#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SRGAP1	57522	genome.wustl.edu	37	12	64377909	64377909	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr12:64377909C>T	ENST00000355086.3	+	2	774	c.250C>T	c.(250-252)Cat>Tat	p.H84Y	SRGAP1_ENST00000543397.1_Missense_Mutation_p.H44Y|SRGAP1_ENST00000357825.3_Missense_Mutation_p.H84Y	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	84	F-BAR domain.|FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.H84Y(1)		breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		CACTAAGGATCATCAACAATA	0.353																																																	1	Substitution - Missense(1)	central_nervous_system(1)						ENSG00000196935						85.0	80.0	82.0					12																	64377909		2203	4300	6503	SRGAP1	SO:0001583	missense	0			-	HGNC	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.250C>T	12.37:g.64377909C>T	ENSP00000347198:p.His84Tyr	Somatic	0	23	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	66	18	78.57	Q9H8A3|Q9P2P2	Missense_Mutation	SNP	28	0.00	0	40	86.35	253	pfam_RhoGAP_dom,pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Fuc/Ara_isomerase_C,smart_FCH_dom,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.H84Y	ENST00000355086.3	37	c.250	CCDS8967.1	12	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327844	0.81690	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.15718	2.4;2.4;2.4	5.03	5.03	0.67393	Fps/Fes/Fer/CIP4 homology (3);	0.000000	0.36234	U	0.002706	T	0.35189	0.0923	M	0.62723	1.935	0.80722	D	1	D;D;D	0.59767	0.985;0.986;0.986	P;P;P	0.57152	0.756;0.743;0.814	T	0.02844	-1.1103	9	.	.	.	.	18.7352	0.91751	0.0:1.0:0.0:0.0	.	84;44;84	Q7Z6B7;G5EA48;Q7Z6B7-2	SRGP1_HUMAN;.;.	Y	84;84;44	ENSP00000347198:H84Y;ENSP00000350480:H84Y;ENSP00000437948:H44Y	.	H	+	1	0	SRGAP1	62664176	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	7.755000	0.85180	2.494000	0.84150	0.650000	0.86243	CAT	-	pfam_FCH_dom,smart_FCH_dom,pfscan_FCH_dom		0.353	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRGAP1	protein_coding	OTTHUMT00000400896.1	C		-		64377909	+1	no_errors	ENST00000355086	ensembl	human	known	74_37	missense	SNP	1.000	T
NUP210	23225	genome.wustl.edu	37	3	13383510	13383510	+	Silent	SNP	C	C	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr3:13383510C>T	ENST00000254508.5	-	22	3160	c.3078G>A	c.(3076-3078)ccG>ccA	p.P1026P	NUP210_ENST00000485755.1_5'Flank	NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1026					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.P1026P(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					ATGTAATGATCGGGGAGGCTG	0.567																																																	1	Substitution - coding silent(1)	endometrium(1)						ENSG00000132182						98.0	98.0	98.0					3																	13383510		2203	4300	6503	NUP210	SO:0001819	synonymous_variant	0			-	HGNC	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.3078G>A	3.37:g.13383510C>T		Somatic	0	39	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Silent	SNP	24	0.00	0	43	0.00	0	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,superfamily_Cadherin-like,smart_Big_2	p.P1026	ENST00000254508.5	37	c.3078	CCDS33704.1	3																																																																																			-	NULL		0.567	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	NUP210	protein_coding	OTTHUMT00000340085.1	C	NM_024923	-		13383510	-1	no_errors	ENST00000254508	ensembl	human	known	74_37	silent	SNP	1.000	T
POU1F1	5449	genome.wustl.edu	37	3	87322591	87322591	+	Intron	SNP	C	C	A	rs189221434	byFrequency	TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr3:87322591C>A	ENST00000350375.2	-	2	267				POU1F1_ENST00000560656.1_Intron|POU1F1_ENST00000344265.3_Silent_p.S66S	NM_000306.2	NP_000297.1	P28069	PIT1_HUMAN	POU class 1 homeobox 1						B cell differentiation (GO:0030183)|cell fate specification (GO:0001708)|determination of adult lifespan (GO:0008340)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear transport (GO:0051169)|positive regulation of cell proliferation (GO:0008284)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin-like growth factor receptor signaling pathway (GO:0043567)|somatotropin secreting cell development (GO:0060133)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|large_intestine(5)|liver(1)|lung(7)|prostate(2)|skin(2)	18	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00229)|Lung(72;0.00677)		ACGTTGTCACCGAGAAATGTG	0.393																																																	0								ENSG00000064835						91.0	80.0	84.0					3																	87322591		2203	4300	6503	POU1F1	SO:0001627	intron_variant	0			-	HGNC	D10216	CCDS2919.1, CCDS46873.1	3p11.2	2011-06-20	2007-07-13		ENSG00000064835	ENSG00000064835		"""Homeoboxes / POU class"""	9210	protein-coding gene	gene with protein product	"""growth hormone factor 1"""	173110	"""POU domain class 1, transcription factor 1"""	PIT1		1956794	Standard	NM_001122757		Approved	GHF-1, POU1F1a	uc010hoj.1	P28069	OTTHUMG00000158992	ENST00000350375.2:c.143-23G>T	3.37:g.87322591C>A		Somatic	0	122	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	68	29.17	O75757|Q15132|Q15133|Q9UD34|Q9UEL3	Silent	SNP	37	0.00	0	53	11.67	7	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.S66	ENST00000350375.2	37	c.198	CCDS2919.1	3																																																																																			-	NULL		0.393	POU1F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU1F1	protein_coding	OTTHUMT00000352827.1	C	NM_000306	-		87322591	-1	no_errors	ENST00000344265	ensembl	human	known	74_37	silent	SNP	0.997	A
CACNB1	782	genome.wustl.edu	37	17	37351189	37351189	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr17:37351189C>G	ENST00000394303.3	-	2	326	c.119G>C	c.(118-120)cGg>cCg	p.R40P	CACNB1_ENST00000582877.1_5'UTR|CACNB1_ENST00000394310.3_Missense_Mutation_p.R40P|CACNB1_ENST00000344140.5_Missense_Mutation_p.R40P	NM_000723.4	NP_000714.3	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1 subunit	40					axon guidance (GO:0007411)|protein targeting to membrane (GO:0006612)|transport (GO:0006810)	sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	16					Dronedarone(DB04855)|Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CCCATCTGACCGTTTGAATCG	0.562																																					Esophageal Squamous(5;100 366 38393 41452 45827)												0								ENSG00000067191						206.0	134.0	158.0					17																	37351189		2203	4300	6503	CACNB1	SO:0001583	missense	0			-	HGNC		CCDS11334.1, CCDS42311.1, CCDS45665.1	17q21-q22	2013-03-20			ENSG00000067191	ENSG00000067191		"""Calcium channel subunits"""	1401	protein-coding gene	gene with protein product		114207		CACNLB1		8381767, 8395940	Standard	NM_000723		Approved		uc002hrm.2	Q02641	OTTHUMG00000133217	ENST00000394303.3:c.119G>C	17.37:g.37351189C>G	ENSP00000377840:p.Arg40Pro	Somatic	0	85	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	69	16.87	A8K114|O15331|Q02639|Q02640|Q8N3X9|Q9C085|Q9UD79	Missense_Mutation	SNP	26	0.00	0	33	15.38	6	pfam_GK/Ca_channel_bsu,pfam_VDCC_L_bsu,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_SH3_domain,prints_VDCC_L_bsu,prints_VDCC_L_b1su	p.R40P	ENST00000394303.3	37	c.119	CCDS42311.1	17	.	.	.	.	.	.	.	.	.	.	C	29.9	5.042210	0.93685	.	.	ENSG00000067191	ENST00000394303;ENST00000344140;ENST00000394310	T;T;T	0.79554	-1.28;-1.28;-1.27	5.79	5.79	0.91817	.	0.112694	0.64402	D	0.000010	D	0.87269	0.6135	L	0.50333	1.59	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.998;0.999	D;D;D;D	0.91635	0.995;0.999;0.991;0.995	D	0.87116	0.2188	10	0.56958	D	0.05	-8.6998	16.9575	0.86263	0.0:1.0:0.0:0.0	.	40;40;40;40	Q6TME4;Q02641-2;Q02641-3;Q02641	.;.;.;CACB1_HUMAN	P	40	ENSP00000377840:R40P;ENSP00000345461:R40P;ENSP00000377847:R40P	ENSP00000345461:R40P	R	-	2	0	CACNB1	34604715	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.846000	0.75399	2.746000	0.94184	0.561000	0.74099	CGG	-	NULL		0.562	CACNB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CACNB1	protein_coding	OTTHUMT00000256945.3	C		-		37351189	-1	no_errors	ENST00000394303	ensembl	human	known	74_37	missense	SNP	1.000	G
B4GALNT1	2583	genome.wustl.edu	37	12	58025114	58025114	+	Silent	SNP	G	G	A			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr12:58025114G>A	ENST00000341156.4	-	3	836	c.252C>T	c.(250-252)tcC>tcT	p.S84S	B4GALNT1_ENST00000449184.3_Silent_p.S84S|B4GALNT1_ENST00000550764.1_Silent_p.S84S|B4GALNT1_ENST00000550943.1_Intron|B4GALNT1_ENST00000552350.1_Silent_p.S84S|B4GALNT1_ENST00000418555.2_Intron	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	84					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			CCCCCCCACTGGACTCACAAC	0.577																																																	0								ENSG00000135454						64.0	74.0	70.0					12																	58025114		2203	4300	6503	B4GALNT1	SO:0001819	synonymous_variant	0			-	HGNC	M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.252C>T	12.37:g.58025114G>A		Somatic	0	24	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	57	310	15.53	B4DE26|Q8N636	Silent	SNP	34	0.00	0	432	21.17	116	pfam_Glyco_trans_2,pirsf_GM2_synthase	p.S84	ENST00000341156.4	37	c.252	CCDS8950.1	12																																																																																			-	pirsf_GM2_synthase		0.577	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT1	protein_coding	OTTHUMT00000407853.1	G	NM_001478	-		58025114	-1	no_errors	ENST00000341156	ensembl	human	known	74_37	silent	SNP	0.981	A
HTT	3064	genome.wustl.edu	37	4	3137957	3137957	+	Nonsense_Mutation	SNP	T	T	G			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr4:3137957T>G	ENST00000355072.5	+	21	2847	c.2702T>G	c.(2701-2703)tTa>tGa	p.L901*		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	901					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CTAAAGCTTTTAAAACTGCAA	0.353																																																	0								ENSG00000197386						124.0	112.0	116.0					4																	3137957		1836	4083	5919	HTT	SO:0001587	stop_gained	0			-	HGNC	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.2702T>G	4.37:g.3137957T>G	ENSP00000347184:p.Leu901*	Somatic	0	61	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q9UQB7	Nonsense_Mutation	SNP	47	0.00	0	53	14.52	9	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.L901*	ENST00000355072.5	37	c.2702	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	T	40	8.275135	0.98737	.	.	ENSG00000197386	ENST00000355072	.	.	.	5.69	5.69	0.88448	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.9513	0.79840	0.0:0.0:0.0:1.0	.	.	.	.	X	901	.	ENSP00000347184:L901X	L	+	2	0	HTT	3107755	1.000000	0.71417	0.975000	0.42487	0.318000	0.28184	5.282000	0.65615	2.163000	0.67991	0.533000	0.62120	TTA	-	superfamily_ARM-type_fold		0.353	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	protein_coding	OTTHUMT00000358234.2	T	NM_002111	-		3137957	+1	no_errors	ENST00000355072	ensembl	human	known	74_37	nonsense	SNP	0.996	G
CNOT4	4850	genome.wustl.edu	37	7	135078741	135078741	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr7:135078741G>T	ENST00000315544.5	-	10	1835	c.1556C>A	c.(1555-1557)tCa>tAa	p.S519*	CNOT4_ENST00000361528.4_Nonsense_Mutation_p.S516*|CNOT4_ENST00000414802.1_Intron|CNOT4_ENST00000428680.2_Nonsense_Mutation_p.S516*|CNOT4_ENST00000356162.4_Intron|CNOT4_ENST00000423368.2_Nonsense_Mutation_p.S519*|CNOT4_ENST00000451834.1_Nonsense_Mutation_p.S516*|CNOT4_ENST00000541284.1_Nonsense_Mutation_p.S519*	NM_001190848.1	NP_001177777.1	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	519					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|protein autoubiquitination (GO:0051865)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	22						ATTACTATTTGAGGTGGGGTT	0.468																																					Ovarian(51;766 1130 5502 35047 50875)												0								ENSG00000080802						51.0	56.0	55.0					7																	135078741		1955	4156	6111	CNOT4	SO:0001587	stop_gained	0			-	HGNC	AF180475	CCDS43650.1, CCDS47719.1, CCDS55164.1, CCDS55165.1, CCDS55166.1, CCDS55167.1	7q33	2013-09-19			ENSG00000080802	ENSG00000080802		"""RNA binding motif (RRM) containing"""	7880	protein-coding gene	gene with protein product		604911		NOT4		10637334	Standard	NM_013316		Approved	CLONE243, NOT4H	uc011kpy.2	O95628	OTTHUMG00000155568	ENST00000315544.5:c.1556C>A	7.37:g.135078741G>T	ENSP00000326731:p.Ser519*	Somatic	0	72	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	57	9.52	B7Z6I4|E7ET38|F8VQP3|O95339|O95627|Q8IYM7|Q8NCL0|Q9NPQ1|Q9NZN6	Nonsense_Mutation	SNP	23	0.00	0	48	0.00	0	pfam_RRM_dom,smart_RRM_dom_euk,pfscan_Znf_RING,pfscan_RRM_dom	p.S519*	ENST00000315544.5	37	c.1556	CCDS55166.1	7	.	.	.	.	.	.	.	.	.	.	G	41	8.579009	0.98870	.	.	ENSG00000080802	ENST00000541284;ENST00000451834;ENST00000423368;ENST00000262563;ENST00000361528;ENST00000428680;ENST00000315544	.	.	.	5.96	5.96	0.96718	.	0.061993	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.8418	19.4101	0.94667	0.0:0.0:1.0:0.0	.	.	.	.	X	519;516;519;519;516;516;519	.	ENSP00000262563:S519X	S	-	2	0	CNOT4	134729281	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.832000	0.97577	0.655000	0.94253	TCA	-	NULL		0.468	CNOT4-201	KNOWN	basic|CCDS	protein_coding	CNOT4	protein_coding		G	NM_013316	-		135078741	-1	no_errors	ENST00000541284	ensembl	human	known	74_37	nonsense	SNP	1.000	T
NIN	51199	genome.wustl.edu	37	14	51225301	51225301	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr14:51225301G>T	ENST00000382041.3	-	18	2637	c.2447C>A	c.(2446-2448)gCc>gAc	p.A816D	NIN_ENST00000324330.9_Missense_Mutation_p.A816D|NIN_ENST00000245441.5_Missense_Mutation_p.A816D|NIN_ENST00000530997.2_Missense_Mutation_p.A816D|NIN_ENST00000382043.4_Intron|NIN_ENST00000453196.1_Missense_Mutation_p.A816D|NIN_ENST00000389868.3_Intron	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	816					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					CTGAAACTGGGCTTCTATTTG	0.463			T	PDGFRB	MPD																																			Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0								ENSG00000100503						49.0	51.0	50.0					14																	51225301		2203	4300	6503	NIN	SO:0001583	missense	0			-	HGNC	AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.2447C>A	14.37:g.51225301G>T	ENSP00000371472:p.Ala816Asp	Somatic	0	40	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	33	0.00	0	44	0.00	0	superfamily_tRNA-bd_arm,pfscan_EF_hand_dom	p.A816D	ENST00000382041.3	37	c.2447	CCDS32079.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.85|15.85	2.955976|2.955976	0.53293|0.53293	.|.	.|.	ENSG00000100503|ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196|ENST00000530997;ENST00000389869;ENST00000530853	T;T;T;T|T	0.08546|0.25250	3.35;3.09;3.08;3.09|1.81	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.551711|.	0.20707|.	N|.	0.087172|.	T|T	0.38108|0.38108	0.1028|0.1028	M|M	0.67953|0.67953	2.075|2.075	0.32316|0.32316	N|N	0.563097|0.563097	D;D;D;D|.	0.89917|.	0.998;0.997;1.0;1.0|.	D;D;D;D|.	0.91635|.	0.948;0.944;0.999;0.998|.	T|T	0.49234|0.49234	-0.8961|-0.8961	10|6	0.31617|.	T|.	0.26|.	-10.0443|-10.0443	9.8432|9.8432	0.41010|0.41010	0.0737:0.1407:0.7856:0.0|0.0737:0.1407:0.7856:0.0	.|.	822;816;816;816|.	Q8N4C6-5;C9J066;Q8N4C6;Q8N4C6-7|.	.;.;NIN_HUMAN;.|.	D|R	816;799;822;816;816;816|306	ENSP00000245441:A816D;ENSP00000371472:A816D;ENSP00000324210:A816D;ENSP00000412391:A816D|ENSP00000436092:S306R	ENSP00000245441:A816D|.	A|S	-|-	2|3	0|2	NIN|NIN	50295051|50295051	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	3.429000|3.429000	0.52800|0.52800	2.802000|2.802000	0.96397|0.96397	0.655000|0.655000	0.94253|0.94253	GCC|AGC	-	NULL		0.463	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	protein_coding	OTTHUMT00000395207.2	G	NM_182946	-		51225301	-1	no_errors	ENST00000245441	ensembl	human	known	74_37	missense	SNP	1.000	T
SRGAP3	9901	genome.wustl.edu	37	3	9094835	9094835	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr3:9094835T>A	ENST00000383836.3	-	9	1626	c.1199A>T	c.(1198-1200)gAt>gTt	p.D400V	SRGAP3_ENST00000433332.3_5'UTR|SRGAP3_ENST00000360413.3_Missense_Mutation_p.D400V	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	400	F-BAR domain.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		TTGGAAGGCATCGGAGACATC	0.512			T	RAF1	pilocytic astrocytoma																																			Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	0								ENSG00000196220						152.0	124.0	134.0					3																	9094835		2203	4300	6503	SRGAP3	SO:0001583	missense	0			-	HGNC	AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.1199A>T	3.37:g.9094835T>A	ENSP00000373347:p.Asp400Val	Somatic	0	63	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	Q8IX13|Q8IZV8	Missense_Mutation	SNP	29	0.00	0	33	0.00	0	pfam_RhoGAP_dom,pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_FCH_dom,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.D400V	ENST00000383836.3	37	c.1199	CCDS2572.1	3	.	.	.	.	.	.	.	.	.	.	T	24.2	4.507098	0.85282	.	.	ENSG00000196220	ENST00000383836;ENST00000360413;ENST00000544908	T;T	0.52983	0.64;0.64	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.67552	0.2905	M	0.68952	2.095	0.80722	D	1	P;D;D	0.76494	0.948;0.999;0.998	P;D;D	0.83275	0.628;0.996;0.994	T	0.69658	-0.5086	10	0.59425	D	0.04	.	15.8164	0.78604	0.0:0.0:0.0:1.0	.	269;400;400	Q9ULR4;O43295-2;O43295	.;.;SRGP2_HUMAN	V	400;400;280	ENSP00000373347:D400V;ENSP00000353587:D400V	ENSP00000353587:D400V	D	-	2	0	SRGAP3	9069835	1.000000	0.71417	0.800000	0.32199	0.783000	0.44284	7.881000	0.87252	2.209000	0.71365	0.533000	0.62120	GAT	-	NULL		0.512	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRGAP3	protein_coding	OTTHUMT00000207137.3	T		-		9094835	-1	no_errors	ENST00000383836	ensembl	human	known	74_37	missense	SNP	1.000	A
FAM138C	654835	genome.wustl.edu	37	9	35199	35199	+	lincRNA	SNP	A	A	G	rs9408059		TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr9:35199A>G	ENST00000449442.2	-	0	403									family with sequence similarity 138, member C																		tgggaggctgaggtgggagga	0.438																																																	0								ENSG00000218839																																			FAM138C			0			-	HGNC			9p24.3	2013-01-30			ENSG00000218839	ENSG00000218839		"""Long non-coding RNAs"""	32333	non-coding RNA	RNA, long non-coding						11779631, 15233989	Standard	NR_026822		Approved	F379	uc003zfv.3		OTTHUMG00000019422		9.37:g.35199A>G		Somatic	0	15	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	7	36.36		RNA	SNP	7	12.50	1	11	8.33	1	-	NULL	ENST00000449442.2	37	NULL		9	.	.	.	.	.	.	.	.	.	.	A	1.738	-0.492428	0.04322	.	.	ENSG00000218839	ENST00000449442;ENST00000305248	.	.	.	0.185	-0.371	0.12525	.	.	.	.	.	T	0.33990	0.0882	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31752	-0.9932	4	0.52906	T	0.07	.	.	.	.	.	.	.	.	P	28	.	ENSP00000303458:S28P	S	-	1	0	FAM138C	25199	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.686000	0.05161	-0.785000	0.04522	-0.782000	0.03352	TCA	-	-		0.438	FAM138C-001	KNOWN	basic	lincRNA	FAM138C	lincRNA	OTTHUMT00000051450.2	A	NR_026822	-		35199	-1	no_errors	ENST00000305248	ensembl	human	known	74_37	rna	SNP	0.000	G
B4GALNT1	2583	genome.wustl.edu	37	12	58025075	58025075	+	Silent	SNP	G	G	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr12:58025075G>T	ENST00000341156.4	-	3	875	c.291C>A	c.(289-291)gtC>gtA	p.V97V	B4GALNT1_ENST00000449184.3_Silent_p.V97V|B4GALNT1_ENST00000550764.1_Silent_p.V97V|B4GALNT1_ENST00000550943.1_Intron|B4GALNT1_ENST00000552350.1_Silent_p.V97V|B4GALNT1_ENST00000418555.2_Intron	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	97					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			CAATAGCTCGGACTTGTTTCT	0.597																																																	0								ENSG00000135454						108.0	118.0	114.0					12																	58025075		2203	4300	6503	B4GALNT1	SO:0001819	synonymous_variant	0			-	HGNC	M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.291C>A	12.37:g.58025075G>T		Somatic	0	28	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	65	321	16.84	B4DE26|Q8N636	Silent	SNP	35	0.00	0	450	20.46	116	pfam_Glyco_trans_2,pirsf_GM2_synthase	p.V97	ENST00000341156.4	37	c.291	CCDS8950.1	12																																																																																			-	pirsf_GM2_synthase		0.597	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT1	protein_coding	OTTHUMT00000407853.1	G	NM_001478	-		58025075	-1	no_errors	ENST00000341156	ensembl	human	known	74_37	silent	SNP	0.533	T
AL133247.2	0	genome.wustl.edu	37	2	31751166	31751167	+	RNA	INS	-	-	ATATATACATATATATAT			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr2:31751166_31751167insATATATACATATATATAT	ENST00000435713.1	+	0	0				SRD5A2_ENST00000405650.1_RNA																							CCTACTATTACATATATACGGG	0.45																																																	0								ENSG00000049319																																			SRD5A2			0				HGNC																													2.37:g.31751166_31751167insATATATACATATATATAT		Somatic	NA	NA	NA		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	26	0.00	0	47	0.00	0	-	NULL	ENST00000435713.1	37	NULL		2																																																																																			-	-		0.450	AL133247.2-001	KNOWN	basic|exp_conf	antisense	SRD5A2	antisense	OTTHUMT00000325125.1	-				31751167	-1	no_errors	ENST00000233139	ensembl	human	known	74_37	rna	INS	0.000:0.000	ATATATACATATATATAT
RP11-782C8.4	0	genome.wustl.edu	37	1	143156621	143156621	+	lincRNA	SNP	C	C	T	rs61786125	byFrequency	TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr1:143156621C>T	ENST00000424474.2	+	0	379				RP11-782C8.2_ENST00000412204.2_lincRNA|RP11-782C8.1_ENST00000438000.1_lincRNA																							AGCCTCTGCACCTCTGTCTTC	0.473																																																	0								ENSG00000230850																																			RP11-782C8.1			0			-	Clone_based_vega_gene																													1.37:g.143156621C>T		Somatic	0	11	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	5	44.44		RNA	SNP	48	21.31	13	111	11.20	14	-	NULL	ENST00000424474.2	37	NULL		1																																																																																			-	-		0.473	RP11-782C8.4-001	KNOWN	not_best_in_genome_evidence|basic|exp_conf	lincRNA	ENSG00000230850	lincRNA	OTTHUMT00000037573.2	C		rs61786125		143156621	+1	no_errors	ENST00000454861	ensembl	human	known	74_37	rna	SNP	0.997	T
TMPRSS2	7113	genome.wustl.edu	37	21	42851103	42851103	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr21:42851103G>A	ENST00000332149.5	-	7	813	c.679C>T	c.(679-681)Cac>Tac	p.H227Y	TMPRSS2_ENST00000458356.1_Missense_Mutation_p.H227Y|TMPRSS2_ENST00000398585.3_Missense_Mutation_p.H264Y	NM_005656.3	NP_005647.3	O15393	TMPS2_HUMAN	transmembrane protease, serine 2	227	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				positive regulation of viral entry into host cell (GO:0046598)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)		TMPRSS2/ETV1(34)|TMPRSS2/ETV5_ENST00000306376(5)|TMPRSS2/ERG(3582)|TMPRSS2/ETV4(13)	central_nervous_system(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	4		Prostate(19;4.48e-07)|all_epithelial(19;0.031)				GCATACCTGTGGTACAGTTTT	0.413			T	"""ERG, ETV1, ETV4, ETV5"""	prostate																																			Dom	yes		21	21q22.3	7113	"""transmembrane protease, serine 2"""		E	0								ENSG00000184012						107.0	106.0	107.0					21																	42851103		2203	4300	6503	TMPRSS2	SO:0001583	missense	0			-	HGNC	U75329	CCDS33564.1, CCDS54486.1	21q22.3	2010-04-13			ENSG00000184012	ENSG00000184012		"""Serine peptidases / Transmembrane"""	11876	protein-coding gene	gene with protein product		602060				9325052	Standard	NM_005656		Approved	PRSS10	uc010gor.3	O15393	OTTHUMG00000086762	ENST00000332149.5:c.679C>T	21.37:g.42851103G>A	ENSP00000330330:p.His227Tyr	Somatic	0	63	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	96	56	62.75	A8K6Z8|B2R8E5|B7Z459|D3DSJ2|F8WES1|Q6GTK7|Q9BXX1	Missense_Mutation	SNP	34	0.00	0	51	60.77	79	pfam_Peptidase_S1,pfam_SRCR,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,superfamily_Srcr_rcpt-rel,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_LDrepeatLR_classA_rpt,pfscan_SRCR,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.H264Y	ENST00000332149.5	37	c.790	CCDS33564.1	21	.	.	.	.	.	.	.	.	.	.	G	4.689	0.128180	0.08981	.	.	ENSG00000184012	ENST00000332149;ENST00000398585;ENST00000458356;ENST00000454499;ENST00000424093	T;T;T;T;T	0.59772	0.24;0.24;0.24;0.24;0.24	5.22	4.25	0.50352	Speract/scavenger receptor (1);Speract/scavenger receptor-related (2);	0.241217	0.35838	N	0.002953	T	0.41696	0.1170	L	0.37750	1.13	0.30371	N	0.78288	B;B	0.23990	0.095;0.016	B;B	0.20384	0.017;0.029	T	0.29610	-1.0006	10	0.13853	T	0.58	.	9.3564	0.38168	0.0:0.0:0.7315:0.2685	.	264;227	F8WES1;O15393	.;TMPS2_HUMAN	Y	227;264;227;227;187	ENSP00000330330:H227Y;ENSP00000381588:H264Y;ENSP00000391216:H227Y;ENSP00000389006:H227Y;ENSP00000397846:H187Y	ENSP00000330330:H227Y	H	-	1	0	TMPRSS2	41772973	1.000000	0.71417	0.992000	0.48379	0.228000	0.25075	2.291000	0.43540	2.443000	0.82685	0.549000	0.68633	CAC	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel		0.413	TMPRSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS2	protein_coding	OTTHUMT00000195189.1	G		-		42851103	-1	no_errors	ENST00000398585	ensembl	human	known	74_37	missense	SNP	0.999	A
KRT86	3892	genome.wustl.edu	37	12	52648120	52648120	+	Intron	SNP	G	G	C			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr12:52648120G>C	ENST00000544024.1	+	1	129				KRT121P_ENST00000529785.1_RNA			O43790	KRT86_HUMAN	keratin 86							extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		CTCTAGGTCTGATTTGCGCAG	0.562																																																	0								ENSG00000135477																																			KRT121P	SO:0001627	intron_variant	0			-	HGNC	X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000544024.1:c.-5+4908G>C	12.37:g.52648120G>C		Somatic	0	82	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	60	106	36.14	P78387	RNA	SNP	27	0.00	0	57	51.69	61	-	NULL	ENST00000544024.1	37	NULL	CCDS41785.1	12																																																																																			-	-		0.562	KRT86-202	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT121P	protein_coding		G	NM_002284	-		52648120	-1	no_errors	ENST00000529785	ensembl	human	known	74_37	rna	SNP	0.195	C
FAM98B	283742	genome.wustl.edu	37	15	38776810	38776810	+	IGR	SNP	G	G	T	rs201831942		TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr15:38776810G>T	ENST00000491535.1	+	0	3111				FAM98B_ENST00000397609.2_Missense_Mutation_p.G418C	NM_001042429.1	NP_001035894.1	Q52LJ0	FA98B_HUMAN	family with sequence similarity 98, member B							cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-splicing ligase complex (GO:0072669)	poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8		all_cancers(109;3.11e-17)|all_epithelial(112;2.64e-15)|Lung NSC(122;2.11e-11)|all_lung(180;5.61e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;9e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0209)		TGGAGGAggtggtggtggtgg	0.468																																																	0								ENSG00000171262						24.0	23.0	24.0					15																	38776810		1555	3441	4996	FAM98B	SO:0001628	intergenic_variant	0			-	HGNC		CCDS10047.2	15q14	2006-11-29		2005-11-20	ENSG00000171262	ENSG00000171262			26773	protein-coding gene	gene with protein product						12477932	Standard	NM_173611		Approved	FLJ38426	uc001zkc.3	Q52LJ0	OTTHUMG00000129831		15.37:g.38776810G>T		Somatic	0	18	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	12	25.00	A8MUW5|Q8N935	Missense_Mutation	SNP	6	0.00	0	20	0.00	0	pfam_Uncharacterised_FAM98	p.G418C	ENST00000491535.1	37	c.1252	CCDS42015.1	15	.	.	.	.	.	.	.	.	.	.	G	5.335	0.247127	0.10130	.	.	ENSG00000171262	ENST00000397609	T	0.49432	0.78	1.64	1.64	0.23874	.	0.000000	0.46145	U	0.000305	T	0.51449	0.1675	L	0.48362	1.52	0.80722	D	1	D	0.76494	0.999	P	0.60286	0.872	T	0.51926	-0.8643	10	0.87932	D	0	.	7.0617	0.25129	0.0:0.286:0.714:0.0	.	418	A8MUW5	.	C	418	ENSP00000380734:G418C	ENSP00000380734:G418C	G	+	1	0	FAM98B	36564102	0.952000	0.32445	0.920000	0.36463	0.923000	0.55619	3.168000	0.50801	0.861000	0.35504	0.557000	0.71058	GGT	-	NULL		0.468	FAM98B-002	KNOWN	basic|CCDS	protein_coding	FAM98B	protein_coding	OTTHUMT00000252071.2	G	NM_173611	-		38776810	+1	no_errors	ENST00000397609	ensembl	human	known	74_37	missense	SNP	0.959	T
NBPF6	653149	genome.wustl.edu	37	1	108926235	108926235	+	Intron	SNP	C	C	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr1:108926235C>T	ENST00000444143.2	+	1	183				NBPF5P_ENST00000357046.4_RNA|NBPF6_ENST00000294652.8_Intron			Q5VWK0	NBPF6_HUMAN	neuroblastoma breakpoint family, member 6							cytoplasm (GO:0005737)				endometrium(2)	2						TTGGCTTCCTCGGTAGGCTCC	0.453																																																	0								ENSG00000243967																																			NBPF5P	SO:0001627	intron_variant	0			-	HGNC		CCDS44184.1	1p13.3	2013-01-17				ENSG00000186086		"""neuroblastoma breakpoint family"""	31988	protein-coding gene	gene with protein product		613996				16079250	Standard	NM_001143987		Approved		uc009wep.3	Q5VWK0	OTTHUMG00000039830	ENST00000444143.2:c.-36+7632C>T	1.37:g.108926235C>T		Somatic	0	66	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	64	17.95	A4QN25	RNA	SNP	14	0.00	0	23	17.86	5	-	NULL	ENST00000444143.2	37	NULL	CCDS44184.1	1																																																																																			-	-		0.453	NBPF6-203	KNOWN	basic|CCDS	protein_coding	NBPF5P	protein_coding	OTTHUMT00000276886.3	C	XM_926213	-		108926235	+1	no_errors	ENST00000357046	ensembl	human	known	74_37	rna	SNP	0.003	T
LOR	4014	genome.wustl.edu	37	1	153233991	153233992	+	In_Frame_Ins	INS	-	-	CTCTGGCGGCGT	rs11272549|rs547333583|rs561634896	byFrequency	TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr1:153233991_153233992insCTCTGGCGGCGT	ENST00000368742.3	+	2	623_624	c.566_567insCTCTGGCGGCGT	c.(565-570)tactct>taCTCTGGCGGCGTctct	p.190_191insGGVS		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	190					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gtctgcggctactctggcggcg	0.743																																																	0								ENSG00000203782																																			LOR	SO:0001652	inframe_insertion	0				HGNC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	Exception_encountered	1.37:g.153233991_153233992insCTCTGGCGGCGT	ENSP00000357731:p.Ser190_Gly191insGlyGlyValSer	Somatic	NA	NA	NA		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5T869|Q5XKF8	In_Frame_Ins	INS	16	0.00	0	24	0.00	0	NULL	p.193in_frame_insVSGG	ENST00000368742.3	37	c.566_567	CCDS30870.1	1																																																																																			-	NULL		0.743	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOR	protein_coding	OTTHUMT00000039107.1	-	NM_000427			153233992	+1	no_errors	ENST00000368742	ensembl	human	known	74_37	in_frame_ins	INS	0.014:0.200	CTCTGGCGGCGT
SLIT3	6586	genome.wustl.edu	37	5	168147374	168147382	+	Intron	DEL	CACCCCCAC	CACCCCCAC	-	rs542888217|rs2337550|rs148674501|rs372307355|rs573971108	byFrequency	TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	CACCCCCAC	CACCCCCAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr5:168147374_168147382delCACCCCCAC	ENST00000519560.1	-	23	2903				SLIT3_ENST00000332966.8_Intron|SLIT3_ENST00000404867.3_Intron|CTC-558O2.1_ENST00000522615.1_RNA	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)						apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTCACCCCATCACCCCCACCACCCCAAAA	0.488														1028	0.205272	0.0234	0.2104	5008	,	,		21079	0.1379		0.328	False		,,,				2504	0.3906				Ovarian(29;311 847 10864 17279 24903)												0								ENSG00000254042																																			CTC-558O2.1	SO:0001627	intron_variant	0				Clone_based_vega_gene	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.2483+1878GTGGGGGTG>-	5.37:g.168147374_168147382delCACCCCCAC		Somatic	NA	NA	NA		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6H8U9|J3KNP3|O95804|Q9UFH5	RNA	DEL	8	66.67	16	8	81.40	35	-	NULL	ENST00000519560.1	37	NULL	CCDS4369.1	5																																																																																			-	-		0.488	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927969	protein_coding	OTTHUMT00000252792.4	CACCCCCAC	NM_003062			168147382	+1	no_errors	ENST00000522615	ensembl	human	known	74_37	rna	DEL	0.002:0.002:0.014:0.008:0.006:0.004:0.003:0.003:0.003	-
PCDH12	51294	genome.wustl.edu	37	5	141335435	141335435	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr5:141335435G>T	ENST00000231484.3	-	1	3192	c.1982C>A	c.(1981-1983)aCc>aAc	p.T661N	AC005740.6_ENST00000607378.1_RNA|PCDH12_ENST00000512221.1_5'Flank	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	661	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGGCATTGGTGACATTGAC	0.577																																																	0								ENSG00000113555						55.0	50.0	51.0					5																	141335435		2203	4300	6503	PCDH12	SO:0001583	missense	0			-	HGNC	AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.1982C>A	5.37:g.141335435G>T	ENSP00000231484:p.Thr661Asn	Somatic	0	30	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	30	0.00	0	49	0.00	0	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T661N	ENST00000231484.3	37	c.1982	CCDS4269.1	5	.	.	.	.	.	.	.	.	.	.	G	12.53	1.966166	0.34659	.	.	ENSG00000113555	ENST00000231484	T	0.48522	0.81	5.38	5.38	0.77491	Cadherin (4);Cadherin-like (1);	0.116191	0.56097	D	0.000024	T	0.54515	0.1863	L	0.58101	1.795	0.41498	D	0.988267	D	0.54601	0.967	P	0.52159	0.691	T	0.57183	-0.7855	10	0.62326	D	0.03	.	12.2273	0.54468	0.0:0.1708:0.8292:0.0	.	661	Q9NPG4	PCD12_HUMAN	N	661	ENSP00000231484:T661N	ENSP00000231484:T661N	T	-	2	0	PCDH12	141315619	1.000000	0.71417	0.998000	0.56505	0.427000	0.31564	4.092000	0.57707	2.802000	0.96397	0.655000	0.94253	ACC	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.577	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH12	protein_coding	OTTHUMT00000251858.1	G	NM_016580	-		141335435	-1	no_errors	ENST00000231484	ensembl	human	known	74_37	missense	SNP	1.000	T
GNRH2	2797	genome.wustl.edu	37	20	3026346	3026350	+	Frame_Shift_Del	DEL	GCCCC	GCCCC	-	rs377041343|rs67749149		TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	GCCCC	GCCCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr20:3026346_3026350delGCCCC	ENST00000245983.2	+	4	378_382	c.327_331delGCCCC	c.(325-333)gagccccgcfs	p.PR110fs	GNRH2_ENST00000359100.2_Frame_Shift_Del_p.PR103fs|GNRH2_ENST00000359987.1_Frame_Shift_Del_p.PR102fs|GNRH2_ENST00000380347.2_Frame_Shift_Del_p.PR103fs|GNRH2_ENST00000380346.2_Frame_Shift_Del_p.PR102fs|MRPS26_ENST00000380325.3_5'Flank	NM_001501.1	NP_001492.1	O43555	GON2_HUMAN	gonadotropin-releasing hormone 2	110					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			ovary(1)|upper_aerodigestive_tract(1)	2						CAGCCCGAGAGCCCCGCCCCGCCCC	0.634																																																	0								ENSG00000125787		,,	4,204,4048		0,0,4,15,174,1935					,,	-2.0	0.0		dbSNP_130	50	46,851,7353		2,8,34,78,687,3316	no	codingComplex,codingComplex,codingComplex	GNRH2	NM_178332.1,NM_178331.1,NM_001501.1	,,	2,8,38,93,861,5251	A1A1,A1A2,A1R,A2A2,A2R,RR		10.8727,4.8872,8.8358	,,	,,		50,1055,11401				GNRH2	SO:0001589	frameshift_variant	0				HGNC	AF036329	CCDS13040.1, CCDS13041.1, CCDS13042.1	20p13	2013-02-26			ENSG00000125787	ENSG00000125787		"""Endogenous ligands"""	4420	protein-coding gene	gene with protein product		602352				9419371, 12447356	Standard	NM_178331		Approved		uc002whr.1	O43555	OTTHUMG00000031723	ENST00000245983.2:c.327_331delGCCCC	20.37:g.3026356_3026360delGCCCC	ENSP00000245983:p.Pro110fs	Somatic	NA	NA	NA		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q14C68|Q14C69|Q9BYN9|Q9BYP0	Frame_Shift_Del	DEL	21	0.00	0	29	0.00	0	pfam_GnRH	p.A113fs	ENST00000245983.2	37	c.327_331	CCDS13040.1	20																																																																																			-	NULL		0.634	GNRH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GNRH2	protein_coding	OTTHUMT00000077694.2	GCCCC	NM_001501			3026350	+1	no_errors	ENST00000245983	ensembl	human	known	74_37	frame_shift_del	DEL	0.024:0.007:0.002:0.001:0.000	-
AP3B1	8546	genome.wustl.edu	37	5	77411983	77412004	+	Frame_Shift_Del	DEL	CTTCCTCAGATTCAGAATAAAA	CTTCCTCAGATTCAGAATAAAA	-	rs370684531|rs377485358|rs113301033	byFrequency	TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	CTTCCTCAGATTCAGAATAAAA	CTTCCTCAGATTCAGAATAAAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr5:77411983_77412004delCTTCCTCAGATTCAGAATAAAA	ENST00000255194.6	-	18	2198_2219	c.2023_2044delTTTTATTCTGAATCTGAGGAAG	c.(2023-2046)ttttattctgaatctgaggaagagfs	p.FYSESEEE675fs	AP3B1_ENST00000519295.1_Frame_Shift_Del_p.FYSESEEE626fs	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	675					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		GAGTCCTCCTCTTCCTCAGATTCAGAATAAAACTTCTTAGCA	0.329									Hermansky-Pudlak syndrome																																								0								ENSG00000132842																																			AP3B1	SO:0001589	frameshift_variant	0	Familial Cancer Database	HPS, HPS1-8		HGNC	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.2023_2044delTTTTATTCTGAATCTGAGGAAG	5.37:g.77411983_77412004delCTTCCTCAGATTCAGAATAAAA	ENSP00000255194:p.Phe675fs	Somatic	NA	NA	NA		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	E5RJ68|O00580|Q7Z393|Q9HD66	Frame_Shift_Del	DEL	45	0.00	0	42	4.55	2	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_beta	p.F675fs	ENST00000255194.6	37	c.2044_2023	CCDS4041.1	5																																																																																			-	pirsf_AP3_beta		0.329	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3B1	protein_coding	OTTHUMT00000225548.2	CTTCCTCAGATTCAGAATAAAA				77412004	-1	no_errors	ENST00000255194	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.980:1.000:1.000:0.994:1.000:1.000:0.999:1.000:1.000:1.000:1.000:1.000	-
SRGAP1	57522	genome.wustl.edu	37	12	64377912	64377912	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr12:64377912C>T	ENST00000355086.3	+	2	777	c.253C>T	c.(253-255)Caa>Taa	p.Q85*	SRGAP1_ENST00000543397.1_Nonsense_Mutation_p.Q45*|SRGAP1_ENST00000357825.3_Nonsense_Mutation_p.Q85*	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	85	F-BAR domain.|FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		TAAGGATCATCAACAATACAA	0.353																																																	0								ENSG00000196935						82.0	78.0	79.0					12																	64377912		2203	4300	6503	SRGAP1	SO:0001587	stop_gained	0			-	HGNC	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.253C>T	12.37:g.64377912C>T	ENSP00000347198:p.Gln85*	Somatic	0	22	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	64	18	78.05	Q9H8A3|Q9P2P2	Nonsense_Mutation	SNP	25	0.00	0	39	86.16	249	pfam_RhoGAP_dom,pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Fuc/Ara_isomerase_C,smart_FCH_dom,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.Q85*	ENST00000355086.3	37	c.253	CCDS8967.1	12	.	.	.	.	.	.	.	.	.	.	C	50	16.726747	0.99870	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	.	.	.	5.16	5.16	0.70880	.	0.000000	0.33792	U	0.004556	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0307	0.92955	0.0:1.0:0.0:0.0	.	.	.	.	X	85;85;45	.	.	Q	+	1	0	SRGAP1	62664179	1.000000	0.71417	0.993000	0.49108	0.785000	0.44390	7.737000	0.84957	2.566000	0.86566	0.650000	0.86243	CAA	-	pfam_FCH_dom,smart_FCH_dom,pfscan_FCH_dom		0.353	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRGAP1	protein_coding	OTTHUMT00000400896.1	C		-		64377912	+1	no_errors	ENST00000355086	ensembl	human	known	74_37	nonsense	SNP	1.000	T
BAIAP2	10458	genome.wustl.edu	37	17	79060381	79060381	+	Splice_Site	SNP	G	G	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr17:79060381G>T	ENST00000321300.6	+	6	582		c.e6+1		BAIAP2_ENST00000573894.1_Splice_Site|BAIAP2_ENST00000435091.3_Splice_Site|BAIAP2_ENST00000575712.1_Splice_Site|BAIAP2_ENST00000575245.1_Splice_Site|BAIAP2_ENST00000428708.2_Splice_Site|BAIAP2_ENST00000321280.7_Splice_Site|BAIAP2_ENST00000392411.3_Splice_Site	NM_001144888.1|NM_017451.2	NP_001138360.1|NP_059345.1	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2						actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of synaptic plasticity (GO:0048167)|response to bacterium (GO:0009617)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	cytoskeletal adaptor activity (GO:0008093)|identical protein binding (GO:0042802)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)	18	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GGAGCTGCAGGTAGGCCCGCC	0.647																																																	0								ENSG00000175866						64.0	69.0	67.0					17																	79060381		2203	4300	6503	BAIAP2	SO:0001630	splice_region_variant	0			-	HGNC	AB015019	CCDS11775.1, CCDS11776.1, CCDS11777.1, CCDS45806.1	17q25.3	2014-09-11			ENSG00000175866				947	protein-coding gene	gene with protein product		605475				10343108	Standard	NM_017451		Approved	BAP2	uc002jzg.2	Q9UQB8	OTTHUMG00000177698	ENST00000321300.6:c.489+1G>T	17.37:g.79060381G>T		Somatic	0	28	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	O43858|Q53HB1|Q86WC1|Q8N5C0|Q96CR7|Q9UBR3|Q9UQ43	Splice_Site	SNP	28	0.00	0	40	0.00	0	-	e6+1	ENST00000321300.6	37	c.489+1	CCDS11775.1	17	.	.	.	.	.	.	.	.	.	.	G	15.15	2.749214	0.49257	.	.	ENSG00000175866	ENST00000321300;ENST00000428708;ENST00000435091;ENST00000321280;ENST00000392411	.	.	.	3.8	3.8	0.43715	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8461	0.78890	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BAIAP2	76674976	1.000000	0.71417	0.989000	0.46669	0.526000	0.34562	7.221000	0.78016	1.928000	0.55862	0.561000	0.74099	.	-	-		0.647	BAIAP2-003	KNOWN	basic|CCDS	protein_coding	BAIAP2	protein_coding	OTTHUMT00000438553.1	G		-	Intron	79060381	+1	no_errors	ENST00000321300	ensembl	human	known	74_37	splice_site	SNP	1.000	T
AC105242.1	0	genome.wustl.edu	37	8	78199114	78199133	+	RNA	DEL	CAGGGGGAACTGGGAGCATT	CAGGGGGAACTGGGAGCATT	-	rs72579714	byFrequency	TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	CAGGGGGAACTGGGAGCATT	CAGGGGGAACTGGGAGCATT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr8:78199114_78199133delCAGGGGGAACTGGGAGCATT	ENST00000410402.3	+	0	63_80																											tccatagagccagggggaactgggagcattcagggggaac	0.577														392	0.0782748	0.1278	0.0764	5008	,	,		22251	0.0		0.1262	False		,,,				2504	0.044																0								ENSG00000222334																																			AC105242.1			0				Clone_based_ensembl_gene																													8.37:g.78199114_78199133delCAGGGGGAACTGGGAGCATT		Somatic	NA	NA	NA		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	27	22.86	8	42	26.32	15	-	NULL	ENST00000410402.3	37	NULL		8																																																																																			-	-		0.577	AC105242.1-201	NOVEL	basic	miRNA	ENSG00000222334	miRNA		CAGGGGGAACTGGGAGCATT				78199133	+1	no_errors	ENST00000410402	ensembl	human	novel	74_37	rna	DEL	0.006:0.006:0.004:0.003:0.002:0.001:0.002:0.005:0.008:0.016:0.022:0.026:0.030:0.032:0.032:0.032:0.031:0.028:0.024:0.018	-
BOD1L1	259282	genome.wustl.edu	37	4	13582792	13582792	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr4:13582792G>T	ENST00000040738.5	-	20	8767	c.8632C>A	c.(8632-8634)Cct>Act	p.P2878T		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2878						nucleus (GO:0005634)	DNA binding (GO:0003677)										TATTTGCGAGGTCTTCCTCTT	0.313																																																	0								ENSG00000038219						54.0	51.0	52.0					4																	13582792		2201	4295	6496	BOD1L1	SO:0001583	missense	0			-	HGNC	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.8632C>A	4.37:g.13582792G>T	ENSP00000040738:p.Pro2878Thr	Somatic	0	50	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	36	0.00	0	67	0.00	0	NULL	p.P2878T	ENST00000040738.5	37	c.8632	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	G	20.9	4.071477	0.76301	.	.	ENSG00000038219	ENST00000040738	T	0.26810	1.71	5.52	5.52	0.82312	AT hook, DNA-binding motif (1);	0.000000	0.56097	D	0.000035	T	0.42899	0.1223	L	0.36672	1.1	0.49483	D	0.999794	D	0.89917	1.0	D	0.85130	0.997	T	0.26985	-1.0087	10	0.72032	D	0.01	-4.5195	16.5824	0.84717	0.0:0.0:1.0:0.0	.	2878	Q8NFC6	BOD1L_HUMAN	T	2878	ENSP00000040738:P2878T	ENSP00000040738:P2878T	P	-	1	0	BOD1L	13191890	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.744000	0.68664	2.598000	0.87819	0.655000	0.94253	CCT	-	NULL		0.313	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	protein_coding	OTTHUMT00000207321.1	G	NM_148894	-		13582792	-1	no_errors	ENST00000040738	ensembl	human	known	74_37	missense	SNP	1.000	T
SMCHD1	23347	genome.wustl.edu	37	18	2795948	2795948	+	Splice_Site	SNP	T	T	A			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr18:2795948T>A	ENST00000320876.6	+	46	6059	c.5721T>A	c.(5719-5721)gaT>gaA	p.D1907E	RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1907					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						TCTTTACAGATCTTCTTCAGC	0.368																																																	0								ENSG00000101596						45.0	39.0	41.0					18																	2795948		1873	4092	5965	SMCHD1	SO:0001630	splice_region_variant	0			-	HGNC	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.5720-1T>A	18.37:g.2795948T>A		Somatic	0	42	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	16	33.33	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	30	0.00	0	40	13.04	6	pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_HATPase_ATP-bd,smart_SMC_hinge	p.D1907E	ENST00000320876.6	37	c.5721	CCDS45822.1	18	.	.	.	.	.	.	.	.	.	.	T	5.134	0.210272	0.09757	.	.	ENSG00000101596	ENST00000320876	T	0.21361	2.01	5.42	-3.03	0.05429	.	.	.	.	.	T	0.11537	0.0281	L	0.39633	1.23	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.25117	-1.0141	9	0.24483	T	0.36	.	1.5981	0.02668	0.1122:0.2046:0.2581:0.4252	.	1907	A6NHR9	SMHD1_HUMAN	E	1907	ENSP00000326603:D1907E	ENSP00000326603:D1907E	D	+	3	2	SMCHD1	2785948	0.993000	0.37304	0.967000	0.41034	0.902000	0.53008	0.011000	0.13264	-0.723000	0.04915	-1.417000	0.01113	GAT	-	NULL		0.368	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCHD1	protein_coding	OTTHUMT00000441082.2	T		-	Missense_Mutation	2795948	+1	no_errors	ENST00000320876	ensembl	human	known	74_37	missense	SNP	0.995	A
SIPA1L2	57568	genome.wustl.edu	37	1	232607223	232607223	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr1:232607223C>T	ENST00000366630.1	-	7	2495	c.2137G>A	c.(2137-2139)Gag>Aag	p.E713K	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.E713K			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	713	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GCCCCAGGCTCCTGGAAGACG	0.413																																																	0								ENSG00000116991						137.0	143.0	141.0					1																	232607223		2123	4272	6395	SIPA1L2	SO:0001583	missense	0			-	HGNC	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.2137G>A	1.37:g.232607223C>T	ENSP00000355589:p.Glu713Lys	Somatic	0	82	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	52	24.64	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	40	0.00	0	49	15.52	9	pfam_DUF3401,pfam_Rap_GAP_dom,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.E713K	ENST00000366630.1	37	c.2137	CCDS41474.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.878050	0.97055	.	.	ENSG00000116991	ENST00000366630;ENST00000262861	D;D	0.97352	-4.35;-4.35	5.98	5.98	0.97165	Rap/ran-GAP (2);	0.000000	0.85682	D	0.000000	D	0.98966	0.9648	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99069	1.0833	10	0.66056	D	0.02	-43.8212	20.4561	0.99145	0.0:1.0:0.0:0.0	.	713	Q9P2F8	SI1L2_HUMAN	K	713	ENSP00000355589:E713K;ENSP00000262861:E713K	ENSP00000262861:E713K	E	-	1	0	SIPA1L2	230673846	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.818000	0.86416	2.843000	0.97960	0.650000	0.86243	GAG	-	pfam_Rap_GAP_dom,pfscan_Rap_GAP_dom		0.413	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L2	protein_coding	OTTHUMT00000092318.1	C	XM_045839	-		232607223	-1	no_errors	ENST00000262861	ensembl	human	known	74_37	missense	SNP	1.000	T
RFTN2	130132	genome.wustl.edu	37	2	198540166	198540166	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr2:198540166C>T	ENST00000295049.4	-	1	553	c.17G>A	c.(16-18)aGa>aAa	p.R6K		NM_144629.2	NP_653230.2	Q52LD8	RFTN2_HUMAN	raftlin family member 2	6					dsRNA transport (GO:0033227)|response to exogenous dsRNA (GO:0043330)	plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(13)|urinary_tract(3)	30						TTCTAGCTTTCTAAGTCCGCA	0.413																																																	0								ENSG00000162944						118.0	129.0	125.0					2																	198540166		2203	4300	6503	RFTN2	SO:0001583	missense	0			-	HGNC	AK055136	CCDS2323.1	2q33.1	2008-02-05	2006-09-28	2006-09-28	ENSG00000162944	ENSG00000162944			26402	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 11"""	C2orf11			Standard	NM_144629		Approved	FLJ30574, Raftlin-2	uc002uuo.4	Q52LD8	OTTHUMG00000132746	ENST00000295049.4:c.17G>A	2.37:g.198540166C>T	ENSP00000295049:p.Arg6Lys	Somatic	0	19	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	8	42.86	Q14DH4|Q2TA69|Q53QE0|Q53SE1|Q96NM3	Missense_Mutation	SNP	32	0.00	0	39	27.78	15	NULL	p.R6K	ENST00000295049.4	37	c.17	CCDS2323.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.347010	0.95807	.	.	ENSG00000162944	ENST00000295049;ENST00000429081	T;T	0.35605	1.3;1.3	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.56891	0.2016	M	0.64997	1.995	0.58432	D	0.999993	D	0.71674	0.998	D	0.77557	0.99	T	0.44050	-0.9353	10	0.18710	T	0.47	-32.0444	18.3002	0.90160	0.0:1.0:0.0:0.0	.	6	Q52LD8	RFTN2_HUMAN	K	6	ENSP00000295049:R6K;ENSP00000398128:R6K	ENSP00000295049:R6K	R	-	2	0	RFTN2	198248411	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.127000	0.77210	2.747000	0.94245	0.585000	0.79938	AGA	-	NULL		0.413	RFTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFTN2	protein_coding	OTTHUMT00000256106.2	C	NM_144629	-		198540166	-1	no_errors	ENST00000295049	ensembl	human	known	74_37	missense	SNP	1.000	T
IRS1	3667	genome.wustl.edu	37	2	227662435	227662435	+	Silent	SNP	G	G	A	rs376825507		TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr2:227662435G>A	ENST00000305123.5	-	1	2040	c.1020C>T	c.(1018-1020)gcC>gcT	p.A340A	RP11-395N3.2_ENST00000607970.1_lincRNA|IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	340	Ser-rich.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		CGTCCACCGAGGCTGGGCGGG	0.721											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000169047	G		2,4392		0,2,2195	50.0	55.0	53.0		1020	-1.3	0.9	2		53	4,8566		0,4,4281	no	coding-synonymous	IRS1	NM_005544.2		0,6,6476	AA,AG,GG		0.0467,0.0455,0.0463		340/1243	227662435	6,12958	2197	4285	6482	IRS1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.1020C>T	2.37:g.227662435G>A		Somatic	0	73	0.00	2321	0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	61	19.74		Silent	SNP	30	0.00	0	34	17.07	7	pfam_Insln_rcpt_S1,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,prints_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1	p.A340	ENST00000305123.5	37	c.1020	CCDS2463.1	2																																																																																			-	NULL		0.721	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS1	protein_coding	OTTHUMT00000256886.3	G	NM_005544	-		227662435	-1	no_errors	ENST00000305123	ensembl	human	known	74_37	silent	SNP	0.951	A
POTEC	388468	genome.wustl.edu	37	18	14542900	14542900	+	Silent	SNP	A	A	G			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr18:14542900A>G	ENST00000358970.5	-	1	245	c.246T>C	c.(244-246)acT>acC	p.T82T	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	82										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						GGTCTCCAGAAGTGCCCACGT	0.582																																																	0								ENSG00000183206						42.0	49.0	47.0					18																	14542900		692	1591	2283	POTEC	SO:0001819	synonymous_variant	0			-	HGNC	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.246T>C	18.37:g.14542900A>G		Somatic	0	435	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	398	314	55.82		Silent	SNP	32	0.00	0	65	54.86	79	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.T82	ENST00000358970.5	37	c.246	CCDS45835.1	18																																																																																			-	NULL		0.582	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	POTEC	protein_coding	OTTHUMT00000371179.1	A	XM_496269	-		14542900	-1	no_errors	ENST00000358970	ensembl	human	known	74_37	silent	SNP	0.015	G
ESF1	51575	genome.wustl.edu	37	20	13753207	13753207	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr20:13753207G>T	ENST00000202816.1	-	5	1311	c.1204C>A	c.(1204-1206)Cca>Aca	p.P402T		NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	402					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						AGCTCTACTGGTCCTTGAACT	0.328																																																	0								ENSG00000089048						184.0	177.0	179.0					20																	13753207		2203	4300	6503	ESF1	SO:0001583	missense	0			-	HGNC		CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.1204C>A	20.37:g.13753207G>T	ENSP00000202816:p.Pro402Thr	Somatic	0	47	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Missense_Mutation	SNP	35	0.00	0	54	0.00	0	pfam_NUC153	p.P402T	ENST00000202816.1	37	c.1204	CCDS13117.1	20	.	.	.	.	.	.	.	.	.	.	G	26.1	4.709453	0.89018	.	.	ENSG00000089048	ENST00000202816	T	0.77098	-1.07	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.91385	0.7282	M	0.93016	3.37	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.92789	0.6247	10	0.87932	D	0	3.3625	19.8105	0.96544	0.0:0.0:1.0:0.0	.	402	Q9H501	ESF1_HUMAN	T	402	ENSP00000202816:P402T	ENSP00000202816:P402T	P	-	1	0	ESF1	13701207	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.966000	0.93397	2.755000	0.94549	0.650000	0.86243	CCA	-	NULL		0.328	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESF1	protein_coding	OTTHUMT00000078049.1	G	NM_016649	-		13753207	-1	no_errors	ENST00000202816	ensembl	human	known	74_37	missense	SNP	1.000	T
MVB12A	93343	genome.wustl.edu	37	19	17526531	17526532	+	Intron	INS	-	-	CTTAA	rs397974159|rs374749606|rs57840155	byFrequency	TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr19:17526531_17526532insCTTAA	ENST00000529490.1	+	2	196				CTD-2521M24.6_ENST00000593957.1_RNA|CTD-2521M24.9_ENST00000500836.2_lincRNA			Q96EY5	MB12A_HUMAN	multivesicular body subunit 12A						protein transport (GO:0015031)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|vesicle (GO:0031982)	lipid binding (GO:0008289)|ubiquitin binding (GO:0043130)										aataaaggactcttaattcgtc	0.49														1174	0.234425	0.2806	0.1643	5008	,	,		16485	0.2163		0.174	False		,,,				2504	0.3027																0								ENSG00000269640																																			CTD-2521M24.9	SO:0001627	intron_variant	0				Clone_based_vega_gene	BC011840	CCDS12359.1	19p13.11	2013-10-11	2012-12-03	2012-12-03	ENSG00000141971	ENSG00000141971			25153	protein-coding gene	gene with protein product			"""family with sequence similarity 125, member A"""	FAM125A		18005716, 20654576, 22232651	Standard	NM_138401		Approved	FLJ32495	uc002ngo.1	Q96EY5	OTTHUMG00000166252	ENST00000529490.1:c.196+2618->CTTAA	19.37:g.17526532_17526536dupCTTAA		Somatic	NA	NA	NA		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q96I18	RNA	INS	9	57.14	12	32	38.46	20	-	NULL	ENST00000529490.1	37	NULL		19																																																																																			-	-		0.490	MVB12A-011	PUTATIVE	mRNA_end_NF|basic|exp_conf	processed_transcript	ENSG00000269640	protein_coding	OTTHUMT00000388722.1	-	NM_138401			17526532	+1	no_errors	ENST00000500836	ensembl	human	known	74_37	rna	INS	0.102:0.102	CTTAA
TAF6L	10629	genome.wustl.edu	37	11	62545600	62545600	+	Splice_Site	SNP	G	G	A			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr11:62545600G>A	ENST00000294168.3	+	4	586	c.385G>A	c.(385-387)Gtt>Att	p.V129I	TMEM223_ENST00000527073.1_Intron	NM_006473.3	NP_006464.1	Q9Y6J9	TAF6L_HUMAN	TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	129					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|histone H3 acetylation (GO:0043966)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	histone deacetylase complex (GO:0000118)|STAGA complex (GO:0030914)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			endometrium(2)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)	16						AGCTGTCAGAGGTGGCTGCCG	0.602																																																	0								ENSG00000162227						52.0	48.0	49.0					11																	62545600		2201	4299	6500	TAF6L	SO:0001630	splice_region_variant	0			-	HGNC	BC008785	CCDS8035.1	11q12.3	2008-02-01	2002-08-29		ENSG00000162227	ENSG00000162227			17305	protein-coding gene	gene with protein product		602946	"""TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425	Standard	NM_006473		Approved	PAF65A	uc001nvc.3	Q9Y6J9	OTTHUMG00000167610	ENST00000294168.3:c.385+1G>A	11.37:g.62545600G>A		Somatic	0	71	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	75	17.58	B2RAT0|Q96HA6	Missense_Mutation	SNP	23	0.00	0	33	19.51	8	pfam_TAF_TATA-bd,pfam_DUF1546,superfamily_Histone-fold,smart_TAF_TATA-bd	p.V129I	ENST00000294168.3	37	c.385	CCDS8035.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.145363	0.94603	.	.	ENSG00000162227	ENST00000294168;ENST00000529509	T;T	0.47528	0.84;0.92	5.69	5.69	0.88448	.	0.000000	0.64402	D	0.000001	T	0.56790	0.2009	L	0.50333	1.59	0.80722	D	1	D;D	0.63880	0.982;0.993	P;P	0.55923	0.479;0.787	T	0.53070	-0.8490	10	0.40728	T	0.16	-0.4222	15.3007	0.73949	0.0:0.0:1.0:0.0	.	129;129	B4DVM4;Q9Y6J9	.;TAF6L_HUMAN	I	129	ENSP00000294168:V129I;ENSP00000434662:V129I	ENSP00000294168:V129I	V	+	1	0	TAF6L	62302176	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.661000	0.91125	2.687000	0.91594	0.462000	0.41574	GTT	-	NULL		0.602	TAF6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF6L	protein_coding	OTTHUMT00000395352.1	G	NM_006473	-	Missense_Mutation	62545600	+1	no_errors	ENST00000294168	ensembl	human	known	74_37	missense	SNP	1.000	A
EPB41L1	2036	genome.wustl.edu	37	20	34797668	34797668	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr20:34797668C>T	ENST00000338074.2	+	15	2088	c.1927C>T	c.(1927-1929)Ctc>Ttc	p.L643F	EPB41L1_ENST00000479336.1_3'UTR|EPB41L1_ENST00000441639.1_Missense_Mutation_p.L569F|EPB41L1_ENST00000373950.2_Missense_Mutation_p.L534F|EPB41L1_ENST00000373941.1_Missense_Mutation_p.L643F|EPB41L1_ENST00000373946.3_Intron|EPB41L1_ENST00000202028.5_Missense_Mutation_p.L569F	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	643					cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					CCTGCCTGAGCTCGACCGGGA	0.612																																																	0								ENSG00000088367						62.0	54.0	57.0					20																	34797668		2203	4300	6503	EPB41L1	SO:0001583	missense	0			-	HGNC	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.1927C>T	20.37:g.34797668C>T	ENSP00000337168:p.Leu643Phe	Somatic	0	28	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	26	25.71	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Missense_Mutation	SNP	21	0.00	0	29	17.14	6	pfam_Band_4.1_C,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_SAB_dom,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pirsf_Band_41_protein,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.L643F	ENST00000338074.2	37	c.1927	CCDS13271.1	20	.	.	.	.	.	.	.	.	.	.	C	19.25	3.791357	0.70452	.	.	ENSG00000088367	ENST00000202028;ENST00000373950;ENST00000397315;ENST00000373951;ENST00000441639;ENST00000344237;ENST00000338074;ENST00000373941	D;D;D;D;D	0.91237	-2.81;-2.73;-2.81;-2.68;-2.68	5.87	4.92	0.64577	.	0.057628	0.64402	D	0.000002	D	0.92257	0.7544	L	0.36672	1.1	0.40977	D	0.984744	D;D;D;D;D;D	0.89917	0.999;1.0;0.997;0.992;0.997;0.992	D;D;D;D;P;P	0.85130	0.946;0.997;0.927;0.914;0.852;0.876	D	0.92095	0.5683	10	0.56958	D	0.05	-7.9001	13.8848	0.63702	0.0:0.9272:0.0:0.0728	.	643;932;643;534;534;569	B7Z653;E9PCJ3;Q9H4G0;Q9H4G0-3;B3KUB6;Q9H4G0-2	.;.;E41L1_HUMAN;.;.;.	F	569;534;643;534;569;932;643;643	ENSP00000202028:L569F;ENSP00000363061:L534F;ENSP00000399214:L569F;ENSP00000337168:L643F;ENSP00000363052:L643F	ENSP00000202028:L569F	L	+	1	0	EPB41L1	34261082	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.638000	0.46562	2.941000	0.99782	0.655000	0.94253	CTC	-	pirsf_Band_41_protein		0.612	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L1	protein_coding	OTTHUMT00000078978.3	C	NM_012156	-		34797668	+1	no_errors	ENST00000338074	ensembl	human	known	74_37	missense	SNP	1.000	T
ZFHX2	85446	genome.wustl.edu	37	14	23994340	23994340	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr14:23994340delT	ENST00000419474.3	-	9	5166	c.4811delA	c.(4810-4812)gagfs	p.E1604fs	RP11-66N24.4_ENST00000556354.1_RNA|RP11-66N24.4_ENST00000554403.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA	NM_033400.2	NP_207646.2	Q9C0A1	ZFHX2_HUMAN	zinc finger homeobox 2	1604					adult behavior (GO:0030534)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	5						GGTCTGGAACTCTGTGAACTT	0.592																																																	0								ENSG00000136367																																			ZFHX2	SO:0001589	frameshift_variant	0				HGNC	AB051549	CCDS55907.1	14q11.2	2012-03-09			ENSG00000136367	ENSG00000136367		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	20152	protein-coding gene	gene with protein product			"""zinc finger protein 409"""	ZNF409		11214970, 10470851	Standard	NM_033400		Approved	KIAA1762, KIAA1056, ZFH-5	uc010tno.2	Q9C0A1	OTTHUMG00000156894	ENST00000419474.3:c.4811delA	14.37:g.23994340delT	ENSP00000413418:p.Glu1604fs	Somatic	0	35	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	Q9UPU6	Frame_Shift_Del	DEL	21	0.00	0	48	4.00	2	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.E1604fs	ENST00000419474.3	37	c.4811	CCDS55907.1	14																																																																																			-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.592	ZFHX2-001	KNOWN	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ZFHX2	protein_coding	OTTHUMT00000346484.3	T	NM_014894			23994340	-1	no_errors	ENST00000419474	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
RCOR1	23186	genome.wustl.edu	37	14	103173719	103173719	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr14:103173719A>G	ENST00000570597.1	+	5	521	c.521A>G	c.(520-522)aAt>aGt	p.N174S	RCOR1_ENST00000262241.6_Missense_Mutation_p.N177S			Q9UKL0	RCOR1_HUMAN	REST corepressor 1	174	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.|Interaction with HDAC1.				blood coagulation (GO:0007596)|histone H4 deacetylation (GO:0070933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	12						CATAAACATAATATCGAAAAG	0.358																																																	0								ENSG00000089902						135.0	134.0	134.0					14																	103173719		2203	4300	6503	RCOR1	SO:0001583	missense	0			-	HGNC	AF155595	CCDS9974.1, CCDS9974.2	14q32.33	2004-04-16	2004-04-16	2004-04-16		ENSG00000089902			17441	protein-coding gene	gene with protein product		607675	"""REST corepressor"""	RCOR		10449787	Standard	NM_015156		Approved	COREST, KIAA0071	uc001ymb.4	Q9UKL0		ENST00000570597.1:c.521A>G	14.37:g.103173719A>G	ENSP00000459789:p.Asn174Ser	Somatic	0	60	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	32	23.81	Q15044|Q6P2I9|Q86VG5	Missense_Mutation	SNP	22	0.00	0	43	23.21	13	pfam_SANT/Myb,pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom,prints_Antifreeze_1	p.N177S	ENST00000570597.1	37	c.530		14	.	.	.	.	.	.	.	.	.	.	A	23.2	4.386572	0.82902	.	.	ENSG00000089902	ENST00000262241	.	.	.	4.98	4.98	0.66077	ELM2 domain (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.76314	0.3970	M	0.66939	2.045	0.80722	D	1	D	0.69078	0.997	D	0.70716	0.97	T	0.78360	-0.2234	9	0.54805	T	0.06	-29.9048	14.9728	0.71246	1.0:0.0:0.0:0.0	.	174	Q9UKL0	RCOR1_HUMAN	S	174	.	ENSP00000262241:N174S	N	+	2	0	RCOR1	102243472	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.255000	0.95524	2.007000	0.58848	0.533000	0.62120	AAT	-	superfamily_Homeodomain-like,pfscan_ELM2_dom		0.358	RCOR1-201	KNOWN	basic|appris_candidate	protein_coding	RCOR1	protein_coding		A	NM_015156	-		103173719	+1	no_errors	ENST00000262241	ensembl	human	known	74_37	missense	SNP	1.000	G
LARP4	113251	genome.wustl.edu	37	12	50855098	50855098	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr12:50855098G>T	ENST00000398473.2	+	11	1414	c.1302G>T	c.(1300-1302)caG>caT	p.Q434H	LARP4_ENST00000518444.1_Missense_Mutation_p.Q433H|LARP4_ENST00000293618.8_Intron|LARP4_ENST00000522085.1_Missense_Mutation_p.Q434H|LARP4_ENST00000347328.5_Missense_Mutation_p.Q363H|LARP4_ENST00000429001.3_Missense_Mutation_p.Q440H|LARP4_ENST00000518561.1_Missense_Mutation_p.Q364H	NM_052879.4|NM_199188.2	NP_443111.4|NP_954658.2	Q71RC2	LARP4_HUMAN	La ribonucleoprotein domain family, member 4	434					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	23						CCACTTTGCAGGTGGAACAGA	0.413																																																	0								ENSG00000161813						87.0	81.0	83.0					12																	50855098		1874	4100	5974	LARP4	SO:0001583	missense	0			-	HGNC	AY004310	CCDS41782.1, CCDS44879.1, CCDS44880.1, CCDS44879.2, CCDS53789.1, CCDS53790.1	12q13.12	2005-08-09			ENSG00000161813	ENSG00000161813		"""La ribonucleoprotein domain containing"""	24320	protein-coding gene	gene with protein product						12477932	Standard	NM_052879		Approved	PP13296	uc001rwp.2	Q71RC2	OTTHUMG00000163724	ENST00000398473.2:c.1302G>T	12.37:g.50855098G>T	ENSP00000381490:p.Gln434His	Somatic	0	34	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A8K6T1|E9PDG5|G3XAA8|G5E976|Q5CZ97|Q6ZV14|Q96NF9	Missense_Mutation	SNP	37	0.00	0	60	0.00	0	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd	p.Q440H	ENST00000398473.2	37	c.1320	CCDS41782.1	12	.	.	.	.	.	.	.	.	.	.	G	8.403	0.842491	0.16963	.	.	ENSG00000161813	ENST00000429001;ENST00000398473;ENST00000522085;ENST00000518444;ENST00000518561;ENST00000520064;ENST00000347328	T;T;T;T;T;T	0.49432	1.48;1.48;0.78;1.48;0.78;1.48	4.37	3.3	0.37823	.	0.345183	0.30752	N	0.008944	T	0.34250	0.0891	L	0.38175	1.15	0.80722	D	1	B;B;B;B;B	0.22146	0.065;0.003;0.046;0.003;0.002	B;B;B;B;B	0.21917	0.037;0.007;0.013;0.004;0.004	T	0.13335	-1.0513	10	0.44086	T	0.13	.	6.8529	0.24024	0.1201:0.1655:0.7144:0.0	.	335;433;363;434;440	Q71RC2-2;Q71RC2-3;G5E976;Q71RC2;Q71RC2-4	.;.;.;LARP4_HUMAN;.	H	440;434;434;433;364;335;363	ENSP00000415464:Q440H;ENSP00000381490:Q434H;ENSP00000429781:Q434H;ENSP00000429077:Q433H;ENSP00000430851:Q364H;ENSP00000340901:Q363H	ENSP00000340901:Q363H	Q	+	3	2	LARP4	49141365	1.000000	0.71417	0.993000	0.49108	0.559000	0.35586	2.047000	0.41269	0.889000	0.36185	0.462000	0.41574	CAG	-	NULL		0.413	LARP4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LARP4	protein_coding	OTTHUMT00000374981.1	G	NM_052879	-		50855098	+1	no_errors	ENST00000429001	ensembl	human	known	74_37	missense	SNP	0.980	T
KRT86	3892	genome.wustl.edu	37	12	52647544	52647544	+	Intron	SNP	G	G	A			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr12:52647544G>A	ENST00000544024.1	+	1	129				KRT121P_ENST00000529785.1_RNA			O43790	KRT86_HUMAN	keratin 86							extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		GGAGAACGCGGATCTCCTGCA	0.542																																																	0								ENSG00000135477																																			KRT121P	SO:0001627	intron_variant	0			-	HGNC	X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000544024.1:c.-5+4332G>A	12.37:g.52647544G>A		Somatic	0	45	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	52	59	46.85	P78387	RNA	SNP	23	0.00	0	64	49.61	63	-	NULL	ENST00000544024.1	37	NULL	CCDS41785.1	12																																																																																			-	-		0.542	KRT86-202	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT121P	protein_coding		G	NM_002284	-		52647544	-1	no_errors	ENST00000529785	ensembl	human	known	74_37	rna	SNP	0.182	A
B4GALNT1	2583	genome.wustl.edu	37	12	58025099	58025099	+	Silent	SNP	G	G	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr12:58025099G>T	ENST00000341156.4	-	3	851	c.267C>A	c.(265-267)ctC>ctA	p.L89L	B4GALNT1_ENST00000449184.3_Silent_p.L89L|B4GALNT1_ENST00000550764.1_Silent_p.L89L|B4GALNT1_ENST00000550943.1_Intron|B4GALNT1_ENST00000552350.1_Silent_p.L89L|B4GALNT1_ENST00000418555.2_Intron	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	89					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			AGGGGAGGGGGAGGCCCCCCC	0.592																																																	0								ENSG00000135454						79.0	90.0	86.0					12																	58025099		2203	4300	6503	B4GALNT1	SO:0001819	synonymous_variant	0			-	HGNC	M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.267C>A	12.37:g.58025099G>T		Somatic	0	24	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	58	312	15.63	B4DE26|Q8N636	Silent	SNP	32	0.00	0	425	21.88	119	pfam_Glyco_trans_2,pirsf_GM2_synthase	p.L89	ENST00000341156.4	37	c.267	CCDS8950.1	12																																																																																			-	pirsf_GM2_synthase		0.592	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT1	protein_coding	OTTHUMT00000407853.1	G	NM_001478	-		58025099	-1	no_errors	ENST00000341156	ensembl	human	known	74_37	silent	SNP	0.000	T
KIAA1462	57608	genome.wustl.edu	37	10	30315983	30315983	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr10:30315983G>T	ENST00000375377.1	-	3	3195	c.3094C>A	c.(3094-3096)Ctc>Atc	p.L1032I		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	1032					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						GACAGTGGGAGCCCTGCCCCC	0.582																																																	0								ENSG00000165757						93.0	94.0	94.0					10																	30315983		1898	4104	6002	KIAA1462	SO:0001583	missense	0			-	HGNC	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.3094C>A	10.37:g.30315983G>T	ENSP00000364526:p.Leu1032Ile	Somatic	0	24	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	16.67	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	23	0.00	0	46	0.00	0	NULL	p.L1032I	ENST00000375377.1	37	c.3094	CCDS41500.1	10	.	.	.	.	.	.	.	.	.	.	G	8.529	0.870641	0.17322	.	.	ENSG00000165757	ENST00000375377	T	0.12039	2.72	4.83	0.421	0.16451	.	1.285910	0.05103	N	0.487426	T	0.11324	0.0276	L	0.44542	1.39	0.09310	N	1	B	0.24426	0.103	B	0.18561	0.022	T	0.34179	-0.9839	10	0.30854	T	0.27	-1.2986	3.1634	0.06528	0.1357:0.3162:0.3954:0.1527	.	1032	Q9P266	K1462_HUMAN	I	1032	ENSP00000364526:L1032I	ENSP00000364526:L1032I	L	-	1	0	KIAA1462	30355989	0.000000	0.05858	0.000000	0.03702	0.197000	0.23852	0.215000	0.17562	-0.127000	0.11661	0.563000	0.77884	CTC	-	NULL		0.582	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1462	protein_coding	OTTHUMT00000047409.1	G	NM_020848	-		30315983	-1	no_errors	ENST00000375377	ensembl	human	known	74_37	missense	SNP	0.000	T
RP11-509A17.3	0	genome.wustl.edu	37	15	20554706	20554706	+	lincRNA	SNP	T	T	C	rs2133835	byFrequency	TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr15:20554706T>C	ENST00000557528.1	+	0	0				snoU13_ENST00000459119.1_RNA																							AGGCCCACGGTAAGAAGGAGC	0.647																																																	0								ENSG00000258654																																			RP11-509A17.3			0			-	Clone_based_vega_gene																													15.37:g.20554706T>C		Somatic	0	19	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	24	22.58		Splice_Site	SNP	42	19.23	10	67	24.72	22	-	NULL	ENST00000557528.1	37	c.NULL		15																																																																																			-	-		0.647	RP11-509A17.3-001	KNOWN	basic	lincRNA	ENSG00000258654	lincRNA	OTTHUMT00000414658.1	T		rs2133835		20554706	+1	no_errors	ENST00000554815	ensembl	human	known	74_37	splice_site	SNP	0.015	C
ENPP5	59084	genome.wustl.edu	37	6	46129094	46129094	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr6:46129094G>C	ENST00000371383.2	-	5	1663	c.1403C>G	c.(1402-1404)gCt>gGt	p.A468G	ENPP5_ENST00000230565.3_Missense_Mutation_p.A468G					ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)											endometrium(3)|kidney(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	12						AGCTATTTCAGCATGCATATC	0.328																																																	0								ENSG00000112796						45.0	43.0	44.0					6																	46129094		2203	4299	6502	ENPP5	SO:0001583	missense	0			-	HGNC	AL035701	CCDS4915.1	6p21.1-p11.2	2010-06-24	2010-06-24		ENSG00000112796	ENSG00000112796			13717	protein-coding gene	gene with protein product						11027689	Standard	XM_005249259		Approved		uc003oxz.1	Q9UJA9	OTTHUMG00000014781	ENST00000371383.2:c.1403C>G	6.37:g.46129094G>C	ENSP00000360436:p.Ala468Gly	Somatic	0	45	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00		Missense_Mutation	SNP	32	0.00	0	51	5.56	3	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.A468G	ENST00000371383.2	37	c.1403	CCDS4915.1	6	.	.	.	.	.	.	.	.	.	.	G	10.90	1.480524	0.26598	.	.	ENSG00000112796	ENST00000371383;ENST00000230565	T;T	0.74315	-0.83;-0.83	5.81	2.03	0.26663	.	2.478390	0.01605	N	0.022228	T	0.48519	0.1504	L	0.50333	1.59	0.23616	N	0.997283	B	0.06786	0.001	B	0.04013	0.001	T	0.10359	-1.0633	10	0.31617	T	0.26	-3.2242	6.6069	0.22729	0.1533:0.2759:0.5707:0.0	.	468	Q9UJA9	ENPP5_HUMAN	G	468	ENSP00000360436:A468G;ENSP00000230565:A468G	ENSP00000230565:A468G	A	-	2	0	ENPP5	46237053	0.610000	0.26983	0.995000	0.50966	0.918000	0.54935	1.053000	0.30442	0.095000	0.17434	-0.933000	0.02702	GCT	-	NULL		0.328	ENPP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP5	protein_coding	OTTHUMT00000040779.2	G		-		46129094	-1	no_errors	ENST00000230565	ensembl	human	known	74_37	missense	SNP	0.988	C
ARFRP1	10139	genome.wustl.edu	37	20	62331337	62331343	+	3'UTR	DEL	GGGGTCA	GGGGTCA	-	rs36121811		TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	GGGGTCA	GGGGTCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr20:62331337_62331343delGGGGTCA	ENST00000359715.5	-	0	1624_1630				ARFRP1_ENST00000324228.2_3'UTR|ARFRP1_ENST00000485858.1_5'UTR|ARFRP1_ENST00000609142.1_3'UTR|ARFRP1_ENST00000440854.1_3'UTR			Q13795	ARFRP_HUMAN	ADP-ribosylation factor related protein 1						gastrulation (GO:0007369)|Golgi to plasma membrane protein transport (GO:0043001)|GTP catabolic process (GO:0006184)|protein localization to Golgi apparatus (GO:0034067)|retrograde transport, endosome to Golgi (GO:0042147)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(38;9.53e-13)|all_epithelial(29;2.64e-14)|Lung NSC(23;7e-10)|all_lung(23;2.53e-09)		Epithelial(9;4.09e-08)|all cancers(9;1.7e-07)|OV - Ovarian serous cystadenocarcinoma(5;0.0102)			AGACCACTTcggggtcacggggtcacg	0.671																																																	0								ENSG00000101246																																			ARFRP1	SO:0001624	3_prime_UTR_variant	0				HGNC	X91504	CCDS13533.1, CCDS46630.1, CCDS68172.1, CCDS68173.1	20q13.3	2014-05-09			ENSG00000101246	ENSG00000101246		"""ADP-ribosylation factors"""	662	protein-coding gene	gene with protein product		604699				8530503	Standard	NM_003224		Approved	ARP, Arp1, ARL18	uc031rup.1	Q13795	OTTHUMG00000032993	ENST00000359715.5:c.*458TGACCCC>-	20.37:g.62331337_62331343delGGGGTCA		Somatic	NA	NA	NA		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B7ZKX7|E1P5J9|Q6IBQ0	RNA	DEL	14	36.36	8	17	0.00	0	-	NULL	ENST00000359715.5	37	NULL	CCDS13533.1	20																																																																																			-	-		0.671	ARFRP1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARFRP1	protein_coding	OTTHUMT00000472024.1	GGGGTCA				62331343	-1	no_errors	ENST00000485858	ensembl	human	known	74_37	rna	DEL	0.010:0.010:0.010:0.009:0.008:0.006:0.005	-
B4GALNT1	2583	genome.wustl.edu	37	12	58024808	58024808	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr12:58024808G>C	ENST00000341156.4	-	4	1029	c.445C>G	c.(445-447)Cta>Gta	p.L149V	B4GALNT1_ENST00000449184.3_Missense_Mutation_p.L149V|B4GALNT1_ENST00000550764.1_Missense_Mutation_p.L149V|B4GALNT1_ENST00000550943.1_5'Flank|B4GALNT1_ENST00000552350.1_Missense_Mutation_p.L149V|B4GALNT1_ENST00000418555.2_Missense_Mutation_p.L94V	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	149					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			ACACCCTGTAGGGGGTACTGG	0.647																																																	0								ENSG00000135454						41.0	43.0	42.0					12																	58024808		2203	4300	6503	B4GALNT1	SO:0001583	missense	0			-	HGNC	M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.445C>G	12.37:g.58024808G>C	ENSP00000341562:p.Leu149Val	Somatic	0	20	0.00		0.6231291131007073	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	66	260	20.18	B4DE26|Q8N636	Missense_Mutation	SNP	35	0.00	0	501	20.48	129	pfam_Glyco_trans_2,pirsf_GM2_synthase	p.L149V	ENST00000341156.4	37	c.445	CCDS8950.1	12	.	.	.	.	.	.	.	.	.	.	.	2.007	-0.428109	0.04701	.	.	ENSG00000135454	ENST00000341156;ENST00000418555;ENST00000550764;ENST00000552350;ENST00000548888	T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82	4.76	3.86	0.44501	.	0.135630	0.48286	D	0.000186	T	0.14960	0.0361	N	0.16567	0.415	0.32800	D	0.500028	P;P;B;B	0.46859	0.885;0.817;0.2;0.001	P;B;B;B	0.48189	0.57;0.23;0.051;0.003	T	0.13791	-1.0496	10	0.08179	T	0.78	-0.6081	3.8168	0.08818	0.0901:0.16:0.585:0.1649	.	149;94;149;149	B4DSP5;B4DE26;Q8N636;Q00973	.;.;.;B4GN1_HUMAN	V	149;94;149;149;149	ENSP00000341562:L149V;ENSP00000401601:L94V;ENSP00000450303:L149V;ENSP00000448500:L149V;ENSP00000447945:L149V	ENSP00000341562:L149V	L	-	1	2	B4GALNT1	56311075	0.983000	0.35010	0.999000	0.59377	0.919000	0.55068	2.005000	0.40864	1.194000	0.43101	0.609000	0.83330	CTA	-	pirsf_GM2_synthase		0.647	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT1	protein_coding	OTTHUMT00000407853.1	G	NM_001478	-		58024808	-1	no_errors	ENST00000341156	ensembl	human	known	74_37	missense	SNP	0.988	C
