#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
STAB1	23166	genome.wustl.edu	37	3	52547961	52547961	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr3:52547961G>T	ENST00000321725.6	+	32	3487	c.3411G>T	c.(3409-3411)ttG>ttT	p.L1137F		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1137	FAS1 4. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		AGCTGGACTTGGTGCCTGCCT	0.642																																																	0								ENSG00000010327						117.0	118.0	117.0					3																	52547961		2203	4300	6503	STAB1	SO:0001583	missense	0			-	HGNC	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.3411G>T	3.37:g.52547961G>T	ENSP00000312946:p.Leu1137Phe	Somatic	0	38	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	41	32.79	A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	23	0.00	0	27	43.75	21	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,smart_EG-like_dom,smart_EGF_laminin,smart_FAS1_domain,smart_EGF-like_Ca-bd_dom,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.L1137F	ENST00000321725.6	37	c.3411	CCDS33768.1	3	.	.	.	.	.	.	.	.	.	.	G	13.10	2.135451	0.37728	.	.	ENSG00000010327	ENST00000321725	D	0.85013	-1.93	4.78	-7.04	0.01578	FAS1 domain (2);	1.472710	0.04393	N	0.362699	T	0.65863	0.2732	N	0.14661	0.345	0.09310	N	1	B	0.30281	0.275	B	0.26864	0.074	T	0.56366	-0.7991	10	0.56958	D	0.05	-1.7564	0.6396	0.00808	0.2612:0.2671:0.1195:0.3522	.	1137	Q9NY15	STAB1_HUMAN	F	1137	ENSP00000312946:L1137F	ENSP00000312946:L1137F	L	+	3	2	STAB1	52523001	0.000000	0.05858	0.002000	0.10522	0.907000	0.53573	-5.243000	0.00138	-1.517000	0.01780	0.462000	0.41574	TTG	-	superfamily_FAS1_domain,pfscan_FAS1_domain		0.642	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB1	protein_coding	OTTHUMT00000351380.2	G	NM_015136	-		52547961	+1	no_errors	ENST00000321725	ensembl	human	known	74_37	missense	SNP	0.000	T
PLXNA2	5362	genome.wustl.edu	37	1	208199993	208199994	+	3'UTR	INS	-	-	TC	rs148574660		TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr1:208199993_208199994insTC	ENST00000367033.3	-	0	7036_7037				PLXNA2_ENST00000483048.1_5'UTR	NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2						axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		cttctcctctttctcttttttt	0.406																																																	0								ENSG00000076356																																			PLXNA2	SO:0001624	3_prime_UTR_variant	0				HGNC	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.*595->GA	1.37:g.208199996_208199997dupTC		Somatic	0	10	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	RNA	INS	18	10.00	2	43	12.24	6	-	NULL	ENST00000367033.3	37	NULL	CCDS31013.1	1																																																																																			-	-		0.406	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	protein_coding	OTTHUMT00000088932.6	-	NM_025179			208199994	-1	no_errors	ENST00000483048	ensembl	human	known	74_37	rna	INS	0.000:0.000	TC
SPIRE2	84501	genome.wustl.edu	37	16	89916879	89916880	+	In_Frame_Ins	INS	-	-	GAG	rs146569219|rs377330880	byFrequency	TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr16:89916879_89916880insGAG	ENST00000378247.3	+	3	499_500	c.456_457insGAG	c.(457-459)gag>GAGgag	p.153_153E>EE	SPIRE2_ENST00000393062.2_In_Frame_Ins_p.153_153E>EE|SPIRE2_ENST00000564878.1_3'UTR	NM_032451.1	NP_115827.1	Q8WWL2	SPIR2_HUMAN	spire-type actin nucleation factor 2	153	KIND. {ECO:0000255|PROSITE- ProRule:PRU00709}.				actin cytoskeleton organization (GO:0030036)|cleavage furrow formation (GO:0036089)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|intracellular transport (GO:0046907)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		ACGGGGGTCCCGAGGAGGAGGA	0.728														371	0.0740815	0.0038	0.0245	5008	,	,		12494	0.2679		0.0606	False		,,,				2504	0.0184																0								ENSG00000204991																																			SPIRE2	SO:0001652	inframe_insertion	0				HGNC	AL834408	CCDS32516.1	16q24	2013-08-27	2013-08-27			ENSG00000204991			30623	protein-coding gene	gene with protein product		609217	"""spire homolog 2 (Drosophila)"", ""spire family actin nucleation factor 2"""			11347906	Standard	NM_032451		Approved	spir-2, KIAA1832	uc002foz.1	Q8WWL2		ENST00000378247.3:c.469_471dupGAG	16.37:g.89916886_89916888dupGAG	ENSP00000367494:p.Glu157dup	Somatic	0	12	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	16	30.43	A4QPB1|Q2TA98|Q6P433|Q8ND47|Q96JJ5	In_Frame_Ins	INS	11	45.00	9	23	36.11	13	superfamily_Znf_FYVE_PHD,smart_KIND	p.156in_frame_insE	ENST00000378247.3	37	c.456_457	CCDS32516.1	16																																																																																			-	smart_KIND		0.728	SPIRE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIRE2	protein_coding	OTTHUMT00000421843.1	-	XM_047462			89916880	+1	no_errors	ENST00000378247	ensembl	human	known	74_37	in_frame_ins	INS	0.051:1.000	GAG
SMARCC2	6601	genome.wustl.edu	37	12	56567544	56567544	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr12:56567544G>C	ENST00000267064.4	-	17	1672	c.1586C>G	c.(1585-1587)tCt>tGt	p.S529C	SMARCC2_ENST00000394023.3_Missense_Mutation_p.S529C|SMARCC2_ENST00000550164.1_Missense_Mutation_p.S529C|SMARCC2_ENST00000347471.4_Missense_Mutation_p.S529C|RP11-977G19.5_ENST00000553176.1_RNA	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	529					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			ATGGAAGTGAGAGGTAGGCGG	0.587																																																	0								ENSG00000139613						146.0	145.0	146.0					12																	56567544		2203	4300	6503	SMARCC2	SO:0001583	missense	0			-	HGNC	U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.1586C>G	12.37:g.56567544G>C	ENSP00000267064:p.Ser529Cys	Somatic	0	39	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	246	264	48.24	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	20	0.00	0	160	52.94	180	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.S529C	ENST00000267064.4	37	c.1586	CCDS8907.1	12	.	.	.	.	.	.	.	.	.	.	G	17.18	3.322627	0.60634	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	T;T;T	0.50813	0.74;0.75;0.73	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.70736	0.3258	M	0.81942	2.565	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.79784	0.984;0.993;0.984;0.984;0.993	T	0.75348	-0.3349	10	0.72032	D	0.01	-11.6603	17.4276	0.87530	0.0:0.0:1.0:0.0	.	418;529;534;529;529	B4DF22;F8VTJ5;Q59G16;Q8TAQ2;Q8TAQ2-2	.;.;.;SMRC2_HUMAN;.	C	529	ENSP00000449396:S529C;ENSP00000302919:S529C;ENSP00000267064:S529C	ENSP00000267064:S529C	S	-	2	0	SMARCC2	54853811	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.747000	0.98863	2.579000	0.87056	0.563000	0.77884	TCT	-	superfamily_Chromodomain-like		0.587	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCC2	protein_coding	OTTHUMT00000408370.1	G		-		56567544	-1	no_errors	ENST00000267064	ensembl	human	known	74_37	missense	SNP	1.000	C
SLC4A7	9497	genome.wustl.edu	37	3	27472860	27472860	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr3:27472860G>A	ENST00000295736.5	-	7	1122	c.1052C>T	c.(1051-1053)cCt>cTt	p.P351L	SLC4A7_ENST00000435667.2_Intron|SLC4A7_ENST00000428386.1_Intron|SLC4A7_ENST00000454389.1_Missense_Mutation_p.P360L|SLC4A7_ENST00000440156.1_Missense_Mutation_p.P347L|SLC4A7_ENST00000445684.1_Missense_Mutation_p.P347L|SLC4A7_ENST00000388777.4_5'UTR|SLC4A7_ENST00000455077.1_Intron|SLC4A7_ENST00000446700.1_Missense_Mutation_p.P343L|SLC4A7_ENST00000425128.2_Missense_Mutation_p.P343L|SLC4A7_ENST00000437179.1_Intron	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	351					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	GTCTTCCTCAGGCGGATGAAT	0.498																																																	0								ENSG00000033867						121.0	128.0	126.0					3																	27472860		2203	4300	6503	SLC4A7	SO:0001583	missense	0			-	HGNC	AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.1052C>T	3.37:g.27472860G>A	ENSP00000295736:p.Pro351Leu	Somatic	0	60	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	42	30.00	A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	27	0.00	0	32	20.00	8	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,tigrfam_HCO3_transpt_euk	p.P360L	ENST00000295736.5	37	c.1079	CCDS33721.1	3	.	.	.	.	.	.	.	.	.	.	G	26.2	4.719596	0.89205	.	.	ENSG00000033867	ENST00000295736;ENST00000454389;ENST00000440156;ENST00000446700;ENST00000445684;ENST00000425128	T;T;T;T;T;T	0.77750	-1.03;-1.03;-1.12;-1.11;-1.12;0.37	5.98	5.98	0.97165	Bicarbonate transporter, cytoplasmic (1);	0.079522	0.49916	N	0.000126	D	0.84252	0.5431	L	0.40543	1.245	0.58432	D	0.999999	D;D;D;P;D	0.89917	1.0;1.0;1.0;0.933;1.0	D;D;D;P;D	0.91635	0.999;0.999;0.999;0.796;0.999	T	0.79713	-0.1688	10	0.26408	T	0.33	.	20.4561	0.99145	0.0:0.0:1.0:0.0	.	347;343;347;360;351	E9PFN4;E9PGC1;B5M453;E9PDL9;Q9Y6M7	.;.;.;.;S4A7_HUMAN	L	351;360;347;343;347;343	ENSP00000295736:P351L;ENSP00000390394:P360L;ENSP00000414797:P347L;ENSP00000406605:P343L;ENSP00000406804:P347L;ENSP00000401949:P343L	ENSP00000295736:P351L	P	-	2	0	SLC4A7	27447864	1.000000	0.71417	0.971000	0.41717	0.958000	0.62258	5.528000	0.67129	2.847000	0.97988	0.591000	0.81541	CCT	-	pfam_Band3_cytoplasmic_dom		0.498	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	SLC4A7	protein_coding	OTTHUMT00000341230.2	G	NM_003615	-		27472860	-1	no_errors	ENST00000454389	ensembl	human	known	74_37	missense	SNP	0.999	A
CRP	1401	genome.wustl.edu	37	1	159683597	159683597	+	Silent	SNP	C	C	T			TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr1:159683597C>T	ENST00000255030.5	-	2	496	c.393G>A	c.(391-393)ggG>ggA	p.G131G	CRP_ENST00000473196.1_5'Flank|CRP_ENST00000368112.1_Intron|CRP_ENST00000343919.2_Intron|CRP_ENST00000368110.1_Intron|CRP_ENST00000368111.1_Intron|CRP_ENST00000437342.1_5'UTR	NM_000567.2	NP_000558.2	P02741	CRP_HUMAN	C-reactive protein, pentraxin-related	131	Pentaxin.				acute-phase response (GO:0006953)|aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|complement activation, classical pathway (GO:0006958)|defense response to Gram-positive bacterium (GO:0050830)|inflammatory response (GO:0006954)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|opsonization (GO:0008228)|positive regulation of dendrite development (GO:1900006)|protein polymerization (GO:0051258)|regulation of interleukin-8 secretion (GO:2000482)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to lead ion (GO:0010288)|wound healing (GO:0042060)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)	calcium ion binding (GO:0005509)|cholesterol binding (GO:0015485)|choline binding (GO:0033265)|complement component C1q binding (GO:0001849)|low-density lipoprotein particle binding (GO:0030169)			breast(1)|endometrium(3)|kidney(1)|lung(15)|ovary(1)|skin(1)	22	all_hematologic(112;0.0429)				inhaled insulin(DB05278)	CCCTGGGCTTCCCATCTACCC	0.522																																																	0								ENSG00000132693						178.0	182.0	180.0					1																	159683597		2203	4300	6503	CRP	SO:0001819	synonymous_variant	0			-	HGNC	M11725	CCDS30911.1	1q23.2	2013-05-13			ENSG00000132693	ENSG00000132693			2367	protein-coding gene	gene with protein product	"""pentraxin 1"""	123260				3840479, 6857266	Standard	NM_000567		Approved	PTX1	uc001ftw.3	P02741	OTTHUMG00000035344	ENST00000255030.5:c.393G>A	1.37:g.159683597C>T		Somatic	0	33	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	108	686	13.60	A8K078|D3DVD9|D3DVE0|Q08AK3|Q8WW75	Silent	SNP	28	0.00	0	757	16.63	151	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.G131	ENST00000255030.5	37	c.393	CCDS30911.1	1																																																																																			-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin		0.522	CRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRP	protein_coding	OTTHUMT00000085553.1	C	NM_000567	-		159683597	-1	no_errors	ENST00000255030	ensembl	human	known	74_37	silent	SNP	0.266	T
ZFYVE26	23503	genome.wustl.edu	37	14	68229454	68229454	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr14:68229454G>T	ENST00000347230.4	-	33	6232	c.6094C>A	c.(6094-6096)Cca>Aca	p.P2032T	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.P2032T|ZFYVE26_ENST00000557306.1_5'Flank	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	2032					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		ACTGCAGCTGGCTGCAAGATC	0.488																																																	0								ENSG00000072121						106.0	87.0	93.0					14																	68229454		2203	4300	6503	ZFYVE26	SO:0001583	missense	0			-	HGNC	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.6094C>A	14.37:g.68229454G>T	ENSP00000251119:p.Pro2032Thr	Somatic	0	50	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	64	28.09	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	28	0.00	0	49	24.62	16	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.P2032T	ENST00000347230.4	37	c.6094	CCDS9788.1	14	.	.	.	.	.	.	.	.	.	.	G	14.94	2.684707	0.47991	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.27104	1.83;1.69	5.62	5.62	0.85841	.	0.118259	0.56097	D	0.000035	T	0.23611	0.0571	N	0.14661	0.345	0.45930	D	0.998762	P;P	0.46784	0.884;0.473	P;B	0.46253	0.509;0.112	T	0.01982	-1.1235	10	0.34782	T	0.22	-12.633	19.6676	0.95898	0.0:0.0:1.0:0.0	.	2032;2032	G3V2D8;Q68DK2	.;ZFY26_HUMAN	T	2032;2011;2032	ENSP00000251119:P2032T;ENSP00000450603:P2032T	ENSP00000251119:P2032T	P	-	1	0	ZFYVE26	67299207	1.000000	0.71417	1.000000	0.80357	0.587000	0.36485	7.435000	0.80391	2.656000	0.90262	0.563000	0.77884	CCA	-	NULL		0.488	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE26	protein_coding	OTTHUMT00000412736.2	G	NM_015346	-		68229454	-1	no_errors	ENST00000347230	ensembl	human	known	74_37	missense	SNP	1.000	T
HELZ2	85441	genome.wustl.edu	37	20	62203364	62203364	+	Intron	SNP	G	G	A			TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr20:62203364G>A	ENST00000467148.1	-	1	348				HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator						cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CTCTGCCTGTGGTGGGCTCCT	0.632																																																	0								ENSG00000130589																																			HELZ2	SO:0001627	intron_variant	0			-	HGNC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.278+96C>T	20.37:g.62203364G>A		Somatic	0	57	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	67	10.67	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	RNA	SNP	53	3.64	2	82	7.87	7	-	NULL	ENST00000467148.1	37	NULL	CCDS33508.1	20																																																																																			-	-		0.632	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	protein_coding	OTTHUMT00000354127.1	G	NM_001037335	-		62203364	-1	no_errors	ENST00000479540	ensembl	human	known	74_37	rna	SNP	0.010	A
MED13	9969	genome.wustl.edu	37	17	60042707	60042707	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr17:60042707G>C	ENST00000397786.2	-	20	4580	c.4504C>G	c.(4504-4506)Cca>Gca	p.P1502A		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1502					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GTGGCAGATGGAGTATTAGCA	0.448																																																	0								ENSG00000108510						157.0	148.0	151.0					17																	60042707		2020	4207	6227	MED13	SO:0001583	missense	0			-	HGNC	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.4504C>G	17.37:g.60042707G>C	ENSP00000380888:p.Pro1502Ala	Somatic	0	22	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	16	48.39	B2RU05|O60334	Missense_Mutation	SNP	37	0.00	0	22	50.00	22	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.P1502A	ENST00000397786.2	37	c.4504	CCDS42366.1	17	.	.	.	.	.	.	.	.	.	.	G	22.3	4.274005	0.80580	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	T	0.67865	-0.29	5.86	4.9	0.64082	.	0.426017	0.28301	N	0.015853	T	0.53061	0.1773	L	0.38531	1.155	0.58432	D	0.999996	B	0.30406	0.278	B	0.27887	0.084	T	0.49643	-0.8918	10	0.07813	T	0.8	4.1394	14.9156	0.70795	0.0686:0.0:0.9314:0.0	.	1502	Q9UHV7	MED13_HUMAN	A	1502;1501	ENSP00000380888:P1502A	ENSP00000262436:P1501A	P	-	1	0	MED13	57397489	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.998000	0.57024	1.479000	0.48272	0.655000	0.94253	CCA	-	NULL		0.448	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13	protein_coding	OTTHUMT00000445461.1	G	NM_005121	-		60042707	-1	no_errors	ENST00000397786	ensembl	human	known	74_37	missense	SNP	1.000	C
SIX5	147912	genome.wustl.edu	37	19	46265047	46265048	+	IGR	INS	-	-	TCCAGC	rs139434566|rs59054027		TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr19:46265047_46265048insTCCAGC	ENST00000317578.6	-	0	3318				AC074212.5_ENST00000559756.1_RNA|AC074212.3_ENST00000457052.2_In_Frame_Ins_p.453_453S>SSS	NM_175875.4	NP_787071	Q8N196	SIX5_HUMAN	SIX homeobox 5						lens development in camera-type eye (GO:0002088)|negative regulation of cell proliferation (GO:0008285)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00783)|GBM - Glioblastoma multiforme(486;0.0802)|Epithelial(262;0.235)		GCAAGGCGCCAtccagctccag	0.658																																																	0								ENSG00000237452																																			AC074212.3	SO:0001628	intergenic_variant	0				Clone_based_vega_gene	L08835	CCDS12673.1	19q13.32	2011-06-20	2007-07-13			ENSG00000177045		"""Homeoboxes / SINE class"""	10891	protein-coding gene	gene with protein product		600963	"""sine oculis homeobox (Drosophila) homolog 5"", ""sine oculis homeobox homolog 5 (Drosophila)"""	DMAHP		8595416	Standard	NM_175875		Approved		uc002pdb.3	Q8N196			19.37:g.46265048_46265053dupTCCAGC		Somatic	NA	NA	NA		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Ins	INS	17	41.38	12	23	36.11	13	pfam_HMG_box_dom,pfam_bHLH_dom,superfamily_HMG_box_dom,superfamily_bHLH_dom,smart_HMG_box_dom,pfscan_bHLH_dom,pfscan_HMG_box_dom	p.456in_frame_insSS	ENST00000317578.6	37	c.1356_1357	CCDS12673.1	19																																																																																			-	NULL		0.658	SIX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000237452	protein_coding	OTTHUMT00000417341.3	-	NM_175875			46265048	+1	no_errors	ENST00000457052	ensembl	human	putative	74_37	in_frame_ins	INS	0.000:0.004	TCCAGC
HIC1	3090	genome.wustl.edu	37	17	1961286	1961286	+	Silent	SNP	C	C	T			TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr17:1961286C>T	ENST00000322941.3	+	2	1359	c.1359C>T	c.(1357-1359)aaC>aaT	p.N453N	HIC1_ENST00000399849.3_Silent_p.N434N|SMG6_ENST00000573166.1_5'Flank	NM_001098202.1	NP_001091672.1	Q14526	HIC1_HUMAN	hypermethylated in cancer 1	453					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(1)|prostate(1)	3				READ - Rectum adenocarcinoma(1115;0.236)		AGCAGCTGAACGCGCACGTGG	0.687																																																	0								ENSG00000177374						13.0	14.0	14.0					17																	1961286		2195	4292	6487	HIC1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS42229.1, CCDS42230.1	17p13.3	2013-01-09				ENSG00000177374		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	4909	protein-coding gene	gene with protein product		603825					Standard	NM_006497		Approved	ZBTB29, ZNF901	uc010cjy.3	Q14526		ENST00000322941.3:c.1359C>T	17.37:g.1961286C>T		Somatic	0	55	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	32	46.67	D3DTI4	Silent	SNP	25	0.00	0	24	44.19	19	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.N453	ENST00000322941.3	37	c.1359	CCDS42229.1	17																																																																																			-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.687	HIC1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HIC1	protein_coding	OTTHUMT00000438878.1	C	NM_006497	-		1961286	+1	no_errors	ENST00000322941	ensembl	human	known	74_37	silent	SNP	0.949	T
HELZ2	85441	genome.wustl.edu	37	20	62203363	62203363	+	Intron	SNP	T	T	C			TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr20:62203363T>C	ENST00000467148.1	-	1	348				HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator						cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GCTCTGCCTGTGGTGGGCTCC	0.632																																																	0								ENSG00000130589																																			HELZ2	SO:0001627	intron_variant	0			-	HGNC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.278+97A>G	20.37:g.62203363T>C		Somatic	0	57	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	69	10.39	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	RNA	SNP	52	5.45	3	82	7.87	7	-	NULL	ENST00000467148.1	37	NULL	CCDS33508.1	20																																																																																			-	-		0.632	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	protein_coding	OTTHUMT00000354127.1	T	NM_001037335	-		62203363	-1	no_errors	ENST00000479540	ensembl	human	known	74_37	rna	SNP	0.001	C
VPS41	27072	genome.wustl.edu	37	7	38948756	38948756	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr7:38948756G>T	ENST00000310301.4	-	1	73	c.19C>A	c.(19-21)Cag>Aag	p.Q7K	VPS41_ENST00000395969.2_Missense_Mutation_p.Q7K	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	7					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						CCCTTTACCTGCTCCTCTGCT	0.592																																																	0								ENSG00000006715						197.0	175.0	183.0					7																	38948756		2203	4300	6503	VPS41	SO:0001583	missense	0			-	HGNC	U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.19C>A	7.37:g.38948756G>T	ENSP00000309457:p.Gln7Lys	Somatic	0	43	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	E9PF36|Q86TP8|Q99851|Q99852	Missense_Mutation	SNP	37	0.00	0	49	0.00	0	pfam_Clathrin_H-chain/VPS_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_VPS41,pfscan_Znf_RING	p.Q7K	ENST00000310301.4	37	c.19	CCDS5457.1	7	.	.	.	.	.	.	.	.	.	.	G	8.647	0.897292	0.17686	.	.	ENSG00000006715	ENST00000310301;ENST00000395969;ENST00000414632	T;T;T	0.42131	0.98;0.98;1.07	4.2	3.24	0.37175	.	0.357255	0.28393	N	0.015507	T	0.21801	0.0525	L	0.28274	0.84	0.30925	N	0.727601	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.22138	-1.0225	10	0.05620	T	0.96	-8.5476	6.7846	0.23665	0.0:0.1919:0.61:0.1981	.	7;7;7	B2RB94;E9PF36;P49754	.;.;VPS41_HUMAN	K	7	ENSP00000309457:Q7K;ENSP00000379297:Q7K;ENSP00000411919:Q7K	ENSP00000265745:Q7K	Q	-	1	0	VPS41	38915281	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.912000	0.39946	2.330000	0.79161	0.655000	0.94253	CAG	-	pirsf_VPS41		0.592	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS41	protein_coding	OTTHUMT00000226986.3	G		-		38948756	-1	no_errors	ENST00000310301	ensembl	human	known	74_37	missense	SNP	1.000	T
ATP6V0A4	50617	genome.wustl.edu	37	7	138447177	138447177	+	Silent	SNP	C	C	T	rs61747679		TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr7:138447177C>T	ENST00000310018.2	-	7	702	c.420G>A	c.(418-420)acG>acA	p.T140T	ATP6V0A4_ENST00000393054.1_Silent_p.T140T|ATP6V0A4_ENST00000353492.4_Silent_p.T140T|ATP6V0A4_ENST00000483139.1_5'UTR	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a4	140					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			NS(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						AATTGGTTTCCGTCTGAAAGT	0.393																																																	0								ENSG00000105929						97.0	89.0	92.0					7																	138447177		2203	4300	6503	ATP6V0A4	SO:0001819	synonymous_variant	0			-	HGNC	AF245517	CCDS5849.1	7q34	2011-06-09	2006-01-20	2002-05-10	ENSG00000105929	ENSG00000105929		"""ATPases / V-type"""	866	protein-coding gene	gene with protein product		605239	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 4"", ""ATPase, H+ transporting, lysosomal V0 subunit A4"""	ATP6N1B, ATP6N2, RTA1C		10577919, 10973252	Standard	XM_005250393		Approved	RDRTA2, VPP2, RTADR, a4, Vph1, Stv1	uc003vuf.3	Q9HBG4	OTTHUMG00000157122	ENST00000310018.2:c.420G>A	7.37:g.138447177C>T		Somatic	0	37	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	47	20.34	A4D1R4|A8KA80|Q32M47	Silent	SNP	35	0.00	0	65	16.46	13	pfam_V-ATPase_116kDa_su	p.T140	ENST00000310018.2	37	c.420	CCDS5849.1	7																																																																																			-	pfam_V-ATPase_116kDa_su		0.393	ATP6V0A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V0A4	protein_coding	OTTHUMT00000347514.1	C	NM_020632	rs61747679		138447177	-1	no_errors	ENST00000310018	ensembl	human	known	74_37	silent	SNP	0.796	T
RP11-782C8.2	0	genome.wustl.edu	37	1	143189128	143189128	+	lincRNA	SNP	G	G	A	rs202058739		TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr1:143189128G>A	ENST00000412204.2	-	0	2503				RP11-782C8.3_ENST00000425124.1_lincRNA|RP11-782C8.1_ENST00000438000.1_lincRNA																							TGACTTGGTTGTTTAAACAGC	0.333																																																	0								ENSG00000232274																																			RP11-782C8.2			0			-	Clone_based_vega_gene																													1.37:g.143189128G>A		Somatic	0	11	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	12	36.84		RNA	SNP	45	11.76	6	69	12.66	10	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			-	-		0.333	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	lincRNA	OTTHUMT00000037567.2	G		rs202058739		143189128	-1	no_errors	ENST00000447389	ensembl	human	known	74_37	rna	SNP	0.005	A
AC106732.1	0	genome.wustl.edu	37	5	73567501	73567546	+	RNA	DEL	ACTGGTACATATTAAGCTGGTGCAATAGTAATTGCAGTTTGCCATT	ACTGGTACATATTAAGCTGGTGCAATAGTAATTGCAGTTTGCCATT	-	rs564923151|rs533454742|rs149095086	byFrequency	TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	ACTGGTACATATTAAGCTGGTGCAATAGTAATTGCAGTTTGCCATT	ACTGGTACATATTAAGCTGGTGCAATAGTAATTGCAGTTTGCCATT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr5:73567501_73567546delACTGGTACATATTAAGCTGGTGCAATAGTAATTGCAGTTTGCCATT	ENST00000410619.1	-	0	44_84																											TCAGACCCAAACTGGTACATAttaagctggtgcaatagtaattgcagtttgccattactttaatgg	0.346														518	0.103435	0.1989	0.072	5008	,	,		22576	0.0069		0.0527	False		,,,				2504	0.1483																0								ENSG00000222551																																			AC106732.1			0				Clone_based_ensembl_gene																													5.37:g.73567501_73567546delACTGGTACATATTAAGCTGGTGCAATAGTAATTGCAGTTTGCCATT		Somatic	NA	NA	NA		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	28	12.50	4	28	6.67	2	-	NULL	ENST00000410619.1	37	NULL		5																																																																																			-	-		0.346	AC106732.1-201	NOVEL	basic	miRNA	ENSG00000222551	miRNA		ACTGGTACATATTAAGCTGGTGCAATAGTAATTGCAGTTTGCCATT				73567546	-1	no_errors	ENST00000410619	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.003:0.004:0.003:0.000:0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.001:0.001:0.001:0.001:0.000:0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.002:0.001:0.002:0.008:0.013:0.015:0.021:0.036:0.034:0.029:0.022:0.010	-
BX119917.1	0	genome.wustl.edu	37	X	71372202	71372209	+	RNA	DEL	CGCGCGCA	CGCGCGCA	-	rs6625958|rs72357649|rs72197346|rs59980083|rs6625957|rs200056633|rs10856127		TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	CGCGCGCA	CGCGCGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chrX:71372202_71372209delCGCGCGCA	ENST00000401114.1	-	0	55_62																											TGTGCATGCGCGCGCGcacacacacaca	0.495																																																	0								ENSG00000215933																																			BX119917.1			0				Clone_based_ensembl_gene																													X.37:g.71372202_71372209delCGCGCGCA		Somatic	NA	NA	NA		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	10	37.50	6	8	50.00	8	-	NULL	ENST00000401114.1	37	NULL		X																																																																																			-	-		0.495	BX119917.1-201	NOVEL	basic	miRNA	ENSG00000215933	miRNA		CGCGCGCA				71372209	-1	no_errors	ENST00000401114	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.015:0.009	-
GALNT6	11226	genome.wustl.edu	37	12	51785401	51785402	+	5'Flank	INS	-	-	AGCCGC	rs143011477	byFrequency	TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr12:51785401_51785402insAGCCGC	ENST00000356317.3	-	0	0				SLC4A8_ENST00000535225.2_Intron|GALNT6_ENST00000603203.1_5'UTR	NM_007210.3	NP_009141.2	Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CGCCGAGGCAAAGCCGCAGCCG	0.757														1258	0.251198	0.0234	0.245	5008	,	,		9662	0.2897		0.4155	False		,,,				2504	0.3548																0								ENSG00000139629																																			GALNT6	SO:0001631	upstream_gene_variant	0				HGNC	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4			12.37:g.51785402_51785407dupAGCCGC	Exception_encountered	Somatic	NA	NA	NA		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q8IYH4|Q9H6G2|Q9UIV5	RNA	INS	23	14.81	4	37	21.28	10	-	NULL	ENST00000356317.3	37	NULL	CCDS8813.1	12																																																																																			-	-		0.757	GALNT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT6	protein_coding	OTTHUMT00000469736.1	-	NM_007210			51785402	-1	no_errors	ENST00000603203	ensembl	human	known	74_37	rna	INS	0.021:0.127	AGCCGC
C19orf35	374872	genome.wustl.edu	37	19	2280757	2280776	+	Intron	DEL	CCTGCCGCTCCCTGCACCCA	CCTGCCGCTCCCTGCACCCA	-	rs545718575|rs202241723|rs10420010|rs535290401	byFrequency	TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	CCTGCCGCTCCCTGCACCCA	CCTGCCGCTCCCTGCACCCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr19:2280757_2280776delCCTGCCGCTCCCTGCACCCA	ENST00000342063.3	-	2	176					NM_198532.2	NP_940934.1	Q6ZS72	CS035_HUMAN	chromosome 19 open reading frame 35											large_intestine(1)|lung(5)|pancreas(1)|prostate(1)	8				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGGCAACCTcctgccgctccctgcacccacctgccgctc	0.655														935	0.186701	0.3457	0.1383	5008	,	,		12619	0.2202		0.0646	False		,,,				2504	0.0971																0								ENSG00000188305																																			C19orf35	SO:0001627	intron_variant	0				HGNC	AK127680	CCDS12087.1	19p13.3	2012-10-26			ENSG00000188305	ENSG00000188305			24793	protein-coding gene	gene with protein product							Standard	NM_198532		Approved	FLJ45778	uc002lvn.2	Q6ZS72	OTTHUMG00000178460	ENST00000342063.3:c.82+72TGGGTGCAGGGAGCGGCAGG>-	19.37:g.2280757_2280776delCCTGCCGCTCCCTGCACCCA		Somatic	NA	NA	NA		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		Frame_Shift_Del	DEL	17	5.56	1	37	0.00	0	NULL	p.V52fs	ENST00000342063.3	37	c.174_155	CCDS12087.1	19																																																																																			-	NULL		0.655	C19orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf35	protein_coding	OTTHUMT00000442080.1	CCTGCCGCTCCCTGCACCCA	NM_198532			2280776	-1	no_errors	ENST00000590316	ensembl	human	known	74_37	frame_shift_del	DEL	0.339:0.033:0.011:0.003:0.002:0.000:0.002:0.002:0.003:0.008:0.009:0.011:0.005:0.001:0.000:0.000:0.000:0.000:0.000:0.000	-
DMD	1756	genome.wustl.edu	37	X	31462736	31462736	+	Silent	SNP	T	T	C			TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chrX:31462736T>C	ENST00000357033.4	-	60	9152	c.8946A>G	c.(8944-8946)cgA>cgG	p.R2982R	DMD_ENST00000474231.1_Silent_p.R522R|DMD_ENST00000343523.2_Silent_p.R522R|DMD_ENST00000378677.2_Silent_p.R2978R|DMD_ENST00000378707.3_Silent_p.R522R|DMD_ENST00000359836.1_Silent_p.R522R|DMD_ENST00000541735.1_Silent_p.R522R	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2982					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CAATTTCTCCTCGAAGTGCCT	0.458																																																	0								ENSG00000198947						129.0	98.0	108.0					X																	31462736		2202	4300	6502	DMD	SO:0001819	synonymous_variant	0			-	HGNC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.8946A>G	X.37:g.31462736T>C		Somatic	0	31	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	74	274	21.26	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	10	0.00	0	203	25.00	68	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.R2982	ENST00000357033.4	37	c.8946	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	T	10.31	1.316027	0.23908	.	.	ENSG00000198947	ENST00000465285	T	0.51071	0.72	5.64	3.17	0.36434	.	0.000000	0.29021	U	0.013384	T	0.44095	0.1277	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.20338	-1.0278	6	.	.	.	.	4.6657	0.12664	0.1692:0.1029:0.0:0.7279	.	.	.	.	G	711	ENSP00000420046:R711G	.	R	-	1	2	DMD	31372657	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.041000	0.41213	0.257000	0.21650	0.481000	0.45027	AGG	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin		0.458	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	protein_coding	OTTHUMT00000056182.2	T	NM_004006	-		31462736	-1	no_errors	ENST00000357033	ensembl	human	known	74_37	silent	SNP	1.000	C
SPNS2	124976	genome.wustl.edu	37	17	4436615	4436615	+	Missense_Mutation	SNP	G	G	A	rs202025950	byFrequency	TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr17:4436615G>A	ENST00000329078.3	+	8	1376	c.1166G>A	c.(1165-1167)cGc>cAc	p.R389H		NM_001124758.1	NP_001118230.1	Q8IVW8	SPNS2_HUMAN	spinster homolog 2 (Drosophila)	389					B cell homeostasis (GO:0001782)|bone development (GO:0060348)|lymph node development (GO:0048535)|lymphocyte migration (GO:0072676)|regulation of eye pigmentation (GO:0048073)|regulation of humoral immune response (GO:0002920)|sphingolipid metabolic process (GO:0006665)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell homeostasis (GO:0043029)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	sphingolipid transporter activity (GO:0046624)			large_intestine(3)|lung(1)|prostate(1)|skin(1)	6						CGCTGGTGCCGCCTGAAGACC	0.642													g|||	7	0.00139776	0.0	0.0086	5008	,	,		16351	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000183018						36.0	37.0	36.0					17																	4436615		1567	3582	5149	SPNS2	SO:0001583	missense	0			GMAF=0	HGNC	BC041772	CCDS42237.1	17p13.2	2008-12-15				ENSG00000183018			26992	protein-coding gene	gene with protein product		612584				12815463	Standard	NM_001124758		Approved		uc002fxx.2	Q8IVW8		ENST00000329078.3:c.1166G>A	17.37:g.4436615G>A	ENSP00000333292:p.Arg389His	Somatic	0	80	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	62	40.38	B9A1T3	Missense_Mutation	SNP	24	0.00	0	27	51.79	29	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.R389H	ENST00000329078.3	37	c.1166	CCDS42237.1	17	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	g	27.9	4.871903	0.91587	.	.	ENSG00000183018	ENST00000329078	T	0.59502	0.26	4.79	4.79	0.61399	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.76730	0.4028	M	0.81341	2.54	0.58432	D	0.999999	D	0.89917	1.0	D	0.71414	0.973	T	0.81143	-0.1067	10	0.87932	D	0	.	16.3995	0.83635	0.0:0.0:1.0:0.0	.	389	Q8IVW8	SPNS2_HUMAN	H	389	ENSP00000333292:R389H	ENSP00000333292:R389H	R	+	2	0	SPNS2	4383364	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	6.837000	0.75354	2.198000	0.70561	0.486000	0.48141	CGC	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.642	SPNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPNS2	protein_coding	OTTHUMT00000438802.1	G		rs202025950		4436615	+1	no_errors	ENST00000329078	ensembl	human	known	74_37	missense	SNP	1.000	A
PLCH2	9651	genome.wustl.edu	37	1	2411240	2411240	+	Silent	SNP	C	C	T			TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr1:2411240C>T	ENST00000419816.2	+	3	613	c.339C>T	c.(337-339)gaC>gaT	p.D113D	PLCH2_ENST00000449969.1_Silent_p.D86D|PLCH2_ENST00000378486.3_Silent_p.D113D|PLCH2_ENST00000378488.3_Silent_p.D113D|PLCH2_ENST00000288766.5_Silent_p.D68D			O75038	PLCH2_HUMAN	phospholipase C, eta 2	113	Necessary for plasma membrane localization. {ECO:0000250}.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		GCTACCCTGACGGCAGCTTCG	0.677																																																	0								ENSG00000149527						10.0	12.0	11.0					1																	2411240		2114	4203	6317	PLCH2	SO:0001819	synonymous_variant	0			-	HGNC	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.339C>T	1.37:g.2411240C>T		Somatic	0	9	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	11	47.62	A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Silent	SNP	24	0.00	0	31	35.42	17	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_EF_hand_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.D113	ENST00000419816.2	37	c.339		1																																																																																			-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.677	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	PLCH2	protein_coding	OTTHUMT00000467514.1	C	NM_014638	-		2411240	+1	no_errors	ENST00000378486	ensembl	human	known	74_37	silent	SNP	0.232	T
TMEM132B	114795	genome.wustl.edu	37	12	126004115	126004115	+	Missense_Mutation	SNP	G	G	A	rs554504714	byFrequency	TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr12:126004115G>A	ENST00000299308.3	+	4	1230	c.1222G>A	c.(1222-1224)Gtc>Atc	p.V408I		NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	408						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		TGAGCTGGTCGTCTCCGAGAT	0.532													g|||	2	0.000399361	0.0015	0.0	5008	,	,		16870	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000139364						102.0	102.0	102.0					12																	126004115		1953	4137	6090	TMEM132B	SO:0001583	missense	0			-	HGNC	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.1222G>A	12.37:g.126004115G>A	ENSP00000299308:p.Val408Ile	Somatic	0	79	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	84	19.23	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	26	0.00	0	37	11.90	5	NULL	p.V408I	ENST00000299308.3	37	c.1222	CCDS41859.1	12	.	.	.	.	.	.	.	.	.	.	g	16.01	3.001789	0.54254	.	.	ENSG00000139364	ENST00000299308	T	0.18657	2.2	5.12	5.12	0.69794	.	51.562600	0.01789	U	0.032201	T	0.23133	0.0559	L	0.49778	1.585	0.80722	D	1	P	0.35527	0.507	B	0.24155	0.051	T	0.25047	-1.0143	10	0.34782	T	0.22	.	12.2214	0.54435	0.0782:0.0:0.9218:0.0	.	408	Q14DG7	T132B_HUMAN	I	408	ENSP00000299308:V408I	ENSP00000299308:V408I	V	+	1	0	TMEM132B	124570068	1.000000	0.71417	0.627000	0.29227	0.973000	0.67179	4.397000	0.59690	2.437000	0.82529	0.621000	0.83404	GTC	-	NULL		0.532	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM132B	protein_coding	OTTHUMT00000400043.1	G	NM_052907	-		126004115	+1	no_errors	ENST00000299308	ensembl	human	known	74_37	missense	SNP	0.991	A
CHL1	10752	genome.wustl.edu	37	3	370047	370047	+	Intron	SNP	A	A	G			TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr3:370047A>G	ENST00000256509.2	+	5	1027				CHL1_ENST00000397491.2_Intron	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		AGTAAGTACTATAACGGGAAT	0.318																																																	0								ENSG00000134121						54.0	59.0	57.0					3																	370047		2203	4299	6502	CHL1	SO:0001627	intron_variant	0			-	HGNC	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.385+10A>G	3.37:g.370047A>G		Somatic	0	25	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	20	42.86	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	RNA	SNP	47	0.00	0	26	38.64	17	-	NULL	ENST00000256509.2	37	NULL	CCDS2556.1	3																																																																																			-	-		0.318	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHL1	protein_coding	OTTHUMT00000207155.2	A	NM_006614	-		370047	+1	no_errors	ENST00000461289	ensembl	human	known	74_37	rna	SNP	0.000	G
PTPRVP	148713	genome.wustl.edu	37	1	202156135	202156136	+	RNA	INS	-	-	CCTCGCT	rs369231344|rs139095833|rs78957599|rs368169635	byFrequency	TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr1:202156135_202156136insCCTCGCT	ENST00000482597.1	+	0	3411_3412					NR_002930.2				protein tyrosine phosphatase, receptor type, V, pseudogene																		CTGCAGGCCCCcctcgctcctc	0.639														3092	0.617412	0.3094	0.6816	5008	,	,		20478	0.6835		0.7137	False		,,,				2504	0.8211																0								ENSG00000243323																																			PTPRVP			0				HGNC	AJ629456		1q32.1	2013-09-26	2010-03-16	2010-03-16	ENSG00000243323	ENSG00000243323		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	13421	pseudogene	pseudogene				PTPRV		15358244	Standard	NR_002930		Approved	OST-PTP, ESP	uc009xaa.2		OTTHUMG00000040524		1.37:g.202156136_202156142dupCCTCGCT		Somatic	NA	NA	NA		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	18	37.93	11	29	36.96	17	-	NULL	ENST00000482597.1	37	NULL		1																																																																																			-	-		0.639	PTPRVP-003	KNOWN	basic	processed_transcript	PTPRVP	pseudogene	OTTHUMT00000334021.1	-	XM_086287			202156136	+1	no_errors	ENST00000482597	ensembl	human	known	74_37	rna	INS	0.022:0.016	CCTCGCT
UFL1	23376	genome.wustl.edu	37	6	96969559	96969578	+	5'Flank	DEL	AACCCCCAGCGCCGCGGTAC	AACCCCCAGCGCCGCGGTAC	-	rs3841018|rs112373805|rs67707404	byFrequency	TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	AACCCCCAGCGCCGCGGTAC	AACCCCCAGCGCCGCGGTAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr6:96969559_96969578delAACCCCCAGCGCCGCGGTAC	ENST00000369278.4	+	0	0				UFL1_ENST00000461673.1_3'UTR|UFL1-AS1_ENST00000430796.1_RNA	NM_015323.4	NP_056138.1	O94874	UFL1_HUMAN	UFM1-specific ligase 1						negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein ufmylation (GO:0071569)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	UFM1 conjugating enzyme activity (GO:0071568)										CGCCGGGAGGAACCCCCAGCGCCGCGGTACAACCACGGCA	0.7														677	0.135184	0.1036	0.1772	5008	,	,		14561	0.0387		0.2157	False		,,,				2504	0.1646																0								ENSG00000014123																																			UFL1	SO:0001631	upstream_gene_variant	0				HGNC	BC036379	CCDS5034.1	6q16.3	2011-08-18	2011-08-18	2011-08-18	ENSG00000014123	ENSG00000014123			23039	protein-coding gene	gene with protein product	"""novel LZAP-binding protein"", ""Regulator of CDK5RAP3 and DDRGK1"""	613372	"""KIAA0776"""	KIAA0776		20018847, 20164180, 20228063, 20531390	Standard	NM_015323		Approved	NLBP, Maxer, RCAD	uc003por.3	O94874	OTTHUMG00000015238		6.37:g.96969559_96969578delAACCCCCAGCGCCGCGGTAC	Exception_encountered	Somatic	NA	NA	NA		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A0PJ53|B4DJ57|C0H5X5|Q8N765|Q9NTQ0	RNA	DEL	13	23.53	4	48	57.14	64	-	NULL	ENST00000369278.4	37	NULL	CCDS5034.1	6																																																																																			-	-		0.700	UFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFL1	protein_coding	OTTHUMT00000041557.1	AACCCCCAGCGCCGCGGTAC	NM_015323			96969578	+1	no_errors	ENST00000461673	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.001:0.000:0.001:0.001:0.003:0.006:0.006:0.002:0.000:0.000:0.000:0.000:0.000:0.000	-
METTL13	51603	genome.wustl.edu	37	1	171765642	171765642	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr1:171765642G>C	ENST00000361735.3	+	8	2112	c.1846G>C	c.(1846-1848)Gtg>Ctg	p.V616L	METTL13_ENST00000362019.3_Missense_Mutation_p.V530L|METTL13_ENST00000458517.1_Missense_Mutation_p.V615L|METTL13_ENST00000466643.1_3'UTR|METTL13_ENST00000367737.5_Missense_Mutation_p.V460L	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	616							methyltransferase activity (GO:0008168)			breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						TCTCAACCTTGTGTGCCGAGA	0.468																																																	0								ENSG00000010165						148.0	139.0	142.0					1																	171765642		2203	4300	6503	METTL13	SO:0001583	missense	0			-	HGNC	AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.1846G>C	1.37:g.171765642G>C	ENSP00000354920:p.Val616Leu	Somatic	0	87	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	332	14.21	A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Missense_Mutation	SNP	35	0.00	0	173	9.90	19	pfam_Methyltransf_11,pfam_Spermidine/spermine_synthase	p.V616L	ENST00000361735.3	37	c.1846	CCDS1299.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.393933	0.96009	.	.	ENSG00000010165	ENST00000458517;ENST00000362019;ENST00000367737;ENST00000361735;ENST00000367736;ENST00000341850	T;T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92;-0.92	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.77471	0.4135	M	0.80332	2.49	0.80722	D	1	D;P;P	0.54207	0.965;0.778;0.663	P;B;B	0.56343	0.796;0.396;0.291	T	0.76077	-0.3091	10	0.06625	T	0.88	-37.4897	19.635	0.95728	0.0:0.0:1.0:0.0	.	615;460;616	B4E2X3;Q8N6R0-1;Q8N6R0	.;.;MTL13_HUMAN	L	615;530;460;616;316;313	ENSP00000401955:V615L;ENSP00000355393:V530L;ENSP00000356711:V460L;ENSP00000354920:V616L;ENSP00000356710:V316L	ENSP00000341732:V313L	V	+	1	0	METTL13	170032265	1.000000	0.71417	0.963000	0.40424	0.925000	0.55904	8.758000	0.91663	2.733000	0.93635	0.655000	0.94253	GTG	-	NULL		0.468	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL13	protein_coding	OTTHUMT00000084528.5	G	NM_014955	-		171765642	+1	no_errors	ENST00000361735	ensembl	human	known	74_37	missense	SNP	1.000	C
HELZ2	85441	genome.wustl.edu	37	20	62203329	62203329	+	Intron	SNP	A	A	G	rs370520084		TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr20:62203329A>G	ENST00000467148.1	-	1	348				HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator						cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CTCCTGCCCTACTCCAAGCTC	0.662																																																	0								ENSG00000130589																																			HELZ2	SO:0001627	intron_variant	0			-	HGNC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.278+131T>C	20.37:g.62203329A>G		Somatic	0	47	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	52	17.19	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	RNA	SNP	41	8.70	4	63	12.50	9	-	NULL	ENST00000467148.1	37	NULL	CCDS33508.1	20																																																																																			-	-		0.662	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	protein_coding	OTTHUMT00000354127.1	A	NM_001037335	-		62203329	-1	no_errors	ENST00000479540	ensembl	human	known	74_37	rna	SNP	0.196	G
SMARCC2	6601	genome.wustl.edu	37	12	56565571	56565571	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr12:56565571G>A	ENST00000267064.4	-	20	2070	c.1984C>T	c.(1984-1986)Caa>Taa	p.Q662*	SMARCC2_ENST00000394023.3_Nonsense_Mutation_p.Q693*|SMARCC2_ENST00000550164.1_Nonsense_Mutation_p.Q693*|SMARCC2_ENST00000347471.4_Nonsense_Mutation_p.Q693*|RP11-977G19.5_ENST00000553176.1_RNA	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	662					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			GGGATGGGTTGGTAGGCCAGG	0.582																																																	0								ENSG00000139613						90.0	84.0	86.0					12																	56565571		2203	4300	6503	SMARCC2	SO:0001587	stop_gained	0			-	HGNC	U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.1984C>T	12.37:g.56565571G>A	ENSP00000267064:p.Gln662*	Somatic	0	26	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	133	147	47.50	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Nonsense_Mutation	SNP	31	0.00	0	212	49.88	211	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.Q662*	ENST00000267064.4	37	c.1984	CCDS8907.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.186625	0.97357	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	.	.	.	4.36	4.36	0.52297	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-12.4247	16.2091	0.82146	0.0:0.0:1.0:0.0	.	.	.	.	X	693;693;693;662	.	ENSP00000267064:Q662X	Q	-	1	0	SMARCC2	54851838	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.657000	0.98554	2.433000	0.82419	0.655000	0.94253	CAA	-	superfamily_Chromodomain-like		0.582	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCC2	protein_coding	OTTHUMT00000408370.1	G		-		56565571	-1	no_errors	ENST00000267064	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ADAM21P1	145241	genome.wustl.edu	37	14	70714300	70714300	+	RNA	SNP	A	A	G	rs112607032	byFrequency	TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr14:70714300A>G	ENST00000530196.1	-	0	218					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		GACAGTAGCCAGAAATAGACA	0.532																																																	0								ENSG00000235812																																			ADAM21P1			0			-	HGNC			14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70714300A>G		Somatic	0	31	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	48	12.73		RNA	SNP	39	2.50	1	54	11.48	7	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			-	-		0.532	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	pseudogene	OTTHUMT00000390451.1	A	NG_002467	rs112607032		70714300	-1	no_errors	ENST00000530196	ensembl	human	known	74_37	rna	SNP	0.000	G
PLCE1	51196	genome.wustl.edu	37	10	96005731	96005731	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr10:96005731G>T	ENST00000371380.3	+	7	2684	c.2449G>T	c.(2449-2451)Gac>Tac	p.D817Y	PLCE1_ENST00000260766.3_Missense_Mutation_p.D817Y|PLCE1_ENST00000371385.3_Missense_Mutation_p.D509Y|PLCE1_ENST00000371375.1_Missense_Mutation_p.D509Y			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	817					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				GTTGGATTCAGACAATGACAT	0.413																																																	0								ENSG00000138193						82.0	80.0	81.0					10																	96005731		1918	4137	6055	PLCE1	SO:0001583	missense	0			-	HGNC		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.2449G>T	10.37:g.96005731G>T	ENSP00000360431:p.Asp817Tyr	Somatic	0	60	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	54	8.47	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	34	0.00	0	40	0.00	0	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_Ras-assoc,pfam_RasGRF_CDC25,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_Ras_GEF_dom,superfamily_C2_dom,smart_RasGRF_CDC25,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,smart_Ras-assoc,pfscan_C2_dom,pfscan_Ras-assoc,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,pfscan_RasGRF_CDC25,prints_Pinositol_PLipase_C	p.D817Y	ENST00000371380.3	37	c.2449	CCDS41552.1	10	.	.	.	.	.	.	.	.	.	.	G	15.87	2.961869	0.53400	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.33654	1.4;1.4;1.4;1.4	6.04	6.04	0.98038	Guanine-nucleotide dissociation stimulator CDC25 (1);Ras guanine nucleotide exchange factor, domain (1);	0.476689	0.22934	N	0.053878	T	0.20981	0.0505	N	0.02011	-0.69	0.45354	D	0.998347	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.06405	0.002;0.002;0.002	T	0.18840	-1.0324	10	0.72032	D	0.01	.	20.6524	0.99598	0.0:0.0:1.0:0.0	.	817;509;817	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	Y	817;817;509;509	ENSP00000260766:D817Y;ENSP00000360431:D817Y;ENSP00000360438:D509Y;ENSP00000360426:D509Y	ENSP00000260766:D817Y	D	+	1	0	PLCE1	95995721	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	9.188000	0.94921	2.890000	0.99128	0.585000	0.79938	GAC	-	superfamily_Ras_GEF_dom,smart_RasGRF_CDC25		0.413	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCE1	protein_coding	OTTHUMT00000049469.3	G	NM_016341	-		96005731	+1	no_errors	ENST00000260766	ensembl	human	known	74_37	missense	SNP	1.000	T
ATAD5	79915	genome.wustl.edu	37	17	29220695	29220695	+	Silent	SNP	C	C	T	rs375680809		TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr17:29220695C>T	ENST00000321990.4	+	21	5202	c.4824C>T	c.(4822-4824)gaC>gaT	p.D1608D		NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1608					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AAACCGGAGACGAAGAAAGCA	0.403																																																	0								ENSG00000176208	C		0,4406		0,0,2203	59.0	67.0	64.0		4824	0.1	0.8	17		64	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ATAD5	NM_024857.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		1608/1845	29220695	1,13005	2203	4300	6503	ATAD5	SO:0001819	synonymous_variant	0			-	HGNC		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.4824C>T	17.37:g.29220695C>T		Somatic	0	17	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	12	42.86	Q05DH0|Q69YR6|Q9H9I1	Silent	SNP	27	0.00	0	29	42.00	21	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.D1608	ENST00000321990.4	37	c.4824	CCDS11260.1	17																																																																																			-	NULL		0.403	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD5	protein_coding	OTTHUMT00000256206.2	C	NM_024857	-		29220695	+1	no_errors	ENST00000321990	ensembl	human	known	74_37	silent	SNP	0.798	T
POTEH	23784	genome.wustl.edu	37	22	16278128	16278128	+	Intron	SNP	A	A	G	rs199670027		TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr22:16278128A>G	ENST00000343518.6	-	5	1080				POTEH-AS1_ENST00000422014.1_RNA|RNU6-816P_ENST00000390914.1_RNA	NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H											NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						CTACTAATTTAAAGTCCTTTG	0.358																																																	0								ENSG00000236666																																			POTEH-AS1	SO:0001627	intron_variant	0			-	HGNC	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.1029-243T>C	22.37:g.16278128A>G		Somatic	0	19	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	15	40.00	A2CEK4|A6NCI1|A9Z1W0	RNA	SNP	36	14.29	6	58	19.44	14	-	NULL	ENST00000343518.6	37	NULL	CCDS46658.1	22																																																																																			-	-		0.358	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEH-AS1	protein_coding	OTTHUMT00000276918.4	A	NM_001136213	rs199670027		16278128	+1	no_errors	ENST00000422014	ensembl	human	known	74_37	rna	SNP	0.230	G
RP11-403I13.8	0	genome.wustl.edu	37	1	149287701	149287701	+	lincRNA	SNP	G	G	A			TCGA-DX-A240-01A-32D-A27P-09	TCGA-DX-A240-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3db6e6cc-1a06-49b9-834e-b6611cde4c4b	2ced1edd-817a-4e6b-96b5-c192f0a91663	g.chr1:149287701G>A	ENST00000433084.1	+	0	251				RNU1-143P_ENST00000516296.1_RNA|RP11-403I13.7_ENST00000424684.1_lincRNA																							CAACTGACAAGATGGTCGCGG	0.692																																																	0								ENSG00000235999																																			RP11-403I13.8			0			-	Clone_based_vega_gene																													1.37:g.149287701G>A		Somatic	0	19	0.00		0.6002284192942311	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	91	29.46		RNA	SNP	69	0.00	0	294	19.89	73	-	NULL	ENST00000433084.1	37	NULL		1																																																																																			-	-		0.692	RP11-403I13.8-001	KNOWN	basic	lincRNA	ENSG00000235999	lincRNA	OTTHUMT00000099633.1	G		-		149287701	+1	no_errors	ENST00000433084	ensembl	human	known	74_37	rna	SNP	0.002	A
