#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
NRXN1	9378	genome.wustl.edu	37	2	50923314	50923319	+	Intron	DEL	GTGTGT	GTGTGT	-	rs202071380|rs201534178|rs200473527		TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	GTGTGT	GTGTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr2:50923314_50923319delGTGTGT	ENST00000406316.2	-	6	2309				NRXN1_ENST00000402717.3_Intron|NRXN1_ENST00000405472.3_Intron|NRXN1_ENST00000404971.1_Intron|NRXN1_ENST00000406859.3_Intron|AC009234.2_ENST00000401372.1_RNA|NRXN1_ENST00000401669.2_Intron	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			Gtacatatacgtgtgtgtgtgtgtgt	0.437																																																	0								ENSG00000216191																																			AC009234.2	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.833-72561ACACAC>-	2.37:g.50923320_50923325delGTGTGT		Somatic	NA	NA	NA		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	RNA	DEL	11	31.25	5	37	26.00	13	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																			-	-		0.437	NRXN1-001	KNOWN	basic|CCDS	protein_coding	ENSG00000216191	protein_coding	OTTHUMT00000325291.2	GTGTGT				50923319	-1	no_errors	ENST00000401372	ensembl	human	novel	74_37	rna	DEL	0.006:0.004:0.003:0.002:0.002:0.000	-
PCLO	27445	genome.wustl.edu	37	7	82784233	82784233	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr7:82784233G>C	ENST00000333891.9	-	2	2061	c.1724C>G	c.(1723-1725)tCt>tGt	p.S575C	PCLO_ENST00000423517.2_Missense_Mutation_p.S575C	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CTGTTTTGCAGATGGAGACAC	0.483																																																	0								ENSG00000186472						373.0	371.0	372.0					7																	82784233		2012	4174	6186	PCLO	SO:0001583	missense	0			-	HGNC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.1724C>G	7.37:g.82784233G>C	ENSP00000334319:p.Ser575Cys	Somatic	0	129	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	63	42.73		Missense_Mutation	SNP	28	0.00	0	33	32.65	16	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.S575C	ENST00000333891.9	37	c.1724	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	G	1.340	-0.594338	0.03771	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.17854	2.26;2.25	5.1	4.2	0.49525	.	.	.	.	.	T	0.21022	0.0506	L	0.27053	0.805	0.47621	D	0.999473	D;D	0.61697	0.99;0.99	P;P	0.53313	0.723;0.723	T	0.01661	-1.1301	9	0.87932	D	0	.	13.237	0.59974	0.0:0.161:0.839:0.0	.	575;575	Q9Y6V0-5;Q9Y6V0-6	.;.	C	521;575;575	ENSP00000334319:S575C;ENSP00000388393:S575C	ENSP00000334319:S575C	S	-	2	0	PCLO	82622169	0.561000	0.26578	0.866000	0.34008	0.047000	0.14425	0.869000	0.27996	1.111000	0.41721	0.557000	0.71058	TCT	-	NULL		0.483	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	protein_coding	OTTHUMT00000337368.5	G	NM_014510	-		82784233	-1	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	SNP	0.665	C
GALNT5	11227	genome.wustl.edu	37	2	158115495	158115495	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr2:158115495T>G	ENST00000259056.4	+	1	1386	c.901T>G	c.(901-903)Ttg>Gtg	p.L301V		NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	301					cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						TTTGGGAAGTTTGTCAAAGGA	0.393																																																	0								ENSG00000136542						67.0	72.0	70.0					2																	158115495		2203	4300	6503	GALNT5	SO:0001583	missense	0			-	HGNC	AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.901T>G	2.37:g.158115495T>G	ENSP00000259056:p.Leu301Val	Somatic	0	24	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	14	36.36	A5PKZ1|Q9UGK7|Q9UHL6	Missense_Mutation	SNP	24	0.00	0	24	27.27	9	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.L301V	ENST00000259056.4	37	c.901	CCDS2203.1	2	.	.	.	.	.	.	.	.	.	.	T	5.697	0.313176	0.10789	.	.	ENSG00000136542	ENST00000259056	T	0.59638	0.25	5.66	-1.71	0.08133	.	6.084050	0.00166	N	0.000000	T	0.41994	0.1183	L	0.32530	0.975	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.04855	-1.0922	10	0.33940	T	0.23	.	0.7187	0.00936	0.3111:0.2113:0.1052:0.3725	.	301	Q7Z7M9	GALT5_HUMAN	V	301	ENSP00000259056:L301V	ENSP00000259056:L301V	L	+	1	2	GALNT5	157823741	0.006000	0.16342	0.001000	0.08648	0.000000	0.00434	-0.244000	0.08903	-0.718000	0.04949	-1.139000	0.01908	TTG	-	NULL		0.393	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT5	protein_coding	OTTHUMT00000254925.2	T	NM_014568	-		158115495	+1	no_errors	ENST00000259056	ensembl	human	known	74_37	missense	SNP	0.000	G
PDPK1	5170	genome.wustl.edu	37	16	2653400	2653400	+	IGR	SNP	C	C	G			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr16:2653400C>G	ENST00000342085.4	+	0	7241				AC141586.5_ENST00000399702.1_RNA	NM_002613.4	NP_002604.1	O15530	PDPK1_HUMAN	3-phosphoinositide dependent protein kinase 1						actin cytoskeleton organization (GO:0030036)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway (GO:0097191)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|focal adhesion assembly (GO:0048041)|hyperosmotic response (GO:0006972)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of endothelial cell migration (GO:0010594)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of mast cell degranulation (GO:0043304)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	3-phosphoinositide-dependent protein kinase activity (GO:0004676)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	7		Ovarian(90;0.17)			Celecoxib(DB00482)	GTGGGCGGGACAGAACGCAAA	0.622																																																	0								ENSG00000215154																																			AC141586.5	SO:0001628	intergenic_variant	0			-	Clone_based_vega_gene	AF017995	CCDS10472.1, CCDS10473.1, CCDS58411.1	16p13.3	2014-03-20	2014-03-20		ENSG00000140992	ENSG00000140992			8816	protein-coding gene	gene with protein product	"""PkB kinase"""	605213				9094314, 9445477	Standard	NM_002613		Approved	PDK1	uc002cqs.4	O15530	OTTHUMG00000128874		16.37:g.2653400C>G		Somatic	0	47	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	34	37.04	H0Y4Z0|Q59EH6|Q6FI20|Q8IV52|Q9BRD5	RNA	SNP	21	0.00	0	19	48.65	18	-	NULL	ENST00000342085.4	37	NULL	CCDS10472.1	16																																																																																			-	-		0.622	PDPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC652276	protein_coding	OTTHUMT00000250831.3	C		-		2653400	+1	no_errors	ENST00000399702	ensembl	human	known	74_37	rna	SNP	0.001	G
CLVS1	157807	genome.wustl.edu	37	8	62371079	62371081	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	TGC	TGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr8:62371079_62371081delTGC	ENST00000519846.1	+	6	1427_1429	c.955_957delTGC	c.(955-957)tgcdel	p.C319del	CLVS1_ENST00000518592.1_In_Frame_Del_p.C40del|CLVS1_ENST00000325897.4_In_Frame_Del_p.C319del			Q8IUQ0	CLVS1_HUMAN	clavesin 1	319					lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						GGAGAGAGAATGCTCACCCAAGC	0.453																																																	0								ENSG00000177182																																			CLVS1	SO:0001651	inframe_deletion	0				HGNC	AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.955_957delTGC	8.37:g.62371079_62371081delTGC	ENSP00000428402:p.Cys319del	Somatic	0	42	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	22	48.84	B2R7M5|C8UZT3|Q8NB32	In_Frame_Del	DEL	27	0.00	0	30	41.18	21	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,prints_CRAL-bd_toc_tran	p.C319in_frame_del	ENST00000519846.1	37	c.955_957	CCDS6176.1	8																																																																																			-	NULL		0.453	CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CLVS1	protein_coding	OTTHUMT00000378323.1	TGC	NM_173519			62371081	+1	no_errors	ENST00000325897	ensembl	human	known	74_37	in_frame_del	DEL	0.586:0.792:0.937	-
ANO6	196527	genome.wustl.edu	37	12	45816840	45816840	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr12:45816840A>G	ENST00000320560.8	+	19	2723	c.2521A>G	c.(2521-2523)Atg>Gtg	p.M841V	ANO6_ENST00000423947.3_Missense_Mutation_p.M862V|ANO6_ENST00000425752.2_Missense_Mutation_p.M841V|ANO6_ENST00000435642.1_Missense_Mutation_p.M841V|ANO6_ENST00000441606.2_Missense_Mutation_p.M823V	NM_001025356.2	NP_001020527.2	Q4KMQ2	ANO6_HUMAN	anoctamin 6	841					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						TATCATTGTCATGGAGGTAGG	0.413																																																	0								ENSG00000177119						115.0	111.0	112.0					12																	45816840		2203	4300	6503	ANO6	SO:0001583	missense	0			-	HGNC	AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000320560.8:c.2521A>G	12.37:g.45816840A>G	ENSP00000320087:p.Met841Val	Somatic	0	76	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Missense_Mutation	SNP	24	0.00	0	25	0.00	0	pfam_Anoctamin	p.M841V	ENST00000320560.8	37	c.2521	CCDS31782.1	12	.	.	.	.	.	.	.	.	.	.	A	12.97	2.098494	0.37048	.	.	ENSG00000177119	ENST00000425752;ENST00000423947;ENST00000435642;ENST00000320560;ENST00000441606	T;T;T;T;T	0.62364	2.6;0.03;2.6;0.03;0.03	4.76	3.6	0.41247	.	0.232072	0.44285	N	0.000474	T	0.51329	0.1668	L	0.31804	0.96	0.43965	D	0.996649	B;B;B;B	0.27559	0.181;0.022;0.027;0.069	B;B;B;B	0.33392	0.163;0.027;0.02;0.032	T	0.51379	-0.8713	10	0.56958	D	0.05	.	10.8773	0.46919	0.9241:0.0:0.0759:0.0	.	823;862;841;841	E9PB30;B9EGG0;E9PCT2;Q4KMQ2	.;.;.;ANO6_HUMAN	V	841;862;841;841;823	ENSP00000391417:M841V;ENSP00000409126:M862V;ENSP00000413840:M841V;ENSP00000320087:M841V;ENSP00000413137:M823V	ENSP00000320087:M841V	M	+	1	0	ANO6	44103107	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.037000	0.57311	0.897000	0.36392	0.533000	0.62120	ATG	-	pfam_Anoctamin		0.413	ANO6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANO6	protein_coding	OTTHUMT00000404822.1	A	XM_113743	-		45816840	+1	no_errors	ENST00000425752	ensembl	human	known	74_37	missense	SNP	1.000	G
TESPA1	9840	genome.wustl.edu	37	12	55354969	55354969	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr12:55354969G>A	ENST00000449076.1	-	10	1682	c.1550C>T	c.(1549-1551)gCt>gTt	p.A517V	TESPA1_ENST00000532804.1_Missense_Mutation_p.A379V|TESPA1_ENST00000524622.1_Missense_Mutation_p.A379V|TESPA1_ENST00000531122.1_Missense_Mutation_p.A379V|TESPA1_ENST00000316577.8_Missense_Mutation_p.A517V|TESPA1_ENST00000524959.1_5'Flank	NM_001136030.2	NP_001129502.1	A2RU30	TESP1_HUMAN	thymocyte expressed, positive selection associated 1	517					COP9 signalosome assembly (GO:0010387)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)											GTCTTTGCCAGCAAAAGTCTG	0.507																																																	0								ENSG00000135426						140.0	166.0	157.0					12																	55354969		2184	4294	6478	TESPA1	SO:0001583	missense	0			-	HGNC	AB018291	CCDS44913.1, CCDS58240.1	12q13.2	2012-03-21	2012-03-21	2012-03-21	ENSG00000135426	ENSG00000135426			29109	protein-coding gene	gene with protein product		615664	"""KIAA0748"""	KIAA0748		9872452	Standard	NM_001136030		Approved		uc001sgn.4	A2RU30	OTTHUMG00000165407	ENST00000449076.1:c.1550C>T	12.37:g.55354969G>A	ENSP00000400892:p.Ala517Val	Somatic	0	35	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	81	253	24.25	B4DPM3|B4E048|B7Z9K7|O94849|Q4G0P2|Q9P0C4	Missense_Mutation	SNP	23	0.00	0	272	28.53	109	NULL	p.A517V	ENST00000449076.1	37	c.1550	CCDS44913.1	12	.	.	.	.	.	.	.	.	.	.	G	13.16	2.153851	0.38021	.	.	ENSG00000135426	ENST00000524622;ENST00000532804;ENST00000449076;ENST00000316577;ENST00000531122	T;T;T;T;T	0.46819	0.86;0.86;0.87;0.87;0.86	4.15	2.33	0.28932	.	0.658638	0.13332	N	0.395823	T	0.32436	0.0829	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.27226	-1.0080	10	0.72032	D	0.01	4.3059	6.4127	0.21700	0.2178:0.0:0.7822:0.0	.	517	A2RU30	K0748_HUMAN	V	379;379;517;517;379	ENSP00000435622:A379V;ENSP00000432030:A379V;ENSP00000400892:A517V;ENSP00000312679:A517V;ENSP00000433098:A379V	ENSP00000312679:A517V	A	-	2	0	KIAA0748	53641236	0.003000	0.15002	0.001000	0.08648	0.015000	0.08874	0.700000	0.25601	0.724000	0.32296	0.650000	0.86243	GCT	-	NULL		0.507	TESPA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TESPA1	protein_coding	OTTHUMT00000383822.1	G	NM_001098815	-		55354969	-1	no_errors	ENST00000316577	ensembl	human	known	74_37	missense	SNP	0.001	A
INA	9118	genome.wustl.edu	37	10	105038013	105038013	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr10:105038013G>A	ENST00000369849.4	+	1	1094	c.1045G>A	c.(1045-1047)Gcc>Acc	p.A349T		NM_032727.3	NP_116116.1	Q16352	AINX_HUMAN	internexin neuronal intermediate filament protein, alpha	349	Coil 2.|Rod.				cell differentiation (GO:0030154)|neurofilament cytoskeleton organization (GO:0060052)|substantia nigra development (GO:0021762)	cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular space (GO:0005615)|neurofilament (GO:0005883)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)	13				Epithelial(162;3.45e-09)|all cancers(201;9.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		GCGGCACAGTGCCGAGGTAGC	0.692																																																	0								ENSG00000148798						8.0	7.0	7.0					10																	105038013		2134	4230	6364	INA	SO:0001583	missense	0			-	HGNC	S78296	CCDS7545.1	10q24	2013-01-16			ENSG00000148798	ENSG00000148798		"""Intermediate filaments type IV"""	6057	protein-coding gene	gene with protein product		605338		NEF5		7769995	Standard	NM_032727		Approved	NF-66	uc001kws.3	Q16352	OTTHUMG00000018986	ENST00000369849.4:c.1045G>A	10.37:g.105038013G>A	ENSP00000358865:p.Ala349Thr	Somatic	0	51	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	13	60.61	B1AQK0|Q9BRC5	Missense_Mutation	SNP	25	0.00	0	22	46.34	19	pfam_IF,pfam_Intermed_filament_DNA-bd,superfamily_Prefoldin	p.A349T	ENST00000369849.4	37	c.1045	CCDS7545.1	10	.	.	.	.	.	.	.	.	.	.	G	15.78	2.934234	0.52866	.	.	ENSG00000148798	ENST00000369849	D	0.95724	-3.79	4.54	4.54	0.55810	Filament (1);	0.113981	0.64402	D	0.000018	D	0.95105	0.8414	L	0.38733	1.17	0.44485	D	0.997424	D;D	0.56035	0.974;0.974	P;P	0.57720	0.826;0.826	D	0.93291	0.6668	10	0.21540	T	0.41	.	17.4425	0.87568	0.0:0.0:1.0:0.0	.	182;349	Q59EM6;Q16352	.;AINX_HUMAN	T	349	ENSP00000358865:A349T	ENSP00000358865:A349T	A	+	1	0	INA	105028003	0.036000	0.19791	0.986000	0.45419	0.986000	0.74619	2.188000	0.42612	2.508000	0.84585	0.561000	0.74099	GCC	-	pfam_IF		0.692	INA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INA	protein_coding	OTTHUMT00000050145.1	G	NM_032727	-		105038013	+1	no_errors	ENST00000369849	ensembl	human	known	74_37	missense	SNP	0.984	A
MDS2	259283	genome.wustl.edu	37	1	23953539	23953540	+	5'Flank	DEL	GA	GA	-	rs146024280		TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr1:23953539_23953540delGA	ENST00000374555.3	+	0	0				MDS2_ENST00000477916.1_3'UTR			Q8NDY4	MDS2_HUMAN	myelodysplastic syndrome 2 translocation associated							extracellular space (GO:0005615)				breast(1)|ovary(2)	3						AAAGGGAGGGGAGAGAGAGAGA	0.535			T	ETV6	MDS																																			Dom	yes		1	1p36	259283	myelodysplastic syndrome 2		L	0								ENSG00000197880																																			MDS2	SO:0001631	upstream_gene_variant	0				HGNC	AJ310434		1p36	2008-02-05			ENSG00000197880	ENSG00000197880			29633	protein-coding gene	gene with protein product		607305				12203785	Standard	NR_027042		Approved		uc001bhi.3	Q8NDY4	OTTHUMG00000002927		1.37:g.23953549_23953550delGA	Exception_encountered	Somatic	0	37	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00		RNA	DEL	18	0.00	0	46	0.00	0	-	NULL	ENST00000374555.3	37	NULL		1																																																																																			-	-		0.535	MDS2-001	KNOWN	basic|appris_principal	protein_coding	MDS2	protein_coding	OTTHUMT00000008172.1	GA	NM_148895			23953540	+1	no_errors	ENST00000477916	ensembl	human	known	74_37	rna	DEL	0.001:0.001	-
PTPRC	5788	genome.wustl.edu	37	1	198685967	198685967	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr1:198685967C>T	ENST00000367376.2	+	13	1613	c.1442C>T	c.(1441-1443)gCt>gTt	p.A481V	PTPRC_ENST00000352140.3_Missense_Mutation_p.A433V|PTPRC_ENST00000442510.2_Missense_Mutation_p.A483V|PTPRC_ENST00000348564.6_Missense_Mutation_p.A322V|PTPRC_ENST00000594404.1_Missense_Mutation_p.A320V	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	481	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						ACTAAAAGTGCTCGTAAGTTA	0.318																																																	0								ENSG00000081237						71.0	76.0	74.0					1																	198685967		2202	4299	6501	PTPRC	SO:0001583	missense	0			-	HGNC	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.1442C>T	1.37:g.198685967C>T	ENSP00000356346:p.Ala481Val	Somatic	0	51	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	16	40.74	A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	47	0.00	0	35	48.53	33	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Leukocyte_common_ag,pfam_PTP_recept_N,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.A483V	ENST00000367376.2	37	c.1448		1	.	.	.	.	.	.	.	.	.	.	C	11.02	1.515370	0.27123	.	.	ENSG00000081237	ENST00000367376;ENST00000367366;ENST00000352140;ENST00000535566;ENST00000530727;ENST00000442510;ENST00000367367;ENST00000348564	T	0.56275	0.47	4.27	-8.55	0.00908	Fibronectin, type III (1);Immunoglobulin-like fold (1);	1.782880	0.03163	N	0.169655	T	0.45074	0.1324	M	0.68593	2.085	0.09310	N	1	P;P;B;B;B	0.43431	0.798;0.807;0.394;0.394;0.394	B;B;B;B;B	0.42245	0.381;0.169;0.048;0.104;0.104	T	0.53099	-0.8486	10	0.44086	T	0.13	.	2.6074	0.04881	0.504:0.1525:0.1992:0.1443	.	417;417;322;433;481	F5GXZ3;B4DSZ5;B1ALS3;E9PC28;P08575	.;.;.;.;PTPRC_HUMAN	V	483;417;433;433;367;481;415;320	ENSP00000193532:A433V	ENSP00000306782:A320V	A	+	2	0	PTPRC	196952590	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.934000	0.01552	-1.903000	0.01093	-0.188000	0.12872	GCT	-	pirsf_Leukocyte_common_ag,superfamily_Fibronectin_type3		0.318	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	PTPRC	protein_coding		C		-		198685967	+1	no_errors	ENST00000442510	ensembl	human	known	74_37	missense	SNP	0.000	T
FAT3	120114	genome.wustl.edu	37	11	92534174	92534174	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr11:92534174T>G	ENST00000298047.6	+	9	8012	c.7995T>G	c.(7993-7995)aaT>aaG	p.N2665K	FAT3_ENST00000409404.2_Missense_Mutation_p.N2665K|FAT3_ENST00000525166.1_Missense_Mutation_p.N2515K			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2665	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CAAAGGGTAATTTTAACCAGC	0.458										TCGA Ovarian(4;0.039)																																							0								ENSG00000165323						39.0	37.0	37.0					11																	92534174		1878	4108	5986	FAT3	SO:0001583	missense	0			-	HGNC	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7995T>G	11.37:g.92534174T>G	ENSP00000298047:p.Asn2665Lys	Somatic	0	47	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	24	45.45	B5MDB0|Q96AU6	Missense_Mutation	SNP	23	0.00	0	23	51.06	24	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.N2665K	ENST00000298047.6	37	c.7995		11	.	.	.	.	.	.	.	.	.	.	T	13.43	2.235259	0.39498	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.51071	0.72;0.72;0.72	6.17	-1.59	0.08453	.	.	.	.	.	T	0.28499	0.0705	L	0.27053	0.805	0.80722	D	1	B	0.24132	0.098	B	0.23852	0.049	T	0.07809	-1.0753	9	0.19147	T	0.46	.	8.4555	0.32897	0.0:0.4516:0.1197:0.4287	.	2665	Q8TDW7-3	.	K	2665;2665;2515	ENSP00000298047:N2665K;ENSP00000387040:N2665K;ENSP00000432586:N2515K	ENSP00000298047:N2665K	N	+	3	2	FAT3	92173822	0.940000	0.31905	0.679000	0.29978	0.964000	0.63967	0.319000	0.19522	-0.530000	0.06349	-0.250000	0.11733	AAT	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.458	FAT3-201	KNOWN	basic	protein_coding	FAT3	protein_coding		T	NM_001008781	-		92534174	+1	no_errors	ENST00000298047	ensembl	human	known	74_37	missense	SNP	0.763	G
CEP290	80184	genome.wustl.edu	37	12	88505602	88505602	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr12:88505602C>G	ENST00000552810.1	-	21	2429	c.2086G>C	c.(2086-2088)Gat>Cat	p.D696H	CEP290_ENST00000397838.3_5'UTR|CEP290_ENST00000309041.7_Missense_Mutation_p.D698H	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	696					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						AGACTCGCATCAAAGATTCCT	0.343																																																	0								ENSG00000198707						42.0	39.0	40.0					12																	88505602		1797	4067	5864	CEP290	SO:0001583	missense	0			-	HGNC	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.2086G>C	12.37:g.88505602C>G	ENSP00000448012:p.Asp696His	Somatic	0	62	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	278	33	89.39	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	32	0.00	0	25	94.27	428	NULL	p.D698H	ENST00000552810.1	37	c.2092	CCDS55858.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.1|20.1	3.932039|3.932039	0.73442|0.73442	.|.	.|.	ENSG00000198707|ENSG00000198707	ENST00000552810;ENST00000309041;ENST00000536998|ENST00000545139	T;T|.	0.78595|.	-1.19;-1.19|.	5.75|5.75	5.75|5.75	0.90469|0.90469	.|.	0.057564|.	0.64402|.	D|.	0.000001|.	T|.	0.74869|.	0.3773|.	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.998;1.0|.	D;D|.	0.80764|.	0.979;0.994|.	T|.	0.71520|.	-0.4568|.	10|.	0.44086|.	T|.	0.13|.	.|.	20.0112|20.0112	0.97449|0.97449	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	696;696|.	Q05BJ6;O15078|.	.;CE290_HUMAN|.	H|S	696;698;696|550	ENSP00000448012:D696H;ENSP00000308021:D698H|.	ENSP00000308021:D698H|.	D|X	-|-	1|2	0|2	CEP290|CEP290	87029733|87029733	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.251000|7.251000	0.78297|0.78297	2.728000|2.728000	0.93425|0.93425	0.580000|0.580000	0.79431|0.79431	GAT|TGA	-	NULL		0.343	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP290	protein_coding	OTTHUMT00000406344.1	C	NM_025114	-		88505602	-1	no_errors	ENST00000309041	ensembl	human	known	74_37	missense	SNP	1.000	G
EPHB2	2048	genome.wustl.edu	37	1	23111370	23111370	+	Silent	SNP	C	C	T			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr1:23111370C>T	ENST00000400191.3	+	3	630	c.612C>T	c.(610-612)ggC>ggT	p.G204G	EPHB2_ENST00000374632.3_Silent_p.G204G|EPHB2_ENST00000544305.1_Silent_p.G204G|EPHB2_ENST00000374627.1_Silent_p.G198G|EPHB2_ENST00000374630.3_Silent_p.G204G	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	204	Cys-rich.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		TCCAGAATGGCGCCATCTTCC	0.627																																																	0								ENSG00000133216						43.0	40.0	41.0					1																	23111370		2203	4300	6503	EPHB2	SO:0001819	synonymous_variant	0			-	HGNC	AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.612C>T	1.37:g.23111370C>T		Somatic	0	64	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	62	10.14	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Silent	SNP	22	0.00	0	32	3.03	1	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G204	ENST00000400191.3	37	c.612		1																																																																																			-	pirsf_Tyr_kinase_ephrin_rcpt		0.627	EPHB2-001	KNOWN	basic	protein_coding	EPHB2	protein_coding	OTTHUMT00000008060.2	C	NM_017449	-		23111370	+1	no_errors	ENST00000400191	ensembl	human	known	74_37	silent	SNP	0.239	T
SLC27A3	11000	genome.wustl.edu	37	1	153749685	153749685	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr1:153749685G>T	ENST00000368661.3	+	3	1231	c.1166G>T	c.(1165-1167)tGc>tTc	p.C389F	SLC27A3_ENST00000271857.2_Missense_Mutation_p.C470F|SLC27A3_ENST00000484014.1_3'UTR	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3	389					fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ATCGTGGGCTGCATGGGCATT	0.522																																																	0								ENSG00000143554						163.0	131.0	142.0					1																	153749685		2203	4300	6503	SLC27A3	SO:0001583	missense	0			-	HGNC	BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155	ENST00000368661.3:c.1166G>T	1.37:g.153749685G>T	ENSP00000357650:p.Cys389Phe	Somatic	0	48	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Missense_Mutation	SNP	26	0.00	0	42	0.00	0	pfam_AMP-dep_Synth/Lig	p.C389F	ENST00000368661.3	37	c.1166	CCDS1053.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.77|14.77	2.635767|2.635767	0.47049|0.47049	.|.	.|.	ENSG00000143554|ENSG00000143554	ENST00000458027|ENST00000271857;ENST00000368661	.|T;T	.|0.40225	.|1.04;1.04	4.92|4.92	3.99|3.99	0.46301|0.46301	.|AMP-dependent synthetase/ligase (1);	.|0.115023	.|0.64402	.|D	.|0.000010	T|T	0.57681|0.57681	0.2070|0.2070	M|M	0.86805|0.86805	2.84|2.84	0.41536|0.41536	D|D	0.988489|0.988489	.|D	.|0.76494	.|0.999	.|D	.|0.77557	.|0.99	T|T	0.66232|0.66232	-0.5975|-0.5975	5|10	.|0.87932	.|D	.|0	-28.7175|-28.7175	10.4274|10.4274	0.44387|0.44387	0.0:0.0:0.8055:0.1945|0.0:0.0:0.8055:0.1945	.|.	.|389	.|Q5K4L6	.|S27A3_HUMAN	S|F	94|470;389	.|ENSP00000271857:C470F;ENSP00000357650:C389F	.|ENSP00000271857:C470F	A|C	+|+	1|2	0|0	SLC27A3|SLC27A3	152016309|152016309	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.665000|0.665000	0.39181|0.39181	2.968000|2.968000	0.49224|0.49224	1.288000|1.288000	0.44600|0.44600	0.491000|0.491000	0.48974|0.48974	GCA|TGC	-	pfam_AMP-dep_Synth/Lig		0.522	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A3	protein_coding		G	NM_024330	-		153749685	+1	no_errors	ENST00000368661	ensembl	human	known	74_37	missense	SNP	0.996	T
ZHX3	23051	genome.wustl.edu	37	20	39833134	39833134	+	Silent	SNP	G	G	A	rs113667928	byFrequency	TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr20:39833134G>A	ENST00000309060.3	-	4	838	c.423C>T	c.(421-423)aaC>aaT	p.N141N	ZHX3_ENST00000540170.1_Silent_p.N141N|ZHX3_ENST00000559234.1_Silent_p.N141N|ZHX3_ENST00000544979.2_Silent_p.N141N|ZHX3_ENST00000558993.1_Silent_p.N141N|ZHX3_ENST00000560361.1_Silent_p.N141N|ZHX3_ENST00000432768.2_Silent_p.N141N|ZHX3_ENST00000557816.1_Silent_p.N141N			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	141					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoblast differentiation (GO:0045669)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)				GCTTGGCCACGTTCCACACAA	0.567																																																	0								ENSG00000174306	G		1,4405	2.1+/-5.4	0,1,2202	96.0	90.0	92.0		423	1.4	1.0	20	dbSNP_132	92	0,8600		0,0,4300	no	coding-synonymous	ZHX3	NM_015035.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		141/957	39833134	1,13005	2203	4300	6503	ZHX3	SO:0001819	synonymous_variant	0			-	HGNC	AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1		9455477	Standard	XM_005260343		Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.423C>T	20.37:g.39833134G>A		Somatic	0	33	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	14	50.00	E1P5W5|F5H820|O43145|Q6NUJ7	Silent	SNP	32	0.00	0	12	64.71	22	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.N141	ENST00000309060.3	37	c.423	CCDS13315.1	20																																																																																			-	NULL		0.567	ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZHX3	protein_coding	OTTHUMT00000079262.3	G	NM_015035	rs113667928		39833134	-1	no_errors	ENST00000309060	ensembl	human	known	74_37	silent	SNP	0.974	A
WDR61	80349	genome.wustl.edu	37	15	78575602	78575608	+	3'UTR	DEL	AAGTATG	AAGTATG	-	rs377473936		TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	AAGTATG	AAGTATG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr15:78575602_78575608delAAGTATG	ENST00000267973.2	-	0	1355_1361				RP11-762H8.4_ENST00000558192.1_RNA|WDR61_ENST00000559332.1_5'UTR|WDR61_ENST00000558459.1_3'UTR|WDR61_ENST00000558311.1_3'UTR			Q9GZS3	WDR61_HUMAN	WD repeat domain 61						histone H3-K4 trimethylation (GO:0080182)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9						CTTTATGTTAAAGTATGAACAGCATTT	0.309																																																	0								ENSG00000140395																																			WDR61	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS10300.1	15q25.1	2013-01-09			ENSG00000140395	ENSG00000140395		"""WD repeat domain containing"""	30300	protein-coding gene	gene with protein product		609540				12477932	Standard	NM_025234		Approved	REC14	uc002bdn.3	Q9GZS3	OTTHUMG00000143735	ENST00000267973.2:c.*172CATACTT>-	15.37:g.78575602_78575608delAAGTATG		Somatic	NA	NA	NA		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	D3DW84|Q6IA22|Q7Z4X4	RNA	DEL	40	0.00	0	37	56.98	49	-	NULL	ENST00000267973.2	37	NULL	CCDS10300.1	15																																																																																			-	-		0.309	WDR61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR61	protein_coding	OTTHUMT00000289803.3	AAGTATG	NM_025234			78575608	-1	no_errors	ENST00000559332	ensembl	human	putative	74_37	rna	DEL	0.044:0.027:0.020:0.017:0.024:0.039:0.066	-
SERPINB1	1992	genome.wustl.edu	37	6	2840713	2840713	+	Silent	SNP	T	T	G			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr6:2840713T>G	ENST00000380739.5	-	2	310	c.108A>C	c.(106-108)tcA>tcC	p.S36S	SERPINB1_ENST00000476896.1_5'UTR|SERPINB1_ENST00000537185.1_5'UTR	NM_030666.3	NP_109591.1	P30740	ILEU_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 1	36					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(2)|ovary(2)	13	Ovarian(93;0.0412)			OV - Ovarian serous cystadenocarcinoma(45;0.0717)		CCATAGCAGATGAAATGCTGA	0.517																																																	0								ENSG00000021355						90.0	85.0	87.0					6																	2840713		2203	4300	6503	SERPINB1	SO:0001819	synonymous_variant	0			-	HGNC	M93056	CCDS4477.1	6p25.2	2014-02-18	2005-08-18		ENSG00000021355	ENSG00000021355		"""Serine (or cysteine) peptidase inhibitors"""	3311	protein-coding gene	gene with protein product		130135	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1"""	ELANH2		1376927, 24172014	Standard	NM_030666		Approved	EI, PI2, anti-elastase	uc003mub.4	P30740	OTTHUMG00000014124	ENST00000380739.5:c.108A>C	6.37:g.2840713T>G		Somatic	0	79	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	57	29.63	A8K5L2|B4DNT0|Q53FB9|Q5W0E1|Q9UDF8	Silent	SNP	30	0.00	0	25	50.98	26	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.S36	ENST00000380739.5	37	c.108	CCDS4477.1	6																																																																																			-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.517	SERPINB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB1	protein_coding	OTTHUMT00000039637.1	T		-		2840713	-1	no_errors	ENST00000380739	ensembl	human	known	74_37	silent	SNP	0.029	G
RP11-467N20.5	0	genome.wustl.edu	37	15	23406924	23406924	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr15:23406924G>T	ENST00000558241.1	-	8	2002	c.1912C>A	c.(1912-1914)Cag>Aag	p.Q638K																	endometrium(1)	1						ttctcttcctgttcctgcatc	0.537																																																	0								ENSG00000259455																																			RP11-467N20.5	SO:0001583	missense	0			-	Clone_based_vega_gene																												ENST00000558241.1:c.1912C>A	15.37:g.23406924G>T	ENSP00000453436:p.Gln638Lys	Somatic	0	233	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	153	25.73		Missense_Mutation	SNP	14	0.00	0	22	29.03	9	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.Q638K	ENST00000558241.1	37	c.1912		15																																																																																			-	NULL		0.537	RP11-467N20.5-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf	protein_coding	ENSG00000259455	protein_coding	OTTHUMT00000415942.1	G		-		23406924	-1	no_errors	ENST00000558241	ensembl	human	novel	74_37	missense	SNP	0.078	T
GNB3	2784	genome.wustl.edu	37	12	6955865	6955866	+	Intron	INS	-	-	CACA	rs111644697|rs138991440|rs370145261|rs199501562|rs535073895|rs76214301	byFrequency	TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr12:6955865_6955866insCACA	ENST00000229264.3	+	11	1321				GNB3_ENST00000435982.2_Intron|CDCA3_ENST00000422785.3_3'UTR|CDCA3_ENST00000604599.1_5'UTR	NM_002075.2	NP_002066.1	P16520	GBB3_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 3						cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell body (GO:0044297)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|stomach(1)	20						acacacacacccacacacccac	0.52														1995	0.398363	0.5265	0.2853	5008	,	,		21463	0.4673		0.3151	False		,,,				2504	0.32																0								ENSG00000111665																																			CDCA3	SO:0001627	intron_variant	0				HGNC		CCDS8564.1, CCDS73427.1	12p13	2013-01-10			ENSG00000111664	ENSG00000111664		"""WD repeat domain containing"""	4400	protein-coding gene	gene with protein product		139130				11770079, 16600389	Standard	XM_005253680		Approved		uc001qrd.3	P16520	OTTHUMG00000168517	ENST00000229264.3:c.917-90->CACA	12.37:g.6955866_6955869dupCACA		Somatic	0	12	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	7	36.36	Q96B71|Q9BQC0	RNA	INS	11	31.25	5	31	13.89	5	-	NULL	ENST00000229264.3	37	NULL	CCDS8564.1	12																																																																																			-	-		0.520	GNB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA3	protein_coding	OTTHUMT00000400006.1	-	NM_002075			6955866	-1	no_errors	ENST00000604599	ensembl	human	known	74_37	rna	INS	0.008:0.009	CACA
CEP290	80184	genome.wustl.edu	37	12	88505548	88505548	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr12:88505548C>T	ENST00000552810.1	-	21	2483	c.2140G>A	c.(2140-2142)Gaa>Aaa	p.E714K	CEP290_ENST00000397838.3_5'UTR|CEP290_ENST00000309041.7_Missense_Mutation_p.E716K	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	714					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						TGTCTTAATTCTTCATTTCTT	0.358																																																	0								ENSG00000198707						57.0	56.0	56.0					12																	88505548		1814	4071	5885	CEP290	SO:0001583	missense	0			-	HGNC	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.2140G>A	12.37:g.88505548C>T	ENSP00000448012:p.Glu714Lys	Somatic	0	81	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	368	41	89.98	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	38	0.00	0	26	94.00	407	NULL	p.E716K	ENST00000552810.1	37	c.2146	CCDS55858.1	12	.	.	.	.	.	.	.	.	.	.	C	36	5.816379	0.96982	.	.	ENSG00000198707	ENST00000552810;ENST00000309041;ENST00000536998	D;D	0.83506	-1.73;-1.73	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.88789	0.6532	L	0.50333	1.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.84554	0.0646	10	0.20519	T	0.43	.	20.0112	0.97449	0.0:1.0:0.0:0.0	.	714;714	Q05BJ6;O15078	.;CE290_HUMAN	K	714;716;714	ENSP00000448012:E714K;ENSP00000308021:E716K	ENSP00000308021:E716K	E	-	1	0	CEP290	87029679	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.312000	0.78968	2.728000	0.93425	0.580000	0.79431	GAA	-	NULL		0.358	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP290	protein_coding	OTTHUMT00000406344.1	C	NM_025114	-		88505548	-1	no_errors	ENST00000309041	ensembl	human	known	74_37	missense	SNP	1.000	T
FSTL4	23105	genome.wustl.edu	37	5	132545944	132545944	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr5:132545944G>A	ENST00000265342.7	-	14	1904	c.1655C>T	c.(1654-1656)tCa>tTa	p.S552L	CTB-49A3.2_ENST00000509051.1_RNA|CTB-49A3.2_ENST00000502776.1_RNA	NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	552						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTGGTCATGTGACTTGTCATA	0.512																																																	0								ENSG00000053108						83.0	73.0	77.0					5																	132545944		2203	4300	6503	FSTL4	SO:0001583	missense	0			-	HGNC	AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.1655C>T	5.37:g.132545944G>A	ENSP00000265342:p.Ser552Leu	Somatic	0	52	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	17	54.05	Q8TBU0|Q9UPU1	Missense_Mutation	SNP	29	0.00	0	20	45.95	17	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Kazal_dom,smart_Kazal_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_EF_hand_dom,pfscan_Ig-like_dom	p.S552L	ENST00000265342.7	37	c.1655	CCDS34238.1	5	.	.	.	.	.	.	.	.	.	.	G	28.1	4.889462	0.91889	.	.	ENSG00000053108	ENST00000265342;ENST00000360575	T	0.31247	1.5	4.92	4.92	0.64577	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.57169	0.2035	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.996;0.997	T	0.56727	-0.7931	10	0.27785	T	0.31	-4.2448	16.6893	0.85317	0.0:0.0:1.0:0.0	.	552;201	Q6MZW2;B3KPF3	FSTL4_HUMAN;.	L	552;383	ENSP00000265342:S552L	ENSP00000265342:S552L	S	-	2	0	FSTL4	132573843	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.333000	0.90026	2.264000	0.75181	0.585000	0.79938	TCA	-	NULL		0.512	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSTL4	protein_coding	OTTHUMT00000370212.1	G	XM_048786	-		132545944	-1	no_errors	ENST00000265342	ensembl	human	known	74_37	missense	SNP	1.000	A
LOC100631378	100631378	genome.wustl.edu	37	19	38321280	38321280	+	lincRNA	SNP	C	C	T			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr19:38321280C>T	ENST00000443870.1	+	0	1090				AC016582.2_ENST00000592640.1_lincRNA																							GAACAGTCTTCTCTATTCGGG	0.507																																																	0								ENSG00000229481																																			CTD-2554C21.3			0			-	Clone_based_vega_gene																													19.37:g.38321280C>T		Somatic	0	75	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	33	50.00		RNA	SNP	29	0.00	0	29	38.30	18	-	NULL	ENST00000443870.1	37	NULL		19																																																																																			-	-		0.507	CTD-2554C21.3-001	KNOWN	basic	lincRNA	ENSG00000229481	lincRNA	OTTHUMT00000459795.1	C		-		38321280	+1	no_errors	ENST00000443870	ensembl	human	known	74_37	rna	SNP	0.096	T
TRIM9	114088	genome.wustl.edu	37	14	51446051	51446051	+	Intron	SNP	C	C	T			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr14:51446051C>T	ENST00000298355.3	-	9	3192				TRIM9_ENST00000338969.5_Silent_p.R789R	NM_015163.5	NP_055978.4	Q9C026	TRIM9_HUMAN	tripartite motif containing 9						negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of SNARE complex assembly (GO:0035544)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|synaptic vesicle (GO:0008021)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_epithelial(31;0.00418)|Breast(41;0.148)					CCCTGGGCAGCCTTTGAACCG	0.572																																																	0								ENSG00000100505																																			TRIM9	SO:0001627	intron_variant	0			-	HGNC	AF220036	CCDS9703.1, CCDS45105.1	14q21.3	2013-02-11	2011-01-25		ENSG00000100505	ENSG00000100505		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16288	protein-coding gene	gene with protein product		606555	"""tripartite motif-containing 9"""			11331580, 11524423	Standard	NM_015163		Approved	SPRING, RNF91	uc001wyx.4	Q9C026	OTTHUMG00000140291	ENST00000298355.3:c.2070+53G>A	14.37:g.51446051C>T		Somatic	0	68	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	23	34.29	D3DSB7|D3DSB8|Q92557|Q96D24|Q96NI4|Q9C025|Q9C027	Silent	SNP	37	0.00	0	20	44.44	16	pfam_SPRY_rcpt,pfam_Fibronectin_type3,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.R789	ENST00000298355.3	37	c.2367	CCDS9703.1	14																																																																																			-	NULL		0.572	TRIM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM9	protein_coding	OTTHUMT00000276874.1	C	NM_015163	-		51446051	-1	no_errors	ENST00000338969	ensembl	human	known	74_37	silent	SNP	0.310	T
RP11-451O13.1	0	genome.wustl.edu	37	1	157895794	157895794	+	RNA	SNP	G	G	T			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr1:157895794G>T	ENST00000452528.1	+	0	31																											ACAATGGCTGGGGATCCCAGC	0.577																																																	0								ENSG00000236957																																			RP11-451O13.1			0			-	Clone_based_vega_gene																													1.37:g.157895794G>T		Somatic	0	54	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52		RNA	SNP	18	0.00	0	45	0.00	0	-	NULL	ENST00000452528.1	37	NULL		1																																																																																			-	-		0.577	RP11-451O13.1-002	KNOWN	basic	processed_transcript	ENSG00000236957	pseudogene	OTTHUMT00000432264.1	G		-		157895794	+1	no_errors	ENST00000452528	ensembl	human	known	74_37	rna	SNP	0.010	T
PRIM2	5558	genome.wustl.edu	37	6	57512788	57512789	+	3'UTR	INS	-	-	TA	rs376103961|rs386701662|rs79832250		TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr6:57512788_57512789insTA	ENST00000389488.2	+	0	1703_1704				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		tgcactctgttgtgtaattgtg	0.436																																																	0								ENSG00000146143																																			PRIM2	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1701->TA	6.37:g.57512788_57512789insTA		Somatic	0	10	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	10	33.33	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	INS	33	26.67	12	36	50.00	36	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			-	-		0.436	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	protein_coding	OTTHUMT00000043468.3	-	NM_000947			57512789	+1	no_errors	ENST00000389488	ensembl	human	known	74_37	rna	INS	0.034:0.053	TA
DPH6	89978	genome.wustl.edu	37	15	35746987	35746987	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr15:35746987G>T	ENST00000256538.4	-	4	373	c.347C>A	c.(346-348)gCt>gAt	p.A116D		NM_080650.3	NP_542381.1	Q7L8W6	DPH6_HUMAN	diphthamine biosynthesis 6	116					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)		ATP binding (GO:0005524)|diphthine-ammonia ligase activity (GO:0017178)										AGAAAGTATAGCACCTACTGA	0.308																																																	0								ENSG00000134146						70.0	75.0	73.0					15																	35746987		2201	4289	6490	DPH6	SO:0001583	missense	0			-	HGNC		CCDS10043.1, CCDS45213.1	15q14	2013-06-19	2013-06-19	2013-05-02	ENSG00000134146	ENSG00000134146	6.3.1.14		30543	protein-coding gene	gene with protein product	"""diphthine--ammonia ligase"""		"""ATP binding domain 4"", ""DPH6 homolog (S. cerevisiae)"""	ATPBD4		23169644, 23468660	Standard	NM_080650		Approved	MGC14798		Q7L8W6	OTTHUMG00000129759	ENST00000256538.4:c.347C>A	15.37:g.35746987G>T	ENSP00000256538:p.Ala116Asp	Somatic	0	11	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	2	83.33	B3KWG1|Q96HJ6	Missense_Mutation	SNP	44	0.00	0	10	75.00	30	pfam_DUF71_dom,tigrfam_DUF71_dom	p.A116D	ENST00000256538.4	37	c.347	CCDS10043.1	15	.	.	.	.	.	.	.	.	.	.	G	24.8	4.565797	0.86439	.	.	ENSG00000134146	ENST00000256538	T	0.30448	1.53	4.92	4.92	0.64577	Domain of unknown function DUF71, ATP-binding domain (2);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.62925	0.2468	M	0.90650	3.135	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.65479	-0.6158	10	0.33940	T	0.23	-16.3311	17.6498	0.88159	0.0:0.0:1.0:0.0	.	116	Q7L8W6	ATBD4_HUMAN	D	116	ENSP00000256538:A116D	ENSP00000256538:A116D	A	-	2	0	ATPBD4	33534279	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.426000	0.90273	2.721000	0.93114	0.650000	0.86243	GCT	-	pfam_DUF71_dom,tigrfam_DUF71_dom		0.308	DPH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPH6	protein_coding	OTTHUMT00000251973.1	G	NM_080650	-		35746987	-1	no_errors	ENST00000256538	ensembl	human	known	74_37	missense	SNP	1.000	T
NEB	4703	genome.wustl.edu	37	2	152539275	152539275	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr2:152539275G>T	ENST00000172853.10	-	29	2991	c.2844C>A	c.(2842-2844)taC>taA	p.Y948*	NEB_ENST00000604864.1_Nonsense_Mutation_p.Y948*|NEB_ENST00000427231.2_Nonsense_Mutation_p.Y948*|NEB_ENST00000603639.1_Nonsense_Mutation_p.Y948*|NEB_ENST00000409198.1_Nonsense_Mutation_p.Y948*|NEB_ENST00000397345.3_Nonsense_Mutation_p.Y948*			P20929	NEBU_HUMAN	nebulin	948					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		AGTCAGCTTTGTATTCAACCT	0.393																																																	0								ENSG00000183091						103.0	100.0	101.0					2																	152539275		1892	4119	6011	NEB	SO:0001587	stop_gained	0			-	HGNC	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.2844C>A	2.37:g.152539275G>T	ENSP00000172853:p.Tyr948*	Somatic	0	48	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Nonsense_Mutation	SNP	27	0.00	0	55	1.79	1	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.Y948*	ENST00000172853.10	37	c.2844		2	.	.	.	.	.	.	.	.	.	.	G	42	9.639704	0.99226	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	.	.	.	5.89	4.07	0.47477	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.0476	0.53489	0.1451:0.0:0.8549:0.0	.	.	.	.	X	948	.	ENSP00000172853:Y948X	Y	-	3	2	NEB	152247521	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	0.623000	0.24447	1.489000	0.48450	0.561000	0.74099	TAC	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif		0.393	NEB-201	KNOWN	basic	protein_coding	NEB	protein_coding		G	NM_004543	-		152539275	-1	no_errors	ENST00000397345	ensembl	human	known	74_37	nonsense	SNP	1.000	T
HNRNPDL	9987	genome.wustl.edu	37	4	83350511	83350511	+	Silent	SNP	G	G	A			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr4:83350511G>A	ENST00000295470.5	-	1	508	c.333C>T	c.(331-333)caC>caT	p.H111H	HNRNPDL_ENST00000514511.1_5'UTR|ENOPH1_ENST00000273920.3_5'Flank|HNRNPDL_ENST00000349655.4_5'UTR|ENOPH1_ENST00000509635.1_5'Flank|HNRNPDL_ENST00000502762.1_Silent_p.H111H|HNRNPDL_ENST00000602300.1_5'UTR	NM_001207000.1|NM_031372.3	NP_001193929.1|NP_112740.1	O14979	HNRDL_HUMAN	heterogeneous nuclear ribonucleoprotein D-like	111					regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|single-stranded DNA binding (GO:0003697)										CGGCAGGGGGGTGCTGGCGCG	0.612																																																	0								ENSG00000152795						59.0	71.0	67.0					4																	83350511		2203	4300	6503	HNRNPDL	SO:0001819	synonymous_variant	0			-	HGNC	D89092	CCDS3593.1, CCDS75153.1	4q21.22	2013-06-12		2013-06-12	ENSG00000152795	ENSG00000152795		"""RNA binding motif (RRM) containing"""	5037	protein-coding gene	gene with protein product		607137		HNRPDL		10072754, 9524220	Standard	NM_001207000		Approved	JKTBP, laAUF1	uc003hmr.3	O14979	OTTHUMG00000130299	ENST00000295470.5:c.333C>T	4.37:g.83350511G>A		Somatic	0	74	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	12	69.57	Q6SPF2|Q7KZ74|Q7KZ75|Q96IM0|Q96S43	Silent	SNP	25	0.00	0	7	63.16	12	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.H111	ENST00000295470.5	37	c.333	CCDS3593.1	4																																																																																			-	NULL		0.612	HNRNPDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPDL	protein_coding	OTTHUMT00000252644.1	G	NM_005463	-		83350511	-1	no_errors	ENST00000295470	ensembl	human	known	74_37	silent	SNP	0.080	A
EHD2	30846	genome.wustl.edu	37	19	48244692	48244693	+	3'UTR	INS	-	-	G	rs3833256|rs397747084	byFrequency	TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr19:48244692_48244693insG	ENST00000263277.3	+	0	1886_1887				EHD2_ENST00000538399.1_3'UTR|EHD2_ENST00000540884.1_3'UTR	NM_014601.3	NP_055416.2	Q9NZN4	EHD2_HUMAN	EH-domain containing 2						blood coagulation (GO:0007596)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein localization to plasma membrane (GO:0072659)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			endometrium(3)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	19		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)		CCGAGTGAGCCGGCCCCCCTCC	0.728													GGg|GG|GGG|deletion	3557	0.710264	0.8487	0.6916	5008	,	,		14502	0.5556		0.6809	False		,,,				2504	0.726																0								ENSG00000024422			3369,711		1461,447,132						2.0	1.0		dbSNP_107	7	5498,2404		2048,1402,501	no	utr-3	EHD2	NM_014601.3		3509,1849,633	A1A1,A1R,RR		30.4227,17.4265,25.9973				8867,3115				EHD2	SO:0001624	3_prime_UTR_variant	0				HGNC	AF181263	CCDS12704.1	19q13.3	2014-08-12			ENSG00000024422	ENSG00000024422		"""EF-hand domain containing"""	3243	protein-coding gene	gene with protein product		605890		PAST2		10673336	Standard	NM_014601		Approved		uc002phj.4	Q9NZN4	OTTHUMG00000183266	ENST00000263277.3:c.*4->G	19.37:g.48244694_48244694dupG		Somatic	0	12	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	12	25.00	B2RDH9|B4DNU6|Q96CB6	RNA	INS	17	26.09	6	23	47.73	21	-	NULL	ENST00000263277.3	37	NULL	CCDS12704.1	19																																																																																			-	-		0.728	EHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD2	protein_coding	OTTHUMT00000465851.1	-				48244693	+1	no_errors	ENST00000540884	ensembl	human	known	74_37	rna	INS	0.938:0.089	G
AK7	122481	genome.wustl.edu	37	14	96909100	96909100	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr14:96909100delG	ENST00000267584.4	+	7	768	c.724delG	c.(724-726)gttfs	p.V242fs		NM_152327.3	NP_689540.2	Q96M32	KAD7_HUMAN	adenylate kinase 7	242					axoneme assembly (GO:0035082)|brain development (GO:0007420)|epithelial cilium movement (GO:0003351)|inflammatory response to antigenic stimulus (GO:0002437)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)			breast(2)|cervix(2)|endometrium(3)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		TGCATTACCAGTTTTTGGCGA	0.433																																																	0								ENSG00000140057						291.0	258.0	269.0					14																	96909100		2203	4300	6503	AK7	SO:0001589	frameshift_variant	0				HGNC	AK057426	CCDS9945.1	14q32.31	2012-08-15			ENSG00000140057	ENSG00000140057		"""Adenylate kinases"""	20091	protein-coding gene	gene with protein product		615364					Standard	NM_152327		Approved	FLJ32864	uc001yfn.3	Q96M32	OTTHUMG00000171421	ENST00000267584.4:c.724delG	14.37:g.96909100delG	ENSP00000267584:p.Val242fs	Somatic	0	122	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	320	13.04	Q8IYP6	Frame_Shift_Del	DEL	30	0.00	0	159	11.67	21	pfam_Dpy-30_motif,pfam_Adenylate_kin,superfamily_P-loop_NTPase	p.V242fs	ENST00000267584.4	37	c.724	CCDS9945.1	14																																																																																			-	NULL		0.433	AK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AK7	protein_coding	OTTHUMT00000413340.1	G				96909100	+1	no_errors	ENST00000267584	ensembl	human	known	74_37	frame_shift_del	DEL	0.377	-
DNAH12	201625	genome.wustl.edu	37	3	57443570	57443570	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr3:57443570G>A	ENST00000351747.2	-	22	3325	c.3145C>T	c.(3145-3147)Cga>Tga	p.R1049*		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	1049	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						AGCTCCACTCGCTCGCCCTCA	0.473																																																	0								ENSG00000174844						106.0	97.0	100.0					3																	57443570		692	1591	2283	DNAH12	SO:0001587	stop_gained	0			-	HGNC	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.3145C>T	3.37:g.57443570G>A	ENSP00000295937:p.Arg1049*	Somatic	0	58	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	19	45.71	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Nonsense_Mutation	SNP	35	0.00	0	33	43.10	25	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R1049*	ENST00000351747.2	37	c.3145		3	.	.	.	.	.	.	.	.	.	.	G	40	8.141422	0.98675	.	.	ENSG00000174844	ENST00000351747;ENST00000495027	.	.	.	5.58	4.7	0.59300	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	15.8292	0.78739	0.0:0.0:0.863:0.137	.	.	.	.	X	1049;1072	.	ENSP00000295937:R1049X	R	-	1	2	DNAH12	57418610	1.000000	0.71417	1.000000	0.80357	0.130000	0.20726	4.754000	0.62191	1.320000	0.45209	-0.182000	0.12963	CGA	-	pfam_Dynein_heavy_dom-2		0.473	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	protein_coding		G	NM_178504	-		57443570	-1	no_errors	ENST00000351747	ensembl	human	known	74_37	nonsense	SNP	1.000	A
RP11-652G5.1	0	genome.wustl.edu	37	16	32618890	32618890	+	RNA	SNP	G	G	T			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr16:32618890G>T	ENST00000562976.1	+	0	425																											TCTGTGCTGTGGACACACCTT	0.552																																																	0								ENSG00000259966																																			RP11-652G5.1			0			-	Clone_based_vega_gene																													16.37:g.32618890G>T		Somatic	0	56	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	38	34.48		RNA	SNP	32	0.00	0	42	26.32	15	-	NULL	ENST00000562976.1	37	NULL		16																																																																																			-	-		0.552	RP11-652G5.1-002	KNOWN	basic	processed_transcript	ENSG00000259966	pseudogene	OTTHUMT00000432347.1	G		-		32618890	+1	no_errors	ENST00000562976	ensembl	human	known	74_37	rna	SNP	0.000	T
ARAP3	64411	genome.wustl.edu	37	5	141038168	141038168	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr5:141038168G>T	ENST00000239440.4	-	24	3454	c.3389C>A	c.(3388-3390)cCa>cAa	p.P1130Q	ARAP3_ENST00000508305.1_Missense_Mutation_p.P961Q|ARAP3_ENST00000512390.1_5'UTR|ARAP3_ENST00000513878.1_Missense_Mutation_p.P792Q	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	1130	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						ACAGTTGTCTGGGAGCTGCTG	0.502																																																	0								ENSG00000120318						53.0	51.0	52.0					5																	141038168		2203	4300	6503	ARAP3	SO:0001583	missense	0			-	HGNC	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.3389C>A	5.37:g.141038168G>T	ENSP00000239440:p.Pro1130Gln	Somatic	0	45	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B4DIT1|D3DQE3	Missense_Mutation	SNP	30	0.00	0	42	0.00	0	pfam_RhoGAP_dom,pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ras-assoc,pfam_SAM_2,pfam_SAM_type1,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.P1130Q	ENST00000239440.4	37	c.3389	CCDS4266.1	5	.	.	.	.	.	.	.	.	.	.	G	25.4	4.631562	0.87660	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878	T;T;T	0.17370	2.28;2.28;2.28	5.99	5.99	0.97316	Ras-association (2);	0.163605	0.53938	D	0.000044	T	0.41351	0.1155	L	0.58810	1.83	0.80722	D	1	D;D;D	0.76494	0.979;0.999;0.997	P;D;D	0.70016	0.866;0.967;0.93	T	0.03641	-1.1017	10	0.62326	D	0.03	.	20.0438	0.97602	0.0:0.0:1.0:0.0	.	792;961;1130	B4DIT1;G5E9Y3;Q8WWN8	.;.;ARAP3_HUMAN	Q	961;1130;792	ENSP00000421826:P961Q;ENSP00000239440:P1130Q;ENSP00000421468:P792Q	ENSP00000239440:P1130Q	P	-	2	0	ARAP3	141018352	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.455000	0.80726	2.843000	0.97960	0.655000	0.94253	CCA	-	pfam_Ras-assoc,pfscan_Ras-assoc		0.502	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP3	protein_coding	OTTHUMT00000251805.1	G	NM_022481	-		141038168	-1	no_errors	ENST00000239440	ensembl	human	known	74_37	missense	SNP	1.000	T
AK7	122481	genome.wustl.edu	37	14	96875257	96875257	+	Silent	SNP	G	G	A			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr14:96875257G>A	ENST00000267584.4	+	4	521	c.477G>A	c.(475-477)gcG>gcA	p.A159A	AK7_ENST00000554313.1_3'UTR	NM_152327.3	NP_689540.2	Q96M32	KAD7_HUMAN	adenylate kinase 7	159					axoneme assembly (GO:0035082)|brain development (GO:0007420)|epithelial cilium movement (GO:0003351)|inflammatory response to antigenic stimulus (GO:0002437)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)			breast(2)|cervix(2)|endometrium(3)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		TGACTTGGGCGCGCTCCAAAG	0.473																																																	0								ENSG00000140057						84.0	81.0	82.0					14																	96875257		2203	4300	6503	AK7	SO:0001819	synonymous_variant	0			-	HGNC	AK057426	CCDS9945.1	14q32.31	2012-08-15			ENSG00000140057	ENSG00000140057		"""Adenylate kinases"""	20091	protein-coding gene	gene with protein product		615364					Standard	NM_152327		Approved	FLJ32864	uc001yfn.3	Q96M32	OTTHUMG00000171421	ENST00000267584.4:c.477G>A	14.37:g.96875257G>A		Somatic	0	71	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	196	10.50	Q8IYP6	Silent	SNP	26	0.00	0	157	12.78	23	pfam_Dpy-30_motif,pfam_Adenylate_kin,superfamily_P-loop_NTPase	p.A159	ENST00000267584.4	37	c.477	CCDS9945.1	14																																																																																			-	NULL		0.473	AK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AK7	protein_coding	OTTHUMT00000413340.1	G		-		96875257	+1	no_errors	ENST00000267584	ensembl	human	known	74_37	silent	SNP	0.372	A
REV3L	5980	genome.wustl.edu	37	6	111680107	111680107	+	Silent	SNP	A	A	C			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr6:111680107A>C	ENST00000358835.3	-	18	7444	c.6990T>G	c.(6988-6990)tcT>tcG	p.S2330S	REV3L-IT1_ENST00000411895.1_RNA|REV3L_ENST00000435970.1_Silent_p.S2252S|REV3L_ENST00000368805.1_Silent_p.S2330S|REV3L_ENST00000368802.3_Silent_p.S2330S			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2330					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		GTGGAGTGTCAGATGAGATGC	0.408								DNA polymerases (catalytic subunits)																																									0								ENSG00000009413						158.0	146.0	150.0					6																	111680107		2203	4300	6503	REV3L	SO:0001819	synonymous_variant	0			-	HGNC	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.6990T>G	6.37:g.111680107A>C		Somatic	0	57	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	25	30.56	O43214|Q5TC33	Silent	SNP	21	0.00	0	28	34.88	15	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.S2330	ENST00000358835.3	37	c.6990	CCDS5091.2	6																																																																																			-	pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B		0.408	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	protein_coding	OTTHUMT00000043695.1	A	NM_002912	-		111680107	-1	no_errors	ENST00000358835	ensembl	human	known	74_37	silent	SNP	0.996	C
LRP1	4035	genome.wustl.edu	37	12	57572170	57572170	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr12:57572170G>T	ENST00000243077.3	+	27	4856	c.4390G>T	c.(4390-4392)Gac>Tac	p.D1464Y		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1464					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	AGCCCGTTACGACGGCTCTGG	0.602																																																	0								ENSG00000123384						90.0	70.0	77.0					12																	57572170		2203	4300	6503	LRP1	SO:0001583	missense	0			-	HGNC	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.4390G>T	12.37:g.57572170G>T	ENSP00000243077:p.Asp1464Tyr	Somatic	0	53	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	112	230	32.75	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	27	0.00	0	221	32.63	108	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.D1464Y	ENST00000243077.3	37	c.4390	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	G	27.1	4.798233	0.90538	.	.	ENSG00000123384	ENST00000243077	D	0.92911	-3.13	4.8	4.8	0.61643	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000001	D	0.96710	0.8926	M	0.90369	3.11	0.58432	D	0.999994	D	0.89917	1.0	D	0.87578	0.998	D	0.97404	0.9998	10	0.72032	D	0.01	.	16.7965	0.85603	0.0:0.0:1.0:0.0	.	1464	Q07954	LRP1_HUMAN	Y	1464	ENSP00000243077:D1464Y	ENSP00000243077:D1464Y	D	+	1	0	LRP1	55858437	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.657000	0.98554	2.503000	0.84419	0.561000	0.74099	GAC	-	smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.602	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	protein_coding	OTTHUMT00000412772.2	G	NM_002332	-		57572170	+1	no_errors	ENST00000243077	ensembl	human	known	74_37	missense	SNP	1.000	T
ARID4A	5926	genome.wustl.edu	37	14	58831291	58831291	+	Silent	SNP	T	T	C			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr14:58831291T>C	ENST00000355431.3	+	20	2857	c.2484T>C	c.(2482-2484)ctT>ctC	p.L828L	ARID4A_ENST00000395168.3_Silent_p.L828L|ARID4A_ENST00000431317.2_Silent_p.L828L|ARID4A_ENST00000348476.3_Silent_p.L828L	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	828					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						CTCATAGTCTTGAATTGTCTT	0.333																																																	0								ENSG00000032219						37.0	41.0	40.0					14																	58831291		2190	4295	6485	ARID4A	SO:0001819	synonymous_variant	0			-	HGNC	S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.2484T>C	14.37:g.58831291T>C		Somatic	0	21	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08	Q15991|Q15992|Q15993	Silent	SNP	33	0.00	0	59	0.00	0	pfam_RBB1NT,pfam_ARID/BRIGHT_DNA-bd,pfam_Tudor-knot,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Chromodomain-like,smart_Tudor,smart_ARID/BRIGHT_DNA-bd,smart_Chromo_domain/shadow,pfscan_ARID/BRIGHT_DNA-bd	p.L828	ENST00000355431.3	37	c.2484	CCDS9732.1	14																																																																																			-	NULL		0.333	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID4A	protein_coding	OTTHUMT00000276927.2	T	NM_023001	-		58831291	+1	no_errors	ENST00000355431	ensembl	human	known	74_37	silent	SNP	0.130	C
ARL13B	200894	genome.wustl.edu	37	3	93769680	93769680	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr3:93769680delC	ENST00000394222.3	+	9	1429	c.1154delC	c.(1153-1155)accfs	p.T385fs	ARL13B_ENST00000539730.1_Frame_Shift_Del_p.T106fs|ARL13B_ENST00000471138.1_Frame_Shift_Del_p.T385fs|ARL13B_ENST00000535334.1_Frame_Shift_Del_p.T282fs|DHFRL1_ENST00000481631.1_Intron|ARL13B_ENST00000303097.7_Frame_Shift_Del_p.T278fs	NM_001174150.1	NP_001167621.1	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 13B	385	Pro-rich.				cilium assembly (GO:0042384)|dorsal/ventral pattern formation (GO:0009953)|formation of radial glial scaffolds (GO:0021943)|heart looping (GO:0001947)|interneuron migration from the subpallium to the cortex (GO:0021830)|left/right axis specification (GO:0070986)|neural tube patterning (GO:0021532)|nonmotile primary cilium assembly (GO:0035058)|small GTPase mediated signal transduction (GO:0007264)|smoothened signaling pathway (GO:0007224)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|intracellular (GO:0005622)|primary cilium (GO:0072372)	GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(2)	10						GGCTGGGGAACCCCTAAAGTC	0.383																																																	0								ENSG00000169379						77.0	78.0	78.0					3																	93769680		2203	4300	6503	ARL13B	SO:0001589	frameshift_variant	0				HGNC	AL713789	CCDS2924.1, CCDS2925.1, CCDS54615.1	3q11	2014-05-09	2005-11-18	2005-11-18	ENSG00000169379	ENSG00000169379		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25419	protein-coding gene	gene with protein product		608922	"""ADP-ribosylation factor-like 2-like 1"""	ARL2L1		15314642, 18674751	Standard	NR_033427		Approved	DKFZp761H079, JBTS8	uc003drf.3	Q3SXY8	OTTHUMG00000159012	ENST00000394222.3:c.1154delC	3.37:g.93769680delC	ENSP00000377769:p.Thr385fs	Somatic	0	33	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	15	48.28	D3DN29|G3V1S8|Q504W8|Q8TCL5	Frame_Shift_Del	DEL	40	0.00	0	30	50.00	30	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom	p.P386fs	ENST00000394222.3	37	c.1154	CCDS2925.1	3																																																																																			-	NULL		0.383	ARL13B-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	ARL13B	protein_coding	OTTHUMT00000352904.1	C	NM_182896			93769680	+1	no_errors	ENST00000394222	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
RGR	5995	genome.wustl.edu	37	10	86007502	86007502	+	Splice_Site	SNP	C	C	T	rs201335015		TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr10:86007502C>T	ENST00000359452.4	+	2	273	c.235C>T	c.(235-237)Cgt>Tgt	p.R79C	RGR_ENST00000372092.3_Splice_Site_p.P62L|RGR_ENST00000358110.5_Splice_Site_p.R79W	NM_001012720.1|NM_002921.3	NP_001012738.1|NP_002912.2	P47804	RGR_HUMAN	retinal G protein coupled receptor	79					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	17						CAGCCTTCTCCGGTACCAGCC	0.642																																					NSCLC(15;204 545 5889 6385 32445)												0								ENSG00000148604						60.0	56.0	57.0					10																	86007502		2203	4300	6503	RGR	SO:0001630	splice_region_variant	0			-	HGNC	BC011349	CCDS7374.1, CCDS41543.1	10q23	2013-02-14			ENSG00000148604	ENSG00000148604		"""GPCR / Class A : Opsin receptors"""	9990	protein-coding gene	gene with protein product	"""RGR-opsin"""	600342				8641686	Standard	NM_002921		Approved	RP44	uc001kdd.1	P47804	OTTHUMG00000018636	ENST00000359452.4:c.236+1C>T	10.37:g.86007502C>T		Somatic	0	69	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	30	36.17	A6NKK7|Q96FC5	Missense_Mutation	SNP	29	0.00	0	25	30.56	11	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_RPE_GPCR,prints_GPCR_Rhodpsn	p.R79C	ENST00000359452.4	37	c.235	CCDS7374.1	10	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	17.85|17.85|17.85	3.489577|3.489577|3.489577	0.64074|0.64074|0.64074	.|.|.	.|.|.	ENSG00000148604|ENSG00000148604|ENSG00000148604	ENST00000372092|ENST00000359452|ENST00000358110	.|T|T	.|0.37752|0.37915	.|1.18|1.17	4.33|4.33|4.33	2.4|2.4|2.4	0.29515|0.29515|0.29515	.|.|GPCR, rhodopsin-like superfamily (1);	.|0.000000|0.000000	.|0.85682|0.85682	.|D|D	.|0.000000|0.000000	T|T|T	0.57388|0.57388|0.57388	0.2050|0.2050|0.2050	M|M|M	0.82716|0.82716|0.82716	2.605|2.605|2.605	0.80722|0.80722|0.80722	D|D|D	1|1|1	P|D|D;D	0.46327|0.69078|0.89917	0.876|0.997|1.0;1.0	B|P|D;D	0.36666|0.51016|0.79784	0.23|0.656|0.988;0.993	T|T|T	0.57854|0.57854|0.57854	-0.7739|-0.7739|-0.7739	8|10|10	0.87932|0.56958|0.87932	D|D|D	0|0.05|0	.|.|.	7.7907|7.7907|7.7907	0.29119|0.29119|0.29119	0.2709:0.4496:0.2795:0.0|0.2709:0.4496:0.2795:0.0|0.2709:0.4496:0.2795:0.0	.|.|.	62|79|79;79	Q96HT6|P47804-2|P47804-3;P47804	.|.|.;RGR_HUMAN	L|C|W	62|79|79	.|ENSP00000352427:R79C|ENSP00000350823:R79W	ENSP00000361164:P62L|ENSP00000352427:R79C|ENSP00000350823:R79W	P|R|R	+|+|+	2|1|1	0|0|2	RGR|RGR|RGR	85997482|85997482|85997482	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.902000|0.902000|0.902000	0.53008|0.53008|0.53008	3.766000|3.766000|3.766000	0.55280|0.55280|0.55280	0.505000|0.505000|0.505000	0.28104|0.28104|0.28104	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	CCG|CGT|CGG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.642	RGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGR	protein_coding	OTTHUMT00000049116.1	C	NM_002921	rs201335015	Missense_Mutation	86007502	+1	no_errors	ENST00000359452	ensembl	human	known	74_37	missense	SNP	1.000	T
TRAK2	66008	genome.wustl.edu	37	2	202259569	202259569	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr2:202259569T>G	ENST00000332624.3	-	9	1355	c.927A>C	c.(925-927)aaA>aaC	p.K309N		NM_015049.2	NP_055864.2	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2	309	HAP1 N-terminal.				protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GABA receptor binding (GO:0050811)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	23						GCAGGTGAAGTTTTAGTTCTT	0.358																																																	0								ENSG00000115993						117.0	102.0	107.0					2																	202259569		2203	4300	6503	TRAK2	SO:0001583	missense	0			-	HGNC	AB038951	CCDS2347.1	2q33.1	2012-03-05	2005-12-13	2005-12-13	ENSG00000115993	ENSG00000115993			13206	protein-coding gene	gene with protein product	"""gamma-aminobutyric acid(A) receptor-interacting factor"", ""milton homolog 2 (Drosophila)"", ""O-linked N-acetylglucosamine transferase interacting protein 98"""	607334	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3"""	ALS2CR3		11161814, 16380713, 20230862	Standard	NM_015049		Approved	CALS-C, KIAA0549, GRIF-1, OIP98, MILT2	uc002uyb.4	O60296	OTTHUMG00000132822	ENST00000332624.3:c.927A>C	2.37:g.202259569T>G	ENSP00000328875:p.Lys309Asn	Somatic	0	76	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	42	34.38	E7EV21|Q8WVH7|Q96NS2|Q9C0K5|Q9C0K6	Missense_Mutation	SNP	41	0.00	0	41	39.71	27	pfam_HAP1_N,pfam_Traffickng_kinesin-bd_prot_dom	p.K309N	ENST00000332624.3	37	c.927	CCDS2347.1	2	.	.	.	.	.	.	.	.	.	.	T	14.27	2.486174	0.44147	.	.	ENSG00000115993	ENST00000332624;ENST00000542292	T	0.17528	2.27	5.51	2.8	0.32819	.	0.126462	0.52532	D	0.000065	T	0.08891	0.0220	N	0.14661	0.345	0.80722	D	1	B	0.31459	0.324	B	0.30179	0.112	T	0.27157	-1.0082	10	0.16896	T	0.51	.	10.6744	0.45776	0.0:0.1476:0.0:0.8524	.	309	O60296	TRAK2_HUMAN	N	309;215	ENSP00000328875:K309N	ENSP00000328875:K309N	K	-	3	2	TRAK2	201967814	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.041000	0.49807	0.922000	0.37019	0.455000	0.32223	AAA	-	pfam_HAP1_N		0.358	TRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAK2	protein_coding	OTTHUMT00000256284.3	T	NM_015049	-		202259569	-1	no_errors	ENST00000332624	ensembl	human	known	74_37	missense	SNP	1.000	G
TTC23	64927	genome.wustl.edu	37	15	99673642	99673642	+	IGR	SNP	G	G	C			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr15:99673642G>C	ENST00000394132.2	-	0	3849				SYNM_ENST00000336292.6_3'UTR|SYNM_ENST00000561323.1_3'UTR|RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000560674.1_3'UTR|SYNM_ENST00000328642.7_3'UTR			Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23											endometrium(2)|large_intestine(3)|lung(9)|urinary_tract(2)	16	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			ATATATTTAAGAGTAAATTTT	0.279																																																	0								ENSG00000182253																																			SYNM	SO:0001628	intergenic_variant	0			-	HGNC		CCDS10379.2	15q26.3	2013-01-11			ENSG00000103852	ENSG00000103852		"""Tetratricopeptide (TTC) repeat domain containing"""	25730	protein-coding gene	gene with protein product						12477932	Standard	NM_001288615		Approved	FLJ12572, HCC-8	uc002bux.3	Q5W5X9	OTTHUMG00000147344		15.37:g.99673642G>C		Somatic	0	20	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	10	47.37	A8K6M5|Q53HK0|Q96BC9|Q9H8W9|Q9H9S7	RNA	SNP	35	0.00	0	35	61.11	55	-	NULL	ENST00000394132.2	37	NULL	CCDS10379.2	15																																																																																			-	-		0.279	TTC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNM	protein_coding	OTTHUMT00000303953.2	G	NM_022905	-		99673642	+1	no_errors	ENST00000558420	ensembl	human	known	74_37	rna	SNP	0.008	C
PLEKHG4B	153478	genome.wustl.edu	37	5	173084	173084	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr5:173084C>G	ENST00000283426.6	+	15	3105	c.3055C>G	c.(3055-3057)Ctg>Gtg	p.L1019V		NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	1019	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		GAAGAAGTATCTGAGGCATGT	0.512																																																	0								ENSG00000153404						149.0	138.0	142.0					5																	173084		2203	4300	6503	PLEKHG4B	SO:0001583	missense	0			-	HGNC	BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.3055C>G	5.37:g.173084C>G	ENSP00000283426:p.Leu1019Val	Somatic	1	117	0.85		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	369	86	81.10		Missense_Mutation	SNP	25	0.00	0	45	79.82	178	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.L1019V	ENST00000283426.6	37	c.3055	CCDS34124.1	5	.	.	.	.	.	.	.	.	.	.	C	3.497	-0.102690	0.06967	.	.	ENSG00000153404	ENST00000283426	T	0.12361	2.69	3.1	2.21	0.28008	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	.	.	.	.	T	0.12689	0.0308	L	0.49640	1.575	0.29752	N	0.836216	B	0.24483	0.104	B	0.27608	0.081	T	0.29971	-0.9994	9	0.16420	T	0.52	.	9.072	0.36497	0.2213:0.7787:0.0:0.0	.	1019	Q96PX9	PKH4B_HUMAN	V	1019	ENSP00000283426:L1019V	ENSP00000283426:L1019V	L	+	1	2	PLEKHG4B	226084	0.992000	0.36948	0.059000	0.19551	0.079000	0.17450	1.191000	0.32138	0.281000	0.22233	-0.470000	0.05040	CTG	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.512	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG4B	protein_coding	OTTHUMT00000365359.1	C	NM_052909	-		173084	+1	no_errors	ENST00000283426	ensembl	human	known	74_37	missense	SNP	1.000	G
PROCA1	147011	genome.wustl.edu	37	17	27037996	27037996	+	5'UTR	SNP	T	T	C	rs139573327|rs71135843|rs11655758	byFrequency	TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr17:27037996T>C	ENST00000579650.1	-	0	321				PROCA1_ENST00000581289.1_Intron|PROCA1_ENST00000439862.3_5'UTR|PROCA1_ENST00000301039.2_Intron			Q8NCQ7	PRCA1_HUMAN	protein interacting with cyclin A1						lipid catabolic process (GO:0016042)		calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(4)|ovary(1)|urinary_tract(1)	16	Lung NSC(42;0.00431)					AGGAGTAGGGTGggaagggag	0.647																																																	0								ENSG00000167525																																			PROCA1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BC029574	CCDS11239.1	17q11.2	2009-04-20	2009-04-20		ENSG00000167525	ENSG00000167525			28600	protein-coding gene	gene with protein product	"""proline-rich cyclin A1-interacting protein"""					15159402	Standard	NM_152465		Approved	MGC39650	uc002hca.1	Q8NCQ7	OTTHUMG00000132682	ENST00000579650.1:c.-686A>G	17.37:g.27037996T>C		Somatic	0	28	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	21	18.52	B4DX95|G5E9R8	RNA	SNP	17	22.73	5	22	4.35	1	-	NULL	ENST00000579650.1	37	NULL		17																																																																																			-	-		0.647	PROCA1-003	KNOWN	basic	processed_transcript	PROCA1	protein_coding	OTTHUMT00000255971.3	T	NM_152465	rs11655758		27037996	-1	no_errors	ENST00000422880	ensembl	human	known	74_37	rna	SNP	0.095	C
MBD6	114785	genome.wustl.edu	37	12	57918117	57918117	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr12:57918117G>A	ENST00000355673.3	+	3	387	c.31G>A	c.(31-33)Gac>Aac	p.D11N	MBD6_ENST00000549231.1_3'UTR|MBD6_ENST00000431731.2_Missense_Mutation_p.D11N	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	11	MBD. {ECO:0000255|PROSITE- ProRule:PRU00338}.					chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						CAGTGGAGCAGACAGAGCTGG	0.562																																																	0								ENSG00000166987						71.0	62.0	65.0					12																	57918117		2203	4300	6503	MBD6	SO:0001583	missense	0			-	HGNC	AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.31G>A	12.37:g.57918117G>A	ENSP00000347896:p.Asp11Asn	Somatic	0	56	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	116	524	18.12	Q8N3M0|Q8NA81|Q96Q00	Missense_Mutation	SNP	25	0.00	0	436	16.25	85	superfamily_DNA-bd_dom,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd	p.D11N	ENST00000355673.3	37	c.31	CCDS8944.1	12	.	.	.	.	.	.	.	.	.	.	G	17.70	3.454907	0.63290	.	.	ENSG00000166987	ENST00000548887;ENST00000551351;ENST00000546805;ENST00000355673;ENST00000546632;ENST00000431731;ENST00000552255;ENST00000552659	.	.	.	3.89	3.89	0.44902	Methyl-CpG DNA binding (1);	0.000000	0.52532	D	0.000061	T	0.51007	0.1649	L	0.38175	1.15	0.39310	D	0.965057	P	0.41393	0.748	B	0.41723	0.365	T	0.62110	-0.6923	9	0.72032	D	0.01	-4.1778	15.1708	0.72872	0.0:0.0:1.0:0.0	.	11	Q96DN6	MBD6_HUMAN	N	11;11;11;11;11;11;11;6	.	ENSP00000347896:D11N	D	+	1	0	MBD6	56204384	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.755000	0.62198	2.162000	0.67917	0.561000	0.74099	GAC	-	superfamily_DNA-bd_dom,pfscan_Methyl_CpG_DNA-bd		0.562	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD6	protein_coding	OTTHUMT00000407250.1	G		-		57918117	+1	no_errors	ENST00000355673	ensembl	human	known	74_37	missense	SNP	1.000	A
MET	4233	genome.wustl.edu	37	7	116371840	116371840	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr7:116371840C>T	ENST00000318493.6	+	3	1506	c.1319C>T	c.(1318-1320)aCa>aTa	p.T440I	MET_ENST00000436117.2_Missense_Mutation_p.T440I|MET_ENST00000397752.3_Missense_Mutation_p.T440I|MET_ENST00000495962.1_3'UTR			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			GTCCTCTTAACATCTATATCC	0.468			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																															Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	0								ENSG00000105976						120.0	113.0	115.0					7																	116371840		1926	4121	6047	MET	SO:0001583	missense	0	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	-	HGNC	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.1319C>T	7.37:g.116371840C>T	ENSP00000317272:p.Thr440Ile	Somatic	0	69	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	44	27.87	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	27	0.00	0	27	35.71	15	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Semap_dom,pfscan_Prot_kinase_dom	p.T440I	ENST00000318493.6	37	c.1319	CCDS47689.1	7	.	.	.	.	.	.	.	.	.	.	C	19.90	3.913253	0.72983	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	T;T;T	0.17213	2.29;2.29;2.29	5.58	5.58	0.84498	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.53738	0.1815	M	0.91406	3.205	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;0.999	T	0.63959	-0.6519	10	0.87932	D	0	-15.7875	19.5825	0.95473	0.0:1.0:0.0:0.0	.	440;440;440;440;440;440;440;440;440;440;440	B5A929;E7EQ94;B5A930;B5A934;B5A936;B5A937;B5A939;B5A941;P08581-2;B5A942;P08581	.;.;.;.;.;.;.;.;.;.;MET_HUMAN	I	440	ENSP00000380860:T440I;ENSP00000317272:T440I;ENSP00000410980:T440I	ENSP00000317272:T440I	T	+	2	0	MET	116159076	1.000000	0.71417	0.997000	0.53966	0.731000	0.41821	5.989000	0.70587	2.624000	0.88883	0.655000	0.94253	ACA	-	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.468	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MET	protein_coding	OTTHUMT00000059620.3	C		-		116371840	+1	no_errors	ENST00000318493	ensembl	human	known	74_37	missense	SNP	1.000	T
TRIM22	10346	genome.wustl.edu	37	11	5730822	5730822	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr11:5730822T>C	ENST00000379965.3	+	8	1718	c.1441T>C	c.(1441-1443)Tat>Cat	p.Y481H	TRIM5_ENST00000380027.1_Intron	NM_001199573.1|NM_006074.4	NP_001186502.1|NP_006065.2	Q8IYM9	TRI22_HUMAN	tripartite motif containing 22	481	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				defense response to virus (GO:0051607)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			kidney(3)|large_intestine(8)|lung(9)|prostate(1)|stomach(2)	23		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)		TGCTTATCCGTATTTCAATCC	0.483																																					GBM(104;491 2336 5222)												0								ENSG00000132274						142.0	147.0	146.0					11																	5730822		2194	4294	6488	TRIM22	SO:0001583	missense	0			-	HGNC	X82200	CCDS41612.1	11p15	2013-01-09	2011-01-25		ENSG00000132274	ENSG00000132274		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16379	protein-coding gene	gene with protein product		606559	"""tripartite motif-containing 22"""			11331580, 11096452	Standard	NM_006074		Approved	STAF50, GPSTAF50, RNF94	uc001mbr.3	Q8IYM9	OTTHUMG00000066904	ENST00000379965.3:c.1441T>C	11.37:g.5730822T>C	ENSP00000369299:p.Tyr481His	Somatic	0	39	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	28	36.36	Q05CQ0|Q15521	Missense_Mutation	SNP	33	0.00	0	33	36.54	19	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.Y481H	ENST00000379965.3	37	c.1441	CCDS41612.1	11	.	.	.	.	.	.	.	.	.	.	T	22.0	4.231553	0.79688	.	.	ENSG00000132274	ENST00000379965;ENST00000545338;ENST00000455293	T	0.69685	-0.42	3.88	3.88	0.44766	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	D	0.84147	0.5408	H	0.94808	3.585	0.24263	N	0.995271	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;1.0;1.0	T	0.73965	-0.3816	9	0.87932	D	0	.	6.3776	0.21515	0.0:0.1173:0.0:0.8827	.	403;477;481	F8WAP8;Q8IYM9-2;Q8IYM9	.;.;TRI22_HUMAN	H	481;292;403	ENSP00000369299:Y481H	ENSP00000369299:Y481H	Y	+	1	0	TRIM22	5687398	0.999000	0.42202	0.810000	0.32431	0.669000	0.39330	5.351000	0.66022	1.721000	0.51461	0.383000	0.25322	TAT	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin		0.483	TRIM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM22	protein_coding	OTTHUMT00000143387.2	T	NM_006074	-		5730822	+1	no_errors	ENST00000379965	ensembl	human	known	74_37	missense	SNP	0.976	C
CCT2	10576	genome.wustl.edu	37	12	69986852	69986852	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr12:69986852C>G	ENST00000299300.6	+	9	1035	c.847C>G	c.(847-849)Ctt>Gtt	p.L283V	CCT2_ENST00000543146.2_Missense_Mutation_p.L236V|CCT2_ENST00000544368.2_Missense_Mutation_p.L283V	NM_006431.2	NP_006422.1	P78371	TCPB_HUMAN	chaperonin containing TCP1, subunit 2 (beta)	283					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(1)	24	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			TGAACGTATTCTTAAGCATGG	0.323																																																	0								ENSG00000166226						95.0	97.0	96.0					12																	69986852		2203	4300	6503	CCT2	SO:0001583	missense	0			-	HGNC	AF026293	CCDS8991.1, CCDS55843.1	12q14	2011-09-02						"""Heat Shock Proteins / Chaperonins"""	1615	protein-coding gene	gene with protein product		605139				9819444	Standard	NM_001198842		Approved	Cctb	uc001svb.1	P78371	OTTHUMG00000169383	ENST00000299300.6:c.847C>G	12.37:g.69986852C>G	ENSP00000299300:p.Leu283Val	Somatic	0	63	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	219	29	88.31	A8K402|B5BTY7|B7Z243|B7Z7K4|B7ZAT2|Q14D36|Q6IAT3	Missense_Mutation	SNP	18	0.00	0	33	88.96	266	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_beta	p.L283V	ENST00000299300.6	37	c.847	CCDS8991.1	12	.	.	.	.	.	.	.	.	.	.	C	4.770	0.143100	0.09083	.	.	ENSG00000166226	ENST00000299300;ENST00000544368;ENST00000543146	T;T;T	0.76448	-1.02;-1.02;-1.02	5.71	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.65780	0.2724	N	0.21617	0.685	0.80722	D	1	B;B	0.13145	0.007;0.004	B;B	0.21917	0.006;0.037	T	0.59316	-0.7477	9	.	.	.	-12.5866	15.6479	0.77068	0.0:0.9238:0.0:0.0762	.	283;283	F5GWF6;P78371	.;TCPB_HUMAN	V	283;283;236	ENSP00000299300:L283V;ENSP00000441847:L283V;ENSP00000445471:L236V	.	L	+	1	0	CCT2	68273119	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.344000	0.59354	2.704000	0.92352	0.644000	0.83932	CTT	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,tigrfam_Chap_CCT_beta		0.323	CCT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT2	protein_coding	OTTHUMT00000403818.1	C	NM_006431	-		69986852	+1	no_errors	ENST00000299300	ensembl	human	known	74_37	missense	SNP	1.000	G
CHN1	1123	genome.wustl.edu	37	2	175666532	175666532	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr2:175666532C>A	ENST00000409900.3	-	12	1424	c.1111G>T	c.(1111-1113)Gat>Tat	p.D371Y	CHN1_ENST00000409156.3_Missense_Mutation_p.D345Y|CHN1_ENST00000295497.7_Missense_Mutation_p.D246Y|CHN1_ENST00000488080.1_5'UTR|CHN1_ENST00000409597.1_Missense_Mutation_p.D187Y	NM_001822.5	NP_001813.1	P15882	CHIN_HUMAN	chimerin 1	371	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				ephrin receptor signaling pathway (GO:0048013)|motor neuron axon guidance (GO:0008045)|positive regulation of signal transduction (GO:0009967)|regulation of axonogenesis (GO:0050770)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.226)			TCATCCGGATCCATAATTTCT	0.408			T	TAF15	extraskeletal myxoid chondrosarcoma																																			Dom	yes		2	2q31-q32.1	1123	chimerin (chimaerin) 1		M	0								ENSG00000128656						150.0	148.0	149.0					2																	175666532		1895	4128	6023	CHN1	SO:0001583	missense	0			-	HGNC		CCDS46454.1, CCDS46455.1, CCDS56147.1	2q31-q32.1	2013-02-14	2012-10-17		ENSG00000128656	ENSG00000128656		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1943	protein-coding gene	gene with protein product	"""Chimerin 1 (GTPase-activating protein, rho, 2)"", ""chimaerin 1"""	118423	"""Duane retraction syndrome 2"", ""chimerin (chimaerin) 1"""	CHN, DURS2		2299665, 15013773, 18653847	Standard	NM_001822		Approved	RhoGAP2, ARHGAP2, n-chimerin	uc002uji.3	P15882	OTTHUMG00000154225	ENST00000409900.3:c.1111G>T	2.37:g.175666532C>A	ENSP00000386741:p.Asp371Tyr	Somatic	0	51	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	25	39.02	A8K1M6|B3KNU6|B4DV19|Q53SD6|Q53SH5|Q96FB0	Missense_Mutation	SNP	34	0.00	0	36	30.77	16	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SH2,superfamily_Rho_GTPase_activation_prot,smart_SH2,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pirsf_N-chimaerin,pfscan_SH2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_DAG/PE-bd	p.D371Y	ENST00000409900.3	37	c.1111	CCDS46455.1	2	.	.	.	.	.	.	.	.	.	.	C	22.7	4.317894	0.81469	.	.	ENSG00000128656	ENST00000409900;ENST00000295497;ENST00000409597;ENST00000409156;ENST00000409089;ENST00000444394	T;T;T;T;T;T	0.14766	2.48;2.48;2.48;2.48;2.48;2.48	5.42	4.55	0.56014	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.48169	0.1485	H	0.97265	3.97	0.80722	D	1	D;D;D	0.61697	0.99;0.984;0.961	P;P;P	0.59595	0.86;0.84;0.514	T	0.67722	-0.5597	10	0.87932	D	0	.	13.5203	0.61563	0.0:0.9247:0.0:0.0753	.	345;371;246	B4DV19;P15882;P15882-2	.;CHIN_HUMAN;.	Y	371;246;187;345;163;146	ENSP00000386741:D371Y;ENSP00000295497:D246Y;ENSP00000386469:D187Y;ENSP00000386470:D345Y;ENSP00000386322:D163Y;ENSP00000411911:D146Y	ENSP00000295497:D246Y	D	-	1	0	CHN1	175374778	1.000000	0.71417	0.997000	0.53966	0.976000	0.68499	7.818000	0.86416	1.419000	0.47118	0.591000	0.81541	GAT	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pirsf_N-chimaerin,pfscan_RhoGAP_dom		0.408	CHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHN1	protein_coding	OTTHUMT00000334453.1	C	NM_001822	-		175666532	-1	no_errors	ENST00000409900	ensembl	human	known	74_37	missense	SNP	1.000	A
RASGRF1	5923	genome.wustl.edu	37	15	79292172	79292172	+	Missense_Mutation	SNP	C	C	T	rs199661393		TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr15:79292172C>T	ENST00000419573.3	-	18	2981	c.2707G>A	c.(2707-2709)Gcc>Acc	p.A903T	RASGRF1_ENST00000558480.2_Missense_Mutation_p.A887T|RASGRF1_ENST00000394745.3_Missense_Mutation_p.A119T|RASGRF1_ENST00000560334.1_5'UTR	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	903					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A903T(1)		breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						AAGGCAGAGGCGGCCGACAAG	0.562																																																	1	Substitution - Missense(1)	prostate(1)						ENSG00000058335	C	THR/ALA,THR/ALA,THR/ALA	0,4392		0,0,2196	140.0	114.0	123.0		2659,2707,355	2.4	0.3	15		123	2,8584	2.2+/-6.3	0,2,4291	yes	missense,missense,missense	RASGRF1	NM_001145648.1,NM_002891.4,NM_153815.2	58,58,58	0,2,6487	TT,TC,CC		0.0233,0.0,0.0154	benign,benign,benign	887/1258,903/1274,119/490	79292172	2,12976	2196	4293	6489	RASGRF1	SO:0001583	missense	0			-	HGNC	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.2707G>A	15.37:g.79292172C>T	ENSP00000405963:p.Ala903Thr	Somatic	0	78	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	90	29.13	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	25	0.00	0	47	30.88	21	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.A903T	ENST00000419573.3	37	c.2707	CCDS10309.1	15	.	.	.	.	.	.	.	.	.	.	C	14.44	2.535203	0.45176	0.0	2.33E-4	ENSG00000058335	ENST00000419573;ENST00000394741;ENST00000394745	T;T	0.64260	-0.09;-0.09	4.34	2.42	0.29668	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.42921	0.1224	L	0.35414	1.06	0.49798	D	0.999822	B;B;B;B	0.31655	0.023;0.225;0.095;0.334	B;B;B;B	0.21708	0.01;0.026;0.016;0.036	T	0.15838	-1.0423	10	0.26408	T	0.33	.	7.9873	0.30220	0.0:0.8104:0.0:0.1896	.	299;887;905;887	B7Z6Z6;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	T	903;887;119	ENSP00000405963:A903T;ENSP00000378228:A119T	ENSP00000378224:A887T	A	-	1	0	RASGRF1	77079227	0.841000	0.29509	0.344000	0.25628	0.822000	0.46500	1.597000	0.36729	0.442000	0.26555	0.591000	0.81541	GCC	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N		0.562	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	RASGRF1	protein_coding	OTTHUMT00000291371.3	C	NM_002891	rs199661393		79292172	-1	no_errors	ENST00000419573	ensembl	human	known	74_37	missense	SNP	0.971	T
PAN2	9924	genome.wustl.edu	37	12	56718437	56718437	+	Silent	SNP	C	C	T			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr12:56718437C>T	ENST00000425394.2	-	11	2032	c.1656G>A	c.(1654-1656)aaG>aaA	p.K552K	PAN2_ENST00000257931.5_Silent_p.K552K|PAN2_ENST00000548043.1_Silent_p.K552K|PAN2_ENST00000440411.3_Silent_p.K552K	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	GACAGAACTCCTTCTGGCAAA	0.502																																																	0								ENSG00000135473						68.0	63.0	65.0					12																	56718437		2203	4300	6503	PAN2	SO:0001819	synonymous_variant	0			-	HGNC	AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.1656G>A	12.37:g.56718437C>T		Somatic	0	55	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	343	9.26		Silent	SNP	38	0.00	0	297	19.51	72	pfam_Exonuclease_RNaseT/DNA_pol3,pfam_Peptidase_C19/C67,superfamily_RNaseH-like_dom,superfamily_WD40_repeat_dom,smart_Exonuclease,pfscan_Peptidase_C19/C67	p.K552	ENST00000425394.2	37	c.1656	CCDS44922.1	12																																																																																			-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.502	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAN2	protein_coding	OTTHUMT00000409024.1	C	NM_014871	-		56718437	-1	no_errors	ENST00000425394	ensembl	human	known	74_37	silent	SNP	1.000	T
PTPRH	5794	genome.wustl.edu	37	19	55715272	55715272	+	Missense_Mutation	SNP	C	C	T	rs199739996		TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr19:55715272C>T	ENST00000376350.3	-	5	786	c.764G>A	c.(763-765)cGa>cAa	p.R255Q	PTPRH_ENST00000263434.5_Intron|PTPRH_ENST00000588559.1_5'UTR	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	255	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		TGTTGTGTTTCGAGTCTCTGT	0.552																																																	0								ENSG00000080031	C	,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	221.0	186.0	198.0		,764	-6.1	0.0	19		198	0,8600		0,0,4300	yes	intron,missense	PTPRH	NM_001161440.1,NM_002842.3	,43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,benign	,255/1116	55715272	1,13005	2203	4300	6503	PTPRH	SO:0001583	missense	0			-	HGNC		CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.764G>A	19.37:g.55715272C>T	ENSP00000365528:p.Arg255Gln	Somatic	0	116	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	43	38.57	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	19	0.00	0	23	43.90	18	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.R255Q	ENST00000376350.3	37	c.764	CCDS33110.1	19	.	.	.	.	.	.	.	.	.	.	C	8.674	0.903492	0.17760	2.27E-4	0.0	ENSG00000080031	ENST00000376350	T	0.56941	0.43	3.13	-6.11	0.02131	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.118370	0.07233	N	0.862827	T	0.27349	0.0671	L	0.31664	0.95	0.09310	N	0.999996	B;P	0.42584	0.248;0.784	B;B	0.34452	0.007;0.183	T	0.21008	-1.0258	10	0.13108	T	0.6	.	5.3374	0.15965	0.1417:0.4505:0.0:0.4079	.	77;255	Q9HD43-2;Q9HD43	.;PTPRH_HUMAN	Q	255	ENSP00000365528:R255Q	ENSP00000365528:R255Q	R	-	2	0	PTPRH	60407084	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.410000	0.00480	-1.501000	0.01817	-0.192000	0.12808	CGA	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.552	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRH	protein_coding	OTTHUMT00000452649.1	C		rs199739996		55715272	-1	no_errors	ENST00000376350	ensembl	human	known	74_37	missense	SNP	0.000	T
NRD1	4898	genome.wustl.edu	37	1	52264037	52264037	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr1:52264037C>T	ENST00000354831.7	-	24	2881	c.2692G>A	c.(2692-2694)Gac>Aac	p.D898N	RP4-657D16.3_ENST00000586761.1_RNA|NRD1_ENST00000485608.1_5'UTR|RP4-657D16.3_ENST00000588291.1_RNA|NRD1_ENST00000544028.1_Missense_Mutation_p.D698N|NRD1_ENST00000539524.1_Missense_Mutation_p.D766N|RP4-657D16.6_ENST00000607338.1_RNA|NRD1_ENST00000352171.7_Missense_Mutation_p.D830N|RP4-657D16.3_ENST00000591675.1_RNA	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	829					cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.D898H(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						TGGTACTTGTCAATCATAGAC	0.433																																																	1	Substitution - Missense(1)	breast(1)						ENSG00000078618						81.0	80.0	80.0					1																	52264037		2203	4300	6503	NRD1	SO:0001583	missense	0			-	HGNC	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.2692G>A	1.37:g.52264037C>T	ENSP00000346890:p.Asp898Asn	Somatic	0	26	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	175	30	85.37	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	27	0.00	0	69	86.52	443	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_LuxS/M16	p.D898N	ENST00000354831.7	37	c.2692	CCDS559.1	1	.	.	.	.	.	.	.	.	.	.	C	19.01	3.744132	0.69418	.	.	ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000371665;ENST00000546169;ENST00000544028	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.64	5.64	0.86602	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.176228	0.51477	D	0.000086	T	0.47488	0.1448	L	0.60455	1.87	0.41784	D	0.989838	D;P;D	0.54772	0.962;0.937;0.968	P;P;P	0.57324	0.818;0.663;0.663	T	0.41106	-0.9527	10	0.87932	D	0	-17.108	15.3815	0.74661	0.0:0.8615:0.1385:0.0	.	830;829;898	F5H6R2;O43847;B1AKJ5	.;NRDC_HUMAN;.	N	830;898;766;260;830;698	ENSP00000262679:D830N;ENSP00000346890:D898N;ENSP00000444416:D766N;ENSP00000442262:D698N	ENSP00000262679:D830N	D	-	1	0	NRD1	52036625	0.990000	0.36364	1.000000	0.80357	0.997000	0.91878	2.227000	0.42972	2.937000	0.99478	0.650000	0.86243	GAC	-	superfamily_Metalloenz_LuxS/M16		0.433	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRD1	protein_coding	OTTHUMT00000023045.1	C	NM_002525	-		52264037	-1	no_errors	ENST00000354831	ensembl	human	known	74_37	missense	SNP	1.000	T
DCTN4	51164	genome.wustl.edu	37	5	150097914	150097914	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr5:150097914delG	ENST00000447998.2	-	11	1110	c.995delC	c.(994-996)ccafs	p.P332fs	DCTN4_ENST00000424236.1_Frame_Shift_Del_p.P275fs|DCTN4_ENST00000446090.2_Frame_Shift_Del_p.P339fs	NM_016221.3	NP_057305.1	Q9UJW0	DCTN4_HUMAN	dynactin 4 (p62)	332					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	10		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTTCTCAACTGGATTTGTAAG	0.488																																																	0								ENSG00000132912						114.0	99.0	104.0					5																	150097914		2203	4300	6503	DCTN4	SO:0001589	frameshift_variant	0				HGNC	AF195120	CCDS4310.1, CCDS47310.1, CCDS47311.1	5q31-q32	2008-05-23			ENSG00000132912	ENSG00000132912			15518	protein-coding gene	gene with protein product		614758				10843801, 16554302	Standard	NM_016221		Approved		uc010jhi.3	Q9UJW0	OTTHUMG00000130079	ENST00000447998.2:c.995delC	5.37:g.150097914delG	ENSP00000416968:p.Pro332fs	Somatic	0	62	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	31	35.42	B3KWW0|D3DQH0|E5RGT5|Q8TAN8	Frame_Shift_Del	DEL	27	0.00	0	33	25.00	11	pfam_Dynactin_p62	p.P339fs	ENST00000447998.2	37	c.1016	CCDS4310.1	5																																																																																			-	pfam_Dynactin_p62		0.488	DCTN4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCTN4	protein_coding	OTTHUMT00000252372.1	G				150097914	-1	no_errors	ENST00000446090	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
FER1L6	654463	genome.wustl.edu	37	8	125113350	125113350	+	Silent	SNP	C	C	A			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr8:125113350C>A	ENST00000522917.1	+	38	5102	c.4896C>A	c.(4894-4896)ggC>ggA	p.G1632G	FER1L6_ENST00000399018.1_Silent_p.G1632G|FER1L6-AS2_ENST00000520031.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1632	C2 6. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GGTTAAAGGGCTTGGAGGATG	0.408																																																	0								ENSG00000214814						83.0	84.0	84.0					8																	125113350		2069	4247	6316	FER1L6	SO:0001819	synonymous_variant	0			-	HGNC	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.4896C>A	8.37:g.125113350C>A		Somatic	0	30	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	22	38.89		Silent	SNP	25	0.00	0	21	51.16	22	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,superfamily_ABC1_TM_dom,smart_C2_dom,pfscan_C2_dom	p.G1632	ENST00000522917.1	37	c.4896	CCDS43767.1	8																																																																																			-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.408	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER1L6	protein_coding	OTTHUMT00000381400.1	C	NM_001039112	-		125113350	+1	no_errors	ENST00000399018	ensembl	human	known	74_37	silent	SNP	0.012	A
L1TD1	54596	genome.wustl.edu	37	1	62672850	62672850	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr1:62672850A>G	ENST00000498273.1	+	3	845	c.550A>G	c.(550-552)Aga>Gga	p.R184G		NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	184										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						tatagatgacagagatggaaa	0.368																																																	0								ENSG00000240563						20.0	19.0	19.0					1																	62672850		2121	4148	6269	L1TD1	SO:0001583	missense	0			-	HGNC	BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.550A>G	1.37:g.62672850A>G	ENSP00000419901:p.Arg184Gly	Somatic	0	34	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	62	10.14	Q8NDA1|Q9NUV8|Q9NV78	Missense_Mutation	SNP	31	0.00	0	107	20.15	27	pfam_Transposase_22,superfamily_STAT_TF_coiled-coil	p.R184G	ENST00000498273.1	37	c.550	CCDS619.1	1	.	.	.	.	.	.	.	.	.	.	A	0.898	-0.723340	0.03158	.	.	ENSG00000240563	ENST00000498273	T	0.14144	2.53	2.03	0.844	0.18943	.	.	.	.	.	T	0.08088	0.0202	N	0.24115	0.695	0.09310	N	1	B	0.28026	0.198	B	0.25291	0.059	T	0.33624	-0.9861	9	0.42905	T	0.14	.	4.9568	0.14046	0.6809:0.3191:0.0:0.0	.	184	Q5T7N2	LITD1_HUMAN	G	184	ENSP00000419901:R184G	ENSP00000419901:R184G	R	+	1	2	L1TD1	62445438	0.000000	0.05858	0.001000	0.08648	0.022000	0.10575	-0.051000	0.11885	0.236000	0.21180	0.260000	0.18958	AGA	-	NULL		0.368	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L1TD1	protein_coding	OTTHUMT00000024688.1	A	NM_019079	-		62672850	+1	no_errors	ENST00000498273	ensembl	human	known	74_37	missense	SNP	0.001	G
SPN	6693	genome.wustl.edu	37	16	29675786	29675786	+	Missense_Mutation	SNP	G	G	A	rs181483014		TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr16:29675786G>A	ENST00000360121.3	+	2	829	c.737G>A	c.(736-738)cGg>cAg	p.R246Q	SPN_ENST00000395389.2_Missense_Mutation_p.R246Q	NM_001030288.2|NM_003123.4	NP_001025459.1|NP_003114.1	O75398	DEAF1_HUMAN	sialophorin	0	SAND. {ECO:0000255|PROSITE- ProRule:PRU00185}.				anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|stomach(1)	15						GTGCCCTTCCGGAACCCAGAT	0.612													g|||	1	0.000199681	0.0008	0.0	5008	,	,		18707	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000197471						78.0	68.0	71.0					16																	29675786		2197	4300	6497	SPN	SO:0001583	missense	0			GMAF=0.0005	HGNC	J04536	CCDS10650.1	16p11.2	2008-07-31	2008-07-31		ENSG00000197471	ENSG00000197471		"""CD molecules"""	11249	protein-coding gene	gene with protein product	"""leukosialin"""	182160	"""sialophorin (gpL115, leukosialin, CD43)"""			2784859, 2521952	Standard	NM_001030288		Approved	LSN, CD43, GPL115	uc002dtm.4	P16150	OTTHUMG00000097765	ENST00000360121.3:c.737G>A	16.37:g.29675786G>A	ENSP00000353238:p.Arg246Gln	Somatic	0	107	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	51	42.05	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Missense_Mutation	SNP	38	0.00	0	18	48.57	17	NULL	p.R246Q	ENST00000360121.3	37	c.737	CCDS10650.1	16	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	.	8.329	0.826046	0.16749	.	.	ENSG00000197471	ENST00000395389;ENST00000436527;ENST00000360121	T;T;T	0.79454	-1.27;-1.27;-1.27	4.93	-9.87	0.00470	.	.	.	.	.	T	0.52025	0.1709	L	0.29908	0.895	0.09310	N	1	B	0.22276	0.067	B	0.11329	0.006	T	0.31586	-0.9938	9	0.15066	T	0.55	.	1.0541	0.01586	0.2613:0.1221:0.3228:0.2939	.	246	P16150	LEUK_HUMAN	Q	246	ENSP00000378787:R246Q;ENSP00000412907:R246Q;ENSP00000353238:R246Q	ENSP00000353238:R246Q	R	+	2	0	SPN	29583287	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.308000	0.00518	-4.204000	0.00065	-1.407000	0.01130	CGG	-	NULL		0.612	SPN-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SPN	protein_coding	OTTHUMT00000215001.2	G		rs181483014		29675786	+1	no_errors	ENST00000360121	ensembl	human	known	74_37	missense	SNP	0.000	A
RSPH6A	81492	genome.wustl.edu	37	19	46303816	46303816	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr19:46303816T>C	ENST00000221538.3	-	5	1946	c.1804A>G	c.(1804-1806)Atg>Gtg	p.M602V	RSPH6A_ENST00000597055.1_Missense_Mutation_p.M602V|RSPH6A_ENST00000600188.1_Missense_Mutation_p.M338V	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	602	Glu-rich.					intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						GCCAGGTGCATGATTTCTGTG	0.667																																																	0								ENSG00000104941						48.0	44.0	45.0					19																	46303816		2203	4299	6502	RSPH6A	SO:0001583	missense	0			-	HGNC	AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.1804A>G	19.37:g.46303816T>C	ENSP00000221538:p.Met602Val	Somatic	0	157	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	71	32.38	Q53FE2|Q6PEZ9	Missense_Mutation	SNP	20	0.00	0	19	36.67	11	pfam_Radial_spoke	p.M602V	ENST00000221538.3	37	c.1804	CCDS12675.1	19	.	.	.	.	.	.	.	.	.	.	T	5.076	0.199673	0.09652	.	.	ENSG00000104941	ENST00000221538	T	0.16597	2.33	5.03	-3.0	0.05480	.	1.045490	0.07323	N	0.877962	T	0.12475	0.0303	L	0.32530	0.975	0.09310	N	1	B	0.23490	0.086	B	0.21360	0.034	T	0.37174	-0.9717	10	0.29301	T	0.29	-9.9806	10.6191	0.45470	0.0:0.0813:0.6689:0.2497	.	602	Q9H0K4	RSH6A_HUMAN	V	602	ENSP00000221538:M602V	ENSP00000221538:M602V	M	-	1	0	RSPH6A	50995656	0.309000	0.24518	0.831000	0.32960	0.245000	0.25701	0.101000	0.15251	-0.400000	0.07656	-0.477000	0.04895	ATG	-	pfam_Radial_spoke		0.667	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH6A	protein_coding	OTTHUMT00000461657.1	T		-		46303816	-1	no_errors	ENST00000221538	ensembl	human	known	74_37	missense	SNP	0.106	C
EFHD2	79180	genome.wustl.edu	37	1	15753676	15753676	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr1:15753676G>A	ENST00000375980.4	+	3	564	c.487G>A	c.(487-489)Ggg>Agg	p.G163R		NM_024329.5	NP_077305.2	Q96C19	EFHD2_HUMAN	EF-hand domain family, member D2	163	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					membrane (GO:0016020)	calcium ion binding (GO:0005509)			large_intestine(1)|skin(1)	2		Renal(390;0.00145)|Breast(348;0.00173)|Colorectal(325;0.00215)|all_lung(284;0.00366)|Lung NSC(340;0.00395)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)|Hepatocellular(190;0.152)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.59e-07)|COAD - Colon adenocarcinoma(227;3.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000119)|KIRC - Kidney renal clear cell carcinoma(229;0.00251)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		GGCGGCGGCCGGGGAGCTTCA	0.682																																																	0								ENSG00000142634						19.0	20.0	20.0					1																	15753676		2201	4300	6501	EFHD2	SO:0001583	missense	0			-	HGNC	BC014923	CCDS155.1	1p36	2014-07-01	2005-01-25		ENSG00000142634	ENSG00000142634		"""EF-hand domain containing"""	28670	protein-coding gene	gene with protein product	"""swiprosin-1"""		"""EF hand domain containing 2"""			21244694	Standard	NM_024329		Approved	MGC4342	uc001awh.2	Q96C19	OTTHUMG00000002254	ENST00000375980.4:c.487G>A	1.37:g.15753676G>A	ENSP00000365147:p.Gly163Arg	Somatic	0	34	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	14	53.33	Q5JYW9	Missense_Mutation	SNP	24	0.00	0	16	44.83	13	smart_EF_hand_dom,pfscan_EF_hand_dom	p.G163R	ENST00000375980.4	37	c.487	CCDS155.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.5|20.5	3.992737|3.992737	0.74703|0.74703	.|.	.|.	ENSG00000142634|ENSG00000142634	ENST00000375980;ENST00000375975|ENST00000445566	T|.	0.44881|.	0.91|.	4.07|4.07	4.07|4.07	0.47477|0.47477	.|.	0.000000|.	0.85682|.	U|.	0.000000|.	T|T	0.79305|0.79305	0.4423|0.4423	M|M	0.87180|0.87180	2.865|2.865	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	T|T	0.83306|0.83306	-0.0025|-0.0025	10|5	0.45353|.	T|.	0.12|.	-39.742|-39.742	15.7247|15.7247	0.77747|0.77747	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	163|.	Q96C19|.	EFHD2_HUMAN|.	R|Q	163;64|65	ENSP00000365147:G163R|.	ENSP00000365142:G64R|.	G|R	+|+	1|2	0|0	EFHD2|EFHD2	15626263|15626263	1.000000|1.000000	0.71417|0.71417	0.920000|0.920000	0.36463|0.36463	0.411000|0.411000	0.31082|0.31082	9.735000|9.735000	0.98825|0.98825	2.209000|2.209000	0.71365|0.71365	0.561000|0.561000	0.74099|0.74099	GGG|CGG	-	pfscan_EF_hand_dom		0.682	EFHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFHD2	protein_coding	OTTHUMT00000006433.1	G	NM_024329	-		15753676	+1	no_errors	ENST00000375980	ensembl	human	known	74_37	missense	SNP	1.000	A
WDFY3	23001	genome.wustl.edu	37	4	85738579	85738579	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr4:85738579G>A	ENST00000295888.4	-	13	2260	c.1853C>T	c.(1852-1854)cCg>cTg	p.P618L	WDFY3_ENST00000322366.6_Missense_Mutation_p.P618L	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	618					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CAATTCCGTCGGTGGGGCTGA	0.453																																																	0								ENSG00000163625						141.0	143.0	142.0					4																	85738579		2203	4300	6503	WDFY3	SO:0001583	missense	0			-	HGNC	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.1853C>T	4.37:g.85738579G>A	ENSP00000295888:p.Pro618Leu	Somatic	0	40	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	18	0.00	0	33	0.00	0	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl_sf,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P618L	ENST00000295888.4	37	c.1853	CCDS3609.1	4	.	.	.	.	.	.	.	.	.	.	G	18.00	3.525477	0.64860	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.63580	-0.05;-0.05	5.47	5.47	0.80525	Armadillo-like helical (1);	0.056003	0.64402	D	0.000001	T	0.52885	0.1762	L	0.46157	1.445	0.80722	D	1	B;B	0.33120	0.398;0.271	B;B	0.22880	0.042;0.042	T	0.51957	-0.8639	10	0.13108	T	0.6	.	19.3245	0.94256	0.0:0.0:1.0:0.0	.	618;618	E2QRK8;Q8IZQ1	.;WDFY3_HUMAN	L	618	ENSP00000318466:P618L;ENSP00000295888:P618L	ENSP00000295888:P618L	P	-	2	0	WDFY3	85957603	1.000000	0.71417	0.975000	0.42487	0.929000	0.56500	5.976000	0.70484	2.581000	0.87130	0.563000	0.77884	CCG	-	superfamily_ARM-type_fold		0.453	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	protein_coding	OTTHUMT00000252811.2	G	NM_014991	-		85738579	-1	no_errors	ENST00000295888	ensembl	human	known	74_37	missense	SNP	1.000	A
ENTPD4	9583	genome.wustl.edu	37	8	23292045	23292046	+	Intron	DEL	CA	CA	-	rs139348326		TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr8:23292045_23292046delCA	ENST00000358689.4	-	12	1696				ENTPD4_ENST00000356206.6_Intron|ENTPD4_ENST00000417069.2_Intron|ENTPD4_ENST00000521321.1_Intron	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4						UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		GTCAAGATGGcacacacacaca	0.545																																																	0								ENSG00000197217																																			ENTPD4	SO:0001627	intron_variant	0				HGNC	AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.1461-54TG>-	8.37:g.23292055_23292056delCA		Somatic	0	20	0.00		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	D3DSS3|O15092	RNA	DEL	14	0.00	0	43	8.51	4	-	NULL	ENST00000358689.4	37	NULL	CCDS6041.1	8																																																																																			-	-		0.545	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	ENTPD4	protein_coding	OTTHUMT00000215142.1	CA	NM_004901			23292046	-1	no_errors	ENST00000522913	ensembl	human	known	74_37	rna	DEL	0.000:0.000	-
PRIM2	5558	genome.wustl.edu	37	6	57512787	57512788	+	3'UTR	INS	-	-	CACCAAGGC	rs373452397|rs376103961|rs386701662|rs79832250		TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr6:57512787_57512788insCACCAAGGC	ENST00000389488.2	+	0	1702_1703				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttgcactctgttgtgtaattgt	0.431																																																	0								ENSG00000146143																																			PRIM2	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1700->CACCAAGGC	6.37:g.57512787_57512788insCACCAAGGC		Somatic	NA	NA	NA		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	INS	47	20.34	12	55	39.56	36	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			-	-		0.431	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	protein_coding	OTTHUMT00000043468.3	-	NM_000947			57512788	+1	no_errors	ENST00000389488	ensembl	human	known	74_37	rna	INS	0.057:0.034	CACCAAGGC
SMARCB1	6598	genome.wustl.edu	37	22	24176678	24176700	+	3'UTR	DEL	CAACAGGTCATGTTCAATTTCTT	CAACAGGTCATGTTCAATTTCTT	-	rs5030614	byFrequency	TCGA-DX-A2IZ-01A-11D-A21Q-09	TCGA-DX-A2IZ-10A-01D-A21Q-09	CAACAGGTCATGTTCAATTTCTT	CAACAGGTCATGTTCAATTTCTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67bb70b2-b6f8-4aa9-80ce-48829f9fec56	9dc2fa01-ef68-44ce-98d0-dddcb6ef4f46	g.chr22:24176678_24176700delCAACAGGTCATGTTCAATTTCTT	ENST00000263121.7	+	0	1665_1687				SMARCB1_ENST00000407422.3_3'UTR|DERL3_ENST00000404056.1_3'UTR|SMARCB1_ENST00000344921.6_3'UTR|DERL3_ENST00000464023.1_5'UTR|DERL3_ENST00000406855.3_3'UTR	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1						ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)			bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				AAATAAAAGGCAACAGGTCATGTTCAATTTCTTCAACAGGTCA	0.435			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid								649	0.129593	0.1838	0.1282	5008	,	,		17370	0.0506		0.1471	False		,,,				2504	0.1207						yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	0								ENSG00000099958																																			DERL3	SO:0001624	3_prime_UTR_variant	0				HGNC	U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.*333CAACAGGTCATGTTCAATTTCTT>-	22.37:g.24176678_24176700delCAACAGGTCATGTTCAATTTCTT		Somatic	NA	NA	NA		0.7182417012031701	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	RNA	DEL	33	8.33	3	18	21.74	5	-	NULL	ENST00000263121.7	37	NULL	CCDS13817.1	22																																																																																			-	-		0.435	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DERL3	protein_coding	OTTHUMT00000319872.1	CAACAGGTCATGTTCAATTTCTT	NM_003073			24176700	-1	no_errors	ENST00000464023	ensembl	human	known	74_37	rna	DEL	0.881:0.744:0.541:0.169:0.191:0.247:0.273:0.214:0.004:0.003:0.003:0.004:0.017:0.025:0.031:0.034:0.036:0.045:0.051:0.010:0.016:0.016:0.010	-
