#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PPP1R1A	5502	genome.wustl.edu	37	12	54975830	54975830	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr12:54975830C>G	ENST00000257905.8	-	5	503	c.333G>C	c.(331-333)caG>caC	p.Q111H	PPP1R1A_ENST00000547431.1_Intron	NM_006741.3	NP_006732	Q13522	PPR1A_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 1A	111					glycogen metabolic process (GO:0005977)|negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein serine/threonine phosphatase inhibitor activity (GO:0004865)			lung(2)	2						GGCGGGACTCCTGGGTTTCTG	0.602																																																	0								ENSG00000135447						68.0	70.0	69.0					12																	54975830		1917	4115	6032	PPP1R1A	SO:0001583	missense	0			-	HGNC	U48707	CCDS44912.1	12q13.2	2012-04-17			ENSG00000135447	ENSG00000135447	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9286	protein-coding gene	gene with protein product		613246				8611507	Standard	NM_006741		Approved		uc001sgg.2	Q13522	OTTHUMG00000169934	ENST00000257905.8:c.333G>C	12.37:g.54975830C>G	ENSP00000257905:p.Gln111His	Somatic	0	40	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	255	40	86.44	Q6IB01|Q8TBJ2|Q8WWV2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PPI_1DARPP-32	p.Q111H	ENST00000257905.8	37	c.333	CCDS44912.1	12	.	.	.	.	.	.	.	.	.	.	C	16.74	3.208158	0.58343	.	.	ENSG00000135447	ENST00000257905	T	0.33216	1.42	5.28	4.39	0.52855	.	0.460512	0.19916	N	0.103199	T	0.43656	0.1257	L	0.55481	1.735	0.29944	N	0.820818	P	0.42123	0.771	P	0.57152	0.814	T	0.34900	-0.9810	10	0.32370	T	0.25	.	10.051	0.42216	0.0:0.9066:0.0:0.0934	.	111	Q13522	PPR1A_HUMAN	H	111	ENSP00000257905:Q111H	ENSP00000257905:Q111H	Q	-	3	2	PPP1R1A	53262097	0.991000	0.36638	1.000000	0.80357	0.633000	0.38033	0.290000	0.18975	1.366000	0.46076	0.655000	0.94253	CAG	-	pfam_PPI_1DARPP-32		0.602	PPP1R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R1A	protein_coding	OTTHUMT00000406604.1	C	NM_006741	-		54975830	-1	no_errors	ENST00000257905	ensembl	human	known	74_37	missense	SNP	1.000	G
EDEM3	80267	genome.wustl.edu	37	1	184680917	184680917	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr1:184680917C>A	ENST00000318130.8	-	15	1897	c.1631G>T	c.(1630-1632)aGt>aTt	p.S544I	EDEM3_ENST00000367512.3_Missense_Mutation_p.S501I|EDEM3_ENST00000466392.1_5'Flank	NM_025191.3	NP_079467.3	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like 3	544					cellular protein metabolic process (GO:0044267)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CTCACGAATACTTTGAGCATA	0.373																																																	0								ENSG00000116406						104.0	98.0	100.0					1																	184680917		2203	4300	6503	EDEM3	SO:0001583	missense	0			-	HGNC	AF288393	CCDS1363.2	1q25	2008-02-05	2006-03-31	2006-03-31	ENSG00000116406	ENSG00000116406			16787	protein-coding gene	gene with protein product		610214	"""chromosome 1 open reading frame 22"""	C1orf22		15537790, 15579471	Standard	NM_025191		Approved		uc010pok.2	Q9BZQ6	OTTHUMG00000035387	ENST00000318130.8:c.1631G>T	1.37:g.184680917C>A	ENSP00000318147:p.Ser544Ile	Somatic	0	89	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	80	20.00	B2RCH6|B7ZLZ2|Q0VGM5|Q5TEZ0|Q9HCW1|Q9UFV7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_47,pfam_Protease-assoc_domain,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.S544I	ENST00000318130.8	37	c.1631	CCDS1363.2	1	.	.	.	.	.	.	.	.	.	.	C	15.40	2.823039	0.50739	.	.	ENSG00000116406	ENST00000318130;ENST00000367512	T;T	0.72942	-0.7;-0.68	5.87	5.87	0.94306	.	0.091756	0.85682	D	0.000000	T	0.56187	0.1968	N	0.24115	0.695	0.46849	D	0.999227	B	0.17465	0.022	B	0.18561	0.022	T	0.50651	-0.8803	9	.	.	.	.	13.4064	0.60915	0.0:0.9285:0.0:0.0715	.	544	Q9BZQ6	EDEM3_HUMAN	I	544;501	ENSP00000318147:S544I;ENSP00000356482:S501I	.	S	-	2	0	EDEM3	182947540	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	2.298000	0.43602	2.779000	0.95612	0.655000	0.94253	AGT	-	NULL		0.373	EDEM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDEM3	protein_coding	OTTHUMT00000085785.3	C	NM_025191	-		184680917	-1	no_errors	ENST00000318130	ensembl	human	known	74_37	missense	SNP	1.000	A
GPRIN1	114787	genome.wustl.edu	37	5	176026122	176026134	+	Frame_Shift_Del	DEL	CAAAGACCCAGGA	CAAAGACCCAGGA	-	rs3797464|rs200519605|rs386695335|rs550332435|rs142779818|rs371149640|rs199714570|rs373697082	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	CAAAGACCCAGGA	CAAAGACCCAGGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr5:176026122_176026134delCAAAGACCCAGGA	ENST00000303991.4	-	2	879_891	c.702_714delTCCTGGGTCTTTG	c.(700-714)gatcctgggtctttgfs	p.DPGSL234fs		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	234				Missing (in Ref. 4; CAD38868). {ECO:0000305}.	neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)		p.L238L(1)		NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCACCTTTCTCAAAGACCCAGGATCCTCCTTCC	0.488																																																	1	Substitution - coding silent(1)	lung(1)						ENSG00000169258			721,3495		76,569,1463						-0.3	0.0		dbSNP_107	106	1092,7070		103,886,3092	no	frameshift	GPRIN1	NM_052899.2		179,1455,4555	A1A1,A1R,RR		13.3791,17.1015,14.647				1813,10565				GPRIN1	SO:0001589	frameshift_variant	0				HGNC	AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.702_714delTCCTGGGTCTTTG	5.37:g.176026122_176026134delCAAAGACCCAGGA	ENSP00000305839:p.Asp234fs	Somatic	NA	NA	NA		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9JM70|Q8ND74|Q96PZ4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.D234fs	ENST00000303991.4	37	c.714_702	CCDS4405.1	5																																																																																			-	NULL		0.488	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN1	protein_coding	OTTHUMT00000253149.1	CAAAGACCCAGGA	NM_052899			176026134	-1	no_errors	ENST00000303991	ensembl	human	known	74_37	frame_shift_del	DEL	0.000:0.000:0.000:0.001:0.004:0.001:0.000:0.000:0.101:0.106:0.114:0.091:0.008	-
KCNH8	131096	genome.wustl.edu	37	3	19575241	19575241	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr3:19575241G>C	ENST00000328405.2	+	16	3240	c.2974G>C	c.(2974-2976)Gat>Cat	p.D992H		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	992	Ser-rich.				potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						TCCAAGCCTTGATTATTCACC	0.483																																					NSCLC(124;1625 1765 8018 24930 42026)												0								ENSG00000183960						187.0	185.0	186.0					3																	19575241		2203	4300	6503	KCNH8	SO:0001583	missense	0			-	HGNC	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2974G>C	3.37:g.19575241G>C	ENSP00000328813:p.Asp992His	Somatic	0	49	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B7Z2I7|Q59GQ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,pfam_PAS_4,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,superfamily_tRNA-bd_arm,smart_PAC,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_EAG,tigrfam_PAS	p.D992H	ENST00000328405.2	37	c.2974	CCDS2632.1	3	.	.	.	.	.	.	.	.	.	.	G	9.990	1.230640	0.22542	.	.	ENSG00000183960	ENST00000328405	D	0.98585	-5.01	5.48	5.48	0.80851	.	0.588281	0.12229	U	0.487640	D	0.95332	0.8485	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	D	0.91041	0.4871	9	.	.	.	.	15.8905	0.79293	0.0:0.1448:0.8552:0.0	.	992	Q96L42	KCNH8_HUMAN	H	992	ENSP00000328813:D992H	.	D	+	1	0	KCNH8	19550245	0.270000	0.24152	0.215000	0.23724	0.968000	0.65278	3.213000	0.51153	2.558000	0.86282	0.655000	0.94253	GAT	-	NULL		0.483	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH8	protein_coding	OTTHUMT00000252139.2	G	NM_144633	-		19575241	+1	no_errors	ENST00000328405	ensembl	human	known	74_37	missense	SNP	0.896	C
DUSP21	63904	genome.wustl.edu	37	X	44703772	44703772	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chrX:44703772G>A	ENST00000339042.4	+	1	524	c.394G>A	c.(394-396)Gcc>Acc	p.A132T		NM_022076.3	NP_071359.3	Q9H596	DUS21_HUMAN	dual specificity phosphatase 21	132	Tyrosine-protein phosphatase.				peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|skin(3)	19						GCTGCTGGACGCCCATACATG	0.557																																																	0								ENSG00000189037						80.0	62.0	68.0					X																	44703772		2203	4300	6503	DUSP21	SO:0001583	missense	0			-	HGNC	AF143321	CCDS14264.1	Xp11.4-p11.23	2011-06-09			ENSG00000189037	ENSG00000189037		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	20476	protein-coding gene	gene with protein product		300678				12408986	Standard	NM_022076		Approved		uc004dgd.3	Q9H596	OTTHUMG00000021401	ENST00000339042.4:c.394G>A	X.37:g.44703772G>A	ENSP00000343244:p.Ala132Thr	Somatic	0	21	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	14	30.00	Q0VDA6|Q6IAJ6|Q6YDQ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP_famB,prints_Atypical_DUSP	p.A132T	ENST00000339042.4	37	c.394	CCDS14264.1	X	.	.	.	.	.	.	.	.	.	.	g	18.05	3.537326	0.65085	.	.	ENSG00000189037	ENST00000339042;ENST00000537377	D	0.92495	-3.05	4.21	4.21	0.49690	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	D	0.95300	0.8475	M	0.80616	2.505	0.80722	D	1	D	0.76494	0.999	D	0.64410	0.925	D	0.95656	0.8711	10	0.87932	D	0	.	13.4772	0.61316	0.0:0.0:1.0:0.0	.	132	Q9H596	DUS21_HUMAN	T	132;131	ENSP00000343244:A132T	ENSP00000343244:A132T	A	+	1	0	DUSP21	44588716	1.000000	0.71417	0.059000	0.19551	0.015000	0.08874	9.492000	0.97957	2.348000	0.79779	0.597000	0.82753	GCC	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat		0.557	DUSP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP21	protein_coding	OTTHUMT00000056323.1	G	NM_022076	-		44703772	+1	no_errors	ENST00000339042	ensembl	human	known	74_37	missense	SNP	1.000	A
ANKRD30BL	554226	genome.wustl.edu	37	2	133015334	133015334	+	5'UTR	SNP	G	G	T	rs1710724|rs449812		TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr2:133015334G>T	ENST00000470729.1	-	0	208				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GGGGGCCTGCGGTACCAGGAA	0.706																																																	0								ENSG00000163046																																			ANKRD30BL	SO:0001623	5_prime_UTR_variant	0			-	HGNC			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-1217C>A	2.37:g.133015334G>T		Somatic	0	35	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	29	23.68	B8ZZL7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			-	-		0.706	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	protein_coding	OTTHUMT00000331354.1	G	NR_027019	-		133015334	-1	no_errors	ENST00000470729	ensembl	human	known	74_37	rna	SNP	0.025	T
R3HDM2	22864	genome.wustl.edu	37	12	57693914	57693914	+	Silent	SNP	G	G	A			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr12:57693914G>A	ENST00000347140.3	-	5	648	c.258C>T	c.(256-258)tcC>tcT	p.S86S	R3HDM2_ENST00000403821.2_Silent_p.S86S|R3HDM2_ENST00000402412.1_Silent_p.S86S|R3HDM2_ENST00000358907.2_Silent_p.S86S			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	86						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						ATGGGGTGGAGGACTCCTCAC	0.393																																																	0								ENSG00000179912						58.0	53.0	55.0					12																	57693914		692	1591	2283	R3HDM2	SO:0001819	synonymous_variant	0			-	HGNC	AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.258C>T	12.37:g.57693914G>A		Somatic	0	34	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	37	43.94	Q2M1T9|Q3ZCT5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.S86	ENST00000347140.3	37	c.258	CCDS8937.2	12																																																																																			-	NULL		0.393	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	R3HDM2	protein_coding	OTTHUMT00000326570.2	G	NM_014925	-		57693914	-1	no_errors	ENST00000347140	ensembl	human	known	74_37	silent	SNP	0.998	A
PRX	57716	genome.wustl.edu	37	19	40900180	40900182	+	In_Frame_Del	DEL	TCC	TCC	-	rs139624657|rs377069149|rs142743305		TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	TCC	TCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr19:40900180_40900182delTCC	ENST00000324001.7	-	7	4347_4349	c.4077_4079delGGA	c.(4075-4080)gaggaa>gaa	p.1359_1360EE>E	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	1359	Poly-Glu.		Missing. {ECO:0000269|PubMed:11133365}.		axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ACTGCcctcttcctcctcctcct	0.695																																																	0								ENSG00000105227																																			PRX	SO:0001651	inframe_deletion	0				HGNC	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.4077_4079delGGA	19.37:g.40900189_40900191delTCC	ENSP00000326018:p.Glu1361del	Somatic	0	21	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	Q9BXL9|Q9HCF2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E1361in_frame_del	ENST00000324001.7	37	c.4079_4077	CCDS33028.1	19																																																																																			-	NULL		0.695	PRX-001	KNOWN	basic|CCDS	protein_coding	PRX	protein_coding	OTTHUMT00000462582.1	TCC	NM_020956			40900182	-1	no_errors	ENST00000324001	ensembl	human	known	74_37	in_frame_del	DEL	0.908:0.904:0.008	-
LINC01410	103352539	genome.wustl.edu	37	9	66468975	66468975	+	lincRNA	SNP	G	G	A	rs2321615	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr9:66468975G>A	ENST00000424345.1	+	0	2542																											gtgcatgcagggaggaaagaa	0.403													.|||	2429	0.485024	0.4818	0.4899	5008	,	,		95344	0.4792		0.4841	False		,,,				2504	0.4928																0								ENSG00000238113																																			RP11-262H14.1			0			-	Clone_based_vega_gene																													9.37:g.66468975G>A		Somatic	0	18	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	8	33.33		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000424345.1	37	NULL		9																																																																																			-	-		0.403	RP11-262H14.1-001	KNOWN	basic	lincRNA	LOC100996870	lincRNA	OTTHUMT00000128851.1	G		rs2321615		66468975	+1	no_errors	ENST00000424345	ensembl	human	known	74_37	rna	SNP	0.020	A
SLC4A8	9498	genome.wustl.edu	37	12	51857442	51857442	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr12:51857442C>G	ENST00000453097.2	+	11	1510	c.1293C>G	c.(1291-1293)caC>caG	p.H431Q	SLC4A8_ENST00000514353.3_Missense_Mutation_p.H378Q|SLC4A8_ENST00000358657.3_Missense_Mutation_p.H458Q|SLC4A8_ENST00000535225.2_Missense_Mutation_p.H378Q|SLC4A8_ENST00000394856.1_Missense_Mutation_p.H378Q	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		ATGTTTGCCACATAGAACAGG	0.463																																																	0								ENSG00000050438						116.0	117.0	116.0					12																	51857442		2203	4300	6503	SLC4A8	SO:0001583	missense	0			-	HGNC	AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.1293C>G	12.37:g.51857442C>G	ENSP00000405812:p.His431Gln	Somatic	0	51	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	118	334	26.11		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.H431Q	ENST00000453097.2	37	c.1293	CCDS44890.1	12	.	.	.	.	.	.	.	.	.	.	C	8.249	0.808491	0.16467	.	.	ENSG00000050438	ENST00000535225;ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000551071	T;T;T;T;T	0.76186	-0.36;-1.0;-1.0;-0.38;-0.38	5.42	3.58	0.41010	.	0.297548	0.39210	N	0.001439	T	0.57388	0.2050	L	0.44542	1.39	0.40242	D	0.977978	P;B;B;B;B;B	0.35363	0.497;0.003;0.01;0.001;0.0;0.0	B;B;B;B;B;B	0.28553	0.091;0.004;0.008;0.002;0.004;0.006	T	0.52946	-0.8507	10	0.13470	T	0.59	.	7.4986	0.27505	0.0:0.6927:0.0:0.3073	.	378;458;378;431;431;431	E7EML0;Q2Y0W8-2;F5GZ31;Q2Y0W8;Q2Y0W8-3;Q2Y0W8-6	.;.;.;S4A8_HUMAN;.;.	Q	378;458;431;378;431;378;378	ENSP00000441520:H378Q;ENSP00000351483:H458Q;ENSP00000405812:H431Q;ENSP00000378325:H378Q;ENSP00000442561:H378Q	ENSP00000315789:H431Q	H	+	3	2	SLC4A8	50143709	0.513000	0.26194	1.000000	0.80357	0.977000	0.68977	0.345000	0.19979	1.451000	0.47736	0.655000	0.94253	CAC	-	tigrfam_HCO3_transpt_euk		0.463	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A8	protein_coding	OTTHUMT00000404356.1	C	NM_004858	-		51857442	+1	no_errors	ENST00000453097	ensembl	human	known	74_37	missense	SNP	0.984	G
OR52E6	390078	genome.wustl.edu	37	11	5863176	5863176	+	5'Flank	SNP	T	T	C			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr11:5863176T>C	ENST00000329322.5	-	0	0				TRIM5_ENST00000380027.1_Intron|OR52E6_ENST00000379946.2_Splice_Site_p.K3E	NM_001005167.1	NP_001005167.1	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E, member 6							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AATTATTGACTTTCCATTAGT	0.373																																																	0								ENSG00000205409						24.0	22.0	22.0					11																	5863176		2059	4239	6298	OR52E6	SO:0001631	upstream_gene_variant	0			-	HGNC	AB065815	CCDS53597.1	11p15.4	2012-08-09				ENSG00000205409		"""GPCR / Class A : Olfactory receptors"""	15215	protein-coding gene	gene with protein product							Standard	NM_001005167		Approved		uc010qzq.2	Q96RD3			11.37:g.5863176T>C	Exception_encountered	Somatic	0	42	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	32	21.95	Q6IFF8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K3E	ENST00000329322.5	37	c.7	CCDS53597.1	11	.	.	.	.	.	.	.	.	.	.	T	0.157	-1.085077	0.01888	.	.	ENSG00000205409	ENST00000379946	T	0.00004	9.81	3.37	2.19	0.27852	.	2.413010	0.02138	N	0.056918	T	0.00039	0.0001	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.07028	-1.0794	6	.	.	.	.	6.5849	0.22614	0.0:0.0:0.2475:0.7525	.	.	.	.	E	3	ENSP00000369279:K3E	.	K	-	1	0	OR52E6	5819752	0.000000	0.05858	0.016000	0.15963	0.029000	0.11900	0.011000	0.13264	0.449000	0.26747	-0.485000	0.04761	AAA	-	NULL		0.373	OR52E6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E6	protein_coding	OTTHUMT00000401144.1	T	NM_001005167	-		5863176	-1	no_errors	ENST00000379946	ensembl	human	known	74_37	missense	SNP	0.034	C
IL17RA	23765	genome.wustl.edu	37	22	17579665	17579665	+	Splice_Site	SNP	C	C	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr22:17579665C>T	ENST00000319363.6	+	4	444	c.311C>T	c.(310-312)gCc>gTc	p.A104V	IL17RA_ENST00000477874.1_3'UTR	NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	104					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)			endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		TCTCCTGCAGCCAGCATCCTG	0.498																																																	0								ENSG00000177663						126.0	93.0	104.0					22																	17579665		2203	4300	6503	IL17RA	SO:0001630	splice_region_variant	0			-	HGNC	U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.311-1C>T	22.37:g.17579665C>T		Somatic	0	37	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	47	16.07	O43844|Q20WK1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEFIR	p.A104V	ENST00000319363.6	37	c.311	CCDS13739.1	22	.	.	.	.	.	.	.	.	.	.	C	20.3	3.971790	0.74246	.	.	ENSG00000177663	ENST00000425985;ENST00000319363	T	0.25250	1.81	5.97	4.93	0.64822	.	0.171616	0.38326	N	0.001735	T	0.43612	0.1255	M	0.64997	1.995	0.39081	D	0.960909	D;D	0.89917	1.0;0.999	P;P	0.61070	0.883;0.77	T	0.26430	-1.0103	9	.	.	.	.	14.3761	0.66879	0.0:0.8155:0.1845:0.0	.	104;104	D3YTB4;Q96F46	.;I17RA_HUMAN	V	104	ENSP00000320936:A104V	.	A	+	2	0	IL17RA	15959665	1.000000	0.71417	1.000000	0.80357	0.479000	0.33129	1.799000	0.38824	2.837000	0.97791	0.655000	0.94253	GCC	-	NULL		0.498	IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17RA	protein_coding	OTTHUMT00000315820.1	C	NM_014339	-	Missense_Mutation	17579665	+1	no_errors	ENST00000319363	ensembl	human	known	74_37	missense	SNP	1.000	T
MT-ND2	4536	genome.wustl.edu	37	M	1884	1884	+	5'Flank	SNP	G	G	A			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chrM:1884G>A	ENST00000361453.3	+	0	0				MT-TV_ENST00000387342.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TF_ENST00000387314.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						TAACTTTGCAAGGAGAGCCAA	0.403																																																	0								ENSG00000210082																																			MT-RNR2	SO:0001631	upstream_gene_variant	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.1884G>A	Exception_encountered	Somatic	0	22	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	13	65.79	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			-	-		0.403	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	protein_coding		G	YP_003024027	-		1884	+1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	SNP	NULL	A
C9orf139	401563	genome.wustl.edu	37	9	139931682	139931683	+	IGR	INS	-	-	GTGGGC	rs149732889|rs61042534	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr9:139931682_139931683insGTGGGC	ENST00000314330.2	+	0	3815				RP11-229P13.20_ENST00000457302.2_lincRNA	NM_207511.1	NP_997394.1	Q6ZV77	CI139_HUMAN	chromosome 9 open reading frame 139											cervix(1)|lung(2)	3	all_cancers(76;0.0893)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.99e-05)|Epithelial(140;0.000493)		AGTGAAGGATGGTGGGCGTGGG	0.678														4498	0.898163	0.8396	0.9452	5008	,	,		19859	0.9444		0.9314	False		,,,				2504	0.862																0								ENSG00000235117																																			RP11-229P13.20	SO:0001628	intergenic_variant	0				Clone_based_vega_gene		CCDS7023.1	9q34.3	2008-02-05			ENSG00000180539	ENSG00000180539			31426	protein-coding gene	gene with protein product							Standard	NM_207511		Approved	FLJ36268, FLJ42909	uc004ckp.1	Q6ZV77	OTTHUMG00000020959		9.37:g.139931683_139931688dupGTGGGC		Somatic	NA	NA	NA		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A2RUA3|B9EGW2|Q5SPY0|Q8N224	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000314330.2	37	NULL	CCDS7023.1	9																																																																																			-	-		0.678	C9orf139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000235117	protein_coding	OTTHUMT00000055213.2	-	NM_207511			139931683	+1	no_errors	ENST00000457302	ensembl	human	known	74_37	rna	INS	0.018:0.034	GTGGGC
PSG2	5670	genome.wustl.edu	37	19	43585990	43585990	+	Intron	DEL	T	T	-	rs58620361	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr19:43585990delT	ENST00000406487.1	-	2	163				PSG2_ENST00000491995.1_5'UTR	NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2						cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				ACCCTTGGTGTTTTTTTTTTT	0.443													|||unknown(HR)	1642	0.327875	0.5598	0.2075	5008	,	,		18087	0.245		0.1859	False		,,,				2504	0.3313																0								ENSG00000242221																																			PSG2	SO:0001627	intron_variant	0				HGNC		CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.65-592A>-	19.37:g.43585990delT		Somatic	0	20	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	Q8TCD9|Q9UEA4|Q9UQ78	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000406487.1	37	NULL	CCDS12616.1	19																																																																																			-	-		0.443	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG2	protein_coding	OTTHUMT00000323083.1	T	NM_031246			43585990	-1	no_errors	ENST00000491995	ensembl	human	known	74_37	rna	DEL	0.004	-
E2F7	144455	genome.wustl.edu	37	12	77458410	77458410	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr12:77458410C>G	ENST00000322886.7	-	2	241	c.6G>C	c.(4-6)gaG>gaC	p.E2D	E2F7_ENST00000416496.2_Missense_Mutation_p.E2D	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	2					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						AACAATTTACCTCCATCTGTA	0.343																																																	0								ENSG00000165891						124.0	117.0	119.0					12																	77458410		2203	4300	6503	E2F7	SO:0001583	missense	0			-	HGNC	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.6G>C	12.37:g.77458410C>G	ENSP00000323246:p.Glu2Asp	Somatic	0	35	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	80	37	68.38	A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_E2F_TDP	p.E2D	ENST00000322886.7	37	c.6	CCDS9016.1	12	.	.	.	.	.	.	.	.	.	.	C	19.19	3.780506	0.70222	.	.	ENSG00000165891	ENST00000322886;ENST00000416496;ENST00000550669;ENST00000547316	D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89	5.11	3.2	0.36748	.	0.145132	0.64402	N	0.000009	D	0.88858	0.6551	L	0.56769	1.78	0.47621	D	0.999476	D;B	0.89917	1.0;0.058	D;B	0.83275	0.996;0.026	D	0.88362	0.2988	10	0.87932	D	0	-19.1147	8.0955	0.30826	0.1581:0.7562:0.0:0.0858	.	2;2	F8VSE7;Q96AV8	.;E2F7_HUMAN	D	2	ENSP00000323246:E2D;ENSP00000393639:E2D;ENSP00000448245:E2D;ENSP00000449033:E2D	ENSP00000323246:E2D	E	-	3	2	E2F7	75982541	0.999000	0.42202	1.000000	0.80357	0.989000	0.77384	0.798000	0.27014	1.339000	0.45563	0.561000	0.74099	GAG	-	NULL		0.343	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F7	protein_coding	OTTHUMT00000406716.1	C	XM_084871	-		77458410	-1	no_errors	ENST00000322886	ensembl	human	known	74_37	missense	SNP	1.000	G
CTTN	2017	genome.wustl.edu	37	11	70255965	70255965	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr11:70255965C>T	ENST00000301843.8	+	5	396	c.190C>T	c.(190-192)Caa>Taa	p.Q64*	CTTN_ENST00000346329.3_Nonsense_Mutation_p.Q64*|CTTN_ENST00000376561.3_Nonsense_Mutation_p.Q64*|CTTN_ENST00000527622.1_3'UTR	NM_005231.3	NP_005222.2	Q14247	SRC8_HUMAN	cortactin	64					negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitotic spindle midzone (GO:1990023)|ruffle (GO:0001726)				breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	31			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		GAATGTCTTTCAAGAGCATCA	0.428																																																	0								ENSG00000085733						216.0	214.0	214.0					11																	70255965		2200	4294	6494	CTTN	SO:0001587	stop_gained	0			-	HGNC	AJ288897	CCDS8197.1, CCDS41680.1, CCDS53676.1	11q13	2008-02-05	2004-06-08	2004-06-09	ENSG00000085733	ENSG00000085733			3338	protein-coding gene	gene with protein product		164765	"""ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate)"""	EMS1		7685625	Standard	NM_005231		Approved		uc001opu.3	Q14247	OTTHUMG00000134307	ENST00000301843.8:c.190C>T	11.37:g.70255965C>T	ENSP00000301843:p.Gln64*	Somatic	0	37	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	79	15.96	Q8N707|Q96H99	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hs1_Cortactin,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_Hs1_Cortactin,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.Q64*	ENST00000301843.8	37	c.190	CCDS41680.1	11	.	.	.	.	.	.	.	.	.	.	C	16.42	3.117914	0.56505	.	.	ENSG00000085733	ENST00000346329;ENST00000301843;ENST00000376561	.	.	.	5.12	4.2	0.49525	.	0.241097	0.41938	D	0.000792	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-23.1195	13.7335	0.62804	0.0:0.9254:0.0:0.0746	.	.	.	.	X	64	.	ENSP00000301843:Q64X	Q	+	1	0	CTTN	69933613	0.919000	0.31177	0.958000	0.39756	0.005000	0.04900	2.270000	0.43355	1.141000	0.42275	0.563000	0.77884	CAA	-	NULL		0.428	CTTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTN	protein_coding	OTTHUMT00000259233.2	C	NM_138565	-		70255965	+1	no_errors	ENST00000301843	ensembl	human	known	74_37	nonsense	SNP	0.996	T
GRIA1	2890	genome.wustl.edu	37	5	153065889	153065889	+	Splice_Site	SNP	G	G	A			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr5:153065889G>A	ENST00000285900.5	+	8	1477	c.1134G>A	c.(1132-1134)aaG>aaA	p.K378K	GRIA1_ENST00000518142.1_Splice_Site_p.K298K|GRIA1_ENST00000518783.1_Splice_Site_p.K388K|GRIA1_ENST00000521843.2_Splice_Site_p.K309K|GRIA1_ENST00000448073.4_Splice_Site_p.K388K|GRIA1_ENST00000340592.5_Splice_Site_p.K378K	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	378					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	GCATCCGAAAGGTAAGGTCCC	0.507																																																	0								ENSG00000155511						89.0	81.0	84.0					5																	153065889		2203	4300	6503	GRIA1	SO:0001630	splice_region_variant	0			-	HGNC		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1134+1G>A	5.37:g.153065889G>A		Somatic	0	25	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	30	21.05	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.K388	ENST00000285900.5	37	c.1164	CCDS4322.1	5																																																																																			-	superfamily_Peripla_BP_I		0.507	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	protein_coding	OTTHUMT00000252456.3	G		-	Silent	153065889	+1	no_errors	ENST00000448073	ensembl	human	known	74_37	silent	SNP	1.000	A
C10orf131	100127889	genome.wustl.edu	37	10	97684071	97684071	+	Splice_Site	SNP	A	A	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr10:97684071A>T	ENST00000423344.2	+	5	270	c.74A>T	c.(73-75)gAt>gTt	p.D25V	ENTPD1-AS1_ENST00000454638.1_RNA|ENTPD1-AS1_ENST00000451364.1_RNA|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1-AS1_ENST00000452728.1_RNA|RP11-248J23.7_ENST00000491114.1_3'UTR	NM_001130446.2	NP_001123918.2	A6NCD4	CJ131_HUMAN	chromosome 10 open reading frame 131	21										endometrium(1)|kidney(1)	2						TTCCTGATAGATTTAGATGCA	0.269																																																	0								ENSG00000173088						67.0	61.0	63.0					10																	97684071		692	1585	2277	C10orf131	SO:0001630	splice_region_variant	0			-	HGNC		CCDS58090.1	10q24.1	2012-05-30			ENSG00000173088	ENSG00000173088			31667	protein-coding gene	gene with protein product							Standard	NM_001130446		Approved	bA690P14.3	uc010qoo.2	A6NCD4	OTTHUMG00000018824	ENST00000423344.2:c.74-1A>T	10.37:g.97684071A>T		Somatic	0	69	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	57	10.94	B1AMZ2|B4DG41	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D25V	ENST00000423344.2	37	c.74	CCDS58090.1	10	.	.	.	.	.	.	.	.	.	.	A	17.44	3.390239	0.62066	.	.	ENSG00000173088	ENST00000371202;ENST00000423344	.	.	.	3.29	-0.659	0.11424	.	0.849158	0.09837	N	0.749431	T	0.36276	0.0961	L	0.57536	1.79	0.18873	N	0.999988	P	0.51147	0.942	P	0.49085	0.6	T	0.21793	-1.0235	8	.	.	.	.	3.121	0.06391	0.5176:0.223:0.2593:0.0	.	25	B4DG41	.	V	21;25	.	.	D	+	2	0	C10orf131	97674061	0.952000	0.32445	0.188000	0.23233	0.877000	0.50540	0.219000	0.17641	-0.219000	0.10003	0.472000	0.43445	GAT	-	NULL		0.269	C10orf131-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf131	protein_coding	OTTHUMT00000468148.1	A	NM_001098847	-	Missense_Mutation	97684071	+1	no_errors	ENST00000423344	ensembl	human	known	74_37	missense	SNP	0.113	T
DLGAP1	9229	genome.wustl.edu	37	18	3879315	3879315	+	Missense_Mutation	SNP	G	G	A	rs572784569		TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr18:3879315G>A	ENST00000315677.3	-	4	1349	c.754C>T	c.(754-756)Cgg>Tgg	p.R252W	DLGAP1_ENST00000515196.2_Missense_Mutation_p.R252W|DLGAP1-AS3_ENST00000577649.1_RNA|DLGAP1_ENST00000584874.1_Missense_Mutation_p.R252W|DLGAP1_ENST00000581527.1_Missense_Mutation_p.R252W	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	252					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				TTGTTGCTCCGGGAGGCCTTC	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		16926	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000170579						61.0	60.0	60.0					18																	3879315		2203	4300	6503	DLGAP1	SO:0001583	missense	0			-	HGNC	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.754C>T	18.37:g.3879315G>A	ENSP00000316377:p.Arg252Trp	Somatic	0	49	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	30	18.92	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GKAP	p.R252W	ENST00000315677.3	37	c.754	CCDS11836.1	18	.	.	.	.	.	.	.	.	.	.	G	18.48	3.633677	0.67130	.	.	ENSG00000170579	ENST00000315677;ENST00000515196	T;T	0.30714	1.52;1.52	5.51	3.52	0.40303	.	0.000000	0.85682	D	0.000000	T	0.50973	0.1647	M	0.64997	1.995	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.987;0.999;0.982	T	0.55483	-0.8134	10	0.87932	D	0	-21.5295	12.9962	0.58648	0.0:0.0:0.5897:0.4102	.	252;252;252	B7Z9Y4;Q6IS01;O14490	.;.;DLGP1_HUMAN	W	252	ENSP00000316377:R252W;ENSP00000445973:R252W	ENSP00000316377:R252W	R	-	1	2	DLGAP1	3869315	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	1.903000	0.39858	1.314000	0.45095	0.655000	0.94253	CGG	-	NULL		0.657	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP1	protein_coding	OTTHUMT00000254394.4	G		-		3879315	-1	no_errors	ENST00000315677	ensembl	human	known	74_37	missense	SNP	1.000	A
PPP1R1A	5502	genome.wustl.edu	37	12	54975829	54975829	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr12:54975829C>T	ENST00000257905.8	-	5	504	c.334G>A	c.(334-336)Gag>Aag	p.E112K	PPP1R1A_ENST00000547431.1_Intron	NM_006741.3	NP_006732	Q13522	PPR1A_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 1A	112					glycogen metabolic process (GO:0005977)|negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein serine/threonine phosphatase inhibitor activity (GO:0004865)			lung(2)	2						GGGCGGGACTCCTGGGTTTCT	0.602																																																	0								ENSG00000135447						68.0	70.0	69.0					12																	54975829		1916	4113	6029	PPP1R1A	SO:0001583	missense	0			-	HGNC	U48707	CCDS44912.1	12q13.2	2012-04-17			ENSG00000135447	ENSG00000135447	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9286	protein-coding gene	gene with protein product		613246				8611507	Standard	NM_006741		Approved		uc001sgg.2	Q13522	OTTHUMG00000169934	ENST00000257905.8:c.334G>A	12.37:g.54975829C>T	ENSP00000257905:p.Glu112Lys	Somatic	0	40	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	251	39	86.55	Q6IB01|Q8TBJ2|Q8WWV2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PPI_1DARPP-32	p.E112K	ENST00000257905.8	37	c.334	CCDS44912.1	12	.	.	.	.	.	.	.	.	.	.	C	18.78	3.697115	0.68386	.	.	ENSG00000135447	ENST00000257905	T	0.32023	1.47	5.28	4.32	0.51571	.	0.320500	0.26948	N	0.021681	T	0.39091	0.1065	L	0.55481	1.735	0.30318	N	0.787903	P	0.48162	0.906	P	0.51777	0.679	T	0.35425	-0.9789	10	0.54805	T	0.06	.	11.3674	0.49679	0.0:0.817:0.183:0.0	.	112	Q13522	PPR1A_HUMAN	K	112	ENSP00000257905:E112K	ENSP00000257905:E112K	E	-	1	0	PPP1R1A	53262096	0.998000	0.40836	1.000000	0.80357	0.649000	0.38597	0.874000	0.28065	2.629000	0.89072	0.655000	0.94253	GAG	-	pfam_PPI_1DARPP-32		0.602	PPP1R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R1A	protein_coding	OTTHUMT00000406604.1	C	NM_006741	-		54975829	-1	no_errors	ENST00000257905	ensembl	human	known	74_37	missense	SNP	1.000	T
KCNH4	23415	genome.wustl.edu	37	17	40321679	40321679	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr17:40321679A>G	ENST00000264661.3	-	9	1738	c.1406T>C	c.(1405-1407)gTg>gCg	p.V469A	KCNH4_ENST00000607371.1_Missense_Mutation_p.V469A	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	469					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CCCGAACACCACAGCGTGCAT	0.647																																					NSCLC(117;707 1703 2300 21308 31858)												0								ENSG00000089558						69.0	56.0	61.0					17																	40321679		2203	4300	6503	KCNH4	SO:0001583	missense	0			-	HGNC	AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.1406T>C	17.37:g.40321679A>G	ENSP00000264661:p.Val469Ala	Somatic	0	66	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	53	17.19		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,pfam_PAS_fold,pfam_PAS_4,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.V469A	ENST00000264661.3	37	c.1406	CCDS11420.1	17	.	.	.	.	.	.	.	.	.	.	A	13.32	2.201400	0.38905	.	.	ENSG00000089558	ENST00000264661	D	0.98531	-4.98	4.36	4.36	0.52297	Ion transport (1);	0.000000	0.33253	N	0.005112	D	0.94994	0.8380	N	0.16903	0.455	0.54753	D	0.999981	B	0.18166	0.026	B	0.30943	0.122	D	0.92550	0.6049	10	0.25751	T	0.34	.	13.7185	0.62712	1.0:0.0:0.0:0.0	.	469	Q9UQ05	KCNH4_HUMAN	A	469	ENSP00000264661:V469A	ENSP00000264661:V469A	V	-	2	0	KCNH4	37575205	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	9.097000	0.94193	1.828000	0.53243	0.379000	0.24179	GTG	-	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_ELK		0.647	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	KCNH4	protein_coding	OTTHUMT00000449791.2	A	NM_012285	-		40321679	-1	no_errors	ENST00000264661	ensembl	human	known	74_37	missense	SNP	1.000	G
MT-ND5	4540	genome.wustl.edu	37	M	12508	12508	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chrM:12508G>A	ENST00000361567.2	+	1	172	c.172G>A	c.(172-174)Gac>Aac	p.D58N	MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TG_ENST00000387429.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	58					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TCATGTGCCTAGACCAAGAAG	0.398																																																	0								ENSG00000198786																																			MT-ND5	SO:0001583	missense	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.172G>A	M.37:g.12508G>A	ENSP00000354813:p.Asp58Asn	Somatic	0	54	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	21	58.82	Q34773|Q8WCY3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.D58N	ENST00000361567.2	37	c.172		MT																																																																																			-	tigrfam_NADHpl_OxRdtase_5		0.398	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	protein_coding		G	YP_003024036	-		12508	+1	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	SNP	NULL	A
EPHA5	2044	genome.wustl.edu	37	4	66356412	66356412	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr4:66356412C>T	ENST00000273854.3	-	5	1685	c.1085G>A	c.(1084-1086)cGg>cAg	p.R362Q	EPHA5_ENST00000511294.1_Missense_Mutation_p.R362Q|EPHA5_ENST00000432638.2_Intron|EPHA5_ENST00000354839.4_Missense_Mutation_p.R362Q	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	362	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						GATGGCATTCCGAGGAGCAGA	0.398										TSP Lung(17;0.13)																																							0								ENSG00000145242						45.0	44.0	44.0					4																	66356412		2203	4300	6503	EPHA5	SO:0001583	missense	0			-	HGNC	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1085G>A	4.37:g.66356412C>T	ENSP00000273854:p.Arg362Gln	Somatic	0	52	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	21	32.26	Q7Z3F2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R362Q	ENST00000273854.3	37	c.1085	CCDS3513.1	4	.	.	.	.	.	.	.	.	.	.	C	14.15	2.450707	0.43531	.	.	ENSG00000145242	ENST00000273854;ENST00000354839;ENST00000511294	T;T;T	0.57273	0.41;0.41;0.41	5.86	5.86	0.93980	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000052	T	0.68155	0.2970	L	0.53780	1.695	0.53688	D	0.999976	D;P;D;P	0.76494	0.999;0.659;0.998;0.568	D;B;D;B	0.67382	0.951;0.153;0.918;0.024	T	0.60352	-0.7280	10	0.26408	T	0.33	.	20.1859	0.98214	0.0:1.0:0.0:0.0	.	362;362;362;362	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	Q	362	ENSP00000273854:R362Q;ENSP00000346899:R362Q;ENSP00000427638:R362Q	ENSP00000273854:R362Q	R	-	2	0	EPHA5	66039007	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.058000	0.57463	2.777000	0.95525	0.591000	0.81541	CGG	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt_N_dom,smart_Fibronectin_type3,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3		0.398	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPHA5	protein_coding	OTTHUMT00000251388.2	C	NM_004439	-		66356412	-1	no_errors	ENST00000273854	ensembl	human	known	74_37	missense	SNP	1.000	T
FBXW10	10517	genome.wustl.edu	37	17	18668118	18668118	+	Silent	SNP	T	T	G			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr17:18668118T>G	ENST00000395665.4	+	8	1718	c.1497T>G	c.(1495-1497)acT>acG	p.T499T	FBXW10_ENST00000395667.1_Silent_p.T499T|FBXW10_ENST00000301938.4_Silent_p.T499T|FBXW10_ENST00000308799.4_Silent_p.T528T			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	499										NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						GGACTATCACTTGCATGGACT	0.468																																																	0								ENSG00000171931						58.0	59.0	58.0					17																	18668118		2201	4279	6480	FBXW10	SO:0001819	synonymous_variant	0			-	HGNC	BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.1497T>G	17.37:g.18668118T>G		Somatic	0	64	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	45	13.46	C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_F-box_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.T528	ENST00000395665.4	37	c.1584	CCDS11199.3	17																																																																																			-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.468	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	FBXW10	protein_coding	OTTHUMT00000313531.2	T	NM_031456	-		18668118	+1	no_errors	ENST00000308799	ensembl	human	known	74_37	silent	SNP	0.998	G
PRPF3	9129	genome.wustl.edu	37	1	150315720	150315726	+	Intron	DEL	AAAAAAT	AAAAAAT	-	rs374394798|rs587654594|rs200239014|rs56047090|rs149908445|rs58514816|rs56860451|rs66790680	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	AAAAAAT	AAAAAAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr1:150315720_150315726delAAAAAAT	ENST00000324862.6	+	10	1447				PRPF3_ENST00000414970.2_Intron|PRPF3_ENST00000543398.1_Intron|PRPF3_ENST00000467329.1_Intron	NM_004698.2	NP_004689.1	O43395	PRPF3_HUMAN	pre-mRNA processing factor 3						mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 x U5 tri-snRNP complex (GO:0046540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		agagaaaaaaaaaaaaTATATATATAT	0.406														4132	0.82508	0.8525	0.8977	5008	,	,		10254	0.625		0.9215	False		,,,				2504	0.8436				Ovarian(168;1070 2670 5178 20729)												0								ENSG00000117360																																			PRPF3	SO:0001627	intron_variant	0				HGNC	AF001947	CCDS951.1	1q21.1	2013-07-16	2013-06-10		ENSG00000117360	ENSG00000117360			17348	protein-coding gene	gene with protein product		607301	"""retinitis pigmentosa 18 (autosomal dominant)"", ""PRP3 pre-mRNA processing factor 3 homolog (yeast)"", ""PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)"""	RP18			Standard	NM_004698		Approved	Prp3, hPrp3, SNRNP90	uc001eum.4	O43395	OTTHUMG00000012807	ENST00000324862.6:c.1283-59AAAAAAT>-	1.37:g.150315720_150315726delAAAAAAT		Somatic	NA	NA	NA		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DSY9|O43446|Q5VT54	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000324862.6	37	NULL	CCDS951.1	1																																																																																			-	-		0.406	PRPF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF3	protein_coding	OTTHUMT00000035836.1	AAAAAAT	NM_004698			150315726	+1	no_errors	ENST00000493553	ensembl	human	known	74_37	rna	DEL	0.001:0.001:0.000:0.001:0.000:0.001:0.001	-
KRTAP5-5	439915	genome.wustl.edu	37	11	1651227	1651228	+	Frame_Shift_Ins	INS	-	-	GAGGC	rs71454096	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr11:1651227_1651228insGAGGC	ENST00000399676.2	+	1	195_196	c.157_158insGAGGC	c.(157-159)gcgfs	p.A53fs		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	53				A -> G (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ctccggctgtgcgggctgtggg	0.683																																																	0								ENSG00000185940																																			KRTAP5-5	SO:0001589	frameshift_variant	0				HGNC	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	Exception_encountered	11.37:g.1651227_1651228insGAGGC	ENSP00000382584:p.Ala53fs	Somatic	NA	NA	NA		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8MWN2	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.A53fs	ENST00000399676.2	37	c.157_158	CCDS41592.1	11																																																																																			-	NULL		0.683	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	protein_coding	OTTHUMT00000127919.1	-				1651228	+1	no_errors	ENST00000399676	ensembl	human	known	74_37	frame_shift_ins	INS	0.083:0.113	GAGGC
KIF26A	26153	genome.wustl.edu	37	14	104638087	104638087	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr14:104638087G>T	ENST00000423312.2	+	6	1141	c.1141G>T	c.(1141-1143)Gca>Tca	p.A381S	KIF26A_ENST00000315264.7_Missense_Mutation_p.A242S	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	381	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GATCTGGCCCGCACAGGGGGC	0.682																																																	0								ENSG00000066735						9.0	13.0	12.0					14																	104638087		1930	4120	6050	KIF26A	SO:0001583	missense	0			-	HGNC	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.1141G>T	14.37:g.104638087G>T	ENSP00000388241:p.Ala381Ser	Somatic	0	51	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	58	17.14	Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.A381S	ENST00000423312.2	37	c.1141	CCDS45171.1	14	.	.	.	.	.	.	.	.	.	.	G	5.199	0.222295	0.09863	.	.	ENSG00000066735	ENST00000423312;ENST00000315264	T;T	0.41758	0.99;0.99	3.77	-2.85	0.05734	Kinesin, motor domain (3);	.	.	.	.	T	0.13670	0.0331	N	0.02539	-0.55	0.20196	N	0.99993	B	0.10296	0.003	B	0.09377	0.004	T	0.35400	-0.9790	9	0.06099	T	0.92	.	8.9911	0.36024	0.0919:0.0:0.1858:0.7222	.	381	Q9ULI4	KI26A_HUMAN	S	381;242	ENSP00000388241:A381S;ENSP00000325452:A242S	ENSP00000325452:A242S	A	+	1	0	KIF26A	103707840	0.993000	0.37304	0.004000	0.12327	0.653000	0.38743	2.564000	0.45931	-0.338000	0.08413	0.462000	0.41574	GCA	-	superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom		0.682	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIF26A	protein_coding	OTTHUMT00000414356.1	G		-		104638087	+1	no_errors	ENST00000423312	ensembl	human	known	74_37	missense	SNP	0.327	T
SLC31A2	1318	genome.wustl.edu	37	9	115923901	115923901	+	Silent	SNP	C	C	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr9:115923901C>T	ENST00000259392.3	+	3	319	c.186C>T	c.(184-186)atC>atT	p.I62I		NM_001860.2	NP_001851.1	O15432	COPT2_HUMAN	solute carrier family 31 (copper transporter), member 2	62					cellular copper ion homeostasis (GO:0006878)|copper ion transport (GO:0006825)|regulation of copper ion transmembrane transport (GO:1902311)	integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|recycling endosome (GO:0055037)	copper ion transmembrane transporter activity (GO:0005375)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	7					Carboplatin(DB00958)|Cisplatin(DB00515)	CAACCTCCATCAGCCAGCAGA	0.557																																																	0								ENSG00000136867						117.0	120.0	119.0					9																	115923901		2129	4239	6368	SLC31A2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS6788.1	9q32	2013-07-17	2013-07-17		ENSG00000136867	ENSG00000136867		"""Solute carriers"""	11017	protein-coding gene	gene with protein product	"""copper transporter 2"""	603088		COPT2		9207117	Standard	NM_001860		Approved	hCTR2, CTR2	uc004bgq.3	O15432	OTTHUMG00000021037	ENST00000259392.3:c.186C>T	9.37:g.115923901C>T		Somatic	0	33	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	643	33	94.98		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cop_transporter	p.I62	ENST00000259392.3	37	c.186	CCDS6788.1	9																																																																																			-	pfam_Cop_transporter		0.557	SLC31A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC31A2	protein_coding	OTTHUMT00000055509.2	C	NM_001860	-		115923901	+1	no_errors	ENST00000259392	ensembl	human	known	74_37	silent	SNP	0.030	T
KRTAP5-5	439915	genome.wustl.edu	37	11	1651229	1651230	+	Frame_Shift_Ins	INS	-	-	TGGCTCC	rs553119014	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr11:1651229_1651230insTGGCTCC	ENST00000399676.2	+	1	197_198	c.159_160insTGGCTCC	c.(160-162)ggcfs	p.G54fs		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	54						keratin filament (GO:0045095)		p.A53A(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccggctgtgcgggctgtggggg	0.683																																																	1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000185940																																			KRTAP5-5	SO:0001589	frameshift_variant	0				HGNC	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	Exception_encountered	11.37:g.1651229_1651230insTGGCTCC	ENSP00000382584:p.Gly54fs	Somatic	NA	NA	NA		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8MWN2	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.G53fs	ENST00000399676.2	37	c.159_160	CCDS41592.1	11																																																																																			-	NULL		0.683	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	protein_coding	OTTHUMT00000127919.1	-				1651230	+1	no_errors	ENST00000399676	ensembl	human	known	74_37	frame_shift_ins	INS	0.325:0.996	TGGCTCC
CLEC5A	23601	genome.wustl.edu	37	7	141631634	141631635	+	Intron	INS	-	-	A	rs201568466|rs369908648|rs201042036	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr7:141631634_141631635insA	ENST00000546910.1	-	6	542				CLEC5A_ENST00000438351.1_Intron|CLEC5A_ENST00000439991.1_Intron|MGAM_ENST00000497554.1_3'UTR|CLEC5A_ENST00000470595.1_Intron|CLEC5A_ENST00000551012.2_Intron	NM_013252.2	NP_037384.1	Q9NY25	CLC5A_HUMAN	C-type lectin domain family 5, member A						cellular defense response (GO:0006968)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myeloid cell apoptotic process (GO:0033033)|osteoblast development (GO:0002076)|positive regulation of cytokine secretion (GO:0050715)|response to virus (GO:0009615)|signal transduction (GO:0007165)|viral process (GO:0016032)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|virus receptor activity (GO:0001618)			endometrium(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	10	Melanoma(164;0.0171)					CTTCTGGAAATAAAAAAAAAAT	0.381													|||unknown(HR)	376	0.0750799	0.0257	0.0735	5008	,	,		18534	0.0685		0.0288	False		,,,				2504	0.1973				GBM(154;1592 2613 3360 42983)												0								ENSG00000257335																																			MGAM	SO:0001627	intron_variant	0				HGNC		CCDS5870.1, CCDS75670.1	7q34	2012-10-03	2005-02-09	2005-02-09	ENSG00000258227	ENSG00000258227		"""C-type lectin domain containing"""	2054	protein-coding gene	gene with protein product		604987	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 5"""	CLECSF5		10449773	Standard	NM_013252		Approved	MDL-1	uc003vwv.1	Q9NY25	OTTHUMG00000157173	ENST00000546910.1:c.346-8->T	7.37:g.141631644_141631644dupA		Somatic	0	9	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	6	45.45	Q52M11|Q9UKQ0	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000546910.1	37	NULL	CCDS5870.1	7																																																																																			-	-		0.381	CLEC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAM	protein_coding	OTTHUMT00000347756.1	-	NM_013252			141631635	+1	no_errors	ENST00000497554	ensembl	human	known	74_37	rna	INS	0.014:0.007	A
LOC101927209	101927209	genome.wustl.edu	37	1	142634555	142634555	+	lincRNA	SNP	A	A	G	rs4362000	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr1:142634555A>G	ENST00000610091.1	-	0	5979				RP11-417J8.3_ENST00000426408.1_lincRNA																							agaagcttagagatgcaggaa	0.597																																																	0								ENSG00000203849																																			RP11-417J8.6			0			-	Clone_based_vega_gene																													1.37:g.142634555A>G		Somatic	0	8	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	5	44.44		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			-	-		0.597	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	lincRNA	OTTHUMT00000037265.2	A		rs4362000		142634555	-1	no_errors	ENST00000369381	ensembl	human	known	74_37	rna	SNP	0.054	G
ZNF229	7772	genome.wustl.edu	37	19	44934383	44934383	+	Silent	SNP	C	C	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr19:44934383C>T	ENST00000588931.1	-	6	1006	c.573G>A	c.(571-573)gcG>gcA	p.A191A	ZNF229_ENST00000291187.4_Silent_p.A185A|CTC-512J12.4_ENST00000588655.1_RNA|ZNF229_ENST00000591289.1_Intron	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	191					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				GGTTCACAAACGCTTTTGCCC	0.428																																																	0								ENSG00000167383						100.0	95.0	97.0					19																	44934383		1857	4096	5953	ZNF229	SO:0001819	synonymous_variant	0			-	HGNC	AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.573G>A	19.37:g.44934383C>T		Somatic	0	46	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	46	11.54	B2RWN3|Q59FV2|Q86WL9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A191	ENST00000588931.1	37	c.573	CCDS42574.1	19																																																																																			-	NULL		0.428	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF229	protein_coding	OTTHUMT00000460833.1	C	NM_014518	-		44934383	-1	no_errors	ENST00000588931	ensembl	human	known	74_37	silent	SNP	0.000	T
SLC6A13	6540	genome.wustl.edu	37	12	352956	352956	+	Missense_Mutation	SNP	C	C	T	rs147275386	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr12:352956C>T	ENST00000343164.4	-	3	278	c.226G>A	c.(226-228)Gtc>Atc	p.V76I	SLC6A13_ENST00000445055.2_Intron	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	76					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			AAGAGGAAGACGAGGTAGGGG	0.527													C|||	2	0.000399361	0.0	0.0	5008	,	,		22796	0.0		0.001	False		,,,				2504	0.001																0								ENSG00000010379	C	,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	96.0	88.0	91.0		,226	5.0	1.0	12	dbSNP_134	91	0,8600		0,0,4300	no	intron,missense	SLC6A13	NM_001190997.2,NM_016615.4	,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,benign	,76/603	352956	1,13005	2203	4300	6503	SLC6A13	SO:0001583	missense	0			GMAF=0.0005	HGNC	U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.226G>A	12.37:g.352956C>T	ENSP00000339260:p.Val76Ile	Somatic	0	87	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	53	8.62	B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_GABA_GAT2	p.V76I	ENST00000343164.4	37	c.226	CCDS8502.1	12	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	5.365	0.252624	0.10185	2.27E-4	0.0	ENSG00000010379	ENST00000313154;ENST00000343164	T	0.72282	-0.64	6.17	4.97	0.65823	.	0.088257	0.85682	N	0.000000	T	0.31857	0.0810	N	0.00382	-1.575	0.80722	D	1	B;B	0.09022	0.002;0.001	B;B	0.12837	0.008;0.005	T	0.46076	-0.9217	10	0.02654	T	1	.	12.2354	0.54512	0.0:0.0665:0.0:0.9335	.	55;76	B4DJS3;Q9NSD5	.;S6A13_HUMAN	I	55;76	ENSP00000339260:V76I	ENSP00000318097:V55I	V	-	1	0	SLC6A13	223217	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.886000	0.63149	1.146000	0.42352	-0.290000	0.09829	GTC	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport		0.527	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A13	protein_coding	OTTHUMT00000397801.1	C	NM_016615	rs147275386		352956	-1	no_errors	ENST00000343164	ensembl	human	known	74_37	missense	SNP	1.000	T
KCNJ6	3763	genome.wustl.edu	37	21	39086687	39086687	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr21:39086687G>A	ENST00000609713.1	-	3	1362	c.773C>T	c.(772-774)aCg>aTg	p.T258M	KCNJ6_ENST00000288309.6_Missense_Mutation_p.T258M|KCNJ6-IT1_ENST00000435001.1_RNA	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	258					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	GTTGATATCCGTCTGGTTCAA	0.502																																					Pancreas(48;379 1118 2936 19024 28214)												0								ENSG00000157542						115.0	117.0	117.0					21																	39086687		1913	4142	6055	KCNJ6	SO:0001583	missense	0			-	HGNC	U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.773C>T	21.37:g.39086687G>A	ENSP00000477437:p.Thr258Met	Somatic	0	71	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	55	11.29	Q3MJ74|Q53WW6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir3.2	p.T258M	ENST00000609713.1	37	c.773	CCDS42927.1	21	.	.	.	.	.	.	.	.	.	.	G	16.65	3.182122	0.57800	.	.	ENSG00000157542	ENST00000400482;ENST00000288309	D;D	0.91577	-2.87;-2.87	6.17	6.17	0.99709	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.95620	0.8576	M	0.79475	2.455	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.94231	0.7476	10	0.46703	T	0.11	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	258	P48051	IRK6_HUMAN	M	258	ENSP00000383330:T258M;ENSP00000288309:T258M	ENSP00000288309:T258M	T	-	2	0	KCNJ6	38008557	1.000000	0.71417	0.973000	0.42090	0.708000	0.40852	8.062000	0.89475	2.941000	0.99782	0.655000	0.94253	ACG	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir		0.502	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ6	protein_coding	OTTHUMT00000194828.2	G	NM_002240	-		39086687	-1	no_errors	ENST00000288309	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF577	84765	genome.wustl.edu	37	19	52384073	52384086	+	5'UTR	DEL	CCAGCCTGGAAGCT	CCAGCCTGGAAGCT	-	rs118177814|rs139238370|rs386810407|rs386810408|rs117384033|rs577315019|rs113357083|rs558902883	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	CCAGCCTGGAAGCT	CCAGCCTGGAAGCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr19:52384073_52384086delCCAGCCTGGAAGCT	ENST00000301399.5	-	0	192_205				ZNF577_ENST00000412216.1_5'UTR|ZNF577_ENST00000485702.1_Intron|ZNF577_ENST00000420592.1_5'UTR|ZNF577_ENST00000451628.2_5'UTR	NM_032679.2	NP_116068.2	Q9BSK1	ZN577_HUMAN	zinc finger protein 577						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		ATGATCTTCCCCAGCCTGGAAGCTCCTTCTTCCA	0.449																																																	0								ENSG00000161551																																			ZNF577	SO:0001623	5_prime_UTR_variant	0				HGNC	AL832871	CCDS12842.2, CCDS46160.1	19q13.41	2013-09-20			ENSG00000161551	ENSG00000161551		"""Zinc fingers, C2H2-type"", ""-"""	28673	protein-coding gene	gene with protein product						12477932	Standard	NM_032679		Approved	MGC4400	uc010yde.2	Q9BSK1	OTTHUMG00000157045	ENST00000301399.5:c.-174AGCTTCCAGGCTGG>-	19.37:g.52384073_52384086delCCAGCCTGGAAGCT		Somatic	NA	NA	NA		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K0B4|A8K6Z7|C9JFB9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000301399.5	37	NULL	CCDS12842.2	19																																																																																			-	-		0.449	ZNF577-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF577	protein_coding	OTTHUMT00000347243.1	CCAGCCTGGAAGCT	NM_032679			52384086	-1	no_errors	ENST00000484095	ensembl	human	known	74_37	rna	DEL	0.001:0.003:0.009:0.021:0.024:0.015:0.009:0.010:0.008:0.001:0.000:0.000:0.001:0.002	-
ALDH3A2	224	genome.wustl.edu	37	17	19552792	19552796	+	Intron	DEL	TTTCT	TTTCT	-	rs142180209|rs373603777	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	TTTCT	TTTCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr17:19552792_19552796delTTTCT	ENST00000176643.6	+	1	599				ALDH3A2_ENST00000395575.2_Intron|Y_RNA_ENST00000578640.1_RNA|ALDH3A2_ENST00000339618.4_Intron|ALDH3A2_ENST00000581518.1_Intron|ALDH3A2_ENST00000579855.1_Intron			P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3 family, member A2						cellular aldehyde metabolic process (GO:0006081)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|oxidation-reduction process (GO:0055114)|peripheral nervous system development (GO:0007422)|phytol metabolic process (GO:0033306)|sesquiterpenoid metabolic process (GO:0006714)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|peroxisome (GO:0005777)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|long-chain-alcohol oxidase activity (GO:0046577)|long-chain-aldehyde dehydrogenase activity (GO:0050061)|medium-chain-aldehyde dehydrogenase activity (GO:0052814)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(2)|prostate(1)	13	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)					tTTGGGTTTCTTTCTTTTCTTTTTT	0.317														1774	0.354233	0.5681	0.3429	5008	,	,		19281	0.0685		0.4414	False		,,,				2504	0.2781																0								ENSG00000264932																																			Y_RNA	SO:0001627	intron_variant	0				RFAM	L47162	CCDS11210.1, CCDS32589.1	17p11.2	2010-05-07			ENSG00000072210	ENSG00000072210	1.2.1.3	"""Aldehyde dehydrogenases"""	403	protein-coding gene	gene with protein product	"""fatty aldehyde dehydrogenase"""	609523		SLS, ALDH10		7894487	Standard	NM_000382		Approved	FALDH	uc002gwa.1	P51648	OTTHUMG00000059471	ENST00000176643.6:c.153+355TTTCT>-	17.37:g.19552797_19552801delTTTCT		Somatic	NA	NA	NA		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6I9T3|Q93011|Q96J37	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000176643.6	37	NULL	CCDS11210.1	17																																																																																			-	-		0.317	ALDH3A2-001	KNOWN	basic|CCDS	protein_coding	ENSG00000264932	protein_coding	OTTHUMT00000132268.1	TTTCT				19552796	-1	no_errors	ENST00000578640	ensembl	human	known	74_37	rna	DEL	0.004:0.003:0.002:0.001:0.002	-
LINC01410	103352539	genome.wustl.edu	37	9	66466327	66466327	+	lincRNA	DEL	G	G	-	rs58593495	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr9:66466327delG	ENST00000424345.1	+	0	960																											agcaggtccaggaatgcactt	0.483													|||unknown(NO_COVERAGE)	2677	0.534545	0.5023	0.5447	5008	,	,		41720	0.5357		0.5447	False		,,,				2504	0.5593																0								ENSG00000238113																																			RP11-262H14.1			0				Clone_based_vega_gene																													9.37:g.66466327delG		Somatic	0	9	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000424345.1	37	NULL		9																																																																																			-	-		0.483	RP11-262H14.1-001	KNOWN	basic	lincRNA	LOC100996870	lincRNA	OTTHUMT00000128851.1	G				66466327	+1	no_errors	ENST00000424345	ensembl	human	known	74_37	rna	DEL	0.090	-
ADAMTS18	170692	genome.wustl.edu	37	16	77359769	77359769	+	Missense_Mutation	SNP	C	C	A	rs200959747		TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr16:77359769C>A	ENST00000282849.5	-	13	2444	c.2026G>T	c.(2026-2028)Gtg>Ttg	p.V676L		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	676	Cys-rich.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						TTACCTTCCACTTTTGTATAG	0.373													C|||	1	0.000199681	0.0	0.0	5008	,	,		18677	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000140873						96.0	86.0	89.0					16																	77359769		2198	4300	6498	ADAMTS18	SO:0001583	missense	0			GMAF=0.0005	HGNC	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2026G>T	16.37:g.77359769C>A	ENSP00000282849:p.Val676Leu	Somatic	0	51	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.V676L	ENST00000282849.5	37	c.2026	CCDS10926.1	16	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	17.08	3.296668	0.60086	.	.	ENSG00000140873	ENST00000282849	T	0.59364	0.27	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.64000	0.2559	M	0.74647	2.275	0.58432	D	0.999999	B;P	0.41475	0.315;0.751	B;B	0.42738	0.233;0.396	T	0.60429	-0.7265	10	0.24483	T	0.36	.	19.4659	0.94939	0.0:1.0:0.0:0.0	.	676;676	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	L	676	ENSP00000282849:V676L	ENSP00000282849:V676L	V	-	1	0	ADAMTS18	75917270	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	7.818000	0.86416	2.840000	0.97914	0.655000	0.94253	GTG	-	NULL		0.373	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS18	protein_coding	OTTHUMT00000269037.1	C		rs200959747		77359769	-1	no_errors	ENST00000282849	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC9C2	284525	genome.wustl.edu	37	1	173486699	173486699	+	Missense_Mutation	SNP	C	C	T	rs147401558		TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr1:173486699C>T	ENST00000367714.3	-	23	3306	c.2884G>A	c.(2884-2886)Gtc>Atc	p.V962I	SLC9C2_ENST00000466087.1_5'UTR	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	962					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										TCACAGATGACGGTATATTCA	0.363													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19328	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000162753						106.0	109.0	108.0					1																	173486699		2203	4300	6503	SLC9C2	SO:0001583	missense	0			GMAF=0.0005	HGNC	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.2884G>A	1.37:g.173486699C>T	ENSP00000356687:p.Val962Ile	Somatic	0	47	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	38	24.00	Q86UF3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cation/H_exchanger,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.V962I	ENST00000367714.3	37	c.2884	CCDS1308.1	1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	9.461	1.093038	0.20471	.	.	ENSG00000162753	ENST00000367714	D	0.93426	-3.22	5.0	4.09	0.47781	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.401961	0.20797	N	0.085505	T	0.76485	0.3994	N	0.14661	0.345	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.70799	-0.4774	10	0.22706	T	0.39	-10.2394	9.9671	0.41732	0.0:0.9048:0.0:0.0952	.	962	Q5TAH2	S9A11_HUMAN	I	962	ENSP00000356687:V962I	ENSP00000356687:V962I	V	-	1	0	SLC9A11	171753322	0.965000	0.33210	0.769000	0.31535	0.025000	0.11179	2.568000	0.45965	1.237000	0.43756	-0.133000	0.14855	GTC	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom		0.363	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9C2	protein_coding	OTTHUMT00000084205.1	C	NM_178527	rs147401558		173486699	-1	no_errors	ENST00000367714	ensembl	human	known	74_37	missense	SNP	0.905	T
TP53	7157	genome.wustl.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	GRCh37	CM951226	TP53	M		ENSG00000141510						132.0	118.0	123.0					17																	7578212		2203	4300	6503	TP53	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	17.37:g.7578212G>A	ENSP00000269305:p.Arg213*	Somatic	0	63	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	42	22.22	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R213*	ENST00000269305.4	37	c.637	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	TP53	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546	-		7578212	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	SNP	0.893	A
GPRIN1	114787	genome.wustl.edu	37	5	176026136	176026146	+	Frame_Shift_Del	DEL	CCTCCTTCCTC	CCTCCTTCCTC	-	rs79403503|rs386695335|rs550332435|rs77245696|rs142779818|rs371149640|rs201635586	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	CCTCCTTCCTC	CCTCCTTCCTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr5:176026136_176026146delCCTCCTTCCTC	ENST00000303991.4	-	2	867_877	c.690_700delGAGGAAGGAGG	c.(688-702)ccgaggaaggaggatfs	p.RKED231fs		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	231				Missing (in Ref. 4; CAD38868). {ECO:0000305}.	neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GACCCAGGATCCTCCTTCCTCGGTGACACTG	0.498																																																	0								ENSG00000169258			563,3699		9,545,1577						-2.4	0.0		dbSNP_134	89	851,7393		18,815,3289	no	frameshift	GPRIN1	NM_052899.2		27,1360,4866	A1A1,A1R,RR		10.3227,13.2098,11.3066				1414,11092				GPRIN1	SO:0001589	frameshift_variant	0				HGNC	AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.690_700delGAGGAAGGAGG	5.37:g.176026136_176026146delCCTCCTTCCTC	ENSP00000305839:p.Arg231fs	Somatic	NA	NA	NA		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9JM70|Q8ND74|Q96PZ4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.R231fs	ENST00000303991.4	37	c.700_690	CCDS4405.1	5																																																																																			-	NULL		0.498	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN1	protein_coding	OTTHUMT00000253149.1	CCTCCTTCCTC	NM_052899			176026146	-1	no_errors	ENST00000303991	ensembl	human	known	74_37	frame_shift_del	DEL	0.001:0.001:0.018:0.050:0.065:0.536:0.053:0.031:0.027:0.000:0.000	-
SAMD15	161394	genome.wustl.edu	37	14	77843764	77843764	+	Start_Codon_SNP	SNP	G	G	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr14:77843764G>T	ENST00000216471.4	+	1	289	c.3G>T	c.(1-3)atG>atT	p.M1I	SAMD15_ENST00000533095.2_Intron|TMED8_ENST00000216468.7_5'Flank	NM_001010860.1	NP_001010860.1	Q9P1V8	SAM15_HUMAN	sterile alpha motif domain containing 15	1										breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						AGCTGCAAATGGCTGAAGTCC	0.522																																																	0								ENSG00000100583						65.0	77.0	73.0					14																	77843764		2203	4300	6503	SAMD15	SO:0001582	initiator_codon_variant	0			-	HGNC	AK093282	CCDS32126.1	14q24.3	2013-01-10	2010-10-20	2010-10-20	ENSG00000100583	ENSG00000100583		"""Sterile alpha motif (SAM) domain containing"""	18631	protein-coding gene	gene with protein product			"""family with sequence similarity 15, member A"", ""chromosome 14 open reading frame 174"""	FAM15A, C14orf174			Standard	XM_006720069		Approved	FLJ35963	uc001xtq.1	Q9P1V8		ENST00000216471.4:c.3G>T	14.37:g.77843764G>T	ENSP00000216471:p.Met1Ile	Somatic	0	31	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q2M3P3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.M1I	ENST00000216471.4	37	c.3	CCDS32126.1	14	.	.	.	.	.	.	.	.	.	.	G	33	5.260376	0.95368	.	.	ENSG00000100583	ENST00000216471	T	0.26373	1.74	5.7	4.8	0.61643	.	0.000000	0.39615	N	0.001303	T	0.19886	0.0478	.	.	.	0.80722	D	1	P	0.42692	0.787	B	0.36186	0.219	T	0.01834	-1.1264	9	0.66056	D	0.02	-3.9053	9.6049	0.39628	0.0932:0.0:0.9068:0.0	.	1	Q9P1V8	SAM15_HUMAN	I	1	ENSP00000216471:M1I	ENSP00000216471:M1I	M	+	3	0	SAMD15	76913517	1.000000	0.71417	0.935000	0.37517	0.620000	0.37586	2.304000	0.43655	2.667000	0.90743	0.655000	0.94253	ATG	-	NULL		0.522	SAMD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD15	protein_coding	OTTHUMT00000394587.2	G	NM_001010860	-	Missense_Mutation	77843764	+1	no_errors	ENST00000216471	ensembl	human	known	74_37	missense	SNP	0.916	T
GIMAP8	155038	genome.wustl.edu	37	7	150174547	150174547	+	Silent	SNP	C	C	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr7:150174547C>T	ENST00000307271.3	+	5	2251	c.1677C>T	c.(1675-1677)taC>taT	p.Y559Y		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	559	AIG1-type G 3.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		TTACGAAATACGCGATTATGC	0.473																																																	0								ENSG00000171115						90.0	91.0	91.0					7																	150174547		2203	4300	6503	GIMAP8	SO:0001819	synonymous_variant	0			-	HGNC	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.1677C>T	7.37:g.150174547C>T		Somatic	0	32	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	19	20.83		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_AIG1,superfamily_P-loop_NTPase	p.Y559	ENST00000307271.3	37	c.1677	CCDS34777.1	7																																																																																			-	pfam_AIG1,superfamily_P-loop_NTPase		0.473	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP8	protein_coding	OTTHUMT00000350701.1	C	NM_175571	-		150174547	+1	no_errors	ENST00000307271	ensembl	human	known	74_37	silent	SNP	0.009	T
SMU1	55234	genome.wustl.edu	37	9	33056193	33056193	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr9:33056193C>A	ENST00000397149.3	-	9	1090	c.1040G>T	c.(1039-1041)gGc>gTc	p.G347V	SMU1_ENST00000536631.1_Missense_Mutation_p.G186V	NM_018225.2	NP_060695.2	Q2TAY7	SMU1_HUMAN	smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)	347						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|lung(4)|ovary(2)|prostate(1)	9			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.11)		GGAGGAATGGCCACGAAATTC	0.333																																																	0								ENSG00000122692						86.0	76.0	80.0					9																	33056193		2203	4300	6503	SMU1	SO:0001583	missense	0			-	HGNC	AK001667	CCDS6534.1	9p12	2013-01-10			ENSG00000122692	ENSG00000122692		"""WD repeat domain containing"""	18247	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 57"""					11438655, 11410362	Standard	NM_018225		Approved	SMU-1, FLJ10805, BWD, fSAP57	uc003zsf.1	Q2TAY7	OTTHUMG00000019757	ENST00000397149.3:c.1040G>T	9.37:g.33056193C>A	ENSP00000380336:p.Gly347Val	Somatic	0	27	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B4E3L0|Q9BU59|Q9HA96|Q9NVD1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,pfam_Nucleoporin_Nup160,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_CTLH_C,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_CTLH_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.G347V	ENST00000397149.3	37	c.1040	CCDS6534.1	9	.	.	.	.	.	.	.	.	.	.	C	27.3	4.820029	0.90873	.	.	ENSG00000122692	ENST00000397149;ENST00000536631	T;T	0.70516	-0.49;-0.49	5.46	5.46	0.80206	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.84556	0.5498	M	0.78456	2.415	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.991;0.997	D	0.86025	0.1509	10	0.87932	D	0	-7.7834	17.1519	0.86780	0.0:1.0:0.0:0.0	.	347;186;347	A0MNN4;B4E3L0;Q2TAY7	.;.;SMU1_HUMAN	V	347;186	ENSP00000380336:G347V;ENSP00000443639:G186V	ENSP00000380336:G347V	G	-	2	0	SMU1	33046193	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.494000	0.81503	2.727000	0.93392	0.655000	0.94253	GGC	-	pfam_WD40_repeat,pfam_Nucleoporin_Nup160,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.333	SMU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMU1	protein_coding	OTTHUMT00000052022.1	C	NM_018225	-		33056193	-1	no_errors	ENST00000397149	ensembl	human	known	74_37	missense	SNP	1.000	A
MUC17	140453	genome.wustl.edu	37	7	100682909	100682909	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr7:100682909G>T	ENST00000306151.4	+	3	8276	c.8212G>T	c.(8212-8214)Ggt>Tgt	p.G2738C		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2738	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AACTGCTGAAGGTACCAGCAT	0.507																																																	0								ENSG00000169876						259.0	257.0	258.0					7																	100682909		2203	4300	6503	MUC17	SO:0001583	missense	0			-	HGNC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.8212G>T	7.37:g.100682909G>T	ENSP00000302716:p.Gly2738Cys	Somatic	0	196	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	148	11.38	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.G2738C	ENST00000306151.4	37	c.8212	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	G	4.985	0.182942	0.09495	.	.	ENSG00000169876	ENST00000306151	T	0.02236	4.38	0.861	-1.51	0.08664	.	.	.	.	.	T	0.04679	0.0127	L	0.29908	0.895	0.09310	N	1	D	0.89917	1.0	D	0.72982	0.979	T	0.38499	-0.9658	9	0.56958	D	0.05	.	5.3744	0.16156	0.3982:0.0:0.6018:0.0	.	2738	Q685J3	MUC17_HUMAN	C	2738	ENSP00000302716:G2738C	ENSP00000302716:G2738C	G	+	1	0	MUC17	100469629	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	0.077000	0.14738	-0.600000	0.05790	0.134000	0.15878	GGT	-	NULL		0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	protein_coding	OTTHUMT00000347161.1	G	NM_001040105	-		100682909	+1	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	SNP	0.000	T
RARA	5914	genome.wustl.edu	37	17	38499264	38499264	+	Intron	SNP	A	A	G			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr17:38499264A>G	ENST00000254066.5	+	3	633				RARA_ENST00000394086.3_Intron|RARA_ENST00000425707.3_Intron|RARA_ENST00000394081.3_Intron|CTD-2267D19.2_ENST00000581080.1_RNA|RARA_ENST00000394089.2_Intron	NM_000964.3	NP_000955.1	P10276	RARA_HUMAN	retinoic acid receptor, alpha						apoptotic cell clearance (GO:0043277)|cellular response to estrogen stimulus (GO:0071391)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|chondroblast differentiation (GO:0060591)|embryonic camera-type eye development (GO:0031076)|face development (GO:0060324)|female pregnancy (GO:0007565)|gene expression (GO:0010467)|germ cell development (GO:0007281)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|intracellular estrogen receptor signaling pathway (GO:0030520)|limb development (GO:0060173)|liver development (GO:0001889)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translational initiation (GO:0045947)|negative regulation of tumor necrosis factor production (GO:0032720)|neural tube closure (GO:0001843)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of binding (GO:0051099)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein phosphorylation (GO:0006468)|regulation of myelination (GO:0031641)|regulation of synaptic plasticity (GO:0048167)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|retinoic acid receptor signaling pathway (GO:0048384)|Sertoli cell fate commitment (GO:0060010)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chromatin DNA binding (GO:0031490)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|mRNA 5'-UTR binding (GO:0048027)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein kinase A binding (GO:0051018)|protein kinase B binding (GO:0043422)|receptor binding (GO:0005102)|retinoic acid binding (GO:0001972)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|translation repressor activity, nucleic acid binding (GO:0000900)|zinc ion binding (GO:0008270)			breast(1)|kidney(4)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|urinary_tract(2)	16		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	TTGCTGGACAATTGAACCCTC	0.542			T	"""PML, ZNF145, TIF1, NUMA1, NPM1"""	APL																																			Dom	yes		17	17q12	5914	"""retinoic acid receptor, alpha"""		L	0								ENSG00000265666						75.0	70.0	72.0					17																	38499264		692	1591	2283	CTD-2267D19.2	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	X06538	CCDS11366.1, CCDS42317.1, CCDS45671.1	17q21.1	2014-01-20			ENSG00000131759	ENSG00000131759		"""Nuclear hormone receptors"""	9864	protein-coding gene	gene with protein product		180240				2825036, 8244378	Standard	NM_001145301		Approved	RAR, NR1B1	uc002huk.2	P10276	OTTHUMG00000133328	ENST00000254066.5:c.179-5304A>G	17.37:g.38499264A>G		Somatic	0	47	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	44	24.14	B8Y636|P78456|Q13440|Q13441|Q96S41|Q9NQS0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000254066.5	37	NULL	CCDS11366.1	17																																																																																			-	-		0.542	RARA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101929693	protein_coding	OTTHUMT00000257136.2	A		-		38499264	-1	no_errors	ENST00000581080	ensembl	human	known	74_37	rna	SNP	0.000	G
UBE2V1	7335	genome.wustl.edu	37	20	48697884	48697884	+	3'UTR	SNP	A	A	T	rs74435910|rs201099481	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr20:48697884A>T	ENST00000371674.3	-	0	1909				UBE2V1_ENST00000371677.3_3'UTR|UBE2V1_ENST00000420027.2_3'UTR|UBE2V1_ENST00000415862.2_3'UTR|TMEM189-UBE2V1_ENST00000341698.2_3'UTR|UBE2V1_ENST00000340309.3_3'UTR|UBE2V1_ENST00000396059.3_5'UTR|UBE2V1_ENST00000371657.5_3'UTR|TMEM189_ENST00000557021.1_3'UTR	NM_001032288.2|NM_001257395.1	NP_001027459.1|NP_001244324.1	Q13404	UB2V1_HUMAN	ubiquitin-conjugating enzyme E2 variant 1						cell differentiation (GO:0030154)|error-free postreplication DNA repair (GO:0042275)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription, DNA-templated (GO:0045893)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|regulation of DNA repair (GO:0006282)|regulation of transcription, DNA-templated (GO:0006355)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)|UBC13-UEV1A complex (GO:0035370)|ubiquitin conjugating enzyme complex (GO:0031371)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|large_intestine(3)|lung(4)	9			BRCA - Breast invasive adenocarcinoma(9;4.74e-06)			ATACtaaattaaaaaaaaaaa	0.338													A|||	19	0.00379393	0.0038	0.0043	5008	,	,		16196	0.006		0.0	False		,,,				2504	0.0051																0								ENSG00000244687																																			UBE2V1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U39360	CCDS13426.1, CCDS13427.1, CCDS33483.1, CCDS58775.1, CCDS74740.1	20q13.2	2007-07-18			ENSG00000244687	ENSG00000244687		"""Ubiquitin-conjugating enzymes E2"""	12494	protein-coding gene	gene with protein product		602995		UBE2V		9418904, 9305758	Standard	NM_001032288		Approved	UEV-1, CROC-1, UEV1A, CROC1		Q13404	OTTHUMG00000152626	ENST00000371674.3:c.*1421T>A	20.37:g.48697884A>T		Somatic	0	44	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	57	11.76	E1P629|Q13403|Q13532|Q5TGE0|Q5TGE3|Q96H34|Q9GZT0|Q9GZW1|Q9H4J3|Q9H4J4|Q9UKL1|Q9UM48|Q9UM49|Q9UM50	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371674.3	37	NULL	CCDS33483.1	20																																																																																			-	-		0.338	UBE2V1-004	KNOWN	basic|CCDS	protein_coding	UBE2V1	protein_coding	OTTHUMT00000080530.1	A	NM_021988	rs201099481		48697884	-1	no_errors	ENST00000396059	ensembl	human	known	74_37	rna	SNP	0.185	T
SNORD3D	780854	genome.wustl.edu	37	17	19015643	19015643	+	lincRNA	SNP	C	C	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr17:19015643C>T	ENST00000362793.1	-	0	432									small nucleolar RNA, C/D box 3D																		GAAAACCTTTCTCGCGACATT	0.547																																																	0								ENSG00000262202																																			SNORD3D			0			-	HGNC			17p11.2	2013-09-05			ENSG00000199663				33192	non-coding RNA	RNA, small nucleolar						9365252	Standard	NR_006882		Approved	U3-4					17.37:g.19015643C>T		Somatic	0	39	0.00		0.5307429492823167	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000362793.1	37	NULL		17																																																																																			-	-		0.547	SNORD3D-201	KNOWN	basic	snoRNA	SNORD3D	lincRNA		C	NR_006882	-		19015643	-1	no_errors	ENST00000573866	ensembl	human	known	74_37	rna	SNP	0.003	T
