#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
AC024132.1	0	genome.wustl.edu	37	4	27209653	27209654	+	lincRNA	DEL	GT	GT	-			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr4:27209653_27209654delGT	ENST00000382007.1	-	0	1981_1982																											TAAAGACTGAgtgtgtgtgtgt	0.446																																																	0								ENSG00000205830			37,127,2860		0,0,37,4,119,1352						-3.5	0.0		dbSNP_119	46	8,184,4818		1,0,6,9,166,2323	no	intergenic				1,0,43,13,285,3675	A1A1,A1A2,A1R,A2A2,A2R,RR		3.8323,5.4233,4.4312				45,311,7678				AC024132.1			0				Clone_based_vega_gene																													4.37:g.27209663_27209664delGT		Somatic	0	23	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	20	9.09		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000382007.1	37	NULL		4																																																																																			-	-		0.446	AC024132.1-001	KNOWN	basic	lincRNA	ENSG00000205830	lincRNA	OTTHUMT00000319578.1	GT				27209654	-1	no_errors	ENST00000382007	ensembl	human	known	74_37	rna	DEL	0.000:0.000	-
SLCO3A1	28232	genome.wustl.edu	37	15	92647634	92647634	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr15:92647634C>A	ENST00000318445.6	+	4	1085	c.871C>A	c.(871-873)Ccg>Acg	p.P291T	SLCO3A1_ENST00000555549.1_3'UTR|SLCO3A1_ENST00000424469.2_Missense_Mutation_p.P291T	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	291					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	GTCCCTGCCCCCGCACTCAGA	0.617																																																	0								ENSG00000176463						131.0	111.0	118.0					15																	92647634		2198	4298	6496	SLCO3A1	SO:0001583	missense	0			-	HGNC	AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.871C>A	15.37:g.92647634C>A	ENSP00000320634:p.Pro291Thr	Somatic	0	90	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	61	27.91	A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.P291T	ENST00000318445.6	37	c.871	CCDS10371.1	15	.	.	.	.	.	.	.	.	.	.	C	14.30	2.492885	0.44352	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000556649;ENST00000555549	T;T	0.37915	1.17;1.17	5.12	5.12	0.69794	Major facilitator superfamily domain, general substrate transporter (1);	0.891618	0.09850	N	0.747740	T	0.34890	0.0913	L	0.36672	1.1	0.44061	D	0.996803	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.11329	0.003;0.001;0.006	T	0.08889	-1.0700	10	0.25106	T	0.35	.	18.5528	0.91072	0.0:1.0:0.0:0.0	.	233;291;291	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	T	291;291;84;10	ENSP00000320634:P291T;ENSP00000387846:P291T	ENSP00000320634:P291T	P	+	1	0	SLCO3A1	90448638	1.000000	0.71417	0.988000	0.46212	0.998000	0.95712	4.252000	0.58785	2.353000	0.79882	0.655000	0.94253	CCG	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter		0.617	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO3A1	protein_coding	OTTHUMT00000313529.1	C	NM_013272	-		92647634	+1	no_errors	ENST00000318445	ensembl	human	known	74_37	missense	SNP	0.995	A
HIST1H1B	3009	genome.wustl.edu	37	6	27834759	27834759	+	Silent	SNP	C	C	T			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr6:27834759C>T	ENST00000331442.3	-	1	600	c.549G>A	c.(547-549)ccG>ccA	p.P183P		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	183					chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						TTGCCTTTTTCGGTTTGGCAG	0.572																																																	0								ENSG00000184357						77.0	77.0	77.0					6																	27834759		2203	4300	6503	HIST1H1B	SO:0001819	synonymous_variant	0			-	HGNC	AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.549G>A	6.37:g.27834759C>T		Somatic	0	64	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	21	46.15	Q14529|Q3MJ42	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	p.P183	ENST00000331442.3	37	c.549	CCDS4635.1	6																																																																																			-	prints_Histone_H5		0.572	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1B	protein_coding	OTTHUMT00000043371.1	C	NM_005322	-		27834759	-1	no_errors	ENST00000331442	ensembl	human	known	74_37	silent	SNP	0.634	T
MICAL3	57553	genome.wustl.edu	37	22	18301276	18301276	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr22:18301276G>A	ENST00000441493.2	-	26	4503	c.4151C>T	c.(4150-4152)tCc>tTc	p.S1384F	MICAL3_ENST00000580469.1_5'Flank	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1384	Pro-rich.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		TTTGGGGATGGACAGAGGCTT	0.637																																																	0								ENSG00000243156						103.0	117.0	112.0					22																	18301276		1921	4115	6036	MICAL3	SO:0001583	missense	0			-	HGNC	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.4151C>T	22.37:g.18301276G>A	ENSP00000416015:p.Ser1384Phe	Somatic	0	39	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	14	41.67	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM,prints_Rng_hydrolase-like	p.S1384F	ENST00000441493.2	37	c.4151	CCDS46659.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.564|5.564	0.288938|0.288938	0.10513|0.10513	.|.	.|.	ENSG00000093100|ENSG00000093100	ENST00000252134|ENST00000441493	.|T	.|0.65549	.|-0.16	4.43|4.43	3.4|3.4	0.38934|0.38934	.|.	.|.	.|.	.|.	.|.	T|T	0.41442|0.41442	0.1159|0.1159	L|L	0.29908|0.29908	0.895|0.895	0.41505|0.41505	D|D	0.988306|0.988306	.|P	.|0.36495	.|0.556	.|B	.|0.31016	.|0.123	T|T	0.18745|0.18745	-1.0327|-1.0327	5|9	.|0.10636	.|T	.|0.68	.|.	9.5088|9.5088	0.39065|0.39065	0.0:0.1561:0.682:0.1619|0.0:0.1561:0.682:0.1619	.|.	.|1384	.|Q7RTP6	.|MICA3_HUMAN	S|F	366|1384	.|ENSP00000416015:S1384F	.|ENSP00000416015:S1384F	P|S	-|-	1|2	0|0	XXbac-B461K10.4|XXbac-B461K10.4	16681276|16681276	1.000000|1.000000	0.71417|0.71417	0.001000|0.001000	0.08648|0.08648	0.000000|0.000000	0.00434|0.00434	7.125000|7.125000	0.77193|0.77193	0.841000|0.841000	0.35020|0.35020	-0.502000|-0.502000	0.04539|0.04539	CCA|TCC	-	NULL		0.637	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL3	protein_coding	OTTHUMT00000447351.1	G		-		18301276	-1	no_errors	ENST00000441493	ensembl	human	known	74_37	missense	SNP	0.077	A
RP11-423O2.5	0	genome.wustl.edu	37	1	142803930	142803930	+	lincRNA	SNP	A	A	G	rs74792472		TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr1:142803930A>G	ENST00000423385.1	-	0	1035																											AATTTGATTAACTTCTAAATT	0.328																																																	0								ENSG00000234978																																			RP11-423O2.5			0			-	Clone_based_vega_gene																													1.37:g.142803930A>G		Somatic	0	25	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	27	15.62		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000423385.1	37	NULL		1																																																																																			-	-		0.328	RP11-423O2.5-001	KNOWN	basic	lincRNA	ENSG00000234978	lincRNA	OTTHUMT00000193203.1	A		rs74792472		142803930	-1	no_errors	ENST00000423385	ensembl	human	known	74_37	rna	SNP	0.001	G
AMER1	139285	genome.wustl.edu	37	X	63410224	63410224	+	Silent	SNP	G	G	A	rs376353035		TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chrX:63410224G>A	ENST00000330258.3	-	2	3215	c.2943C>T	c.(2941-2943)gaC>gaT	p.D981D	AMER1_ENST00000403336.1_Intron|AMER1_ENST00000374869.3_Intron	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	981	Pro-rich.				adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									TGGAAGGCCTGTCCAACTGGT	0.567																																																	67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)						ENSG00000184675	G		0,3424		0,0,0,1427,570	30.0	32.0	31.0		2943	0.7	0.1	X		31	1,6502		0,0,1,2355,1792	no	coding-synonymous	FAM123B	NM_152424.3		0,0,1,3782,2362	AA,AG,A,GG,G		0.0154,0.0,0.0101		981/1136	63410224	1,9926	1997	4148	6145	AMER1	SO:0001819	synonymous_variant	0			-	HGNC	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.2943C>T	X.37:g.63410224G>A		Somatic	0	42	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A2IB86|Q8N885	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Uncharacterised_FAM123	p.D981	ENST00000330258.3	37	c.2943	CCDS14377.2	X																																																																																			-	NULL		0.567	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AMER1	protein_coding	OTTHUMT00000316584.1	G	NM_152424	-		63410224	-1	no_errors	ENST00000330258	ensembl	human	known	74_37	silent	SNP	0.147	A
STAT2	6773	genome.wustl.edu	37	12	56743168	56743168	+	Intron	SNP	C	C	T			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr12:56743168C>T	ENST00000314128.4	-	15	1365				STAT2_ENST00000556539.1_Intron|STAT2_ENST00000557235.1_Intron|STAT2_ENST00000418572.2_Nonsense_Mutation_p.W457*			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa						cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						ATGCCTTCTTCCAAAGCTGCT	0.473																																																	0								ENSG00000170581						130.0	134.0	133.0					12																	56743168		2203	4300	6503	STAT2	SO:0001627	intron_variant	0			-	HGNC	BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.1341+41G>A	12.37:g.56743168C>T		Somatic	0	97	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	1257	112	91.82	B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_STAT_TF_alpha,pfam_STAT_TF_DNA-bd,pfam_STAT_TF_prot_interaction,superfamily_STAT_TF_coiled-coil,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction	p.W457*	ENST00000314128.4	37	c.1371	CCDS8917.1	12	.	.	.	.	.	.	.	.	.	.	C	15.13	2.742219	0.49151	.	.	ENSG00000170581	ENST00000418572	.	.	.	5.3	0.333	0.15943	.	.	.	.	.	.	.	.	.	.	.	0.25495	N	0.98761	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.0791	0.09917	0.1531:0.5088:0.0:0.3381	.	.	.	.	X	457	.	ENSP00000387354:W457X	W	-	3	0	STAT2	55029435	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.056000	0.11787	-0.135000	0.11495	-0.244000	0.11960	TGG	-	NULL		0.473	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT2	protein_coding	OTTHUMT00000410277.1	C	NM_005419	-		56743168	-1	no_errors	ENST00000418572	ensembl	human	putative	74_37	nonsense	SNP	0.000	T
WASH4P	374677	genome.wustl.edu	37	16	64458	64458	+	Missense_Mutation	SNP	G	G	A	rs12444477	byFrequency	TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr16:64458G>A	ENST00000326592.9	-	10	2015	c.1357C>T	c.(1357-1359)Cgc>Tgc	p.R453C	DDX11L10_ENST00000513886.1_RNA			A8MWX3	WASH4_HUMAN	WAS protein family homolog 4 pseudogene	453					Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										TCTGACACGCGGGCAAAGGCT	0.647													G|||	1540	0.307508	0.2057	0.438	5008	,	,		8528	0.0298		0.5865	False		,,,				2504	0.3517																0								ENSG00000234769																																			WASH4P	SO:0001583	missense	0			-	HGNC			16p13.3	2014-08-28	2008-01-16	2008-01-16	ENSG00000234769	ENSG00000234769		"""WAS protein homologs"""	14126	other	unknown			"""family with sequence similarity 39, member C pseudogene"""	FAM39CP		9054936, 11701968, 18159949	Standard	NG_003159		Approved	FLJ31670		A8MWX3	OTTHUMG00000059914	ENST00000326592.9:c.1357C>T	16.37:g.64458G>A	ENSP00000317542:p.Arg453Cys	Somatic	0	58	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	47	9.62		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WASH1_WAHD	p.R453C	ENST00000326592.9	37	c.1357		16	.	.	.	.	.	.	.	.	.	.	g	14.62	2.590989	0.46214	.	.	ENSG00000234769	ENST00000326592	.	.	.	0.379	0.379	0.16213	.	0.059594	0.64402	N	0.000005	T	0.56217	0.1970	.	.	.	0.09310	P	0.99999140115	.	.	.	.	.	.	T	0.67848	-0.5564	4	0.87932	D	0	-0.2976	.	.	.	.	.	.	.	C	453	.	ENSP00000317542:R453C	R	-	1	0	WASH4P	4458	1.000000	0.71417	0.794000	0.32065	0.583000	0.36354	2.115000	0.41921	0.437000	0.26423	0.184000	0.17185	CGC	-	NULL		0.647	WASH4P-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal	protein_coding	WASH4P	protein_coding	OTTHUMT00000133175.2	G	NG_003159	rs12444477		64458	-1	no_errors	ENST00000326592	ensembl	human	novel	74_37	missense	SNP	1.000	A
PRDM16	63976	genome.wustl.edu	37	1	3321419	3321419	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr1:3321419G>A	ENST00000270722.5	+	7	1050	c.1001G>A	c.(1000-1002)gGc>gAc	p.G334D	PRDM16_ENST00000511072.1_Missense_Mutation_p.G335D|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378391.2_Missense_Mutation_p.G334D|PRDM16_ENST00000442529.2_Missense_Mutation_p.G334D|PRDM16_ENST00000378398.3_Missense_Mutation_p.G335D|PRDM16_ENST00000514189.1_Missense_Mutation_p.G335D|PRDM16_ENST00000441472.2_Missense_Mutation_p.G334D			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	334					brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		CACGACAGCGGCAAACGCTTC	0.642			T	EVI1	"""MDS, AML"""																																			Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	0								ENSG00000142611						73.0	81.0	78.0					1																	3321419		2187	4286	6473	PRDM16	SO:0001583	missense	0			-	HGNC	AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.1001G>A	1.37:g.3321419G>A	ENSP00000270722:p.Gly334Asp	Somatic	0	68	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	53	8.62	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.G334D	ENST00000270722.5	37	c.1001	CCDS41236.2	1	.	.	.	.	.	.	.	.	.	.	G	33	5.258413	0.95368	.	.	ENSG00000142611	ENST00000511072;ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000514189;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	T;T;T;T;T;T;T;T;T	0.14516	2.5;2.5;2.5;2.5;2.5;2.5;2.5;2.5;2.5	4.63	4.63	0.57726	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.134990	0.32687	U	0.005762	T	0.20292	0.0488	N	0.12663	0.25	0.80722	D	1	D;D;D;B	0.89917	1.0;0.992;0.975;0.209	D;P;P;B	0.91635	0.999;0.73;0.776;0.05	T	0.19614	-1.0300	10	0.30854	T	0.27	.	16.2418	0.82411	0.0:0.0:1.0:0.0	.	334;334;334;334	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	D	335;335;334;334;334;335;334;150;150;143	ENSP00000426975:G335D;ENSP00000367651:G335D;ENSP00000407968:G334D;ENSP00000405253:G334D;ENSP00000367643:G334D;ENSP00000421400:G335D;ENSP00000270722:G334D;ENSP00000422504:G150D;ENSP00000425796:G143D	ENSP00000270722:G334D	G	+	2	0	PRDM16	3311279	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	7.681000	0.84073	2.107000	0.64212	0.467000	0.42956	GGC	-	pfscan_Znf_C2H2		0.642	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRDM16	protein_coding	OTTHUMT00000001382.3	G	NM_022114	-		3321419	+1	no_errors	ENST00000270722	ensembl	human	known	74_37	missense	SNP	1.000	A
DCX	1641	genome.wustl.edu	37	X	110644349	110644349	+	Missense_Mutation	SNP	G	G	A	rs104894780		TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chrX:110644349G>A	ENST00000338081.3	-	3	988	c.817C>T	c.(817-819)Cgg>Tgg	p.R273W	DCX_ENST00000356220.3_Missense_Mutation_p.R192W|DCX_ENST00000496551.1_5'UTR|DCX_ENST00000371993.2_Missense_Mutation_p.R192W|DCX_ENST00000356915.2_Missense_Mutation_p.R192W|DCX_ENST00000488120.1_Missense_Mutation_p.R192W	NM_000555.3	NP_000546.2	O43602	DCX_HUMAN	doublecortin	273	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.		R -> W (in LISX1 and SBHX). {ECO:0000269|PubMed:11175293, ECO:0000269|PubMed:9489699}.		axon extension (GO:0048675)|axon guidance (GO:0007411)|brain development (GO:0007420)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neuron migration (GO:0001764)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuron projection (GO:0043005)	microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|skin(6)|upper_aerodigestive_tract(1)	41						ACAGCCTTCCGAGGCTTCACC	0.557																																																	0			GRCh37	CM980529	DCX	M	rs104894780	ENSG00000077279						118.0	100.0	106.0					X																	110644349		2203	4300	6503	DCX	SO:0001583	missense	0			-	HGNC	AF040254	CCDS14556.1, CCDS14557.1, CCDS14558.1	Xq22.3-q23	2008-08-01	2008-08-01		ENSG00000077279	ENSG00000077279			2714	protein-coding gene	gene with protein product	"""doublecortex"""	300121	"""doublecortex; lissencephaly, X-linked (doublecortin)"""			9489699, 9489700	Standard	NM_178151		Approved	SCLH, DC, LISX, DBCN, XLIS	uc004epd.3	O43602	OTTHUMG00000022204	ENST00000338081.3:c.817C>T	X.37:g.110644349G>A	ENSP00000337697:p.Arg273Trp	Somatic	0	27	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	17	63.27	A6NFY6|A9Z1V8|D3DUY8|D3DUY9|D3DUZ0|O43911|Q5JYZ5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Doublecortin_dom,smart_Doublecortin_dom,pirsf_Doublecortin_chordata,pfscan_Doublecortin_dom	p.R273W	ENST00000338081.3	37	c.817	CCDS14556.1	X	.	.	.	.	.	.	.	.	.	.	G	20.8	4.043537	0.75732	.	.	ENSG00000077279	ENST00000356915;ENST00000371993;ENST00000338081;ENST00000356220;ENST00000488120	D;D;D;D;D	0.93712	-3.27;-3.27;-3.27;-3.27;-3.27	4.74	2.85	0.33270	Doublecortin domain (4);	0.128241	0.52532	D	0.000064	D	0.96463	0.8846	M	0.86178	2.8	0.80722	A	1	D;P	0.89917	1.0;0.454	D;B	0.78314	0.991;0.161	D	0.97370	0.9975	9	0.72032	D	0.01	.	13.0367	0.58877	0.0:0.0:0.7066:0.2934	.	261;273	B4DM53;O43602	.;DCX_HUMAN	W	192;192;273;192;192	ENSP00000349385:R192W;ENSP00000361061:R192W;ENSP00000337697:R273W;ENSP00000348553:R192W;ENSP00000419861:R192W	ENSP00000337697:R273W	R	-	1	2	DCX	110531005	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	5.691000	0.68249	0.438000	0.26450	0.600000	0.82982	CGG	-	smart_Doublecortin_dom,pirsf_Doublecortin_chordata,pfscan_Doublecortin_dom		0.557	DCX-006	KNOWN	basic|CCDS	protein_coding	DCX	protein_coding	OTTHUMT00000357058.1	G	NM_178153	rs104894780		110644349	-1	no_errors	ENST00000338081	ensembl	human	known	74_37	missense	SNP	1.000	A
SIGLEC14	100049587	genome.wustl.edu	37	19	52149191	52149191	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr19:52149191C>A	ENST00000360844.6	-	3	585	c.544G>T	c.(544-546)Ggg>Tgg	p.G182W	SIGLEC5_ENST00000599649.1_Intron|SIGLEC5_ENST00000534261.2_5'Flank|SIGLEC5_ENST00000222107.4_Intron|SIGLEC5_ENST00000429354.3_Intron	NM_001098612.1	NP_001092082.1	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14	182	Ig-like C2-type 1.				cell adhesion (GO:0007155)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		AGGGCATTCCCCGTCCAGGAG	0.662																																																	0								ENSG00000254415																																			SIGLEC14	SO:0001583	missense	0			-	HGNC	AY854038	CCDS42604.1	19q13.41	2013-01-29			ENSG00000254415	ENSG00000254415		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32926	protein-coding gene	gene with protein product						17012248	Standard	NM_001098612		Approved		uc002pxf.4	Q08ET2	OTTHUMG00000165511	ENST00000360844.6:c.544G>T	19.37:g.52149191C>A	ENSP00000354090:p.Gly182Trp	Somatic	0	37	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39	Q6UXG0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Ig_I-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G182W	ENST00000360844.6	37	c.544	CCDS42604.1	19	.	.	.	.	.	.	.	.	.	.	C	14.85	2.658102	0.47467	.	.	ENSG00000254415	ENST00000360844	D	0.90444	-2.67	3.09	3.09	0.35607	Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.146853	0.31531	N	0.007498	D	0.93523	0.7933	M	0.82823	2.61	0.09310	N	1	D	0.65815	0.995	P	0.58873	0.847	D	0.86661	0.1904	10	0.87932	D	0	.	9.8004	0.40761	0.0:1.0:0.0:0.0	.	182	Q08ET2	SIG14_HUMAN	W	182	ENSP00000354090:G182W	ENSP00000354090:G182W	G	-	1	0	SIGLEC14	56841003	0.029000	0.19370	0.015000	0.15790	0.027000	0.11550	1.719000	0.38011	1.750000	0.51863	0.508000	0.49915	GGG	-	pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like_dom		0.662	SIGLEC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC14	protein_coding	OTTHUMT00000466899.2	C	NM_001098612	-		52149191	-1	no_errors	ENST00000360844	ensembl	human	known	74_37	missense	SNP	0.030	A
RAVER2	55225	genome.wustl.edu	37	1	65247087	65247087	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr1:65247087G>A	ENST00000294428.3	+	4	889	c.811G>A	c.(811-813)Gtt>Att	p.V271I	RAVER2_ENST00000371072.4_Missense_Mutation_p.V271I|RAVER2_ENST00000430964.2_De_novo_Start_OutOfFrame			Q9HCJ3	RAVR2_HUMAN	ribonucleoprotein, PTB-binding 2	271	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						AGGTAGTTACGTTGGTGGCTT	0.418																																																	0								ENSG00000162437						142.0	142.0	142.0					1																	65247087		2006	4174	6180	RAVER2	SO:0001583	missense	0			-	HGNC	AB046799	CCDS41345.1	1p31.3	2013-02-12			ENSG00000162437	ENSG00000162437		"""RNA binding motif (RRM) containing"""	25577	protein-coding gene	gene with protein product		609953				16051233	Standard	NM_018211		Approved	KIAA1579, FLJ10770	uc001dbs.2	Q9HCJ3	OTTHUMG00000009102	ENST00000294428.3:c.811G>A	1.37:g.65247087G>A	ENSP00000294428:p.Val271Ile	Somatic	0	68	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	51	40.00	Q6P141|Q9NPV7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.V271I	ENST00000294428.3	37	c.811		1	.	.	.	.	.	.	.	.	.	.	G	4.508	0.094166	0.08632	.	.	ENSG00000162437	ENST00000371072;ENST00000294428	T;T	0.15603	2.41;2.41	5.43	5.43	0.79202	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.390908	0.25836	N	0.027987	T	0.04137	0.0115	N	0.22421	0.69	0.46113	D	0.998875	B;B	0.11235	0.004;0.003	B;B	0.10450	0.005;0.003	T	0.34527	-0.9825	10	0.17832	T	0.49	-16.6374	8.0904	0.30797	0.0853:0.0:0.7557:0.159	.	271;271	Q9HCJ3;Q9HCJ3-2	RAVR2_HUMAN;.	I	271	ENSP00000360112:V271I;ENSP00000294428:V271I	ENSP00000294428:V271I	V	+	1	0	RAVER2	65019675	0.190000	0.23276	0.039000	0.18376	0.010000	0.07245	1.237000	0.32695	2.562000	0.86427	0.591000	0.81541	GTT	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.418	RAVER2-201	KNOWN	basic	protein_coding	RAVER2	protein_coding		G	NM_018211	-		65247087	+1	no_errors	ENST00000294428	ensembl	human	known	74_37	missense	SNP	0.016	A
LOR	4014	genome.wustl.edu	37	1	153233991	153233992	+	In_Frame_Ins	INS	-	-	CTCTGGCGGCGG	rs11272549|rs547333583|rs561634896	byFrequency	TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr1:153233991_153233992insCTCTGGCGGCGG	ENST00000368742.3	+	2	623_624	c.566_567insCTCTGGCGGCGG	c.(565-570)tactct>taCTCTGGCGGCGGctct	p.194_195insGGGS		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	194					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gtctgcggctactctggcggcg	0.743														3247	0.648363	0.6664	0.7954	5008	,	,		5032	0.4563		0.7147	False		,,,				2504	0.6493																0								ENSG00000203782			178,190		86,6,92						-7.1	0.0		dbSNP_120	1	749,435		350,49,193	no	coding	LOR	NM_000427.2		436,55,285	A1A1,A1R,RR		36.7399,48.3696,40.2706				927,625				LOR	SO:0001652	inframe_insertion	0				HGNC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.567_578dupCTCTGGCGGCGG	1.37:g.153233991_153233992insCTCTGGCGGCGG	ENSP00000357731:p.Gly191_Ser194dup	Somatic	NA	NA	NA		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5T869|Q5XKF8	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.193in_frame_insGSGG	ENST00000368742.3	37	c.566_567	CCDS30870.1	1																																																																																			-	NULL		0.743	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOR	protein_coding	OTTHUMT00000039107.1	-	NM_000427			153233992	+1	no_errors	ENST00000368742	ensembl	human	known	74_37	in_frame_ins	INS	0.014:0.200	CTCTGGCGGCGG
MICAL3	57553	genome.wustl.edu	37	22	18301218	18301218	+	Silent	SNP	G	G	A			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr22:18301218G>A	ENST00000441493.2	-	26	4561	c.4209C>T	c.(4207-4209)acC>acT	p.T1403T	MICAL3_ENST00000580469.1_5'Flank	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1403	Pro-rich.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		GGGACCGGGGGGTTGGCAGGG	0.672																																																	0								ENSG00000243156						75.0	86.0	82.0					22																	18301218		1926	4120	6046	MICAL3	SO:0001819	synonymous_variant	0			-	HGNC	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.4209C>T	22.37:g.18301218G>A		Somatic	0	49	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	19	44.12	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM,prints_Rng_hydrolase-like	p.T1403	ENST00000441493.2	37	c.4209	CCDS46659.1	22	.	.	.	.	.	.	.	.	.	.	G	0.019	-1.452584	0.01080	.	.	ENSG00000093100	ENST00000252134	.	.	.	4.42	-5.7	0.02421	.	.	.	.	.	T	0.46795	0.1411	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46816	-0.9164	4	.	.	.	.	5.9118	0.19033	0.5076:0.0:0.2951:0.1973	.	.	.	.	L	385	.	.	P	-	2	0	XXbac-B461K10.4	16681218	0.774000	0.28592	0.003000	0.11579	0.003000	0.03518	-0.156000	0.10100	-1.089000	0.03073	-1.436000	0.01078	CCC	-	NULL		0.672	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL3	protein_coding	OTTHUMT00000447351.1	G		-		18301218	-1	no_errors	ENST00000441493	ensembl	human	known	74_37	silent	SNP	0.396	A
STAT2	6773	genome.wustl.edu	37	12	56743279	56743279	+	Silent	SNP	C	C	T			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr12:56743279C>T	ENST00000314128.4	-	15	1295	c.1272G>A	c.(1270-1272)gtG>gtA	p.V424V	STAT2_ENST00000556539.1_5'UTR|STAT2_ENST00000557235.1_Silent_p.V420V|STAT2_ENST00000418572.2_Silent_p.V420V|RNU7-40P_ENST00000516397.1_RNA			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	424					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						GTTCCTCTGTCACACCTAGTG	0.517																																																	0								ENSG00000170581						173.0	167.0	169.0					12																	56743279		2203	4300	6503	STAT2	SO:0001819	synonymous_variant	0			-	HGNC	BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.1272G>A	12.37:g.56743279C>T		Somatic	0	79	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	1135	73	93.88	B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_STAT2_C,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.V424	ENST00000314128.4	37	c.1272	CCDS8917.1	12																																																																																			-	pfam_STAT_TF_DNA-bd,superfamily_p53-like_TF_DNA-bd		0.517	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT2	protein_coding	OTTHUMT00000410277.1	C	NM_005419	-		56743279	-1	no_errors	ENST00000314128	ensembl	human	known	74_37	silent	SNP	0.990	T
RNF212	285498	genome.wustl.edu	37	4	1087327	1087328	+	Intron	INS	-	-	CTGCCCAGGCTGGAGCCAGCC	rs376912904|rs386670461|rs142232513|rs539986150|rs138488801	byFrequency	TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr4:1087327_1087328insCTGCCCAGGCTGGAGCCAGCC	ENST00000433731.2	-	4	308				RNF212_ENST00000333673.5_In_Frame_Ins_p.241_241S>WLAPAWAA|RNF212_ENST00000382968.5_Intron			Q495C1	RN212_HUMAN	ring finger protein 212						chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		CAGAGCCTGTGACCTCCACGGC	0.619																																																	0								ENSG00000178222																																			RNF212	SO:0001627	intron_variant	0				HGNC	AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.247-2701->GGCTGGCTCCAGCCTGGGCAG	4.37:g.1087327_1087328insCTGCCCAGGCTGGAGCCAGCC		Somatic	NA	NA	NA		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfscan_Znf_RING	p.S241in_frame_insWLAPAWAA	ENST00000433731.2	37	c.722_721	CCDS46996.1	4																																																																																			-	NULL		0.619	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF212	protein_coding	OTTHUMT00000359124.2	-	NM_194439			1087328	-1	no_errors	ENST00000333673	ensembl	human	known	74_37	in_frame_ins	INS	0.085:0.000	CTGCCCAGGCTGGAGCCAGCC
POLN	353497	genome.wustl.edu	37	4	2181178	2181178	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr4:2181178C>T	ENST00000511885.2	-	8	1389	c.1036G>A	c.(1036-1038)Ggg>Agg	p.G346R	POLN_ENST00000515357.1_5'UTR|POLN_ENST00000382865.1_Missense_Mutation_p.G346R			Q7Z5Q5	DPOLN_HUMAN	polymerase (DNA directed) nu	346					double-strand break repair via homologous recombination (GO:0000724)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	nucleus (GO:0005634)	cyclin binding (GO:0030332)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(2)|skin(4)|urinary_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			GGATCTAGCCCTATAAAATCA	0.363								DNA polymerases (catalytic subunits)																																									0								ENSG00000130997						67.0	65.0	66.0					4																	2181178		2203	4300	6503	POLN	SO:0001583	missense	0			-	HGNC	AF044578	CCDS3360.1	4p16.3	2012-05-18			ENSG00000130997	ENSG00000130997		"""DNA polymerases"""	18870	protein-coding gene	gene with protein product		610887				12794064	Standard	NM_181808		Approved		uc003ger.2	Q7Z5Q5	OTTHUMG00000090081	ENST00000511885.2:c.1036G>A	4.37:g.2181178C>T	ENSP00000435506:p.Gly346Arg	Somatic	0	37	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	26	25.71	A2A336|B4E158|Q4TTW4|Q6ZNF4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA-dir_DNA_pol_A_palm_dom,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_A_palm_dom,prints_DNA_polymerase_A	p.G346R	ENST00000511885.2	37	c.1036	CCDS3360.1	4	.	.	.	.	.	.	.	.	.	.	C	18.03	3.531552	0.64972	.	.	ENSG00000130997	ENST00000511885;ENST00000382865;ENST00000253313	T;T	0.04454	3.62;3.62	5.61	5.61	0.85477	.	0.187268	0.35124	N	0.003437	T	0.16981	0.0408	M	0.63428	1.95	0.27464	N	0.953058	D;D	0.71674	0.998;0.988	D;P	0.65010	0.931;0.629	T	0.01557	-1.1325	10	0.41790	T	0.15	-20.53	15.1521	0.72709	0.0:1.0:0.0:0.0	.	346;346	E7ERY2;Q7Z5Q5	.;DPOLN_HUMAN	R	346;346;37	ENSP00000435506:G346R;ENSP00000372316:G346R	ENSP00000253313:G37R	G	-	1	0	POLN	2150976	0.886000	0.30341	0.876000	0.34364	0.800000	0.45204	2.890000	0.48609	2.656000	0.90262	0.561000	0.74099	GGG	-	superfamily_RNaseH-like_dom		0.363	POLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLN	protein_coding	OTTHUMT00000205684.2	C	NM_181808	-		2181178	-1	no_errors	ENST00000382865	ensembl	human	known	74_37	missense	SNP	0.564	T
GPR78	27201	genome.wustl.edu	37	4	8583114	8583114	+	Silent	SNP	G	G	A			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr4:8583114G>A	ENST00000382487.4	+	1	822	c.405G>A	c.(403-405)ctG>ctA	p.L135L	GPR78_ENST00000509216.1_Intron	NM_080819.4	NP_543009.2	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	135					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(4)|kidney(4)|large_intestine(1)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26						GACAGTCGCTGGCCTTCTCAG	0.706																																																	0								ENSG00000155269						11.0	13.0	12.0					4																	8583114		2175	4261	6436	GPR78	SO:0001819	synonymous_variant	0			-	HGNC	AF411107	CCDS3403.1	4p16.1	2012-08-21			ENSG00000155269	ENSG00000155269		"""GPCR / Class A : Orphans"""	4528	protein-coding gene	gene with protein product		606921				11574155	Standard	NM_080819		Approved		uc003glk.4	Q96P69	OTTHUMG00000128483	ENST00000382487.4:c.405G>A	4.37:g.8583114G>A		Somatic	0	29	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08	Q8NGV3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.L135	ENST00000382487.4	37	c.405	CCDS3403.1	4																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.706	GPR78-005	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR78	protein_coding	OTTHUMT00000359201.1	G		-		8583114	+1	no_errors	ENST00000382487	ensembl	human	known	74_37	silent	SNP	1.000	A
AP2A2	161	genome.wustl.edu	37	11	993375	993375	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr11:993375G>C	ENST00000448903.2	+	12	1685	c.1544G>C	c.(1543-1545)aGa>aCa	p.R515T	AP2A2_ENST00000332231.5_Missense_Mutation_p.R516T|AP2A2_ENST00000534328.1_Intron	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	515					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)	p.R516K(1)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		GGAGACCCGAGATCCAGGTGA	0.657																																																	1	Substitution - Missense(1)	ovary(1)						ENSG00000183020						37.0	41.0	40.0					11																	993375		1925	4129	6054	AP2A2	SO:0001583	missense	0			-	HGNC	AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.1544G>C	11.37:g.993375G>C	ENSP00000413234:p.Arg515Thr	Somatic	0	54	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	56	13.85	O75403|Q53ET1|Q96SI8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a-adaptin_app_sub_C,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP2_complex_asu	p.R516T	ENST00000448903.2	37	c.1547	CCDS44512.1	11	.	.	.	.	.	.	.	.	.	.	G	10.60	1.395537	0.25205	.	.	ENSG00000183020	ENST00000448903;ENST00000332231;ENST00000448757;ENST00000529125;ENST00000452310	T;T	0.28454	1.61;1.61	3.51	3.51	0.40186	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.49575	0.1565	L	0.61218	1.895	0.80722	D	1	D;P;P	0.64830	0.994;0.898;0.91	D;B;P	0.73708	0.981;0.43;0.566	T	0.44817	-0.9303	10	0.21014	T	0.42	-44.1555	15.903	0.79397	0.0:0.0:1.0:0.0	.	254;516;515	B7Z1Q4;O94973-2;O94973	.;.;AP2A2_HUMAN	T	515;516;516;252;255	ENSP00000413234:R515T;ENSP00000327694:R516T	ENSP00000327694:R516T	R	+	2	0	AP2A2	983375	1.000000	0.71417	0.218000	0.23776	0.076000	0.17211	9.709000	0.98729	1.896000	0.54893	0.462000	0.41574	AGA	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP2_complex_asu		0.657	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AP2A2	protein_coding	OTTHUMT00000385431.2	G	NM_012305	-		993375	+1	no_errors	ENST00000332231	ensembl	human	known	74_37	missense	SNP	0.970	C
PGBD2	267002	genome.wustl.edu	37	1	249212342	249212348	+	Frame_Shift_Del	DEL	TTGCCTG	TTGCCTG	-	rs374563843		TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	TTGCCTG	TTGCCTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr1:249212342_249212348delTTGCCTG	ENST00000329291.5	+	3	1706_1712	c.1559_1565delTTGCCTG	c.(1558-1566)attgcctgtfs	p.IAC520fs	PGBD2_ENST00000355360.4_Frame_Shift_Del_p.IAC269fs|PGBD2_ENST00000539153.1_Frame_Shift_Del_p.IAC517fs	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	520										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			CGGAGATACATTGCCTGTGTGTATCTG	0.522																																																	0								ENSG00000185220																																			PGBD2	SO:0001589	frameshift_variant	0				HGNC	AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.1559_1565delTTGCCTG	1.37:g.249212342_249212348delTTGCCTG	ENSP00000331643:p.Ile520fs	Somatic	NA	NA	NA		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KVR8|Q6MZF8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.I520fs	ENST00000329291.5	37	c.1559_1565	CCDS31128.1	1																																																																																			-	NULL		0.522	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PGBD2	protein_coding	OTTHUMT00000097318.1	TTGCCTG				249212348	+1	no_errors	ENST00000329291	ensembl	human	known	74_37	frame_shift_del	DEL	0.060:0.048:0.922:0.964:0.963:0.966:0.961	-
S100A4	6275	genome.wustl.edu	37	1	153516163	153516163	+	3'UTR	DEL	A	A	-	rs71820511	byFrequency	TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr1:153516163delA	ENST00000368716.4	-	0	525				S100A4_ENST00000481009.1_5'UTR|S100A4_ENST00000368714.1_3'UTR|S100A4_ENST00000368715.1_3'UTR|S100A5_ENST00000368718.1_5'Flank|S100A4_ENST00000354332.4_3'UTR|S100A5_ENST00000359215.1_5'Flank|S100A5_ENST00000368717.2_5'Flank	NM_002961.2	NP_002952.1	P26447	S10A4_HUMAN	S100 calcium binding protein A4						epithelial to mesenchymal transition (GO:0001837)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)			large_intestine(2)|lung(1)|prostate(1)	4	all_lung(78;5.98e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Trifluoperazine(DB00831)	GCCAGGGTGGAAAAAAAAAAG	0.527													|||unknown(HR)	155	0.0309505	0.1021	0.0072	5008	,	,		16324	0.001		0.002	False		,,,				2504	0.0123																0								ENSG00000196154																																			S100A4	SO:0001624	3_prime_UTR_variant	0				HGNC	BC016300	CCDS1042.1	1q12-q22	2013-01-10	2006-09-11		ENSG00000196154	ENSG00000196154		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10494	protein-coding gene	gene with protein product	"""fibroblast-specific protein-1"""	114210	"""S100 calcium-binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog)"", ""S100 calcium binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog)"""	MTS1, CAPL		3155863	Standard	NM_019554		Approved	P9KA, 18A2, PEL98, 42A, FSP1	uc001fbz.3	P26447	OTTHUMG00000013546	ENST00000368716.4:c.*72T>-	1.37:g.153516163delA		Somatic	0	48	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	31	8.82	A8K7R8|D3DV46|Q6ICP8	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368716.4	37	NULL	CCDS1042.1	1																																																																																			-	-		0.527	S100A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A4	protein_coding	OTTHUMT00000037714.1	A	NM_002961			153516163	-1	no_errors	ENST00000468373	ensembl	human	known	74_37	rna	DEL	0.000	-
DCLK3	85443	genome.wustl.edu	37	3	36759633	36759633	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr3:36759633C>T	ENST00000416516.2	-	4	2111	c.1621G>A	c.(1621-1623)Gtg>Atg	p.V541M	DCLK3_ENST00000498047.1_5'UTR	NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	541	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						TAGAGGATCACGCCAGCAGCC	0.547																																																	0								ENSG00000163673						145.0	159.0	154.0					3																	36759633		2142	4280	6422	DCLK3	SO:0001583	missense	0			-	HGNC	AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.1621G>A	3.37:g.36759633C>T	ENSP00000394484:p.Val541Met	Somatic	0	40	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	32	33.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V541M	ENST00000416516.2	37	c.1621	CCDS43064.1	3	.	.	.	.	.	.	.	.	.	.	C	17.12	3.309393	0.60414	.	.	ENSG00000163673	ENST00000416516	T	0.51817	0.69	5.51	5.51	0.81932	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.30159	N	0.010275	T	0.77089	0.4079	M	0.92026	3.265	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.81722	-0.0803	10	0.87932	D	0	.	19.7913	0.96458	0.0:1.0:0.0:0.0	.	541	Q9C098	DCLK3_HUMAN	M	541	ENSP00000394484:V541M	ENSP00000394484:V541M	V	-	1	0	DCLK3	36734637	1.000000	0.71417	0.960000	0.40013	0.060000	0.15804	6.079000	0.71291	2.765000	0.95021	0.555000	0.69702	GTG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.547	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLK3	protein_coding	OTTHUMT00000341727.1	C	XM_047355	-		36759633	-1	no_errors	ENST00000416516	ensembl	human	known	74_37	missense	SNP	1.000	T
DGCR2	9993	genome.wustl.edu	37	22	19026588	19026588	+	Silent	SNP	C	C	A			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr22:19026588C>A	ENST00000263196.7	-	10	1690	c.1443G>T	c.(1441-1443)ggG>ggT	p.G481G	DGCR2_ENST00000545799.1_3'UTR|DGCR2_ENST00000537045.1_Silent_p.G440G	NM_001184781.1|NM_005137.2	NP_001171710.1|NP_005128.1	P98153	IDD_HUMAN	DiGeorge syndrome critical region gene 2	481					cell adhesion (GO:0007155)|cognition (GO:0050890)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)	18	Colorectal(54;0.0993)					TCCCACCATCCCCAGGGGCTG	0.642																																																	0								ENSG00000070413						38.0	39.0	39.0					22																	19026588		2202	4298	6500	DGCR2	SO:0001819	synonymous_variant	0			-	HGNC	D79985	CCDS33598.1, CCDS54496.1	22q11.21	2008-06-12			ENSG00000070413	ENSG00000070413			2845	protein-coding gene	gene with protein product	"""integral membrane protein DGCR2"""	600594				7655455, 8630060	Standard	NM_005137		Approved	KIAA0163, LAN, IDD, DGS-C, SEZ-12	uc002zoq.1	P98153	OTTHUMG00000150141	ENST00000263196.7:c.1443G>T	22.37:g.19026588C>A		Somatic	0	109	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	64	35.64	A6NIB5|A8K6K5|B5TY34|B7Z935	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,superfamily_C-type_lectin_fold,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_C-type_lectin,smart_VWF_C,pfscan_LDrepeatLR_classA_rpt,pfscan_C-type_lectin	p.G481	ENST00000263196.7	37	c.1443	CCDS33598.1	22																																																																																			-	NULL		0.642	DGCR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	DGCR2	protein_coding	OTTHUMT00000316504.1	C	NM_005137	-		19026588	-1	no_errors	ENST00000263196	ensembl	human	known	74_37	silent	SNP	0.306	A
FAM182B	728882	genome.wustl.edu	37	20	25840516	25840516	+	Intron	SNP	T	T	C			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr20:25840516T>C	ENST00000376403.1	-	1	142				FAM182B_ENST00000478164.1_Intron|FAM182B_ENST00000376404.2_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B											lung(1)	1						tgtggagaggtcaggccggag	0.627																																																	0								ENSG00000175170																																			FAM182B	SO:0001627	intron_variant	0			-	HGNC			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.236+3179A>G	20.37:g.25840516T>C		Somatic	0	63	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	37	11.90	Q4G0Q1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376403.1	37	NULL		20																																																																																			-	-		0.627	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	FAM182B	protein_coding	OTTHUMT00000078463.2	T	NR_026714	-		25840516	-1	no_errors	ENST00000584356	ensembl	human	known	74_37	rna	SNP	0.024	C
GEN1	348654	genome.wustl.edu	37	2	17962592	17962592	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr2:17962592G>T	ENST00000381254.2	+	14	2327	c.2113G>T	c.(2113-2115)Gaa>Taa	p.E705*	GEN1_ENST00000317402.7_Nonsense_Mutation_p.E705*|SMC6_ENST00000402989.1_Intron	NM_001130009.1	NP_001123481.1	Q17RS7	GEN_HUMAN	GEN1 Holliday junction 5' flap endonuclease	705					DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|resolution of recombination intermediates (GO:0071139)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	crossover junction endodeoxyribonuclease activity (GO:0008821)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E705*(1)		breast(6)|central_nervous_system(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TAGTGTAAAAGAATCTTGTAT	0.338								Homologous recombination																																									1	Substitution - Nonsense(1)	large_intestine(1)						ENSG00000178295						101.0	112.0	108.0					2																	17962592		2203	4300	6503	GEN1	SO:0001587	stop_gained	0			-	HGNC	AK098188	CCDS1691.1	2p24.2	2013-06-04	2013-06-04		ENSG00000178295	ENSG00000178295			26881	protein-coding gene	gene with protein product	"""Holliday junction resolvase"""	612449	"""Gen endonuclease homolog 1 (Drosophila)"""			15576351	Standard	NM_182625		Approved	FLJ40869, Gen	uc002rct.2	Q17RS7	OTTHUMG00000121173	ENST00000381254.2:c.2113G>T	2.37:g.17962592G>T	ENSP00000370653:p.Glu705*	Somatic	0	29	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	Q17RS9|Q6ZN37	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_XPG-I_dom,pfam_XPG_DNA_repair_N,superfamily_5-3_exonuclease_C,smart_XPG_DNA_repair_N,smart_XPG-I_dom,smart_HhH2,prints_XPG/Rad2	p.E705*	ENST00000381254.2	37	c.2113	CCDS1691.1	2	.	.	.	.	.	.	.	.	.	.	G	20.8	4.051865	0.75960	.	.	ENSG00000178295	ENST00000317402;ENST00000381254;ENST00000536097	.	.	.	5.41	2.41	0.29592	.	0.461525	0.18472	N	0.140200	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-7.5156	7.7641	0.28970	0.1458:0.3712:0.483:0.0	.	.	.	.	X	705;705;342	.	ENSP00000318977:E705X	E	+	1	0	GEN1	17826073	0.896000	0.30565	0.013000	0.15412	0.014000	0.08584	1.615000	0.36922	0.763000	0.33175	0.655000	0.94253	GAA	-	NULL		0.338	GEN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GEN1	protein_coding	OTTHUMT00000241661.2	G	NM_182625	-		17962592	+1	no_errors	ENST00000317402	ensembl	human	known	74_37	nonsense	SNP	0.005	T
HFM1	164045	genome.wustl.edu	37	1	91818856	91818856	+	Splice_Site	SNP	C	C	T			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr1:91818856C>T	ENST00000370425.3	-	14	1784	c.1686G>A	c.(1684-1686)agG>agA	p.R562R	HFM1_ENST00000462405.1_5'Flank|HFM1_ENST00000370424.3_Splice_Site_p.R241R|HFM1_ENST00000294696.5_5'UTR	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	562	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		ACTTCTGTAACCTATTTAAAA	0.274																																																	0								ENSG00000162669						68.0	65.0	66.0					1																	91818856		1782	4038	5820	HFM1	SO:0001630	splice_region_variant	0			-	HGNC	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.1686-1G>A	1.37:g.91818856C>T		Somatic	0	34	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	37	17.78	B1B0B6|Q8N9Q0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R562	ENST00000370425.3	37	c.1686	CCDS30769.2	1																																																																																			-	superfamily_P-loop_NTPase,pfscan_Helicase_C		0.274	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HFM1	protein_coding	OTTHUMT00000316716.2	C	NM_001017975	-	Silent	91818856	-1	no_errors	ENST00000370425	ensembl	human	known	74_37	silent	SNP	1.000	T
SENP2	59343	genome.wustl.edu	37	3	185316763	185316763	+	Silent	SNP	A	A	T			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr3:185316763A>T	ENST00000296257.5	+	4	549	c.309A>T	c.(307-309)tcA>tcT	p.S103S	SENP2_ENST00000427465.2_Intron|SENP2_ENST00000545472.1_Silent_p.S93S|SENP2_ENST00000465201.1_3'UTR	NM_021627.2	NP_067640.2	Q9HC62	SENP2_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 2	103					cellular protein metabolic process (GO:0044267)|dorsal/ventral axis specification (GO:0009950)|heart development (GO:0007507)|labyrinthine layer development (GO:0060711)|mRNA transport (GO:0051028)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein binding (GO:0032091)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|protein transport (GO:0015031)|regulation of DNA endoreduplication (GO:0032875)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of Wnt signaling pathway (GO:0030111)|spongiotrophoblast layer development (GO:0060712)|trophoblast giant cell differentiation (GO:0060707)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	SUMO-specific protease activity (GO:0016929)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(3)	12	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			CGAACTCTTCATCTTGTGAAC	0.363																																																	0								ENSG00000163904						132.0	125.0	128.0					3																	185316763		2203	4300	6503	SENP2	SO:0001819	synonymous_variant	0			-	HGNC	AF151697	CCDS33902.1	3q28	2005-08-17	2005-08-17		ENSG00000163904	ENSG00000163904			23116	protein-coding gene	gene with protein product		608261	"""SUMO1/sentrin/SMT3 specific protease 2"""			11896061, 11489887	Standard	XM_005247690		Approved	SMT3IP2, KIAA1331, DKFZp762A2316, AXAM2	uc003fpn.3	Q9HC62	OTTHUMG00000156658	ENST00000296257.5:c.309A>T	3.37:g.185316763A>T		Somatic	0	48	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	20	65.52	B4DQ42|Q8IW97|Q96SR2|Q9P2L5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I59F	ENST00000296257.5	37	c.175	CCDS33902.1	3																																																																																			-	NULL		0.363	SENP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SENP2	protein_coding	OTTHUMT00000345159.1	A	NM_021627	-		185316763	+1	no_errors	ENST00000439684	ensembl	human	known	74_37	missense	SNP	0.965	T
BAI3	577	genome.wustl.edu	37	6	70034783	70034783	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr6:70034783C>A	ENST00000370598.1	+	21	3655	c.2834C>A	c.(2833-2835)aCt>aAt	p.T945N	BAI3_ENST00000238918.8_Missense_Mutation_p.T151N	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	945	Poly-Thr.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				ACAACCACCACTGCATTTTTG	0.418																																																	0								ENSG00000135298						142.0	130.0	134.0					6																	70034783		2203	4300	6503	BAI3	SO:0001583	missense	0			-	HGNC	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.2834C>A	6.37:g.70034783C>A	ENSP00000359630:p.Thr945Asn	Somatic	0	122	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	106	27.40	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.T945N	ENST00000370598.1	37	c.2834	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	C	34	5.330994	0.95733	.	.	ENSG00000135298	ENST00000370598;ENST00000238918	T;T	0.44881	0.91;0.91	6.07	6.07	0.98685	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	T	0.58750	0.2144	M	0.66439	2.03	0.80722	D	1	D;P;D	0.63880	0.992;0.872;0.993	D;P;D	0.65233	0.933;0.659;0.909	T	0.58869	-0.7560	10	0.87932	D	0	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	151;945;945	B7Z356;A8K0Y1;O60242	.;.;BAI3_HUMAN	N	945;151	ENSP00000359630:T945N;ENSP00000238918:T151N	ENSP00000238918:T151N	T	+	2	0	BAI3	70091504	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.792000	0.85828	2.885000	0.99019	0.655000	0.94253	ACT	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like		0.418	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	protein_coding	OTTHUMT00000041120.1	C		-		70034783	+1	no_errors	ENST00000370598	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF708	7562	genome.wustl.edu	37	19	21477333	21477333	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr19:21477333G>T	ENST00000356929.3	-	4	632	c.435C>A	c.(433-435)taC>taA	p.Y145*		NM_021269.2	NP_067092.2	P17019	ZN708_HUMAN	zinc finger protein 708	81					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(2)|stomach(1)	32						AGACTTTCACGTATTTGTCAC	0.363																																																	0								ENSG00000182141						146.0	132.0	137.0					19																	21477333		2203	4300	6503	ZNF708	SO:0001587	stop_gained	0			-	HGNC	X52339	CCDS32980.1	19p12	2014-02-14	2006-08-22	2005-08-16	ENSG00000182141	ENSG00000182141		"""Zinc fingers, C2H2-type"", ""-"""	12945	protein-coding gene	gene with protein product			"""zinc finger protein 15-like 1 (KOX 8)"", ""zinc finger protein 708"", ""zinc finger protein 708 (KOX8)"""	ZNF15, ZNF15L1		2014798	Standard	NM_021269		Approved	KOX8	uc002npq.1	P17019	OTTHUMG00000182841	ENST00000356929.3:c.435C>A	19.37:g.21477333G>T	ENSP00000349401:p.Tyr145*	Somatic	0	54	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	47	9.62	Q6ZMR0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y145*	ENST00000356929.3	37	c.435	CCDS32980.1	19	.	.	.	.	.	.	.	.	.	.	.	14.46	2.541518	0.45280	.	.	ENSG00000182141	ENST00000356929	.	.	.	1.07	1.07	0.20283	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	5.7143	0.17952	0.3975:0.0:0.6025:0.0	.	.	.	.	X	145	.	ENSP00000349401:Y145X	Y	-	3	2	ZNF708	21269173	0.001000	0.12720	0.012000	0.15200	0.011000	0.07611	0.959000	0.29240	-0.491000	0.06697	-0.522000	0.04353	TAC	-	pfscan_Znf_C2H2		0.363	ZNF708-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF708	protein_coding	OTTHUMT00000463953.1	G	NM_021269	-		21477333	-1	no_errors	ENST00000356929	ensembl	human	known	74_37	nonsense	SNP	0.136	T
AP2A2	161	genome.wustl.edu	37	11	993358	993358	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr11:993358G>C	ENST00000448903.2	+	12	1668	c.1527G>C	c.(1525-1527)ttG>ttC	p.L509F	AP2A2_ENST00000332231.5_Missense_Mutation_p.L510F|AP2A2_ENST00000534328.1_Intron	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	509					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		TTGGAAACTTGATAGCTGGAG	0.637																																																	0								ENSG00000183020						40.0	46.0	44.0					11																	993358		1930	4140	6070	AP2A2	SO:0001583	missense	0			-	HGNC	AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.1527G>C	11.37:g.993358G>C	ENSP00000413234:p.Leu509Phe	Somatic	0	62	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	65	14.29	O75403|Q53ET1|Q96SI8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a-adaptin_app_sub_C,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP2_complex_asu	p.L510F	ENST00000448903.2	37	c.1530	CCDS44512.1	11	.	.	.	.	.	.	.	.	.	.	G	9.611	1.131336	0.21041	.	.	ENSG00000183020	ENST00000448903;ENST00000332231;ENST00000448757;ENST00000529125;ENST00000452310	T;T	0.39406	1.08;1.08	3.51	3.51	0.40186	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000006	T	0.65903	0.2736	M	0.87038	2.855	0.58432	D	0.999996	D;B;B	0.69078	0.997;0.304;0.238	D;B;B	0.77557	0.99;0.15;0.233	T	0.71368	-0.4614	10	0.54805	T	0.06	-40.4217	11.9147	0.52759	0.0:0.1768:0.8231:0.0	.	248;510;509	B7Z1Q4;O94973-2;O94973	.;.;AP2A2_HUMAN	F	509;510;510;246;249	ENSP00000413234:L509F;ENSP00000327694:L510F	ENSP00000327694:L510F	L	+	3	2	AP2A2	983358	1.000000	0.71417	0.996000	0.52242	0.308000	0.27856	0.668000	0.25127	1.896000	0.54893	0.462000	0.41574	TTG	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP2_complex_asu		0.637	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AP2A2	protein_coding	OTTHUMT00000385431.2	G	NM_012305	-		993358	+1	no_errors	ENST00000332231	ensembl	human	known	74_37	missense	SNP	1.000	C
RYR1	6261	genome.wustl.edu	37	19	38951142	38951142	+	Missense_Mutation	SNP	C	C	T	rs142548565		TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr19:38951142C>T	ENST00000359596.3	+	20	2488	c.2488C>T	c.(2488-2490)Cgg>Tgg	p.R830W	RYR1_ENST00000360985.3_Missense_Mutation_p.R830W|RYR1_ENST00000355481.4_Missense_Mutation_p.R830W			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	830					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.R830W(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GGAGTATCGACGGGAGGGGCC	0.632																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000196218	C	TRP/ARG,TRP/ARG	0,4406		0,0,2203	68.0	73.0	71.0		2488,2488	1.9	0.9	19	dbSNP_134	71	4,8596	3.7+/-12.6	0,4,4296	yes	missense,missense	RYR1	NM_000540.2,NM_001042723.1	101,101	0,4,6499	TT,TC,CC		0.0465,0.0,0.0308	probably-damaging,probably-damaging	830/5039,830/5034	38951142	4,13002	2203	4300	6503	RYR1	SO:0001583	missense	0			-	HGNC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.2488C>T	19.37:g.38951142C>T	ENSP00000352608:p.Arg830Trp	Somatic	0	65	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	28	34.88	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.R830W	ENST00000359596.3	37	c.2488	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	c	15.55	2.866632	0.51588	0.0	4.65E-4	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.96940	-4.17;-4.18;-4.17	4.13	1.89	0.25635	.	0.091594	0.43416	U	0.000573	D	0.96583	0.8885	L	0.57536	1.79	0.26910	N	0.966923	D;D	0.89917	1.0;0.999	D;D	0.70016	0.967;0.96	D	0.91398	0.5141	10	0.51188	T	0.08	.	8.8285	0.35069	0.3047:0.556:0.1393:0.0	.	830;830	P21817-2;P21817	.;RYR1_HUMAN	W	830	ENSP00000352608:R830W;ENSP00000347667:R830W;ENSP00000354254:R830W	ENSP00000347667:R830W	R	+	1	2	RYR1	43642982	0.468000	0.25839	0.892000	0.35008	0.972000	0.66771	1.165000	0.31822	0.447000	0.26695	0.299000	0.19835	CGG	-	NULL		0.632	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	protein_coding	OTTHUMT00000462137.1	C		rs142548565		38951142	+1	no_errors	ENST00000359596	ensembl	human	known	74_37	missense	SNP	0.739	T
XYLB	9942	genome.wustl.edu	37	3	38411731	38411732	+	Intron	INS	-	-	CACACACACA	rs196387|rs71085317|rs150130857	byFrequency	TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr3:38411731_38411732insCACACACACA	ENST00000207870.3	+	9	855				XYLB_ENST00000542835.1_Intron	NM_005108.3	NP_005099.2	O75191	XYLB_HUMAN	xylulokinase homolog (H. influenzae)						carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|D-xylose metabolic process (GO:0042732)|generation of precursor metabolites and energy (GO:0006091)|xylulose catabolic process (GO:0005998)|xylulose metabolic process (GO:0005997)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|xylulokinase activity (GO:0004856)			endometrium(3)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|prostate(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		GCACTGTAGCGcacacacacac	0.5														304	0.0607029	0.0484	0.0548	5008	,	,		17817	0.0655		0.0825	False		,,,				2504	0.0542																0								ENSG00000093217																																			XYLB	SO:0001627	intron_variant	0				HGNC	AB015046	CCDS2678.1	3p22-p21.3	2006-12-18	2001-12-04		ENSG00000093217	ENSG00000093217			12839	protein-coding gene	gene with protein product		604049	"""xylulokinase (H. influenzae) homolog"""			9763671	Standard	NM_005108		Approved	FLJ10343, FLJ12539	uc003cic.2	O75191	OTTHUMG00000131294	ENST00000207870.3:c.765+66->CACACACACA	3.37:g.38411732_38411741dupCACACACACA		Somatic	NA	NA	NA		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RAW4|B4DDT2|B9EH64	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000207870.3	37	NULL	CCDS2678.1	3																																																																																			-	-		0.500	XYLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLB	protein_coding	OTTHUMT00000254062.2	-	NM_005108			38411732	+1	no_errors	ENST00000487569	ensembl	human	putative	74_37	rna	INS	0.000:0.000	CACACACACA
AKAP6	9472	genome.wustl.edu	37	14	33147640	33147640	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr14:33147640A>G	ENST00000280979.4	+	8	3024	c.2854A>G	c.(2854-2856)Aaa>Gaa	p.K952E	AKAP6_ENST00000557272.1_Missense_Mutation_p.K952E|AKAP6_ENST00000557354.1_Missense_Mutation_p.K952E	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	952					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		TGATATGTCAAAAGTTCATTC	0.413																																					Melanoma(49;821 1200 7288 13647 42351)												0								ENSG00000151320						191.0	180.0	184.0					14																	33147640		2203	4300	6503	AKAP6	SO:0001583	missense	0			-	HGNC	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.2854A>G	14.37:g.33147640A>G	ENSP00000280979:p.Lys952Glu	Somatic	0	58	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	46	25.81	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Spectrin/alpha-actinin	p.K952E	ENST00000280979.4	37	c.2854	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	A	19.29	3.798775	0.70567	.	.	ENSG00000151320	ENST00000280979;ENST00000557354;ENST00000557272	T;T;T	0.19806	3.39;2.12;2.14	5.0	5.0	0.66597	.	0.078146	0.56097	D	0.000032	T	0.25901	0.0631	N	0.08118	0	0.39895	D	0.973829	D;D	0.76494	0.999;0.997	D;D	0.75020	0.918;0.985	T	0.33369	-0.9871	10	0.62326	D	0.03	-17.2443	13.565	0.61813	1.0:0.0:0.0:0.0	.	952;952	A7E242;Q13023	.;AKAP6_HUMAN	E	952	ENSP00000280979:K952E;ENSP00000450531:K952E;ENSP00000451247:K952E	ENSP00000280979:K952E	K	+	1	0	AKAP6	32217391	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.358000	0.73055	2.007000	0.58848	0.477000	0.44152	AAA	-	NULL		0.413	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	protein_coding	OTTHUMT00000276617.2	A	NM_004274	-		33147640	+1	no_errors	ENST00000280979	ensembl	human	known	74_37	missense	SNP	1.000	G
SENP1	29843	genome.wustl.edu	37	12	48459425	48459425	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr12:48459425C>T	ENST00000004980.5	-	11	1551	c.1073G>A	c.(1072-1074)cGc>cAc	p.R358H	SENP1_ENST00000551330.1_Missense_Mutation_p.R358H|SENP1_ENST00000549595.1_Missense_Mutation_p.R358H|SENP1_ENST00000339976.6_3'UTR|SENP1_ENST00000448372.1_Missense_Mutation_p.R358H|SENP1_ENST00000549518.1_Missense_Mutation_p.R358H			Q9P0U3	SENP1_HUMAN	SUMO1/sentrin specific peptidase 1	358					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cellular protein metabolic process (GO:0044267)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|proteolysis (GO:0006508)|regulation of definitive erythrocyte differentiation (GO:0010724)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|SUMO-specific protease activity (GO:0016929)			large_intestine(3)|lung(1)|pancreas(2)|stomach(1)	7		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				TTCAATCTGGCGCAATCTTTC	0.338																																																	0								ENSG00000079387						63.0	56.0	58.0					12																	48459425		1848	4077	5925	SENP1	SO:0001583	missense	0			-	HGNC	AF149770	CCDS44868.1, CCDS44868.2	12q13.1	2008-02-05	2005-08-17			ENSG00000079387			17927	protein-coding gene	gene with protein product		612157	"""SUMO1/sentrin specific protease 1"""			10652325, 14563852	Standard	NM_001267595		Approved		uc009zkx.4	Q9P0U3	OTTHUMG00000169896	ENST00000004980.5:c.1073G>A	12.37:g.48459425C>T	ENSP00000004980:p.Arg358His	Somatic	0	42	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	25	23.53	A8K7P5|Q86XC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.R358H	ENST00000004980.5	37	c.1073	CCDS44868.2	12	.	.	.	.	.	.	.	.	.	.	C	34	5.327461	0.95733	.	.	ENSG00000079387	ENST00000004980;ENST00000448372;ENST00000551330;ENST00000549595;ENST00000549518	T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.44307	0.1287	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.25641	-1.0126	10	0.72032	D	0.01	-8.0321	20.017	0.97481	0.0:1.0:0.0:0.0	.	358;358	Q9P0U3;Q9P0U3-2	SENP1_HUMAN;.	H	358	ENSP00000004980:R358H;ENSP00000394791:R358H;ENSP00000446681:R358H;ENSP00000450076:R358H;ENSP00000447328:R358H	ENSP00000004980:R358H	R	-	2	0	SENP1	46745692	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.202000	0.72131	2.832000	0.97577	0.655000	0.94253	CGC	-	NULL		0.338	SENP1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SENP1	protein_coding	OTTHUMT00000406471.1	C	NM_014554	-		48459425	-1	no_errors	ENST00000004980	ensembl	human	known	74_37	missense	SNP	1.000	T
PKLR	5313	genome.wustl.edu	37	1	155269901	155269901	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr1:155269901T>C	ENST00000342741.4	-	2	309	c.271A>G	c.(271-273)Att>Gtt	p.I91V	PKLR_ENST00000392414.3_Missense_Mutation_p.I60V	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	91					ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	ATGGTGGCAATGATGCTGGTA	0.552																																																	0								ENSG00000143627						70.0	69.0	69.0					1																	155269901		2203	4300	6503	PKLR	SO:0001583	missense	0			-	HGNC	BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.271A>G	1.37:g.155269901T>C	ENSP00000339933:p.Ile91Val	Somatic	0	70	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	42	36.36	O75758|P11973	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pyrv_Knase_brl,pfam_Pyrv_Knase_C,superfamily_Pyrv/PenolPyrv_Kinase-like_dom,superfamily_Pyrv_Knase_C,superfamily_Pyrv_Knase-like_insert_dom,prints_Pyr_Knase,tigrfam_Pyr_Knase	p.I91V	ENST00000342741.4	37	c.271	CCDS1109.1	1	.	.	.	.	.	.	.	.	.	.	T	11.93	1.785272	0.31593	.	.	ENSG00000143627	ENST00000423816;ENST00000392414;ENST00000342741;ENST00000271946	D;D	0.99207	-5.56;-5.56	4.02	4.02	0.46733	Pyruvate/Phosphoenolpyruvate kinase (2);Pyruvate kinase, barrel (1);	0.055870	0.64402	D	0.000001	D	0.92273	0.7549	N	0.10645	0.015	0.47737	D	0.999504	B;B	0.19935	0.04;0.01	B;B	0.26864	0.074;0.074	D	0.89859	0.4015	10	0.14252	T	0.57	-11.6263	5.9764	0.19382	0.0:0.1172:0.0:0.8828	.	91;82	P30613;B1AVT1	KPYR_HUMAN;.	V	116;60;91;27	ENSP00000376214:I60V;ENSP00000339933:I91V	ENSP00000271946:I27V	I	-	1	0	PKLR	153536525	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	1.669000	0.37492	1.663000	0.50791	0.472000	0.43445	ATT	-	pfam_Pyrv_Knase_brl,superfamily_Pyrv/PenolPyrv_Kinase-like_dom,tigrfam_Pyr_Knase		0.552	PKLR-001	KNOWN	basic|CCDS	protein_coding	PKLR	protein_coding	OTTHUMT00000087407.2	T	NM_000298	-		155269901	-1	no_errors	ENST00000342741	ensembl	human	known	74_37	missense	SNP	1.000	C
AFP	174	genome.wustl.edu	37	4	74315183	74315183	+	Splice_Site	SNP	G	G	T			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr4:74315183G>T	ENST00000395792.2	+	9	1290	c.1190G>T	c.(1189-1191)gGa>gTa	p.G397V	AFP_ENST00000226359.2_Splice_Site_p.G397V	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein	397	Albumin 2. {ECO:0000255|PROSITE- ProRule:PRU00769}.				ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CAAGATAAAGGAGTAAGTTGC	0.373									Alpha-Fetoprotein, Hereditary Persistence of																																								0								ENSG00000081051						71.0	73.0	72.0					4																	74315183		2203	4300	6503	AFP	SO:0001630	splice_region_variant	0	Familial Cancer Database	HPAFP	-	HGNC	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.1191+1G>T	4.37:g.74315183G>T		Somatic	0	40	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34	B2RBU3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,pirsf_Serum_albumin/AFP,prints_Alpha-fetoprotein,prints_ALB/AFP/VDB	p.G397V	ENST00000395792.2	37	c.1190	CCDS3556.1	4	.	.	.	.	.	.	.	.	.	.	G	9.431	1.085623	0.20390	.	.	ENSG00000081051	ENST00000395792;ENST00000226359	T;T	0.73469	-0.75;-0.75	5.87	4.07	0.47477	Serum albumin-like (1);Serum albumin, N-terminal (2);	0.468657	0.24409	N	0.038767	T	0.57829	0.2080	N	0.21282	0.65	0.49915	D	0.999835	B;B	0.26400	0.148;0.1	B;B	0.30029	0.11;0.054	T	0.51608	-0.8684	10	0.22109	T	0.4	.	7.7647	0.28972	0.0859:0.0:0.7438:0.1702	.	239;397	B4DMX4;P02771	.;FETA_HUMAN	V	397	ENSP00000379138:G397V;ENSP00000226359:G397V	ENSP00000226359:G397V	G	+	2	0	AFP	74534047	1.000000	0.71417	0.988000	0.46212	0.066000	0.16364	0.649000	0.24843	1.564000	0.49628	0.655000	0.94253	GGA	-	superfamily_Serum_albumin-like,smart_Serum_albumin_N,pirsf_Serum_albumin/AFP		0.373	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFP	protein_coding	OTTHUMT00000252284.3	G		-	Missense_Mutation	74315183	+1	no_errors	ENST00000395792	ensembl	human	known	74_37	missense	SNP	0.993	T
LOC63930	63930	genome.wustl.edu	37	20	61665964	61665964	+	lincRNA	SNP	A	A	T			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr20:61665964A>T	ENST00000607802.1	+	0	91				LINC00029_ENST00000370341.3_lincRNA	NR_033370.1																						AGAAATCCGGAAACAAGGGAC	0.517																																																	0								ENSG00000125514																																			LINC00029			0			-	HGNC																													20.37:g.61665964A>T		Somatic	0	45	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	27	30.77		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000607802.1	37	NULL		20																																																																																			-	-		0.517	RP11-305P22.9-001	KNOWN	basic	lincRNA	LINC00029	lincRNA	OTTHUMT00000470475.1	A		-		61665964	-1	no_errors	ENST00000370341	ensembl	human	known	74_37	rna	SNP	0.001	T
MICAL3	57553	genome.wustl.edu	37	22	18301275	18301275	+	Silent	SNP	G	G	A			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr22:18301275G>A	ENST00000441493.2	-	26	4504	c.4152C>T	c.(4150-4152)tcC>tcT	p.S1384S	MICAL3_ENST00000580469.1_5'Flank	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1384	Pro-rich.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		TTTTGGGGATGGACAGAGGCT	0.637																																																	0								ENSG00000243156						102.0	116.0	111.0					22																	18301275		1920	4114	6034	MICAL3	SO:0001819	synonymous_variant	0			-	HGNC	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.4152C>T	22.37:g.18301275G>A		Somatic	0	39	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	13	41.67	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM,prints_Rng_hydrolase-like	p.S1384	ENST00000441493.2	37	c.4152	CCDS46659.1	22	.	.	.	.	.	.	.	.	.	.	g	0.011	-1.737865	0.00681	.	.	ENSG00000093100	ENST00000252134	.	.	.	4.43	-2.01	0.07410	.	.	.	.	.	T	0.18341	0.0440	.	.	.	0.20926	N	0.999825	.	.	.	.	.	.	T	0.22243	-1.0222	4	.	.	.	.	0.9721	0.01418	0.4395:0.2146:0.1387:0.2072	.	.	.	.	L	366	.	.	P	-	2	0	XXbac-B461K10.4	16681275	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.154000	0.10130	-0.972000	0.03559	-1.562000	0.00884	CCA	-	NULL		0.637	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL3	protein_coding	OTTHUMT00000447351.1	G		-		18301275	-1	no_errors	ENST00000441493	ensembl	human	known	74_37	silent	SNP	0.001	A
GAL3ST1	9514	genome.wustl.edu	37	22	30950947	30950947	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr22:30950947C>T	ENST00000402321.1	-	3	1582	c.1265G>A	c.(1264-1266)cGg>cAg	p.R422Q	GAL3ST1_ENST00000338911.5_Missense_Mutation_p.R422Q|GAL3ST1_ENST00000406955.1_Missense_Mutation_p.R422Q|GAL3ST1_ENST00000401975.1_Missense_Mutation_p.R422Q|GAL3ST1_ENST00000402369.1_Missense_Mutation_p.R422Q|GAL3ST1_ENST00000406361.1_Missense_Mutation_p.R422Q|GAL3ST1_ENST00000443111.2_Missense_Mutation_p.R422Q			Q99999	G3ST1_HUMAN	galactose-3-O-sulfotransferase 1	422				R -> E (in Ref. 1; AA sequence). {ECO:0000305}.	galactosylceramide biosynthetic process (GO:0006682)|glycosphingolipid metabolic process (GO:0006687)|myelination (GO:0042552)|protein N-linked glycosylation (GO:0006487)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|sphingolipid metabolic process (GO:0006665)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	galactosylceramide sulfotransferase activity (GO:0001733)|sulfotransferase activity (GO:0008146)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21						ACGTCACCACCGCAGGAAATC	0.682																																																	0								ENSG00000128242						45.0	41.0	42.0					22																	30950947		2203	4300	6503	GAL3ST1	SO:0001583	missense	0			-	HGNC	D88667	CCDS13879.1	22q12.2	2007-04-02			ENSG00000128242	ENSG00000128242		"""Sulfotransferases, membrane-bound"""	24240	protein-coding gene	gene with protein product	"""cerebroside (3' phosphoadenylylsulfate:galactosylceramide 3') sulfotransferase"""	602300				9847074, 9030544	Standard	NM_004861		Approved	CST	uc003aii.1	Q99999	OTTHUMG00000151200	ENST00000402321.1:c.1265G>A	22.37:g.30950947C>T	ENSP00000385735:p.Arg422Gln	Somatic	0	49	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	30	43.40	Q96C63	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Gal-3-0_sulfotransfrase,superfamily_P-loop_NTPase	p.R422Q	ENST00000402321.1	37	c.1265	CCDS13879.1	22	.	.	.	.	.	.	.	.	.	.	c	10.12	1.263311	0.23051	.	.	ENSG00000128242	ENST00000406955;ENST00000402321;ENST00000402369;ENST00000401975;ENST00000338911;ENST00000406361;ENST00000443111	T;T;T;T;T;T;T	0.17691	2.26;2.26;2.26;2.26;2.26;2.26;2.26	5.73	-1.77	0.07982	.	0.424732	0.26146	N	0.026068	T	0.07324	0.0185	N	0.13043	0.29	0.45452	D	0.998428	B	0.06786	0.001	B	0.01281	0.0	T	0.36237	-0.9756	10	0.20519	T	0.43	-10.2743	7.1798	0.25765	0.1094:0.4456:0.0:0.445	.	422	Q99999	G3ST1_HUMAN	Q	422	ENSP00000385825:R422Q;ENSP00000385735:R422Q;ENSP00000384122:R422Q;ENSP00000384388:R422Q;ENSP00000343234:R422Q;ENSP00000385207:R422Q;ENSP00000402587:R422Q	ENSP00000343234:R422Q	R	-	2	0	GAL3ST1	29280947	0.999000	0.42202	0.098000	0.21074	0.792000	0.44763	1.935000	0.40173	-0.553000	0.06158	-0.291000	0.09656	CGG	-	NULL		0.682	GAL3ST1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GAL3ST1	protein_coding	OTTHUMT00000321745.1	C	NM_004861	-		30950947	-1	no_errors	ENST00000338911	ensembl	human	known	74_37	missense	SNP	0.346	T
EPHB1	2047	genome.wustl.edu	37	3	134644703	134644703	+	Missense_Mutation	SNP	C	C	T	rs536029159		TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr3:134644703C>T	ENST00000398015.3	+	2	474	c.104C>T	c.(103-105)aCg>aTg	p.T35M	EPHB1_ENST00000488154.1_3'UTR	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	35	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						CTGGGCTGGACGGCCAATCCT	0.458													C|||	1	0.000199681	0.0	0.0	5008	,	,		20439	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000154928																																			EPHB1	SO:0001583	missense	0			-	HGNC	L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.104C>T	3.37:g.134644703C>T	ENSP00000381097:p.Thr35Met	Somatic	0	35	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	19	61.22	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.T35M	ENST00000398015.3	37	c.104	CCDS46921.1	3	.	.	.	.	.	.	.	.	.	.	C	15.11	2.735981	0.49045	.	.	ENSG00000154928	ENST00000460895;ENST00000398015;ENST00000497173;ENST00000473867;ENST00000474732	T;T;T;T;T	0.03831	3.79;3.79;3.79;3.79;3.79	4.33	4.33	0.51752	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.067175	0.56097	D	0.000023	T	0.14442	0.0349	L	0.48642	1.525	0.80722	D	1	D;D	0.64830	0.994;0.988	D;P	0.63793	0.918;0.797	T	0.02391	-1.1166	10	0.40728	T	0.16	.	17.0176	0.86423	0.0:1.0:0.0:0.0	.	35;35	B5A969;P54762	.;EPHB1_HUMAN	M	13;35;13;13;13	ENSP00000417435:T13M;ENSP00000381097:T35M;ENSP00000419688:T13M;ENSP00000417216:T13M;ENSP00000418352:T13M	ENSP00000381097:T35M	T	+	2	0	EPHB1	136127393	0.999000	0.42202	1.000000	0.80357	0.975000	0.68041	5.278000	0.65592	2.253000	0.74438	0.555000	0.69702	ACG	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom		0.458	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB1	protein_coding	OTTHUMT00000357671.1	C	NM_004441	-		134644703	+1	no_errors	ENST00000398015	ensembl	human	known	74_37	missense	SNP	1.000	T
ASTN1	460	genome.wustl.edu	37	1	176903441	176903441	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr1:176903441T>C	ENST00000367654.3	-	16	2753	c.2542A>G	c.(2542-2544)Aca>Gca	p.T848A	ASTN1_ENST00000367657.3_Missense_Mutation_p.T840A|ASTN1_ENST00000424564.2_Missense_Mutation_p.T840A|ASTN1_ENST00000361833.2_Missense_Mutation_p.T840A|ASTN1_ENST00000281881.3_5'Flank	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	848					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.T840A(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						GCACGAGATGTAGCCCCATCC	0.527																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000152092						93.0	80.0	84.0					1																	176903441		2203	4300	6503	ASTN1	SO:0001583	missense	0			-	HGNC	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2542A>G	1.37:g.176903441T>C	ENSP00000356626:p.Thr848Ala	Somatic	0	28	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	33	31.25	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Fibronectin_type3,smart_EG-like_dom,smart_MACPF,pfscan_Fibronectin_type3	p.T848A	ENST00000367654.3	37	c.2542		1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.809980	0.90707	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.61173	0.2326	L	0.40543	1.245	0.80722	D	1	D;D	0.61697	0.99;0.99	D;D	0.72982	0.979;0.979	T	0.63440	-0.6637	10	0.72032	D	0.01	-17.3327	16.0098	0.80391	0.0:0.0:0.0:1.0	.	840;840	O14525-2;B1AJS1	.;.	A	840;840;848;840;840	ENSP00000356629:T840A;ENSP00000354536:T840A;ENSP00000356626:T848A;ENSP00000395041:T840A	ENSP00000354536:T840A	T	-	1	0	ASTN1	175170064	1.000000	0.71417	0.989000	0.46669	0.950000	0.60333	7.517000	0.81783	2.254000	0.74563	0.533000	0.62120	ACA	-	smart_MACPF		0.527	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	protein_coding		T	NM_004319	-		176903441	-1	no_errors	ENST00000367654	ensembl	human	known	74_37	missense	SNP	0.998	C
SPPL2B	56928	genome.wustl.edu	37	19	2341094	2341101	+	RNA	DEL	CTCCCTGG	CTCCCTGG	-	rs77642174|rs76166147|rs386805838|rs547300749	byFrequency	TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	CTCCCTGG	CTCCCTGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr19:2341094_2341101delCTCCCTGG	ENST00000452401.2	+	0	1033							Q8TCT7	SPP2B_HUMAN	signal peptide peptidase like 2B						membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	endosome membrane (GO:0010008)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACTCCCTGCCCTCCCTGGAGGCCGCCCC	0.702														1248	0.249201	0.0469	0.3718	5008	,	,		14617	0.25		0.4294	False		,,,				2504	0.2495																0								ENSG00000005206																																			SPPL2B			0				HGNC		CCDS74252.1, CCDS74253.1	19p13.3	2012-02-21			ENSG00000005206	ENSG00000005206			30627	protein-coding gene	gene with protein product	"""intramembrane protease 4"""	608239				10819331	Standard	NM_001077238		Approved	IMP4, PSL1, KIAA1532	uc002lvs.3	Q8TCT7			19.37:g.2341094_2341101delCTCCCTGG		Somatic	NA	NA	NA		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	D6W609|O60365|Q567S3|Q8IUH9|Q9BUY6|Q9H3M4|Q9NPN2|Q9P1Z6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000452401.2	37	NULL		19																																																																																			-	-		0.702	SPPL2B-202	KNOWN	basic	processed_transcript	SPPL2B	processed_transcript		CTCCCTGG	NM_020172			2341101	+1	no_errors	ENST00000592738	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.010:0.001:0.000:0.000:0.001:0.000	-
SLC4A4	8671	genome.wustl.edu	37	4	72412086	72412086	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr4:72412086T>A	ENST00000264485.5	+	19	2579	c.2462T>A	c.(2461-2463)tTg>tAg	p.L821*	SLC4A4_ENST00000351898.6_Intron|SLC4A4_ENST00000340595.3_Nonsense_Mutation_p.L777*|SLC4A4_ENST00000425175.1_Nonsense_Mutation_p.L821*	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	821					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	GGGTATCACTTGGATCTCTTT	0.438																																																	0								ENSG00000080493						259.0	213.0	228.0					4																	72412086		2203	4300	6503	SLC4A4	SO:0001587	stop_gained	0			-	HGNC	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.2462T>A	4.37:g.72412086T>A	ENSP00000264485:p.Leu821*	Somatic	0	117	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	62	27.06	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.L821*	ENST00000264485.5	37	c.2462	CCDS43236.1	4	.	.	.	.	.	.	.	.	.	.	T	42	9.480197	0.99183	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000340595	.	.	.	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.7067	0.77588	0.0:0.0:0.0:1.0	.	.	.	.	X	821;821;777	.	ENSP00000264485:L821X	L	+	2	0	SLC4A4	72630950	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	8.040000	0.89188	2.104000	0.64026	0.528000	0.53228	TTG	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk		0.438	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A4	protein_coding	OTTHUMT00000362090.1	T	NM_003759	-		72412086	+1	no_errors	ENST00000425175	ensembl	human	known	74_37	nonsense	SNP	1.000	A
TNPO3	23534	genome.wustl.edu	37	7	128640525	128640525	+	Silent	SNP	A	A	C			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr7:128640525A>C	ENST00000265388.5	-	7	1112	c.969T>G	c.(967-969)acT>acG	p.T323T	TNPO3_ENST00000482320.1_Silent_p.T257T|TNPO3_ENST00000471234.1_Silent_p.T323T|TNPO3_ENST00000393245.1_Silent_p.T323T|TNPO3_ENST00000471166.1_Silent_p.T323T			Q9Y5L0	TNPO3_HUMAN	transportin 3	323					splicing factor protein import into nucleus (GO:0035048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(3)	22						GCAGCTCCAGAGTTCGAAGGT	0.413																																					Pancreas(147;583 2585 39696 52331)												0								ENSG00000064419						83.0	89.0	87.0					7																	128640525		2203	4300	6503	TNPO3	SO:0001819	synonymous_variant	0			-	HGNC	AF145029	CCDS5809.1, CCDS55162.1	7q32.2	2014-02-03			ENSG00000064419	ENSG00000064419		"""Importins"""	17103	protein-coding gene	gene with protein product	"""importin 12"""	610032	"""limb girdle muscular dystrophy 1F (autosomal dominant)"""	LGMD1F		10366588, 10713112, 23543484, 23667635	Standard	NM_012470		Approved	TRN-SR, MTR10A, TRN-SR2, IPO12	uc003vol.2	Q9Y5L0	OTTHUMG00000158409	ENST00000265388.5:c.969T>G	7.37:g.128640525A>C		Somatic	0	22	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	26	23.53	A4D1K9|C9IZM0|Q6NUM1|Q96G71|Q96GU9|Q9Y3R2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold	p.T323	ENST00000265388.5	37	c.969	CCDS5809.1	7																																																																																			-	superfamily_ARM-type_fold		0.413	TNPO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNPO3	protein_coding	OTTHUMT00000350929.1	A	NM_012470	-		128640525	-1	no_errors	ENST00000393245	ensembl	human	known	74_37	silent	SNP	0.999	C
EPHB2	2048	genome.wustl.edu	37	1	23233390	23233390	+	Silent	SNP	C	C	T			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr1:23233390C>T	ENST00000400191.3	+	11	2094	c.2076C>T	c.(2074-2076)agC>agT	p.S692S	EPHB2_ENST00000374627.1_Silent_p.S687S|EPHB2_ENST00000374632.3_Silent_p.S693S|EPHB2_ENST00000374630.3_Silent_p.S692S	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	692	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		TGACCAAGAGCACACCTGTGA	0.602																																																	0								ENSG00000133216						97.0	69.0	78.0					1																	23233390		2203	4300	6503	EPHB2	SO:0001819	synonymous_variant	0			-	HGNC	AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.2076C>T	1.37:g.23233390C>T		Somatic	0	35	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	28	44.00	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S692	ENST00000400191.3	37	c.2076		1																																																																																			-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.602	EPHB2-001	KNOWN	basic	protein_coding	EPHB2	protein_coding	OTTHUMT00000008060.2	C	NM_017449	-		23233390	+1	no_errors	ENST00000400191	ensembl	human	known	74_37	silent	SNP	1.000	T
NRG2	9542	genome.wustl.edu	37	5	139422532	139422534	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr5:139422532_139422534delGCT	ENST00000361474.1	-	1	345_347	c.121_123delAGC	c.(121-123)agcdel	p.S41del	NRG2_ENST00000545385.1_In_Frame_Del_p.S41del|NRG2_ENST00000289422.7_In_Frame_Del_p.S41del|NRG2_ENST00000289409.4_In_Frame_Del_p.S41del|NRG2_ENST00000541337.1_In_Frame_Del_p.S41del|NRG2_ENST00000394770.1_In_Frame_Del_p.S41del|NRG2_ENST00000358522.3_In_Frame_Del_p.S41del	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	41	Poly-Ser.				embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.S41delS(2)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			tgccgctctcgctgctgctgctg	0.7																																																	2	Deletion - In frame(2)	soft_tissue(1)|central_nervous_system(1)						ENSG00000158458		,,,,	9,5,109,1819		2,0,0,5,1,0,3,19,71,870					,,,,	0.6	0.8			4	20,40,281,3927		5,0,1,9,12,0,16,38,204,1849	no	codingComplex,codingComplex,codingComplex,codingComplex,codingComplex	NRG2	NM_013983.2,NM_013982.2,NM_013981.3,NM_004883.2,NM_001184935.1	,,,,	7,0,1,14,13,0,19,57,275,2719	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		7.9897,6.3337,7.4718	,,,,	,,,,		29,45,390,5746				NRG2	SO:0001651	inframe_deletion	0				HGNC		CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.121_123delAGC	5.37:g.139422541_139422543delGCT	ENSP00000354910:p.Ser41del	Somatic	0	27	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	8	20.00		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_EG-like_dom,pfscan_Ig-like_dom	p.S41in_frame_del	ENST00000361474.1	37	c.123_121	CCDS4217.1	5																																																																																			-	NULL		0.700	NRG2-001	KNOWN	basic|CCDS	protein_coding	NRG2	protein_coding	OTTHUMT00000251340.1	GCT	NM_013982			139422534	-1	no_errors	ENST00000545385	ensembl	human	known	74_37	in_frame_del	DEL	0.905:0.938:0.962	-
AP2A2	161	genome.wustl.edu	37	11	993284	993284	+	Splice_Site	SNP	G	G	A			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr11:993284G>A	ENST00000448903.2	+	12	1594	c.1453G>A	c.(1453-1455)Gct>Act	p.A485T	AP2A2_ENST00000332231.5_Splice_Site_p.A486T|AP2A2_ENST00000534328.1_Intron	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	485					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		TGCTTCGCAGGCTCTTCAGGC	0.632																																																	0								ENSG00000183020						31.0	36.0	35.0					11																	993284		1989	4157	6146	AP2A2	SO:0001630	splice_region_variant	0			-	HGNC	AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.1453-1G>A	11.37:g.993284G>A		Somatic	0	61	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	54	15.62	O75403|Q53ET1|Q96SI8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a-adaptin_app_sub_C,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP2_complex_asu	p.A486T	ENST00000448903.2	37	c.1456	CCDS44512.1	11	.	.	.	.	.	.	.	.	.	.	G	14.12	2.439772	0.43326	.	.	ENSG00000183020	ENST00000448903;ENST00000332231;ENST00000448757;ENST00000529125;ENST00000452310	T;T	0.26373	1.74;1.74	3.66	3.66	0.41972	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.52805	0.1757	M	0.80746	2.51	0.80722	D	1	D;D;D	0.89917	0.998;1.0;0.997	D;D;P	0.85130	0.981;0.997;0.884	T	0.60286	-0.7293	9	.	.	.	-11.868	16.226	0.82293	0.0:0.0:1.0:0.0	.	224;486;485	B7Z1Q4;O94973-2;O94973	.;.;AP2A2_HUMAN	T	485;486;486;222;225	ENSP00000413234:A485T;ENSP00000327694:A486T	.	A	+	1	0	AP2A2	983284	1.000000	0.71417	0.807000	0.32361	0.265000	0.26407	7.837000	0.86796	1.979000	0.57680	0.462000	0.41574	GCT	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP2_complex_asu		0.632	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AP2A2	protein_coding	OTTHUMT00000385431.2	G	NM_012305	-	Missense_Mutation	993284	+1	no_errors	ENST00000332231	ensembl	human	known	74_37	missense	SNP	1.000	A
RP11-826N14.1	0	genome.wustl.edu	37	5	175467785	175467785	+	RNA	SNP	G	G	A	rs187668175	byFrequency	TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr5:175467785G>A	ENST00000509643.1	+	0	39																											CATCGTGGACGGGAGTAAAGT	0.527													g|||	2	0.000399361	0.0	0.0014	5008	,	,		34306	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000250992																																			RP11-826N14.1			0			GMAF=0.0005	Clone_based_vega_gene																													5.37:g.175467785G>A		Somatic	0	134	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	138	12.66		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000509643.1	37	NULL		5																																																																																			-	-		0.527	RP11-826N14.1-001	KNOWN	basic	antisense	ENSG00000250992	antisense	OTTHUMT00000371916.1	G		rs187668175		175467785	+1	no_errors	ENST00000509643	ensembl	human	known	74_37	rna	SNP	0.037	A
CXorf22	170063	genome.wustl.edu	37	X	35969300	35969300	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chrX:35969300G>T	ENST00000297866.5	+	5	775	c.709G>T	c.(709-711)Gtt>Ttt	p.V237F		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	237										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						AGCTCATGTGGTTGAGCAGAT	0.348																																																	0								ENSG00000165164						116.0	102.0	107.0					X																	35969300		2202	4300	6502	CXorf22	SO:0001583	missense	0			-	HGNC	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.709G>T	X.37:g.35969300G>T	ENSP00000297866:p.Val237Phe	Somatic	0	18	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	5	70.59	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_PapD-like	p.V237F	ENST00000297866.5	37	c.709	CCDS14237.2	X	.	.	.	.	.	.	.	.	.	.	G	22.5	4.295943	0.81025	.	.	ENSG00000165164	ENST00000297866	T	0.21361	2.01	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.49864	0.1582	M	0.78049	2.395	0.38991	D	0.959153	D	0.89917	1.0	D	0.97110	1.0	T	0.53085	-0.8488	10	0.51188	T	0.08	-25.866	17.7567	0.88451	0.0:0.0:1.0:0.0	.	237	Q6ZTR5	CX022_HUMAN	F	237	ENSP00000297866:V237F	ENSP00000297866:V237F	V	+	1	0	CXorf22	35879221	1.000000	0.71417	0.888000	0.34837	0.960000	0.62799	6.957000	0.76019	2.412000	0.81896	0.506000	0.49869	GTT	-	NULL		0.348	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf22	protein_coding	OTTHUMT00000056216.2	G	NM_152632	-		35969300	+1	no_errors	ENST00000297866	ensembl	human	known	74_37	missense	SNP	0.923	T
NKX2-2	4821	genome.wustl.edu	37	20	21492811	21492811	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr20:21492811C>A	ENST00000377142.4	-	2	928	c.572G>T	c.(571-573)gGt>gTt	p.G191V	NKX2-2-AS1_ENST00000549659.1_RNA	NM_002509.3	NP_002500.1	O95096	NKX22_HUMAN	NK2 homeobox 2	191					astrocyte differentiation (GO:0048708)|brain development (GO:0007420)|digestive tract development (GO:0048565)|endocrine pancreas development (GO:0031018)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|oligodendrocyte development (GO:0014003)|optic nerve development (GO:0021554)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell fate commitment (GO:0003327)|ventral spinal cord interneuron fate determination (GO:0060580)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|core promoter proximal region DNA binding (GO:0001159)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						CACCTCCATACCTTTCTCGGC	0.667																																																	0								ENSG00000125820						39.0	41.0	40.0					20																	21492811		2202	4300	6502	NKX2-2	SO:0001583	missense	0			-	HGNC	AF019415	CCDS13145.1	20p11.22	2012-03-09	2007-07-09	2002-10-04	ENSG00000125820	ENSG00000125820		"""Homeoboxes / ANTP class : NKL subclass"""	7835	protein-coding gene	gene with protein product		604612	"""NK-2 (Drosophila) homolog B"", ""NK2 transcription factor related, locus 2 (Drosophila)"""	NKX2B		9703340, 1346742	Standard	NM_002509		Approved	NKX2.2	uc002wsi.3	O95096	OTTHUMG00000170524	ENST00000377142.4:c.572G>T	20.37:g.21492811C>A	ENSP00000366347:p.Gly191Val	Somatic	0	120	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	54	40.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.G191V	ENST00000377142.4	37	c.572	CCDS13145.1	20	.	.	.	.	.	.	.	.	.	.	C	17.51	3.407232	0.62399	.	.	ENSG00000125820	ENST00000377142	D	0.91996	-2.95	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.91140	0.7210	M	0.62723	1.935	0.80722	D	1	B	0.23490	0.086	B	0.24269	0.052	D	0.87890	0.2683	10	0.35671	T	0.21	.	19.0448	0.93015	0.0:1.0:0.0:0.0	.	191	O95096	NKX22_HUMAN	V	191	ENSP00000366347:G191V	ENSP00000366347:G191V	G	-	2	0	NKX2-2	21440811	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.078000	0.57606	2.489000	0.83994	0.462000	0.41574	GGT	-	NULL		0.667	NKX2-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX2-2	protein_coding	OTTHUMT00000078278.9	C		-		21492811	-1	no_errors	ENST00000377142	ensembl	human	known	74_37	missense	SNP	1.000	A
RNF43	54894	genome.wustl.edu	37	17	56435245	56435245	+	Missense_Mutation	SNP	C	C	A	rs35946293		TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr17:56435245C>A	ENST00000584437.1	-	8	3847	c.1892G>T	c.(1891-1893)aGc>aTc	p.S631I	RNF43_ENST00000577716.1_Missense_Mutation_p.S631I|RNF43_ENST00000581868.1_Missense_Mutation_p.S504I|RNF43_ENST00000577625.1_Missense_Mutation_p.S504I|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000500597.2_Missense_Mutation_p.S590I|RNF43_ENST00000407977.2_Missense_Mutation_p.S631I|RNF43_ENST00000583753.1_Missense_Mutation_p.S590I			Q68DV7	RNF43_HUMAN	ring finger protein 43	631	Pro-rich.				negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GGGGCAGATGCTGGAGGCGTC	0.647																																																	0								ENSG00000108375						64.0	74.0	70.0					17																	56435245		2201	4296	6497	RNF43	SO:0001583	missense	0			-	HGNC		CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.1892G>T	17.37:g.56435245C>A	ENSP00000463069:p.Ser631Ile	Somatic	0	68	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	32	47.54	A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,superfamily_PAS,smart_Znf_RING,pfscan_Znf_RING	p.S631I	ENST00000584437.1	37	c.1892	CCDS11607.1	17	.	.	.	.	.	.	.	.	.	.	C	6.476	0.455964	0.12283	.	.	ENSG00000108375	ENST00000407977;ENST00000500597	T;T	0.09163	3.15;3.01	5.18	0.772	0.18510	.	0.707659	0.14067	N	0.343638	T	0.07234	0.0183	L	0.27053	0.805	0.09310	N	1	P;P;B	0.47677	0.571;0.899;0.435	B;B;B	0.41988	0.206;0.372;0.102	T	0.27297	-1.0078	10	0.56958	D	0.05	-11.4638	5.0337	0.14423	0.0:0.583:0.1513:0.2657	.	590;631;631	Q68DV7-2;Q68DV7-4;Q68DV7	.;.;RNF43_HUMAN	I	631;590	ENSP00000385328:S631I;ENSP00000441969:S590I	ENSP00000385328:S631I	S	-	2	0	RNF43	53790244	0.000000	0.05858	0.019000	0.16419	0.137000	0.21094	-0.814000	0.04486	0.188000	0.20168	0.205000	0.17691	AGC	-	NULL		0.647	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF43	protein_coding	OTTHUMT00000444713.1	C	NM_017763	-		56435245	-1	no_errors	ENST00000407977	ensembl	human	known	74_37	missense	SNP	0.002	A
GLT8D2	83468	genome.wustl.edu	37	12	104397053	104397053	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A3LT-01A-12D-A21Q-09	TCGA-DX-A3LT-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2f02ff7-8433-4cb5-9324-34f13edeaca1	c31a8d8b-6d3a-4e91-a25a-0a4791b3a0c2	g.chr12:104397053T>G	ENST00000360814.4	-	5	549	c.144A>C	c.(142-144)gaA>gaC	p.E48D	GLT8D2_ENST00000546436.1_Missense_Mutation_p.E48D|GLT8D2_ENST00000548660.1_Missense_Mutation_p.E48D	NM_031302.3	NP_112592.1	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	48						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			kidney(3)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	16						GAATCTCTTCTTCCAGTTCTT	0.448																																																	0								ENSG00000120820						185.0	157.0	166.0					12																	104397053		2203	4300	6503	GLT8D2	SO:0001583	missense	0			-	HGNC	BC022343	CCDS9096.1	12q23.3	2013-02-22			ENSG00000120820	ENSG00000120820		"""Glycosyltransferase family 8 domain containing"""	24890	protein-coding gene	gene with protein product							Standard	NM_031302		Approved	FLJ31494	uc001tkh.1	Q9H1C3	OTTHUMG00000170120	ENST00000360814.4:c.144A>C	12.37:g.104397053T>G	ENSP00000354053:p.Glu48Asp	Somatic	0	47	0.00		0.6602040560853327	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	39	40.30	Q96KA2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_8	p.E48D	ENST00000360814.4	37	c.144	CCDS9096.1	12	.	.	.	.	.	.	.	.	.	.	t	12.59	1.984196	0.35036	.	.	ENSG00000120820	ENST00000360814;ENST00000546436;ENST00000548660	T;T;T	0.32272	1.46;1.46;1.46	5.73	-9.86	0.00473	.	0.318283	0.36703	N	0.002457	T	0.13200	0.0320	N	0.24115	0.695	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.27571	-1.0070	10	0.20519	T	0.43	.	11.3669	0.49677	0.0:0.4436:0.3741:0.1822	.	48	Q9H1C3	GL8D2_HUMAN	D	48	ENSP00000354053:E48D;ENSP00000449750:E48D;ENSP00000447450:E48D	ENSP00000354053:E48D	E	-	3	2	GLT8D2	102921183	0.001000	0.12720	0.083000	0.20561	0.887000	0.51463	-1.684000	0.01932	-2.286000	0.00670	-0.363000	0.07495	GAA	-	NULL		0.448	GLT8D2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLT8D2	protein_coding	OTTHUMT00000407371.1	T	NM_031302	-		104397053	-1	no_errors	ENST00000360814	ensembl	human	known	74_37	missense	SNP	0.171	G
