00000036638.2	T	XM_060104	-		152059914	-1	no_errors	ENST00000368806	ensembl	human	known	74_37	missense	SNP	0.974	A
SEMA5A	9037	genome.wustl.edu	37	5	9054348	9054348	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr5:9054348C>A	ENST00000382496.5	-	19	3205	c.2540G>T	c.(2539-2541)tGg>tTg	p.W847L	MIR4636_ENST00000582271.1_RNA	NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	847	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CCAGGGGGACCAGCAAGACCA	0.512																																																	0								ENSG00000112902						71.0	64.0	66.0					5																	9054348		2203	4300	6503	SEMA5A	SO:0001583	missense	0			-	HGNC	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2540G>T	5.37:g.9054348C>A	ENSP00000371936:p.Trp847Leu	Somatic	0	34	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	18	30.77	D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.W847L	ENST00000382496.5	37	c.2540	CCDS3875.1	5	.	.	.	.	.	.	.	.	.	.	C	32	5.129340	0.94473	.	.	ENSG00000112902	ENST00000382496	T	0.63417	-0.04	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.87593	0.6216	H	0.98664	4.295	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.91923	0.5549	10	0.87932	D	0	.	17.4491	0.87587	0.0:1.0:0.0:0.0	.	847	Q13591	SEM5A_HUMAN	L	847	ENSP00000371936:W847L	ENSP00000371936:W847L	W	-	2	0	SEMA5A	9107348	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.422000	0.80217	2.793000	0.96121	0.561000	0.74099	TGG	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.512	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA5A	protein_coding	OTTHUMT00000206989.2	C		-		9054348	-1	no_errors	ENST00000382496	ensembl	human	known	74_37	missense	SNP	1.000	A
SULT2A1	6822	genome.wustl.edu	37	19	48386833	48386833	+	Splice_Site	SNP	C	C	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr19:48386833C>A	ENST00000222002.3	-	2	485		c.e2+1			NM_003167.3	NP_003158.2	Q06520	ST2A1_HUMAN	sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1						3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|bile acid catabolic process (GO:0030573)|cellular lipid metabolic process (GO:0044255)|digestion (GO:0007586)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	bile-salt sulfotransferase activity (GO:0047704)|sulfotransferase activity (GO:0008146)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|skin(1)	20		all_cancers(25;3.02e-09)|all_lung(116;6.48e-07)|all_epithelial(76;7.35e-07)|Lung NSC(112;1.56e-06)|all_neural(266;0.0146)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000254)|all cancers(93;0.000545)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.0552)	Abiraterone(DB05812)|Acetaminophen(DB00316)	TATGCACTGACCTTGGCCTTG	0.453																																																	0								ENSG00000105398						138.0	102.0	114.0					19																	48386833		2203	4300	6503	SULT2A1	SO:0001630	splice_region_variant	0			-	HGNC	X70222	CCDS12707.1	19q13.3	2014-05-21			ENSG00000105398	ENSG00000105398	2.8.2.2	"""Sulfotransferases, cytosolic"""	11458	protein-coding gene	gene with protein product		125263		STD		1588921, 7736787	Standard	NM_003167		Approved	DHEA-ST	uc002phr.2	Q06520	OTTHUMG00000162469	ENST00000222002.3:c.345+1G>T	19.37:g.48386833C>A		Somatic	0	83	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	35	40.68		Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e2+1	ENST00000222002.3	37	c.345+1	CCDS12707.1	19	.	.	.	.	.	.	.	.	.	.	c	13.59	2.284074	0.40394	.	.	ENSG00000105398	ENST00000222002	.	.	.	3.57	3.57	0.40892	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0525	0.58962	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SULT2A1	53078645	1.000000	0.71417	1.000000	0.80357	0.625000	0.37756	3.119000	0.50422	2.027000	0.59764	0.643000	0.83706	.	-	-		0.453	SULT2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT2A1	protein_coding	OTTHUMT00000369044.1	C	NM_003167	-	Intron	48386833	-1	no_errors	ENST00000222002	ensembl	human	known	74_37	splice_site	SNP	1.000	A
SLC32A1	140679	genome.wustl.edu	37	20	37356949	37356949	+	Silent	SNP	C	C	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr20:37356949C>T	ENST00000217420.1	+	2	1508	c.1245C>T	c.(1243-1245)cgC>cgT	p.R415R		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	415					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	AAGGCAGCCGCGCCTTTTTCC	0.622																																																	0								ENSG00000101438						33.0	36.0	35.0					20																	37356949		2203	4300	6503	SLC32A1	SO:0001819	synonymous_variant	0			-	HGNC	AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.1245C>T	20.37:g.37356949C>T		Somatic	0	76	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	41	32.79	Q8N489	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_AA_transpt_TM	p.R415	ENST00000217420.1	37	c.1245	CCDS13307.1	20																																																																																			-	pfam_AA_transpt_TM		0.622	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC32A1	protein_coding	OTTHUMT00000079206.1	C	NM_080552	-		37356949	+1	no_errors	ENST00000217420	ensembl	human	known	74_37	silent	SNP	0.998	T
IGF2R	3482	genome.wustl.edu	37	6	160482875	160482875	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr6:160482875C>G	ENST00000356956.1	+	25	3645	c.3497C>G	c.(3496-3498)tCt>tGt	p.S1166C		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1166					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	GCGAATGGATCTTTGAGCATC	0.537																																																	0								ENSG00000197081						159.0	146.0	150.0					6																	160482875		2203	4300	6503	IGF2R	SO:0001583	missense	0			-	HGNC	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.3497C>G	6.37:g.160482875C>G	ENSP00000349437:p.Ser1166Cys	Somatic	0	100	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	31	46.55	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CIMR,pfam_FN_type2_col-bd,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	p.S1166C	ENST00000356956.1	37	c.3497	CCDS5273.1	6	.	.	.	.	.	.	.	.	.	.	C	15.24	2.774927	0.49786	.	.	ENSG00000197081	ENST00000356956	T	0.04049	3.72	5.5	5.5	0.81552	Mannose-6-phosphate receptor, binding (1);	0.055307	0.85682	D	0.000000	T	0.19685	0.0473	M	0.86573	2.825	0.54753	D	0.999983	D	0.89917	1.0	D	0.79784	0.993	T	0.00795	-1.1563	10	0.66056	D	0.02	-16.845	17.5389	0.87841	0.0:1.0:0.0:0.0	.	1166	P11717	MPRI_HUMAN	C	1166	ENSP00000349437:S1166C	ENSP00000349437:S1166C	S	+	2	0	IGF2R	160402865	1.000000	0.71417	0.501000	0.27601	0.035000	0.12851	5.530000	0.67141	2.735000	0.93741	0.655000	0.94253	TCT	-	pfam_CIMR,superfamily_Man6P_isomerase_rcpt-bd_dom		0.537	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2R	protein_coding	OTTHUMT00000042931.1	C	NM_000876	-		160482875	+1	no_errors	ENST00000356956	ensembl	human	known	74_37	missense	SNP	0.921	G
SLIT3	6586	genome.wustl.edu	37	5	168151482	168151482	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr5:168151482C>G	ENST00000519560.1	-	21	2697	c.2278G>C	c.(2278-2280)Gaa>Caa	p.E760Q	SLIT3_ENST00000332966.8_Missense_Mutation_p.E760Q|SLIT3_ENST00000404867.3_Missense_Mutation_p.E760Q	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	760					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGGTTTCCTTCCAGGTACCTG	0.512																																					Ovarian(29;311 847 10864 17279 24903)												0								ENSG00000184347						68.0	63.0	65.0					5																	168151482		2203	4298	6501	SLIT3	SO:0001583	missense	0			-	HGNC	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.2278G>C	5.37:g.168151482C>G	ENSP00000430333:p.Glu760Gln	Somatic	0	58	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	29	36.96	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EG-like_dom,pfam_Leu-rich_rpt,pfam_Laminin_G,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.E760Q	ENST00000519560.1	37	c.2278	CCDS4369.1	5	.	.	.	.	.	.	.	.	.	.	c	21.3	4.132898	0.77662	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.79940	-1.32;-1.32;-1.32	4.34	4.34	0.51931	.	0.105910	0.64402	D	0.000004	T	0.80884	0.4709	N	0.20881	0.62	0.58432	D	0.999996	P	0.41041	0.736	P	0.53809	0.735	D	0.84225	0.0463	10	0.87932	D	0	.	17.1167	0.86690	0.0:1.0:0.0:0.0	.	760	O75094	SLIT3_HUMAN	Q	760	ENSP00000430333:E760Q;ENSP00000332164:E760Q;ENSP00000384890:E760Q	ENSP00000332164:E760Q	E	-	1	0	SLIT3	168084060	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.376000	0.73141	2.264000	0.75181	0.489000	0.48404	GAA	-	NULL		0.512	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT3	protein_coding	OTTHUMT00000252792.4	C	NM_003062	-		168151482	-1	no_errors	ENST00000519560	ensembl	human	known	74_37	missense	SNP	1.000	G
MATK	4145	genome.wustl.edu	37	19	3779407	3779407	+	Missense_Mutation	SNP	C	C	A	rs374133861		TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr19:3779407C>A	ENST00000310132.6	-	11	1368	c.970G>T	c.(970-972)Gtg>Ttg	p.V324L	MATK_ENST00000585778.1_Missense_Mutation_p.V324L|MATK_ENST00000395040.2_Missense_Mutation_p.V283L|MATK_ENST00000395045.2_Missense_Mutation_p.V325L	NM_139355.2	NP_647612.1	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase	324	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	26		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGGTGTTCACGAGGGCTCGA	0.652																																																	0								ENSG00000007264						46.0	49.0	48.0					19																	3779407		2203	4300	6503	MATK	SO:0001583	missense	0			-	HGNC	L18974	CCDS12113.1, CCDS12114.1, CCDS42468.1	19p13.3	2013-02-14						"""SH2 domain containing"""	6906	protein-coding gene	gene with protein product	"""Csk-homologous kinase"", ""tyrosine-protein kinase CTK"", ""protein kinase HYL"", ""hematopoietic consensus tyrosine-lacking kinase"", ""tyrosylprotein kinase"", ""hydroxyaryl-protein kinase"", ""Csk-type protein tyrosine kinase"", ""HYL tyrosine kinase"", ""tyrosine kinase MATK"", ""leukocyte carboxyl-terminal src kinase related"""	600038				8288563, 7530249	Standard	NM_139355		Approved	HYLTK, CTK, HYL, Lsk, CHK, HHYLTK, DKFZp434N1212, MGC1708, MGC2101	uc002lyt.3	P42679		ENST00000310132.6:c.970G>T	19.37:g.3779407C>A	ENSP00000308734:p.Val324Leu	Somatic	0	46	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	7	56.25	B3KNZ9|Q9NST8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.V325L	ENST00000310132.6	37	c.973	CCDS12114.1	19	.	.	.	.	.	.	.	.	.	.	C	11.81	1.748690	0.30955	.	.	ENSG00000007264	ENST00000395045;ENST00000310132;ENST00000395040	T;T;T	0.55588	0.51;0.51;0.51	3.52	3.52	0.40303	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.346320	0.25701	N	0.028864	T	0.25606	0.0623	N	0.00611	-1.325	0.43508	D	0.995769	D;P;D	0.53151	0.958;0.943;0.958	P;P;P	0.50570	0.644;0.627;0.644	T	0.36432	-0.9748	10	0.02654	T	1	-38.7195	14.618	0.68562	0.0:1.0:0.0:0.0	.	324;325;324	F1T0G6;B3KNZ9;P42679	.;.;MATK_HUMAN	L	325;324;283	ENSP00000378485:V325L;ENSP00000308734:V324L;ENSP00000378481:V283L	ENSP00000308734:V324L	V	-	1	0	MATK	3730407	0.782000	0.28689	0.235000	0.24058	0.859000	0.49053	1.550000	0.36223	1.990000	0.58119	0.306000	0.20318	GTG	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.652	MATK-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	MATK	protein_coding	OTTHUMT00000453639.1	C	NM_139355	-		3779407	-1	no_errors	ENST00000395045	ensembl	human	known	74_37	missense	SNP	0.769	A
VSTM2L	128434	genome.wustl.edu	37	20	36561976	36561976	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr20:36561976G>C	ENST00000373461.4	+	3	574	c.327G>C	c.(325-327)gaG>gaC	p.E109D	VSTM2L_ENST00000373459.4_Intron|VSTM2L_ENST00000373458.3_Intron	NM_080607.2	NP_542174.1	Q96N03	VTM2L_HUMAN	V-set and transmembrane domain containing 2 like	109	Ig-like.									central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(1)|skin(1)	8		Myeloproliferative disorder(115;0.00878)				CAGGGAAGGAGGCAACCAAAA	0.512																																																	0								ENSG00000132821						100.0	91.0	94.0					20																	36561976		2203	4300	6503	VSTM2L	SO:0001583	missense	0			-	HGNC	AL109964	CCDS13299.1	20q11.23	2013-01-11	2007-08-10	2007-08-10	ENSG00000132821	ENSG00000132821		"""Immunoglobulin superfamily / V-set domain containing"""	16096	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 102"""	C20orf102			Standard	NM_080607		Approved	dJ1118M15.2	uc002xhk.4	Q96N03	OTTHUMG00000032430	ENST00000373461.4:c.327G>C	20.37:g.36561976G>C	ENSP00000362560:p.Glu109Asp	Somatic	0	23	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	11	50.00	E1P5V7|Q5JWZ4|Q5JWZ5|Q8ND45|Q9BR37	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.E109D	ENST00000373461.4	37	c.327	CCDS13299.1	20	.	.	.	.	.	.	.	.	.	.	G	2.055	-0.416672	0.04766	.	.	ENSG00000132821	ENST00000373461	T	0.68025	-0.3	4.89	-2.6	0.06190	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.336851	0.34777	N	0.003699	T	0.21509	0.0518	N	0.00301	-1.68	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46442	-0.9191	10	0.02654	T	1	-0.787	10.2449	0.43334	0.0:0.323:0.527:0.15	.	109	Q96N03	VTM2L_HUMAN	D	109	ENSP00000362560:E109D	ENSP00000362560:E109D	E	+	3	2	VSTM2L	35995390	0.557000	0.26546	0.985000	0.45067	0.975000	0.68041	-0.431000	0.06965	-0.172000	0.10779	-0.494000	0.04653	GAG	-	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom		0.512	VSTM2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSTM2L	protein_coding	OTTHUMT00000079133.1	G		-		36561976	+1	no_errors	ENST00000373461	ensembl	human	known	74_37	missense	SNP	0.962	C
CNTNAP3	79937	genome.wustl.edu	37	9	39174372	39174372	+	Intron	SNP	T	T	A	rs113196130		TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr9:39174372T>A	ENST00000297668.6	-	7	1145				CNTNAP3_ENST00000377659.1_Intron|CNTNAP3_ENST00000377656.2_Intron|CNTNAP3_ENST00000358144.2_Intron|CNTNAP3_ENST00000377653.2_5'UTR|CNTNAP3_ENST00000323947.7_Intron	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3						cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TTCAAACCCATCTTTTTTTTT	0.343																																																	0								ENSG00000106714																																			CNTNAP3	SO:0001627	intron_variant	0			-	HGNC	AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.1071+1573A>T	9.37:g.39174372T>A		Somatic	0	42	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	16.67	B1AMA0|Q9C0E9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000297668.6	37	NULL	CCDS6616.1	9																																																																																			-	-		0.343	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3	protein_coding	OTTHUMT00000052511.1	T	NM_033655	rs200822754		39174372	-1	no_errors	ENST00000377653	ensembl	human	known	74_37	rna	SNP	0.776	A
RYR2	6262	genome.wustl.edu	37	1	237666727	237666727	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr1:237666727delT	ENST00000366574.2	+	22	2852	c.2535delT	c.(2533-2535)actfs	p.T845fs	RYR2_ENST00000542537.1_Frame_Shift_Del_p.T829fs|RYR2_ENST00000360064.6_Frame_Shift_Del_p.T843fs	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	845					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAGAAAGAACTTACACACGCG	0.507																																																	0								ENSG00000198626						123.0	128.0	126.0					1																	237666727		2025	4170	6195	RYR2	SO:0001589	frameshift_variant	0				HGNC	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.2535delT	1.37:g.237666727delT	ENSP00000355533:p.Thr845fs	Somatic	0	56	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	Q15411|Q546N8|Q5T3P2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.Y844fs	ENST00000366574.2	37	c.2529	CCDS55691.1	1																																																																																			-	NULL		0.507	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	T	NM_001035			237666727	+1	no_errors	ENST00000360064	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
CAMTA1	23261	genome.wustl.edu	37	1	7805021	7805021	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr1:7805021A>G	ENST00000303635.7	+	17	4516	c.4309A>G	c.(4309-4311)Atg>Gtg	p.M1437V	CAMTA1_ENST00000476864.1_Start_Codon_SNP_p.M1V|CAMTA1_ENST00000439411.2_Missense_Mutation_p.M1437V	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	1437					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		TAGCAGTACAATGAGCTGGCT	0.512			T	WWTR1	epitheliod hemangioendothelioma																																			Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	0								ENSG00000171735						118.0	103.0	108.0					1																	7805021		2203	4300	6503	CAMTA1	SO:0001583	missense	0			-	HGNC	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.4309A>G	1.37:g.7805021A>G	ENSP00000306522:p.Met1437Val	Somatic	0	49	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	13	48.00	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CG-1_dom,pfam_IPT,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.M1437V	ENST00000303635.7	37	c.4309	CCDS30576.1	1	.	.	.	.	.	.	.	.	.	.	A	17.14	3.314470	0.60524	.	.	ENSG00000171735	ENST00000303635;ENST00000439411;ENST00000414738;ENST00000303646;ENST00000476864	T;T;T	0.55413	2.04;1.85;0.52	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.66877	0.2834	L	0.52126	1.63	0.58432	D	0.999999	P;P;D;P	0.61080	0.459;0.865;0.989;0.534	B;P;D;P	0.74348	0.058;0.824;0.983;0.621	T	0.67273	-0.5712	10	0.48119	T	0.1	-24.6153	15.4947	0.75641	1.0:0.0:0.0:0.0	.	1437;500;393;1437	Q9Y6Y1-2;B4DXR3;Q7Z7P1;Q9Y6Y1	.;.;.;CMTA1_HUMAN	V	1437;1437;500;393;1	ENSP00000306522:M1437V;ENSP00000402561:M1437V;ENSP00000452319:M1V	ENSP00000306522:M1437V	M	+	1	0	CAMTA1	7727608	1.000000	0.71417	0.910000	0.35882	0.908000	0.53690	9.007000	0.93597	2.062000	0.61559	0.533000	0.62120	ATG	-	NULL		0.512	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA1	protein_coding	OTTHUMT00000003588.3	A	NM_015215	-		7805021	+1	no_errors	ENST00000303635	ensembl	human	known	74_37	missense	SNP	1.000	G
KIAA1958	158405	genome.wustl.edu	37	9	115248931	115248931	+	5'Flank	SNP	G	G	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr9:115248931G>A	ENST00000337530.6	+	0	0				C9orf147_ENST00000463223.1_5'UTR|C9orf147_ENST00000457681.1_Intron|KIAA1958_ENST00000536272.1_5'Flank|KIAA1958_ENST00000374244.3_5'Flank	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958											endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						CAGGAGGCTCGATCTACACCT	0.667																																																	0								ENSG00000230185																																			C9orf147	SO:0001631	upstream_gene_variant	0			-	HGNC	AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508		9.37:g.115248931G>A	Exception_encountered	Somatic	0	44	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	15	34.78	B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000337530.6	37	NULL	CCDS35108.1	9																																																																																			-	-		0.667	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	C9orf147	protein_coding	OTTHUMT00000053690.1	G	NM_133465	-		115248931	-1	no_errors	ENST00000463223	ensembl	human	known	74_37	rna	SNP	0.000	A
ADORA3	140	genome.wustl.edu	37	1	112045735	112045735	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr1:112045735T>C	ENST00000241356.4	-	1	647	c.242A>G	c.(241-243)tAc>tGc	p.Y81C	ADORA3_ENST00000369717.4_Intron|ADORA3_ENST00000486342.1_5'Flank|ADORA3_ENST00000369716.4_Missense_Mutation_p.Y81C	NM_000677.3	NP_000668.1	P33765	AA3R_HUMAN	adenosine A3 receptor	81					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	AAGGCAGCTGTAGAAGTGGAT	0.507																																																	0								ENSG00000121933						91.0	68.0	76.0					1																	112045735		2203	4300	6503	ADORA3	SO:0001583	missense	0			-	HGNC	BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000241356.4:c.242A>G	1.37:g.112045735T>C	ENSP00000241356:p.Tyr81Cys	Somatic	0	74	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	24	17.24	A2A3P4|Q6UWU0|Q9BYZ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Adeno_A3_rcpt,prints_GPCR_Rhodpsn	p.Y81C	ENST00000241356.4	37	c.242	CCDS839.1	1	.	.	.	.	.	.	.	.	.	.	T	17.34	3.366164	0.61513	.	.	ENSG00000121933	ENST00000369716;ENST00000241356	T;T	0.72051	-0.62;-0.62	5.26	5.26	0.73747	GPCR, rhodopsin-like superfamily (1);	0.177903	0.27486	N	0.019143	T	0.79003	0.4373	M	0.72576	2.205	0.38190	D	0.939874	D;D	0.89917	1.0;0.994	D;D	0.73380	0.943;0.98	T	0.81775	-0.0778	10	0.56958	D	0.05	-13.4802	15.1188	0.72426	0.0:0.0:0.0:1.0	.	81;81	P33765;P33765-2	AA3R_HUMAN;.	C	81	ENSP00000358730:Y81C;ENSP00000241356:Y81C	ENSP00000241356:Y81C	Y	-	2	0	ADORA3	111847258	1.000000	0.71417	0.389000	0.26208	0.916000	0.54674	5.936000	0.70153	2.112000	0.64535	0.459000	0.35465	TAC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.507	ADORA3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA3	protein_coding	OTTHUMT00000033065.1	T	NM_000677, NM_020683	-		112045735	-1	no_errors	ENST00000369716	ensembl	human	known	74_37	missense	SNP	0.992	C
MCM5	4174	genome.wustl.edu	37	22	35804413	35804413	+	Silent	SNP	G	G	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr22:35804413G>A	ENST00000216122.4	+	6	763	c.609G>A	c.(607-609)ggG>ggA	p.G203G	MCM5_ENST00000382011.5_Silent_p.G160G	NM_006739.3	NP_006730.2	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	203					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29						ATCAGGCTGGGCGCCCCAAAT	0.552																																																	0								ENSG00000100297						72.0	64.0	67.0					22																	35804413		2203	4300	6503	MCM5	SO:0001819	synonymous_variant	0			-	HGNC		CCDS13915.1	22q13.1-q13.2	2007-04-04	2007-04-04		ENSG00000100297	ENSG00000100297			6948	protein-coding gene	gene with protein product		602696	"""minichromosome maintenance deficient (S. cerevisiae) 5 (cell division cycle 46)"", ""MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)"""	CDC46		8751386, 10591208	Standard	NM_006739		Approved		uc003anu.4	P33992	OTTHUMG00000150961	ENST00000216122.4:c.609G>A	22.37:g.35804413G>A		Somatic	0	109	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	62	32.61	O60785|Q14578|Q9BTJ4|Q9BWL8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MCM_DNA-dep_ATPase,superfamily_NA-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM5,prints_MCM_DNA-dep_ATPase	p.G203	ENST00000216122.4	37	c.609	CCDS13915.1	22																																																																																			-	superfamily_NA-bd_OB-fold,smart_MCM_DNA-dep_ATPase		0.552	MCM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM5	protein_coding	OTTHUMT00000320661.3	G		-		35804413	+1	no_errors	ENST00000216122	ensembl	human	known	74_37	silent	SNP	0.971	A
MUC5B	727897	genome.wustl.edu	37	11	1271465	1271465	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr11:1271465A>G	ENST00000529681.1	+	31	13413	c.13355A>G	c.(13354-13356)gAg>gGg	p.E4452G	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.E4455G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4452	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ATCCTCACAGAGCCGAGCACT	0.662																																																	0								ENSG00000117983						63.0	76.0	71.0					11																	1271465		2012	4150	6162	MUC5B	SO:0001583	missense	0			-	HGNC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.13355A>G	11.37:g.1271465A>G	ENSP00000436812:p.Glu4452Gly	Somatic	0	123	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	34	42.62	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.E4455G	ENST00000529681.1	37	c.13364	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	-	3.990	-0.004745	0.07773	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844;ENST00000535652	T;T	0.17528	2.27;2.47	1.28	-2.56	0.06268	.	.	.	.	.	T	0.13756	0.0333	L	0.55990	1.75	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.01281	0.0;0.0	T	0.24941	-1.0146	9	0.87932	D	0	.	3.0357	0.06121	0.3977:0.0:0.3667:0.2356	.	4925;4455	A7Y9J9;E9PBJ0	.;.	G	4452;4455;4396;4302;231	ENSP00000436812:E4452G;ENSP00000415793:E4455G	ENSP00000343037:E4396G	E	+	2	0	MUC5B	1228041	.	.	0.000000	0.03702	0.390000	0.30446	.	.	-2.220000	0.00728	0.240000	0.17902	GAG	-	NULL		0.662	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	protein_coding	OTTHUMT00000390041.2	A	XM_001126093	-		1271465	+1	no_errors	ENST00000447027	ensembl	human	known	74_37	missense	SNP	0.000	G
BPIFB4	149954	genome.wustl.edu	37	20	31671211	31671211	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr20:31671211G>T	ENST00000375483.3	+	3	208	c.208G>T	c.(208-210)Gga>Tga	p.G70*		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	70						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										CCATGTCCGAGGACCCCCCCC	0.488																																																	0								ENSG00000186191						88.0	86.0	87.0					20																	31671211		2203	4300	6503	BPIFB4	SO:0001587	stop_gained	0			-	HGNC	AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.208G>T	20.37:g.31671211G>T	ENSP00000364632:p.Gly70*	Somatic	0	46	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	29	23.68	Q5TDX6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.G70*	ENST00000375483.3	37	c.208	CCDS13213.2	20	.	.	.	.	.	.	.	.	.	.	g	9.989	1.230201	0.22542	.	.	ENSG00000186191	ENST00000375483	.	.	.	2.89	2.89	0.33648	.	0.236202	0.21187	U	0.078701	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-0.0016	9.3529	0.38149	0.0:0.0:1.0:0.0	.	.	.	.	X	70	.	ENSP00000364632:G70X	G	+	1	0	BPIFB4	31134872	0.985000	0.35326	0.350000	0.25708	0.012000	0.07955	2.537000	0.45702	1.607000	0.50170	0.306000	0.20318	GGA	-	NULL		0.488	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB4	protein_coding	OTTHUMT00000078655.5	G	NM_182519	-		31671211	+1	no_errors	ENST00000375483	ensembl	human	known	74_37	nonsense	SNP	0.470	T
OR51B6	390058	genome.wustl.edu	37	11	5372976	5372976	+	Missense_Mutation	SNP	T	T	A	rs201384979		TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr11:5372976T>A	ENST00000380219.1	+	1	239	c.239T>A	c.(238-240)cTa>cAa	p.L80Q	HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA	NM_001004750.1	NP_001004750.1	Q9H340	O51B6_HUMAN	olfactory receptor, family 51, subfamily B, member 6	80					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	21		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCCACAGTGCTAGGTGTTCTG	0.473																																																	0								ENSG00000176239						132.0	122.0	126.0					11																	5372976		2201	4297	6498	OR51B6	SO:0001583	missense	0			-	HGNC		CCDS31379.1	11p15.4	2012-08-09			ENSG00000176239	ENSG00000176239		"""GPCR / Class A : Olfactory receptors"""	19600	protein-coding gene	gene with protein product							Standard	NM_001004750		Approved		uc010qzb.2	Q9H340	OTTHUMG00000066669	ENST00000380219.1:c.239T>A	11.37:g.5372976T>A	ENSP00000369568:p.Leu80Gln	Somatic	0	88	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	23	53.06		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	p.L80Q	ENST00000380219.1	37	c.239	CCDS31379.1	11	.	.	.	.	.	.	.	.	.	.	T	13.26	2.183394	0.38511	.	.	ENSG00000176239	ENST00000537299;ENST00000380219	T	0.00514	6.88	5.15	4.0	0.46444	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41500	D	0.000878	T	0.03651	0.0104	H	0.99357	4.53	0.09310	N	1	D	0.67145	0.996	D	0.67900	0.954	T	0.29088	-1.0023	10	0.87932	D	0	.	11.1788	0.48616	0.0:0.0:0.1545:0.8455	.	80	Q9H340	O51B6_HUMAN	Q	79;80	ENSP00000369568:L80Q	ENSP00000369568:L80Q	L	+	2	0	OR51B6	5329552	0.693000	0.27728	0.135000	0.22099	0.247000	0.25773	3.904000	0.56325	0.953000	0.37825	0.455000	0.32223	CTA	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.473	OR51B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51B6	protein_coding	OTTHUMT00000142960.1	T	NM_001004750	-		5372976	+1	no_errors	ENST00000380219	ensembl	human	known	74_37	missense	SNP	0.168	A
PLET1	349633	genome.wustl.edu	37	11	112118610	112118617	+	IGR	DEL	ACACACAC	ACACACAC	-	rs79699298|rs202146857|rs146953253		TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	ACACACAC	ACACACAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr11:112118610_112118617delACACACAC	ENST00000338832.2	-	0	1541				AP002884.1_ENST00000401135.1_RNA	NM_001145024.1	NP_001138496.1	Q6UQ28	PLET1_HUMAN							cell differentiation (GO:0030154)|negative regulation of cell-matrix adhesion (GO:0001953)|positive regulation of cell migration (GO:0030335)|wound healing, spreading of epidermal cells (GO:0035313)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)				endometrium(2)	2						atgtatatATacacacacacacacacac	0.351																																																	0								ENSG00000215954																																			AP002884.1	SO:0001628	intergenic_variant	0				Clone_based_ensembl_gene																													11.37:g.112118618_112118625delACACACAC		Somatic	NA	NA	NA		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6UQ24|Q6UQ25|Q6UQ27	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000338832.2	37	NULL		11																																																																																			-	-		0.351	C11orf34-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000215954	protein_coding		ACACACAC				112118617	+1	no_errors	ENST00000401135	ensembl	human	novel	74_37	rna	DEL	0.028:0.021:0.024:0.025:0.042:0.052:0.057:0.059	-
STAG1	10274	genome.wustl.edu	37	3	136152441	136152441	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr3:136152441G>T	ENST00000383202.2	-	16	1863	c.1607C>A	c.(1606-1608)gCt>gAt	p.A536D	STAG1_ENST00000536929.1_Missense_Mutation_p.A120D|STAG1_ENST00000434713.2_Missense_Mutation_p.A310D|STAG1_ENST00000236698.5_Missense_Mutation_p.A536D	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	536					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						TGCCTCAGCAGCTTGACGAAT	0.403																																																	0								ENSG00000118007						97.0	89.0	92.0					3																	136152441		2203	4300	6503	STAG1	SO:0001583	missense	0			-	HGNC	Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.1607C>A	3.37:g.136152441G>T	ENSP00000372689:p.Ala536Asp	Somatic	0	40	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	O00539|Q6P275	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_STAG,superfamily_ARM-type_fold	p.A536D	ENST00000383202.2	37	c.1607	CCDS3090.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.8|22.8	4.331674|4.331674	0.81690|0.81690	.|.	.|.	ENSG00000118007|ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713;ENST00000536929|ENST00000492318	T;T;T;T|.	0.42900|.	1.49;1.49;1.62;0.96|.	5.66|5.66	5.66|5.66	0.87406|0.87406	Armadillo-type fold (1);|.	0.050931|.	0.85682|.	D|.	0.000000|.	T|T	0.81950|0.81950	0.4931|0.4931	M|M	0.79926|0.79926	2.475|2.475	0.80722|0.80722	D|D	1|1	B;B;B|.	0.21905|.	0.062;0.003;0.062|.	B;B;B|.	0.26693|.	0.072;0.005;0.072|.	T|T	0.81673|0.81673	-0.0826|-0.0826	10|5	0.72032|.	D|.	0.01|.	.|.	19.7468|19.7468	0.96255|0.96255	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	553;536;536|.	Q4LE48;Q6P275;Q8WVM7|.	.;.;STAG1_HUMAN|.	D|M	536;536;310;120|147	ENSP00000372689:A536D;ENSP00000236698:A536D;ENSP00000404396:A310D;ENSP00000445787:A120D|.	ENSP00000236698:A536D|.	A|L	-|-	2|1	0|2	STAG1|STAG1	137635131|137635131	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	9.476000|9.476000	0.97823|0.97823	2.678000|2.678000	0.91216|0.91216	0.563000|0.563000	0.77884|0.77884	GCT|CTG	-	superfamily_ARM-type_fold		0.403	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAG1	protein_coding	OTTHUMT00000357366.1	G	NM_005862	-		136152441	-1	no_errors	ENST00000383202	ensembl	human	known	74_37	missense	SNP	1.000	T
POLD1	5424	genome.wustl.edu	37	19	50909545	50909545	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr19:50909545G>C	ENST00000440232.2	+	11	1402	c.1349G>C	c.(1348-1350)aGc>aCc	p.S450T	POLD1_ENST00000599857.1_Missense_Mutation_p.S450T|POLD1_ENST00000595904.1_Missense_Mutation_p.S450T	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	450					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		AAGGTTGTCAGCATGGTGGGC	0.647								DNA polymerases (catalytic subunits)																																									0								ENSG00000062822						57.0	58.0	57.0					19																	50909545		2203	4300	6503	POLD1	SO:0001583	missense	0			-	HGNC		CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.1349G>C	19.37:g.50909545G>C	ENSP00000406046:p.Ser450Thr	Somatic	0	123	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	71	16.47	Q8NER3|Q96H98	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2	p.S450T	ENST00000440232.2	37	c.1349	CCDS12795.1	19	.	.	.	.	.	.	.	.	.	.	G	13.34	2.207979	0.39003	.	.	ENSG00000062822	ENST00000440232;ENST00000376930	T	0.09350	2.99	4.44	4.44	0.53790	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.051041	0.85682	D	0.000000	T	0.03608	0.0103	N	0.01464	-0.85	0.38402	D	0.945682	B;B	0.12013	0.005;0.002	B;B	0.17098	0.017;0.01	T	0.40683	-0.9550	10	0.31617	T	0.26	-50.4231	6.8783	0.24158	0.192:0.0:0.808:0.0	.	450;450	E7EVW0;P28340	.;DPOD1_HUMAN	T	450;451	ENSP00000406046:S450T	ENSP00000366129:S451T	S	+	2	0	POLD1	55601357	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.211000	0.58507	2.482000	0.83794	0.655000	0.94253	AGC	-	pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B		0.647	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	POLD1	protein_coding	OTTHUMT00000464732.1	G		-		50909545	+1	no_errors	ENST00000440232	ensembl	human	known	74_37	missense	SNP	1.000	C
ATXN3L	92552	genome.wustl.edu	37	X	13337747	13337747	+	Missense_Mutation	SNP	C	C	T	rs199861470		TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chrX:13337747C>T	ENST00000380622.2	-	1	771	c.307G>A	c.(307-309)Ggc>Agc	p.G103S	GS1-600G8.3_ENST00000431486.1_RNA	NM_001135995.1	NP_001129467.1	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	103	Josephin. {ECO:0000255|PROSITE- ProRule:PRU00331}.				protein deubiquitination (GO:0016579)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						GGATCAATGCCGAGCTTCTGA	0.333																																																	0								ENSG00000123594	C	SER/GLY	0,2627		0,0,1059,509	75.0	61.0	65.0		307	-1.9	0.0	X		65	1,5497		0,1,1915,1666	yes	missense	ATXN3L	NM_001135995.1	56	0,1,2974,2175	TT,TC,CC,C		0.0182,0.0,0.0123	benign	103/356	13337747	1,8124	1568	3582	5150	ATXN3L	SO:0001583	missense	0			-	HGNC		CCDS48080.1	Xp22	2010-09-30			ENSG00000123594	ENSG00000123594			24173	protein-coding gene	gene with protein product		300920					Standard	NM_001135995		Approved	MJDL	uc010ned.3	Q9H3M9	OTTHUMG00000021146	ENST00000380622.2:c.307G>A	X.37:g.13337747C>T	ENSP00000369996:p.Gly103Ser	Somatic	0	22	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	B2RNY8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Josephin,pfam_Ubiquitin-int_motif,smart_Ubiquitin-int_motif,prints_Josephin,pfscan_Josephin,pfscan_Ubiquitin-int_motif	p.G103S	ENST00000380622.2	37	c.307	CCDS48080.1	X	.	.	.	.	.	.	.	.	.	.	C	5.287	0.238346	0.10023	0.0	1.82E-4	ENSG00000123594	ENST00000380622	T	0.38401	1.14	0.943	-1.89	0.07689	.	0.302450	0.44097	D	0.000492	T	0.16557	0.0398	N	0.12182	0.205	0.09310	N	1	B	0.17667	0.023	B	0.20184	0.028	T	0.07404	-1.0774	10	0.40728	T	0.16	.	6.3813	0.21536	0.0:0.489:0.0:0.511	.	103	Q9H3M9	ATX3L_HUMAN	S	103	ENSP00000369996:G103S	ENSP00000369996:G103S	G	-	1	0	ATXN3L	13247668	0.995000	0.38212	0.004000	0.12327	0.016000	0.09150	0.609000	0.24238	-1.396000	0.02071	-1.339000	0.01253	GGC	-	pfam_Josephin,pfscan_Josephin		0.333	ATXN3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN3L	protein_coding	OTTHUMT00000055785.2	C	NM_001135995	rs199861470		13337747	-1	no_errors	ENST00000380622	ensembl	human	known	74_37	missense	SNP	0.029	T
SLFN5	162394	genome.wustl.edu	37	17	33592430	33592430	+	Silent	SNP	T	T	G			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr17:33592430T>G	ENST00000299977.4	+	5	2347	c.2199T>G	c.(2197-2199)ccT>ccG	p.P733P	SLFN5_ENST00000542451.1_3'UTR	NM_144975.3	NP_659412.3	Q08AF3	SLFN5_HUMAN	schlafen family member 5	733					cell differentiation (GO:0030154)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(8)|liver(2)|lung(6)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	34		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		GACAAAATCCTCCACCTAACC	0.483																																																	0								ENSG00000166750						91.0	95.0	94.0					17																	33592430		2203	4300	6503	SLFN5	SO:0001819	synonymous_variant	0			-	HGNC	BX647942	CCDS32619.1	17q12	2006-04-05				ENSG00000166750			28286	protein-coding gene	gene with protein product		614952				9846487	Standard	NM_144975		Approved	MGC19764	uc002hjf.4	Q08AF3		ENST00000299977.4:c.2199T>G	17.37:g.33592430T>G		Somatic	0	80	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	32	17.95	Q08AF2|Q8WU54|Q96A82	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA-4,pfam_DUF2075,superfamily_P-loop_NTPase	p.P733	ENST00000299977.4	37	c.2199	CCDS32619.1	17																																																																																			-	superfamily_P-loop_NTPase		0.483	SLFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN5	protein_coding	OTTHUMT00000448649.2	T	NM_144975	-		33592430	+1	no_errors	ENST00000299977	ensembl	human	known	74_37	silent	SNP	0.037	G
KCNK4	50801	genome.wustl.edu	37	11	64064689	64064689	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr11:64064689G>T	ENST00000539216.1	+	3	772	c.412G>T	c.(412-414)Gtc>Ttc	p.V138F	KCNK4_ENST00000539651.1_3'UTR|RP11-783K16.10_ENST00000539086.1_RNA|KCNK4_ENST00000422670.2_Missense_Mutation_p.V138F|KCNK4_ENST00000394525.2_Missense_Mutation_p.V138F|Y_RNA_ENST00000384297.1_RNA|KCNK4_ENST00000538767.1_Silent_p.G71G			Q9NYG8	KCNK4_HUMAN	potassium channel, subfamily K, member 4	138					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(2)|large_intestine(2)|lung(3)|prostate(2)|urinary_tract(1)	10						ACTGGCAGGGGTCGGGGACCG	0.627																																																	0								ENSG00000182450						48.0	51.0	50.0					11																	64064689		2201	4297	6498	KCNK4	SO:0001583	missense	0			-	HGNC	AF247042	CCDS8067.1	11q13	2012-03-07			ENSG00000182450	ENSG00000182450		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6279	protein-coding gene	gene with protein product		605720				10767409, 16382106	Standard	NM_033310		Approved	K2p4.1, TRAAK	uc001nzk.1	Q9NYG8	OTTHUMG00000168006	ENST00000539216.1:c.412G>T	11.37:g.64064689G>T	ENSP00000444948:p.Val138Phe	Somatic	0	55	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	19	36.67	B5TJL1|Q96T94	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TASK	p.V138F	ENST00000539216.1	37	c.412	CCDS8067.1	11	.	.	.	.	.	.	.	.	.	.	G	25.3	4.625988	0.87560	.	.	ENSG00000182450	ENST00000422670;ENST00000539852;ENST00000394525;ENST00000544845;ENST00000539216	T;T;T	0.25749	1.78;1.78;1.78	5.36	4.44	0.53790	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	T	0.42607	0.1210	L	0.52126	1.63	0.53005	D	0.999964	D	0.63046	0.992	D	0.70487	0.969	T	0.28364	-1.0046	10	0.87932	D	0	.	12.1902	0.54266	0.0853:0.0:0.9147:0.0	.	138	Q9NYG8	KCNK4_HUMAN	F	138;163;138;200;138	ENSP00000402797:V138F;ENSP00000378033:V138F;ENSP00000444948:V138F	ENSP00000378033:V138F	V	+	1	0	KCNK4	63821265	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	6.103000	0.71492	2.521000	0.84997	0.555000	0.69702	GTC	-	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl_TASK		0.627	KCNK4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCNK4	protein_coding	OTTHUMT00000396430.1	G	NM_033311	-		64064689	+1	no_errors	ENST00000394525	ensembl	human	known	74_37	missense	SNP	1.000	T
FAM47A	158724	genome.wustl.edu	37	X	34149685	34149685	+	Silent	SNP	C	C	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chrX:34149685C>T	ENST00000346193.3	-	1	762	c.711G>A	c.(709-711)ccG>ccA	p.P237P		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	237	Pro-rich.							p.L235_H246delLRPEPPETGVSH(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						CTGGAGGCTCCGGGCGGAGAT	0.627													C|||	3	0.000794702	0.0	0.0029	3775	,	,		10659	0.0		0.001	False		,,,				2504	0.0																1	Deletion - In frame(1)	ovary(1)						ENSG00000185448						31.0	32.0	32.0					X																	34149685		2199	4295	6494	FAM47A	SO:0001819	synonymous_variant	0			-	HGNC	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.711G>A	X.37:g.34149685C>T		Somatic	0	97	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	93	83	52.84	A8K8I9|Q8TAA0	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P237	ENST00000346193.3	37	c.711	CCDS43926.1	X																																																																																			-	NULL		0.627	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47A	protein_coding	OTTHUMT00000056205.1	C	NM_203408	-		34149685	-1	no_errors	ENST00000346193	ensembl	human	known	74_37	silent	SNP	0.109	T
B3GNT7	93010	genome.wustl.edu	37	2	232262748	232262748	+	Silent	SNP	G	G	A	rs377346766		TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr2:232262748G>A	ENST00000287590.5	+	2	579	c.318G>A	c.(316-318)ccG>ccA	p.P106P	B3GNT7_ENST00000479618.1_3'UTR	NM_145236.2	NP_660279.1	Q8NFL0	B3GN7_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7	106					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)			endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)	17		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)|Medulloblastoma(418;0.232)		Epithelial(121;3.22e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		TCCTGGAGCCGCAGTTCCGGC	0.617																																																	0								ENSG00000156966						41.0	47.0	45.0					2																	232262748		2014	4162	6176	B3GNT7	SO:0001819	synonymous_variant	0			-	HGNC	AK000770	CCDS46540.1	2q36.1	2013-02-21			ENSG00000156966	ENSG00000156966		"""Beta 3-glycosyltransferases"""	18811	protein-coding gene	gene with protein product		615313				12061784	Standard	NM_145236		Approved	beta3GnT7	uc002vrs.3	Q8NFL0	OTTHUMG00000153880	ENST00000287590.5:c.318G>A	2.37:g.232262748G>A		Somatic	0	53	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	B3KWY4|B7WNP0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_31,pfam_Fringe-like	p.P106	ENST00000287590.5	37	c.318	CCDS46540.1	2																																																																																			-	NULL		0.617	B3GNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT7	protein_coding	OTTHUMT00000332827.1	G	NM_145236	-		232262748	+1	no_errors	ENST00000287590	ensembl	human	known	74_37	silent	SNP	0.405	A
CTCFL	140690	genome.wustl.edu	37	20	56073701	56073701	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr20:56073701A>T	ENST00000608263.1	-	10	2558	c.1897T>A	c.(1897-1899)Ttt>Att	p.F633I	CTCFL_ENST00000371196.2_Missense_Mutation_p.F633I|CTCFL_ENST00000423479.3_Missense_Mutation_p.F633I|CTCFL_ENST00000609232.1_Missense_Mutation_p.F633I|CTCFL_ENST00000243914.3_Missense_Mutation_p.F633I|CTCFL_ENST00000429804.3_Missense_Mutation_p.F583I	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	633					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			GCGACAGGAAACATCTCTCCT	0.498																																																	0								ENSG00000124092						142.0	125.0	131.0					20																	56073701		2203	4300	6503	CTCFL	SO:0001583	missense	0			-	HGNC		CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.1897T>A	20.37:g.56073701A>T	ENSP00000476783:p.Phe633Ile	Somatic	0	59	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	36	29.41	A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F633I	ENST00000608263.1	37	c.1897	CCDS13459.1	20	.	.	.	.	.	.	.	.	.	.	A	10.32	1.317540	0.23908	.	.	ENSG00000124092	ENST00000423479;ENST00000243914;ENST00000371196;ENST00000429804	T;T;T;T	0.09073	3.02;3.06;3.06;3.23	4.38	0.019	0.14119	.	2.059020	0.02751	N	0.117459	T	0.04543	0.0124	N	0.08118	0	0.09310	N	0.999999	B;B;B;B	0.10296	0.0;0.003;0.0;0.0	B;B;B;B	0.06405	0.0;0.002;0.0;0.0	T	0.36065	-0.9763	10	0.29301	T	0.29	1.009	3.261	0.06849	0.1641:0.4099:0.3295:0.0965	.	583;633;633;633	E7EUE3;A1L4C6;A6XGL8;Q8NI51	.;.;.;CTCFL_HUMAN	I	633;633;633;583	ENSP00000415579:F633I;ENSP00000243914:F633I;ENSP00000360239:F633I;ENSP00000415329:F583I	ENSP00000243914:F633I	F	-	1	0	CTCFL	55507107	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.472000	0.06623	-0.251000	0.09542	-1.509000	0.00949	TTT	-	NULL		0.498	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	CTCFL	protein_coding	OTTHUMT00000472040.1	A	NM_080618	-		56073701	-1	no_errors	ENST00000423479	ensembl	human	known	74_37	missense	SNP	0.001	T
TAOK3	51347	genome.wustl.edu	37	12	118604652	118604653	+	Intron	INS	-	-	ACAC	rs376430378|rs373259313|rs200569755|rs7487392		TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr12:118604652_118604653insACAC	ENST00000392533.3	-	18	2390				TAOK3_ENST00000537952.1_Intron|TAOK3_ENST00000419821.2_Intron|AC026366.1_ENST00000408353.1_RNA	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					cacacacacatacacacacaca	0.421																																																	0								ENSG00000221280																																			AC026366.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.1900-4820->GTGT	12.37:g.118604657_118604660dupACAC		Somatic	0	13	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	9	18.18	Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392533.3	37	NULL	CCDS9188.1	12																																																																																			-	-		0.421	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221280	protein_coding	OTTHUMT00000401456.2	-	NM_016281			118604653	+1	no_errors	ENST00000408353	ensembl	human	novel	74_37	rna	INS	0.002:0.000	ACAC
CAPZA1	829	genome.wustl.edu	37	1	113202197	113202202	+	Intron	DEL	TCTCTC	TCTCTC	-	rs149635516|rs113906793	byFrequency	TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	TCTCTC	TCTCTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr1:113202197_113202202delTCTCTC	ENST00000263168.3	+	7	1178				CAPZA1_ENST00000476936.1_Intron	NM_006135.2	NP_006126.1	P52907	CAZA1_HUMAN	capping protein (actin filament) muscle Z-line, alpha 1						actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|WASH complex (GO:0071203)	actin binding (GO:0003779)			breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AATGACAGTTTCTCTCTCTCTCTTTT	0.393																																																	0								ENSG00000116489																																			CAPZA1	SO:0001627	intron_variant	0				HGNC	U56637	CCDS30805.1	1p13.2	2014-05-09			ENSG00000116489	ENSG00000116489			1488	protein-coding gene	gene with protein product		601580				7665558, 9119363	Standard	NM_006135		Approved		uc001ecj.1	P52907	OTTHUMG00000011769	ENST00000263168.3:c.507-121TCTCTC>-	1.37:g.113202203_113202208delTCTCTC		Somatic	NA	NA	NA		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q53FQ6|Q6FHD5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000263168.3	37	NULL	CCDS30805.1	1																																																																																			-	-		0.393	CAPZA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPZA1	protein_coding	OTTHUMT00000032567.2	TCTCTC	NM_006135			113202202	+1	no_errors	ENST00000466066	ensembl	human	known	74_37	rna	DEL	0.000:0.008:0.000:0.000:0.000:0.000	-
FADS2	9415	genome.wustl.edu	37	11	61615735	61615735	+	Silent	SNP	G	G	C			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr11:61615735G>C	ENST00000278840.4	+	5	1353	c.723G>C	c.(721-723)ctG>ctC	p.L241L	FADS2_ENST00000257261.6_Silent_p.L219L|FADS2_ENST00000522056.1_Silent_p.L210L|FADS2_ENST00000521849.1_Silent_p.L241L	NM_004265.2	NP_004256.1	O95864	FADS2_HUMAN	fatty acid desaturase 2	241					alpha-linolenic acid metabolic process (GO:0036109)|linoleic acid metabolic process (GO:0043651)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)			breast(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20					Alpha-Linolenic Acid(DB00132)	TGTTTGTTCTGGGCGAATGGC	0.537																																																	0								ENSG00000134824						216.0	169.0	185.0					11																	61615735		2202	4299	6501	FADS2	SO:0001819	synonymous_variant	0			-	HGNC	AF084559	CCDS8012.1, CCDS60807.1, CCDS60808.1	11q12.2	2013-01-25			ENSG00000134824	ENSG00000134824	1.14.19.3	"""Fatty acid desaturases"""	3575	protein-coding gene	gene with protein product	"""delta-6-desaturase"""	606149		LLCDL2			Standard	NM_004265		Approved	FADSD6, D6D, TU13, DES6, SLL0262	uc001nsl.1	O95864	OTTHUMG00000163794	ENST00000278840.4:c.723G>C	11.37:g.61615735G>C		Somatic	0	111	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	31	32.61	A8K2M6|B7Z634|Q6MZQ7|Q96H07|Q96SV8|Q9H3G3|Q9Y3X4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fatty_acid_desaturase-1,pfam_Cyt_B5-like_heme/steroid-bd,superfamily_Cyt_B5-like_heme/steroid-bd,pirsf_Fatty_acid/sphinglp_desaturase,pfscan_Cyt_B5-like_heme/steroid-bd	p.L241	ENST00000278840.4	37	c.723	CCDS8012.1	11																																																																																			-	pfam_Fatty_acid_desaturase-1,pirsf_Fatty_acid/sphinglp_desaturase		0.537	FADS2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FADS2	protein_coding	OTTHUMT00000375586.2	G	NM_004265	-		61615735	+1	no_errors	ENST00000278840	ensembl	human	known	74_37	silent	SNP	0.997	C
BAZ2A	11176	genome.wustl.edu	37	12	57011222	57011222	+	Silent	SNP	G	G	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr12:57011222G>A	ENST00000551812.1	-	2	292	c.99C>T	c.(97-99)ctC>ctT	p.L33L	BAZ2A_ENST00000379441.3_Silent_p.L33L|BAZ2A_ENST00000179765.5_Silent_p.L31L|BAZ2A_ENST00000549884.1_Silent_p.L31L	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	33					chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						CGTTAGTGTAGAGGCCCTCCC	0.567																																																	0								ENSG00000076108						37.0	40.0	39.0					12																	57011222		1953	4140	6093	BAZ2A	SO:0001819	synonymous_variant	0			-	HGNC	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.99C>T	12.37:g.57011222G>A		Somatic	0	71	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	21	40.00	B3KN66|O00536|O15030|Q68DI8|Q96H26	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_dom,superfamily_Znf_FYVE_PHD,smart_Methyl_CpG_DNA-bd,smart_AT_hook_DNA-bd_motif,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.L33	ENST00000551812.1	37	c.99	CCDS44924.1	12																																																																																			-	NULL		0.567	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAZ2A	protein_coding	OTTHUMT00000408561.1	G	NM_013449	-		57011222	-1	no_errors	ENST00000551812	ensembl	human	known	74_37	silent	SNP	1.000	A
KDM6B	23135	genome.wustl.edu	37	17	7752697	7752697	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr17:7752697C>T	ENST00000448097.2	+	11	3422	c.3091C>T	c.(3091-3093)Cgt>Tgt	p.R1031C	KDM6B_ENST00000254846.5_Missense_Mutation_p.R1031C			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1031					cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						GATCCAGGGTCGTGAGAAGTC	0.672																																																	0								ENSG00000132510						14.0	12.0	13.0					17																	7752697		2183	4276	6459	KDM6B	SO:0001583	missense	0			-	HGNC	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.3091C>T	17.37:g.7752697C>T	ENSP00000412513:p.Arg1031Cys	Somatic	0	59	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	41	45.33	C9IZ40|Q96G33	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.R1031C	ENST00000448097.2	37	c.3091		17	.	.	.	.	.	.	.	.	.	.	C	4.156	0.027342	0.08054	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	T;T	0.39229	1.09;1.1	3.67	3.67	0.42095	.	.	.	.	.	T	0.41328	0.1154	N	0.19112	0.55	0.46241	D	0.998943	D;D	0.89917	0.991;1.0	P;P	0.59487	0.586;0.858	T	0.37009	-0.9724	9	0.87932	D	0	-5.5574	8.6805	0.34205	0.0:0.8906:0.0:0.1094	.	1031;1031	O15054;O15054-1	KDM6B_HUMAN;.	C	1031	ENSP00000254846:R1031C;ENSP00000412513:R1031C	ENSP00000254846:R1031C	R	+	1	0	KDM6B	7693422	0.829000	0.29322	0.956000	0.39512	0.153000	0.21895	1.648000	0.37271	2.074000	0.62210	0.462000	0.41574	CGT	-	NULL		0.672	KDM6B-002	KNOWN	basic	protein_coding	KDM6B	protein_coding	OTTHUMT00000440248.1	C	XM_043272	-		7752697	+1	no_errors	ENST00000254846	ensembl	human	known	74_37	missense	SNP	0.933	T
KIF28P	100130097	genome.wustl.edu	37	1	246954133	246954133	+	RNA	SNP	C	C	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr1:246954133C>T	ENST00000451123.1	-	0	0				RP11-439E19.3_ENST00000421003.1_RNA|RP11-439E19.3_ENST00000505748.1_RNA|RP11-439E19.3_ENST00000419361.1_RNA																							CAGCAAACGGCGGTTTCCGTG	0.537																																																	0								ENSG00000227953																																			RP11-439E19.3			0			-	Clone_based_vega_gene																													1.37:g.246954133C>T		Somatic	0	83	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	4	76.47		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000451123.1	37	NULL		1																																																																																			-	-		0.537	RP11-439E19.8-002	KNOWN	basic|exp_conf	processed_transcript	LOC149134	pseudogene	OTTHUMT00000331247.2	C		-		246954133	+1	no_errors	ENST00000419361	ensembl	human	known	74_37	rna	SNP	0.000	T
DCT	1638	genome.wustl.edu	37	13	95121205	95121205	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr13:95121205G>C	ENST00000377028.5	-	2	803	c.390C>G	c.(388-390)atC>atG	p.I130M	DCT_ENST00000490854.1_5'Flank|DCT_ENST00000446125.1_Missense_Mutation_p.I130M	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	130					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		TCAAGGAATGGATGTTCTGCC	0.522																																																	0								ENSG00000080166						203.0	205.0	204.0					13																	95121205		2203	4300	6503	DCT	SO:0001583	missense	0			-	HGNC	D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.390C>G	13.37:g.95121205G>C	ENSP00000366227:p.Ile130Met	Somatic	0	63	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	46	26.98	Q09GT4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.I130M	ENST00000377028.5	37	c.390	CCDS9470.1	13	.	.	.	.	.	.	.	.	.	.	G	17.26	3.345518	0.61073	.	.	ENSG00000080166	ENST00000377028;ENST00000446125	D;D	0.99070	-5.39;-5.39	5.79	2.11	0.27256	Uncharacterised domain, di-copper centre (2);	0.044846	0.85682	D	0.000000	D	0.99214	0.9727	H	0.95043	3.615	0.58432	D	0.999997	D;P	0.60160	0.987;0.951	P;P	0.60473	0.875;0.549	D	0.99110	1.0846	9	.	.	.	-19.876	7.3381	0.26621	0.1925:0.0:0.6889:0.1186	.	130;130	Q09GT4;P40126	.;TYRP2_HUMAN	M	130	ENSP00000366227:I130M;ENSP00000392762:I130M	.	I	-	3	3	DCT	93919206	1.000000	0.71417	0.942000	0.38095	0.850000	0.48378	3.268000	0.51585	0.366000	0.24427	0.655000	0.94253	ATC	-	superfamily_Unchr_di-copper_centre		0.522	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCT	protein_coding	OTTHUMT00000045461.3	G		-		95121205	-1	no_errors	ENST00000446125	ensembl	human	known	74_37	missense	SNP	1.000	C
SLC1A3	6507	genome.wustl.edu	37	5	36680650	36680651	+	Frame_Shift_Ins	INS	-	-	AACAACTTTG			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr5:36680650_36680651insAACAACTTTG	ENST00000265113.4	+	8	1724_1725	c.1248_1249insAACAACTTTG	c.(1249-1251)aacfs	p.-420fs	CTD-2353F22.1_ENST00000510740.1_RNA|SLC1A3_ENST00000381918.3_Frame_Shift_Ins_p.-420fs	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3						auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TTGCTCAAGTTAACAACTTTGA	0.46																																																	0								ENSG00000079215																																			SLC1A3	SO:0001589	frameshift_variant	0				HGNC		CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.1249_1258dupAACAACTTTG	5.37:g.36680651_36680660dupAACAACTTTG	ENSP00000265113:p.Glu420fs	Somatic	NA	NA	NA		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2R5T3|Q4JCQ8	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.E420fs	ENST00000265113.4	37	c.1248_1249	CCDS3919.1	5																																																																																			-	pfam_Na-dicarboxylate_symporter		0.460	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC1A3	protein_coding	OTTHUMT00000207579.2	-	NM_004172			36680651	+1	no_errors	ENST00000265113	ensembl	human	known	74_37	frame_shift_ins	INS	0.746:1.000	AACAACTTTG
DPF3	8110	genome.wustl.edu	37	14	73190401	73190401	+	Silent	SNP	C	C	G			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr14:73190401C>G	ENST00000556509.1	-	5	464	c.465G>C	c.(463-465)ggG>ggC	p.G155G	DPF3_ENST00000541685.1_Silent_p.G155G|DPF3_ENST00000546183.1_Silent_p.G165G|DPF3_ENST00000557704.1_5'UTR	NM_001280542.1	NP_001267471.1	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3	155					chromatin modification (GO:0016568)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)	22				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		CTTCTTCATTCCCTTCTTCTA	0.403																																																	0								ENSG00000205683						228.0	225.0	226.0					14																	73190401		1852	4102	5954	DPF3	SO:0001819	synonymous_variant	0			-	HGNC	U43919	CCDS45133.1, CCDS61495.1, CCDS61496.1, CCDS61497.1	14q24.2	2014-05-13			ENSG00000205683	ENSG00000205683		"""Zinc fingers, PHD-type"""	17427	protein-coding gene	gene with protein product		601672				11845289, 8812431	Standard	NM_012074		Approved	cer-d4, Cerd4, FLJ14079, BAF45c	uc010ari.1	Q92784		ENST00000556509.1:c.465G>C	14.37:g.73190401C>G		Somatic	0	145	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	16	61.90	A8MSI3|B7Z276|F5H575|Q32UJ0|Q6P9E6|Q6ZT41|Q9H7Y5	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G210	ENST00000556509.1	37	c.630		14																																																																																			-	NULL		0.403	DPF3-004	NOVEL	basic|appris_principal|exp_conf	protein_coding	DPF3	protein_coding	OTTHUMT00000413152.2	C		-		73190401	-1	no_errors	ENST00000366353	ensembl	human	known	74_37	silent	SNP	0.989	G
FKBP7	51661	genome.wustl.edu	37	2	179330469	179330469	+	3'UTR	DEL	A	A	-	rs75348694|rs11336824	byFrequency	TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr2:179330469delA	ENST00000424785.2	-	0	755				FKBP7_ENST00000464248.1_5'UTR	NM_001135212.1|NM_181342.2	NP_001128684.1|NP_851939.1	Q9Y680	FKBP7_HUMAN	FK506 binding protein 7						chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			GTAAATAGCTAAAAAAAAAAA	0.318														2149	0.429113	0.5144	0.2622	5008	,	,		19034	0.6637		0.2435	False		,,,				2504	0.3814				Melanoma(26;682 927 5286 17599 46613)												0								ENSG00000079150		,	22,0,2021,2223		0,0,5,17,0,0,0,442,1132,537	23.0	31.0	29.0		,	-0.9	0.0	2	dbSNP_130	38	39,11,1862,6340		0,0,4,35,0,1,10,124,1609,2343	no	utr-3,utr-3	FKBP7	NM_181342.2,NM_001135212.1	,	0,0,9,52,0,1,10,566,2741,2880	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		23.1701,47.8903,31.5945	,	,	179330469	61,11,3883,8563	2187	4293	6480	FKBP7	SO:0001624	3_prime_UTR_variant	0				HGNC	AF092137	CCDS2280.1, CCDS46462.1	2q31.2	2013-01-10	2001-11-28		ENSG00000079150	ENSG00000079150		"""EF-hand domain containing"""	3723	protein-coding gene	gene with protein product		607062	"""FK506-binding protein 7"""			9806833	Standard	NM_181342		Approved	FKBP23	uc002umk.3	Q9Y680	OTTHUMG00000132577	ENST00000424785.2:c.*28T>-	2.37:g.179330469delA		Somatic	0	19	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	22	21.43	Q4ZG70|Q6V3B2|Q86U65|Q96DA4|Q9Y6B0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000424785.2	37	NULL	CCDS2280.1	2																																																																																			-	-		0.318	FKBP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FKBP7	protein_coding	OTTHUMT00000255783.1	A	NM_181342			179330469	-1	no_errors	ENST00000464248	ensembl	human	known	74_37	rna	DEL	0.000	-
EFCAB5	374786	genome.wustl.edu	37	17	28386420	28386420	+	Intron	SNP	C	C	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr17:28386420C>A	ENST00000394835.3	+	14	2772				AC104984.4_ENST00000583250.1_RNA|EFCAB5_ENST00000536908.2_Intron|EFCAB5_ENST00000320856.5_Intron|EFCAB5_ENST00000378738.3_Intron|EFCAB5_ENST00000541045.1_Intron|EFCAB5_ENST00000394832.2_Intron|RNY4P13_ENST00000384284.1_RNA	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5								calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						TGAATCACTGCATTTTCCCTT	0.468																																																	0								ENSG00000265289																																			AC104984.4	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.2581-143C>A	17.37:g.28386420C>A		Somatic	0	19	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	2	75.00	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000394835.3	37	NULL	CCDS11254.2	17																																																																																			-	-		0.468	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000265289	protein_coding	OTTHUMT00000256120.4	C	NM_198529	-		28386420	-1	no_errors	ENST00000583250	ensembl	human	known	74_37	rna	SNP	0.050	A
PHKA1	5255	genome.wustl.edu	37	X	71819704	71819704	+	Intron	SNP	G	G	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chrX:71819704G>T	ENST00000373542.4	-	28	3232				PHKA1_ENST00000541944.1_Intron|PHKA1_ENST00000373539.3_Missense_Mutation_p.H1029N|PHKA1_ENST00000373545.3_Missense_Mutation_p.H970N|PHKA1_ENST00000339490.3_Intron	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)						carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					CCCAGGGGATGACCACCATTG	0.343																																																	0								ENSG00000067177						17.0	15.0	16.0					X																	71819704		874	1988	2862	PHKA1	SO:0001627	intron_variant	0			-	HGNC		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.3072+2136C>A	X.37:g.71819704G>T		Somatic	0	26	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.H1029N	ENST00000373542.4	37	c.3085	CCDS14421.1	X	.	.	.	.	.	.	.	.	.	.	G	5.161	0.215195	0.09810	.	.	ENSG00000067177	ENST00000373545;ENST00000373539	D;D	0.90385	-2.66;-2.66	3.88	3.88	0.44766	.	0.783408	0.11939	N	0.514923	D	0.88160	0.6362	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.81536	-0.0888	7	0.19147	T	0.46	-0.065	10.2032	0.43097	0.0:0.0:1.0:0.0	.	.	.	.	N	970;1029	ENSP00000362646:H970N;ENSP00000362640:H1029N	ENSP00000362640:H1029N	H	-	1	0	PHKA1	71736429	0.993000	0.37304	0.983000	0.44433	0.656000	0.38851	4.076000	0.57591	1.760000	0.52011	0.513000	0.50165	CAT	-	NULL		0.343	PHKA1-001	KNOWN	basic|CCDS	protein_coding	PHKA1	protein_coding	OTTHUMT00000058896.1	G		-		71819704	-1	no_errors	ENST00000373539	ensembl	human	known	74_37	missense	SNP	0.987	T
OBSCN	84033	genome.wustl.edu	37	1	228463525	228463525	+	Silent	SNP	C	C	G			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr1:228463525C>G	ENST00000422127.1	+	21	6062	c.6018C>G	c.(6016-6018)acC>acG	p.T2006T	RP5-1139B12.3_ENST00000602529.1_RNA|OBSCN_ENST00000359599.6_Silent_p.T853T|RP5-1139B12.2_ENST00000602517.1_RNA|OBSCN_ENST00000570156.2_Silent_p.T2381T|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000366707.4_5'UTR|RP5-1139B12.3_ENST00000602947.1_RNA|OBSCN_ENST00000284548.11_Silent_p.T2006T	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2006	Ig-like 20.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCTCGGTGACCCTGGAGGTGG	0.697																																																	0								ENSG00000154358						12.0	16.0	14.0					1																	228463525		1952	4156	6108	OBSCN	SO:0001819	synonymous_variant	0			-	HGNC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.6018C>G	1.37:g.228463525C>G		Somatic	0	54	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	6	70.00	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.T2006	ENST00000422127.1	37	c.6018	CCDS58065.1	1																																																																																			-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.697	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	protein_coding		C	NM_052843	-		228463525	+1	no_errors	ENST00000422127	ensembl	human	known	74_37	silent	SNP	0.000	G
COL14A1	7373	genome.wustl.edu	37	8	121293244	121293244	+	Missense_Mutation	SNP	A	A	G	rs115441480		TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr8:121293244A>G	ENST00000297848.3	+	31	4040	c.3770A>G	c.(3769-3771)aAt>aGt	p.N1257S	COL14A1_ENST00000309791.4_Missense_Mutation_p.N1257S|COL14A1_ENST00000247781.3_Missense_Mutation_p.N1162S	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GGTACCTTCAATGTGTTTCCA	0.348																																																	0								ENSG00000187955	A	SER/ASN	0,4406		0,0,2203	95.0	99.0	98.0		3770	5.9	1.0	8	dbSNP_132	98	1,8599	1.2+/-3.3	0,1,4299	no	missense	COL14A1	NM_021110.1	46	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging	1257/1797	121293244	1,13005	2203	4300	6503	COL14A1	SO:0001583	missense	0			-	HGNC		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.3770A>G	8.37:g.121293244A>G	ENSP00000297848:p.Asn1257Ser	Somatic	0	90	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	65	13.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_A,pfam_Fibronectin_type3,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.N1257S	ENST00000297848.3	37	c.3770	CCDS34938.1	8	.	.	.	.	.	.	.	.	.	.	A	12.09	1.833255	0.32421	0.0	1.16E-4	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781	T;T;T	0.02015	4.5;4.5;4.5	5.9	5.9	0.94986	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.08626	0.0214	L	0.49699	1.58	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.50980	-0.8763	10	0.17832	T	0.49	.	16.3155	0.82918	1.0:0.0:0.0:0.0	.	1257	Q05707	COEA1_HUMAN	S	1257;1257;1162	ENSP00000311809:N1257S;ENSP00000297848:N1257S;ENSP00000247781:N1162S	ENSP00000247781:N1162S	N	+	2	0	COL14A1	121362425	1.000000	0.71417	0.996000	0.52242	0.234000	0.25298	9.309000	0.96252	2.260000	0.74910	0.528000	0.53228	AAT	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G		0.348	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL14A1	protein_coding	OTTHUMT00000313657.2	A	NM_021110	rs115441480		121293244	+1	no_errors	ENST00000297848	ensembl	human	known	74_37	missense	SNP	1.000	G
CCDC180	100499483	genome.wustl.edu	37	9	100000739	100000739	+	5'Flank	SNP	C	C	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr9:100000739C>A	ENST00000357054.1	+	0	0				CCDC180_ENST00000395220.1_5'Flank|CCDC180_ENST00000411667.2_5'Flank|CCDC180_ENST00000375205.2_5'Flank|RP11-498P14.5_ENST00000366109.2_lincRNA|CCDC180_ENST00000375202.2_5'Flank|RP11-23J9.5_ENST00000375204.2_RNA			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GCAGAAGTTTCCCCCTTGGGC	0.657																																																	0								ENSG00000203279																																			RP11-498P14.5	SO:0001631	upstream_gene_variant	0			-	Clone_based_vega_gene	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001		9.37:g.100000739C>A	Exception_encountered	Somatic	0	63	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	25	45.65	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000357054.1	37	NULL		9																																																																																			-	-		0.657	CCDC180-201	KNOWN	basic	protein_coding	ENSG00000203279	protein_coding		C	NM_020893	-		100000739	-1	no_errors	ENST00000366109	ensembl	human	known	74_37	rna	SNP	0.998	A
GPER1	2852	genome.wustl.edu	37	7	1132439	1132439	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr7:1132439G>A	ENST00000297469.3	+	2	1766	c.1075G>A	c.(1075-1077)Gtc>Atc	p.V359I	GPER1_ENST00000397092.1_Missense_Mutation_p.V359I|GPER1_ENST00000397088.3_Missense_Mutation_p.V359I|GPER1_ENST00000401670.1_Missense_Mutation_p.V359I|C7orf50_ENST00000357429.6_Intron|C7orf50_ENST00000488073.1_Intron|C7orf50_ENST00000397098.3_Intron|C7orf50_ENST00000397100.2_Intron	NM_001505.2	NP_001496.1	Q99527	GPER1_HUMAN	G protein-coupled estrogen receptor 1	359					apoptotic chromosome condensation (GO:0030263)|cell cycle (GO:0007049)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucose stimulus (GO:0071333)|cellular response to mineralocorticoid stimulus (GO:0071389)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to tumor necrosis factor (GO:0071356)|cytosolic calcium ion homeostasis (GO:0051480)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA metabolic process (GO:0051053)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of leukocyte activation (GO:0002695)|negative regulation of lipid biosynthetic process (GO:0051055)|neuronal action potential (GO:0019228)|nuclear fragmentation involved in apoptotic nuclear change (GO:0030264)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of gene expression (GO:0010628)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of insulin secretion (GO:0032024)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vasodilation (GO:0045909)|steroid hormone mediated signaling pathway (GO:0043401)	axon (GO:0030424)|axon terminus (GO:0043679)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|dendritic spine head (GO:0044327)|dendritic spine membrane (GO:0032591)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|keratin filament (GO:0045095)|mitochondrial membrane (GO:0031966)|neuronal postsynaptic density (GO:0097481)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	chromatin binding (GO:0003682)|estrogen receptor activity (GO:0030284)|G-protein coupled receptor activity (GO:0004930)|mineralocorticoid receptor activity (GO:0017082)|steroid binding (GO:0005496)										CCTGAAGGCCGTCATTCCAGA	0.592																																																	0								ENSG00000164850						59.0	48.0	52.0					7																	1132439		2203	4299	6502	GPER1	SO:0001583	missense	0			-	HGNC	U63917	CCDS5322.1	7p22	2013-08-14	2007-07-03	2013-08-14	ENSG00000164850	ENSG00000164850			4485	protein-coding gene	gene with protein product		601805	"""G protein-coupled receptor 30"""	CMKRL2, GPR30, GPER		9479505, 17655271	Standard	NM_001098201		Approved	FEG-1, GPCR-Br, LERGU, LERGU2, DRY12, LyGPR, CEPR	uc003skb.2	Q99527	OTTHUMG00000023680	ENST00000297469.3:c.1075G>A	7.37:g.1132439G>A	ENSP00000297469:p.Val359Ile	Somatic	0	74	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	62	15.07	A8K6C5|B5BUJ1|O00143|O43494|Q13631|Q6FHL1|Q96F42|Q99981	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.V359I	ENST00000297469.3	37	c.1075	CCDS5322.1	7	.	.	.	.	.	.	.	.	.	.	G	8.627	0.892670	0.17613	.	.	ENSG00000164850	ENST00000401670;ENST00000397092;ENST00000297469;ENST00000397088	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	5.65	4.75	0.60458	.	.	.	.	.	T	0.48960	0.1529	L	0.27053	0.805	0.09310	N	1	P	0.40398	0.716	B	0.28011	0.085	T	0.23655	-1.0182	9	0.23302	T	0.38	.	15.035	0.71738	0.0:0.176:0.824:0.0	.	359	Q99527	GPER_HUMAN	I	359	ENSP00000385151:V359I;ENSP00000380281:V359I;ENSP00000297469:V359I;ENSP00000380277:V359I	ENSP00000297469:V359I	V	+	1	0	GPER	1098965	1.000000	0.71417	0.001000	0.08648	0.259000	0.26198	4.960000	0.63673	1.286000	0.44565	0.655000	0.94253	GTC	-	NULL		0.592	GPER1-030	KNOWN	basic|appris_principal|CCDS	protein_coding	GPER1	protein_coding	OTTHUMT00000060001.1	G	NM_001039966	-		1132439	+1	no_errors	ENST00000297469	ensembl	human	known	74_37	missense	SNP	0.009	A
PTPRM	5797	genome.wustl.edu	37	18	7888142	7888142	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr18:7888142G>T	ENST00000332175.8	+	3	1272	c.235G>T	c.(235-237)Ggg>Tgg	p.G79W	PTPRM_ENST00000400053.4_Missense_Mutation_p.G17W|PTPRM_ENST00000400060.4_Missense_Mutation_p.G79W|PTPRM_ENST00000580170.1_Missense_Mutation_p.G79W	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	79	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GAGACCTGAGGGGCAGAGAGC	0.458																																																	0								ENSG00000173482						170.0	179.0	176.0					18																	7888142		2203	4300	6503	PTPRM	SO:0001583	missense	0			-	HGNC	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.235G>T	18.37:g.7888142G>T	ENSP00000331418:p.Gly79Trp	Somatic	0	39	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.G79W	ENST00000332175.8	37	c.235	CCDS11840.1	18	.	.	.	.	.	.	.	.	.	.	G	18.98	3.737916	0.69304	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053	T;T;T	0.03094	4.05;4.05;4.05	5.73	3.73	0.42828	Concanavalin A-like lectin/glucanase (1);MAM domain (5);	0.294002	0.37219	N	0.002188	T	0.10937	0.0267	M	0.91196	3.185	0.80722	D	1	B;B	0.10296	0.003;0.003	B;B	0.15484	0.013;0.013	T	0.03483	-1.1032	10	0.87932	D	0	.	14.171	0.65510	0.0:0.1091:0.7651:0.1258	.	79;79	A7MBN1;P28827	.;PTPRM_HUMAN	W	79;79;17	ENSP00000331418:G79W;ENSP00000382933:G79W;ENSP00000382927:G17W	ENSP00000331418:G79W	G	+	1	0	PTPRM	7878142	1.000000	0.71417	0.991000	0.47740	0.976000	0.68499	5.577000	0.67444	1.401000	0.46761	0.655000	0.94253	GGG	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom,prints_MAM_dom		0.458	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRM	protein_coding	OTTHUMT00000254456.1	G		-		7888142	+1	no_errors	ENST00000400060	ensembl	human	known	74_37	missense	SNP	0.963	T
GCSAM	257144	genome.wustl.edu	37	3	111849124	111849124	+	Intron	DEL	A	A	-	rs5851820	byFrequency	TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr3:111849124delA	ENST00000308910.4	-	2	283				C3orf52_ENST00000467942.2_3'UTR|GCSAM_ENST00000484193.1_Intron	NM_001190259.1|NM_001190260.1|NM_152785.4	NP_001177188.1|NP_001177189.1|NP_689998.1	Q8N6F7	GCSAM_HUMAN	germinal center-associated, signaling and motility						negative regulation of lymphocyte migration (GO:2000402)|regulation of B cell receptor signaling pathway (GO:0050855)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|myosin II binding (GO:0045159)|protein kinase binding (GO:0019901)										TCTCCTGTCCAAAGTTTTCAA	0.413													|||unknown(NO_COVERAGE)	852	0.170128	0.0212	0.2176	5008	,	,		21424	0.1607		0.3708	False		,,,				2504	0.1411																0								ENSG00000114529																																			C3orf52	SO:0001627	intron_variant	0				HGNC	BC030506	CCDS2964.1, CCDS54621.1, CCDS54622.1	3q13.13	2012-09-03	2012-08-23	2012-08-23	ENSG00000174500	ENSG00000174500			20253	protein-coding gene	gene with protein product	"""human germinal center-associated lymphoma"""	607792	"""germinal center expressed transcript 2"""	GCET2			Standard	NM_152785		Approved	MGC40441, HGAL	uc021xcl.1	Q8N6F7	OTTHUMG00000159231	ENST00000308910.4:c.98+167T>-	3.37:g.111849124delA		Somatic	0	19	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	C9JD17|C9JUG6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000308910.4	37	NULL	CCDS2964.1	3																																																																																			-	-		0.413	GCSAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C3orf52	protein_coding	OTTHUMT00000353967.2	A	NM_152785			111849124	+1	no_errors	ENST00000467942	ensembl	human	known	74_37	rna	DEL	0.006	-
IGFN1	91156	genome.wustl.edu	37	1	201175746	201175746	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr1:201175746G>T	ENST00000335211.4	+	12	1855	c.1725G>T	c.(1723-1725)agG>agT	p.R575S	IGFN1_ENST00000295591.8_5'UTR|IGFN1_ENST00000451870.2_Intron	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GGAGCAGCAGGGAAGGAAAGG	0.602																																																	0								ENSG00000163395						56.0	62.0	60.0					1																	201175746		692	1591	2283	IGFN1	SO:0001583	missense	0			-	HGNC	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.1725G>T	1.37:g.201175746G>T	ENSP00000334714:p.Arg575Ser	Somatic	0	34	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39	F8WAI1|Q9NT72	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R575S	ENST00000335211.4	37	c.1725	CCDS53455.1	1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.958928	0.53400	.	.	ENSG00000163395	ENST00000335211	T	0.51574	0.7	4.82	3.9	0.45041	.	.	.	.	.	T	0.27866	0.0686	N	0.08118	0	0.80722	D	1	.	.	.	.	.	.	T	0.05550	-1.0878	6	.	.	.	.	8.2366	0.31629	0.1139:0.0:0.8861:0.0	.	.	.	.	S	575	ENSP00000334714:R575S	.	R	+	3	2	IGFN1	199442369	0.723000	0.28027	0.580000	0.28601	0.172000	0.22775	1.275000	0.33144	0.987000	0.38709	0.655000	0.94253	AGG	-	NULL		0.602	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	protein_coding		G	NM_178275	-		201175746	+1	no_errors	ENST00000335211	ensembl	human	known	74_37	missense	SNP	0.947	T
PNLDC1	154197	genome.wustl.edu	37	6	160238167	160238167	+	Silent	SNP	C	C	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr6:160238167C>T	ENST00000610273.1	+	15	1279	c.1108C>T	c.(1108-1110)Cta>Tta	p.L370L	PNLDC1_ENST00000392167.3_Silent_p.L381L	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	370						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		ACACTTGCTTCTACAGAAGAT	0.393																																																	0								ENSG00000146453						210.0	193.0	199.0					6																	160238167		2203	4298	6501	PNLDC1	SO:0001819	synonymous_variant	0			-	HGNC	AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.1108C>T	6.37:g.160238167C>T		Somatic	0	106	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	78	25.71	Q5TAP7|Q8N7X5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RNase_CAF1,superfamily_RNaseH-like_dom	p.L370	ENST00000610273.1	37	c.1108	CCDS5271.1	6																																																																																			-	superfamily_RNaseH-like_dom		0.393	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	PNLDC1	protein_coding		C	NM_173516	-		160238167	+1	no_errors	ENST00000610273	ensembl	human	known	74_37	silent	SNP	0.886	T
GPR31	2853	genome.wustl.edu	37	6	167571125	167571125	+	Silent	SNP	C	C	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr6:167571125C>T	ENST00000366834.1	-	1	692	c.195G>A	c.(193-195)gcG>gcA	p.A65A		NM_005299.2	NP_005290.2	O00270	GPR31_HUMAN	G protein-coupled receptor 31	65					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(4)|large_intestine(4)|lung(7)|prostate(1)	17		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;4.81e-20)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;0.00492)		AAGGCAGGCACGCAGCCAACA	0.662																																																	0								ENSG00000120436						49.0	38.0	42.0					6																	167571125		2202	4299	6501	GPR31	SO:0001819	synonymous_variant	0			-	HGNC	U65402	CCDS5299.1	6q27	2012-08-21				ENSG00000120436		"""GPCR / Class A : Orphans"""	4486	protein-coding gene	gene with protein product	"""hydroxyeicosatetraenoic (HETE) acid receptor 1"", ""12-(S)-HETE acid receptor"""	602043				9205127, 21712392	Standard	NM_005299		Approved	HETER1, 12-HETER	uc011egq.2	O00270		ENST00000366834.1:c.195G>A	6.37:g.167571125C>T		Somatic	0	57	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	18	37.93	B0M0K2|Q4VBL3|Q9NQ20	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.A65	ENST00000366834.1	37	c.195	CCDS5299.1	6																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.662	GPR31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR31	protein_coding	OTTHUMT00000043111.1	C	NM_005299	-		167571125	-1	no_errors	ENST00000366834	ensembl	human	known	74_37	silent	SNP	0.004	T
CCDC180	100499483	genome.wustl.edu	37	9	100000738	100000738	+	5'Flank	SNP	T	T	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr9:100000738T>A	ENST00000357054.1	+	0	0				CCDC180_ENST00000395220.1_5'Flank|CCDC180_ENST00000411667.2_5'Flank|CCDC180_ENST00000375205.2_5'Flank|RP11-498P14.5_ENST00000366109.2_lincRNA|CCDC180_ENST00000375202.2_5'Flank|RP11-23J9.5_ENST00000375204.2_RNA			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											TGCAGAAGTTTCCCCCTTGGG	0.657																																																	0								ENSG00000203279																																			RP11-498P14.5	SO:0001631	upstream_gene_variant	0			-	Clone_based_vega_gene	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001		9.37:g.100000738T>A	Exception_encountered	Somatic	0	62	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	25	45.65	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000357054.1	37	NULL		9																																																																																			-	-		0.657	CCDC180-201	KNOWN	basic	protein_coding	ENSG00000203279	protein_coding		T	NM_020893	-		100000738	-1	no_errors	ENST00000366109	ensembl	human	known	74_37	rna	SNP	0.998	A
LAMA1	284217	genome.wustl.edu	37	18	7032079	7032079	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr18:7032079G>A	ENST00000389658.3	-	16	2353	c.2260C>T	c.(2260-2262)Cac>Tac	p.H754Y		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	754	Laminin EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CAAACGCCGTGAACATTACAC	0.478																																																	0								ENSG00000101680						119.0	98.0	105.0					18																	7032079		2203	4300	6503	LAMA1	SO:0001583	missense	0			-	HGNC	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.2260C>T	18.37:g.7032079G>A	ENSP00000374309:p.His754Tyr	Somatic	0	51	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.H754Y	ENST00000389658.3	37	c.2260	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	G	14.77	2.633914	0.47049	.	.	ENSG00000101680	ENST00000389658	T	0.61392	0.11	5.39	5.39	0.77823	EGF-like, laminin (3);	0.607393	0.16043	N	0.232330	T	0.56630	0.1998	L	0.33668	1.02	0.09310	N	1	D	0.54047	0.964	P	0.49252	0.604	T	0.51616	-0.8683	10	0.31617	T	0.26	.	17.3336	0.87274	0.0:0.0:1.0:0.0	.	754	P25391	LAMA1_HUMAN	Y	754	ENSP00000374309:H754Y	ENSP00000374309:H754Y	H	-	1	0	LAMA1	7022079	0.998000	0.40836	0.045000	0.18777	0.003000	0.03518	2.676000	0.46883	2.512000	0.84698	0.655000	0.94253	CAC	-	pfam_EGF_laminin,smart_EGF_laminin,smart_EG-like_dom,pfscan_EGF_laminin		0.478	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	protein_coding	OTTHUMT00000257369.1	G	NM_005559	-		7032079	-1	no_errors	ENST00000389658	ensembl	human	known	74_37	missense	SNP	0.025	A
CYP4F8	11283	genome.wustl.edu	37	19	15730502	15730502	+	RNA	SNP	C	C	T	rs61746468	byFrequency	TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr19:15730502C>T	ENST00000441682.2	+	0	516							P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 8						icosanoid metabolic process (GO:0006690)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alkane 1-monooxygenase activity (GO:0018685)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(1)	26						TCGCTTGTGACGCCTGCCTTC	0.512													C|||	505	0.100839	0.0484	0.1254	5008	,	,		20410	0.0397		0.2137	False		,,,				2504	0.1012																0								ENSG00000186526						66.0	67.0	67.0					19																	15730502		2203	4300	6503	CYP4F8			0			-	HGNC	AF133298	CCDS74303.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186526	ENSG00000186526		"""Cytochrome P450s"""	2648	protein-coding gene	gene with protein product		611545	"""cytochrome P450, subfamily IVF, polypeptide 8"""			10405341	Standard	NM_007253		Approved		uc002nbi.3	P98187	OTTHUMG00000182386		19.37:g.15730502C>T		Somatic	1	176	0.56		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	123	9.56		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000441682.2	37	NULL		19	.	.	.	.	.	.	.	.	.	.	.	13.01	2.108844	0.37242	.	.	ENSG00000186526	ENST00000441682;ENST00000443973	.	.	.	2.97	2.97	0.34412	.	0.000000	0.85682	U	0.000000	T	0.73321	0.3572	.	.	.	.	.	.	D	0.89917	1.0	D	0.79784	0.993	T	0.82092	-0.0628	7	0.72032	D	0.01	.	11.7336	0.51752	0.0:1.0:0.0:0.0	rs61746468	152	P98187	CP4F8_HUMAN	M	151;1	.	ENSP00000409702:T151M	T	+	2	0	CYP4F8	15591502	0.996000	0.38824	0.994000	0.49952	0.015000	0.08874	3.539000	0.53604	1.680000	0.50976	0.305000	0.20034	ACG	-	-		0.512	CYP4F8-201	KNOWN	basic	processed_transcript	CYP4F8	processed_transcript		C	NM_007253	rs61746468		15730502	+1	no_errors	ENST00000441682	ensembl	human	known	74_37	rna	SNP	1.000	T
ACAD10	80724	genome.wustl.edu	37	12	112174704	112174704	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr12:112174704T>A	ENST00000313698.4	+	12	1765	c.1610T>A	c.(1609-1611)cTc>cAc	p.L537H	ACAD10_ENST00000413681.3_3'UTR|ACAD10_ENST00000455480.2_Missense_Mutation_p.L568H|ACAD10_ENST00000549590.1_Missense_Mutation_p.L537H|ACAD10_ENST00000392636.2_Missense_Mutation_p.L139H	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	537						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						ATGTACTGTCTCCAAATGGGG	0.488																																																	0								ENSG00000111271						134.0	120.0	125.0					12																	112174704		2203	4300	6503	ACAD10	SO:0001583	missense	0			-	HGNC	AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.1610T>A	12.37:g.112174704T>A	ENSP00000325137:p.Leu537His	Somatic	0	52	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	15	60.53	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aminoglycoside_PTrfase,pfam_AcylCo_DH/oxidase_C,pfam_Acyl-CoA_DH_2_C,pfam_AcylCoA_DH/ox_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_HAD-like_dom,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_Kinase-like_dom,superfamily_AcylCo_DH/oxidase_C,superfamily_HAD-like_dom,prints_HAD-SF_hydro_IA,tigrfam_HAD-SF_ppase_IA/epoxid_hydro_N,tigrfam_HAD-SF_hydro_IA	p.L568H	ENST00000313698.4	37	c.1703	CCDS31903.1	12	.	.	.	.	.	.	.	.	.	.	T	3.211	-0.161687	0.06502	.	.	ENSG00000111271	ENST00000392636;ENST00000413681;ENST00000549590;ENST00000455480;ENST00000313698	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.29	0.894	0.19242	Protein kinase-like domain (1);	1.124420	0.06475	N	0.731781	T	0.25568	0.0622	L	0.42245	1.32	0.09310	N	1	B;B;B	0.13145	0.003;0.002;0.007	B;B;B	0.15052	0.012;0.004;0.01	T	0.30416	-0.9979	10	0.45353	T	0.12	.	5.5631	0.17154	0.3787:0.0:0.2072:0.414	.	568;537;537	G3XAJ0;Q6JQN1;Q6JQN1-2	.;ACD10_HUMAN;.	H	139;537;537;568;537	ENSP00000376411:L139H;ENSP00000446959:L537H;ENSP00000389813:L568H;ENSP00000325137:L537H	ENSP00000325137:L537H	L	+	2	0	ACAD10	110659087	0.000000	0.05858	0.079000	0.20413	0.274000	0.26718	-0.740000	0.04861	0.303000	0.22785	0.459000	0.35465	CTC	-	superfamily_Kinase-like_dom		0.488	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD10	protein_coding	OTTHUMT00000368307.1	T	NM_025247	-		112174704	+1	no_errors	ENST00000455480	ensembl	human	known	74_37	missense	SNP	0.000	A
RIMS2	9699	genome.wustl.edu	37	8	104933942	104933942	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr8:104933942T>G	ENST00000436393.2	+	8	1701	c.1460T>G	c.(1459-1461)aTt>aGt	p.I487S	RIMS2_ENST00000262231.10_Missense_Mutation_p.I564S|RIMS2_ENST00000406091.3_Missense_Mutation_p.I709S|RIMS2_ENST00000507740.1_Missense_Mutation_p.I517S			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	787					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CGTCCTTCTATTTCTGTTACC	0.368										HNSCC(12;0.0054)																																							0								ENSG00000176406						183.0	171.0	175.0					8																	104933942		1849	4102	5951	RIMS2	SO:0001583	missense	0			-	HGNC	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.1460T>G	8.37:g.104933942T>G	ENSP00000390665:p.Ile487Ser	Somatic	0	134	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	88	63	58.28	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.I709S	ENST00000436393.2	37	c.2126		8	.	.	.	.	.	.	.	.	.	.	T	25.5	4.642863	0.87859	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.21031	2.03;2.53;2.14;2.22;2.17;2.1;2.55	5.85	5.85	0.93711	.	.	.	.	.	T	0.36853	0.0982	L	0.32530	0.975	0.80722	D	1	P;D;D;D;D;D	0.69078	0.548;0.975;0.983;0.975;0.988;0.997	P;D;D;P;D;D	0.72982	0.518;0.92;0.979;0.885;0.919;0.971	T	0.12656	-1.0539	9	0.87932	D	0	.	16.2291	0.82321	0.0:0.0:0.0:1.0	.	787;787;487;564;517;709	Q9UQ26;Q9UQ26-2;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.;.	S	709;740;709;787;517;564;517;517;487	ENSP00000427018:I709S;ENSP00000384892:I709S;ENSP00000425205:I517S;ENSP00000262231:I564S;ENSP00000423559:I517S;ENSP00000386228:I517S;ENSP00000390665:I487S	ENSP00000262231:I564S	I	+	2	0	RIMS2	105003118	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.966000	0.87956	2.238000	0.73509	0.528000	0.53228	ATT	-	NULL		0.368	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	protein_coding	OTTHUMT00000367217.1	T	NM_001100117	-		104933942	+1	no_errors	ENST00000406091	ensembl	human	known	74_37	missense	SNP	1.000	G
SERPINB10	5273	genome.wustl.edu	37	18	61584739	61584739	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr18:61584739delA	ENST00000238508.3	+	3	277	c.218delA	c.(217-219)gaafs	p.E73fs		NM_005024.1	NP_005015.1	P48595	SPB10_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 10	73					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R76fs*7(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(3)|stomach(2)	24		Esophageal squamous(42;0.131)				CCTGAAAGTGAAAAAAAAAGG	0.284																																																	1	Deletion - Frameshift(1)	large_intestine(1)						ENSG00000242550			39,129,4010		1,0,37,2,125,1924	26.0	26.0	26.0			5.3	1.0	18		27	67,232,7845		0,0,67,0,232,3773	no	codingComplex	SERPINB10	NM_005024.1		1,0,104,2,357,5697	A1A1,A1A2,A1R,A2A2,A2R,RR		3.6714,4.0211,3.79			61584739	106,361,11855	2173	4255	6428	SERPINB10	SO:0001589	frameshift_variant	0				HGNC	U35459	CCDS11990.1	18q21.3	2014-02-18	2005-08-18		ENSG00000242550	ENSG00000242550		"""Serine (or cysteine) peptidase inhibitors"""	8942	protein-coding gene	gene with protein product	"""protease inhibitor 10 (ovalbumin type, bomapin)"""	602058	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10"""	PI10		9268635, 10871600, 24172014	Standard	NM_005024		Approved	bomapin		P48595	OTTHUMG00000060594	ENST00000238508.3:c.218delA	18.37:g.61584739delA	ENSP00000238508:p.Glu73fs	Somatic	0	52	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	Q4VAX4|Q4VAX7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.R76fs	ENST00000238508.3	37	c.218	CCDS11990.1	18																																																																																			-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.284	SERPINB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB10	protein_coding	OTTHUMT00000134012.3	A	NM_005024			61584739	+1	no_errors	ENST00000238508	ensembl	human	known	74_37	frame_shift_del	DEL	0.998	-
GLI1	2735	genome.wustl.edu	37	12	57865299	57865299	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr12:57865299C>T	ENST00000228682.2	+	12	2867	c.2776C>T	c.(2776-2778)Cag>Tag	p.Q926*	GLI1_ENST00000543426.1_Nonsense_Mutation_p.Q798*|GLI1_ENST00000546141.1_Nonsense_Mutation_p.Q885*	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	926					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			ACCTTCCTACCAGAGTCCCAA	0.552																																					Pancreas(157;841 1936 10503 41495 50368)												0								ENSG00000111087						36.0	39.0	38.0					12																	57865299		2203	4300	6503	GLI1	SO:0001587	stop_gained	0			-	HGNC		CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.2776C>T	12.37:g.57865299C>T	ENSP00000228682:p.Gln926*	Somatic	0	23	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	4	69.23	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q926*	ENST00000228682.2	37	c.2776	CCDS8940.1	12	.	.	.	.	.	.	.	.	.	.	C	37	6.029879	0.97216	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467;ENST00000443131	.	.	.	4.53	2.69	0.31865	.	0.000000	0.40908	D	0.000991	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	4.4193	0.11472	0.0:0.6219:0.2195:0.1586	.	.	.	.	X	798;926;885;885;394	.	ENSP00000228682:Q926X	Q	+	1	0	GLI1	56151566	0.446000	0.25665	1.000000	0.80357	0.938000	0.57974	1.655000	0.37345	1.258000	0.44101	-0.273000	0.10243	CAG	-	NULL		0.552	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI1	protein_coding	OTTHUMT00000394197.1	C	NM_005269	-		57865299	+1	no_errors	ENST00000228682	ensembl	human	known	74_37	nonsense	SNP	0.967	T
BRD1	23774	genome.wustl.edu	37	22	50181108	50181108	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr22:50181108C>G	ENST00000216267.8	-	7	2880	c.2394G>C	c.(2392-2394)agG>agC	p.R798S	BRD1_ENST00000342989.5_Missense_Mutation_p.R524S|BRD1_ENST00000404034.1_Missense_Mutation_p.R798S|BRD1_ENST00000542442.1_Missense_Mutation_p.R486S|BRD1_ENST00000404760.1_Missense_Mutation_p.R929S|BRD1_ENST00000457780.2_Missense_Mutation_p.G902A	NM_014577.1	NP_055392.1	O95696	BRD1_HUMAN	bromodomain containing 1	798					histone H3 acetylation (GO:0043966)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleus (GO:0005634)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	37		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		GCGACCTTTTCCTTGGCTGCA	0.592																																																	0								ENSG00000100425						57.0	58.0	58.0					22																	50181108		2203	4300	6503	BRD1	SO:0001583	missense	0			-	HGNC	AF005067	CCDS14080.1	22q13.33	2008-07-01	2002-01-14		ENSG00000100425	ENSG00000100425			1102	protein-coding gene	gene with protein product	"""BR140-like"""	604589	"""bromodomain-containing 1"""			10591208, 10602503	Standard	NM_014577		Approved	BRL, BRPF2	uc003biv.3	O95696	OTTHUMG00000150288	ENST00000216267.8:c.2394G>C	22.37:g.50181108C>G	ENSP00000216267:p.Arg798Ser	Somatic	0	51	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	32	33.33	A6ZJA4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Enhancer_polycomb-like_N,pfam_Bromodomain,pfam_PWWP_dom,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP_dom,prints_Bromodomain,pfscan_PWWP_dom,pfscan_Znf_PHD-finger,pfscan_Bromodomain	p.R798S	ENST00000216267.8	37	c.2394	CCDS14080.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.54|13.54	2.267851|2.267851	0.40095|0.40095	.|.	.|.	ENSG00000100425|ENSG00000100425	ENST00000457780|ENST00000216267;ENST00000404034;ENST00000404760;ENST00000542442;ENST00000342989;ENST00000419212	T|T;T;T;T;T	0.14144|0.38401	2.53|2.15;2.15;2.4;1.14;1.67	5.39|5.39	3.25|3.25	0.37280|0.37280	.|.	.|0.049476	.|0.85682	.|D	.|0.000000	T|T	0.36826|0.36826	0.0981|0.0981	L|L	0.60455|0.60455	1.87|1.87	0.25517|0.25517	N|N	0.987407|0.987407	.|P;D;P;P	.|0.53151	.|0.919;0.958;0.919;0.952	.|P;P;B;P	.|0.51833	.|0.456;0.681;0.324;0.657	T|T	0.18935|0.18935	-1.0321|-1.0321	7|10	0.21014|0.09590	T|T	0.42|0.72	.|.	6.5644|6.5644	0.22503|0.22503	0.0:0.5636:0.0:0.4364|0.0:0.5636:0.0:0.4364	.|.	.|929;524;798;929	.|Q86X06;B7Z926;O95696;O95696-2	.|.;.;BRD1_HUMAN;.	A|S	902|798;798;929;486;524;389	ENSP00000410042:G902A|ENSP00000216267:R798S;ENSP00000384076:R798S;ENSP00000385858:R929S;ENSP00000437514:R486S;ENSP00000345886:R524S	ENSP00000410042:G902A|ENSP00000216267:R798S	G|R	-|-	2|3	0|2	BRD1|BRD1	48567112|48567112	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.302000|1.302000	0.33459|0.33459	0.529000|0.529000	0.28599|0.28599	0.655000|0.655000	0.94253|0.94253	GGA|AGG	-	NULL		0.592	BRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BRD1	protein_coding	OTTHUMT00000317402.1	C	NM_014577	-		50181108	-1	no_errors	ENST00000216267	ensembl	human	known	74_37	missense	SNP	1.000	G
UBE2Q2P1	388165	genome.wustl.edu	37	15	85081824	85081824	+	RNA	SNP	G	G	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr15:85081824G>T	ENST00000339094.1	-	0	1616					NR_003661.2				ubiquitin-conjugating enzyme E2Q family member 2 pseudogene 1																		GAAGATCACTGTGCAAAGAAC	0.269																																																	0								ENSG00000189136						35.0	32.0	33.0					15																	85081824		692	1583	2275	UBE2Q2P1			0			-	HGNC			15q25.2	2013-11-05	2009-12-17	2009-12-17	ENSG00000189136	ENSG00000189136			37439	pseudogene	pseudogene			"""ubiquitin-conjugating enzyme E2Q family pseudogene 1"""	UBE2QP1			Standard	NR_003661		Approved	FLJ43276	uc002bkn.1		OTTHUMG00000148662		15.37:g.85081824G>T		Somatic	0	40	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000339094.1	37	NULL		15																																																																																			-	-		0.269	UBE2Q2P1-002	KNOWN	basic	processed_transcript	UBE2Q2P1	pseudogene	OTTHUMT00000308970.2	G	NR_003661	-		85081824	-1	no_errors	ENST00000339094	ensembl	human	known	74_37	rna	SNP	1.000	T
ZAR1L	646799	genome.wustl.edu	37	13	32886050	32886050	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr13:32886050C>T	ENST00000533490.2	-	3	431	c.13G>A	c.(13-15)Gtc>Atc	p.V5I	ZAR1L_ENST00000345108.6_Missense_Mutation_p.V5I			A6NP61	ZAR1L_HUMAN	zygote arrest 1-like	5						cytoplasm (GO:0005737)				NS(1)|kidney(1)	2						GGAACACGGACAAAGCGCTCC	0.542																																																	0								ENSG00000189167						41.0	42.0	42.0					13																	32886050		692	1591	2283	ZAR1L	SO:0001583	missense	0			-	HGNC		CCDS45023.1	13q13.1	2014-02-20			ENSG00000189167	ENSG00000189167			37116	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 7"""					18442940	Standard	NM_001136571		Approved	Z3CXXC7	uc010abc.1	A6NP61	OTTHUMG00000016694	ENST00000533490.2:c.13G>A	13.37:g.32886050C>T	ENSP00000437289:p.Val5Ile	Somatic	0	85	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	7	70.83	B2RV03|B7ZBU2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V5I	ENST00000533490.2	37	c.13	CCDS45023.1	13	.	.	.	.	.	.	.	.	.	.	c	9.019	0.984329	0.18889	.	.	ENSG00000189167	ENST00000345108;ENST00000533490	.	.	.	4.54	1.77	0.24775	.	0.412681	0.10595	U	0.656362	T	0.26085	0.0636	L	0.40543	1.245	0.09310	N	1	P	0.42456	0.78	B	0.38106	0.265	T	0.09618	-1.0666	9	0.12103	T	0.63	-3.1986	9.9565	0.41671	0.2788:0.5868:0.1344:0.0	.	5	A6NP61	ZAR1L_HUMAN	I	5	.	ENSP00000344616:V5I	V	-	1	0	ZAR1L	31784050	0.002000	0.14202	0.019000	0.16419	0.865000	0.49528	0.218000	0.17622	0.161000	0.19458	0.639000	0.83563	GTC	-	NULL		0.542	ZAR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAR1L	protein_coding	OTTHUMT00000044403.5	C		-		32886050	-1	no_errors	ENST00000345108	ensembl	human	known	74_37	missense	SNP	0.130	T
MED12L	116931	genome.wustl.edu	37	3	151075070	151075070	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr3:151075070A>G	ENST00000474524.1	+	18	2664	c.2626A>G	c.(2626-2628)Aca>Gca	p.T876A	MED12L_ENST00000491549.1_3'UTR|P2RY12_ENST00000302632.3_Intron|MED12L_ENST00000273432.4_Missense_Mutation_p.T736A	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	876						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGGAAGTTATACAACAGGACT	0.453																																																	0								ENSG00000144893						111.0	96.0	101.0					3																	151075070		2203	4300	6503	MED12L	SO:0001583	missense	0			-	HGNC	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.2626A>G	3.37:g.151075070A>G	ENSP00000417235:p.Thr876Ala	Somatic	0	142	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	60	34	63.83	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.T876A	ENST00000474524.1	37	c.2626	CCDS33876.1	3	.	.	.	.	.	.	.	.	.	.	A	19.11	3.763927	0.69878	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.79247	-1.25;-1.25	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.85039	0.5606	L	0.55743	1.74	0.80722	D	1	P;D;D	0.61697	0.911;0.99;0.984	P;D;D	0.70935	0.755;0.971;0.956	D	0.86669	0.1909	10	0.87932	D	0	-21.8398	15.2053	0.73175	1.0:0.0:0.0:0.0	.	736;876;876	F8WAE6;Q86YW9-4;Q86YW9	.;.;MD12L_HUMAN	A	876;736	ENSP00000417235:T876A;ENSP00000273432:T736A	ENSP00000273432:T736A	T	+	1	0	MED12L	152557760	1.000000	0.71417	0.916000	0.36221	0.996000	0.88848	8.503000	0.90509	2.113000	0.64589	0.533000	0.62120	ACA	-	NULL		0.453	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	protein_coding	OTTHUMT00000357707.2	A	NM_053002	-		151075070	+1	no_errors	ENST00000474524	ensembl	human	known	74_37	missense	SNP	1.000	G
AADAT	51166	genome.wustl.edu	37	4	170983085	170983085	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr4:170983085delC	ENST00000337664.4	-	12	1470	c.1194delG	c.(1192-1194)ttgfs	p.L398fs	AADAT_ENST00000509167.1_Frame_Shift_Del_p.L402fs|AADAT_ENST00000353187.2_Frame_Shift_Del_p.L398fs|AADAT_ENST00000515480.1_Frame_Shift_Del_p.L398fs	NM_016228.3	NP_057312.1	Q8N5Z0	AADAT_HUMAN	aminoadipate aminotransferase	398					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|kynurenine metabolic process (GO:0070189)|L-kynurenine metabolic process (GO:0097052)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	mitochondrial matrix (GO:0005759)	2-aminoadipate transaminase activity (GO:0047536)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|pancreas(1)|stomach(1)	11		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0355)|LUSC - Lung squamous cell carcinoma(193;0.118)		AGGATGCTCTCAAGTAAGGGC	0.418																																																	0								ENSG00000109576						134.0	114.0	121.0					4																	170983085		2203	4300	6503	AADAT	SO:0001589	frameshift_variant	0				HGNC	AF097994	CCDS3814.1, CCDS75209.1	4q33	2010-12-09			ENSG00000109576	ENSG00000109576	2.6.1.39		17929	protein-coding gene	gene with protein product	"""kynurenine aminotransferase II"", ""L kynurenine/alpha aminoadipate aminotransferase"""	611754				12126930, 10441733	Standard	NM_182662		Approved	KATII, KAT2	uc003isr.3	Q8N5Z0	OTTHUMG00000160912	ENST00000337664.4:c.1194delG	4.37:g.170983085delC	ENSP00000336808:p.Leu398fs	Somatic	0	56	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	13	13.33	B3KP84|Q9UL02	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.R403fs	ENST00000337664.4	37	c.1206	CCDS3814.1	4																																																																																			-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase		0.418	AADAT-004	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	AADAT	protein_coding	OTTHUMT00000362952.1	C	NM_016228			170983085	-1	no_errors	ENST00000509167	ensembl	human	known	74_37	frame_shift_del	DEL	0.993	-
ACTN1	87	genome.wustl.edu	37	14	69350935	69350935	+	Missense_Mutation	SNP	T	T	A	rs564524574		TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr14:69350935T>A	ENST00000193403.6	-	14	1968	c.1585A>T	c.(1585-1587)Atg>Ttg	p.M529L	ACTN1_ENST00000394419.4_Missense_Mutation_p.M529L|ACTN1_ENST00000538545.2_Missense_Mutation_p.M529L|ACTN1_ENST00000376839.3_Missense_Mutation_p.M464L|ACTN1_ENST00000438964.2_Missense_Mutation_p.M529L	NM_001102.3	NP_001093.1	P12814	ACTN1_HUMAN	actinin, alpha 1	529	Interaction with DDN.				actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of apoptotic process (GO:0042981)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|double-stranded RNA binding (GO:0003725)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|vinculin binding (GO:0017166)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(9)|prostate(2)|urinary_tract(1)	27				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		AGGTCCTCCATGGCCCCCTCC	0.627																																																	0								ENSG00000072110						97.0	80.0	86.0					14																	69350935		2203	4300	6503	ACTN1	SO:0001583	missense	0			-	HGNC	M95178	CCDS9792.1, CCDS45129.1, CCDS45130.1	14q24.1	2014-08-08			ENSG00000072110	ENSG00000072110		"""EF-hand domain containing"""	163	protein-coding gene	gene with protein product		102575				2349951	Standard	NM_001102		Approved		uc001xkm.3	P12814	OTTHUMG00000171386	ENST00000193403.6:c.1585A>T	14.37:g.69350935T>A	ENSP00000193403:p.Met529Leu	Somatic	0	144	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	9	78.57	B3V8S3|B4DHH3|B7TY16|Q1HE25|Q9BTN1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.M529L	ENST00000193403.6	37	c.1585	CCDS9792.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.37|14.37	2.515821|2.515821	0.44763|0.44763	.|.	.|.	ENSG00000072110|ENSG00000072110	ENST00000553290|ENST00000193403;ENST00000394419;ENST00000438964;ENST00000376839;ENST00000538545;ENST00000544964	.|T;T;T;T;T;T	.|0.50001	.|0.76;0.76;0.76;0.76;0.76;0.76	4.68|4.68	4.68|4.68	0.58851|0.58851	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.50309|0.50309	0.1608|0.1608	M|M	0.75447|0.75447	2.3|2.3	0.80722|0.80722	D|D	1|1	.|B;B;B;B;B	.|0.16396	.|0.017;0.012;0.0;0.0;0.003	.|B;B;B;B;B	.|0.25759	.|0.063;0.043;0.014;0.014;0.011	T|T	0.49872|0.49872	-0.8893|-0.8893	5|10	.|0.33141	.|T	.|0.24	.|.	14.5916|14.5916	0.68368|0.68368	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|160;529;529;529;176	.|B7Z2W3;P12814-2;Q1HE25;P12814;B4DFY0	.|.;.;.;ACTN1_HUMAN;.	L|L	29|529;529;529;464;529;119	.|ENSP00000193403:M529L;ENSP00000377941:M529L;ENSP00000414272:M529L;ENSP00000366035:M464L;ENSP00000439828:M529L;ENSP00000444422:M119L	.|ENSP00000193403:M529L	H|M	-|-	2|1	0|0	ACTN1|ACTN1	68420688|68420688	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.086000|6.086000	0.71352|0.71352	2.100000|2.100000	0.63781|0.63781	0.533000|0.533000	0.62120|0.62120	CAT|ATG	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.627	ACTN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ACTN1	protein_coding	OTTHUMT00000413233.3	T	NM_001102	-		69350935	-1	no_errors	ENST00000394419	ensembl	human	known	74_37	missense	SNP	1.000	A
ANKRD40	91369	genome.wustl.edu	37	17	48776876	48776876	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr17:48776876G>A	ENST00000285243.6	-	3	931	c.662C>T	c.(661-663)tCt>tTt	p.S221F	Y_RNA_ENST00000364470.1_RNA	NM_052855.3	NP_443087.1	Q6AI12	ANR40_HUMAN	ankyrin repeat domain 40	221	Pro-rich.									breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11			BRCA - Breast invasive adenocarcinoma(22;2.03e-09)			CGGGACAGAAGAAAACAGGGA	0.542																																																	0								ENSG00000154945						124.0	132.0	130.0					17																	48776876		2203	4300	6503	ANKRD40	SO:0001583	missense	0			-	HGNC	BC012978	CCDS11572.1	17q21.33	2013-01-10			ENSG00000154945	ENSG00000154945		"""Ankyrin repeat domain containing"""	28233	protein-coding gene	gene with protein product						12477932	Standard	NM_052855		Approved	MGC15396	uc002iso.3	Q6AI12	OTTHUMG00000162255	ENST00000285243.6:c.662C>T	17.37:g.48776876G>A	ENSP00000285243:p.Ser221Phe	Somatic	0	135	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	42	34.38	Q96E32	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S221F	ENST00000285243.6	37	c.662	CCDS11572.1	17	.	.	.	.	.	.	.	.	.	.	G	21.4	4.139893	0.77775	.	.	ENSG00000154945	ENST00000285243	T	0.26518	1.73	5.17	5.17	0.71159	.	0.125086	0.56097	D	0.000039	T	0.25865	0.0630	L	0.29908	0.895	0.47065	D	0.999304	D	0.54772	0.968	P	0.48368	0.575	T	0.01500	-1.1339	10	0.72032	D	0.01	-13.3908	12.8684	0.57951	0.0854:0.0:0.9146:0.0	.	221	Q6AI12	ANR40_HUMAN	F	221	ENSP00000285243:S221F	ENSP00000285243:S221F	S	-	2	0	ANKRD40	46131875	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.821000	0.55700	2.567000	0.86603	0.650000	0.86243	TCT	-	NULL		0.542	ANKRD40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD40	protein_coding	OTTHUMT00000368201.2	G	NM_052855	-		48776876	-1	no_errors	ENST00000285243	ensembl	human	known	74_37	missense	SNP	1.000	A
ITGB4	3691	genome.wustl.edu	37	17	73753572	73753572	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr17:73753572G>T	ENST00000200181.3	+	40	5592	c.5405G>T	c.(5404-5406)aGc>aTc	p.S1802I	ITGB4_ENST00000339591.3_Missense_Mutation_p.S1785I|GALK1_ENST00000225614.2_Intron|ITGB4_ENST00000579662.1_Missense_Mutation_p.S1732I|ITGB4_ENST00000449880.2_Missense_Mutation_p.S1785I|ITGB4_ENST00000450894.3_Missense_Mutation_p.S1732I	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	1802					amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GAGTTTGTGAGCCGGACACTG	0.637																																																	0								ENSG00000132470						77.0	72.0	74.0					17																	73753572		2203	4300	6503	ITGB4	SO:0001583	missense	0			-	HGNC		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.5405G>T	17.37:g.73753572G>T	ENSP00000200181:p.Ser1802Ile	Somatic	0	35	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Integrin_bsu-4,pfam_Integrin_bsu_N,pfam_Fibronectin_type3,pfam_Calx_beta,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Fibronectin_type3,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,smart_Calx_beta,smart_Fibronectin_type3,prints_Integrin_bsu,pfscan_Fibronectin_type3	p.S1802I	ENST00000200181.3	37	c.5405	CCDS11727.1	17	.	.	.	.	.	.	.	.	.	.	G	10.02	1.237139	0.22711	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	T;T;T	0.76839	-1.05;-0.99;-0.99	4.17	1.93	0.25924	.	0.212284	0.43579	D	0.000545	T	0.76307	0.3969	L	0.54323	1.7	0.80722	D	1	P;B;P	0.37781	0.512;0.378;0.608	B;B;B	0.42653	0.394;0.221;0.221	T	0.79135	-0.1928	10	0.87932	D	0	.	14.5315	0.67929	0.0:0.5344:0.4656:0.0	.	1785;1732;1802	P16144-3;A0AVL6;P16144	.;.;ITB4_HUMAN	I	1802;1785;1785	ENSP00000200181:S1802I;ENSP00000344079:S1785I;ENSP00000400217:S1785I	ENSP00000200181:S1802I	S	+	2	0	ITGB4	71265167	1.000000	0.71417	0.993000	0.49108	0.677000	0.39632	1.489000	0.35562	0.718000	0.32166	0.462000	0.41574	AGC	-	pirsf_Integrin_bsu-4		0.637	ITGB4-001	KNOWN	basic|CCDS	protein_coding	ITGB4	protein_coding	OTTHUMT00000448334.1	G		-		73753572	+1	no_errors	ENST00000200181	ensembl	human	known	74_37	missense	SNP	0.998	T
PFKFB2	5208	genome.wustl.edu	37	1	207228190	207228192	+	Intron	DEL	TTA	TTA	-			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	TTA	TTA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr1:207228190_207228192delTTA	ENST00000367080.3	+	2	209				YOD1_ENST00000367084.1_5'Flank|PFKFB2_ENST00000411990.2_Intron|YOD1_ENST00000391927.1_5'Flank|PFKFB2_ENST00000367079.2_Intron|PFKFB2_ENST00000545806.1_Intron	NM_006212.2	NP_006203.2	O60825	F262_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2						carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose catabolic process (GO:0006007)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|lactate metabolic process (GO:0006089)|positive regulation of glucokinase activity (GO:0033133)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|protein kinase binding (GO:0019901)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	20	Prostate(682;0.19)					TCTCAGCATTTTATCTTGGGAAT	0.399																																																	0								ENSG00000123836																																			PFKFB2	SO:0001627	intron_variant	0				HGNC		CCDS31003.1, CCDS31004.1	1q31-q32.2	2012-07-13			ENSG00000123836	ENSG00000123836	2.7.1.105, 3.1.3.46		8873	protein-coding gene	gene with protein product		171835					Standard	XM_005273162		Approved		uc001hfg.3	O60825	OTTHUMG00000036033	ENST00000367080.3:c.85+43TTA>-	1.37:g.207228190_207228192delTTA		Somatic	0	42	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	4	60.00	O60824|Q5VVQ3|Q5VVQ4|Q9H3P1	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000367080.3	37	NULL	CCDS31004.1	1																																																																																			-	-		0.399	PFKFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKFB2	protein_coding	OTTHUMT00000087838.1	TTA				207228192	+1	no_errors	ENST00000468857	ensembl	human	putative	74_37	rna	DEL	0.682:0.629:0.168	-
ARHGEF12	23365	genome.wustl.edu	37	11	120331407	120331407	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr11:120331407G>T	ENST00000397843.2	+	27	2720	c.2554G>T	c.(2554-2556)Gtt>Ttt	p.V852F	ARHGEF12_ENST00000356641.3_Missense_Mutation_p.V833F|ARHGEF12_ENST00000532993.1_Missense_Mutation_p.V749F|AP000758.1_ENST00000595283.1_5'Flank	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	852	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		AATGAAGGCTGTTCGAAAGAG	0.338			T	MLL	AML																																			Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	0								ENSG00000196914						151.0	150.0	151.0					11																	120331407		1829	4074	5903	ARHGEF12	SO:0001583	missense	0			-	HGNC	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.2554G>T	11.37:g.120331407G>T	ENSP00000380942:p.Val852Phe	Somatic	0	35	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	O15086|Q6P526	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RGS-like_dom,pfam_DH-domain,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_DH-domain,superfamily_PDZ,smart_PDZ,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.V833F	ENST00000397843.2	37	c.2497	CCDS41727.1	11	.	.	.	.	.	.	.	.	.	.	G	24.3	4.515499	0.85389	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	T;T;T	0.68765	-0.35;-0.35;-0.35	5.78	2.92	0.33932	Dbl homology (DH) domain (5);	0.312310	0.22940	N	0.053781	T	0.69869	0.3159	L	0.46741	1.465	0.53688	D	0.99997	P;D;D	0.63046	0.659;0.99;0.992	P;P;P	0.61658	0.547;0.827;0.892	T	0.64089	-0.6489	10	0.22109	T	0.4	-9.1543	10.7462	0.46181	0.2045:0.0:0.7955:0.0	.	749;833;852	B4DGW2;Q9NZN5-2;Q9NZN5	.;.;ARHGC_HUMAN	F	852;833;749	ENSP00000380942:V852F;ENSP00000349056:V833F;ENSP00000432984:V749F	ENSP00000349056:V833F	V	+	1	0	ARHGEF12	119836617	0.940000	0.31905	1.000000	0.80357	0.983000	0.72400	1.263000	0.33004	0.813000	0.34350	0.555000	0.69702	GTT	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.338	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ARHGEF12	protein_coding	OTTHUMT00000388052.1	G	NM_015313	-		120331407	+1	no_errors	ENST00000356641	ensembl	human	known	74_37	missense	SNP	1.000	T
FREM1	158326	genome.wustl.edu	37	9	14842509	14842509	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr9:14842509A>C	ENST00000380880.3	-	9	2326	c.1543T>G	c.(1543-1545)Ttg>Gtg	p.L515V	FREM1_ENST00000380881.4_Missense_Mutation_p.L516V|FREM1_ENST00000422223.2_Missense_Mutation_p.L515V			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	515					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TCTTTGGGCAAGACGTTGATG	0.507																																																	0								ENSG00000164946						145.0	145.0	145.0					9																	14842509		2038	4193	6231	FREM1	SO:0001583	missense	0			-	HGNC	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.1543T>G	9.37:g.14842509A>C	ENSP00000370262:p.Leu515Val	Somatic	0	56	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,superfamily_Cadherin-like,smart_C-type_lectin,pfscan_C-type_lectin	p.L516V	ENST00000380880.3	37	c.1546	CCDS47952.1	9	.	.	.	.	.	.	.	.	.	.	A	18.36	3.607230	0.66558	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.27256	1.68;1.68;1.68	5.93	2.33	0.28932	.	0.096026	0.52532	D	0.000073	T	0.32793	0.0841	L	0.44542	1.39	0.45762	D	0.998656	D	0.89917	1.0	D	0.91635	0.999	T	0.25676	-1.0125	10	0.11794	T	0.64	-9.8604	6.267	0.20932	0.4781:0.0:0.5219:0.0	.	515	Q5H8C1	FREM1_HUMAN	V	516;515;515	ENSP00000370263:L516V;ENSP00000412940:L515V;ENSP00000370262:L515V	ENSP00000370257:L518V	L	-	1	2	FREM1	14832509	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.165000	0.50778	0.506000	0.28125	-0.274000	0.10170	TTG	-	NULL		0.507	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	protein_coding	OTTHUMT00000339474.2	A	NM_144966	-		14842509	-1	no_errors	ENST00000380881	ensembl	human	known	74_37	missense	SNP	1.000	C
SORCS3	22986	genome.wustl.edu	37	10	106917026	106917026	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr10:106917026C>T	ENST00000369701.3	+	10	1840	c.1613C>T	c.(1612-1614)cCa>cTa	p.P538L		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	538					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		AGAGGAAGCCCAGTGCACTGC	0.562																																					NSCLC(116;1497 1690 7108 13108 14106)												0								ENSG00000156395						83.0	73.0	76.0					10																	106917026		2203	4300	6503	SORCS3	SO:0001583	missense	0			-	HGNC	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.1613C>T	10.37:g.106917026C>T	ENSP00000358715:p.Pro538Leu	Somatic	0	47	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.P538L	ENST00000369701.3	37	c.1613	CCDS7558.1	10	.	.	.	.	.	.	.	.	.	.	C	14.11	2.437331	0.43224	.	.	ENSG00000156395	ENST00000369701	T	0.25414	1.8	6.04	5.14	0.70334	VPS10 (1);	0.249150	0.42053	D	0.000768	T	0.22205	0.0535	L	0.39147	1.195	0.51767	D	0.999939	B	0.11235	0.004	B	0.15484	0.013	T	0.02705	-1.1121	9	.	.	.	.	14.7616	0.69610	0.0:0.9315:0.0:0.0685	.	538	Q9UPU3	SORC3_HUMAN	L	538	ENSP00000358715:P538L	.	P	+	2	0	SORCS3	106907016	0.499000	0.26083	0.982000	0.44146	0.862000	0.49288	2.027000	0.41078	2.873000	0.98535	0.563000	0.77884	CCA	-	smart_VPS10		0.562	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS3	protein_coding	OTTHUMT00000050221.1	C	NM_014978	-		106917026	+1	no_errors	ENST00000369701	ensembl	human	known	74_37	missense	SNP	0.954	T
ENTPD8	377841	genome.wustl.edu	37	9	140331717	140331717	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr9:140331717C>T	ENST00000472938.1	-	3	305	c.289G>A	c.(289-291)Gag>Aag	p.E97K	ENTPD8_ENST00000344119.2_Missense_Mutation_p.E97K|ENTPD8_ENST00000371506.2_Missense_Mutation_p.E97K			Q5MY95	ENTP8_HUMAN	ectonucleoside triphosphate diphosphohydrolase 8	97					nucleoside diphosphate biosynthetic process (GO:0009133)|nucleoside monophosphate biosynthetic process (GO:0009124)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			biliary_tract(1)|lung(4)|prostate(1)|skin(1)	7	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000224)|Epithelial(140;0.000898)		TGCAGGCTCTCACCAGCCTGT	0.637																																																	0								ENSG00000188833						52.0	57.0	55.0					9																	140331717		2203	4300	6503	ENTPD8	SO:0001583	missense	0			-	HGNC	AY359088	CCDS7043.1, CCDS43913.1	9q34.3	2013-09-20			ENSG00000188833	ENSG00000188833			24860	protein-coding gene	gene with protein product	"""GLSR2492"""					12975309	Standard	NM_198585		Approved	UNQ2492, NTPDase-8	uc004cmw.3	Q5MY95	OTTHUMG00000131831	ENST00000472938.1:c.289G>A	9.37:g.140331717C>T	ENSP00000420531:p.Glu97Lys	Somatic	0	23	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	A2BG17|Q6UVZ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GDA1_CD39_NTPase	p.E97K	ENST00000472938.1	37	c.289	CCDS43913.1	9	.	.	.	.	.	.	.	.	.	.	C	5.718	0.316997	0.10845	.	.	ENSG00000188833	ENST00000344119;ENST00000371506;ENST00000472938;ENST00000493135	T;T;T;T	0.10763	2.84;2.84;2.84;2.84	4.37	3.44	0.39384	.	0.288820	0.27981	N	0.017067	T	0.07052	0.0179	L	0.28344	0.845	0.38972	D	0.958777	P;B	0.35011	0.48;0.392	B;B	0.37943	0.13;0.261	T	0.24657	-1.0154	10	0.09084	T	0.74	-6.1791	8.3109	0.32071	0.0:0.8128:0.0:0.1872	.	97;97	Q5MY95-2;Q5MY95	.;ENTP8_HUMAN	K	97;97;97;84	ENSP00000344089:E97K;ENSP00000360561:E97K;ENSP00000420531:E97K;ENSP00000420099:E84K	ENSP00000344089:E97K	E	-	1	0	ENTPD8	139451538	0.000000	0.05858	0.926000	0.36857	0.568000	0.35870	0.398000	0.20899	2.275000	0.75901	0.561000	0.74099	GAG	-	pfam_GDA1_CD39_NTPase		0.637	ENTPD8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD8	protein_coding	OTTHUMT00000355991.1	C	NM_198585	-		140331717	-1	no_errors	ENST00000371506	ensembl	human	known	74_37	missense	SNP	0.945	T
LRRC49	54839	genome.wustl.edu	37	15	71276481	71276483	+	In_Frame_Del	DEL	CAA	CAA	-	rs3834543|rs398027832|rs201509714|rs56720495	byFrequency	TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	CAA	CAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr15:71276481_71276483delCAA	ENST00000260382.5	+	11	1314_1316	c.1054_1056delCAA	c.(1054-1056)caadel	p.Q354del	LRRC49_ENST00000544974.2_In_Frame_Del_p.Q344del|LRRC49_ENST00000436542.2_3'UTR|LRRC49_ENST00000560369.1_In_Frame_Del_p.Q359del|LRRC49_ENST00000560158.2_In_Frame_Del_p.Q42del|LRRC49_ENST00000560691.1_In_Frame_Del_p.Q60del|LRRC49_ENST00000443425.2_In_Frame_Del_p.Q310del	NM_001199017.1|NM_017691.3	NP_001185946.1|NP_060161.2	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	354				Missing (in Ref. 1; BAA90984 and 4; AAH37982). {ECO:0000305}.		cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(3)|skin(3)	34						GTGGGACTTGCAACAACAACGAG	0.389														2183	0.435903	0.2383	0.4539	5008	,	,		14780	0.6032		0.4742	False		,,,				2504	0.4785																0								ENSG00000137821		,,	1217,3047		165,887,1080					,,	3.4	1.0		dbSNP_107	101	3897,4357		922,2053,1152	no	coding,coding,coding	LRRC49	NM_017691.3,NM_001199018.1,NM_001199017.1	,,	1087,2940,2232	A1A1,A1R,RR		47.2135,28.5413,40.8532	,,	,,		5114,7404				LRRC49	SO:0001651	inframe_deletion	0				HGNC		CCDS32282.1, CCDS55971.1, CCDS58376.1, CCDS61694.1	15q23	2005-08-09				ENSG00000137821			25965	protein-coding gene	gene with protein product						12477932	Standard	NM_001199017		Approved	FLJ20156	uc010ukf.2	Q8IUZ0		ENST00000260382.5:c.1054_1056delCAA	15.37:g.71276487_71276489delCAA	ENSP00000260382:p.Gln354del	Somatic	0	46	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	B3KVX1|B7Z366|F5H1J4|G5E9T5|H0YLN4|Q9NXM6	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.Q354in_frame_del	ENST00000260382.5	37	c.1054_1056	CCDS32282.1	15																																																																																			-	NULL		0.389	LRRC49-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRRC49	protein_coding	OTTHUMT00000417209.3	CAA	NM_017691			71276483	+1	no_errors	ENST00000260382	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:0.997	-
KRTAP5-7	440050	genome.wustl.edu	37	11	71238609	71238609	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr11:71238609G>A	ENST00000398536.4	+	1	297	c.263G>A	c.(262-264)gGt>gAt	p.G88D		NM_001012503.1	NP_001012521.1	Q6L8G8	KRA57_HUMAN	keratin associated protein 5-7	88	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				breast(1)|endometrium(1)|kidney(3)|lung(6)|ovary(1)	12						GGGGGCTGTGGTTCTTGTGgc	0.647																																																	0								ENSG00000244411						76.0	101.0	92.0					11																	71238609		2200	4294	6494	KRTAP5-7	SO:0001583	missense	0			-	HGNC	AB126076	CCDS41682.1	11q13.4	2008-02-05			ENSG00000244411	ENSG00000244411		"""Keratin associated proteins"""	23602	protein-coding gene	gene with protein product						15144888	Standard	NM_001012503		Approved	KRTAP5.7, KRTAP5-3	uc001oqq.1	Q6L8G8	OTTHUMG00000057570	ENST00000398536.4:c.263G>A	11.37:g.71238609G>A	ENSP00000417330:p.Gly88Asp	Somatic	0	181	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	103	9.65	B2RNM3|Q701N5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G88D	ENST00000398536.4	37	c.263	CCDS41682.1	11	.	.	.	.	.	.	.	.	.	.	N	0.008	-1.889805	0.00527	.	.	ENSG00000244411	ENST00000398536	T	0.01560	4.77	1.63	1.63	0.23807	.	.	.	.	.	T	0.04137	0.0115	M	0.89840	3.065	0.18873	N	0.999985	D	0.55605	0.972	B	0.42827	0.399	T	0.37776	-0.9691	9	0.13108	T	0.6	.	9.2506	0.37554	0.0:0.0:1.0:0.0	.	88	Q6L8G8	KRA57_HUMAN	D	88	ENSP00000417330:G88D	ENSP00000417330:G88D	G	+	2	0	KRTAP5-7	70916257	1.000000	0.71417	0.192000	0.23308	0.042000	0.13812	1.013000	0.29937	1.227000	0.43598	0.281000	0.19383	GGT	-	NULL		0.647	KRTAP5-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-7	protein_coding	OTTHUMT00000127953.1	G		-		71238609	+1	no_errors	ENST00000398536	ensembl	human	known	74_37	missense	SNP	0.478	A
ATR	545	genome.wustl.edu	37	3	142279108	142279108	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr3:142279108delT	ENST00000350721.4	-	6	1659	c.1538delA	c.(1537-1539)aacfs	p.N513fs	ATR_ENST00000383101.3_Intron	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	513					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						GTTTTACCAGTTCATGTTTTG	0.368								Other conserved DNA damage response genes																																									0								ENSG00000175054						91.0	92.0	91.0					3																	142279108		2203	4300	6503	ATR	SO:0001589	frameshift_variant	0				HGNC	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.1538delA	3.37:g.142279108delT	ENSP00000343741:p.Asn513fs	Somatic	0	54	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	17	63.04	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PI3/4_kinase_cat_dom,pfam_PIK-rel_kinase_FAT,pfam_UME,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_UME,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_HEAT_type_2,pfscan_PI3/4_kinase_cat_dom	p.N513fs	ENST00000350721.4	37	c.1538	CCDS3124.1	3																																																																																			-	superfamily_ARM-type_fold		0.368	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATR	protein_coding	OTTHUMT00000353995.2	T	NM_001184			142279108	-1	no_errors	ENST00000350721	ensembl	human	known	74_37	frame_shift_del	DEL	0.288	-
UBXN1	51035	genome.wustl.edu	37	11	62445877	62445877	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr11:62445877G>A	ENST00000301935.5	-	4	390	c.224C>T	c.(223-225)tCt>tTt	p.S75F	UBXN1_ENST00000529640.1_Missense_Mutation_p.S75F|UBXN1_ENST00000524762.1_5'UTR|UBXN1_ENST00000294119.2_Missense_Mutation_p.S75F|UBXN1_ENST00000533000.1_5'Flank			Q04323	UBXN1_HUMAN	UBX domain protein 1	75	Interaction with BRCA1.				negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|K6-linked polyubiquitin binding (GO:0071796)|polyubiquitin binding (GO:0031593)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|lung(12)	17						AGCAGAACCAGATCCTACAAA	0.488																																																	0								ENSG00000162191						208.0	186.0	193.0					11																	62445877		2202	4299	6501	UBXN1	SO:0001583	missense	0			-	HGNC		CCDS8029.1, CCDS66105.1, CCDS73307.1	11q23	2014-02-12	2008-07-25		ENSG00000162191	ENSG00000162191		"""UBX domain containing"""	18402	protein-coding gene	gene with protein product	"""SAPK substrate protein 1"""					12838346, 20351172	Standard	NM_001286078		Approved	LOC51035, 2B28, UBXD10, SAKS1	uc001nuj.3	Q04323	OTTHUMG00000167580	ENST00000301935.5:c.224C>T	11.37:g.62445877G>A	ENSP00000303991:p.Ser75Phe	Somatic	0	83	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	61	23.75	Q9BV93|Q9BVV5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UBX,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,smart_UBX,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_UBX	p.S75F	ENST00000301935.5	37	c.224		11	.	.	.	.	.	.	.	.	.	.	G	21.8	4.206919	0.79127	.	.	ENSG00000162191	ENST00000294119;ENST00000301935;ENST00000529640;ENST00000534176	T;T;T;T	0.25749	1.78;1.8;1.81;1.81	5.85	5.85	0.93711	.	0.460915	0.26109	N	0.026287	T	0.23171	0.0560	L	0.38175	1.15	0.09310	N	1	B;B;B;B;B	0.30664	0.0;0.011;0.028;0.289;0.0	B;B;B;B;B	0.26094	0.0;0.006;0.007;0.066;0.001	T	0.21621	-1.0240	10	0.72032	D	0.01	0.5978	16.0378	0.80642	0.0:0.0:1.0:0.0	.	75;75;75;75;75	B4DU88;B4DNC6;E9PRQ7;Q04323;Q04323-2	.;.;.;UBXN1_HUMAN;.	F	75	ENSP00000294119:S75F;ENSP00000303991:S75F;ENSP00000435964:S75F;ENSP00000435625:S75F	ENSP00000294119:S75F	S	-	2	0	UBXN1	62202453	0.033000	0.19621	0.013000	0.15412	0.969000	0.65631	2.575000	0.46025	2.941000	0.99782	0.655000	0.94253	TCT	-	NULL		0.488	UBXN1-002	KNOWN	basic|appris_candidate_longest	protein_coding	UBXN1	protein_coding	OTTHUMT00000395153.1	G	NM_015853	-		62445877	-1	no_errors	ENST00000294119	ensembl	human	known	74_37	missense	SNP	0.018	A
PIWIL1	9271	genome.wustl.edu	37	12	130831088	130831088	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr12:130831088G>T	ENST00000245255.3	+	5	762	c.490G>T	c.(490-492)Gat>Tat	p.D164Y		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	164					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		TCATGCTTTTGATGGAACGAT	0.388																																																	0								ENSG00000125207						97.0	94.0	95.0					12																	130831088		2203	4300	6503	PIWIL1	SO:0001583	missense	0			-	HGNC	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.490G>T	12.37:g.130831088G>T	ENSP00000245255:p.Asp164Tyr	Somatic	0	64	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Piwi,pfam_PAZ_dom,pfam_GAGE,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.D164Y	ENST00000245255.3	37	c.490	CCDS9268.1	12	.	.	.	.	.	.	.	.	.	.	G	27.6	4.845861	0.91277	.	.	ENSG00000125207	ENST00000245255;ENST00000546060;ENST00000542723;ENST00000540672	T;T;T;T	0.11712	2.75;2.75;2.75;2.75	5.73	5.73	0.89815	Argonaute/Dicer protein, PAZ (1);	0.043237	0.85682	D	0.000000	T	0.44685	0.1305	M	0.91768	3.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.53753	-0.8394	10	0.87932	D	0	-1.9736	18.8981	0.92432	0.0:0.0:1.0:0.0	.	164;164	Q96J94;Q96J94-2	PIWL1_HUMAN;.	Y	164;164;164;25	ENSP00000245255:D164Y;ENSP00000442086:D164Y;ENSP00000438582:D164Y;ENSP00000441695:D25Y	ENSP00000245255:D164Y	D	+	1	0	PIWIL1	129397041	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.833000	0.99426	2.691000	0.91804	0.650000	0.86243	GAT	-	superfamily_PAZ_dom		0.388	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	protein_coding	OTTHUMT00000399510.1	G		-		130831088	+1	no_errors	ENST00000245255	ensembl	human	known	74_37	missense	SNP	1.000	T
DDC	1644	genome.wustl.edu	37	7	50607642	50607642	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr7:50607642C>T	ENST00000444124.2	-	3	486	c.286G>A	c.(286-288)Ggg>Agg	p.G96R	DDC_ENST00000426377.1_Intron|DDC_ENST00000357936.5_Missense_Mutation_p.G96R|DDC_ENST00000489162.1_5'UTR|DDC_ENST00000431062.1_Missense_Mutation_p.G96R|AC018705.5_ENST00000454521.1_RNA|DDC_ENST00000380984.4_Missense_Mutation_p.G96R	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	96	2 X approximate tandem repeats.				catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	CCAATGGCCCCGCACAGCATG	0.657																																																	0								ENSG00000132437						84.0	69.0	74.0					7																	50607642		2200	4300	6500	DDC	SO:0001583	missense	0			-	HGNC		CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.286G>A	7.37:g.50607642C>T	ENSP00000403644:p.Gly96Arg	Somatic	0	62	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	23	39.47	C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PyrdxlP-dep_de-COase,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase,prints_Aromatic_deC	p.G96R	ENST00000444124.2	37	c.286	CCDS5511.1	7	.	.	.	.	.	.	.	.	.	.	C	24.4	4.523399	0.85600	.	.	ENSG00000132437	ENST00000357936;ENST00000431062;ENST00000444124;ENST00000380984	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	5.5	5.5	0.81552	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.048766	0.85682	D	0.000000	T	0.68247	0.2980	M	0.89353	3.025	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.988	T	0.74699	-0.3577	10	0.87932	D	0	-8.6482	19.4023	0.94635	0.0:1.0:0.0:0.0	.	96;96	Q53Y41;P20711	.;DDC_HUMAN	R	96	ENSP00000350616:G96R;ENSP00000399184:G96R;ENSP00000403644:G96R;ENSP00000370371:G96R	ENSP00000350616:G96R	G	-	1	0	DDC	50575136	1.000000	0.71417	0.956000	0.39512	0.703000	0.40648	4.957000	0.63652	2.573000	0.86826	0.655000	0.94253	GGG	-	pfam_PyrdxlP-dep_de-COase,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase,prints_Aromatic_deC		0.657	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DDC	protein_coding	OTTHUMT00000342593.1	C		-		50607642	-1	no_errors	ENST00000357936	ensembl	human	known	74_37	missense	SNP	0.998	T
HCK	3055	genome.wustl.edu	37	20	30659487	30659487	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr20:30659487T>C	ENST00000520553.1	+	2	268	c.22T>C	c.(22-24)Ttc>Ctc	p.F8L	HCK_ENST00000534862.1_Missense_Mutation_p.F9L|HCK_ENST00000375862.2_Missense_Mutation_p.F29L|HCK_ENST00000518730.1_Missense_Mutation_p.F8L|HCK_ENST00000538448.1_Missense_Mutation_p.F8L|HCK_ENST00000375852.2_Missense_Mutation_p.F29L	NM_001172129.1|NM_001172130.1|NM_001172131.1|NM_002110.3	NP_001165600.1|NP_001165601.1|NP_001165602.1|NP_002101.2	P08631	HCK_HUMAN	HCK proto-oncogene, Src family tyrosine kinase	29					cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|innate immune response-activating signal transduction (GO:0002758)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte degranulation (GO:0043299)|leukocyte migration involved in immune response (GO:0002522)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of defense response to virus by virus (GO:0050690)|regulation of inflammatory response (GO:0050727)|regulation of phagocytosis (GO:0050764)|regulation of podosome assembly (GO:0071801)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|respiratory burst after phagocytosis (GO:0045728)|viral process (GO:0016032)	caveola (GO:0005901)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(4)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)		Bosutinib(DB06616)	GAAGTCCAAGTTCCTCCAGGT	0.562																																																	0								ENSG00000101336						126.0	109.0	115.0					20																	30659487		2203	4300	6503	HCK	SO:0001583	missense	0			-	HGNC	AK026432	CCDS33460.1, CCDS54453.1, CCDS54455.1, CCDS54456.1	20q11-q12	2014-06-25	2014-06-25		ENSG00000101336	ENSG00000101336		"""SH2 domain containing"""	4840	protein-coding gene	gene with protein product		142370	"""hemopoietic cell kinase"""			3496523	Standard	NM_002110		Approved	JTK9	uc002wxh.3	P08631	OTTHUMG00000032204	ENST00000520553.1:c.22T>C	20.37:g.30659487T>C	ENSP00000429848:p.Phe8Leu	Somatic	0	118	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	65	27.78	A8K1I1|B4DQB6|E1P5M2|Q29RX1|Q2VPE2|Q504R5|Q5T7K1|Q5T7K2|Q96CC0|Q9H5Y5|Q9NUA4|Q9UMJ5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.F29L	ENST00000520553.1	37	c.85	CCDS54455.1	20	.	.	.	.	.	.	.	.	.	.	T	5.878	0.346183	0.11126	.	.	ENSG00000101336	ENST00000534862;ENST00000538448;ENST00000375862;ENST00000520553;ENST00000518730;ENST00000375852	T;T;T;T;T;T	0.72615	-0.65;-0.66;-0.66;-0.66;-0.65;-0.67	4.28	4.28	0.50868	.	0.738828	0.12255	N	0.485241	T	0.56645	0.1999	L	0.27053	0.805	0.31716	N	0.638975	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.56944	-0.7895	10	0.31617	T	0.26	.	9.9759	0.41783	0.0:0.0:0.0:1.0	.	8;29	P08631-3;P08631	.;HCK_HUMAN	L	9;8;29;8;8;29	ENSP00000444986:F9L;ENSP00000441169:F8L;ENSP00000365022:F29L;ENSP00000429848:F8L;ENSP00000427757:F8L;ENSP00000365012:F29L	ENSP00000365012:F29L	F	+	1	0	HCK	30123148	0.968000	0.33430	0.996000	0.52242	0.346000	0.29079	1.279000	0.33191	1.936000	0.56123	0.254000	0.18369	TTC	-	NULL		0.562	HCK-006	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	HCK	protein_coding	OTTHUMT00000375751.1	T		-		30659487	+1	no_errors	ENST00000375852	ensembl	human	known	74_37	missense	SNP	0.992	C
CSTF2	1478	genome.wustl.edu	37	X	100093229	100093229	+	Splice_Site	SNP	C	C	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chrX:100093229C>A	ENST00000372972.2	+	13	1629	c.1613C>A	c.(1612-1614)gCt>gAt	p.A538D	CSTF2_ENST00000415585.2_Splice_Site_p.A558D	NM_001325.2	NP_001316.1	P33240	CSTF2_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa	538	Interaction with RPO2TC1.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cleavage body (GO:0071920)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|skin(2)|stomach(1)	13						TCTGCACAGGCTGCTTTGATT	0.403																																																	0								ENSG00000101811						93.0	90.0	91.0					X																	100093229		2203	4300	6503	CSTF2	SO:0001630	splice_region_variant	0			-	HGNC	BC017712	CCDS14473.1	Xq22.1	2013-02-12	2002-08-29		ENSG00000101811	ENSG00000101811		"""RNA binding motif (RRM) containing"""	2484	protein-coding gene	gene with protein product		300907	"""cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kD"""			1741396	Standard	XM_006724622		Approved		uc004egh.3	P33240	OTTHUMG00000022709	ENST00000372972.2:c.1612-1C>A	X.37:g.100093229C>A		Somatic	0	25	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08	Q5H951|Q6LA74|Q8N502	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.A558D	ENST00000372972.2	37	c.1673	CCDS14473.1	X	.	.	.	.	.	.	.	.	.	.	C	28.1	4.894072	0.91889	.	.	ENSG00000101811	ENST00000415585;ENST00000372972;ENST00000458320	T;T	0.19806	2.2;2.12	5.83	5.83	0.93111	.	0.046453	0.85682	D	0.000000	T	0.48314	0.1493	M	0.66297	2.02	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.996;0.999	T	0.45629	-0.9248	10	0.87932	D	0	-14.3608	19.1309	0.93406	0.0:1.0:0.0:0.0	.	558;521;538	E7EWR4;P33240-2;P33240	.;.;CSTF2_HUMAN	D	558;538;514	ENSP00000387996:A558D;ENSP00000362063:A538D	ENSP00000362063:A538D	A	+	2	0	CSTF2	99979885	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.298000	0.78815	2.468000	0.83385	0.600000	0.82982	GCT	-	NULL		0.403	CSTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSTF2	protein_coding	OTTHUMT00000058926.1	C	NM_001325	-	Missense_Mutation	100093229	+1	no_errors	ENST00000415585	ensembl	human	known	74_37	missense	SNP	1.000	A
GINS4	84296	genome.wustl.edu	37	8	41387793	41387793	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr8:41387793delA	ENST00000276533.3	+	2	282	c.72delA	c.(70-72)gcafs	p.A24fs	GINS4_ENST00000523277.2_Frame_Shift_Del_p.A24fs|GINS4_ENST00000518671.1_Frame_Shift_Del_p.A24fs|GINS4_ENST00000520710.1_Frame_Shift_Del_p.A24fs	NM_032336.2	NP_115712.1	Q9BRT9	SLD5_HUMAN	GINS complex subunit 4 (Sld5 homolog)	24					DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)				breast(1)|lung(2)|skin(1)	4	Ovarian(28;0.014)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.00732)|Lung NSC(58;0.0207)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	Colorectal(10;0.0014)|OV - Ovarian serous cystadenocarcinoma(14;0.00329)|LUSC - Lung squamous cell carcinoma(45;0.0137)|COAD - Colon adenocarcinoma(11;0.0147)			TAACTCCTGCAGAGCTCATTG	0.468																																																	0								ENSG00000147536						119.0	114.0	116.0					8																	41387793		2203	4300	6503	GINS4	SO:0001589	frameshift_variant	0				HGNC	BC005995	CCDS6116.1	8p11.21	2006-05-04			ENSG00000147536	ENSG00000147536			28226	protein-coding gene	gene with protein product		610611				12477932	Standard	NM_032336		Approved	MGC14799, SLD5	uc003xnx.3	Q9BRT9	OTTHUMG00000164079	ENST00000276533.3:c.72delA	8.37:g.41387793delA	ENSP00000276533:p.Ala24fs	Somatic	0	44	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	25	24.24	B2R8H5|D3DSY0|Q8N648	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GINS_complex,pirsf_GINS_Sld5	p.E25fs	ENST00000276533.3	37	c.72	CCDS6116.1	8																																																																																			-	pirsf_GINS_Sld5		0.468	GINS4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GINS4	protein_coding	OTTHUMT00000377150.1	A	NM_032336			41387793	+1	no_errors	ENST00000276533	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
AC026700.1	0	genome.wustl.edu	37	5	84823943	84823944	+	RNA	DEL	CA	CA	-	rs537929167|rs368649367	byFrequency	TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr5:84823943_84823944delCA	ENST00000401134.1	-	0	8_9																											catgcacatgcacacacacaca	0.337																																																	0								ENSG00000215953																																			AC026700.1			0				Clone_based_ensembl_gene																													5.37:g.84823953_84823954delCA		Somatic	0	51	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	21	22.22		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401134.1	37	NULL		5																																																																																			-	-		0.337	AC026700.1-201	NOVEL	basic	miRNA	ENSG00000215953	miRNA		CA				84823944	-1	no_errors	ENST00000401134	ensembl	human	novel	74_37	rna	DEL	0.030:0.032	-
SATL1	340562	genome.wustl.edu	37	X	84349150	84349150	+	Silent	SNP	G	G	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chrX:84349150G>A	ENST00000395409.3	-	4	1859	c.1299C>T	c.(1297-1299)gtC>gtT	p.V433V	SATL1_ENST00000509231.1_Silent_p.V620V|SATL1_ENST00000332921.5_Silent_p.V433V			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	433	Acetyl-CoA binding. {ECO:0000250}.|N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.						N-acetyltransferase activity (GO:0008080)			NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						AAGCTTGTGTGACATAAAAGT	0.338																																																	0								ENSG00000184788						104.0	88.0	94.0					X																	84349150		2203	4300	6503	SATL1	SO:0001819	synonymous_variant	0			-	HGNC	BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.1299C>T	X.37:g.84349150G>A		Somatic	0	57	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	165	9.78	A0AVK7|E9PB72|Q5H8V9	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_Acyl_CoA_acyltransferase	p.V620	ENST00000395409.3	37	c.1860		X																																																																																			-	superfamily_Acyl_CoA_acyltransferase		0.338	SATL1-202	KNOWN	basic|appris_principal	protein_coding	SATL1	protein_coding		G	XM_291339	-		84349150	-1	no_errors	ENST00000509231	ensembl	human	known	74_37	silent	SNP	0.990	A
PIK3R4	30849	genome.wustl.edu	37	3	130454733	130454733	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr3:130454733C>T	ENST00000356763.3	-	3	1404	c.847G>A	c.(847-849)Gat>Aat	p.D283N		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	283	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						ATACTGTGATCTTCAATTTTA	0.323																																																	0								ENSG00000196455						127.0	135.0	132.0					3																	130454733		2203	4299	6502	PIK3R4	SO:0001583	missense	0			-	HGNC	Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.847G>A	3.37:g.130454733C>T	ENSP00000349205:p.Asp283Asn	Somatic	0	59	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	45	27.42	Q2TBF4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_WD40_repeat,pfam_HEAT,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_WD40_repeat,pfscan_HEAT_type_2,pfscan_Prot_kinase_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D283N	ENST00000356763.3	37	c.847	CCDS3067.1	3	.	.	.	.	.	.	.	.	.	.	C	24.6	4.552593	0.86127	.	.	ENSG00000196455	ENST00000356763	T	0.11495	2.77	5.48	5.48	0.80851	Serine/threonine-protein kinase-like domain (1);Armadillo-like helical (1);Protein kinase-like domain (1);Armadillo-type fold (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.24586	0.0596	L	0.55834	1.745	0.80722	D	1	P	0.44521	0.837	P	0.53224	0.721	T	0.00057	-1.2174	10	0.38643	T	0.18	-34.1858	19.7147	0.96110	0.0:1.0:0.0:0.0	.	283	Q99570	PI3R4_HUMAN	N	283	ENSP00000349205:D283N	ENSP00000349205:D283N	D	-	1	0	PIK3R4	131937423	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.687000	0.84139	2.732000	0.93576	0.591000	0.81541	GAT	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom		0.323	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R4	protein_coding	OTTHUMT00000356668.1	C	NM_014602	-		130454733	-1	no_errors	ENST00000356763	ensembl	human	known	74_37	missense	SNP	1.000	T
HCAR3	8843	genome.wustl.edu	37	12	123200108	123200108	+	3'UTR	SNP	G	G	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr12:123200108G>A	ENST00000528880.2	-	0	1331				RP11-324E6.6_ENST00000543611.1_lincRNA|HCAR1_ENST00000356987.2_Intron	NM_006018.2	NP_006009.2	P49019	HCAR3_HUMAN	hydroxycarboxylic acid receptor 3						G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9					Niacin(DB00627)	ATCTTAGGCCGAGTCCAGTGA	0.483																																																	0								ENSG00000256249						81.0	86.0	84.0					12																	123200108		2188	4291	6479	RP11-324E6.6	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene	D10923	CCDS53842.1	12q24.31	2012-08-08	2011-05-30	2011-05-30		ENSG00000255398		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	16824	protein-coding gene	gene with protein product		606039	"""G protein-coupled receptor 109B"""	GPR109B		7505609, 9205127, 18983141, 21454438	Standard	NM_006018		Approved	HCA3, HM74	uc001ucy.4	P49019		ENST00000528880.2:c.*13C>T	12.37:g.123200108G>A		Somatic	0	134	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	47	39.74	A8K4G5|B2R830|E9PI97|Q8NGE4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000528880.2	37	NULL	CCDS53842.1	12																																																																																			-	-		0.483	HCAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000256249	protein_coding	OTTHUMT00000387549.2	G	NM_006018	-		123200108	+1	no_errors	ENST00000543611	ensembl	human	known	74_37	rna	SNP	0.010	A
UNC80	285175	genome.wustl.edu	37	2	210705324	210705324	+	Silent	SNP	G	G	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr2:210705324G>A	ENST00000439458.1	+	20	3395	c.3315G>A	c.(3313-3315)ctG>ctA	p.L1105L	UNC80_ENST00000272845.6_Silent_p.L1100L	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1105					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						AGGACCTCCTGGACATTAGCT	0.443																																																	0								ENSG00000144406						157.0	133.0	140.0					2																	210705324		692	1591	2283	UNC80	SO:0001819	synonymous_variant	0			-	HGNC	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.3315G>A	2.37:g.210705324G>A		Somatic	0	61	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	23	23.33	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L1105	ENST00000439458.1	37	c.3315	CCDS46504.1	2																																																																																			-	NULL		0.443	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	protein_coding		G	NM_182587	-		210705324	+1	no_errors	ENST00000439458	ensembl	human	known	74_37	silent	SNP	0.994	A
PRR9	574414	genome.wustl.edu	37	1	153190623	153190623	+	Start_Codon_SNP	SNP	G	G	C			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr1:153190623G>C	ENST00000368744.3	+	2	59	c.3G>C	c.(1-3)atG>atC	p.M1I		NM_001195571.1	NP_001182500.1	Q5T870	PRR9_HUMAN	proline rich 9	1										prostate(1)	1						ACCCTAGGATGTCCTTCAGTG	0.498																																																	0								ENSG00000203783																																			PRR9	SO:0001582	initiator_codon_variant	0			-	HGNC	AL161636	CCDS55639.1	1q21.3	2008-07-02			ENSG00000203783	ENSG00000203783			32057	protein-coding gene	gene with protein product							Standard	NM_001195571		Approved		uc021ozw.1	Q5T870	OTTHUMG00000013936	ENST00000368744.3:c.3G>C	1.37:g.153190623G>C	ENSP00000357733:p.Met1Ile	Somatic	0	68	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	137	12.10		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.M1I	ENST00000368744.3	37	c.3	CCDS55639.1	1	.	.	.	.	.	.	.	.	.	.	G	18.24	3.580602	0.65992	.	.	ENSG00000203783	ENST00000368744	.	.	.	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000004	T	0.70263	0.3204	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74396	-0.3679	6	0.87932	D	0	-7.8237	14.9118	0.70764	0.0:0.0:1.0:0.0	.	.	.	.	I	1	.	ENSP00000357733:M1I	M	+	3	0	PRR9	151457247	1.000000	0.71417	1.000000	0.80357	0.623000	0.37688	4.484000	0.60271	2.580000	0.87095	0.467000	0.42956	ATG	-	NULL		0.498	PRR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR9	protein_coding	OTTHUMT00000039105.1	G		-	Missense_Mutation	153190623	+1	no_errors	ENST00000368744	ensembl	human	known	74_37	missense	SNP	1.000	C
WRN	7486	genome.wustl.edu	37	8	30924631	30924631	+	Missense_Mutation	SNP	G	G	T	rs561603992		TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr8:30924631G>T	ENST00000298139.5	+	6	836	c.587G>T	c.(586-588)cGc>cTc	p.R196L		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	196	3'-5' exonuclease.|Interaction with WRNIP1. {ECO:0000250}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		AAGTCTATCCGCTGTAGCAAT	0.413			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)		yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	0								ENSG00000165392						90.0	79.0	82.0					8																	30924631		2203	4300	6503	WRN	SO:0001583	missense	0	Familial Cancer Database	WS, Adult Progeria	-	HGNC		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.587G>T	8.37:g.30924631G>T	ENSP00000298139:p.Arg196Leu	Somatic	0	75	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	45	28.12	A1KYY9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_3'-5'_exonuclease_dom,pfam_Helicase_C,pfam_RQC_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_HRDC_dom,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,superfamily_HRDC-like,smart_3'-5'_exonuclease_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_HRDC_dom,pfscan_HRDC_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.R196L	ENST00000298139.5	37	c.587	CCDS6082.1	8	.	.	.	.	.	.	.	.	.	.	G	32	5.127865	0.94473	.	.	ENSG00000165392	ENST00000298139	T	0.60548	0.18	5.82	5.82	0.92795	-5&apos (2);Ribonuclease H-like (1); exonuclease (2);3&apos (2);	0.056461	0.64402	D	0.000001	D	0.83335	0.5232	M	0.93638	3.44	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.86886	0.2045	10	0.87932	D	0	-10.7416	19.6956	0.96023	0.0:0.0:1.0:0.0	.	196	Q14191	WRN_HUMAN	L	196	ENSP00000298139:R196L	ENSP00000298139:R196L	R	+	2	0	WRN	31044173	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.019000	0.70818	2.757000	0.94681	0.561000	0.74099	CGC	-	pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom		0.413	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRN	protein_coding	OTTHUMT00000376248.1	G		-		30924631	+1	no_errors	ENST00000298139	ensembl	human	known	74_37	missense	SNP	1.000	T
FMNL2	114793	genome.wustl.edu	37	2	153482063	153482063	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr2:153482063A>G	ENST00000475377.2	+	3	274	c.74A>G	c.(73-75)gAg>gGg	p.E25G	FMNL2_ENST00000497192.1_3'UTR|FMNL2_ENST00000288670.9_Missense_Mutation_p.E650G			Q96PY5	FMNL2_HUMAN	formin-like 2	650	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						ATTGATGATGAGCGAATTCTG	0.443																																																	0								ENSG00000157827						122.0	115.0	117.0					2																	153482063		1859	4097	5956	FMNL2	SO:0001583	missense	0			-	HGNC	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000475377.2:c.74A>G	2.37:g.153482063A>G	ENSP00000418959:p.Glu25Gly	Somatic	0	53	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	13	65.79	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin,prints_Wilms_tumour	p.E650G	ENST00000475377.2	37	c.1949		2	.	.	.	.	.	.	.	.	.	.	A	21.5	4.154452	0.78114	.	.	ENSG00000157827	ENST00000288670;ENST00000421344;ENST00000475377	T;T	0.18338	2.22;2.22	6.17	6.17	0.99709	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	T	0.40067	0.1102	L	0.60957	1.885	0.80722	D	1	D;B;B	0.76494	0.999;0.06;0.357	D;B;B	0.81914	0.995;0.22;0.214	T	0.06570	-1.0819	10	0.54805	T	0.06	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	650;131;650	Q96PY5;Q6ZN96;Q96PY5-3	FMNL2_HUMAN;.;.	G	650;131;25	ENSP00000288670:E650G;ENSP00000418959:E25G	ENSP00000288670:E650G	E	+	2	0	FMNL2	153190309	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.371000	0.80710	0.533000	0.62120	GAG	-	pfam_FH2_Formin,smart_FH2_Formin		0.443	FMNL2-002	NOVEL	basic|exp_conf	protein_coding	FMNL2	protein_coding	OTTHUMT00000333583.3	A	NM_052905	-		153482063	+1	no_errors	ENST00000288670	ensembl	human	known	74_37	missense	SNP	1.000	G
HSDL2	84263	genome.wustl.edu	37	9	115171212	115171212	+	Silent	SNP	C	C	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr9:115171212C>T	ENST00000398805.3	+	4	533	c.306C>T	c.(304-306)gcC>gcT	p.A102A	HSDL2_ENST00000488101.1_3'UTR|HSDL2_ENST00000262542.7_5'UTR|HSDL2_ENST00000539114.1_5'UTR|HSDL2_ENST00000398803.1_Intron	NM_032303.4	NP_115679.2	Q6YN16	HSDL2_HUMAN	hydroxysteroid dehydrogenase like 2	102						membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|cervix(2)|endometrium(1)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(2)	13						TAAATAATGCCAGTGCCATTA	0.358																																																	0								ENSG00000119471						121.0	107.0	111.0					9																	115171212		1874	4122	5996	HSDL2	SO:0001819	synonymous_variant	0			-	HGNC	AY093428	CCDS43864.1, CCDS56582.1	9q32	2011-09-14			ENSG00000119471	ENSG00000119471		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18572	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 13C, member 1"""		"""chromosome 9 open reading frame 99"""	C9orf99		12834046, 19027726	Standard	NM_032303		Approved	SDR13C1	uc004bga.2	Q6YN16	OTTHUMG00000020504	ENST00000398805.3:c.306C>T	9.37:g.115171212C>T		Somatic	0	57	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	38	33.33	A8K1L4|A8K8X1|A8MSV3|Q658M8|Q9BT58	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SCP2_sterol-bd_dom,pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,superfamily_SCP2_sterol-bd_dom,prints_Glc/ribitol_DH	p.A102	ENST00000398805.3	37	c.306	CCDS43864.1	9																																																																																			-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH		0.358	HSDL2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	HSDL2	protein_coding	OTTHUMT00000053681.1	C	NM_032303	-		115171212	+1	no_errors	ENST00000398805	ensembl	human	novel	74_37	silent	SNP	1.000	T
DNM1	1759	genome.wustl.edu	37	9	131008703	131008703	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr9:131008703G>T	ENST00000372923.3	+	16	1794	c.1702G>T	c.(1702-1704)Gac>Tac	p.D568Y	DNM1_ENST00000393594.3_Missense_Mutation_p.D568Y|MIR3154_ENST00000577829.1_RNA|DNM1_ENST00000486160.1_Missense_Mutation_p.D568Y|DNM1_ENST00000493925.1_3'UTR|MIR199B_ENST00000384849.1_RNA|DNM1_ENST00000341179.7_Missense_Mutation_p.D568Y|DNM1_ENST00000475805.1_Missense_Mutation_p.D568Y	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	568	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						GCTGTCTGTGGACAACCTCAA	0.542																																					GBM(113;146 1575 2722 28670 29921)												0								ENSG00000106976						193.0	144.0	161.0					9																	131008703		2203	4300	6503	DNM1	SO:0001583	missense	0			-	HGNC	L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.1702G>T	9.37:g.131008703G>T	ENSP00000362014:p.Asp568Tyr	Somatic	0	96	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin_SF	p.D568Y	ENST00000372923.3	37	c.1702	CCDS6895.1	9	.	.	.	.	.	.	.	.	.	.	G	18.08	3.544353	0.65198	.	.	ENSG00000106976	ENST00000475805;ENST00000341179;ENST00000372923;ENST00000393589;ENST00000393594;ENST00000486160;ENST00000543158	T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03	4.71	4.71	0.59529	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.83087	0.5178	M	0.89785	3.06	0.80722	D	1	B;B	0.18610	0.029;0.013	B;B	0.23150	0.044;0.026	D	0.83674	0.0168	10	0.87932	D	0	-7.4965	17.8368	0.88700	0.0:0.0:1.0:0.0	.	568;568	Q05193;Q05193-3	DYN1_HUMAN;.	Y	568;568;568;563;568;568;113	ENSP00000419225:D568Y;ENSP00000345680:D568Y;ENSP00000362014:D568Y;ENSP00000377219:D568Y;ENSP00000420045:D568Y	ENSP00000345680:D568Y	D	+	1	0	DNM1	130048524	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.510000	0.98004	2.436000	0.82500	0.498000	0.49722	GAC	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.542	DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNM1	protein_coding	OTTHUMT00000054367.1	G	NM_004408	-		131008703	+1	no_errors	ENST00000372923	ensembl	human	known	74_37	missense	SNP	1.000	T
IRGC	56269	genome.wustl.edu	37	19	44223832	44223832	+	Silent	SNP	C	C	T	rs572996178		TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr19:44223832C>T	ENST00000244314.5	+	2	1321	c.1122C>T	c.(1120-1122)ggC>ggT	p.G374G		NM_019612.3	NP_062558.1	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	374						membrane (GO:0016020)	GTP binding (GO:0005525)|hydrolase activity, acting on acid anhydrides (GO:0016817)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(2)	25		Prostate(69;0.0435)				TGGTGGCTGGCGGCATCAGCT	0.652																																					Colon(189;350 2037 11447 13433 38914)												0								ENSG00000124449						33.0	29.0	30.0					19																	44223832		2203	4299	6502	IRGC	SO:0001819	synonymous_variant	0			-	HGNC	BC066939	CCDS12629.1	19q13.32	2008-02-05	2005-10-31	2005-10-31	ENSG00000124449	ENSG00000124449			28835	protein-coding gene	gene with protein product			"""immunity-related GTPase family, cinema 1"""	IRGC1		12477932	Standard	NM_019612		Approved	Iigp5, CINEMA	uc002oxh.3	Q6NXR0	OTTHUMG00000154587	ENST00000244314.5:c.1122C>T	19.37:g.44223832C>T		Somatic	0	133	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	87	29.03	Q05BR8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Interferon-induced_GTPase,superfamily_P-loop_NTPase	p.G374	ENST00000244314.5	37	c.1122	CCDS12629.1	19																																																																																			-	NULL		0.652	IRGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRGC	protein_coding	OTTHUMT00000336191.1	C	NM_019612	-		44223832	+1	no_errors	ENST00000244314	ensembl	human	known	74_37	silent	SNP	0.000	T
LRRC9	341883	genome.wustl.edu	37	14	60524696	60524696	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr14:60524696G>T	ENST00000445360.1	+	31	4436	c.4232G>T	c.(4231-4233)aGc>aTc	p.S1411I	RP11-16B13.1_ENST00000555432.1_RNA|RP11-16B13.1_ENST00000554123.1_RNA			Q6ZRR7	LRRC9_HUMAN	leucine rich repeat containing 9	1411																	AGTGGATTCAGCCATTACTTG	0.368																																																	0								ENSG00000131951																																			LRRC9	SO:0001583	missense	0			-	HGNC	AK128037		14q23.1	2013-01-29	2003-11-19		ENSG00000131951	ENSG00000131951			19848	other	unknown			"""leucine-rich repeat-containing 9"""				Standard	NR_075071		Approved	FLJ46156	uc001xep.1	Q6ZRR7	OTTHUMG00000028948	ENST00000445360.1:c.4232G>T	14.37:g.60524696G>T	ENSP00000454748:p.Ser1411Ile	Somatic	0	68	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S1411I	ENST00000445360.1	37	c.4232		14																																																																																			-	NULL		0.368	LRRC9-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	LRRC9	protein_coding	OTTHUMT00000072281.3	G		-		60524696	+1	no_errors	ENST00000445360	ensembl	human	novel	74_37	missense	SNP	0.779	T
ARHGAP24	83478	genome.wustl.edu	37	4	86643057	86643057	+	Missense_Mutation	SNP	G	G	A	rs144785317	byFrequency	TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr4:86643057G>A	ENST00000395184.1	+	3	666	c.200G>A	c.(199-201)gGa>gAa	p.G67E	MIR4451_ENST00000580577.1_RNA|ARHGAP24_ENST00000503995.1_Missense_Mutation_p.G67E|ARHGAP24_ENST00000506421.1_3'UTR	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	67	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)			breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		TTTCTGCCTGGAAATAAAGTT	0.343																																																	0								ENSG00000138639	G	GLU/GLY	0,4406		0,0,2203	157.0	156.0	156.0		200	5.0	1.0	4	dbSNP_134	156	8,8592	6.4+/-24.3	0,8,4292	yes	missense	ARHGAP24	NM_001025616.2	98	0,8,6495	AA,AG,GG		0.093,0.0,0.0615	probably-damaging	67/749	86643057	8,12998	2203	4300	6503	ARHGAP24	SO:0001583	missense	0			-	HGNC	AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.200G>A	4.37:g.86643057G>A	ENSP00000378611:p.Gly67Glu	Somatic	0	121	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	56	8.20	Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.G67E	ENST00000395184.1	37	c.200	CCDS34025.1	4	.	.	.	.	.	.	.	.	.	.	G	21.0	4.090071	0.76756	0.0	9.3E-4	ENSG00000138639	ENST00000395184;ENST00000503995	T;T	0.74737	-0.87;-0.87	4.97	4.97	0.65823	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.062753	0.64402	D	0.000006	D	0.84234	0.5427	L	0.58925	1.835	0.80722	D	1	P;D;D	0.89917	0.931;1.0;0.996	P;D;D	0.97110	0.877;1.0;0.93	D	0.85919	0.1445	10	0.87932	D	0	.	17.3669	0.87366	0.0:0.0:1.0:0.0	.	67;67;212	Q8N264;Q8N264-4;Q8N264-5	RHG24_HUMAN;.;.	E	67	ENSP00000378611:G67E;ENSP00000423206:G67E	ENSP00000378611:G67E	G	+	2	0	ARHGAP24	86862081	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	8.196000	0.89725	2.469000	0.83416	0.650000	0.86243	GGA	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.343	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP24	protein_coding	OTTHUMT00000252815.2	G	NM_031305	rs144785317		86643057	+1	no_errors	ENST00000395184	ensembl	human	known	74_37	missense	SNP	1.000	A
NLRP11	204801	genome.wustl.edu	37	19	56329269	56329269	+	Splice_Site	SNP	C	C	T	rs372781070		TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr19:56329269C>T	ENST00000589093.1	-	2	365		c.e2+1		NLRP11_ENST00000360133.3_Splice_Site|NLRP11_ENST00000592953.1_Intron|NLRP11_ENST00000443188.1_Splice_Site|NLRP11_ENST00000589824.2_Splice_Site			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11								ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)	p.?(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		ACCCCACTCACGGTTTCGTCT	0.423																																																	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)						ENSG00000179873	C		0,4406		0,0,2203	90.0	84.0	86.0			1.5	0.3	19		86	1,8599	1.2+/-3.3	0,1,4299	no	splice-5	NLRP11	NM_145007.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077			56329269	1,13005	2203	4300	6503	NLRP11	SO:0001630	splice_region_variant	0			-	HGNC	AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.271+1G>A	19.37:g.56329269C>T		Somatic	0	34	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	13	31.58	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e1+1	ENST00000589093.1	37	c.271+1	CCDS12935.1	19	.	.	.	.	.	.	.	.	.	.	C	8.387	0.838774	0.16891	0.0	1.16E-4	ENSG00000179873	ENST00000443188;ENST00000360133	.	.	.	2.5	1.46	0.22682	.	.	.	.	.	.	.	.	.	.	.	0.37501	D	0.916779	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.2883	0.15714	0.0:0.8339:0.0:0.1661	.	.	.	.	.	-1	.	.	.	-	.	.	NLRP11	61021081	0.341000	0.24801	0.315000	0.25238	0.067000	0.16453	0.513000	0.22770	0.625000	0.30304	0.650000	0.86243	.	-	-		0.423	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP11	protein_coding	OTTHUMT00000453657.1	C	NM_145007	-	Intron	56329269	-1	no_errors	ENST00000443188	ensembl	human	known	74_37	splice_site	SNP	0.359	T
OAZ2	4947	genome.wustl.edu	37	15	64995295	64995295	+	5'UTR	SNP	T	T	C			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr15:64995295T>C	ENST00000326005.6	-	0	185				AC100830.3_ENST00000560387.1_RNA|OAZ2_ENST00000559753.1_5'UTR|OAZ2_ENST00000560258.2_5'UTR|OAZ2_ENST00000560837.1_5'UTR			O95190	OAZ2_HUMAN	ornithine decarboxylase antizyme 2						cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of catalytic activity (GO:0043086)|polyamine biosynthetic process (GO:0006596)|polyamine metabolic process (GO:0006595)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein catabolic process (GO:0045732)|regulation of cellular amino acid metabolic process (GO:0006521)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	ornithine decarboxylase inhibitor activity (GO:0008073)									L-Ornithine(DB00129)	AGGGAGTGGATAGATGGATGA	0.687																																																	0								ENSG00000180304						23.0	32.0	29.0					15																	64995295		1978	4100	6078	OAZ2	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF057297	CCDS58372.1	15q22.31	2006-05-11				ENSG00000180304			8096	protein-coding gene	gene with protein product		604152				9782076, 10352227	Standard	NM_002537		Approved		uc002ano.2	O95190		ENST00000326005.6:c.-48A>G	15.37:g.64995295T>C		Somatic	0	100	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	19	53.66		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000326005.6	37	NULL	CCDS58372.1	15																																																																																			-	-		0.687	OAZ2-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	OAZ2	protein_coding	OTTHUMT00000418707.2	T	NM_002537	-		64995295	-1	no_errors	ENST00000559665	ensembl	human	known	74_37	rna	SNP	1.000	C
ADAM21P1	145241	genome.wustl.edu	37	14	70713565	70713565	+	RNA	SNP	G	G	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr14:70713565G>T	ENST00000530196.1	-	0	953					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		TCTGTTCTATGCTTGTCATTG	0.348																																																	0								ENSG00000235812																																			ADAM21P1			0			-	HGNC			14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70713565G>T		Somatic	1	105	0.94		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	7	80.56		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			-	-		0.348	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	pseudogene	OTTHUMT00000390451.1	G	NG_002467	-		70713565	-1	no_errors	ENST00000530196	ensembl	human	known	74_37	rna	SNP	0.035	T
LINC00052	145978	genome.wustl.edu	37	15	88121520	88121521	+	lincRNA	DEL	TC	TC	-	rs558084890|rs367939444|rs142830514	byFrequency	TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr15:88121520_88121521delTC	ENST00000560153.1	+	0	389_390				RP11-648K4.2_ENST00000560439.1_lincRNA	NR_026869.1		Q96N35	TMM83_HUMAN	long intergenic non-protein coding RNA 52							integral component of membrane (GO:0016021)											tctgtttatgtctctctctctc	0.431																																																	0								ENSG00000259527																																			LINC00052			0				HGNC	AK056023		15q25.3	2012-10-12	2011-08-10	2011-08-10		ENSG00000259527		"""Long non-coding RNAs"""	26455	non-coding RNA	RNA, long non-coding			"""transmembrane protein 83"", ""non-protein coding RNA 52"""	TMEM83, NCRNA00052			Standard	NR_026869		Approved	FLJ31461	uc002bmc.1	Q96N35			15.37:g.88121530_88121531delTC		Somatic	0	85	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000560153.1	37	NULL		15																																																																																			-	-		0.431	LINC00052-002	KNOWN	basic	lincRNA	LINC00052	lincRNA	OTTHUMT00000416151.1	TC	XR_017978			88121521	+1	no_errors	ENST00000560153	ensembl	human	known	74_37	rna	DEL	0.018:0.021	-
UNC45B	146862	genome.wustl.edu	37	17	33491118	33491118	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr17:33491118C>A	ENST00000268876.5	+	9	1181	c.1084C>A	c.(1084-1086)Ctc>Atc	p.L362I	UNC45B_ENST00000378449.1_Missense_Mutation_p.L362I|UNC45B_ENST00000591048.1_Missense_Mutation_p.L362I|UNC45B_ENST00000433649.1_Missense_Mutation_p.L362I|UNC45B_ENST00000394570.2_Missense_Mutation_p.L362I|RP11-799D4.3_ENST00000585646.1_RNA	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	362					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				CATCAACAAGCTCTATGATGA	0.557																																																	0								ENSG00000141161						199.0	185.0	190.0					17																	33491118		2203	4300	6503	UNC45B	SO:0001583	missense	0			-	HGNC	AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.1084C>A	17.37:g.33491118C>A	ENSP00000268876:p.Leu362Ile	Somatic	0	51	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	27	34.15	Q495Q8|Q495Q9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UNC-45/Ring3,superfamily_ARM-type_fold,smart_TPR_repeat,smart_Armadillo,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L362I	ENST00000268876.5	37	c.1084	CCDS11292.1	17	.	.	.	.	.	.	.	.	.	.	C	14.74	2.626709	0.46840	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	4.54	4.54	0.55810	.	0.125169	0.53938	D	0.000055	T	0.57519	0.2059	L	0.47716	1.5	0.40657	D	0.982096	P;D;D	0.89917	0.938;1.0;0.977	P;D;P	0.87578	0.69;0.998;0.896	T	0.50890	-0.8774	10	0.05959	T	0.93	-14.5627	16.8198	0.85743	0.0:1.0:0.0:0.0	.	362;362;362	Q8IWX7-2;Q8IWX7-3;Q8IWX7	.;.;UN45B_HUMAN	I	362	ENSP00000378071:L362I;ENSP00000268876:L362I;ENSP00000412840:L362I;ENSP00000367710:L362I	ENSP00000268876:L362I	L	+	1	0	UNC45B	30515231	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	4.653000	0.61462	2.530000	0.85305	0.561000	0.74099	CTC	-	pfam_UNC-45/Ring3		0.557	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UNC45B	protein_coding	OTTHUMT00000256458.2	C	NM_173167	-		33491118	+1	no_errors	ENST00000268876	ensembl	human	known	74_37	missense	SNP	1.000	A
C15orf61	145853	genome.wustl.edu	37	15	67813895	67813895	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr15:67813895G>C	ENST00000342683.4	+	1	490	c.309G>C	c.(307-309)caG>caC	p.Q103H	C15orf61_ENST00000557807.1_5'Flank|IQCH-AS1_ENST00000559298.1_lincRNA	NM_001143936.1	NP_001137408.1	A6NNL5	CO061_HUMAN	chromosome 15 open reading frame 61	103						extracellular region (GO:0005576)											TGGCCCGGCAGAACCGCTTCT	0.701																																																	0								ENSG00000189227						10.0	12.0	11.0					15																	67813895		686	1588	2274	C15orf61	SO:0001583	missense	0			-	HGNC		CCDS45289.1	15q23	2012-09-27			ENSG00000189227	ENSG00000189227			34453	protein-coding gene	gene with protein product							Standard	NM_001143936		Approved	LOC145853	uc002aqs.3	A6NNL5		ENST00000342683.4:c.309G>C	15.37:g.67813895G>C	ENSP00000342254:p.Gln103His	Somatic	0	63	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	32	20.93	B4DFB2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q103H	ENST00000342683.4	37	c.309	CCDS45289.1	15	.	.	.	.	.	.	.	.	.	.	G	10.06	1.246881	0.22796	.	.	ENSG00000189227	ENST00000342683	.	.	.	4.84	3.91	0.45181	.	0.083033	0.48286	D	0.000195	T	0.39708	0.1088	N	0.16478	0.41	0.80722	D	1	B	0.17667	0.023	B	0.18871	0.023	T	0.28650	-1.0037	9	0.56958	D	0.05	-16.2834	9.2868	0.37762	0.0781:0.1444:0.7775:0.0	.	103	A6NNL5	CO061_HUMAN	H	103	.	ENSP00000342254:Q103H	Q	+	3	2	C15orf61	65600949	1.000000	0.71417	0.965000	0.40720	0.014000	0.08584	1.134000	0.31442	1.234000	0.43709	0.563000	0.77884	CAG	-	NULL		0.701	C15orf61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf61	protein_coding	OTTHUMT00000417492.1	G	NM_001143936	-		67813895	+1	no_errors	ENST00000342683	ensembl	human	known	74_37	missense	SNP	0.997	C
ATM	472	genome.wustl.edu	37	11	108192088	108192088	+	Silent	SNP	C	C	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr11:108192088C>T	ENST00000452508.2	+	46	6702	c.6513C>T	c.(6511-6513)ccC>ccT	p.P2171P	C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Silent_p.P2171P			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2171	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CGCTCTATCCCACACTTAGCA	0.418			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0								ENSG00000149311						175.0	163.0	167.0					11																	108192088		2201	4298	6499	ATM	SO:0001819	synonymous_variant	0	Familial Cancer Database	AT, Louis-Bar syndrome	-	HGNC	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.6513C>T	11.37:g.108192088C>T		Somatic	0	79	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.P2171	ENST00000452508.2	37	c.6513	CCDS31669.1	11																																																																																			-	pfam_PIK-rel_kinase_FAT,superfamily_ARM-type_fold,pfscan_PIK_FAT		0.418	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	protein_coding	OTTHUMT00000389938.1	C	NM_000051	-		108192088	+1	no_errors	ENST00000278616	ensembl	human	known	74_37	silent	SNP	0.001	T
GARNL3	84253	genome.wustl.edu	37	9	130005414	130005414	+	IGR	SNP	G	G	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr9:130005414G>A								RALGPS1 (19971 upstream) : GARNL3 (20526 downstream)																							GTGCCTTGTGGGAGTCAGATA	0.522																																																	0								ENSG00000136895						35.0	32.0	33.0					9																	130005414		876	1991	2867	GARNL3	SO:0001628	intergenic_variant	0			-	HGNC																													9.37:g.130005414G>A		Somatic	0	64	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	33	13.16		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G10E		37	c.29		9	.	.	.	.	.	.	.	.	.	.	G	13.13	2.145828	0.37923	.	.	ENSG00000136895	ENST00000439286;ENST00000444677;ENST00000446764;ENST00000373399	T;T	0.43688	1.94;0.94	4.79	3.88	0.44766	.	.	.	.	.	T	0.44052	0.1275	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.19031	-1.0318	5	.	.	.	.	8.0103	0.30349	0.107:0.0:0.893:0.0	.	.	.	.	E	10	ENSP00000400579:G10E;ENSP00000411160:G10E	.	G	+	2	0	GARNL3	129045235	1.000000	0.71417	1.000000	0.80357	0.561000	0.35649	2.716000	0.47219	2.582000	0.87167	0.557000	0.71058	GGG	-	NULL	0	0.522					GARNL3			G		-		130005414	+1	no_errors	ENST00000429629	ensembl	human	known	74_37	missense	SNP	1.000	A
TMEM78	677790	genome.wustl.edu	37	1	229385670	229385671	+	Frame_Shift_Del	DEL	TC	TC	-	rs71561726|rs140311590|rs35330340	byFrequency	TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr1:229385670_229385671delTC	ENST00000323223.2	+	1	288_289	c.229_230delTC	c.(229-231)tctfs	p.S77fs				Q5T7P6	TMM78_HUMAN	transmembrane protein 78	77						integral component of membrane (GO:0016021)											tctctctctttctctctttctt	0.465														787	0.157149	0.2648	0.0937	5008	,	,		19793	0.0833		0.1431	False		,,,				2504	0.1472																0								ENSG00000177800																																			TMEM78	SO:0001589	frameshift_variant	0				HGNC	AK097487		1q42.13	2008-08-27			ENSG00000177800	ENSG00000177800			32307	protein-coding gene	gene with protein product							Standard			Approved	FLJ40168		Q5T7P6	OTTHUMG00000037629	ENST00000323223.2:c.229_230delTC	1.37:g.229385674_229385675delTC	ENSP00000324799:p.Ser77fs	Somatic	0	15	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	7	30.00	Q8N802	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.F79fs	ENST00000323223.2	37	c.229_230		1																																																																																			-	NULL		0.465	TMEM78-001	KNOWN	basic|appris_principal	protein_coding	TMEM78	protein_coding	OTTHUMT00000091730.2	TC				229385671	+1	no_errors	ENST00000323223	ensembl	human	known	74_37	frame_shift_del	DEL	0.029:0.021	-
EPHA8	2046	genome.wustl.edu	37	1	22925406	22925406	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr1:22925406T>C	ENST00000166244.3	+	13	2326	c.2254T>C	c.(2254-2256)Tca>Cca	p.S752P		NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	752	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GCGCTACCTCTCAGACCTGGG	0.627																																																	0								ENSG00000070886						71.0	59.0	63.0					1																	22925406		2202	4300	6502	EPHA8	SO:0001583	missense	0			-	HGNC	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.2254T>C	1.37:g.22925406T>C	ENSP00000166244:p.Ser752Pro	Somatic	0	77	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	30	37.50	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.S752P	ENST00000166244.3	37	c.2254	CCDS225.1	1	.	.	.	.	.	.	.	.	.	.	T	19.12	3.765411	0.69878	.	.	ENSG00000070886	ENST00000166244	T	0.62498	0.02	4.21	3.05	0.35203	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.074223	0.56097	D	0.000032	T	0.73705	0.3621	M	0.76727	2.345	0.80722	D	1	D	0.69078	0.997	D	0.63113	0.911	T	0.75156	-0.3417	10	0.87932	D	0	.	10.0649	0.42297	0.0:0.0:0.1696:0.8304	.	752	P29322	EPHA8_HUMAN	P	752	ENSP00000166244:S752P	ENSP00000166244:S752P	S	+	1	0	EPHA8	22797993	1.000000	0.71417	0.989000	0.46669	0.992000	0.81027	3.213000	0.51153	0.742000	0.32697	0.454000	0.30748	TCA	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.627	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA8	protein_coding	OTTHUMT00000008085.1	T	NM_020526	-		22925406	+1	no_errors	ENST00000166244	ensembl	human	known	74_37	missense	SNP	1.000	C
MARK1	4139	genome.wustl.edu	37	1	220825491	220825491	+	Splice_Site	SNP	G	G	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr1:220825491G>A	ENST00000366917.4	+	15	2001	c.1735G>A	c.(1735-1737)Ggt>Agt	p.G579S	MARK1_ENST00000402574.1_Splice_Site_p.G444S|MARK1_ENST00000366918.4_Splice_Site_p.G557S					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		TTACCGGCCTGGGTAATGTGT	0.428																																																	0								ENSG00000116141						115.0	108.0	110.0					1																	220825491		2203	4300	6503	MARK1	SO:0001630	splice_region_variant	0			-	HGNC	AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.1736+1G>A	1.37:g.220825491G>A		Somatic	0	63	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	32	20.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KA1_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.G579S	ENST00000366917.4	37	c.1735	CCDS31029.2	1	.	.	.	.	.	.	.	.	.	.	G	9.737	1.163771	0.21538	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.27402	1.67;1.67;1.67	5.74	3.88	0.44766	.	0.543405	0.20470	N	0.091706	T	0.10637	0.0260	N	0.03194	-0.395	0.35344	D	0.786768	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.0;0.001	T	0.23190	-1.0195	10	0.02654	T	1	.	7.4892	0.27452	0.3546:0.0:0.6454:0.0	.	579;444;579;557	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	S	444;557;579	ENSP00000386017:G444S;ENSP00000355885:G557S;ENSP00000355884:G579S	ENSP00000355884:G579S	G	+	1	0	MARK1	218892114	0.999000	0.42202	1.000000	0.80357	0.950000	0.60333	1.932000	0.40143	0.892000	0.36259	0.563000	0.77884	GGT	-	NULL		0.428	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	protein_coding	OTTHUMT00000090899.1	G		-	Missense_Mutation	220825491	+1	no_errors	ENST00000366917	ensembl	human	known	74_37	missense	SNP	1.000	A
ARSD	414	genome.wustl.edu	37	X	2825157	2825158	+	3'UTR	INS	-	-	AAAA	rs10634744|rs397742096		TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chrX:2825157_2825158insAAAA	ENST00000381154.1	-	0	2011_2012				ARSD-AS1_ENST00000414053.1_RNA	NM_001669.3	NP_001660.2	P51689	ARSD_HUMAN	arylsulfatase D						cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			large_intestine(3)|lung(3)	6		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				cactctgtctcaaaaaagaaag	0.505														717	0.189934	0.1566	0.036	3775	,	,		18580	0.3155		0.0338	False		,,,				2504	0.136																0								ENSG00000006756																																			ARSD	SO:0001624	3_prime_UTR_variant	0				HGNC	X83572	CCDS35196.1	Xp22.3	2013-02-14			ENSG00000006756	ENSG00000006756		"""Arylsulfatase family"""	717	protein-coding gene	gene with protein product		300002				7720070	Standard	NM_001669		Approved		uc004cqy.3	P51689	OTTHUMG00000021077	ENST00000381154.1:c.*155->TTTT	X.37:g.2825158_2825161dupAAAA		Somatic	0	10	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29	Q9UHJ8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000381154.1	37	NULL	CCDS35196.1	X																																																																																			-	-		0.505	ARSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSD	protein_coding	OTTHUMT00000055636.1	-				2825158	-1	no_errors	ENST00000495294	ensembl	human	known	74_37	rna	INS	0.277:0.277	AAAA
DHRS13	147015	genome.wustl.edu	37	17	27225817	27225817	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr17:27225817C>G	ENST00000378895.4	-	5	902	c.776G>C	c.(775-777)aGa>aCa	p.R259T	DHRS13_ENST00000426464.2_Missense_Mutation_p.R178T|DHRS13_ENST00000581974.1_5'Flank|DHRS13_ENST00000394901.3_Missense_Mutation_p.R209T|FLOT2_ENST00000394908.4_5'Flank|FLOT2_ENST00000394906.2_5'Flank|RP11-20B24.4_ENST00000580603.1_RNA|FLOT2_ENST00000577789.1_5'Flank|FLOT2_ENST00000585169.1_5'Flank|RP11-20B24.4_ENST00000579187.1_RNA	NM_144683.3	NP_653284.2	Q6UX07	DHR13_HUMAN	dehydrogenase/reductase (SDR family) member 13	259						extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	9	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.59e-06)|all cancers(11;9.27e-06)|BRCA - Breast invasive adenocarcinoma(11;5.78e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			GGCACCCCCTCTTGGTGCCCG	0.602																																																	0								ENSG00000167536						13.0	14.0	14.0					17																	27225817		2203	4297	6500	DHRS13	SO:0001583	missense	0			-	HGNC	BC015582	CCDS11246.2	17q11.2	2011-09-14			ENSG00000167536	ENSG00000167536	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	28326	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 5"""					12975309, 19027726	Standard	NM_144683		Approved	MGC23280, SDR7C5	uc002hde.4	Q6UX07	OTTHUMG00000132678	ENST00000378895.4:c.776G>C	17.37:g.27225817C>G	ENSP00000368173:p.Arg259Thr	Somatic	0	72	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	41	32.79	Q96BH7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH	p.R259T	ENST00000378895.4	37	c.776	CCDS11246.2	17	.	.	.	.	.	.	.	.	.	.	C	13.06	2.122933	0.37436	.	.	ENSG00000167536	ENST00000378895;ENST00000394901;ENST00000426464	D;D;D	0.89415	-2.51;-2.51;-2.51	5.48	0.619	0.17630	NAD(P)-binding domain (1);	0.840788	0.11162	N	0.592920	T	0.80270	0.4592	L	0.39898	1.24	0.09310	N	1	B;B	0.26547	0.152;0.039	B;B	0.24006	0.05;0.023	T	0.67063	-0.5765	10	0.44086	T	0.13	.	1.798	0.03065	0.1341:0.434:0.2118:0.22	.	178;259	B4DJC5;Q6UX07	.;DHR13_HUMAN	T	259;209;178	ENSP00000368173:R259T;ENSP00000378361:R209T;ENSP00000412826:R178T	ENSP00000368173:R259T	R	-	2	0	DHRS13	24249943	0.000000	0.05858	0.320000	0.25306	0.954000	0.61252	0.087000	0.14958	0.133000	0.18654	0.561000	0.74099	AGA	-	NULL		0.602	DHRS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRS13	protein_coding	OTTHUMT00000255952.1	C	NM_144683	-		27225817	-1	no_errors	ENST00000378895	ensembl	human	known	74_37	missense	SNP	0.001	G
CA3	761	genome.wustl.edu	37	8	86351943	86351943	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr8:86351943C>A	ENST00000285381.2	+	2	120	c.37C>A	c.(37-39)Cct>Act	p.P13T	RP11-317J10.2_ENST00000517697.1_RNA|RP11-317J10.2_ENST00000521761.1_RNA	NM_005181.3	NP_005172.1	P07451	CAH3_HUMAN	carbonic anhydrase III, muscle specific	13					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|response to ethanol (GO:0045471)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	carbonate dehydratase activity (GO:0004089)|nickel cation binding (GO:0016151)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23					Acetazolamide(DB00819)|Zonisamide(DB00909)	TTTCCTAGGTCCTGACCACTG	0.473																																																	0								ENSG00000164879						50.0	49.0	49.0					8																	86351943		2203	4300	6503	CA3	SO:0001583	missense	0			-	HGNC	AJ006473	CCDS6238.1	8q21.2	2012-10-02					4.2.1.1	"""Carbonic anhydrases"""	1374	protein-coding gene	gene with protein product		114750				6221502	Standard	NM_005181		Approved	Car3, CAIII	uc003ydj.3	P07451		ENST00000285381.2:c.37C>A	8.37:g.86351943C>A	ENSP00000285381:p.Pro13Thr	Somatic	0	43	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	39	25.00	B2R867|B3KUC8|O60842	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.P13T	ENST00000285381.2	37	c.37	CCDS6238.1	8	.	.	.	.	.	.	.	.	.	.	C	23.3	4.396744	0.83120	.	.	ENSG00000164879	ENST00000285381;ENST00000426378	T	0.56444	0.46	5.75	5.75	0.90469	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	D	0.82861	0.5129	H	0.96662	3.86	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88214	0.2892	10	0.87932	D	0	-18.9902	18.9294	0.92558	0.0:1.0:0.0:0.0	.	13	P07451	CAH3_HUMAN	T	13	ENSP00000285381:P13T	ENSP00000285381:P13T	P	+	1	0	CA3	86539195	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	6.993000	0.76245	2.706000	0.92434	0.603000	0.83216	CCT	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a		0.473	CA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA3	protein_coding	OTTHUMT00000381090.1	C	NM_005181	-		86351943	+1	no_errors	ENST00000285381	ensembl	human	known	74_37	missense	SNP	1.000	A
NEURL4	84461	genome.wustl.edu	37	17	7230036	7230036	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr17:7230036C>T	ENST00000399464.2	-	4	1101	c.1086G>A	c.(1084-1086)atG>atA	p.M362I	NEURL4_ENST00000570460.1_Missense_Mutation_p.M340I|NEURL4_ENST00000315614.7_Missense_Mutation_p.M362I	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	362	NHR 2. {ECO:0000255|PROSITE- ProRule:PRU00400}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						ACACCTCAAACATCTCATTGT	0.557																																																	0								ENSG00000215041						36.0	37.0	37.0					17																	7230036		1951	4140	6091	NEURL4	SO:0001583	missense	0			-	HGNC		CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.1086G>A	17.37:g.7230036C>T	ENSP00000382390:p.Met362Ile	Somatic	0	29	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	50	15.25	Q6GPI8|Q96IU9|Q9H0B0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neu_Z,superfamily_ConA-like_lec_gl_sf,smart_Neu_Z,pfscan_Neu_Z	p.M362I	ENST00000399464.2	37	c.1086	CCDS42251.1	17	.	.	.	.	.	.	.	.	.	.	C	22.3	4.266153	0.80358	.	.	ENSG00000215041	ENST00000315614;ENST00000399464	T;T	0.31510	1.5;1.49	4.79	4.79	0.61399	NEUZ (3);	0.000000	0.85682	D	0.000000	T	0.18593	0.0446	N	0.04355	-0.22	0.48830	D	0.999717	B;B	0.20052	0.041;0.027	B;B	0.28385	0.054;0.089	T	0.09378	-1.0677	10	0.51188	T	0.08	-29.8545	15.2186	0.73292	0.0:1.0:0.0:0.0	.	362;362	Q96JN8-2;Q96JN8	.;NEUL4_HUMAN	I	362	ENSP00000319826:M362I;ENSP00000382390:M362I	ENSP00000319826:M362I	M	-	3	0	NEURL4	7170760	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.127000	0.77210	2.653000	0.90120	0.655000	0.94253	ATG	-	pfam_Neu_Z,smart_Neu_Z,pfscan_Neu_Z		0.557	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEURL4	protein_coding	OTTHUMT00000255434.2	C	NM_032442	-		7230036	-1	no_errors	ENST00000399464	ensembl	human	known	74_37	missense	SNP	1.000	T
UBTD2	92181	genome.wustl.edu	37	5	171706280	171706280	+	Intron	SNP	G	G	C			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr5:171706280G>C	ENST00000393792.2	-	1	476				AC008671.1_ENST00000410800.1_RNA	NM_152277.2	NP_689490.2	Q8WUN7	UBTD2_HUMAN	ubiquitin domain containing 2							cytoplasm (GO:0005737)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)|skin(1)	10	Renal(175;0.000159)|Lung NSC(126;0.00976)|all_lung(126;0.0156)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ttgcactaacgtaataactgc	0.328																																																	0								ENSG00000222732																																			AC008671.1	SO:0001627	intron_variant	0			-	Clone_based_ensembl_gene	AF251700	CCDS4379.2	5q35.1	2008-10-30			ENSG00000168246	ENSG00000168246			24463	protein-coding gene	gene with protein product	"""dendritic cell derived ubiquitin like protein"""	610174				12507522	Standard	NM_152277		Approved	DC-UbP, MGC30022	uc003mbp.1	Q8WUN7	OTTHUMG00000130519	ENST00000393792.2:c.70+4319C>G	5.37:g.171706280G>C		Somatic	0	57	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	25	39.53	Q8TDQ3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000393792.2	37	NULL	CCDS4379.2	5																																																																																			-	-		0.328	UBTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000222732	protein_coding	OTTHUMT00000252936.1	G	NM_152277	-		171706280	+1	no_errors	ENST00000410800	ensembl	human	novel	74_37	rna	SNP	0.000	C
SMG7	9887	genome.wustl.edu	37	1	183520047	183520047	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr1:183520047G>C	ENST00000347615.2	+	20	3264	c.3145G>C	c.(3145-3147)Gat>Cat	p.D1049H	SMG7_ENST00000456731.2_Missense_Mutation_p.D961H|SMG7_ENST00000367537.3_Missense_Mutation_p.D1082H|SMG7_ENST00000508461.1_Missense_Mutation_p.D1057H|SMG7_ENST00000507469.1_Missense_Mutation_p.D1053H|SMG7_ENST00000515829.2_Missense_Mutation_p.D1003H	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	1049					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						GTGGAAAACTGATAAGCCAGG	0.438																																																	0								ENSG00000116698						78.0	77.0	77.0					1																	183520047		2203	4300	6503	SMG7	SO:0001583	missense	0			-	HGNC	D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.3145G>C	1.37:g.183520047G>C	ENSP00000340766:p.Asp1049His	Somatic	0	56	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	95	8.65	B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EST1	p.D1053H	ENST00000347615.2	37	c.3157	CCDS1355.1	1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.715284	0.89112	.	.	ENSG00000116698	ENST00000456731;ENST00000367537;ENST00000508461;ENST00000347615;ENST00000507469;ENST00000515829	T;T;T;T;T;T	0.25414	1.86;1.85;1.8;1.85;1.84;1.85	5.34	5.34	0.76211	.	0.153413	0.56097	D	0.000025	T	0.35537	0.0935	N	0.24115	0.695	0.58432	D	0.999996	D;D;P;D;D	0.60575	0.966;0.966;0.95;0.966;0.988	P;P;P;P;P	0.58577	0.751;0.751;0.824;0.751;0.841	T	0.16571	-1.0398	10	0.72032	D	0.01	-13.4611	19.4085	0.94658	0.0:0.0:1.0:0.0	.	1057;961;1003;1049;1053	E9PCI0;E9PCE5;Q92540-2;Q92540;E9PEH2	.;.;.;SMG7_HUMAN;.	H	961;1082;1057;1049;1053;1003	ENSP00000407629:D961H;ENSP00000356507:D1082H;ENSP00000426915:D1057H;ENSP00000340766:D1049H;ENSP00000425133:D1053H;ENSP00000421358:D1003H	ENSP00000340766:D1049H	D	+	1	0	SMG7	181786670	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.100000	0.76989	2.637000	0.89404	0.650000	0.86243	GAT	-	NULL		0.438	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SMG7	protein_coding	OTTHUMT00000085432.1	G	NM_014837	-		183520047	+1	no_errors	ENST00000507469	ensembl	human	known	74_37	missense	SNP	1.000	C
RFX6	222546	genome.wustl.edu	37	6	117249984	117249984	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr6:117249984C>A	ENST00000332958.2	+	18	2477	c.2461C>A	c.(2461-2463)Cac>Aac	p.H821N		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	821					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						GGTGAATCAGCACGTTTCTGT	0.438																																																	0								ENSG00000185002						163.0	143.0	150.0					6																	117249984		2203	4300	6503	RFX6	SO:0001583	missense	0			-	HGNC	BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.2461C>A	6.37:g.117249984C>A	ENSP00000332208:p.His821Asn	Somatic	0	94	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	2	90.91	Q5T6B3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA-bd_RFX	p.H821N	ENST00000332958.2	37	c.2461	CCDS5113.1	6	.	.	.	.	.	.	.	.	.	.	C	24.5	4.539750	0.85917	.	.	ENSG00000185002	ENST00000332958	T	0.60797	0.16	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.63686	0.2532	L	0.34521	1.04	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	T	0.65998	-0.6032	10	0.72032	D	0.01	-21.5527	20.0442	0.97604	0.0:1.0:0.0:0.0	.	821	Q8HWS3	RFX6_HUMAN	N	821	ENSP00000332208:H821N	ENSP00000332208:H821N	H	+	1	0	RFX6	117356677	1.000000	0.71417	0.715000	0.30552	0.802000	0.45316	7.398000	0.79919	2.814000	0.96858	0.655000	0.94253	CAC	-	NULL		0.438	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX6	protein_coding	OTTHUMT00000041970.2	C	NM_173560	-		117249984	+1	no_errors	ENST00000332958	ensembl	human	known	74_37	missense	SNP	1.000	A
RECK	8434	genome.wustl.edu	37	9	36108140	36108140	+	Missense_Mutation	SNP	A	A	G	rs199710956		TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr9:36108140A>G	ENST00000377966.3	+	14	2310	c.1744A>G	c.(1744-1746)Att>Gtt	p.I582V		NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	582					blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			GAAGTCTTGTATTGTTGGAGG	0.338																																																	0								ENSG00000122707	A	VAL/ILE	0,4406		0,0,2203	81.0	74.0	77.0		1744	5.4	1.0	9		77	4,8596	3.7+/-12.6	0,4,4296	yes	missense	RECK	NM_021111.2	29	0,4,6499	GG,GA,AA		0.0465,0.0,0.0308	benign	582/972	36108140	4,13002	2203	4300	6503	RECK	SO:0001583	missense	0			-	HGNC	E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.1744A>G	9.37:g.36108140A>G	ENSP00000367202:p.Ile582Val	Somatic	0	105	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	48	9.43	B2RNS1|Q5W0K6|Q8WX37	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kazal_dom,superfamily_Prot_inh_PMP,smart_Kazal_dom	p.I582V	ENST00000377966.3	37	c.1744	CCDS6597.1	9	.	.	.	.	.	.	.	.	.	.	A	7.210	0.595175	0.13875	0.0	4.65E-4	ENSG00000122707	ENST00000377966	T	0.42131	0.98	5.38	5.38	0.77491	.	0.117864	0.64402	D	0.000016	T	0.22085	0.0532	N	0.04508	-0.205	0.33986	D	0.648569	B;B	0.18166	0.026;0.026	B;B	0.16289	0.015;0.015	T	0.25467	-1.0131	10	0.22706	T	0.39	-16.5417	13.6181	0.62121	1.0:0.0:0.0:0.0	.	582;582	A8K9D8;O95980	.;RECK_HUMAN	V	582	ENSP00000367202:I582V	ENSP00000367202:I582V	I	+	1	0	RECK	36098140	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.586000	0.67503	2.162000	0.67917	0.528000	0.53228	ATT	-	NULL		0.338	RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECK	protein_coding	OTTHUMT00000052409.1	A		rs199710956		36108140	+1	no_errors	ENST00000377966	ensembl	human	known	74_37	missense	SNP	1.000	G
CHRNB4	1143	genome.wustl.edu	37	15	78921713	78921713	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr15:78921713T>A	ENST00000261751.3	-	5	1045	c.934A>T	c.(934-936)Acc>Tcc	p.T312S	CHRNB4_ENST00000560511.1_5'Flank|RP11-335K5.2_ENST00000559120.1_RNA|CHRNB4_ENST00000412074.2_Intron	NM_000750.3	NP_000741.1	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4 (neuronal)	312					action potential (GO:0001508)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|regulation of neurotransmitter secretion (GO:0046928)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			endometrium(7)|kidney(1)|lung(13)|prostate(1)	22					Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)	CAGACGCTGGTGACGATGGAG	0.597																																																	0								ENSG00000117971						133.0	108.0	117.0					15																	78921713		2196	4293	6489	CHRNB4	SO:0001583	missense	0			-	HGNC	U48861	CCDS10306.1, CCDS58392.1	15q24	2012-02-11	2012-02-07		ENSG00000117971	ENSG00000117971		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1964	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 4 (neuronal)"""	118509	"""cholinergic receptor, nicotinic, beta polypeptide 4"""			2004777	Standard	NM_000750		Approved		uc002bed.1	P30926	OTTHUMG00000143860	ENST00000261751.3:c.934A>T	15.37:g.78921713T>A	ENSP00000261751:p.Thr312Ser	Somatic	0	83	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	33	34.00	A4FTX5|E9PHE8|Q16607|Q4VBA5|Q8WXC8|Q9BQR4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.T312S	ENST00000261751.3	37	c.934	CCDS10306.1	15	.	.	.	.	.	.	.	.	.	.	T	27.0	4.790046	0.90367	.	.	ENSG00000117971	ENST00000261751	D	0.85556	-2.0	5.57	5.57	0.84162	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.85605	0.5735	L	0.37466	1.105	0.80722	D	1	P	0.45212	0.853	P	0.51415	0.669	D	0.86949	0.2084	10	0.62326	D	0.03	.	15.7134	0.77649	0.0:0.0:0.0:1.0	.	312	P30926	ACHB4_HUMAN	S	312	ENSP00000261751:T312S	ENSP00000261751:T312S	T	-	1	0	CHRNB4	76708768	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	7.987000	0.88182	2.130000	0.65690	0.533000	0.62120	ACC	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel		0.597	CHRNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB4	protein_coding	OTTHUMT00000290108.1	T		-		78921713	-1	no_errors	ENST00000261751	ensembl	human	known	74_37	missense	SNP	1.000	A
UNC5B	219699	genome.wustl.edu	37	10	72975564	72975571	+	Intron	DEL	GTGTGTGT	GTGTGTGT	-	rs61070575|rs55848098|rs201949769|rs151276494|rs55906066|rs72091766|rs71924552		TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	GTGTGTGT	GTGTGTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr10:72975564_72975571delGTGTGTGT	ENST00000335350.6	+	1	495				UNC5B_ENST00000373192.4_Intron|UNC5B-AS1_ENST00000447119.2_RNA|UNC5B-AS1_ENST00000449737.1_RNA|AL359832.1_ENST00000401185.1_RNA	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)						anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						TCTCTGCTTGgtgtgtgtgtgtgtgtgt	0.481																																																	0								ENSG00000216004																																			AL359832.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.79+2743GTGTGTGT>-	10.37:g.72975572_72975579delGTGTGTGT		Somatic	NA	NA	NA		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000335350.6	37	NULL	CCDS7309.1	10																																																																																			-	-		0.481	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216004	protein_coding	OTTHUMT00000048541.1	GTGTGTGT	NM_170744			72975571	+1	no_errors	ENST00000401185	ensembl	human	novel	74_37	rna	DEL	0.024:0.453:0.476:0.522:0.594:0.095:0.090:0.011	-
CHSY3	337876	genome.wustl.edu	37	5	129521365	129521365	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr5:129521365C>T	ENST00000305031.4	+	3	2888	c.2530C>T	c.(2530-2532)Cct>Tct	p.P844S		NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	844					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		TAACTTGGACCCTAAGCAGTA	0.428																																																	0								ENSG00000198108						83.0	81.0	81.0					5																	129521365		2203	4300	6503	CHSY3	SO:0001583	missense	0			-	HGNC	AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.2530C>T	5.37:g.129521365C>T	ENSP00000302629:p.Pro844Ser	Somatic	0	44	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	12	40.00	B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Chond_GalNAc,pfam_Fringe-like	p.P844S	ENST00000305031.4	37	c.2530	CCDS34223.1	5	.	.	.	.	.	.	.	.	.	.	C	12.43	1.936547	0.34189	.	.	ENSG00000198108	ENST00000305031	T	0.14640	2.49	4.06	4.06	0.47325	.	0.000000	0.48286	D	0.000198	T	0.16854	0.0405	L	0.57536	1.79	0.52501	D	0.999956	B	0.29341	0.242	B	0.29663	0.105	T	0.05920	-1.0856	9	.	.	.	.	17.5595	0.87902	0.0:1.0:0.0:0.0	.	844	Q70JA7	CHSS3_HUMAN	S	844	ENSP00000302629:P844S	.	P	+	1	0	CHSY3	129549264	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.845000	0.62853	2.557000	0.86248	0.650000	0.86243	CCT	-	pfam_Chond_GalNAc		0.428	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHSY3	protein_coding	OTTHUMT00000371453.1	C	NM_175856	-		129521365	+1	no_errors	ENST00000305031	ensembl	human	known	74_37	missense	SNP	1.000	T
DFNB31	25861	genome.wustl.edu	37	9	117240969	117240969	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr9:117240969T>A	ENST00000362057.3	-	2	869	c.701A>T	c.(700-702)tAc>tTc	p.Y234F	DFNB31_ENST00000374057.3_Missense_Mutation_p.Y234F|DFNB31_ENST00000265134.6_5'UTR	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	234					inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CACCCAGGTGTAGATGTGGTT	0.667																																																	0								ENSG00000095397						38.0	36.0	37.0					9																	117240969		2203	4300	6503	DFNB31	SO:0001583	missense	0			-	HGNC	AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.701A>T	9.37:g.117240969T>A	ENSP00000354623:p.Tyr234Phe	Somatic	0	96	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	55	34.52	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.Y234F	ENST00000362057.3	37	c.701	CCDS6806.1	9	.	.	.	.	.	.	.	.	.	.	T	28.1	4.890673	0.91889	.	.	ENSG00000095397	ENST00000362057;ENST00000374057	T;T	0.16743	2.32;2.32	5.53	5.53	0.82687	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.39517	0.1081	M	0.69823	2.125	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.993;0.995	T	0.17077	-1.0381	10	0.16896	T	0.51	-23.1489	15.6591	0.77169	0.0:0.0:0.0:1.0	.	234;234;234	Q9P202-2;B9EGE6;Q9P202	.;.;WHRN_HUMAN	F	234	ENSP00000354623:Y234F;ENSP00000363170:Y234F	ENSP00000354623:Y234F	Y	-	2	0	DFNB31	116280790	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.630000	0.83225	2.097000	0.63578	0.374000	0.22700	TAC	-	superfamily_PDZ		0.667	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DFNB31	protein_coding	OTTHUMT00000053776.2	T	NM_015404	-		117240969	-1	no_errors	ENST00000362057	ensembl	human	known	74_37	missense	SNP	1.000	A
PCDHGA8	9708	genome.wustl.edu	37	5	140773965	140773965	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr5:140773965C>A	ENST00000398604.2	+	1	1585	c.1585C>A	c.(1585-1587)Cag>Aag	p.Q529K	PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	529	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGAGACCTGCAGCTACTGGT	0.592																																																	0								ENSG00000253767						78.0	92.0	87.0					5																	140773965		2197	4300	6497	PCDHGA8	SO:0001583	missense	0			-	HGNC	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.1585C>A	5.37:g.140773965C>A	ENSP00000381605:p.Gln529Lys	Somatic	0	86	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	18	45.45	A7MCZ4|O15039	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q529K	ENST00000398604.2	37	c.1585	CCDS47291.1	5	.	.	.	.	.	.	.	.	.	.	.	1.482	-0.557044	0.03967	.	.	ENSG00000253767	ENST00000398604	T	0.50277	0.75	5.06	3.12	0.35913	Cadherin (5);Cadherin-like (1);	0.000000	0.29932	U	0.010828	T	0.44685	0.1305	M	0.62723	1.935	0.09310	N	1	B;B	0.16802	0.019;0.016	B;B	0.20384	0.029;0.017	T	0.36962	-0.9726	10	0.32370	T	0.25	.	13.0053	0.58701	0.2933:0.7067:0.0:0.0	.	529;529	Q9Y5G5;Q9Y5G5-2	PCDG8_HUMAN;.	K	529	ENSP00000381605:Q529K	ENSP00000381605:Q529K	Q	+	1	0	PCDHGA8	140754149	0.000000	0.05858	0.018000	0.16275	0.001000	0.01503	-0.367000	0.07553	1.105000	0.41606	0.655000	0.94253	CAG	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.592	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA8	protein_coding	OTTHUMT00000376972.1	C	NM_032088	-		140773965	+1	no_errors	ENST00000398604	ensembl	human	known	74_37	missense	SNP	0.051	A
MIR205HG	642587	genome.wustl.edu	37	1	209605637	209605648	+	lincRNA	DEL	AGCAGCAGCAGC	AGCAGCAGCAGC	-	rs71788170|rs74820836|rs150848171|rs3842530		TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	AGCAGCAGCAGC	AGCAGCAGCAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr1:209605637_209605648delAGCAGCAGCAGC	ENST00000384891.1	+	0	220					NR_029622.1				MIR205 host gene (non-protein coding)																		ccaccaccgTagcagcagcagcagcagcagca	0.561																																																	0								ENSG00000230937																																			MIR205HG			0				HGNC			1q32.2	2014-02-12	2011-11-07		ENSG00000230937	ENSG00000230937		"""Long non-coding RNAs"""	43562	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 510"""						Standard	NM_001104548		Approved	LINC00510	uc009xcn.3		OTTHUMG00000036267		1.37:g.209605637_209605648delAGCAGCAGCAGC		Somatic	NA	NA	NA		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000384891.1	37	NULL		1																																																																																			-	-		0.561	MIR205HG-202	KNOWN	basic	miRNA	MIR205HG	lincRNA		AGCAGCAGCAGC				209605648	+1	no_errors	ENST00000366437	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.002:0.000:0.000:0.000:0.000:0.000:0.000	-
MNDA	4332	genome.wustl.edu	37	1	158813136	158813136	+	Silent	SNP	T	T	G			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr1:158813136T>G	ENST00000368141.4	+	3	594	c.333T>G	c.(331-333)ctT>ctG	p.L111L		NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	111					B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					AAGTGGGTCTTGCGGCACCTG	0.443																																																	0								ENSG00000163563						49.0	47.0	48.0					1																	158813136		2203	4300	6503	MNDA	SO:0001819	synonymous_variant	0			-	HGNC	BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.333T>G	1.37:g.158813136T>G		Somatic	0	31	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	54	14.29		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HIN200/IF120x,pfam_DAPIN,pfscan_DAPIN,pfscan_HIN200/IF120x	p.L111	ENST00000368141.4	37	c.333	CCDS1177.1	1																																																																																			-	NULL		0.443	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MNDA	protein_coding	OTTHUMT00000059069.1	T	NM_002432	-		158813136	+1	no_errors	ENST00000368141	ensembl	human	known	74_37	silent	SNP	0.001	G
NPHS1	4868	genome.wustl.edu	37	19	36330257	36330257	+	Silent	SNP	G	G	T			TCGA-DX-A1KY-01A-11D-A24N-09	TCGA-DX-A1KY-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	65d03611-7930-43a7-a751-a6a0e2854593	89c21466-106d-42dd-bdff-dce05eb7cb32	g.chr19:36330257G>T	ENST00000378910.5	-	22	2990	c.2991C>A	c.(2989-2991)acC>acA	p.T997T	NPHS1_ENST00000353632.6_Silent_p.T997T	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	997	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)	p.T997T(1)		NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TCAGCGTGAAGGTGGTGGCCT	0.582																																																	1	Substitution - coding silent(1)	lung(1)						ENSG00000161270						97.0	83.0	88.0					19																	36330257		2203	4300	6503	NPHS1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.2991C>A	19.37:g.36330257G>T		Somatic	0	68	0.00		0.7638932148785781	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	42	16.00	A6NDH2|C3RX61	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CD80_C2-set,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.T997	ENST00000378910.5	37	c.2991	CCDS32996.1	19																																																																																			-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.582	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS1	protein_coding	OTTHUMT00000452553.1	G		-		36330257	-1	no_errors	ENST00000378910	ensembl	human	known	74_37	silent	SNP	0.963	T
