#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
LOC440040	440040	genome.wustl.edu	37	11	49598216	49598222	+	RNA	DEL	AGAAGCC	AGAAGCC	-	rs372596512		TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	AGAAGCC	AGAAGCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr11:49598216_49598222delAGAAGCC	ENST00000527477.1	+	0	820_826																											TTCTGCTCCAAGAAGCCCATAGTAGGG	0.498																																																	0								ENSG00000205035																																			RP11-707M1.1			0				Clone_based_vega_gene																													11.37:g.49598216_49598222delAGAAGCC		Somatic	NA	NA	NA		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	7	41.67	5	17	0.00	0	-	NULL	ENST00000527477.1	37	NULL		11																																																																																			-	-		0.498	RP11-707M1.1-003	KNOWN	basic	processed_transcript	LOC440040	pseudogene	OTTHUMT00000391378.2	AGAAGCC				49598222	+1	no_errors	ENST00000527477	ensembl	human	known	74_37	rna	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
GVINP1	387751	genome.wustl.edu	37	11	6739525	6739525	+	RNA	SNP	T	T	G			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr11:6739525T>G	ENST00000526769.3	-	0	3679					NR_003945.1		Q7Z2Y8	GVIN1_HUMAN	GTPase, very large interferon inducible pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										GCCTCATTTCTATTCTTGATA	0.433																																																	0								ENSG00000254838																																			GVINP1			0			-	HGNC	BX538318		11p15.4	2014-03-18	2010-09-28	2010-09-28	ENSG00000254838	ENSG00000254838			25813	pseudogene	pseudogene	"""very large inducible GTPase 1"""		"""GTPase, very large interferon inducible 1"", ""GTPase, very large interferon inducible 1, pseudogene"""	GVIN1, GVIN1P		12874213, 19369598	Standard	NR_003945		Approved	VLIG-1, FLJ13373, VLIG1	uc001meo.4	Q7Z2Y8	OTTHUMG00000165506		11.37:g.6739525T>G		Somatic	0	31	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	24	25.00	A6NFL2|Q9H8N5	RNA	SNP	32	0.00	0	33	25.00	11	-	NULL	ENST00000526769.3	37	NULL		11																																																																																			-	-		0.433	GVINP1-002	KNOWN	basic|exp_conf	processed_transcript	GVINP1	pseudogene	OTTHUMT00000386960.3	T	NR_003945	-		6739525	-1	no_errors	ENST00000526769	ensembl	human	known	74_37	rna	SNP	1.000	G
STXBP1	6812	genome.wustl.edu	37	9	130438208	130438208	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr9:130438208C>G	ENST00000373299.1	+	14	1351	c.1236C>G	c.(1234-1236)atC>atG	p.I412M	STXBP1_ENST00000481942.1_3'UTR|STXBP1_ENST00000373302.3_Missense_Mutation_p.I412M	NM_001032221.3	NP_001027392.1	P61764	STXB1_HUMAN	syntaxin binding protein 1	412					axon target recognition (GO:0007412)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long term synaptic depression (GO:0060292)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|protein stabilization (GO:0050821)|protein transport (GO:0015031)|regulation of insulin secretion (GO:0050796)|regulation of SNARE complex assembly (GO:0035542)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|regulation of synaptic vesicle priming (GO:0010807)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|SNARE binding (GO:0000149)|syntaxin binding (GO:0019905)|syntaxin-1 binding (GO:0017075)			breast(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|skin(2)	23						TTCTCTACATCTTTTTGAAGA	0.488																																																	0								ENSG00000136854						115.0	87.0	96.0					9																	130438208		2203	4300	6503	STXBP1	SO:0001583	missense	0			-	HGNC	AF004563	CCDS6874.1, CCDS35146.1	9q34.1	2008-07-21			ENSG00000136854	ENSG00000136854			11444	protein-coding gene	gene with protein product	"""syntaxin-binding protein 1"""	602926				9545644	Standard	NM_001032221		Approved	hUNC18, MUNC18-1, UNC18, rbSec1	uc004brk.2	P61764	OTTHUMG00000020713	ENST00000373299.1:c.1236C>G	9.37:g.130438208C>G	ENSP00000362396:p.Ile412Met	Somatic	0	61	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	43	20.37	B1AM97|Q28208|Q62759|Q64320|Q96TG8	Missense_Mutation	SNP	29	3.33	1	39	31.58	18	pfam_Sec1-like,superfamily_Sec1-like	p.I412M	ENST00000373299.1	37	c.1236	CCDS35146.1	9	.	.	.	.	.	.	.	.	.	.	C	16.54	3.152395	0.57259	.	.	ENSG00000136854	ENST00000535154;ENST00000373302;ENST00000541198;ENST00000373299	T;T	0.78126	-1.15;-1.15	5.61	3.76	0.43208	.	0.000000	0.85682	D	0.000000	D	0.86940	0.6054	M	0.86651	2.83	0.58432	D	0.999993	D;D	0.76494	0.999;0.999	D;D	0.74348	0.983;0.972	D	0.86175	0.1602	10	0.87932	D	0	-6.8574	6.9786	0.24690	0.3084:0.6117:0.0:0.0799	.	412;412	P61764;P61764-2	STXB1_HUMAN;.	M	366;412;244;412	ENSP00000362399:I412M;ENSP00000362396:I412M	ENSP00000362396:I412M	I	+	3	3	STXBP1	129478029	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.041000	0.30291	0.829000	0.34733	0.655000	0.94253	ATC	-	pfam_Sec1-like,superfamily_Sec1-like		0.488	STXBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP1	protein_coding	OTTHUMT00000054229.1	C	NM_003165	-		130438208	+1	no_errors	ENST00000373299	ensembl	human	known	74_37	missense	SNP	1.000	G
ABLIM1	3983	genome.wustl.edu	37	10	116444077	116444077	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr10:116444077G>T	ENST00000369252.4	-	1	337	c.36C>A	c.(34-36)gaC>gaA	p.D12E	ABLIM1_ENST00000533213.2_Missense_Mutation_p.D12E	NM_001003407.1|NM_001003408.1	NP_001003407.1|NP_001003408.1	O14639	ABLM1_HUMAN	actin binding LIM protein 1	0					axon guidance (GO:0007411)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	30		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		TGTGATGAGGGTCCGTGAGCT	0.463																																																	0								ENSG00000099204						205.0	165.0	179.0					10																	116444077		2203	4300	6503	ABLIM1	SO:0001583	missense	0			-	HGNC	AF005654	CCDS7590.1, CCDS31289.1	10q25	2008-07-07		2002-09-13	ENSG00000099204	ENSG00000099204			78	protein-coding gene	gene with protein product		602330		LIMAB1, ABLIM		9245787	Standard	NM_002313		Approved	abLIM, limatin	uc021pyw.1	O14639	OTTHUMG00000019088	ENST00000369252.4:c.36C>A	10.37:g.116444077G>T	ENSP00000358256:p.Asp12Glu	Somatic	0	53	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	51	8.93	A6NI16|A6NJ06|A8MXA9|B3KVH2|Q15039|Q5JVV1|Q5JVV2|Q5T6N2|Q5T6N3|Q5T6N5|Q68CQ9|Q9BUP1	Missense_Mutation	SNP	17	0.00	0	35	0.00	0	pfam_Znf_LIM,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Znf_LIM,smart_Villin_headpiece,pfscan_Villin_headpiece,pfscan_Znf_LIM	p.D12E	ENST00000369252.4	37	c.36	CCDS31288.1	10	.	.	.	.	.	.	.	.	.	.	G	10.77	1.443344	0.25987	.	.	ENSG00000099204	ENST00000369252;ENST00000369267;ENST00000533213	T;T	0.26660	1.72;1.72	5.87	0.515	0.17013	.	.	.	.	.	T	0.09113	0.0225	N	0.08118	0	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.35400	-0.9790	9	0.02654	T	1	.	6.978	0.24688	0.155:0.4145:0.4304:0.0	.	12;12;12	F8W8M4;A6NKJ2;B3KVH2	.;.;.	E	12	ENSP00000358256:D12E;ENSP00000433629:D12E	ENSP00000358256:D12E	D	-	3	2	ABLIM1	116434067	0.667000	0.27484	0.919000	0.36401	0.383000	0.30230	0.301000	0.19174	0.176000	0.19873	0.655000	0.94253	GAC	-	NULL		0.463	ABLIM1-201	KNOWN	basic|CCDS	protein_coding	ABLIM1	protein_coding		G		-		116444077	-1	no_errors	ENST00000369252	ensembl	human	known	74_37	missense	SNP	0.963	T
U2SURP	23350	genome.wustl.edu	37	3	142720221	142720222	+	5'Flank	INS	-	-	GGACAACGA	rs3832221|rs11282240	byFrequency	TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr3:142720221_142720222insGGACAACGA	ENST00000473835.2	+	0	0				RP11-372E1.6_ENST00000595774.1_RNA|RP11-372E1.6_ENST00000595248.1_RNA|U2SURP_ENST00000493598.2_5'Flank|U2SURP_ENST00000397933.2_5'Flank|RP11-372E1.6_ENST00000497652.1_RNA|RP11-91G21.1_ENST00000597953.1_lincRNA	NM_001080415.1	NP_001073884.1	O15042	SR140_HUMAN	U2 snRNP-associated SURP domain containing						RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	31						CAGCTGGCCCTGATTCTCTGAA	0.515														3604	0.719649	0.8949	0.6988	5008	,	,		19350	0.7212		0.6183	False		,,,				2504	0.6002																0								ENSG00000241570																																			RP11-372E1.6	SO:0001631	upstream_gene_variant	0				Clone_based_vega_gene	BK000564	CCDS46928.1	3q23	2013-02-12			ENSG00000163714	ENSG00000163714		"""RNA binding motif (RRM) containing"""	30855	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein a"", ""Ser/Arg-rich domain protein, 140 kDa"", ""U2 associated SR140 protein"""					9205841, 12234937	Standard	NM_001080415		Approved	fSAPa, SR140	uc003evh.1	O15042	OTTHUMG00000159323		3.37:g.142720221_142720222insGGACAACGA	Exception_encountered	Somatic	NA	NA	NA		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A0PJ60|Q0D2M1|Q2NKQ7|Q9BR70	RNA	INS	5	75.00	15	17	60.47	26	-	NULL	ENST00000473835.2	37	NULL	CCDS46928.1	3																																																																																			-	-		0.515	U2SURP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927832	protein_coding	OTTHUMT00000354603.2	-	NM_001080415			142720222	+1	no_errors	ENST00000595248	ensembl	human	known	74_37	rna	INS	0.005:0.015	GGACAACGA
PRB3	5544	genome.wustl.edu	37	12	11420936	11420936	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr12:11420936G>A	ENST00000279573.7	-	3	382	c.247C>T	c.(247-249)Cca>Tca	p.P83S	PRB3_ENST00000440870.3_5'UTR|PRB3_ENST00000538488.1_Missense_Mutation_p.P83S|PRB3_ENST00000381842.3_Missense_Mutation_p.P83S			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	83	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			CCTCCTTGTGGGGGTGGTCCT	0.627																																																	0								ENSG00000197870						143.0	174.0	164.0					12																	11420936		2141	4261	6402	PRB3	SO:0001583	missense	0			-	HGNC			12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.247C>T	12.37:g.11420936G>A	ENSP00000279573:p.Pro83Ser	Somatic	0	59	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	126	125	50.00	Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Missense_Mutation	SNP	10	0.00	0	17	55.26	21	NULL	p.P83S	ENST00000279573.7	37	c.247		12	.	.	.	.	.	.	.	.	.	.	.	7.309	0.614614	0.14129	.	.	ENSG00000197870	ENST00000381842;ENST00000538488	T;T	0.05081	3.5;3.5	0.948	-0.147	0.13428	.	.	.	.	.	T	0.03783	0.0107	.	.	.	0.09310	N	1	P	0.48694	0.914	B	0.35182	0.197	T	0.41752	-0.9491	8	0.46703	T	0.11	.	5.7815	0.18310	0.0:0.0:0.6862:0.3137	.	83	Q04118	PRB3_HUMAN	S	83	ENSP00000371264:P83S;ENSP00000442626:P83S	ENSP00000279573:P83S	P	-	1	0	PRB3	11312203	0.391000	0.25221	0.001000	0.08648	0.035000	0.12851	1.251000	0.32862	-0.051000	0.13334	0.194000	0.17425	CCA	-	NULL		0.627	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	PRB3	protein_coding	OTTHUMT00000402119.5	G	NM_006249	-		11420936	-1	no_errors	ENST00000381842	ensembl	human	known	74_37	missense	SNP	0.193	A
METTL21B	25895	genome.wustl.edu	37	12	58163396	58163396	+	5'Flank	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr12:58163396G>A	ENST00000300209.8	+	0	0				METTL21B_ENST00000551420.1_5'Flank|METTL21B_ENST00000548256.1_5'Flank|METTL1_ENST00000257848.7_Missense_Mutation_p.H114Y|METTL1_ENST00000548681.1_5'Flank|CYP27B1_ENST00000228606.4_5'Flank|METTL1_ENST00000324871.7_Silent_p.I175I	NM_015433.2	NP_056248.2	Q96AZ1	MT21B_HUMAN	methyltransferase like 21B							cytoplasm (GO:0005737)|intracellular (GO:0005622)	methyltransferase activity (GO:0008168)			endometrium(1)|lung(1)	2						TGGGACTGATGATTCGCCACT	0.537																																																	0								ENSG00000037897						184.0	160.0	168.0					12																	58163396		2203	4300	6503	METTL1	SO:0001631	upstream_gene_variant	0			-	HGNC	AL050100, AF455816	CCDS8957.1, CCDS31848.1	12q14.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000123427	ENSG00000123427			24936	protein-coding gene	gene with protein product		615258	"""family with sequence similarity 119, member B"""	FAM119B		12477932	Standard	NM_015433		Approved	DKFZP586D0919	uc001sqg.3	Q96AZ1	OTTHUMG00000170459		12.37:g.58163396G>A	Exception_encountered	Somatic	0	39	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	123	227	35.14	Q9H749|Q9Y3W2	Missense_Mutation	SNP	26	0.00	0	251	36.78	146	NULL	p.H114Y	ENST00000300209.8	37	c.340	CCDS8957.1	12	.	.	.	.	.	.	.	.	.	.	G	8.570	0.879932	0.17467	.	.	ENSG00000037897	ENST00000257848;ENST00000547653;ENST00000548504	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	T	0.15565	0.0375	.	.	.	0.26733	N	0.970553	B	0.24258	0.1	B	0.22152	0.038	T	0.23619	-1.0183	7	0.02654	T	1	-17.6657	8.8521	0.35206	0.1603:0.0:0.8397:0.0	.	114	Q53FS9	.	Y	114;15;40	.	ENSP00000257848:H114Y	H	-	1	0	METTL1	56449663	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.454000	0.60068	2.690000	0.91761	0.655000	0.94253	CAT	-	NULL		0.537	METTL21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL1	protein_coding	OTTHUMT00000409268.1	G	NM_015433	-		58163396	-1	no_errors	ENST00000257848	ensembl	human	known	74_37	missense	SNP	1.000	A
WDFY4	57705	genome.wustl.edu	37	10	50098744	50098744	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr10:50098744G>C	ENST00000325239.5	+	43	7315	c.7288G>C	c.(7288-7290)Gtc>Ctc	p.V2430L	RP11-523O18.7_ENST00000430438.1_RNA|WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	2430						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CACGGGTGATGTCTACTGTAC	0.537																																																	0								ENSG00000128815						118.0	90.0	99.0					10																	50098744		692	1591	2283	WDFY4	SO:0001583	missense	0			-	HGNC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.7288G>C	10.37:g.50098744G>C	ENSP00000320563:p.Val2430Leu	Somatic	0	63	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	63	12.50	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	19	0.00	0	27	25.00	9	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V2430L	ENST00000325239.5	37	c.7288	CCDS44385.1	10	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	15.40|15.40|15.40	2.821460|2.821460|2.821460	0.50633|0.50633|0.50633	.|.|.	.|.|.	ENSG00000128815|ENSG00000128815|ENSG00000128815	ENST00000312002|ENST00000265453|ENST00000426033;ENST00000325239	.|.|T	.|.|0.60171	.|.|0.21	4.83|4.83|4.83	3.92|3.92|3.92	0.45320|0.45320|0.45320	.|.|PH-BEACH domain (1);	.|.|0.161988	.|.|0.39687	.|.|N	.|.|0.001300	T|T|T	0.48857|0.48857|0.48857	0.1523|0.1523|0.1523	M|M|M	0.64997|0.64997|0.64997	1.995|1.995|1.995	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|B	.|.|0.33857	.|.|0.429	.|.|B	.|.|0.28232	.|.|0.087	T|T|T	0.45234|0.45234|0.45234	-0.9275|-0.9275|-0.9275	5|5|9	.|.|.	.|.|.	.|.|.	.|.|.	9.1137|9.1137|9.1137	0.36744|0.36744|0.36744	0.1021:0.0:0.8979:0.0|0.1021:0.0:0.8979:0.0|0.1021:0.0:0.8979:0.0	.|.|.	.|.|2430	.|.|Q6ZS81	.|.|WDFY4_HUMAN	S|I|L	1520|516|2430	.|.|ENSP00000320563:V2430L	.|.|.	C|M|V	+|+|+	2|3|1	0|0|0	WDFY4|WDFY4|WDFY4	49768750|49768750|49768750	0.989000|0.989000|0.989000	0.36119|0.36119|0.36119	0.983000|0.983000|0.983000	0.44433|0.44433|0.44433	0.949000|0.949000|0.949000	0.60115|0.60115|0.60115	2.128000|2.128000|2.128000	0.42045|0.42045|0.42045	1.149000|1.149000|1.149000	0.42402|0.42402|0.42402	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	TGT|ATG|GTC	-	NULL		0.537	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	protein_coding		G	XM_033379	-		50098744	+1	no_errors	ENST00000325239	ensembl	human	known	74_37	missense	SNP	0.998	C
PLD2	5338	genome.wustl.edu	37	17	4711609	4711609	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr17:4711609G>T	ENST00000263088.6	+	4	412	c.281G>T	c.(280-282)gGc>gTc	p.G94V	RP11-81A22.5_ENST00000571067.1_lincRNA|PLD2_ENST00000572940.1_Missense_Mutation_p.G94V	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	94	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor internalization (GO:0002031)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					Choline(DB00122)	TTGACTCACGGCGACTTTTCC	0.552																																																	0								ENSG00000129219						190.0	181.0	184.0					17																	4711609		2203	4300	6503	PLD2	SO:0001583	missense	0			-	HGNC	AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219	3.1.4.4		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384				9858823, 9582313	Standard	NM_002663		Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.281G>T	17.37:g.4711609G>T	ENSP00000263088:p.Gly94Val	Somatic	0	28	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	Missense_Mutation	SNP	26	0.00	0	38	0.00	0	pfam_Phox,pfam_PLipase_D/transphosphatidylase,superfamily_Phox,smart_Phox,smart_Pleckstrin_homology,smart_PLipase_D/transphosphatidylase,pirsf_PLipase_D_euk,pfscan_Phox,pfscan_PLipase_D/transphosphatidylase	p.G94V	ENST00000263088.6	37	c.281	CCDS11057.1	17	.	.	.	.	.	.	.	.	.	.	G	23.7	4.452119	0.84209	.	.	ENSG00000129219	ENST00000263088	T	0.32988	1.43	5.37	4.39	0.52855	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.57829	0.2080	M	0.86028	2.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.64067	-0.6494	10	0.87932	D	0	-17.0607	12.329	0.55028	0.0853:0.0:0.9147:0.0	.	94;94	O14939-2;O14939	.;PLD2_HUMAN	V	94	ENSP00000263088:G94V	ENSP00000263088:G94V	G	+	2	0	PLD2	4658573	1.000000	0.71417	0.874000	0.34290	0.960000	0.62799	6.095000	0.71439	2.497000	0.84241	0.561000	0.74099	GGC	-	pfam_Phox,superfamily_Phox,smart_Phox,pirsf_PLipase_D_euk,pfscan_Phox		0.552	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD2	protein_coding	OTTHUMT00000207561.3	G	NM_002663	-		4711609	+1	no_errors	ENST00000263088	ensembl	human	known	74_37	missense	SNP	0.993	T
USP6	9098	genome.wustl.edu	37	17	5072153	5072153	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr17:5072153G>C	ENST00000574788.1	+	35	5550	c.3320G>C	c.(3319-3321)aGt>aCt	p.S1107T	USP6_ENST00000332776.4_3'UTR|USP6_ENST00000304328.5_Missense_Mutation_p.S790T|USP6_ENST00000250066.6_Missense_Mutation_p.S1107T			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	1107	USP.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						TTTGATCCGAGTGCTTTTTTG	0.463			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																			Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	0								ENSG00000129204						107.0	118.0	114.0					17																	5072153		2203	4300	6503	USP6	SO:0001583	missense	0			-	HGNC	X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.3320G>C	17.37:g.5072153G>C	ENSP00000460380:p.Ser1107Thr	Somatic	0	79	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	94	25.40	Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	28	0.00	0	40	23.08	12	pfam_Peptidase_C19/C67,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom,pfscan_Peptidase_C19/C67	p.S1107T	ENST00000574788.1	37	c.3320	CCDS11069.2	17	.	.	.	.	.	.	.	.	.	.	G	7.566	0.665660	0.14710	.	.	ENSG00000129204	ENST00000250066;ENST00000304328	T;T	0.35048	1.33;1.33	2.35	2.35	0.29111	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.110562	0.85682	D	0.000000	T	0.37293	0.0998	L	0.28504	0.86	0.48571	D	0.99967	P;D	0.67145	0.933;0.996	P;P	0.57283	0.597;0.817	T	0.09207	-1.0685	10	0.37606	T	0.19	.	10.4068	0.44266	0.0:0.0:1.0:0.0	.	790;1107	P35125-2;P35125	.;UBP6_HUMAN	T	1107;790	ENSP00000250066:S1107T;ENSP00000305473:S790T	ENSP00000250066:S1107T	S	+	2	0	USP6	5012877	1.000000	0.71417	1.000000	0.80357	0.122000	0.20287	8.953000	0.93041	1.313000	0.45069	0.184000	0.17185	AGT	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.463	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP6	protein_coding	OTTHUMT00000438990.1	G	NM_004505	-		5072153	+1	no_errors	ENST00000250066	ensembl	human	known	74_37	missense	SNP	1.000	C
NTSR1	4923	genome.wustl.edu	37	20	61364426	61364427	+	Intron	INS	-	-	ACGTATCCA	rs11473957|rs35976792	byFrequency	TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr20:61364426_61364427insACGTATCCA	ENST00000370501.3	+	2	1085				RP11-93B14.4_ENST00000430184.1_RNA	NM_002531.2	NP_002522.2	P30989	NTR1_HUMAN	neurotensin receptor 1 (high affinity)						adult locomotory behavior (GO:0008344)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(16)|prostate(1)|skin(3)	27	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			GCCCTGAGGCCACGTATCCAAG	0.554																																					GBM(37;400 780 6403 19663 35669)												0								ENSG00000223669																																			RP11-93B14.4	SO:0001627	intron_variant	0				Clone_based_vega_gene		CCDS13502.1	20q13	2012-08-08			ENSG00000101188	ENSG00000101188		"""GPCR / Class A : Neurotensin receptors"""	8039	protein-coding gene	gene with protein product		162651				8075503	Standard	NM_002531		Approved	NTR	uc002ydf.3	P30989	OTTHUMG00000032932	ENST00000370501.3:c.715-21610->ACGTATCCA	20.37:g.61364427_61364435dupACGTATCCA		Somatic	NA	NA	NA		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q9H4H1|Q9H4T5	RNA	INS	8	61.90	13	13	50.00	13	-	NULL	ENST00000370501.3	37	NULL	CCDS13502.1	20																																																																																			-	-		0.554	NTSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000223669	protein_coding	OTTHUMT00000080061.1	-				61364427	-1	no_errors	ENST00000430184	ensembl	human	known	74_37	rna	INS	0.055:0.020	ACGTATCCA
SLC6A18	348932	genome.wustl.edu	37	5	1238115	1238115	+	Silent	SNP	C	C	G	rs111842636	byFrequency	TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr5:1238115C>G	ENST00000324642.3	+	5	795	c.672C>G	c.(670-672)ctC>ctG	p.L224L	SLC6A18_ENST00000296821.4_Silent_p.L224L	NM_182632.2	NP_872438.2	Q96N87	S6A18_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 18	224					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(4)|upper_aerodigestive_tract(1)	34	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CCATCTTTCTCATCAGAGGGC	0.493																																																	0								ENSG00000164363						152.0	141.0	145.0					5																	1238115		2203	4300	6503	SLC6A18	SO:0001819	synonymous_variant	0			-	HGNC	AK055798	CCDS3860.1	5p15	2013-07-19	2013-07-19		ENSG00000164363	ENSG00000164363		"""Solute carriers"""	26441	protein-coding gene	gene with protein product		610300	"""solute carrier family 6 (neurotransmitter transporter), member 18"", ""solute carrier family 6, member 18"""			19478081	Standard	NM_182632		Approved	FLJ31236, Xtrp2	uc003jby.2	Q96N87	OTTHUMG00000090356	ENST00000324642.3:c.672C>G	5.37:g.1238115C>G		Somatic	0	53	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	162	135	54.36		Silent	SNP	31	0.00	0	85	58.69	125	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.L224	ENST00000324642.3	37	c.672	CCDS3860.1	5																																																																																			-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport		0.493	SLC6A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A18	protein_coding	OTTHUMT00000206728.3	C	NM_182632	-		1238115	+1	no_errors	ENST00000324642	ensembl	human	known	74_37	silent	SNP	0.906	G
FSD1L	83856	genome.wustl.edu	37	9	108246756	108246756	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr9:108246756A>G	ENST00000481272.1	+	7	678	c.559A>G	c.(559-561)Atg>Gtg	p.M187V	FSD1L_ENST00000484973.1_Missense_Mutation_p.M155V|FSD1L_ENST00000495708.1_Missense_Mutation_p.M187V|FSD1L_ENST00000480279.1_3'UTR|FSD1L_ENST00000374710.3_Missense_Mutation_p.M155V|FSD1L_ENST00000394926.3_Missense_Mutation_p.M155V|FSD1L_ENST00000539376.1_Missense_Mutation_p.M30V	NM_001145313.1	NP_001138785.1	Q9BXM9	FSD1L_HUMAN	fibronectin type III and SPRY domain containing 1-like	187	COS. {ECO:0000255|PROSITE- ProRule:PRU00586}.									NS(1)|endometrium(1)	2						GGAAAGACAGATGCTGCAAAC	0.353																																																	0								ENSG00000106701						65.0	58.0	60.0					9																	108246756		692	1591	2283	FSD1L	SO:0001583	missense	0			-	HGNC	AF316830	CCDS6765.2, CCDS47999.1, CCDS6765.3, CCDS75870.1	9q31	2013-02-11	2006-03-10	2006-03-10	ENSG00000106701	ENSG00000106701		"""Fibronectin type III domain containing"""	13753	protein-coding gene	gene with protein product		609829	"""cystatin and DUF19 domain containing 1"", ""coiled-coil domain containing 10"""	CSDUFD1, CCDC10, FSD1NL, FSD1CL		11267680	Standard	XM_005252254		Approved		uc004bcq.2	Q9BXM9	OTTHUMG00000020426	ENST00000481272.1:c.559A>G	9.37:g.108246756A>G	ENSP00000417492:p.Met187Val	Somatic	0	24	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	18	51.35	A2A338|A6NKH7|B7Z5S6|B7Z5W3|Q5T879|Q5T880	Missense_Mutation	SNP	50	0.00	0	62	37.37	37	pfam_SPRY_rcpt,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,prints_Butyrophylin	p.M30V	ENST00000481272.1	37	c.88	CCDS47999.1	9	.	.	.	.	.	.	.	.	.	.	A	10.86	1.470820	0.26423	.	.	ENSG00000106701	ENST00000495708;ENST00000374710;ENST00000481272;ENST00000484973;ENST00000394926;ENST00000539376	T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01	5.01	5.01	0.66863	Fibronectin, type III (1);COS domain (1);	0.324209	0.25472	U	0.030421	T	0.27832	0.0685	N	0.19112	0.55	0.24542	N	0.99406	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.002;0.003	T	0.13818	-1.0495	10	0.44086	T	0.13	.	10.3014	0.43654	0.9196:0.0:0.0804:0.0	.	155;187;155	F8W946;Q9BXM9;Q9BXM9-2	.;FSD1L_HUMAN;.	V	187;155;187;155;155;30	ENSP00000420624:M187V;ENSP00000363842:M155V;ENSP00000417492:M187V;ENSP00000419691:M155V;ENSP00000378384:M155V;ENSP00000438140:M30V	ENSP00000363842:M155V	M	+	1	0	FSD1L	107286577	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.936000	0.48971	2.009000	0.58944	0.528000	0.53228	ATG	-	superfamily_Fibronectin_type3		0.353	FSD1L-007	NOVEL	basic|CCDS	protein_coding	FSD1L	protein_coding	OTTHUMT00000349935.1	A	NM_207647	-		108246756	+1	no_errors	ENST00000539376	ensembl	human	known	74_37	missense	SNP	1.000	G
SNX14	57231	genome.wustl.edu	37	6	86251705	86251705	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr6:86251705G>T	ENST00000314673.3	-	15	1622	c.1446C>A	c.(1444-1446)aaC>aaA	p.N482K	SNX14_ENST00000369627.2_Missense_Mutation_p.N482K|SNX14_ENST00000346348.3_Missense_Mutation_p.N438K|SNX14_ENST00000505648.1_Missense_Mutation_p.N430K|SNX14_ENST00000508980.1_5'UTR|SNX14_ENST00000513865.1_Intron	NM_153816.3	NP_722523.1	Q9Y5W7	SNX14_HUMAN	sorting nexin 14	482					protein transport (GO:0015031)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)	phosphatidylinositol binding (GO:0035091)			NS(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(11)|skin(1)	22		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		CAACCTACCTGTTCAATTTTG	0.294																																																	0								ENSG00000135317						96.0	85.0	89.0					6																	86251705		2203	4299	6502	SNX14	SO:0001583	missense	0			-	HGNC	AF121863	CCDS5003.1, CCDS5004.1, CCDS75490.1	6q15	2008-10-22			ENSG00000135317	ENSG00000135317		"""Sorting nexins"""	14977	protein-coding gene	gene with protein product						11485546, 11736640	Standard	XM_005248738		Approved	RGS-PX2	uc003pkr.3	Q9Y5W7	OTTHUMG00000015140	ENST00000314673.3:c.1446C>A	6.37:g.86251705G>T	ENSP00000313121:p.Asn482Lys	Somatic	0	41	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B4DI55|Q4VBR3|Q5TCF9|Q5TCG0|Q6NUI7|Q6PI37|Q9BSD1	Missense_Mutation	SNP	31	0.00	0	67	0.00	0	pfam_Phox_assoc,pfam_Sorting_nexin_C,pfam_Phox,pfam_RGS_dom,superfamily_Phox,superfamily_Regulat_G_prot_signal_superfam,smart_PX_assoc_Snx13,smart_Regulat_G_prot_signal_superfam,smart_Phox,pfscan_Phox,pfscan_Phox_assoc,pfscan_Regulat_G_prot_signal_superfam	p.N482K	ENST00000314673.3	37	c.1446	CCDS5004.1	6	.	.	.	.	.	.	.	.	.	.	G	16.90	3.248906	0.59103	.	.	ENSG00000135317	ENST00000346348;ENST00000314673;ENST00000505648;ENST00000369627;ENST00000515216	T;T;T;T;T	0.23147	1.97;1.92;1.93;1.95;1.96	5.7	3.91	0.45181	.	0.140193	0.64402	D	0.000002	T	0.10035	0.0246	L	0.29908	0.895	0.41681	D	0.98929	P;P;P;P	0.48503	0.911;0.688;0.736;0.828	B;B;B;B	0.42593	0.392;0.178;0.169;0.318	T	0.05022	-1.0911	10	0.33940	T	0.23	-12.0088	12.6005	0.56494	0.1362:0.0:0.8638:0.0	.	482;438;482;430	Q9Y5W7-4;Q9Y5W7-2;Q9Y5W7;Q9Y5W7-3	.;.;SNX14_HUMAN;.	K	438;482;430;482;409	ENSP00000257769:N438K;ENSP00000313121:N482K;ENSP00000427380:N430K;ENSP00000358641:N482K;ENSP00000425630:N409K	ENSP00000313121:N482K	N	-	3	2	SNX14	86308424	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.114000	0.64648	0.739000	0.32628	0.585000	0.79938	AAC	-	NULL		0.294	SNX14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX14	protein_coding	OTTHUMT00000041393.2	G	NM_153816	-		86251705	-1	no_errors	ENST00000314673	ensembl	human	known	74_37	missense	SNP	1.000	T
CYP27B1	1594	genome.wustl.edu	37	12	58163174	58163174	+	5'Flank	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr12:58163174G>A	ENST00000228606.4	-	0	0				CYP27B1_ENST00000546496.1_5'Flank|METTL21B_ENST00000551420.1_5'Flank|METTL21B_ENST00000548256.1_5'Flank|METTL1_ENST00000257848.7_Silent_p.Y134Y|METTL1_ENST00000548681.1_5'Flank|METTL1_ENST00000324871.7_Missense_Mutation_p.T196I	NM_000785.3	NP_000776.1	O15528	CP27B_HUMAN	cytochrome P450, family 27, subfamily B, polypeptide 1						bone mineralization (GO:0030282)|calcitriol biosynthetic process from calciol (GO:0036378)|calcium ion homeostasis (GO:0055074)|calcium ion transport (GO:0006816)|decidualization (GO:0046697)|G1 to G0 transition (GO:0070314)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of bone mineralization (GO:0030500)|response to estrogen (GO:0043627)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	calcidiol 1-monooxygenase activity (GO:0004498)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|urinary_tract(1)	15	all_cancers(7;8.09e-80)|Lung NSC(6;2.26e-27)|all_lung(6;1.99e-25)|all_epithelial(6;3.62e-18)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;1.97e-113)|all cancers(5;1.54e-78)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		Alfacalcidol(DB01436)|Calcidiol(DB00146)|Corticotropin(DB01285)|Ergocalciferol(DB00153)	ATCGGTTATGGTATACACCAG	0.542																																																	0								ENSG00000037897						74.0	60.0	65.0					12																	58163174		2203	4300	6503	METTL1	SO:0001631	upstream_gene_variant	0			-	HGNC	AB006987	CCDS8954.1	12q14.1	2013-11-13	2003-01-14		ENSG00000111012	ENSG00000111012		"""Cytochrome P450s"""	2606	protein-coding gene	gene with protein product	"""VDDR I"", ""1alpha(OH)ase"", ""25-Hydroxyvitamin D3 1alpha-hydroxylase"""	609506	"""cytochrome P450, subfamily XXVIIB (25-hydroxyvitamin D-1-alpha-hydroxylase), polypeptide 1"""	VDD1, PDDR		9295274, 9344864	Standard	NM_000785		Approved	CYP1, P450c1	uc001spz.1	O15528	OTTHUMG00000170457		12.37:g.58163174G>A	Exception_encountered	Somatic	0	16	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	99	28.78	B2RC61|Q548T3	Missense_Mutation	SNP	24	0.00	0	245	35.77	137	pfam_tRNA_(Gua-N-7)_MeTrfase,tigrfam_tRNA_(Gua-N-7)_MeTrfase	p.T196I	ENST00000228606.4	37	c.587	CCDS8954.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.1|25.1	4.607272|4.607272	0.87157|0.87157	.|.	.|.	ENSG00000037897|ENSG00000037897	ENST00000547653|ENST00000324871	.|T	.|0.36878	.|1.23	5.82|5.82	5.82|5.82	0.92795|0.92795	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.40791|0.40791	0.1131|0.1131	L|L	0.56280|0.56280	1.765|1.765	0.80722|0.80722	D|D	1|1	.|B	.|0.33379	.|0.41	.|B	.|0.40329	.|0.326	T|T	0.11891|0.11891	-1.0569|-1.0569	5|10	.|0.10377	.|T	.|0.69	-19.4635|-19.4635	18.8531|18.8531	0.92240|0.92240	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|196	.|Q9UBP6	.|TRMB_HUMAN	S|I	42|196	.|ENSP00000314441:T196I	.|ENSP00000314441:T196I	P|T	-|-	1|2	0|0	METTL1|METTL1	56449441|56449441	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.941000|0.941000	0.58515|0.58515	8.702000|8.702000	0.91338|0.91338	2.761000|2.761000	0.94854|0.94854	0.655000|0.655000	0.94253|0.94253	CCA|ACC	-	pfam_tRNA_(Gua-N-7)_MeTrfase,tigrfam_tRNA_(Gua-N-7)_MeTrfase		0.542	CYP27B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL1	protein_coding	OTTHUMT00000409248.1	G	NM_000785	-		58163174	-1	no_errors	ENST00000324871	ensembl	human	known	74_37	missense	SNP	1.000	A
MT-ND5	4540	genome.wustl.edu	37	M	13471	13471	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chrM:13471G>A	ENST00000361567.2	+	1	1135	c.1135G>A	c.(1135-1137)Gca>Aca	p.A379T	MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	379					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TTGGCAGCCTAGCATTAGCAG	0.428																																																	0								ENSG00000198786																																			MT-ND5	SO:0001583	missense	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1135G>A	M.37:g.13471G>A	ENSP00000354813:p.Ala379Thr	Somatic	0	25	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	45	16.67	Q34773|Q8WCY3	Missense_Mutation	SNP	1720	0.29	5	1995	23.49	613	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.A379T	ENST00000361567.2	37	c.1135		MT																																																																																			-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5		0.428	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	protein_coding		G	YP_003024036	-		13471	+1	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	SNP	NULL	A
CCNYL2	414194	genome.wustl.edu	37	10	42924561	42924594	+	RNA	DEL	CACCTTTGCTTGATATGATAATATAGTGCCAAGG	CACCTTTGCTTGATATGATAATATAGTGCCAAGG	-	rs372503885|rs74262004|rs6143878	byFrequency	TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	CACCTTTGCTTGATATGATAATATAGTGCCAAGG	CACCTTTGCTTGATATGATAATATAGTGCCAAGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr10:42924561_42924594delCACCTTTGCTTGATATGATAATATAGTGCCAAGG	ENST00000483242.3	-	0	804_835					NR_103829.1		Q5T2Q4	CCYL2_HUMAN	cyclin Y-like 2						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)			p.?(4)		breast(2)|endometrium(1)|lung(3)|ovary(1)	7						TAAAAAAGCTCACCTTTGCTTGATATGATAATATAGTGCCAAGGTCACACTGTG	0.355														1695	0.338458	0.289	0.2723	5008	,	,		18253	0.2411		0.3191	False		,,,				2504	0.5726																4	Unknown(4)	breast(4)						ENSG00000182632																																			CCNYL2			0				HGNC	BC039000		10q11.21	2007-02-09	2007-02-09	2007-02-09	ENSG00000182632	ENSG00000182632			23495	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 21"""	C10orf21			Standard	NR_103829		Approved	bA178A10.2		Q5T2Q4	OTTHUMG00000018009		10.37:g.42924561_42924594delCACCTTTGCTTGATATGATAATATAGTGCCAAGG		Somatic	NA	NA	NA		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		Splice_Site	DEL	14	36.36	8	20	0.00	0	-	NULL	ENST00000483242.3	37	c.NULL		10																																																																																			-	-		0.355	CCNYL2-002	KNOWN	basic	processed_transcript	CCNYL2	pseudogene	OTTHUMT00000047670.5	CACCTTTGCTTGATATGATAATATAGTGCCAAGG	XM_936368			42924594	-1	no_errors	ENST00000483242	ensembl	human	known	74_37	splice_site_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.997:0.995:1.000:1.000:0.999:1.000:0.996:0.996:0.999	-
POTEA	340441	genome.wustl.edu	37	8	43159910	43159910	+	RNA	SNP	C	C	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr8:43159910C>T	ENST00000522175.2	+	0	766				RNU6-104P_ENST00000459597.1_RNA			Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A											breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(27)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						AATAGCAATCCAGGTAAGACT	0.358																																																	0								ENSG00000188877						76.0	80.0	79.0					8																	43159910		2058	4230	6288	POTEA			0			-	HGNC	AY462869		8p11.1	2013-01-11	2008-11-26	2008-11-26	ENSG00000188877	ENSG00000188877		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33893	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 3"""	608915	"""ANKRD26-like family A, member 1"""	A26A1			Standard	NM_001002920		Approved	POTE8, POTE-8, CT104.3	uc003xpz.1	Q6S8J7	OTTHUMG00000164111		8.37:g.43159910C>T		Somatic	0	70	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	201	252	44.37	A6ND17|A6ND71|Q6S8J6	RNA	SNP	29	0.00	0	40	45.95	34	-	NULL	ENST00000522175.2	37	NULL		8																																																																																			-	-		0.358	POTEA-003	KNOWN	basic	processed_transcript	POTEA	pseudogene	OTTHUMT00000383492.1	C	NM_001002920	-		43159910	+1	no_errors	ENST00000522175	ensembl	human	known	74_37	rna	SNP	0.062	T
RADIL	55698	genome.wustl.edu	37	7	4917282	4917282	+	Silent	SNP	C	C	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr7:4917282C>T	ENST00000399583.3	-	2	676	c.489G>A	c.(487-489)tcG>tcA	p.S163S	RADIL_ENST00000536091.1_Silent_p.S163S	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	163	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)		p.S163S(1)		NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		CCTCCACGTCCGACCTCTTCC	0.597																																																	1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000157927						60.0	72.0	68.0					7																	4917282		2071	4197	6268	RADIL	SO:0001819	synonymous_variant	0			-	HGNC	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.489G>A	7.37:g.4917282C>T		Somatic	0	81	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	110	17.29	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Silent	SNP	23	0.00	0	25	26.47	9	pfam_Dil_domain,pfam_Ras-assoc,pfam_PDZ,superfamily_PDZ,superfamily_SMAD_FHA_domain,smart_Ras-assoc,smart_PDZ,pfscan_Dilute,pfscan_PDZ,pfscan_Ras-assoc	p.S163	ENST00000399583.3	37	c.489	CCDS43544.1	7																																																																																			-	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc		0.597	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RADIL	protein_coding	OTTHUMT00000323769.2	C	NM_018059	-		4917282	-1	no_errors	ENST00000399583	ensembl	human	known	74_37	silent	SNP	0.078	T
MAGEB1	4112	genome.wustl.edu	37	X	30269613	30269613	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chrX:30269613C>T	ENST00000378981.3	+	4	1324	c.1003C>T	c.(1003-1005)Cgt>Tgt	p.R335C	MAGEB1_ENST00000397548.2_Missense_Mutation_p.R335C|MAGEB1_ENST00000397550.1_Missense_Mutation_p.R335C	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	335										NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						TTTTAGAGCGCGTTCTAGAGC	0.502													C|||	1	0.000264901	0.0	0.0	3775	,	,		13682	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000214107						70.0	65.0	67.0					X																	30269613		2202	4300	6502	MAGEB1	SO:0001583	missense	0			-	HGNC		CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.1003C>T	X.37:g.30269613C>T	ENSP00000368264:p.Arg335Cys	Somatic	0	60	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	84	17.65	B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Missense_Mutation	SNP	32	0.00	0	46	19.30	11	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.R335C	ENST00000378981.3	37	c.1003	CCDS14222.1	X	.	.	.	.	.	.	.	.	.	.	C	8.332	0.826735	0.16749	.	.	ENSG00000214107	ENST00000378981;ENST00000397550;ENST00000397548	T;T;T	0.01647	4.71;4.71;4.71	3.1	-2.63	0.06133	.	.	.	.	.	T	0.01523	0.0049	L	0.37697	1.125	0.09310	N	1	B	0.12630	0.006	B	0.04013	0.001	T	0.44574	-0.9319	9	0.46703	T	0.11	.	3.3415	0.07120	0.5085:0.2509:0.0:0.2406	.	335	P43366	MAGB1_HUMAN	C	335	ENSP00000368264:R335C;ENSP00000380683:R335C;ENSP00000380681:R335C	ENSP00000368264:R335C	R	+	1	0	MAGEB1	30179534	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	0.441000	0.21611	-0.877000	0.04012	-0.322000	0.08575	CGT	-	NULL		0.502	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB1	protein_coding	OTTHUMT00000056160.1	C	NM_002363	-		30269613	+1	no_errors	ENST00000378981	ensembl	human	known	74_37	missense	SNP	0.000	T
KCNH3	23416	genome.wustl.edu	37	12	49948143	49948143	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr12:49948143G>A	ENST00000257981.6	+	11	2202	c.1942G>A	c.(1942-1944)Gag>Aag	p.E648K		NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	648					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						GATCGGCTGTGAGCTGCCCCG	0.637																																																	0								ENSG00000135519						68.0	76.0	73.0					12																	49948143		2203	4300	6503	KCNH3	SO:0001583	missense	0			-	HGNC	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.1942G>A	12.37:g.49948143G>A	ENSP00000257981:p.Glu648Lys	Somatic	0	73	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	149	9.15	Q9UQ06	Missense_Mutation	SNP	22	0.00	0	83	4.60	4	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_cNMP-bd_dom,pfam_PAS_4,pfam_PAS_fold,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.E648K	ENST00000257981.6	37	c.1942	CCDS8786.1	12	.	.	.	.	.	.	.	.	.	.	G	19.84	3.901324	0.72754	.	.	ENSG00000135519	ENST00000257981	D	0.96716	-4.1	4.81	4.81	0.61882	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (2);	0.000000	0.47455	D	0.000224	D	0.93844	0.8031	N	0.17082	0.46	0.45261	D	0.998269	B	0.29571	0.249	B	0.41135	0.348	D	0.92881	0.6323	10	0.56958	D	0.05	.	16.1975	0.82042	0.0:0.0:1.0:0.0	.	648	Q9ULD8	KCNH3_HUMAN	K	648	ENSP00000257981:E648K	ENSP00000257981:E648K	E	+	1	0	KCNH3	48234410	0.999000	0.42202	1.000000	0.80357	0.981000	0.71138	2.725000	0.47294	2.628000	0.89032	0.563000	0.77884	GAG	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_ERG		0.637	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH3	protein_coding	OTTHUMT00000404571.2	G	NM_012284	-		49948143	+1	no_errors	ENST00000257981	ensembl	human	known	74_37	missense	SNP	1.000	A
KCNH3	23416	genome.wustl.edu	37	12	49948321	49948321	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr12:49948321G>A	ENST00000257981.6	+	11	2380	c.2120G>A	c.(2119-2121)gGg>gAg	p.G707E		NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	707					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						CTGGGTGCTGGGGGAGGCTCT	0.657																																																	0								ENSG00000135519						45.0	44.0	44.0					12																	49948321		2203	4300	6503	KCNH3	SO:0001583	missense	0			-	HGNC	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.2120G>A	12.37:g.49948321G>A	ENSP00000257981:p.Gly707Glu	Somatic	0	44	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	97	8.49	Q9UQ06	Missense_Mutation	SNP	23	0.00	0	88	3.26	3	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_cNMP-bd_dom,pfam_PAS_4,pfam_PAS_fold,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.G707E	ENST00000257981.6	37	c.2120	CCDS8786.1	12	.	.	.	.	.	.	.	.	.	.	G	24.0	4.484265	0.84854	.	.	ENSG00000135519	ENST00000257981	D	0.99287	-5.69	5.05	5.05	0.67936	.	0.000000	0.47852	D	0.000218	D	0.96414	0.8830	N	0.08118	0	0.58432	D	0.999993	B	0.27656	0.184	B	0.20767	0.031	D	0.94562	0.7763	10	0.72032	D	0.01	.	16.7233	0.85415	0.0:0.0:1.0:0.0	.	707	Q9ULD8	KCNH3_HUMAN	E	707	ENSP00000257981:G707E	ENSP00000257981:G707E	G	+	2	0	KCNH3	48234588	0.999000	0.42202	0.990000	0.47175	0.994000	0.84299	4.867000	0.63013	2.744000	0.94065	0.563000	0.77884	GGG	-	NULL		0.657	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH3	protein_coding	OTTHUMT00000404571.2	G	NM_012284	-		49948321	+1	no_errors	ENST00000257981	ensembl	human	known	74_37	missense	SNP	1.000	A
FMNL3	91010	genome.wustl.edu	37	12	50042925	50042925	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr12:50042925G>A	ENST00000293590.5	-	21	2635	c.2402C>T	c.(2401-2403)tCc>tTc	p.S801F	FMNL3_ENST00000335154.5_Missense_Mutation_p.S801F|FMNL3_ENST00000550488.1_Missense_Mutation_p.S801F|FMNL3_ENST00000352151.5_Missense_Mutation_p.S750F			Q8IVF7	FMNL3_HUMAN	formin-like 3	801	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)	GTPase activating protein binding (GO:0032794)			breast(4)|endometrium(7)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|stomach(1)	39						CCGGTCAGTGGACTTGGTATC	0.562																																																	0								ENSG00000161791						127.0	137.0	134.0					12																	50042925		2108	4231	6339	FMNL3	SO:0001583	missense	0			-	HGNC	AK128195	CCDS41780.1, CCDS44874.1	12q13.12	2006-04-10							23698	protein-coding gene	gene with protein product						12684686	Standard	NM_198900		Approved	DKFZp762B245, MGC45819, WBP3	uc001ruv.1	Q8IVF7	OTTHUMG00000169651	ENST00000293590.5:c.2402C>T	12.37:g.50042925G>A	ENSP00000293590:p.Ser801Phe	Somatic	0	32	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	62	26.19	B0JZA7|Q6ZRJ1	Missense_Mutation	SNP	26	0.00	0	109	32.72	53	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin	p.S801F	ENST00000293590.5	37	c.2402		12	.	.	.	.	.	.	.	.	.	.	G	28.1	4.892867	0.91889	.	.	ENSG00000161791	ENST00000335154;ENST00000550488;ENST00000352151;ENST00000293590	T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37	5.44	5.44	0.79542	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	D	0.87305	0.6144	H	0.94925	3.6	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.999	D;D;D	0.97110	1.0;0.994;0.998	D	0.90405	0.4405	10	0.87932	D	0	.	18.4218	0.90594	0.0:0.0:1.0:0.0	.	750;801;801	Q8IVF7-2;Q8IVF7-3;Q8IVF7	.;.;FMNL3_HUMAN	F	801;801;750;801	ENSP00000335655:S801F;ENSP00000447479:S801F;ENSP00000344311:S750F;ENSP00000293590:S801F	ENSP00000293590:S801F	S	-	2	0	FMNL3	48329192	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.733000	0.98818	2.723000	0.93209	0.655000	0.94253	TCC	-	pfam_FH2_Formin,smart_FH2_Formin		0.562	FMNL3-201	KNOWN	basic	protein_coding	FMNL3	protein_coding		G	NM_175736	-		50042925	-1	no_errors	ENST00000293590	ensembl	human	known	74_37	missense	SNP	1.000	A
TLN2	83660	genome.wustl.edu	37	15	63055824	63055824	+	Missense_Mutation	SNP	G	G	T	rs372775961		TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr15:63055824G>T	ENST00000561311.1	+	39	5254	c.5024G>T	c.(5023-5025)cGg>cTg	p.R1675L	TLN2_ENST00000306829.6_Missense_Mutation_p.R1675L|TLN2_ENST00000472902.1_Missense_Mutation_p.R68L			Q9Y4G6	TLN2_HUMAN	talin 2	1675					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CGGTGCATCCGGGACATCGAG	0.607																																																	0								ENSG00000171914						54.0	45.0	48.0					15																	63055824		2203	4300	6503	TLN2	SO:0001583	missense	0			-	HGNC	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.5024G>T	15.37:g.63055824G>T	ENSP00000453508:p.Arg1675Leu	Somatic	0	42	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	A6NLB8	Missense_Mutation	SNP	26	0.00	0	37	0.00	0	pfam_Talin_cent,pfam_ILWEQ_dom,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.R1675L	ENST00000561311.1	37	c.5024	CCDS32261.1	15	.	.	.	.	.	.	.	.	.	.	G	33	5.199581	0.94997	.	.	ENSG00000171914	ENST00000306829	T	0.69685	-0.42	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.82125	0.4969	M	0.83953	2.67	0.80722	D	1	D;D	0.53619	0.961;0.961	P;P	0.61275	0.886;0.776	T	0.83210	-0.0074	10	0.46703	T	0.11	-23.0219	18.8097	0.92053	0.0:0.0:1.0:0.0	.	719;1675	G1UI21;Q9Y4G6	.;TLN2_HUMAN	L	1675	ENSP00000303476:R1675L	ENSP00000303476:R1675L	R	+	2	0	TLN2	60843116	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	9.813000	0.99286	2.441000	0.82636	0.655000	0.94253	CGG	-	NULL		0.607	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	protein_coding	OTTHUMT00000257878.2	G		-		63055824	+1	no_errors	ENST00000306829	ensembl	human	known	74_37	missense	SNP	1.000	T
MOG	4340	genome.wustl.edu	37	6	29641137	29641137	+	IGR	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr6:29641137G>A	ENST00000376917.3	+	0	2160				ZFP57_ENST00000488757.1_Missense_Mutation_p.R251C|ZFP57_ENST00000376883.1_Missense_Mutation_p.R231C|ZFP57_ENST00000376881.3_Missense_Mutation_p.R231C	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						AGATGGACGCGGCGGTGACGA	0.557																																																	0								ENSG00000204644						79.0	87.0	84.0					6																	29641137		1350	2609	3959	ZFP57	SO:0001628	intergenic_variant	0			-	HGNC		CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099		6.37:g.29641137G>A		Somatic	0	60	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	61	26.51	A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Missense_Mutation	SNP	28	0.00	0	29	19.44	7	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R251C	ENST00000376917.3	37	c.751	CCDS34370.1	6	.	.	.	.	.	.	.	.	.	.	G	18.65	3.669375	0.67814	.	.	ENSG00000204644	ENST00000488757;ENST00000376881;ENST00000376883	T;T;T	0.19394	2.15;2.15;2.15	4.48	3.6	0.41247	.	0.139361	0.33834	N	0.004509	T	0.36276	0.0961	M	0.82823	2.61	0.39035	D	0.960011	D;P	0.89917	1.0;0.945	D;P	0.91635	0.999;0.448	T	0.38628	-0.9652	10	0.87932	D	0	-22.2198	10.2746	0.43501	0.0985:0.0:0.9015:0.0	.	251;231	Q9NU63-3;Q9NU63-2	.;.	C	251;231;231	ENSP00000418259:R251C;ENSP00000366078:R231C;ENSP00000366080:R231C	ENSP00000366078:R231C	R	-	1	0	ZFP57	29749116	0.003000	0.15002	0.995000	0.50966	0.908000	0.53690	1.081000	0.30791	1.224000	0.43551	0.563000	0.77884	CGC	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.557	MOG-001	KNOWN	basic|CCDS	protein_coding	ZFP57	protein_coding	OTTHUMT00000076160.3	G	NM_002433	-		29641137	-1	no_errors	ENST00000488757	ensembl	human	known	74_37	missense	SNP	0.825	A
METTL21B	25895	genome.wustl.edu	37	12	58163564	58163564	+	5'Flank	SNP	G	G	C			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr12:58163564G>C	ENST00000300209.8	+	0	0				METTL21B_ENST00000551420.1_5'Flank|METTL21B_ENST00000548256.1_5'Flank|METTL1_ENST00000257848.7_Intron|METTL1_ENST00000548681.1_5'Flank|CYP27B1_ENST00000228606.4_5'Flank|METTL21B_ENST00000333012.5_5'Flank|METTL1_ENST00000324871.7_Nonsense_Mutation_p.Y150*	NM_015433.2	NP_056248.2	Q96AZ1	MT21B_HUMAN	methyltransferase like 21B							cytoplasm (GO:0005737)|intracellular (GO:0005622)	methyltransferase activity (GO:0008168)			endometrium(1)|lung(1)	2						CCTGGCCCTTGTAGAAGAAGT	0.607																																																	0								ENSG00000037897						58.0	55.0	56.0					12																	58163564		2203	4300	6503	METTL1	SO:0001631	upstream_gene_variant	0			-	HGNC	AL050100, AF455816	CCDS8957.1, CCDS31848.1	12q14.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000123427	ENSG00000123427			24936	protein-coding gene	gene with protein product		615258	"""family with sequence similarity 119, member B"""	FAM119B		12477932	Standard	NM_015433		Approved	DKFZP586D0919	uc001sqg.3	Q96AZ1	OTTHUMG00000170459		12.37:g.58163564G>C	Exception_encountered	Somatic	0	50	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	49	267	15.51	Q9H749|Q9Y3W2	Nonsense_Mutation	SNP	21	0.00	0	241	19.00	57	pfam_tRNA_(Gua-N-7)_MeTrfase,tigrfam_tRNA_(Gua-N-7)_MeTrfase	p.Y150*	ENST00000300209.8	37	c.450	CCDS8957.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.86|15.86	2.959054|2.959054	0.53400|0.53400	.|.	.|.	ENSG00000037897|ENSG00000037897	ENST00000548504|ENST00000324871	.|.	.|.	.|.	5.08|5.08	1.79|1.79	0.24919|0.24919	.|.	.|1.444940	.|0.03848	.|N	.|0.271858	T|.	0.70011|.	0.3175|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.55471|.	-0.8136|.	4|.	.|0.49607	.|T	.|0.09	1.7929|1.7929	12.6322|12.6322	0.56663|0.56663	0.0:0.0:0.3968:0.6032|0.0:0.0:0.3968:0.6032	.|.	.|.	.|.	.|.	E|X	29|150	.|.	.|ENSP00000314441:Y150X	Q|Y	-|-	1|3	0|2	METTL1|METTL1	56449831|56449831	0.795000|0.795000	0.28851|0.28851	0.859000|0.859000	0.33776|0.33776	0.989000|0.989000	0.77384|0.77384	1.150000|1.150000	0.31639|0.31639	0.434000|0.434000	0.26340|0.26340	0.655000|0.655000	0.94253|0.94253	CAA|TAC	-	pfam_tRNA_(Gua-N-7)_MeTrfase,tigrfam_tRNA_(Gua-N-7)_MeTrfase		0.607	METTL21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL1	protein_coding	OTTHUMT00000409268.1	G	NM_015433	-		58163564	-1	no_errors	ENST00000324871	ensembl	human	known	74_37	nonsense	SNP	0.123	C
ARMCX4	100131755	genome.wustl.edu	37	X	100746403	100746403	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chrX:100746403G>A	ENST00000423738.3	+	2	3029	c.2827G>A	c.(2827-2829)Ggc>Agc	p.G943S		NM_001256155.1	NP_001243084.1	Q5H9R4	ARMX4_HUMAN	armadillo repeat containing, X-linked 4	228						integral component of membrane (GO:0016021)				lung(1)	1						GGCTGGGGCAGGCATAATGGG	0.557																																																	0								ENSG00000196440																																			ARMCX4	SO:0001583	missense	0			-	HGNC	AK096955	CCDS59170.1	Xq22	2014-03-21	2009-11-26		ENSG00000196440	ENSG00000196440		"""Armadillo repeat containing"""	28615	protein-coding gene	gene with protein product			"""chromosome X open reading frame 35"", ""armadillo repeat containing, X-linked 4 pseudogene"""	CXorf35		16221301, 22569362	Standard	NR_028407		Approved	MGC40053, GASP4	uc031tkc.1	Q5H9R4	OTTHUMG00000022030	ENST00000423738.3:c.2827G>A	X.37:g.100746403G>A	ENSP00000404304:p.Gly943Ser	Somatic	0	36	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	60	35.48	A8K928|B3KXA4|Q5H9K8|Q8N8D6	Missense_Mutation	SNP	20	0.00	0	36	53.25	41	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,pfscan_Armadillo	p.G943S	ENST00000423738.3	37	c.2827	CCDS59170.1	X	.	.	.	.	.	.	.	.	.	.	.	9.013	0.982878	0.18889	.	.	ENSG00000196440	ENST00000423738	.	.	.	4.39	1.57	0.23409	.	.	.	.	.	T	0.32496	0.0831	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23691	-1.0181	4	.	.	.	.	7.4861	0.27435	0.3246:0.0:0.6754:0.0	.	.	.	.	S	1047	.	.	G	+	1	0	ARMCX4	100633059	0.021000	0.18746	0.001000	0.08648	0.004000	0.04260	1.497000	0.35649	0.067000	0.16545	-0.208000	0.12717	GGC	-	NULL		0.557	ARMCX4-010	PUTATIVE	upstream_ATG|upstream_uORF|basic|appris_principal|CCDS	protein_coding	ARMCX4	protein_coding	OTTHUMT00000370455.2	G	NM_001256155	-		100746403	+1	no_errors	ENST00000423738	ensembl	human	putative	74_37	missense	SNP	0.005	A
USP29	57663	genome.wustl.edu	37	19	57640072	57640072	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr19:57640072T>C	ENST00000254181.4	+	4	483	c.29T>C	c.(28-30)aTc>aCc	p.I10T	USP29_ENST00000598197.1_Missense_Mutation_p.I10T	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	10					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TGTGGATTCATCCAAATTTGG	0.338																																																	0								ENSG00000131864						44.0	45.0	45.0					19																	57640072		2203	4300	6503	USP29	SO:0001583	missense	0			-	HGNC		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.29T>C	19.37:g.57640072T>C	ENSP00000254181:p.Ile10Thr	Somatic	0	29	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51		Missense_Mutation	SNP	38	0.00	0	60	0.00	0	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.I10T	ENST00000254181.4	37	c.29	CCDS33124.1	19	.	.	.	.	.	.	.	.	.	.	T	8.737	0.918162	0.17982	.	.	ENSG00000131864	ENST00000254181	T	0.58358	0.34	2.79	0.672	0.17935	.	1.100210	0.07308	U	0.875304	T	0.43277	0.1240	L	0.46157	1.445	0.09310	N	1	P	0.40398	0.716	B	0.37833	0.259	T	0.37150	-0.9718	10	0.87932	D	0	-1.1064	4.9387	0.13954	0.0:0.2361:0.0:0.7639	.	10	Q9HBJ7	UBP29_HUMAN	T	10	ENSP00000254181:I10T	ENSP00000254181:I10T	I	+	2	0	USP29	62331884	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	0.424000	0.21330	0.060000	0.16281	0.482000	0.46254	ATC	-	NULL		0.338	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP29	protein_coding	OTTHUMT00000465075.1	T		-		57640072	+1	no_errors	ENST00000254181	ensembl	human	known	74_37	missense	SNP	0.000	C
STKLD1	169436	genome.wustl.edu	37	9	136269043	136269043	+	Splice_Site	SNP	G	G	C			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr9:136269043G>C	ENST00000371957.3	+	16	1710		c.e16-1		C9orf96_ENST00000371955.1_Splice_Site	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN									ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CCTTTCTGCAGGCTGCATCAA	0.662																																																	0								ENSG00000198870						39.0	43.0	41.0					9																	136269043		2203	4300	6503	C9orf96	SO:0001630	splice_region_variant	0			-	HGNC																												ENST00000371957.3:c.1604-1G>C	9.37:g.136269043G>C		Somatic	0	51	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q5T8U8|Q6ZMP6|Q6ZMQ5	Splice_Site	SNP	29	0.00	0	43	8.33	4	-	e16-1	ENST00000371957.3	37	c.1604-1	CCDS35169.1	9	.	.	.	.	.	.	.	.	.	.	G	13.69	2.313845	0.40996	.	.	ENSG00000198870	ENST00000371957;ENST00000371955	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5501	0.87873	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C9orf96	135258864	1.000000	0.71417	1.000000	0.80357	0.302000	0.27658	5.846000	0.69444	2.354000	0.79902	0.561000	0.74099	.	-	-		0.662	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf96	protein_coding	OTTHUMT00000054855.1	G		-	Intron	136269043	+1	no_errors	ENST00000371957	ensembl	human	known	74_37	splice_site	SNP	1.000	C
WDFY4	57705	genome.wustl.edu	37	10	50098739	50098743	+	Frame_Shift_Del	DEL	GTGAT	GTGAT	-	rs41283283|rs41283285	byFrequency	TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	GTGAT	GTGAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr10:50098739_50098743delGTGAT	ENST00000325239.5	+	43	7310_7314	c.7283_7287delGTGAT	c.(7282-7287)ggtgatfs	p.GD2428fs	RP11-523O18.7_ENST00000430438.1_RNA|WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	2428						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						TCTCCCACGGGTGATGTCTACTGTA	0.537																																																	0								ENSG00000128815																																			WDFY4	SO:0001589	frameshift_variant	0				HGNC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.7283_7287delGTGAT	10.37:g.50098739_50098743delGTGAT	ENSP00000320563:p.Gly2428fs	Somatic	NA	NA	NA		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Frame_Shift_Del	DEL	23	0.00	0	27	0.00	0	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D2429fs	ENST00000325239.5	37	c.7283_7287	CCDS44385.1	10																																																																																			-	NULL		0.537	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	protein_coding		GTGAT	XM_033379			50098743	+1	no_errors	ENST00000325239	ensembl	human	known	74_37	frame_shift_del	DEL	0.966:0.949:0.993:0.993:0.972	-
ZNF835	90485	genome.wustl.edu	37	19	57184443	57184444	+	5'Flank	INS	-	-	T	rs398079963|rs149340079|rs76688250	byFrequency	TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr19:57184443_57184444insT	ENST00000537055.2	-	0	0				AC007228.9_ENST00000602145.1_lincRNA|AC007228.5_ENST00000599726.1_lincRNA	NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						GAAAAAAATTGTTTTTACGTTA	0.208													|||unknown(NO_COVERAGE)	3002	0.599441	0.7504	0.4841	5008	,	,		12973	0.6587		0.4324	False		,,,				2504	0.5879																0								ENSG00000268568																																			AC007228.9	SO:0001631	upstream_gene_variant	0				Clone_based_vega_gene	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0			19.37:g.57184448_57184448dupT	Exception_encountered	Somatic	0	9	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	8	42.86	B7Z5Y0|G3V1S0	RNA	INS	22	48.84	21	41	43.84	32	-	NULL	ENST00000537055.2	37	NULL	CCDS56105.1	19																																																																																			-	-		0.208	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000268568	protein_coding	OTTHUMT00000459800.1	-	NM_001005850			57184444	-1	no_errors	ENST00000602145	ensembl	human	known	74_37	rna	INS	0.762:0.770	T
CEL	1056	genome.wustl.edu	37	9	135941960	135941960	+	Silent	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr9:135941960G>A	ENST00000372080.4	+	5	607	c.591G>A	c.(589-591)gtG>gtA	p.V197V	CEL_ENST00000351304.7_Silent_p.V194V	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	194					cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		TTGCTTGGGTGAAGAGGAATA	0.642																																																	0								ENSG00000170835						98.0	108.0	105.0					9																	135941960		1962	4148	6110	CEL	SO:0001819	synonymous_variant	0			-	HGNC	M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.591G>A	9.37:g.135941960G>A		Somatic	0	33	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.64	Q16398|Q5T7U7|Q9UCH1|Q9UP41	Silent	SNP	25	0.00	0	48	9.43	5	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.V197	ENST00000372080.4	37	c.591	CCDS43896.1	9																																																																																			-	pfam_CarbesteraseB,pfam_AB_hydrolase_3		0.642	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEL	protein_coding	OTTHUMT00000054823.1	G		-		135941960	+1	no_errors	ENST00000372080	ensembl	human	known	74_37	silent	SNP	1.000	A
KRT16	3868	genome.wustl.edu	37	17	39766252	39766252	+	Missense_Mutation	SNP	G	G	A	rs150387381		TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr17:39766252G>A	ENST00000301653.4	-	8	1421	c.1357C>T	c.(1357-1359)Cgt>Tgt	p.R453C		NM_005557.3	NP_005548.2	P08779	K1C16_HUMAN	keratin 16	453	Tail.			SRQTRPILK -> AVRPGPSS (in Ref. 1; AAA59460). {ECO:0000305}.	aging (GO:0007568)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|epidermis development (GO:0008544)|hair cycle (GO:0042633)|intermediate filament cytoskeleton organization (GO:0045104)|negative regulation of cell migration (GO:0030336)	cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		Breast(137;0.000307)				CGGGTCTGACGGCTCGAAGAG	0.612																																																	0								ENSG00000186832						29.0	29.0	29.0					17																	39766252		2203	4300	6503	KRT16	SO:0001583	missense	0			-	HGNC	S79867	CCDS11401.1	17q21.2	2013-01-16	2008-08-01		ENSG00000186832	ENSG00000186832		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6423	protein-coding gene	gene with protein product	"""focal non-epidermolytic palmoplantar keratoderma"""	148067				2451124, 16831889	Standard	NM_005557		Approved	NEPPK	uc002hxg.4	P08779	OTTHUMG00000133495	ENST00000301653.4:c.1357C>T	17.37:g.39766252G>A	ENSP00000301653:p.Arg453Cys	Somatic	0	81	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	93	19.83	A8K488|P30654|Q16402|Q9UBG8	Missense_Mutation	SNP	21	0.00	0	39	22.00	11	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.R453C	ENST00000301653.4	37	c.1357	CCDS11401.1	17	.	.	.	.	.	.	.	.	.	.	G	13.21	2.170637	0.38315	.	.	ENSG00000186832	ENST00000301653	D	0.83163	-1.69	4.59	3.61	0.41365	.	0.263263	0.27249	N	0.020229	T	0.58278	0.2111	N	0.08118	0	0.09310	N	0.999998	P	0.51537	0.946	B	0.34346	0.18	T	0.55547	-0.8124	10	0.33141	T	0.24	.	7.6214	0.28187	0.115:0.0:0.885:0.0	.	453	P08779	K1C16_HUMAN	C	453	ENSP00000301653:R453C	ENSP00000301653:R453C	R	-	1	0	KRT16	37019778	0.026000	0.19158	0.041000	0.18516	0.197000	0.23852	1.612000	0.36889	2.104000	0.64026	0.462000	0.41574	CGT	-	NULL		0.612	KRT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT16	protein_coding	OTTHUMT00000257408.1	G	NM_005557	-		39766252	-1	no_errors	ENST00000301653	ensembl	human	known	74_37	missense	SNP	0.003	A
SLC18A2	6571	genome.wustl.edu	37	10	119014856	119014856	+	Missense_Mutation	SNP	G	G	A	rs201547103		TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr10:119014856G>A	ENST00000298472.5	+	7	912	c.769G>A	c.(769-771)Gcc>Acc	p.A257T	SLC18A2_ENST00000497497.1_3'UTR	NM_003054.4	NP_003045.2	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 2	257					aging (GO:0007568)|cellular response to ammonium ion (GO:0071242)|cellular response to drug (GO:0035690)|death (GO:0016265)|dopamine transport (GO:0015872)|endocytic recycling (GO:0032456)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|negative regulation of neurotransmitter transport (GO:0051589)|neurotransmitter loading into synaptic vesicle (GO:0098700)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to corticosterone (GO:0051412)|response to herbicide (GO:0009635)|response to starvation (GO:0042594)|response to zinc ion (GO:0010043)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)|terminal bouton (GO:0043195)	amine transmembrane transporter activity (GO:0005275)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)|serotonin transmembrane transporter activity (GO:0015222)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)	29		Colorectal(252;0.19)		all cancers(201;0.029)	Amphetamine(DB00182)|Benzphetamine(DB00865)|Deserpidine(DB01089)|Dextroamphetamine(DB01576)|Ephedra(DB01363)|Ephedrine(DB01364)|Isometheptene(DB06706)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Propylhexedrine(DB06714)|Reserpine(DB00206)|Tetrabenazine(DB04844)	GGTGCTGGCCGCCCTGGTACT	0.627																																																	0								ENSG00000165646	G	THR/ALA	0,4406		0,0,2203	61.0	58.0	59.0		769	3.2	1.0	10		59	1,8599	1.2+/-3.3	0,1,4299	yes	missense	SLC18A2	NM_003054.4	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	257/515	119014856	1,13005	2203	4300	6503	SLC18A2	SO:0001583	missense	0			-	HGNC	L14269	CCDS7599.1	10q25	2013-07-18	2013-07-18		ENSG00000165646	ENSG00000165646		"""Solute carriers"""	10935	protein-coding gene	gene with protein product		193001		VMAT2			Standard	NM_003054		Approved	SVMT, SVAT	uc001ldd.2	Q05940	OTTHUMG00000019121	ENST00000298472.5:c.769G>A	10.37:g.119014856G>A	ENSP00000298472:p.Ala257Thr	Somatic	0	55	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	46	17.54	B2RC96|D3DRC4|Q15876|Q4G147|Q5VW49|Q9H3P6	Missense_Mutation	SNP	15	6.25	1	29	14.71	5	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.A257T	ENST00000298472.5	37	c.769	CCDS7599.1	10	.	.	.	.	.	.	.	.	.	.	G	14.00	2.406096	0.42715	0.0	1.16E-4	ENSG00000165646	ENST00000298472	T	0.58940	0.3	5.26	3.21	0.36854	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.177544	0.49305	N	0.000155	T	0.48960	0.1529	L	0.50333	1.59	0.43080	D	0.994739	B	0.19935	0.04	B	0.22601	0.04	T	0.36040	-0.9764	10	0.20519	T	0.43	-13.5312	11.6774	0.51438	0.1545:0.0:0.8455:0.0	.	257	Q05940	VMAT2_HUMAN	T	257	ENSP00000298472:A257T	ENSP00000298472:A257T	A	+	1	0	SLC18A2	119004846	0.214000	0.23563	0.975000	0.42487	0.977000	0.68977	1.396000	0.34531	0.592000	0.29728	0.563000	0.77884	GCC	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.627	SLC18A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC18A2	protein_coding	OTTHUMT00000050563.1	G	NM_003054	rs201547103		119014856	+1	no_errors	ENST00000298472	ensembl	human	known	74_37	missense	SNP	0.992	A
KRT10	3858	genome.wustl.edu	37	17	38978609	38978609	+	Silent	SNP	A	A	G			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr17:38978609A>G	ENST00000269576.5	-	1	238	c.229T>C	c.(229-231)Tta>Cta	p.L77L	TMEM99_ENST00000496847.1_Intron|TMEM99_ENST00000301665.3_Intron	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	77	Gly-rich.|Head.				cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				AAACCTCCTAATCCTCCATAG	0.562																																																	0								ENSG00000186395						108.0	122.0	117.0					17																	38978609		2203	4300	6503	KRT10	SO:0001819	synonymous_variant	0			-	HGNC	J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.229T>C	17.37:g.38978609A>G		Somatic	0	60	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	63	17.11	Q14664|Q8N175	Silent	SNP	24	0.00	0	33	23.26	10	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.L77	ENST00000269576.5	37	c.229	CCDS11377.1	17																																																																																			-	NULL		0.562	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT10	protein_coding	OTTHUMT00000257875.1	A	NM_000421	-		38978609	-1	no_errors	ENST00000269576	ensembl	human	known	74_37	silent	SNP	0.000	G
MAN1A1	4121	genome.wustl.edu	37	6	119514953	119514953	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr6:119514953C>T	ENST00000368468.3	-	9	1756	c.1315G>A	c.(1315-1317)Gat>Aat	p.D439N		NM_005907.3	NP_005898.2	P33908	MA1A1_HUMAN	mannosidase, alpha, class 1A, member 1	439					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|mannosidase activity (GO:0015923)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|skin(3)	24		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)		TGAACAGCATCAAAATACATC	0.358																																					Ovarian(136;8 1825 12608 33541 47587)												0								ENSG00000111885						113.0	107.0	109.0					6																	119514953		2203	4300	6503	MAN1A1	SO:0001583	missense	0			-	HGNC	AK025599	CCDS5122.1	6q22	2008-08-29			ENSG00000111885	ENSG00000111885	3.2.1.113		6821	protein-coding gene	gene with protein product		604344				8223597	Standard	NM_005907		Approved		uc003pym.2	P33908	OTTHUMG00000015472	ENST00000368468.3:c.1315G>A	6.37:g.119514953C>T	ENSP00000357453:p.Asp439Asn	Somatic	0	45	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	90	246	26.79	E7EU32|Q6P052|Q9NU44|Q9UJI3	Missense_Mutation	SNP	29	0.00	0	218	32.09	103	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.D439N	ENST00000368468.3	37	c.1315	CCDS5122.1	6	.	.	.	.	.	.	.	.	.	.	C	16.37	3.103581	0.56291	.	.	ENSG00000111885	ENST00000368468	T	0.71579	-0.58	5.72	5.72	0.89469	.	0.232964	0.43260	D	0.000593	T	0.60560	0.2278	L	0.45137	1.4	0.80722	D	1	B	0.26635	0.155	B	0.35413	0.202	T	0.58504	-0.7625	10	0.37606	T	0.19	-1.0333	19.88	0.96892	0.0:1.0:0.0:0.0	.	439	P33908	MA1A1_HUMAN	N	439	ENSP00000357453:D439N	ENSP00000357453:D439N	D	-	1	0	MAN1A1	119556652	1.000000	0.71417	1.000000	0.80357	0.152000	0.21847	4.909000	0.63314	2.703000	0.92315	0.655000	0.94253	GAT	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47		0.358	MAN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1A1	protein_coding	OTTHUMT00000042015.1	C	NM_005907	-		119514953	-1	no_errors	ENST00000368468	ensembl	human	known	74_37	missense	SNP	1.000	T
ERBB3	2065	genome.wustl.edu	37	12	56480358	56480358	+	Silent	SNP	T	T	G			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr12:56480358T>G	ENST00000267101.3	+	4	905	c.465T>G	c.(463-465)ctT>ctG	p.L155L	ERBB3_ENST00000415288.2_Silent_p.L96L|ERBB3_ENST00000450146.2_Intron	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	155					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			ACGATAAGCTTTGTCACATGG	0.498																																																	0								ENSG00000065361						237.0	203.0	215.0					12																	56480358		2203	4300	6503	ERBB3	SO:0001819	synonymous_variant	0			-	HGNC	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.465T>G	12.37:g.56480358T>G		Somatic	0	49	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	60	126	32.26	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Silent	SNP	29	0.00	0	61	28.24	24	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Furin-like_Cys-rich_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L155	ENST00000267101.3	37	c.465	CCDS31833.1	12																																																																																			-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_EGF_rcpt_L		0.498	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	protein_coding	OTTHUMT00000407619.3	T		-		56480358	+1	no_errors	ENST00000267101	ensembl	human	known	74_37	silent	SNP	0.680	G
TBC1D5	9779	genome.wustl.edu	37	3	17226625	17226625	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr3:17226625C>T	ENST00000253692.7	-	19	3492	c.1828G>A	c.(1828-1830)Gca>Aca	p.A610T	TBC1D5_ENST00000446818.2_Missense_Mutation_p.A632T|TBC1D5_ENST00000429383.4_Missense_Mutation_p.A610T|TBC1D5_ENST00000429924.2_Missense_Mutation_p.A584T|TBC1D5_ENST00000414318.2_5'UTR	NM_014744.2	NP_055559.1	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5	610						retromer complex (GO:0030904)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	36						ATCACCTTTGCACAGTATTTG	0.413																																																	0								ENSG00000131374						156.0	131.0	139.0					3																	17226625		2203	4300	6503	TBC1D5	SO:0001583	missense	0			-	HGNC	D86965	CCDS33714.1, CCDS46770.1	3p24.3	2013-07-09			ENSG00000131374	ENSG00000131374			19166	protein-coding gene	gene with protein product		615740				19531583	Standard	NM_014744		Approved	KIAA0210	uc003cbe.3	Q92609	OTTHUMG00000155488	ENST00000253692.7:c.1828G>A	3.37:g.17226625C>T	ENSP00000253692:p.Ala610Thr	Somatic	0	87	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	80	22.33	A6NP25|C9JP52	Missense_Mutation	SNP	31	0.00	0	47	34.72	25	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.A610T	ENST00000253692.7	37	c.1828	CCDS33714.1	3	.	.	.	.	.	.	.	.	.	.	C	35	5.509180	0.96386	.	.	ENSG00000131374	ENST00000253692;ENST00000429383;ENST00000446818;ENST00000429924	T;T;T;T	0.58506	1.35;1.35;1.35;0.33	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.63558	0.2521	N	0.24115	0.695	0.80722	D	1	D;D;D;D	0.69078	0.981;0.997;0.993;0.993	P;P;P;P	0.61397	0.699;0.888;0.849;0.849	T	0.65553	-0.6140	10	0.59425	D	0.04	-15.6633	18.9775	0.92743	0.0:1.0:0.0:0.0	.	584;632;610;610	C9J3F6;C9JP52;B9A6K1;Q92609	.;.;.;TBCD5_HUMAN	T	610;610;632;584	ENSP00000253692:A610T;ENSP00000398127:A610T;ENSP00000402935:A632T;ENSP00000411925:A584T	ENSP00000253692:A610T	A	-	1	0	TBC1D5	17201629	1.000000	0.71417	0.996000	0.52242	0.962000	0.63368	6.996000	0.76263	2.785000	0.95823	0.655000	0.94253	GCA	-	NULL		0.413	TBC1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D5	protein_coding	OTTHUMT00000340301.3	C	NM_014744	-		17226625	-1	no_errors	ENST00000253692	ensembl	human	known	74_37	missense	SNP	1.000	T
TRRAP	8295	genome.wustl.edu	37	7	98592415	98592415	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr7:98592415C>T	ENST00000359863.4	+	66	10420	c.10211C>T	c.(10210-10212)gCg>gTg	p.A3404V	TRRAP_ENST00000446306.3_Missense_Mutation_p.A3393V|TRRAP_ENST00000355540.3_Missense_Mutation_p.A3375V	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3404					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GCCCGGCGGGCGCAGGCCACT	0.572																																																	0								ENSG00000196367						101.0	109.0	106.0					7																	98592415		2203	4300	6503	TRRAP	SO:0001583	missense	0			-	HGNC	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.10211C>T	7.37:g.98592415C>T	ENSP00000352925:p.Ala3404Val	Somatic	0	36	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	31	13.89	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	27	0.00	0	36	12.20	5	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.A3404V	ENST00000359863.4	37	c.10211	CCDS59066.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.727156|5.727156	0.96847|0.96847	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306|ENST00000456197	T;T|.	0.03212|.	4.01;4.02|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71550|0.71550	0.3353|0.3353	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	D;D;D|.	0.71674|.	0.998;0.993;0.997|.	P;B;P|.	0.59221|.	0.854;0.427;0.719|.	T|T	0.68273|0.68273	-0.5452|-0.5452	10|5	0.44086|.	T|.	0.13|.	.|.	19.2202|19.2202	0.93793|0.93793	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	3375;3132;3404|.	Q9Y4A5-2;Q59FH1;Q9Y4A5|.	.;.;TRRAP_HUMAN|.	V|C	3404;3375;3392|3133	ENSP00000352925:A3404V;ENSP00000347733:A3375V|.	ENSP00000347733:A3375V|.	A|R	+|+	2|1	0|0	TRRAP|TRRAP	98430351|98430351	1.000000|1.000000	0.71417|0.71417	0.835000|0.835000	0.33067|0.33067	0.979000|0.979000	0.70002|0.70002	7.818000|7.818000	0.86416|0.86416	2.529000|2.529000	0.85273|0.85273	0.561000|0.561000	0.74099|0.74099	GCG|CGC	-	NULL		0.572	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	protein_coding	OTTHUMT00000317978.1	C	NM_003496	-		98592415	+1	no_errors	ENST00000359863	ensembl	human	known	74_37	missense	SNP	1.000	T
SETD1B	23067	genome.wustl.edu	37	12	122247833	122247833	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr12:122247833C>T	ENST00000604567.1	+	6	1050	c.982C>T	c.(982-984)Cat>Tat	p.H328Y	SETD1B_ENST00000542440.1_Missense_Mutation_p.H328Y|SETD1B_ENST00000267197.5_Missense_Mutation_p.H328Y			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	328					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						CCACGAACATCATTATGTACA	0.642																																																	0								ENSG00000139718						18.0	23.0	22.0					12																	122247833		692	1591	2283	SETD1B	SO:0001583	missense	0			-	HGNC	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.982C>T	12.37:g.122247833C>T	ENSP00000474253:p.His328Tyr	Somatic	0	35	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	122	129	48.61	F6MFW1	Missense_Mutation	SNP	22	0.00	0	163	51.47	175	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.H328Y	ENST00000604567.1	37	c.982		12	.	.	.	.	.	.	.	.	.	.	C	11.22	1.574797	0.28092	.	.	ENSG00000139718	ENST00000542440;ENST00000267197	D;D	0.94537	-3.45;-3.45	5.0	5.0	0.66597	.	.	.	.	.	D	0.95554	0.8555	L	0.59436	1.845	0.45172	D	0.998186	D	0.67145	0.996	P	0.56788	0.806	D	0.94583	0.7781	9	0.33141	T	0.24	.	18.3221	0.90242	0.0:1.0:0.0:0.0	.	328	Q9UPS6	SET1B_HUMAN	Y	328	ENSP00000442924:H328Y;ENSP00000267197:H328Y	ENSP00000267197:H328Y	H	+	1	0	SETD1B	120732216	1.000000	0.71417	0.972000	0.41901	0.098000	0.18820	7.654000	0.83653	2.313000	0.78055	0.563000	0.77884	CAT	-	NULL		0.642	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	SETD1B	protein_coding	OTTHUMT00000468264.1	C	XM_037523	-		122247833	+1	no_errors	ENST00000267197	ensembl	human	known	74_37	missense	SNP	1.000	T
DNM1P47	100216544	genome.wustl.edu	37	15	102299838	102299838	+	RNA	SNP	G	G	C			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr15:102299838G>C	ENST00000561463.1	+	0	7884									DNM1 pseudogene 47																		CGGCAGAGCAGGCAGACCAAG	0.592																																																	0								ENSG00000259660																																			DNM1P47			0			-	HGNC	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102299838G>C		Somatic	0	31	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	64	9.86		RNA	SNP	9	0.00	0	14	0.00	0	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	-		0.592	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	pseudogene	OTTHUMT00000417589.1	G	NG_009149	-		102299838	+1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	SNP	0.965	C
ODF3B	440836	genome.wustl.edu	37	22	50968892	50968892	+	3'UTR	SNP	C	C	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr22:50968892C>A	ENST00000329363.4	-	0	915				ODF3B_ENST00000401779.1_Silent_p.A236A|TYMP_ENST00000395678.3_5'Flank|ODF3B_ENST00000403326.1_3'UTR|ODF3B_ENST00000405135.1_Silent_p.A275A|TYMP_ENST00000395681.1_5'Flank|TYMP_ENST00000252029.3_5'Flank|TYMP_ENST00000395680.1_5'Flank	NM_001014440.3	NP_001014440.2	A8MYP8	ODF3B_HUMAN	outer dense fiber of sperm tails 3B											lung(2)	2						CGTGTGGGGCCGCTCCCGCCT	0.682																																																	0								ENSG00000177989						14.0	22.0	19.0					22																	50968892		1929	4113	6042	ODF3B	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS43039.1	22q13.33	2008-10-24			ENSG00000177989	ENSG00000177989			34388	protein-coding gene	gene with protein product							Standard	NM_001014440		Approved		uc003bmh.2	A8MYP8	OTTHUMG00000150334	ENST00000329363.4:c.*17G>T	22.37:g.50968892C>A		Somatic	0	63	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	43	30.65	A0PK18	Silent	SNP	15	0.00	0	30	9.09	3	NULL	p.A275	ENST00000329363.4	37	c.825	CCDS43039.1	22																																																																																			-	NULL		0.682	ODF3B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ODF3B	protein_coding		C		-		50968892	-1	no_errors	ENST00000405135	ensembl	human	putative	74_37	silent	SNP	0.018	A
PCDHGA4	56111	genome.wustl.edu	37	5	140735522	140735522	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr5:140735522G>A	ENST00000571252.1	+	1	755	c.755G>A	c.(754-756)cGt>cAt	p.R252H	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	252	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTAAGTGTTCGTGAGAACGTT	0.507																																																	0								ENSG00000262576						34.0	37.0	36.0					5																	140735522		2038	4185	6223	PCDHGA4	SO:0001583	missense	0			-	HGNC	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.755G>A	5.37:g.140735522G>A	ENSP00000458570:p.Arg252His	Somatic	0	32	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	26	16.13	Q9Y5D3	Missense_Mutation	SNP	25	0.00	0	36	14.29	6	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R252H	ENST00000571252.1	37	c.755	CCDS58979.1	5																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin		0.507	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA4	protein_coding	OTTHUMT00000437959.1	G	NM_018917	-		140735522	+1	no_errors	ENST00000571252	ensembl	human	known	74_37	missense	SNP	0.000	A
GOLGA3	2802	genome.wustl.edu	37	12	133384827	133384827	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr12:133384827G>C	ENST00000450791.2	-	4	1011	c.828C>G	c.(826-828)aaC>aaG	p.N276K	GOLGA3_ENST00000537452.1_Missense_Mutation_p.N276K|GOLGA3_ENST00000545875.1_Missense_Mutation_p.N276K|GOLGA3_ENST00000456883.2_Missense_Mutation_p.N276K|GOLGA3_ENST00000204726.3_Missense_Mutation_p.N276K			Q08378	GOGA3_HUMAN	golgin A3	276					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		CACTGCTTCTGTTCTGCTTCA	0.577																																																	0								ENSG00000090615						128.0	136.0	133.0					12																	133384827		2203	4300	6503	GOLGA3	SO:0001583	missense	0			-	HGNC	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.828C>G	12.37:g.133384827G>C	ENSP00000410378:p.Asn276Lys	Somatic	0	14	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	27	44.90	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	24	0.00	0	33	50.00	33	superfamily_Prefoldin	p.N276K	ENST00000450791.2	37	c.828	CCDS9281.1	12	.	.	.	.	.	.	.	.	.	.	G	12.71	2.018177	0.35606	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61	5.23	3.38	0.38709	.	0.465733	0.26522	N	0.023904	T	0.25158	0.0611	L	0.54323	1.7	0.80722	D	1	P;P;B	0.38078	0.617;0.465;0.313	B;B;B	0.30855	0.121;0.085;0.115	T	0.03202	-1.1061	10	0.40728	T	0.16	.	10.9961	0.47578	0.1542:0.0:0.8458:0.0	.	276;276;276	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	K	276	ENSP00000204726:N276K;ENSP00000410378:N276K;ENSP00000409303:N276K;ENSP00000442143:N276K;ENSP00000442603:N276K	ENSP00000204726:N276K	N	-	3	2	GOLGA3	131894900	0.796000	0.28864	0.008000	0.14137	0.482000	0.33219	1.138000	0.31491	0.689000	0.31550	-0.225000	0.12378	AAC	-	NULL		0.577	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA3	protein_coding	OTTHUMT00000397569.2	G	NM_005895	-		133384827	-1	no_errors	ENST00000204726	ensembl	human	known	74_37	missense	SNP	0.880	C
DLC1	10395	genome.wustl.edu	37	8	13072066	13072066	+	Intron	SNP	C	C	T	rs397737359|rs34727279	byFrequency	TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr8:13072066C>T	ENST00000276297.4	-	5	1758				DLC1_ENST00000512044.2_Intron	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein						actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						CCAACCCCACCTTTTTTTTTT	0.483																																																	0								ENSG00000164741																																			DLC1	SO:0001627	intron_variant	0			-	HGNC	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.1348+90711G>A	8.37:g.13072066C>T		Somatic	0	55	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	29	19.44	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	RNA	SNP	26	0.00	0	33	5.71	2	-	NULL	ENST00000276297.4	37	NULL	CCDS5989.1	8																																																																																			-	-		0.483	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	protein_coding	OTTHUMT00000207632.2	C	NM_182643, NM_006094	-		13072066	-1	no_errors	ENST00000506171	ensembl	human	known	74_37	rna	SNP	0.004	T
STXBP1	6812	genome.wustl.edu	37	9	130438121	130438121	+	Silent	SNP	C	C	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr9:130438121C>T	ENST00000373299.1	+	14	1264	c.1149C>T	c.(1147-1149)atC>atT	p.I383I	STXBP1_ENST00000481942.1_3'UTR|STXBP1_ENST00000373302.3_Silent_p.I383I	NM_001032221.3	NP_001027392.1	P61764	STXB1_HUMAN	syntaxin binding protein 1	383					axon target recognition (GO:0007412)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long term synaptic depression (GO:0060292)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|protein stabilization (GO:0050821)|protein transport (GO:0015031)|regulation of insulin secretion (GO:0050796)|regulation of SNARE complex assembly (GO:0035542)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|regulation of synaptic vesicle priming (GO:0010807)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|SNARE binding (GO:0000149)|syntaxin binding (GO:0019905)|syntaxin-1 binding (GO:0017075)			breast(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|skin(2)	23						GAGAGAAGATCAAGGACCCTA	0.493																																																	0								ENSG00000136854						145.0	106.0	119.0					9																	130438121		2203	4300	6503	STXBP1	SO:0001819	synonymous_variant	0			-	HGNC	AF004563	CCDS6874.1, CCDS35146.1	9q34.1	2008-07-21			ENSG00000136854	ENSG00000136854			11444	protein-coding gene	gene with protein product	"""syntaxin-binding protein 1"""	602926				9545644	Standard	NM_001032221		Approved	hUNC18, MUNC18-1, UNC18, rbSec1	uc004brk.2	P61764	OTTHUMG00000020713	ENST00000373299.1:c.1149C>T	9.37:g.130438121C>T		Somatic	0	88	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	69	21.59	B1AM97|Q28208|Q62759|Q64320|Q96TG8	Silent	SNP	25	0.00	0	40	27.27	15	pfam_Sec1-like,superfamily_Sec1-like	p.I383	ENST00000373299.1	37	c.1149	CCDS35146.1	9																																																																																			-	pfam_Sec1-like,superfamily_Sec1-like		0.493	STXBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP1	protein_coding	OTTHUMT00000054229.1	C	NM_003165	-		130438121	+1	no_errors	ENST00000373299	ensembl	human	known	74_37	silent	SNP	1.000	T
PRR5L	79899	genome.wustl.edu	37	11	36485195	36485195	+	3'UTR	DEL	A	A	-	rs200390084	byFrequency	TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr11:36485195delA	ENST00000378867.3	+	0	2371				PRR5L_ENST00000389693.3_3'UTR|PRR5L_ENST00000311599.5_3'UTR	NM_024841.4	NP_079117.3	Q6MZQ0	PRR5L_HUMAN	proline rich 5 like						negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|regulation of fibroblast migration (GO:0010762)|TORC2 signaling (GO:0038203)	mitochondrion (GO:0005739)|TORC2 complex (GO:0031932)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)	19						TGTATCGTTTAAAAAAAAAAA	0.393													|||unknown(HR)	1189	0.23742	0.2224	0.3184	5008	,	,		21881	0.1944		0.2913	False		,,,				2504	0.1892																0								ENSG00000135362																																			PRR5L	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS31463.1, CCDS53617.1	11p13-p12	2009-07-09				ENSG00000135362			25878	protein-coding gene	gene with protein product	"""protein observed with Rictor-2"""	611728				17461779	Standard	NM_024841		Approved	FLJ14213, PROTOR-2	uc001mwp.3	Q6MZQ0		ENST00000378867.3:c.*909A>-	11.37:g.36485195delA		Somatic	0	15	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	16	23.81	A4QN22|E9PKY1|Q96H46|Q9H7V4	RNA	DEL	31	0.00	0	40	0.00	0	-	NULL	ENST00000378867.3	37	NULL	CCDS31463.1	11																																																																																			-	-		0.393	PRR5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRR5L	protein_coding	OTTHUMT00000389209.1	A	NM_024841			36485195	+1	no_errors	ENST00000389693	ensembl	human	known	74_37	rna	DEL	0.022	-
KCNH3	23416	genome.wustl.edu	37	12	49948182	49948182	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr12:49948182G>A	ENST00000257981.6	+	11	2241	c.1981G>A	c.(1981-1983)Gac>Aac	p.D661N		NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	661					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.D661N(1)		NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						GGCCAATGCCGACGTGAAGGG	0.652																																																	1	Substitution - Missense(1)	prostate(1)						ENSG00000135519						78.0	80.0	79.0					12																	49948182		2203	4300	6503	KCNH3	SO:0001583	missense	0			-	HGNC	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.1981G>A	12.37:g.49948182G>A	ENSP00000257981:p.Asp661Asn	Somatic	0	69	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	147	11.45	Q9UQ06	Missense_Mutation	SNP	23	0.00	0	88	3.30	3	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_cNMP-bd_dom,pfam_PAS_4,pfam_PAS_fold,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.D661N	ENST00000257981.6	37	c.1981	CCDS8786.1	12	.	.	.	.	.	.	.	.	.	.	G	20.2	3.948682	0.73787	.	.	ENSG00000135519	ENST00000257981	D	0.92446	-3.04	4.81	4.81	0.61882	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (2);	0.000000	0.48767	D	0.000180	D	0.89255	0.6663	L	0.48986	1.54	0.28505	N	0.91384	B	0.32526	0.374	B	0.32928	0.155	T	0.82822	-0.0267	10	0.27785	T	0.31	.	16.1975	0.82042	0.0:0.0:1.0:0.0	.	661	Q9ULD8	KCNH3_HUMAN	N	661	ENSP00000257981:D661N	ENSP00000257981:D661N	D	+	1	0	KCNH3	48234449	0.992000	0.36948	0.382000	0.26119	0.880000	0.50808	2.399000	0.44495	2.628000	0.89032	0.563000	0.77884	GAC	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom		0.652	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH3	protein_coding	OTTHUMT00000404571.2	G	NM_012284	-		49948182	+1	no_errors	ENST00000257981	ensembl	human	known	74_37	missense	SNP	0.478	A
KCNH3	23416	genome.wustl.edu	37	12	49948322	49948322	+	Silent	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr12:49948322G>A	ENST00000257981.6	+	11	2381	c.2121G>A	c.(2119-2121)ggG>ggA	p.G707G		NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	707					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						TGGGTGCTGGGGGAGGCTCTG	0.657																																																	0								ENSG00000135519						45.0	43.0	44.0					12																	49948322		2203	4300	6503	KCNH3	SO:0001819	synonymous_variant	0			-	HGNC	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.2121G>A	12.37:g.49948322G>A		Somatic	0	44	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	96	8.57	Q9UQ06	Silent	SNP	23	0.00	0	88	3.30	3	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_cNMP-bd_dom,pfam_PAS_4,pfam_PAS_fold,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.G707	ENST00000257981.6	37	c.2121	CCDS8786.1	12																																																																																			-	NULL		0.657	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH3	protein_coding	OTTHUMT00000404571.2	G	NM_012284	-		49948322	+1	no_errors	ENST00000257981	ensembl	human	known	74_37	silent	SNP	0.014	A
GAREML	150946	genome.wustl.edu	37	2	26410287	26410287	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr2:26410287G>A	ENST00000401533.2	+	6	1916	c.1786G>A	c.(1786-1788)Gcc>Acc	p.A596T	GAREML_ENST00000407684.1_Intron|GAREML_ENST00000496070.1_3'UTR	NM_001168241.1	NP_001161713.1	Q75VX8	GAREL_HUMAN	GRB2 associated, regulator of MAPK1-like	596	Pro-rich.					extracellular vesicular exosome (GO:0070062)											CGGTCGAGCCGCCTCCCTTCT	0.662																																																	0								ENSG00000157833						71.0	67.0	68.0					2																	26410287		692	1591	2283	GAREML	SO:0001583	missense	0			-	HGNC	AK090454, AB015349, AB124552	CCDS54336.1, CCDS54337.1	2p23.3	2012-11-30	2012-11-30	2012-11-30	ENSG00000157833	ENSG00000157833			27172	protein-coding gene	gene with protein product			"""family with sequence similarity 59, member B"""	FAM59B			Standard	NM_001168241		Approved	KIAA2038, FLJ00375	uc002rgw.2	Q75VX8	OTTHUMG00000151935	ENST00000401533.2:c.1786G>A	2.37:g.26410287G>A	ENSP00000384593:p.Ala596Thr	Somatic	0	85	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	67	17.07	B5MC97|B7WNK9|Q8NF27|Q9UIK8	Missense_Mutation	SNP	23	0.00	0	26	18.75	6	superfamily_SAM/pointed	p.A596T	ENST00000401533.2	37	c.1786	CCDS54336.1	2	.	.	.	.	.	.	.	.	.	.	G	0.116	-1.132222	0.01756	.	.	ENSG00000157833	ENST00000401533	T	0.13307	2.6	5.2	-0.73	0.11154	.	1.463100	0.04536	N	0.387133	T	0.04543	0.0124	N	0.02916	-0.46	0.21445	N	0.999683	B	0.09022	0.002	B	0.04013	0.001	T	0.34601	-0.9822	10	0.15066	T	0.55	-4.8854	0.5517	0.00664	0.3411:0.1723:0.311:0.1756	.	596	Q75VX8	FA59B_HUMAN	T	596	ENSP00000384593:A596T	ENSP00000384593:A596T	A	+	1	0	FAM59B	26263791	0.000000	0.05858	0.001000	0.08648	0.025000	0.11179	-0.204000	0.09425	-0.041000	0.13558	-0.229000	0.12294	GCC	-	NULL		0.662	GAREML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAREML	protein_coding	OTTHUMT00000324498.2	G	NM_001168241	-		26410287	+1	no_errors	ENST00000401533	ensembl	human	known	74_37	missense	SNP	0.002	A
PRPF40B	25766	genome.wustl.edu	37	12	50036712	50036712	+	Silent	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr12:50036712G>A	ENST00000380281.1	+	21	2119	c.2055G>A	c.(2053-2055)caG>caA	p.Q685Q	PRPF40B_ENST00000548825.2_Splice_Site|FMNL3_ENST00000335154.5_3'UTR|PRPF40B_ENST00000261897.1_Silent_p.Q672Q			Q6NWY9	PR40B_HUMAN	PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)	685					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34						GCCTCTAGCAGACTGAATGCC	0.537																																																	0								ENSG00000110844						121.0	100.0	107.0					12																	50036712		2203	4300	6503	PRPF40B	SO:0001819	synonymous_variant	0			-	HGNC	AF049525	CCDS31796.1, CCDS31796.2	12q13.12	2014-09-17	2006-04-04			ENSG00000110844			25031	protein-coding gene	gene with protein product	"""Huntingtin interacting protein C"""		"""PRP40 pre-mRNA processing factor 40 homolog B (yeast)"""			9700202	Standard	NM_001031698		Approved	HYPC	uc001rus.2	Q6NWY9		ENST00000380281.1:c.2055G>A	12.37:g.50036712G>A		Somatic	0	36	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	103	9.65	O75401|Q6PI09|Q6ZWB3|Q8NCZ1|Q9H5G4|Q9NT95	Splice_Site	SNP	25	0.00	0	141	4.67	7	-	e22-1	ENST00000380281.1	37	c.2119-1		12																																																																																			-	-		0.537	PRPF40B-001	KNOWN	basic	protein_coding	PRPF40B	protein_coding	OTTHUMT00000404838.1	G	NM_012272	-		50036712	+1	no_errors	ENST00000548825	ensembl	human	known	74_37	splice_site	SNP	1.000	A
ANAPC5	51433	genome.wustl.edu	37	12	121747544	121747544	+	Silent	SNP	C	C	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr12:121747544C>T	ENST00000261819.3	-	16	2137	c.2016G>A	c.(2014-2016)gtG>gtA	p.V672V	ANAPC5_ENST00000344395.4_Silent_p.V560V|ANAPC5_ENST00000441917.2_Silent_p.V560V|ANAPC5_ENST00000541887.1_Silent_p.V659V|ANAPC5_ENST00000535482.1_Silent_p.V338V|ANAPC5_ENST00000544314.1_5'UTR	NM_016237.4	NP_057321.2	Q9UJX4	APC5_HUMAN	anaphase promoting complex subunit 5	672					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(6)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(3)	31	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CTGCTGAAGCCACCTGGCACT	0.512																																																	0								ENSG00000089053						80.0	74.0	76.0					12																	121747544		2203	4300	6503	ANAPC5	SO:0001819	synonymous_variant	0			-	HGNC	AF191339	CCDS9220.1, CCDS45000.1	12q24.31	2014-08-12			ENSG00000089053	ENSG00000089053		"""Anaphase promoting complex subunits"""	15713	protein-coding gene	gene with protein product		606948				9469815	Standard	NM_016237		Approved	APC5	uc001uag.3	Q9UJX4	OTTHUMG00000169157	ENST00000261819.3:c.2016G>A	12.37:g.121747544C>T		Somatic	0	44	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	172	81	67.98	E9PFB2|Q8N4H7|Q9BQD4	Silent	SNP	29	0.00	0	78	72.34	204	smart_TPR_repeat	p.V672	ENST00000261819.3	37	c.2016	CCDS9220.1	12																																																																																			-	NULL		0.512	ANAPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC5	protein_coding	OTTHUMT00000402582.1	C		-		121747544	-1	no_errors	ENST00000261819	ensembl	human	known	74_37	silent	SNP	1.000	T
MYO5C	55930	genome.wustl.edu	37	15	52571803	52571803	+	Silent	SNP	C	C	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr15:52571803C>T	ENST00000261839.7	-	3	368	c.207G>A	c.(205-207)gaG>gaA	p.E69E	MYO5C_ENST00000541028.1_5'UTR|MIR1266_ENST00000408125.1_RNA|MYO5C_ENST00000443683.2_5'UTR	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	69	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		TGAGGTCATTCTCGCCCACGA	0.483																																																	0								ENSG00000128833						67.0	66.0	67.0					15																	52571803		1904	4125	6029	MYO5C	SO:0001819	synonymous_variant	0			-	HGNC	AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.207G>A	15.37:g.52571803C>T		Somatic	0	40	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	Q6P1W8	Silent	SNP	29	0.00	0	30	25.00	10	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E69	ENST00000261839.7	37	c.207	CCDS42036.1	15																																																																																			-	superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.483	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5C	protein_coding	OTTHUMT00000419562.1	C	NM_018728	-		52571803	-1	no_errors	ENST00000261839	ensembl	human	known	74_37	silent	SNP	1.000	T
SYK	6850	genome.wustl.edu	37	9	93606231	93606231	+	Silent	SNP	C	C	T	rs200626943		TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr9:93606231C>T	ENST00000375754.4	+	2	199	c.51C>T	c.(49-51)ttC>ttT	p.F17F	SYK_ENST00000375746.1_Silent_p.F17F|SYK_ENST00000375747.1_Silent_p.F17F|SYK_ENST00000375751.4_Silent_p.F17F|SYK_ENST00000476708.1_3'UTR	NM_003177.5	NP_003168.2	P43405	KSYK_HUMAN	spleen tyrosine kinase	17	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of JUN kinase activity (GO:0007257)|adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|B cell receptor signaling pathway (GO:0050853)|beta selection (GO:0043366)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|cell proliferation (GO:0008283)|cellular response to molecule of fungal origin (GO:0071226)|defense response to bacterium (GO:0042742)|enzyme linked receptor protein signaling pathway (GO:0007167)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte activation involved in immune response (GO:0002366)|leukocyte cell-cell adhesion (GO:0007159)|leukotriene biosynthetic process (GO:0019370)|lymph vessel development (GO:0001945)|macrophage activation involved in immune response (GO:0002281)|neutrophil activation involved in immune response (GO:0002283)|neutrophil chemotaxis (GO:0030593)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of bone resorption (GO:0045780)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of arachidonic acid secretion (GO:0090237)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of neutrophil degranulation (GO:0043313)|regulation of phagocytosis (GO:0050764)|regulation of platelet activation (GO:0010543)|regulation of platelet aggregation (GO:0090330)|regulation of superoxide anion generation (GO:0032928)|serotonin secretion by platelet (GO:0002554)|viral process (GO:0016032)	B cell receptor complex (GO:0019815)|cytosol (GO:0005829)|early phagosome (GO:0032009)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|integrin binding (GO:0005178)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)|skin(2)|stomach(2)	26						CCTTCTTTTTCGGCAACATCA	0.627			T	"""ETV6, ITK"""	"""MDS, peripheral T-cell lymphoma"""																																			Dom	yes		9	9q22	6850	spleen tyrosine kinase		L	0								ENSG00000165025						32.0	24.0	27.0					9																	93606231		2203	4300	6503	SYK	SO:0001819	synonymous_variant	0			-	HGNC	L28824	CCDS6688.1, CCDS47992.1	9q22	2013-02-14			ENSG00000165025	ENSG00000165025		"""SH2 domain containing"""	11491	protein-coding gene	gene with protein product		600085				8082894, 1423621	Standard	XM_005252147		Approved		uc004aqz.3	P43405	OTTHUMG00000020200	ENST00000375754.4:c.51C>T	9.37:g.93606231C>T		Somatic	0	34	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	30	18.92		Silent	SNP	26	0.00	0	42	14.29	7	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,superfamily_Kinase-like_dom,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_SH2,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.F17	ENST00000375754.4	37	c.51	CCDS6688.1	9																																																																																			-	pfam_SH2,smart_SH2,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_SH2		0.627	SYK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYK	protein_coding	OTTHUMT00000053018.1	C		rs200626943		93606231	+1	no_errors	ENST00000375746	ensembl	human	known	74_37	silent	SNP	0.814	T
CEL	1056	genome.wustl.edu	37	9	135944447	135944447	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr9:135944447G>A	ENST00000372080.4	+	9	1112	c.1096G>A	c.(1096-1098)Gac>Aac	p.D366N	CEL_ENST00000351304.7_Missense_Mutation_p.D363N	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	363					cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		CCCCAGGGAGGACTTCTACAA	0.572																																																	0								ENSG00000170835						16.0	23.0	21.0					9																	135944447		1535	3589	5124	CEL	SO:0001583	missense	0			-	HGNC	M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.1096G>A	9.37:g.135944447G>A	ENSP00000361151:p.Asp366Asn	Somatic	0	31	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	46	14.81	Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	10	0.00	0	27	15.62	5	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.D366N	ENST00000372080.4	37	c.1096	CCDS43896.1	9	.	.	.	.	.	.	.	.	.	.	G	16.38	3.107954	0.56291	.	.	ENSG00000170835	ENST00000372080;ENST00000351304;ENST00000303626	T;T	0.67523	-0.27;-0.27	5.37	3.42	0.39159	Carboxylesterase, type B (1);	0.379902	0.30556	N	0.009369	T	0.63129	0.2485	L	0.37630	1.12	0.47476	D	0.999433	P	0.50272	0.933	P	0.51229	0.663	T	0.65619	-0.6124	10	0.87932	D	0	.	9.1044	0.36689	0.0835:0.2216:0.6949:0.0	.	363	P19835	CEL_HUMAN	N	366;363;365	ENSP00000361151:D366N;ENSP00000342217:D363N	ENSP00000304021:D365N	D	+	1	0	CEL	134934268	1.000000	0.71417	1.000000	0.80357	0.292000	0.27327	4.149000	0.58091	1.273000	0.44346	0.491000	0.48974	GAC	-	pfam_CarbesteraseB		0.572	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEL	protein_coding	OTTHUMT00000054823.1	G		-		135944447	+1	no_errors	ENST00000372080	ensembl	human	known	74_37	missense	SNP	0.998	A
LPCAT2	54947	genome.wustl.edu	37	16	55584939	55584939	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr16:55584939delA	ENST00000262134.5	+	11	1324	c.1140delA	c.(1138-1140)ggafs	p.G380fs		NM_017839.4	NP_060309.2	Q7L5N7	PCAT2_HUMAN	lysophosphatidylcholine acyltransferase 2	380					glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	12						GAAGAATTGGAATTGAAGAAT	0.343																																																	0								ENSG00000087253						123.0	122.0	122.0					16																	55584939		2198	4300	6498	LPCAT2	SO:0001589	frameshift_variant	0				HGNC	AK000488	CCDS10753.1	16q12.2	2013-01-10	2007-12-17	2007-12-17	ENSG00000087253	ENSG00000087253		"""EF-hand domain containing"""	26032	protein-coding gene	gene with protein product		612040	"""acyltransferase like 1"""	AYTL1		16704971	Standard	NM_017839		Approved	FLJ20481	uc002eie.4	Q7L5N7	OTTHUMG00000133238	ENST00000262134.5:c.1140delA	16.37:g.55584939delA	ENSP00000262134:p.Gly380fs	Somatic	0	72	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	100	13.04	A3KBM1|Q6MZJ6|Q9NX23	Frame_Shift_Del	DEL	43	0.00	0	50	0.00	0	pfam_EF_hand_dom,pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.I381fs	ENST00000262134.5	37	c.1140	CCDS10753.1	16																																																																																			-	NULL		0.343	LPCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT2	protein_coding	OTTHUMT00000256977.2	A	NM_017839			55584939	+1	no_errors	ENST00000262134	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
RN7SL319P	106479339	genome.wustl.edu	37	15	76077689	76077690	+	RNA	INS	-	-	G	rs200411336	byFrequency	TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr15:76077689_76077690insG	ENST00000395215.3	+	0	1184				RN7SL319P_ENST00000480656.2_RNA																							agcaagatcttgttcttaaaag	0.515													|||unknown(NO_COVERAGE)	899	0.179513	0.0817	0.255	5008	,	,		17448	0.2599		0.2028	False		,,,				2504	0.1513																0								ENSG00000241807																																			RN7SL319P			0				HGNC																													15.37:g.76077690_76077690dupG		Somatic	0	14	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	13	43.48		RNA	INS	15	6.25	1	19	9.52	2	-	NULL	ENST00000395215.3	37	NULL		15																																																																																			-	-		0.515	RP11-24M17.5-001	KNOWN	basic	processed_transcript	RN7SL319P	pseudogene	OTTHUMT00000420501.1	-				76077690	+1	no_errors	ENST00000480656	ensembl	human	known	74_37	rna	INS	0.981:0.985	G
MT-CO2	4513	genome.wustl.edu	37	M	7850	7850	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chrM:7850G>A	ENST00000361739.1	+	1	265	c.265G>A	c.(265-267)Gag>Aag	p.E89K	MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	89					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						ACATAACAGACGAGGTCAACG	0.502																																																	0								ENSG00000198712																																			MT-CO2	SO:0001583	missense	0			-	HGNC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.265G>A	M.37:g.7850G>A	ENSP00000354876:p.Glu89Lys	Somatic	0	319	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	97	833	10.43	Q37526	Missense_Mutation	SNP	1601	0.06	1	2280	10.22	260	pfam_Cyt_c_oxidase_su2_C,pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cupredoxin,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	p.E89K	ENST00000361739.1	37	c.265		MT																																																																																			-	superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,tigrfam_Cyt_c_oxidase_su2		0.502	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	MT-CO2	protein_coding		G	YP_003024029	-		7850	+1	no_errors	ENST00000361739	ensembl	human	known	74_37	missense	SNP	NULL	A
POTEA	340441	genome.wustl.edu	37	8	43159855	43159855	+	RNA	SNP	C	C	G			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr8:43159855C>G	ENST00000522175.2	+	0	711				RNU6-104P_ENST00000459597.1_RNA			Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A											breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(27)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TTGCCAATTACTTTCTGACTA	0.294																																																	0								ENSG00000188877						66.0	63.0	64.0					8																	43159855		1923	4164	6087	POTEA			0			-	HGNC	AY462869		8p11.1	2013-01-11	2008-11-26	2008-11-26	ENSG00000188877	ENSG00000188877		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33893	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 3"""	608915	"""ANKRD26-like family A, member 1"""	A26A1			Standard	NM_001002920		Approved	POTE8, POTE-8, CT104.3	uc003xpz.1	Q6S8J7	OTTHUMG00000164111		8.37:g.43159855C>G		Somatic	0	70	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	166	202	44.99	A6ND17|A6ND71|Q6S8J6	RNA	SNP	32	0.00	0	46	36.99	27	-	NULL	ENST00000522175.2	37	NULL		8																																																																																			-	-		0.294	POTEA-003	KNOWN	basic	processed_transcript	POTEA	pseudogene	OTTHUMT00000383492.1	C	NM_001002920	-		43159855	+1	no_errors	ENST00000522175	ensembl	human	known	74_37	rna	SNP	0.005	G
USP48	84196	genome.wustl.edu	37	1	22073626	22073626	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr1:22073626T>A	ENST00000308271.9	-	8	1573	c.925A>T	c.(925-927)Aaa>Taa	p.K309*	USP48_ENST00000529637.1_Nonsense_Mutation_p.K309*|USP48_ENST00000421625.2_Nonsense_Mutation_p.K309*|USP48_ENST00000400301.1_Nonsense_Mutation_p.K309*	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	309	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		TTCAGCTTTTTCTTATGTCCA	0.289																																																	0								ENSG00000090686						89.0	86.0	87.0					1																	22073626		2203	4300	6503	USP48	SO:0001587	stop_gained	0			-	HGNC	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.925A>T	1.37:g.22073626T>A	ENSP00000309262:p.Lys309*	Somatic	0	42	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	29	14.71	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Nonsense_Mutation	SNP	37	0.00	0	50	12.28	7	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67,pfscan_Ubiquitin_supergroup	p.K309*	ENST00000308271.9	37	c.925	CCDS30623.1	1	.	.	.	.	.	.	.	.	.	.	T	45	11.402039	0.99556	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000529637;ENST00000421625	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.2953	0.66308	0.0:0.0:0.0:1.0	.	.	.	.	X	309	.	ENSP00000309262:K309X	K	-	1	0	USP48	21946213	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.851000	0.75425	1.965000	0.57142	0.455000	0.32223	AAA	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.289	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP48	protein_coding	OTTHUMT00000021372.1	T	NM_032236	-		22073626	-1	no_errors	ENST00000308271	ensembl	human	known	74_37	nonsense	SNP	1.000	A
FAM186B	84070	genome.wustl.edu	37	12	49992542	49992542	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr12:49992542G>A	ENST00000257894.2	-	5	2521	c.2360C>T	c.(2359-2361)cCc>cTc	p.P787L	FAM186B_ENST00000551047.1_Intron|FAM186B_ENST00000544141.1_Missense_Mutation_p.P697L	NM_032130.2	NP_115506.1	Q8IYM0	F186B_HUMAN	family with sequence similarity 186, member B	787						protein complex (GO:0043234)				breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GCCCACCTTGGGGAACATGGT	0.667																																																	0								ENSG00000135436						51.0	48.0	49.0					12																	49992542		2203	4300	6503	FAM186B	SO:0001583	missense	0			-	HGNC	AL136748	CCDS8788.1	12q13.12	2008-09-17	2008-09-17	2008-09-17	ENSG00000135436	ENSG00000135436			25296	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 25"""	C12orf25		11230166	Standard	NM_032130		Approved	DKFZP434J0113	uc001ruo.3	Q8IYM0	OTTHUMG00000167427	ENST00000257894.2:c.2360C>T	12.37:g.49992542G>A	ENSP00000257894:p.Pro787Leu	Somatic	0	28	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	52	11.86	B4DZ15|Q8TCP7|Q9H0L3	Missense_Mutation	SNP	13	0.00	0	55	5.17	3	NULL	p.P787L	ENST00000257894.2	37	c.2360	CCDS8788.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.0|22.0	4.230519|4.230519	0.79688|0.79688	.|.	.|.	ENSG00000135436|ENSG00000135436	ENST00000544141;ENST00000532262;ENST00000257894|ENST00000548841	T;T;T|T	0.44083|0.42131	0.93;0.93;0.93|0.98	5.28|5.28	4.33|4.33	0.51752|0.51752	.|.	0.000000|0.000000	0.42420|0.42420	D|D	0.000709|0.000709	T|T	0.53594|0.53594	0.1806|0.1806	M|M	0.72479|0.72479	2.2|2.2	0.43703|0.43703	D|D	0.996169|0.996169	D;D|.	0.76494|.	0.999;0.999|.	D;D|.	0.76575|.	0.988;0.982|.	T|T	0.51624|0.51624	-0.8682|-0.8682	9|7	.|.	.|.	.|.	-24.8923|-24.8923	10.6893|10.6893	0.45862|0.45862	0.0:0.0:0.8096:0.1904|0.0:0.0:0.8096:0.1904	.|.	697;787|.	B4DZ15;Q8IYM0|.	.;F186B_HUMAN|.	L|S	697;400;787|11	ENSP00000438569:P697L;ENSP00000436995:P400L;ENSP00000257894:P787L|ENSP00000448989:P11S	.|.	P|P	-|-	2|1	0|0	FAM186B|FAM186B	48278809|48278809	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	3.298000|3.298000	0.51818|0.51818	2.642000|2.642000	0.89623|0.89623	0.650000|0.650000	0.86243|0.86243	CCC|CCA	-	NULL		0.667	FAM186B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM186B	protein_coding	OTTHUMT00000394583.2	G	NM_032130	-		49992542	-1	no_errors	ENST00000257894	ensembl	human	known	74_37	missense	SNP	1.000	A
SETD1B	23067	genome.wustl.edu	37	12	122247621	122247621	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr12:122247621C>T	ENST00000604567.1	+	6	838	c.770C>T	c.(769-771)gCt>gTt	p.A257V	SETD1B_ENST00000542440.1_Missense_Mutation_p.A257V|SETD1B_ENST00000267197.5_Missense_Mutation_p.A257V			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	257					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						CAGGACACAGCTTATTCCAGC	0.637																																																	0								ENSG00000139718						66.0	73.0	71.0					12																	122247621		692	1591	2283	SETD1B	SO:0001583	missense	0			-	HGNC	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.770C>T	12.37:g.122247621C>T	ENSP00000474253:p.Ala257Val	Somatic	0	78	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	325	410	44.04	F6MFW1	Missense_Mutation	SNP	28	0.00	0	177	48.40	166	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.A257V	ENST00000604567.1	37	c.770		12	.	.	.	.	.	.	.	.	.	.	C	8.820	0.937293	0.18206	.	.	ENSG00000139718	ENST00000542440;ENST00000267197	D;D	0.95238	-3.65;-3.65	5.29	4.39	0.52855	.	.	.	.	.	D	0.95535	0.8549	L	0.59436	1.845	0.46499	D	0.999073	D	0.60575	0.988	P	0.57204	0.815	D	0.95588	0.8652	9	0.66056	D	0.02	.	15.9312	0.79659	0.0:0.8646:0.1354:0.0	.	257	Q9UPS6	SET1B_HUMAN	V	257	ENSP00000442924:A257V;ENSP00000267197:A257V	ENSP00000267197:A257V	A	+	2	0	SETD1B	120732004	1.000000	0.71417	0.253000	0.24343	0.004000	0.04260	5.831000	0.69330	1.215000	0.43411	-0.305000	0.09177	GCT	-	NULL		0.637	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	SETD1B	protein_coding	OTTHUMT00000468264.1	C	XM_037523	-		122247621	+1	no_errors	ENST00000267197	ensembl	human	known	74_37	missense	SNP	1.000	T
IVL	3713	genome.wustl.edu	37	1	152883175	152883175	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr1:152883175A>T	ENST00000368764.3	+	2	966	c.902A>T	c.(901-903)aAg>aTg	p.K301M	IVL_ENST00000392667.2_Missense_Mutation_p.K155M			P07476	INVO_HUMAN	involucrin	301	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAGCAGGAGAAGCAGCCAGAG	0.637																																																	0								ENSG00000163207						19.0	19.0	19.0					1																	152883175		2063	4020	6083	IVL	SO:0001583	missense	0			-	HGNC	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.902A>T	1.37:g.152883175A>T	ENSP00000357753:p.Lys301Met	Somatic	0	55	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	71	29.00	Q5T7P4	Missense_Mutation	SNP	25	0.00	0	37	28.57	16	pfam_Involucrin_N,pfam_Involucrin_rpt	p.K301M	ENST00000368764.3	37	c.902	CCDS1030.1	1	.	.	.	.	.	.	.	.	.	.	G	9.840	1.190704	0.21954	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.10668	3.02;2.85	3.75	-0.0893	0.13669	.	.	.	.	.	T	0.02688	0.0081	N	0.14661	0.345	0.09310	N	1	P	0.43885	0.82	P	0.45998	0.5	T	0.40421	-0.9564	9	0.46703	T	0.11	.	7.0113	0.24863	0.6817:0.0:0.3183:0.0	.	301	P07476	INVO_HUMAN	M	301;155	ENSP00000357753:K301M;ENSP00000376435:K155M	ENSP00000357753:K301M	K	+	2	0	IVL	151149799	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	0.188000	0.17018	0.027000	0.15297	-1.786000	0.00637	AAG	-	pfam_Involucrin_rpt		0.637	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVL	protein_coding	OTTHUMT00000034664.1	A	NM_005547	-		152883175	+1	no_errors	ENST00000368764	ensembl	human	known	74_37	missense	SNP	0.017	T
SLC6A18	348932	genome.wustl.edu	37	5	1238154	1238154	+	Silent	SNP	C	C	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr5:1238154C>T	ENST00000324642.3	+	5	834	c.711C>T	c.(709-711)ctC>ctT	p.L237L	SLC6A18_ENST00000296821.4_Silent_p.L237L	NM_182632.2	NP_872438.2	Q96N87	S6A18_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 18	237					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(4)|upper_aerodigestive_tract(1)	34	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CAAAAGGACTCATCTACTTGT	0.517																																																	0								ENSG00000164363						131.0	116.0	121.0					5																	1238154		2203	4300	6503	SLC6A18	SO:0001819	synonymous_variant	0			-	HGNC	AK055798	CCDS3860.1	5p15	2013-07-19	2013-07-19		ENSG00000164363	ENSG00000164363		"""Solute carriers"""	26441	protein-coding gene	gene with protein product		610300	"""solute carrier family 6 (neurotransmitter transporter), member 18"", ""solute carrier family 6, member 18"""			19478081	Standard	NM_182632		Approved	FLJ31236, Xtrp2	uc003jby.2	Q96N87	OTTHUMG00000090356	ENST00000324642.3:c.711C>T	5.37:g.1238154C>T		Somatic	0	58	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	162	139	53.82		Silent	SNP	29	0.00	0	81	55.49	101	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.L237	ENST00000324642.3	37	c.711	CCDS3860.1	5																																																																																			-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.517	SLC6A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A18	protein_coding	OTTHUMT00000206728.3	C	NM_182632	-		1238154	+1	no_errors	ENST00000324642	ensembl	human	known	74_37	silent	SNP	0.000	T
STKLD1	169436	genome.wustl.edu	37	9	136270458	136270458	+	Silent	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr9:136270458G>A	ENST00000371957.3	+	18	2063	c.1956G>A	c.(1954-1956)gtG>gtA	p.V652V	C9orf96_ENST00000371955.1_Silent_p.V185V	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		652							ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CCAGCCTGGTGAGTGACAGCA	0.602																																																	0								ENSG00000198870						49.0	43.0	45.0					9																	136270458		2203	4298	6501	C9orf96	SO:0001819	synonymous_variant	0			-	HGNC																												ENST00000371957.3:c.1956G>A	9.37:g.136270458G>A		Somatic	0	19	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	17	26.09	Q5T8U8|Q6ZMP6|Q6ZMQ5	Silent	SNP	31	0.00	0	46	9.80	5	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V652	ENST00000371957.3	37	c.1956	CCDS35169.1	9																																																																																			-	NULL		0.602	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf96	protein_coding	OTTHUMT00000054855.1	G		-		136270458	+1	no_errors	ENST00000371957	ensembl	human	known	74_37	silent	SNP	0.998	A
RP11-43F13.4	0	genome.wustl.edu	37	5	1004311	1004314	+	lincRNA	DEL	GTGT	GTGT	-	rs3083863|rs72705193|rs57997780|rs61651856	byFrequency	TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	GTGT	GTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr5:1004311_1004314delGTGT	ENST00000606540.1	+	0	0				AC116351.2_ENST00000408317.1_RNA																							GGGGACgtgggtgtgtgtgtgtgt	0.588																																																	0								ENSG00000221244																																			AC116351.2			0				Clone_based_ensembl_gene																													5.37:g.1004319_1004322delGTGT		Somatic	0	32	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	63	12.50		RNA	DEL	8	11.11	1	33	0.00	0	-	NULL	ENST00000606540.1	37	NULL		5																																																																																			-	-		0.588	RP11-43F13.4-001	KNOWN	basic	lincRNA	ENSG00000221244	lincRNA	OTTHUMT00000470457.1	GTGT				1004314	+1	no_errors	ENST00000408317	ensembl	human	novel	74_37	rna	DEL	0.057:0.050:0.043:0.036	-
CMSS1	84319	genome.wustl.edu	37	3	99891167	99891167	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr3:99891167C>T	ENST00000421999.2	+	8	733	c.587C>T	c.(586-588)gCg>gTg	p.A196V	CMSS1_ENST00000489081.1_Missense_Mutation_p.A178V	NM_032359.3	NP_115735.2	Q9BQ75	CMS1_HUMAN	cms1 ribosomal small subunit homolog (yeast)	196							poly(A) RNA binding (GO:0044822)										CAGGTCCAGGCGCAGGTAAAG	0.413																																																	0								ENSG00000184220						65.0	69.0	68.0					3																	99891167		2203	4300	6503	CMSS1	SO:0001583	missense	0			-	HGNC		CCDS2935.1, CCDS54618.1	3q12.1	2012-09-20	2012-09-20	2012-09-20	ENSG00000184220	ENSG00000184220			28666	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 26"""	C3orf26		12477932	Standard	NM_032359		Approved	MGC4308	uc003dtl.3	Q9BQ75	OTTHUMG00000159054	ENST00000421999.2:c.587C>T	3.37:g.99891167C>T	ENSP00000410396:p.Ala196Val	Somatic	0	32	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	61	14.08	A8K5S7|B4DUM1|E9PHS3	Missense_Mutation	SNP	33	0.00	0	42	23.64	13	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase	p.A196V	ENST00000421999.2	37	c.587	CCDS2935.1	3	.	.	.	.	.	.	.	.	.	.	C	11.87	1.766689	0.31228	.	.	ENSG00000184220	ENST00000421999;ENST00000489081;ENST00000478909	T;T;T	0.30182	1.54;1.54;1.54	5.69	3.32	0.38043	DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.091723	0.64402	D	0.000001	T	0.16854	0.0405	N	0.20530	0.585	0.38732	D	0.953681	B	0.22211	0.066	B	0.12156	0.007	T	0.10613	-1.0622	9	.	.	.	.	8.5429	0.33404	0.7348:0.1362:0.0:0.1289	.	196	Q9BQ75	CC026_HUMAN	V	196;178;152	ENSP00000410396:A196V;ENSP00000419161:A178V;ENSP00000417293:A152V	.	A	+	2	0	C3orf26	101373857	1.000000	0.71417	0.812000	0.32479	0.240000	0.25518	4.166000	0.58203	0.440000	0.26502	-1.026000	0.02426	GCG	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase		0.413	CMSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMSS1	protein_coding	OTTHUMT00000353060.1	C	NM_032359	-		99891167	+1	no_errors	ENST00000421999	ensembl	human	known	74_37	missense	SNP	0.993	T
LOC440040	440040	genome.wustl.edu	37	11	49598199	49598210	+	RNA	DEL	CTCTTCCTTCTG	CTCTTCCTTCTG	-	rs71479502|rs3750925|rs7939515	byFrequency	TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	CTCTTCCTTCTG	CTCTTCCTTCTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr11:49598199_49598210delCTCTTCCTTCTG	ENST00000527477.1	+	0	803_814																											ATGGCTCCTCCTCTTCCTTCTGCTCCAAGAAG	0.505																																																	0								ENSG00000205035																																			RP11-707M1.1			0				Clone_based_vega_gene																													11.37:g.49598199_49598210delCTCTTCCTTCTG		Somatic	NA	NA	NA		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	16	23.81	5	25	0.00	0	-	NULL	ENST00000527477.1	37	NULL		11																																																																																			-	-		0.505	RP11-707M1.1-003	KNOWN	basic	processed_transcript	LOC440040	pseudogene	OTTHUMT00000391378.2	CTCTTCCTTCTG				49598210	+1	no_errors	ENST00000527477	ensembl	human	known	74_37	rna	DEL	0.006:0.002:0.026:0.005:0.020:0.025:0.013:0.243:0.771:0.857:0.990:0.998	-
PDE8B	8622	genome.wustl.edu	37	5	76709035	76709035	+	Silent	SNP	C	C	T	rs373238717		TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr5:76709035C>T	ENST00000264917.5	+	17	1857	c.1812C>T	c.(1810-1812)atC>atT	p.I604I	PDE8B_ENST00000333194.4_Silent_p.I549I|PDE8B_ENST00000340978.3_Silent_p.I557I|PDE8B_ENST00000342343.4_Silent_p.I584I|PDE8B_ENST00000346042.3_Silent_p.I507I|PDE8B_ENST00000505283.1_Silent_p.I69I	NM_003719.3	NP_003710.1	O95263	PDE8B_HUMAN	phosphodiesterase 8B	604	Catalytic. {ECO:0000250}.				cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|negative regulation of insulin secretion (GO:0046676)|negative regulation of steroid hormone biosynthetic process (GO:0090032)|phosphorelay signal transduction system (GO:0000160)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)		GMDS/PDE8B(2)	NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(15)|ovary(1)|prostate(2)|skin(3)	40		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)	Caffeine(DB00201)|Ketotifen(DB00920)	TCCAAGTGATCGAAGCCAACT	0.488																																																	0								ENSG00000113231						208.0	192.0	197.0					5																	76709035		2203	4300	6503	PDE8B	SO:0001819	synonymous_variant	0			-	HGNC	AF079529	CCDS4037.1, CCDS34190.1, CCDS34191.1, CCDS34192.1, CCDS34193.1	5q14.1	2008-05-15			ENSG00000113231	ENSG00000113231	3.1.4.17	"""Phosphodiesterases"""	8794	protein-coding gene	gene with protein product		603390				9784418	Standard	NM_003719		Approved		uc003kfa.3	O95263	OTTHUMG00000102170	ENST00000264917.5:c.1812C>T	5.37:g.76709035C>T		Somatic	0	55	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	73	21.51	Q5J7V7|Q86XK8|Q8IUJ7|Q8IUJ8|Q8IUJ9|Q8IUK0|Q8N3T2	Silent	SNP	22	0.00	0	50	19.35	12	pfam_PDEase_catalytic_dom,pfam_PDEase_PDE8,pfam_Sig_transdc_resp-reg_receiver,pfam_PAS_fold,pfam_PAS_4,pfam_PAS_fold_3,superfamily_PAS,superfamily_CheY-like_superfamily,smart_PAS,smart_HD/PDEase_dom,pfscan_PAS,prints_PDEase,tigrfam_PAS	p.I604	ENST00000264917.5	37	c.1812	CCDS4037.1	5																																																																																			-	NULL		0.488	PDE8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE8B	protein_coding	OTTHUMT00000220015.3	C	NM_003719	-		76709035	+1	no_errors	ENST00000264917	ensembl	human	known	74_37	silent	SNP	0.456	T
METTL21B	25895	genome.wustl.edu	37	12	58163566	58163566	+	5'Flank	SNP	A	A	G			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr12:58163566A>G	ENST00000300209.8	+	0	0				METTL21B_ENST00000551420.1_5'Flank|METTL21B_ENST00000548256.1_5'Flank|METTL1_ENST00000257848.7_Intron|METTL1_ENST00000548681.1_5'Flank|CYP27B1_ENST00000228606.4_5'Flank|METTL21B_ENST00000333012.5_5'Flank|METTL1_ENST00000324871.7_Missense_Mutation_p.Y150H	NM_015433.2	NP_056248.2	Q96AZ1	MT21B_HUMAN	methyltransferase like 21B							cytoplasm (GO:0005737)|intracellular (GO:0005622)	methyltransferase activity (GO:0008168)			endometrium(1)|lung(1)	2						TGGCCCTTGTAGAAGAAGTTA	0.607																																																	0								ENSG00000037897						59.0	55.0	56.0					12																	58163566		2203	4300	6503	METTL1	SO:0001631	upstream_gene_variant	0			-	HGNC	AL050100, AF455816	CCDS8957.1, CCDS31848.1	12q14.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000123427	ENSG00000123427			24936	protein-coding gene	gene with protein product		615258	"""family with sequence similarity 119, member B"""	FAM119B		12477932	Standard	NM_015433		Approved	DKFZP586D0919	uc001sqg.3	Q96AZ1	OTTHUMG00000170459		12.37:g.58163566A>G	Exception_encountered	Somatic	0	54	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	273	13.88	Q9H749|Q9Y3W2	Missense_Mutation	SNP	23	0.00	0	248	17.61	53	pfam_tRNA_(Gua-N-7)_MeTrfase,tigrfam_tRNA_(Gua-N-7)_MeTrfase	p.Y150H	ENST00000300209.8	37	c.448	CCDS8957.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.236|8.236	0.805802|0.805802	0.16467|0.16467	.|.	.|.	ENSG00000037897|ENSG00000037897	ENST00000548504|ENST00000324871	.|T	.|0.41065	.|1.01	5.08|5.08	3.23|3.23	0.37069|0.37069	.|.	.|1.444940	.|0.03848	.|N	.|0.271858	T|T	0.20292|0.20292	0.0488|0.0488	N|N	0.02181|0.02181	-0.65|-0.65	0.51012|0.51012	D|D	0.999909|0.999909	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.15838|0.15838	-1.0423|-1.0423	5|10	.|0.41790	.|T	.|0.15	1.7929|1.7929	5.1734|5.1734	0.15122|0.15122	0.1802:0.0:0.6563:0.1635|0.1802:0.0:0.6563:0.1635	.|.	.|150	.|Q9UBP6	.|TRMB_HUMAN	P|H	28|150	.|ENSP00000314441:Y150H	.|ENSP00000314441:Y150H	L|Y	-|-	2|1	0|0	METTL1|METTL1	56449833|56449833	0.982000|0.982000	0.34865|0.34865	0.875000|0.875000	0.34327|0.34327	0.986000|0.986000	0.74619|0.74619	1.974000|1.974000	0.40559|0.40559	0.521000|0.521000	0.28445|0.28445	-0.242000|-0.242000	0.12053|0.12053	CTA|TAC	-	pfam_tRNA_(Gua-N-7)_MeTrfase,tigrfam_tRNA_(Gua-N-7)_MeTrfase		0.607	METTL21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL1	protein_coding	OTTHUMT00000409268.1	A	NM_015433	-		58163566	-1	no_errors	ENST00000324871	ensembl	human	known	74_37	missense	SNP	0.286	G
TTC37	9652	genome.wustl.edu	37	5	94803639	94803640	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr5:94803639_94803640delAG	ENST00000358746.2	-	42	4848_4849	c.4550_4551delCT	c.(4549-4551)tctfs	p.S1517fs		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	1517						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						TTGATGCAATAGATTTGGGATA	0.366																																																	0								ENSG00000198677																																			TTC37	SO:0001589	frameshift_variant	0				HGNC	AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.4550_4551delCT	5.37:g.94803639_94803640delAG	ENSP00000351596:p.Ser1517fs	Somatic	0	33	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	30	14.29	O15077|Q6PJI3	Frame_Shift_Del	DEL	29	0.00	0	50	0.00	0	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S1517fs	ENST00000358746.2	37	c.4551_4550	CCDS4072.1	5																																																																																			-	NULL		0.366	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC37	protein_coding	OTTHUMT00000241651.1	AG	NM_014639			94803640	-1	no_errors	ENST00000358746	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
PHLDB2	90102	genome.wustl.edu	37	3	111658466	111658466	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr3:111658466G>T	ENST00000431670.2	+	7	2686	c.2275G>T	c.(2275-2277)Gtt>Ttt	p.V759F	PHLDB2_ENST00000412622.1_Missense_Mutation_p.V716F|PHLDB2_ENST00000495180.1_Missense_Mutation_p.V345F|PHLDB2_ENST00000481953.1_Missense_Mutation_p.V716F|PHLDB2_ENST00000393923.3_Missense_Mutation_p.V743F|PHLDB2_ENST00000393925.3_Missense_Mutation_p.V759F	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	759						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						ACGGAACATCGTTTCTAGAAA	0.388																																																	0								ENSG00000144824						85.0	85.0	85.0					3																	111658466		2203	4300	6503	PHLDB2	SO:0001583	missense	0			-	HGNC		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.2275G>T	3.37:g.111658466G>T	ENSP00000405405:p.Val759Phe	Somatic	0	26	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	36	0.00	0	55	0.00	0	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.V759F	ENST00000431670.2	37	c.2275	CCDS46886.1	3	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221926	0.79464	.	.	ENSG00000144824	ENST00000359729;ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000393925;ENST00000481953;ENST00000495180	T;T;T;T;T;T;T	0.52983	0.64;0.64;0.64;0.64;0.64;0.64;0.64	5.86	5.86	0.93980	.	0.140106	0.47093	D	0.000244	T	0.66829	0.2829	M	0.61703	1.905	0.54753	D	0.999982	D;P;D;D	0.71674	0.998;0.801;0.994;0.994	D;P;P;P	0.65443	0.935;0.476;0.871;0.808	T	0.65463	-0.6162	10	0.59425	D	0.04	.	19.3335	0.94306	0.0:0.0:1.0:0.0	.	345;759;716;743	E9PGF6;Q86SQ0;Q86SQ0-2;Q86SQ0-3	.;PHLB2_HUMAN;.;.	F	743;743;759;716;716;759;716;345	ENSP00000377500:V743F;ENSP00000405405:V759F;ENSP00000405292:V716F;ENSP00000418296:V716F;ENSP00000377502:V759F;ENSP00000418319:V716F;ENSP00000420303:V345F	ENSP00000352764:V743F	V	+	1	0	PHLDB2	113141156	1.000000	0.71417	0.860000	0.33809	0.905000	0.53344	7.408000	0.80041	2.937000	0.99478	0.650000	0.86243	GTT	-	NULL		0.388	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB2	protein_coding	OTTHUMT00000354337.1	G	NM_145753	-		111658466	+1	no_errors	ENST00000393925	ensembl	human	known	74_37	missense	SNP	0.997	T
STXBP1	6812	genome.wustl.edu	37	9	130438152	130438152	+	Silent	SNP	C	C	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr9:130438152C>T	ENST00000373299.1	+	14	1295	c.1180C>T	c.(1180-1182)Ctg>Ttg	p.L394L	STXBP1_ENST00000481942.1_3'UTR|STXBP1_ENST00000373302.3_Silent_p.L394L	NM_001032221.3	NP_001027392.1	P61764	STXB1_HUMAN	syntaxin binding protein 1	394					axon target recognition (GO:0007412)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long term synaptic depression (GO:0060292)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|protein stabilization (GO:0050821)|protein transport (GO:0015031)|regulation of insulin secretion (GO:0050796)|regulation of SNARE complex assembly (GO:0035542)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|regulation of synaptic vesicle priming (GO:0010807)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|SNARE binding (GO:0000149)|syntaxin binding (GO:0019905)|syntaxin-1 binding (GO:0017075)			breast(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|skin(2)	23						CGTCCCCATTCTGCTGGATGC	0.507																																																	0								ENSG00000136854						160.0	114.0	130.0					9																	130438152		2203	4300	6503	STXBP1	SO:0001819	synonymous_variant	0			-	HGNC	AF004563	CCDS6874.1, CCDS35146.1	9q34.1	2008-07-21			ENSG00000136854	ENSG00000136854			11444	protein-coding gene	gene with protein product	"""syntaxin-binding protein 1"""	602926				9545644	Standard	NM_001032221		Approved	hUNC18, MUNC18-1, UNC18, rbSec1	uc004brk.2	P61764	OTTHUMG00000020713	ENST00000373299.1:c.1180C>T	9.37:g.130438152C>T		Somatic	0	80	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	64	20.99	B1AM97|Q28208|Q62759|Q64320|Q96TG8	Silent	SNP	31	0.00	0	35	36.36	20	pfam_Sec1-like,superfamily_Sec1-like	p.L394	ENST00000373299.1	37	c.1180	CCDS35146.1	9																																																																																			-	pfam_Sec1-like,superfamily_Sec1-like		0.507	STXBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP1	protein_coding	OTTHUMT00000054229.1	C	NM_003165	-		130438152	+1	no_errors	ENST00000373299	ensembl	human	known	74_37	silent	SNP	1.000	T
PIK3R4	30849	genome.wustl.edu	37	3	130398323	130398323	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr3:130398323G>T	ENST00000356763.3	-	20	4470	c.3913C>A	c.(3913-3915)Cag>Aag	p.Q1305K	PIK3R4_ENST00000512677.1_5'Flank	NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	1305					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						TGCTTATTCTGAATTTCCTGT	0.473																																																	0								ENSG00000196455						130.0	132.0	132.0					3																	130398323		2203	4300	6503	PIK3R4	SO:0001583	missense	0			-	HGNC	Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.3913C>A	3.37:g.130398323G>T	ENSP00000349205:p.Gln1305Lys	Somatic	0	11	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	15	25.00	Q2TBF4	Missense_Mutation	SNP	33	0.00	0	29	35.56	16	pfam_Prot_kinase_dom,pfam_WD40_repeat,pfam_HEAT,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_WD40_repeat,pfscan_HEAT_type_2,pfscan_Prot_kinase_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q1305K	ENST00000356763.3	37	c.3913	CCDS3067.1	3	.	.	.	.	.	.	.	.	.	.	G	16.17	3.047194	0.55110	.	.	ENSG00000196455	ENST00000356763	T	0.05139	3.49	5.59	5.59	0.84812	WD40 repeat-like-containing domain (1);	0.050545	0.85682	D	0.000000	T	0.07007	0.0178	L	0.29908	0.895	0.54753	D	0.999983	B	0.25667	0.131	B	0.21546	0.035	T	0.42932	-0.9422	10	0.21540	T	0.41	-19.3173	19.5818	0.95469	0.0:0.0:1.0:0.0	.	1305	Q99570	PI3R4_HUMAN	K	1305	ENSP00000349205:Q1305K	ENSP00000349205:Q1305K	Q	-	1	0	PIK3R4	131881013	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.155000	0.94700	2.645000	0.89757	0.491000	0.48974	CAG	-	superfamily_WD40_repeat_dom		0.473	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R4	protein_coding	OTTHUMT00000356668.1	G	NM_014602	-		130398323	-1	no_errors	ENST00000356763	ensembl	human	known	74_37	missense	SNP	1.000	T
FOXI1	2299	genome.wustl.edu	37	5	169533511	169533511	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr5:169533511G>C	ENST00000306268.6	+	1	611	c.550G>C	c.(550-552)Gtg>Ctg	p.V184L	FOXI1_ENST00000449804.2_Missense_Mutation_p.V184L			Q12951	FOXI1_HUMAN	forkhead box I1	184					embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTTCAAGAAGGTGCCCCGCGA	0.587									Pendred syndrome																																								0								ENSG00000168269						39.0	43.0	42.0					5																	169533511		2203	4300	6503	FOXI1	SO:0001583	missense	0	Familial Cancer Database	Goiter-Deafness syndrome	-	HGNC	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.550G>C	5.37:g.169533511G>C	ENSP00000304286:p.Val184Leu	Somatic	0	73	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	136	17.58	Q14518|Q66SR7|Q8N6L8	Missense_Mutation	SNP	20	0.00	0	36	14.29	6	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.V184L	ENST00000306268.6	37	c.550	CCDS4372.1	5	.	.	.	.	.	.	.	.	.	.	G	17.68	3.449041	0.63178	.	.	ENSG00000168269	ENST00000306268;ENST00000449804	D;D	0.96745	-4.11;-4.11	4.86	4.86	0.63082	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.000000	0.85682	D	0.000000	D	0.97473	0.9173	M	0.75615	2.305	0.80722	D	1	D;D	0.57899	0.976;0.981	P;P	0.58077	0.741;0.832	D	0.98109	1.0419	10	0.72032	D	0.01	.	18.1961	0.89822	0.0:0.0:1.0:0.0	.	184;184	Q12951-2;Q12951	.;FOXI1_HUMAN	L	184	ENSP00000304286:V184L;ENSP00000415483:V184L	ENSP00000304286:V184L	V	+	1	0	FOXI1	169466089	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.801000	0.85960	2.513000	0.84729	0.650000	0.86243	GTG	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head		0.587	FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXI1	protein_coding	OTTHUMT00000252827.2	G	NM_144769, NM_012188	-		169533511	+1	no_errors	ENST00000306268	ensembl	human	known	74_37	missense	SNP	1.000	C
BX119917.1	0	genome.wustl.edu	37	X	71372202	71372209	+	RNA	DEL	CGCGCGCA	CGCGCGCA	-	rs6625958|rs72357649|rs72197346|rs59980083|rs6625957|rs200056633|rs10856127		TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	CGCGCGCA	CGCGCGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chrX:71372202_71372209delCGCGCGCA	ENST00000401114.1	-	0	55_62																											TGTGCATGCGCGCGCGcacacacacaca	0.495																																																	0								ENSG00000215933																																			BX119917.1			0				Clone_based_ensembl_gene																													X.37:g.71372202_71372209delCGCGCGCA		Somatic	NA	NA	NA		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	11	38.89	7	14	0.00	0	-	NULL	ENST00000401114.1	37	NULL		X																																																																																			-	-		0.495	BX119917.1-201	NOVEL	basic	miRNA	ENSG00000215933	miRNA		CGCGCGCA				71372209	-1	no_errors	ENST00000401114	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.015:0.009	-
CCDC53	51019	genome.wustl.edu	37	12	102419810	102419810	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LS-01A-11D-A21Q-09	TCGA-DX-A3LS-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	075fc96d-6742-4ef3-9369-482592ad3a2f	dc2e1f2d-585d-4dab-9bb2-aee31ee5b436	g.chr12:102419810G>A	ENST00000240079.6	-	6	603	c.442C>T	c.(442-444)Cca>Tca	p.P148S	CCDC53_ENST00000545679.1_Missense_Mutation_p.P147S|CCDC53_ENST00000539515.1_5'UTR	NM_016053.2	NP_057137.1	Q9Y3C0	CCD53_HUMAN	coiled-coil domain containing 53	148						actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|WASH complex (GO:0071203)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						GCCATCACTGGTACACCCTAA	0.333																																																	0								ENSG00000120860						52.0	48.0	49.0					12																	102419810		1817	4070	5887	CCDC53	SO:0001583	missense	0			-	HGNC	AF151874	CCDS44959.1, CCDS73512.1	12q23.3	2014-05-09			ENSG00000120860	ENSG00000120860			24256	protein-coding gene	gene with protein product						10810093, 20498093	Standard	XM_005268939		Approved	CGI-116	uc010svw.2	Q9Y3C0	OTTHUMG00000168187	ENST00000240079.6:c.442C>T	12.37:g.102419810G>A	ENSP00000240079:p.Pro148Ser	Somatic	0	44	0.00		0.5384983119144784	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	76	676	10.11	B2RC74|Q53FF0|Q6IAI4|Q96QK0	Missense_Mutation	SNP	34	0.00	0	627	10.94	77	pfam_WASH_CCDC53	p.P148S	ENST00000240079.6	37	c.442	CCDS44959.1	12	.	.	.	.	.	.	.	.	.	.	G	22.9	4.353074	0.82132	.	.	ENSG00000120860	ENST00000240079;ENST00000545679;ENST00000542923	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	D	0.85344	0.5675	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	D	0.87726	0.2576	8	0.87932	D	0	.	17.0001	0.86378	0.0:0.0:1.0:0.0	.	147;148	F5GZ97;Q9Y3C0	.;CCD53_HUMAN	S	148;147;61	.	ENSP00000240079:P148S	P	-	1	0	CCDC53	100943940	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.755000	0.74914	2.756000	0.94617	0.655000	0.94253	CCA	-	pfam_WASH_CCDC53		0.333	CCDC53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC53	protein_coding	OTTHUMT00000398685.1	G	NM_016053	-		102419810	-1	no_errors	ENST00000240079	ensembl	human	known	74_37	missense	SNP	1.000	A
