#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ARFGAP2	84364	genome.wustl.edu	37	11	47186904	47186904	+	3'UTR	SNP	C	C	T			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr11:47186904C>T	ENST00000524782.1	-	0	1923				ARFGAP2_ENST00000426335.2_3'UTR|ARFGAP2_ENST00000319543.6_3'UTR|RP11-390K5.6_ENST00000524412.1_RNA|ARFGAP2_ENST00000395449.3_5'UTR	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2						protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						CAAAGGCCACCCCACACACAC	0.567																																																	0								ENSG00000149182																																			ARFGAP2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.*129G>A	11.37:g.47186904C>T		Somatic	0	23	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	14	33.33	B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	RNA	SNP	31	0.00	0	39	22.00	11	-	NULL	ENST00000524782.1	37	NULL	CCDS7926.1	11																																																																																			-	-		0.567	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGAP2	protein_coding	OTTHUMT00000391425.1	C	NM_032389	-		47186904	-1	no_errors	ENST00000395449	ensembl	human	known	74_37	rna	SNP	0.662	T
L1TD1	54596	genome.wustl.edu	37	1	62672642	62672642	+	Silent	SNP	G	G	A			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr1:62672642G>A	ENST00000498273.1	+	3	637	c.342G>A	c.(340-342)ggG>ggA	p.G114G		NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	114										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						aaaaaacagggatggtaggga	0.333																																																	0								ENSG00000240563						68.0	80.0	76.0					1																	62672642		2182	4289	6471	L1TD1	SO:0001819	synonymous_variant	0			-	HGNC	BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.342G>A	1.37:g.62672642G>A		Somatic	0	18	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	19	56.82	Q8NDA1|Q9NUV8|Q9NV78	Silent	SNP	34	0.00	0	64	57.89	88	pfam_Transposase_22,superfamily_STAT_TF_coiled-coil	p.G114	ENST00000498273.1	37	c.342	CCDS619.1	1																																																																																			-	NULL		0.333	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L1TD1	protein_coding	OTTHUMT00000024688.1	G	NM_019079	-		62672642	+1	no_errors	ENST00000498273	ensembl	human	known	74_37	silent	SNP	0.000	A
OPN1LW	5956	genome.wustl.edu	37	X	153421955	153421955	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chrX:153421955G>A	ENST00000369951.4	+	5	991	c.931G>A	c.(931-933)Gcc>Acc	p.A311T		NM_020061.4	NP_064445.2	P04000	OPSR_HUMAN	opsin 1 (cone pigments), long-wave-sensitive	311					phototransduction, visible light (GO:0007603)|positive regulation of cytokinesis (GO:0032467)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	15	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGCCTACTTTGCCAAAAGTGC	0.537																																																	0								ENSG00000102076						309.0	279.0	289.0					X																	153421955		2195	4273	6468	OPN1LW	SO:0001583	missense	0			-	HGNC	Z68193	CCDS14742.1	Xq28	2013-01-08	2008-04-16		ENSG00000102076	ENSG00000102076		"""GPCR / Class A : Opsin receptors"""	9936	protein-coding gene	gene with protein product	"""cone dystrophy 5 (X-linked)"""	300822	"""color blindness, protan"", ""red cone photoreceptor pigment"""	CBBM, RCP, CBP			Standard	NM_020061		Approved	COD5	uc004fjz.4	P04000	OTTHUMG00000034295	ENST00000369951.4:c.931G>A	X.37:g.153421955G>A	ENSP00000358967:p.Ala311Thr	Somatic	0	33	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11		Missense_Mutation	SNP	8	0.00	0	25	0.00	0	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_7TM,prints_Opsin_red/grn,prints_GPCR_Rhodpsn,prints_Opsin	p.A311T	ENST00000369951.4	37	c.931	CCDS14742.1	X	.	.	.	.	.	.	.	.	.	.	G	20.3	3.968814	0.74131	.	.	ENSG00000102076	ENST00000369951	T	0.39229	1.09	4.57	3.63	0.41609	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.67239	0.2872	M	0.90595	3.13	0.54753	D	0.999988	D	0.89917	1.0	D	0.97110	1.0	T	0.73357	-0.4008	10	0.87932	D	0	.	10.1068	0.42539	0.0:0.0:0.6687:0.3313	.	311	P04000	OPSR_HUMAN	T	311	ENSP00000358967:A311T	ENSP00000358967:A311T	A	+	1	0	OPN1LW	153075149	0.974000	0.33945	1.000000	0.80357	0.981000	0.71138	0.666000	0.25097	1.989000	0.58080	0.436000	0.28706	GCC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Opsin		0.537	OPN1LW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPN1LW	protein_coding	OTTHUMT00000082839.2	G	NM_020061	-		153421955	+1	no_errors	ENST00000369951	ensembl	human	known	74_37	missense	SNP	1.000	A
A2ML1	144568	genome.wustl.edu	37	12	8990042	8990080	+	In_Frame_Del	DEL	CTATGGAAAGCCCATGCTAGGGGCAGTGCAGGTATCTGT	CTATGGAAAGCCCATGCTAGGGGCAGTGCAGGTATCTGT	-	rs377672586		TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	CTATGGAAAGCCCATGCTAGGGGCAGTGCAGGTATCTGT	CTATGGAAAGCCCATGCTAGGGGCAGTGCAGGTATCTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr12:8990042_8990080delCTATGGAAAGCCCATGCTAGGGGCAGTGCAGGTATCTGT	ENST00000299698.7	+	8	915_953	c.735_773delCTATGGAAAGCCCATGCTAGGGGCAGTGCAGGTATCTGT	c.(733-774)acctatggaaagcccatgctaggggcagtgcaggtatctgtg>acg	p.YGKPMLGAVQVSV246del		NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1									p.G252V(1)		NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						TTAGGTACACCTATGGAAAGCCCATGCTAGGGGCAGTGCAGGTATCTGTGTGTCAGAAG	0.481																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000166535																																			A2ML1	SO:0001651	inframe_deletion	0				HGNC	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.735_773delCTATGGAAAGCCCATGCTAGGGGCAGTGCAGGTATCTGT	12.37:g.8990042_8990080delCTATGGAAAGCCCATGCTAGGGGCAGTGCAGGTATCTGT	ENSP00000299698:p.Tyr246_Val258del	Somatic	NA	NA	NA		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Del	DEL	29	0.00	0	31	3.12	1	pfam_A2M_comp,pfam_Macroglobln_a2,pfam_A2M_N_2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.YGKPMLGAVQVSV246in_frame_del	ENST00000299698.7	37	c.735_773	CCDS8596.2	12																																																																																			-	NULL		0.481	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2ML1	protein_coding	OTTHUMT00000250304.3	CTATGGAAAGCCCATGCTAGGGGCAGTGCAGGTATCTGT	NM_144670			8990080	+1	no_errors	ENST00000299698	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:0.997:1.000:1.000:0.996:1.000:0.999:0.989:0.984:0.951:0.052:0.001:0.007:0.005:0.002:0.000:0.000:0.079:0.077:0.033:0.004:0.002:0.001:0.031:0.026:0.019:0.017:0.008:0.006:0.038:0.032:0.003:0.009:0.009:0.000:0.154:0.178	-
CDKN1A	1026	genome.wustl.edu	37	6	36651975	36651975	+	Missense_Mutation	SNP	G	G	A	rs376481017		TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr6:36651975G>A	ENST00000405375.1	+	2	332	c.97G>A	c.(97-99)Gac>Aac	p.D33N	CDKN1A_ENST00000478800.1_3'UTR|CDKN1A_ENST00000373711.2_Missense_Mutation_p.D33N|CDKN1A_ENST00000448526.2_Missense_Mutation_p.D67N|CDKN1A_ENST00000244741.5_Missense_Mutation_p.D33N	NM_001220778.1	NP_001207707.1	P38936	CDN1A_HUMAN	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	33					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to ionizing radiation (GO:0071479)|cellular senescence (GO:0090398)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of gene expression (GO:0010629)|negative regulation of phosphorylation (GO:0042326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of DNA biosynthetic process (GO:2000278)|regulation of protein import into nucleus, translocation (GO:0033158)|response to arsenic-containing substance (GO:0046685)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to hyperoxia (GO:0055093)|response to organonitrogen compound (GO:0010243)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|stress-induced premature senescence (GO:0090400)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA-p21 complex (GO:0070557)	cyclin-dependent protein kinase activating kinase activity (GO:0019912)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|urinary_tract(5)	15						GCTGAGCCGCGACTGTGATGC	0.647																																																	0								ENSG00000124762						41.0	38.0	39.0					6																	36651975		2203	4300	6503	CDKN1A	SO:0001583	missense	0			-	HGNC	U03106	CCDS4824.1	6p21.1	2009-01-21			ENSG00000124762	ENSG00000124762			1784	protein-coding gene	gene with protein product		116899		CDKN1			Standard	NM_000389		Approved	P21, CIP1, WAF1, SDI1, CAP20, p21CIP1, p21Cip1/Waf1	uc021yzb.1	P38936	OTTHUMG00000014603	ENST00000405375.1:c.97G>A	6.37:g.36651975G>A	ENSP00000384849:p.Asp33Asn	Somatic	0	70	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	54	25.00	Q14010|Q6FI05|Q9BUT4	Missense_Mutation	SNP	27	0.00	0	33	25.00	11	pfam_CDI	p.D67N	ENST00000405375.1	37	c.199	CCDS4824.1	6	.	.	.	.	.	.	.	.	.	.	G	19.08	3.757731	0.69648	.	.	ENSG00000124762	ENST00000448526;ENST00000244741;ENST00000405375;ENST00000373711	D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99	5.06	5.06	0.68205	.	0.000000	0.56097	D	0.000030	D	0.89584	0.6757	M	0.80616	2.505	0.45554	D	0.998507	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.99;0.994;0.978	D	0.87010	0.2122	10	0.23302	T	0.38	-38.2672	13.8081	0.63246	0.0:0.0:1.0:0.0	.	67;33;33	B4DQP9;P38936;Q96LE1	.;CDN1A_HUMAN;.	N	67;33;33;33	ENSP00000409259:D67N;ENSP00000244741:D33N;ENSP00000384849:D33N;ENSP00000362815:D33N	ENSP00000244741:D33N	D	+	1	0	CDKN1A	36759953	1.000000	0.71417	0.907000	0.35723	0.062000	0.15995	6.535000	0.73838	2.642000	0.89623	0.561000	0.74099	GAC	-	pfam_CDI		0.647	CDKN1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKN1A	protein_coding	OTTHUMT00000040354.1	G	NM_078467	-		36651975	+1	no_errors	ENST00000448526	ensembl	human	known	74_37	missense	SNP	0.959	A
GCNT3	9245	genome.wustl.edu	37	15	59911094	59911094	+	Silent	SNP	G	G	A	rs200140304		TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr15:59911094G>A	ENST00000396065.1	+	3	1105	c.657G>A	c.(655-657)ccG>ccA	p.P219P	GCNT3_ENST00000560585.1_Silent_p.P219P	NM_004751.2	NP_004742.1	O95395	GCNT3_HUMAN	glucosaminyl (N-acetyl) transferase 3, mucin type	219					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|immunoglobulin production in mucosal tissue (GO:0002426)|intestinal absorption (GO:0050892)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|tissue morphogenesis (GO:0048729)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0047225)|beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GCTCAGTGCCGTGGAAATACT	0.502													G|||	1	0.000199681	0.0	0.0	5008	,	,		20355	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000140297	G		0,4380		0,0,2190	132.0	128.0	129.0		657	-12.3	0.0	15		129	1,8579	1.2+/-3.3	0,1,4289	no	coding-synonymous	GCNT3	NM_004751.2		0,1,6479	AA,AG,GG		0.0117,0.0,0.0077		219/439	59911094	1,12959	2190	4290	6480	GCNT3	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	AF102542	CCDS10172.1	15q22	2013-02-25			ENSG00000140297	ENSG00000140297	2.4.1.102, 2.4.1.150	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4205	protein-coding gene	gene with protein product		606836				9915862, 9988682	Standard	NM_004751		Approved	C2GnT-M, C2/4GnT, C2GnT2	uc002age.3	O95395	OTTHUMG00000132726	ENST00000396065.1:c.657G>A	15.37:g.59911094G>A		Somatic	0	52	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	28	31.71		Silent	SNP	29	0.00	0	44	25.42	15	pfam_Glyco_trans_14	p.P219	ENST00000396065.1	37	c.657	CCDS10172.1	15																																																																																			-	pfam_Glyco_trans_14		0.502	GCNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCNT3	protein_coding	OTTHUMT00000256068.1	G	NM_004751	rs200140304		59911094	+1	no_errors	ENST00000396065	ensembl	human	known	74_37	silent	SNP	0.000	A
PRUNE2	158471	genome.wustl.edu	37	9	79326018	79326018	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr9:79326018G>A	ENST00000376718.3	-	8	1295	c.1172C>T	c.(1171-1173)tCt>tTt	p.S391F	PRUNE2_ENST00000428286.1_Missense_Mutation_p.S32F	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	391					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						CTCTATGTCAGAACCATACAA	0.512																																																	0								ENSG00000106772						43.0	39.0	40.0					9																	79326018		1568	3582	5150	PRUNE2	SO:0001583	missense	0			-	HGNC	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.1172C>T	9.37:g.79326018G>A	ENSP00000365908:p.Ser391Phe	Somatic	0	44	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	42	36.36	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	29	0.00	0	60	36.84	35	pfam_Bcl2-/adenovirus-E1B,pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	p.S32F	ENST00000376718.3	37	c.95	CCDS47982.1	9	.	.	.	.	.	.	.	.	.	.	G	15.58	2.875982	0.51695	.	.	ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033	T;T	0.68331	-0.32;-0.29	5.84	5.84	0.93424	.	0.000000	0.53938	D	0.000052	T	0.77267	0.4105	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78201	-0.2296	10	0.87932	D	0	-14.0842	20.1379	0.98040	0.0:0.0:1.0:0.0	.	391	Q8WUY3	PRUN2_HUMAN	F	391;32;390	ENSP00000365908:S391F;ENSP00000397425:S32F	ENSP00000365908:S391F	S	-	2	0	PRUNE2	78515838	1.000000	0.71417	1.000000	0.80357	0.244000	0.25665	8.855000	0.92236	2.779000	0.95612	0.655000	0.94253	TCT	-	NULL		0.512	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	PRUNE2	protein_coding	OTTHUMT00000052730.2	G	NM_138818	-		79326018	-1	no_errors	ENST00000428286	ensembl	human	known	74_37	missense	SNP	1.000	A
OR1J2	26740	genome.wustl.edu	37	9	125273445	125273445	+	Missense_Mutation	SNP	G	G	A	rs372492437		TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr9:125273445G>A	ENST00000335302.5	+	1	365	c.365G>A	c.(364-366)cGa>cAa	p.R122Q		NM_054107.1	NP_473448.1	Q8NGS2	OR1J2_HUMAN	olfactory receptor, family 1, subfamily J, member 2	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R122L(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(7)|stomach(1)	26						GCATATGACCGATATGTTGCC	0.408													G|||	1	0.000199681	0.0	0.0014	5008	,	,		24907	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	pancreas(1)						ENSG00000197233	G	GLN/ARG	0,4406		0,0,2203	186.0	151.0	163.0		365	3.1	0.0	9		163	1,8599	1.2+/-3.3	0,1,4299	no	missense	OR1J2	NM_054107.1	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	122/314	125273445	1,13005	2203	4300	6503	OR1J2	SO:0001583	missense	0			-	HGNC		CCDS35121.1	9q33.2	2013-09-20			ENSG00000197233	ENSG00000197233		"""GPCR / Class A : Olfactory receptors"""	8209	protein-coding gene	gene with protein product				OR1J3, OR1J5			Standard	XM_005251920		Approved	OST044	uc011lyv.2	Q8NGS2	OTTHUMG00000020604	ENST00000335302.5:c.365G>A	9.37:g.125273445G>A	ENSP00000335575:p.Arg122Gln	Somatic	0	63	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	63	80	44.06	A3KFL9|Q6IF14|Q96R90|Q9NZP1	Missense_Mutation	SNP	34	0.00	0	48	56.36	62	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R122Q	ENST00000335302.5	37	c.365	CCDS35121.1	9	.	.	.	.	.	.	.	.	.	.	G	15.12	2.740198	0.49045	0.0	1.16E-4	ENSG00000197233	ENST00000335302;ENST00000444856	T	0.76968	-1.06	5.02	3.11	0.35812	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36002	U	0.002860	D	0.89434	0.6714	M	0.93241	3.395	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81106	-0.1083	10	0.72032	D	0.01	.	10.2558	0.43397	0.1725:0.0:0.8275:0.0	.	122	Q8NGS2	OR1J2_HUMAN	Q	122	ENSP00000335575:R122Q	ENSP00000335575:R122Q	R	+	2	0	OR1J2	124313266	0.632000	0.27172	0.002000	0.10522	0.021000	0.10359	3.814000	0.55643	1.339000	0.45563	0.650000	0.86243	CGA	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.408	OR1J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1J2	protein_coding	OTTHUMT00000053932.1	G		-		125273445	+1	no_errors	ENST00000335302	ensembl	human	known	74_37	missense	SNP	0.037	A
L1TD1	54596	genome.wustl.edu	37	1	62672499	62672499	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr1:62672499G>A	ENST00000498273.1	+	3	494	c.199G>A	c.(199-201)Gag>Aag	p.E67K		NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	67										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						cctgatgtttgaggagatgag	0.368																																																	0								ENSG00000240563						25.0	25.0	25.0					1																	62672499		2199	4297	6496	L1TD1	SO:0001583	missense	0			-	HGNC	BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.199G>A	1.37:g.62672499G>A	ENSP00000419901:p.Glu67Lys	Somatic	0	15	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	19	52.50	Q8NDA1|Q9NUV8|Q9NV78	Missense_Mutation	SNP	34	0.00	0	60	58.90	86	pfam_Transposase_22,superfamily_STAT_TF_coiled-coil	p.E67K	ENST00000498273.1	37	c.199	CCDS619.1	1	.	.	.	.	.	.	.	.	.	.	G	17.32	3.360379	0.61403	.	.	ENSG00000240563	ENST00000498273	T	0.10960	2.82	2.21	0.117	0.14652	.	.	.	.	.	T	0.07728	0.0194	N	0.24115	0.695	0.09310	N	1	P	0.41232	0.743	B	0.43783	0.431	T	0.37572	-0.9700	9	0.19590	T	0.45	.	6.4692	0.21999	0.0:0.0:0.4792:0.5208	.	67	Q5T7N2	LITD1_HUMAN	K	67	ENSP00000419901:E67K	ENSP00000419901:E67K	E	+	1	0	L1TD1	62445087	0.010000	0.17322	0.003000	0.11579	0.553000	0.35397	0.291000	0.18994	0.042000	0.15717	0.313000	0.20887	GAG	-	NULL		0.368	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L1TD1	protein_coding	OTTHUMT00000024688.1	G	NM_019079	-		62672499	+1	no_errors	ENST00000498273	ensembl	human	known	74_37	missense	SNP	0.004	A
C15orf48	84419	genome.wustl.edu	37	15	45724279	45724279	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr15:45724279delA	ENST00000344300.3	+	3	322	c.132delA	c.(130-132)cgafs	p.R44fs	C15orf48_ENST00000396650.2_Frame_Shift_Del_p.R44fs|MIR147B_ENST00000390185.1_RNA|RP11-519G16.5_ENST00000559553.1_RNA	NM_032413.3	NP_115789.1	Q9C002	NMES1_HUMAN	chromosome 15 open reading frame 48	44						mitochondrion (GO:0005739)|nucleus (GO:0005634)				large_intestine(1)|lung(2)|ovary(1)	4		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.67e-16)|GBM - Glioblastoma multiforme(94;1.71e-06)		GCCTTGATCGAAAAAAAAATC	0.318																																																	0								ENSG00000166920						109.0	107.0	107.0					15																	45724279		2198	4298	6496	C15orf48	SO:0001589	frameshift_variant	0				HGNC		CCDS10124.1	15q21.1	2014-05-29			ENSG00000166920	ENSG00000166920			29898	protein-coding gene	gene with protein product	"""normal mucosa of esophagus specific 1"""	608409				12209954	Standard	NM_032413		Approved	NMES1	uc001zvh.4	Q9C002	OTTHUMG00000131424	ENST00000344300.3:c.132delA	15.37:g.45724279delA	ENSP00000341610:p.Arg44fs	Somatic	0	41	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	37	11.90		Frame_Shift_Del	DEL	49	0.00	0	64	1.54	1	NULL	p.N47fs	ENST00000344300.3	37	c.132	CCDS10124.1	15																																																																																			-	NULL		0.318	C15orf48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf48	protein_coding	OTTHUMT00000254217.2	A	NM_032413			45724279	+1	no_errors	ENST00000344300	ensembl	human	known	74_37	frame_shift_del	DEL	0.693	-
PREX2	80243	genome.wustl.edu	37	8	69104676	69104676	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr8:69104676G>T	ENST00000288368.4	+	37	4797	c.4520G>T	c.(4519-4521)gGg>gTg	p.G1507V		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1507					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AGTGCTTCTGGGGTTGGACTG	0.567																																																	0								ENSG00000046889						75.0	61.0	66.0					8																	69104676		2203	4300	6503	PREX2	SO:0001583	missense	0			-	HGNC	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.4520G>T	8.37:g.69104676G>T	ENSP00000288368:p.Gly1507Val	Somatic	0	43	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	27	22.86	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	25	0.00	0	26	25.71	9	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.G1507V	ENST00000288368.4	37	c.4520	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	G	25.2	4.617642	0.87359	.	.	ENSG00000046889	ENST00000288368	T	0.60920	0.15	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.75671	0.3881	M	0.69823	2.125	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.79082	-0.1949	10	0.87932	D	0	.	18.4181	0.90577	0.0:0.0:1.0:0.0	.	1507	Q70Z35	PREX2_HUMAN	V	1507	ENSP00000288368:G1507V	ENSP00000288368:G1507V	G	+	2	0	PREX2	69267230	1.000000	0.71417	0.673000	0.29887	0.885000	0.51271	9.277000	0.95755	2.427000	0.82271	0.467000	0.42956	GGG	-	NULL		0.567	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	protein_coding	OTTHUMT00000378620.1	G	NM_025170	-		69104676	+1	no_errors	ENST00000288368	ensembl	human	known	74_37	missense	SNP	0.999	T
WNK2	65268	genome.wustl.edu	37	9	96009927	96009927	+	Missense_Mutation	SNP	G	G	A	rs368902215		TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr9:96009927G>A	ENST00000297954.4	+	7	1645	c.1645G>A	c.(1645-1647)Gcg>Acg	p.A549T	WNK2_ENST00000356055.3_5'UTR|WNK2_ENST00000349097.3_Missense_Mutation_p.A161T|WNK2_ENST00000395477.2_Missense_Mutation_p.A549T|WNK2_ENST00000395475.2_Missense_Mutation_p.A535T|WNK2_ENST00000427277.2_Missense_Mutation_p.A161T	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	549					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						GATCTGGCCCGCGCTGCAGCC	0.657																																																	0								ENSG00000165238	G	THR/ALA	0,4398		0,0,2199	23.0	18.0	19.0		1645	3.3	0.0	9		19	1,8597		0,1,4298	no	missense	WNK2	NM_006648.3	58	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	549/2218	96009927	1,12995	2199	4299	6498	WNK2	SO:0001583	missense	0			-	HGNC	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.1645G>A	9.37:g.96009927G>A	ENSP00000297954:p.Ala549Thr	Somatic	0	54	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	66	15.19	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	17	0.00	0	58	14.71	10	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A549T	ENST00000297954.4	37	c.1645		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.93|12.93	2.085619|2.085619	0.36758|0.36758	0.0|0.0	1.16E-4|1.16E-4	ENSG00000165238|ENSG00000165238	ENST00000448039;ENST00000297954;ENST00000395477;ENST00000395475;ENST00000349097;ENST00000427277|ENST00000411624	T;T;T;T;T;T|.	0.71579|.	-0.58;-0.44;-0.43;-0.57;0.13;0.14|.	5.39|5.39	3.27|3.27	0.37495|0.37495	.|.	0.878523|.	0.10170|.	N|.	0.707293|.	T|T	0.49558|0.49558	0.1564|0.1564	M|M	0.69823|0.69823	2.125|2.125	0.20975|0.20975	N|N	0.999819|0.999819	D;P;D;D;D|.	0.61080|.	0.989;0.876;0.981;0.989;0.981|.	B;B;B;B;B|.	0.42245|.	0.381;0.308;0.32;0.381;0.32|.	T|T	0.37033|0.37033	-0.9723|-0.9723	10|5	0.27082|.	T|.	0.32|.	.|.	8.3379|8.3379	0.32225|0.32225	0.1219:0.1645:0.7136:0.0|0.1219:0.1645:0.7136:0.0	.|.	549;549;152;549;549|.	Q9Y3S1-2;Q9Y3S1-4;A6PVR4;F8W9F9;Q9Y3S1|.	.;.;.;.;WNK2_HUMAN|.	T|H	549;549;549;535;161;161|152	ENSP00000412465:A549T;ENSP00000297954:A549T;ENSP00000378860:A549T;ENSP00000378858:A535T;ENSP00000297876:A161T;ENSP00000411181:A161T|.	ENSP00000297954:A549T|.	A|R	+|+	1|2	0|0	WNK2|WNK2	95049748|95049748	0.011000|0.011000	0.17503|0.17503	0.046000|0.046000	0.18839|0.18839	0.735000|0.735000	0.41995|0.41995	1.757000|1.757000	0.38400|0.38400	2.545000|2.545000	0.85829|0.85829	0.549000|0.549000	0.68633|0.68633	GCG|CGC	-	NULL		0.657	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	WNK2	protein_coding	OTTHUMT00000317359.1	G	NM_006648	-		96009927	+1	no_errors	ENST00000297954	ensembl	human	known	74_37	missense	SNP	0.002	A
THBS4	7060	genome.wustl.edu	37	5	79355569	79355569	+	Silent	SNP	C	C	T	rs200566165		TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr5:79355569C>T	ENST00000350881.2	+	7	1018	c.828C>T	c.(826-828)ccC>ccT	p.P276P	THBS4_ENST00000511733.1_Silent_p.P185P|CTD-2201I18.1_ENST00000503007.1_RNA	NM_003248.4	NP_003239.2	P35443	TSP4_HUMAN	thrombospondin 4	276				P -> A (in Ref. 1; no nucleotide entry and 2; CAA79635). {ECO:0000305}.	behavioral response to pain (GO:0048266)|endothelial cell-cell adhesion (GO:0071603)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of tissue remodeling (GO:0034103)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|tissue remodeling (GO:0048771)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)|integrin binding (GO:0005178)			breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|stomach(3)	34		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		CGGTGGTGCCCCCGGCTCCCC	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		19192	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000113296						123.0	123.0	123.0					5																	79355569		2203	4300	6503	THBS4	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC		CCDS4049.1	5q13	2008-05-15			ENSG00000113296	ENSG00000113296			11788	protein-coding gene	gene with protein product		600715				7852353	Standard	NM_003248		Approved		uc021yaw.1	P35443	OTTHUMG00000108173	ENST00000350881.2:c.828C>T	5.37:g.79355569C>T		Somatic	0	28	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	36	21.74	B2R909|Q86TG2	Silent	SNP	22	0.00	0	35	30.00	15	pfam_Thrombospondin_C,pfam_Thbs/COMP_coiled-coil,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.P276	ENST00000350881.2	37	c.828	CCDS4049.1	5																																																																																			-	NULL		0.567	THBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS4	protein_coding	OTTHUMT00000226977.1	C		rs200566165		79355569	+1	no_errors	ENST00000350881	ensembl	human	known	74_37	silent	SNP	0.009	T
TOX3	27324	genome.wustl.edu	37	16	52473155	52473155	+	Silent	SNP	C	C	T			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr16:52473155C>T	ENST00000219746.9	-	7	1997	c.1713G>A	c.(1711-1713)tcG>tcA	p.S571S	TOX3_ENST00000407228.3_Silent_p.S566S	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	571	Gln-rich.				apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)			NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						TACTGACCTGCGATAATACTT	0.507																																																	0								ENSG00000103460						46.0	46.0	46.0					16																	52473155		2000	4189	6189	TOX3	SO:0001819	synonymous_variant	0			-	HGNC	U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.1713G>A	16.37:g.52473155C>T		Somatic	0	39	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	41	19.61	B4DRD0|B5MCW4	Silent	SNP	28	0.00	0	38	22.45	11	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.S571	ENST00000219746.9	37	c.1713	CCDS54009.1	16																																																																																			-	NULL		0.507	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TOX3	protein_coding	OTTHUMT00000422534.1	C	XM_049037	-		52473155	-1	no_errors	ENST00000219746	ensembl	human	known	74_37	silent	SNP	0.011	T
ABCF3	55324	genome.wustl.edu	37	3	183906580	183906580	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr3:183906580G>C	ENST00000429586.2	+	8	1053	c.868G>C	c.(868-870)Gaa>Caa	p.E290Q	ABCF3_ENST00000292808.5_Missense_Mutation_p.E284Q|EIF2B5_ENST00000444495.1_Intron	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3	290	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AGAGCTGGCAGAAATCTATGC	0.552																																																	0								ENSG00000161204						68.0	76.0	73.0					3																	183906580		2203	4300	6503	ABCF3	SO:0001583	missense	0			-	HGNC	U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.868G>C	3.37:g.183906580G>C	ENSP00000411471:p.Glu290Gln	Somatic	0	24	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Missense_Mutation	SNP	22	0.00	0	57	0.00	0	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E290Q	ENST00000429586.2	37	c.868	CCDS3254.1	3	.	.	.	.	.	.	.	.	.	.	G	14.04	2.417766	0.42918	.	.	ENSG00000161204	ENST00000429586;ENST00000292808	D;D	0.92805	-3.11;-3.11	5.24	4.36	0.52297	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.89326	0.6683	L	0.37507	1.11	0.80722	D	1	B;P	0.38250	0.235;0.624	B;B	0.42692	0.142;0.395	D	0.87098	0.2177	10	0.33141	T	0.24	-13.9657	14.2818	0.66219	0.0:0.0:0.85:0.15	.	284;290	Q9NUQ8-2;Q9NUQ8	.;ABCF3_HUMAN	Q	290;284	ENSP00000411471:E290Q;ENSP00000292808:E284Q	ENSP00000292808:E284Q	E	+	1	0	ABCF3	185389274	1.000000	0.71417	0.998000	0.56505	0.886000	0.51366	8.924000	0.92827	1.180000	0.42898	0.655000	0.94253	GAA	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.552	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF3	protein_coding	OTTHUMT00000346047.1	G	NM_018358	-		183906580	+1	no_errors	ENST00000429586	ensembl	human	known	74_37	missense	SNP	0.999	C
KRAS	3845	genome.wustl.edu	37	12	25398282	25398282	+	Missense_Mutation	SNP	C	C	A	rs121913535		TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr12:25398282C>A	ENST00000256078.4	-	2	100	c.37G>T	c.(37-39)Ggc>Tgc	p.G13C	KRAS_ENST00000556131.1_Missense_Mutation_p.G13C|KRAS_ENST00000311936.3_Missense_Mutation_p.G13C|KRAS_ENST00000557334.1_Missense_Mutation_p.G13C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	13			G -> D (in a breast carcinoma cell line and GASC; somatic mutation). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:3627975}.|G -> R (in pylocytic astrocytoma; somatic mutation; increase activation of the Ras pathway). {ECO:0000269|PubMed:16247081}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G13C(213)|p.G13S(59)|p.G13R(43)|p.G12_G13insG(3)|p.G13N(1)|p.G13I(1)|p.G12_G13insA(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			TTGCCTACGCCACCAGCTCCA	0.343	G13C(MORCPR_LUNG)|G13C(NCIH1355_LUNG)|G13C(NCIH1734_LUNG)|G13C(TOV21G_OVARY)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)			Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	321	Substitution - Missense(317)|Insertion - In frame(4)	large_intestine(126)|lung(111)|stomach(14)|thyroid(13)|biliary_tract(13)|endometrium(9)|ovary(8)|haematopoietic_and_lymphoid_tissue(5)|pancreas(5)|soft_tissue(4)|upper_aerodigestive_tract(4)|prostate(3)|oesophagus(2)|urinary_tract(1)|salivary_gland(1)|thymus(1)|liver(1)						ENSG00000133703						89.0	79.0	83.0					12																	25398282		2203	4300	6503	KRAS	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	-	HGNC	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.37G>T	12.37:g.25398282C>A	ENSP00000256078:p.Gly13Cys	Somatic	0	22	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	33	13.16	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	39	0.00	0	54	3.57	2	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.G13C	ENST00000256078.4	37	c.37	CCDS8703.1	12	.	.	.	.	.	.	.	.	.	.	C	25.9	4.686065	0.88639	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	D;T;T;T	0.83755	-1.76;-0.81;-0.81;-0.81	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.92740	0.7692	M	0.88640	2.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.981;0.997	D	0.93619	0.6946	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	13;13	P01116-2;P01116	.;RASK_HUMAN	C	13	ENSP00000308495:G13C;ENSP00000452512:G13C;ENSP00000256078:G13C;ENSP00000451856:G13C	ENSP00000256078:G13C	G	-	1	0	KRAS	25289549	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGC	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.343	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KRAS	protein_coding	OTTHUMT00000412232.1	C	NM_033360	rs121913535		25398282	-1	no_errors	ENST00000256078	ensembl	human	known	74_37	missense	SNP	1.000	A
RCVRN	5957	genome.wustl.edu	37	17	9801316	9801317	+	3'UTR	INS	-	-	GTGTGTGC	rs531533066|rs376748693	byFrequency	TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr17:9801316_9801317insGTGTGTGC	ENST00000226193.5	-	0	1138_1139				RCVRN_ENST00000570909.3_5'UTR	NM_002903.2	NP_002894.1	P35243	RECO_HUMAN	recoverin						phototransduction, visible light (GO:0007603)|positive regulation of guanylate cyclase activity (GO:0031284)|regulation of calcium ion transport (GO:0051924)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	dendrite (GO:0030425)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|upper_aerodigestive_tract(1)	12						tgtgtgtgtgtgcgcgcgcgtg	0.589																																																	0								ENSG00000109047																																			RCVRN	SO:0001624	3_prime_UTR_variant	0				HGNC	BC001720	CCDS11151.1	17p13.1	2013-01-10		2006-09-26	ENSG00000109047	ENSG00000109047		"""EF-hand domain containing"""	9937	protein-coding gene	gene with protein product		179618		RCV1		1387789, 12507501, 1467959, 12789533	Standard	NM_002903		Approved		uc002gme.1	P35243	OTTHUMG00000130268	ENST00000226193.5:c.*96->GCACACAC	17.37:g.9801316_9801317insGTGTGTGC		Somatic	NA	NA	NA		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q53XL0	RNA	INS	20	13.04	3	26	7.14	2	-	NULL	ENST00000226193.5	37	NULL	CCDS11151.1	17																																																																																			-	-		0.589	RCVRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCVRN	protein_coding	OTTHUMT00000252600.2	-	NM_002903			9801317	-1	no_errors	ENST00000570909	ensembl	human	putative	74_37	rna	INS	0.000:0.000	GTGTGTGC
MT-ND2	4536	genome.wustl.edu	37	M	2300	2300	+	5'Flank	SNP	G	G	A			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chrM:2300G>A	ENST00000361453.3	+	0	0				MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						AGAAGAACTAATGTTAGTATA	0.388																																																	0								ENSG00000210082																																			MT-RNR2	SO:0001631	upstream_gene_variant	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2300G>A	Exception_encountered	Somatic	0	41	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	28	40.43	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	2194	0.09	2	1853	45.29	1535	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			-	-		0.388	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	protein_coding		G	YP_003024027	-		2300	+1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	SNP	NULL	A
SNAP25	6616	genome.wustl.edu	37	20	10287451	10287452	+	3'UTR	DEL	AC	AC	-	rs145069282	byFrequency	TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr20:10287451_10287452delAC	ENST00000254976.2	+	0	1438_1439				SNAP25-AS1_ENST00000421143.2_RNA|SNAP25_ENST00000304886.2_3'UTR|SNAP25-AS1_ENST00000453544.1_RNA|SNAP25_ENST00000495883.1_3'UTR	NM_130811.2	NP_570824.1	P60880	SNP25_HUMAN	synaptosomal-associated protein, 25kDa						energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long-term synaptic potentiation (GO:0060291)|neurotransmitter secretion (GO:0007269)|neurotransmitter uptake (GO:0001504)|regulation of establishment of protein localization (GO:0070201)|regulation of insulin secretion (GO:0050796)|regulation of neuron projection development (GO:0010975)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|SNARE complex (GO:0031201)|synaptobrevin 2-SNAP-25-syntaxin-1a-complexin I complex (GO:0070032)|trans-Golgi network (GO:0005802)	calcium-dependent protein binding (GO:0048306)			endometrium(1)|large_intestine(2)|lung(8)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	18					Botulinum Toxin Type A(DB00083)	TGATGAGACAACACACACACAC	0.347														16	0.00319489	0.0053	0.0029	5008	,	,		20483	0.002		0.004	False		,,,				2504	0.001																0								ENSG00000132639																																			SNAP25	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS13109.1, CCDS13110.1	20p12-p11.2	2008-08-01	2002-08-29		ENSG00000132639	ENSG00000132639			11132	protein-coding gene	gene with protein product	"""resistance to inhibitors of cholinesterase 4 homolog"""	600322	"""synaptosomal-associated protein, 25kD"""	SNAP		8661740, 10692432	Standard	NM_003081		Approved	SNAP-25, RIC-4, RIC4, SEC9, bA416N4.2, dJ1068F16.2	uc002wnr.2	P60880	OTTHUMG00000031863	ENST00000254976.2:c.*607AC>-	20.37:g.10287461_10287462delAC		Somatic	0	43	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B2RAU4|D3DW16|D3DW17|P13795|P36974|P70557|P70558|Q53EM2|Q5U0B5|Q8IXK3|Q96FM2|Q9BR45	RNA	DEL	27	6.90	2	68	1.45	1	-	NULL	ENST00000254976.2	37	NULL	CCDS13110.1	20																																																																																			-	-		0.347	SNAP25-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SNAP25	protein_coding	OTTHUMT00000077976.3	AC	NM_130811			10287452	+1	no_errors	ENST00000495883	ensembl	human	known	74_37	rna	DEL	0.884:0.856	-
CLCNKA	1187	genome.wustl.edu	37	1	16360144	16360144	+	Silent	SNP	T	T	C	rs371202740		TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr1:16360144T>C	ENST00000331433.4	+	20	2074	c.2055T>C	c.(2053-2055)gcT>gcC	p.A685A	CLCNKA_ENST00000420078.1_Silent_p.A684A|CLCNKA_ENST00000375692.1_Silent_p.A684A|CLCNKA_ENST00000464764.1_3'UTR|CLCNKA_ENST00000439316.2_Silent_p.A642A			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka	685					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	ATCCGCCAGCTCCAAAGTGAG	0.582																																																	0								ENSG00000186510						82.0	81.0	82.0					1																	16360144		2202	4300	6502	CLCNKA	SO:0001819	synonymous_variant	0			-	HGNC		CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	ENST00000331433.4:c.2055T>C	1.37:g.16360144T>C		Somatic	0	42	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	44	12.00	B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	Silent	SNP	33	0.00	0	45	4.26	2	pfam_Cl-channel_volt-gated,pfam_CBS_dom,superfamily_Cl-channel_core,smart_CBS_dom,prints_Cl-channel_volt-gated,prints_Cl_channel-K	p.A685	ENST00000331433.4	37	c.2055	CCDS167.1	1																																																																																			-	NULL		0.582	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLCNKA	protein_coding	OTTHUMT00000026326.1	T		-		16360144	+1	no_errors	ENST00000331433	ensembl	human	known	74_37	silent	SNP	0.903	C
L1TD1	54596	genome.wustl.edu	37	1	62672847	62672847	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr1:62672847G>A	ENST00000498273.1	+	3	842	c.547G>A	c.(547-549)Gac>Aac	p.D183N		NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	183										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						caatatagatgacagagatgg	0.368																																																	0								ENSG00000240563						19.0	19.0	19.0					1																	62672847		2135	4168	6303	L1TD1	SO:0001583	missense	0			-	HGNC	BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.547G>A	1.37:g.62672847G>A	ENSP00000419901:p.Asp183Asn	Somatic	0	24	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	26	54.39	Q8NDA1|Q9NUV8|Q9NV78	Missense_Mutation	SNP	46	0.00	0	64	59.49	94	pfam_Transposase_22,superfamily_STAT_TF_coiled-coil	p.D183N	ENST00000498273.1	37	c.547	CCDS619.1	1	.	.	.	.	.	.	.	.	.	.	G	9.584	1.124436	0.20959	.	.	ENSG00000240563	ENST00000498273	T	0.14266	2.52	2.03	1.11	0.20524	.	.	.	.	.	T	0.05273	0.0140	N	0.12182	0.205	0.09310	N	1	B	0.22909	0.077	B	0.19148	0.024	T	0.42172	-0.9467	9	0.05959	T	0.93	.	4.5029	0.11872	0.195:0.0:0.805:0.0	.	183	Q5T7N2	LITD1_HUMAN	N	183	ENSP00000419901:D183N	ENSP00000419901:D183N	D	+	1	0	L1TD1	62445435	0.000000	0.05858	0.002000	0.10522	0.036000	0.12997	-0.062000	0.11674	0.440000	0.26502	0.313000	0.20887	GAC	-	NULL		0.368	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L1TD1	protein_coding	OTTHUMT00000024688.1	G	NM_019079	-		62672847	+1	no_errors	ENST00000498273	ensembl	human	known	74_37	missense	SNP	0.002	A
RNF212	285498	genome.wustl.edu	37	4	1087327	1087328	+	Intron	INS	-	-	CTGCCCAGGCTGGAGCCAGCC	rs376912904|rs386670461|rs142232513|rs539986150|rs138488801	byFrequency	TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr4:1087327_1087328insCTGCCCAGGCTGGAGCCAGCC	ENST00000433731.2	-	4	308				RNF212_ENST00000333673.5_In_Frame_Ins_p.241_241S>WLAPAWAA|RNF212_ENST00000382968.5_Intron			Q495C1	RN212_HUMAN	ring finger protein 212						chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		CAGAGCCTGTGACCTCCACGGC	0.619																																																	0								ENSG00000178222																																			RNF212	SO:0001627	intron_variant	0				HGNC	AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.247-2701->GGCTGGCTCCAGCCTGGGCAG	4.37:g.1087327_1087328insCTGCCCAGGCTGGAGCCAGCC		Somatic	NA	NA	NA		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	In_Frame_Ins	INS	13	7.14	1	33	21.43	9	pfscan_Znf_RING	p.S241in_frame_insWLAPAWAA	ENST00000433731.2	37	c.722_721	CCDS46996.1	4																																																																																			-	NULL		0.619	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF212	protein_coding	OTTHUMT00000359124.2	-	NM_194439			1087328	-1	no_errors	ENST00000333673	ensembl	human	known	74_37	in_frame_ins	INS	0.085:0.000	CTGCCCAGGCTGGAGCCAGCC
ZDHHC11	79844	genome.wustl.edu	37	5	712139	712139	+	Intron	SNP	T	T	A	rs111351502	byFrequency	TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr5:712139T>A	ENST00000424784.2	-	14	1931				ZDHHC11B_ENST00000508859.2_3'UTR|ZDHHC11B_ENST00000522356.1_5'UTR			Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			GCAGCCCATCTTCCTGGAGAT	0.562													t|||	2442	0.48762	0.5522	0.4683	5008	,	,		24038	0.5248		0.4911	False		,,,				2504	0.3722																0								ENSG00000206077																																			ZDHHC11B	SO:0001627	intron_variant	0			-	HGNC	AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000424784.2:c.1237-1140A>T	5.37:g.712139T>A		Somatic	0	19	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53	Q6UWR9	RNA	SNP	9	30.77	4	16	11.11	2	-	NULL	ENST00000424784.2	37	NULL	CCDS3857.1	5																																																																																			-	-		0.562	ZDHHC11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC11B	protein_coding		T	NM_024786	rs111351502		712139	-1	no_errors	ENST00000522356	ensembl	human	known	74_37	rna	SNP	0.000	A
C12orf56	115749	genome.wustl.edu	37	12	64706514	64706514	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr12:64706514C>G	ENST00000543942.2	-	5	1539	c.913G>C	c.(913-915)Gat>Cat	p.D305H	RPS11P6_ENST00000535684.1_RNA|C12orf56_ENST00000333722.5_Intron	NM_001170633.1	NP_001164104.1	Q8IXR9	CL056_HUMAN	chromosome 12 open reading frame 56	305										NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)	15			GBM - Glioblastoma multiforme(3;0.000582)	GBM - Glioblastoma multiforme(28;0.0259)		TAGAAGGGATCTTGTAAAAGA	0.338																																																	0								ENSG00000185306						156.0	138.0	143.0					12																	64706514		692	1591	2283	C12orf56	SO:0001583	missense	0			-	HGNC		CCDS44935.1, CCDS61182.1	12q14.2	2012-08-15			ENSG00000185306	ENSG00000185306			26967	protein-coding gene	gene with protein product							Standard	NM_001099676		Approved		uc021qzu.1	Q8IXR9	OTTHUMG00000168782	ENST00000543942.2:c.913G>C	12.37:g.64706514C>G	ENSP00000446101:p.Asp305His	Somatic	0	15	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	23	20.69		Missense_Mutation	SNP	26	0.00	0	60	42.86	45	NULL	p.D305H	ENST00000543942.2	37	c.913		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.487|7.487	0.649774|0.649774	0.14516|0.14516	.|.	.|.	ENSG00000185306|ENSG00000185306	ENST00000433716|ENST00000543942;ENST00000543259	.|.	.|.	.|.	4.87|4.87	4.87|4.87	0.63330|0.63330	.|.	.|.	.|.	.|.	.|.	T|T	0.59473|0.59473	0.2196|0.2196	M|M	0.71581|0.71581	2.175|2.175	0.25264|0.25264	N|N	0.989578|0.989578	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.53507|0.53507	-0.8429|-0.8429	5|5	.|.	.|.	.|.	.|.	13.7156|13.7156	0.62693|0.62693	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	H|N	308|303;156	.|.	.|.	D|K	-|-	1|3	0|2	C12orf56|C12orf56	62992781|62992781	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.408000|0.408000	0.30992|0.30992	3.182000|3.182000	0.50910|0.50910	2.695000|2.695000	0.91970|0.91970	0.655000|0.655000	0.94253|0.94253	GAT|AAG	-	NULL		0.338	C12orf56-008	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf56	protein_coding	OTTHUMT00000401058.2	C	NM_001099676	-		64706514	-1	no_errors	ENST00000543942	ensembl	human	putative	74_37	missense	SNP	1.000	G
BDNF	627	genome.wustl.edu	37	11	27681176	27681177	+	5'UTR	INS	-	-	TGTGTG	rs149254890|rs397725548|rs28722151	byFrequency	TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr11:27681176_27681177insTGTGTG	ENST00000525528.1	-	0	28_29				BDNF_ENST00000533246.1_Intron|BDNF_ENST00000395983.3_Intron|BDNF_ENST00000395986.2_Intron|BDNF-AS_ENST00000502161.2_RNA|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000395980.2_Intron|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000395981.3_Intron|BDNF_ENST00000314915.6_Intron|BDNF_ENST00000439476.2_5'UTR|BDNF_ENST00000533131.1_Intron|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000418212.1_Intron|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000395978.3_Intron|BDNF_ENST00000420794.1_Intron|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000530861.1_Intron|BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000525950.1_Intron|BDNF_ENST00000532997.1_Intron|BDNF-AS_ENST00000501176.2_RNA|BDNF_ENST00000438929.1_Intron|BDNF_ENST00000356660.4_Intron|BDNF_ENST00000584049.1_Intron	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor						axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						GATGTTCTCTCtgtgtgtgtgt	0.446																																																	0								ENSG00000245573																																			BDNF-AS	SO:0001623	5_prime_UTR_variant	0				HGNC	AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.-1066->CACACA	11.37:g.27681177_27681182dupTGTGTG		Somatic	NA	NA	NA		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	RNA	INS	18	21.74	5	49	14.04	8	-	NULL	ENST00000525528.1	37	NULL	CCDS7866.1	11																																																																																			-	-		0.446	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BDNF-AS	protein_coding	OTTHUMT00000388135.1	-	NM_170735			27681177	+1	no_errors	ENST00000530313	ensembl	human	known	74_37	rna	INS	0.003:0.002	TGTGTG
AAK1	22848	genome.wustl.edu	37	2	69685840	69685841	+	IGR	DEL	CA	CA	-	rs550880792|rs542320825|rs142247580		TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr2:69685840_69685841delCA	ENST00000409068.1	-	0	2606				RP11-427H3.3_ENST00000606389.2_lincRNA			Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1						endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						GATGAATGAGcacacacacaca	0.421																																																	0								ENSG00000188971																																			RP11-427H3.3	SO:0001628	intergenic_variant	0				Clone_based_vega_gene	AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648		2.37:g.69685850_69685851delCA		Somatic	0	34	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	30	21.05	Q4ZFZ3|Q53RX6|Q9UPV4	RNA	DEL	36	0.00	0	42	4.55	2	-	NULL	ENST00000409068.1	37	NULL		2																																																																																			-	-		0.421	AAK1-011	PUTATIVE	basic	protein_coding	ENSG00000188971	protein_coding	OTTHUMT00000333994.1	CA	NM_014911			69685841	-1	no_errors	ENST00000606389	ensembl	human	known	74_37	rna	DEL	0.000:0.000	-
U1	0	genome.wustl.edu	37	1	17198851	17198851	+	lincRNA	SNP	G	G	C	rs7364841	byFrequency	TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr1:17198851G>C	ENST00000362684.1	+	0	0																											AGCTGCGGCCGGGTCGCTGCA	0.652																																																	0								ENSG00000228549																																			U1			0			-	RFAM																													1.37:g.17198851G>C		Somatic	0	12	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	25	19.35		RNA	SNP	66	12.00	9	112	15.79	21	-	NULL	ENST00000362684.1	37	NULL		1																																																																																			-	-		0.652	U1.1-201	KNOWN	basic	snRNA	LOC101927806	lincRNA		G		rs7364841		17198851	+1	no_errors	ENST00000438002	ensembl	human	known	74_37	rna	SNP	0.001	C
RSPRY1	89970	genome.wustl.edu	37	16	57261275	57261275	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr16:57261275G>A	ENST00000537866.1	+	11	2056	c.1183G>A	c.(1183-1185)Gat>Aat	p.D395N	RSPRY1_ENST00000394420.4_Missense_Mutation_p.D395N|RSPRY1_ENST00000563073.1_3'UTR			Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	395	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					extracellular region (GO:0005576)	zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|urinary_tract(3)	27						CATTGGGGATGATGAATACTC	0.502																																																	0								ENSG00000159579						134.0	104.0	114.0					16																	57261275		2198	4300	6498	RSPRY1	SO:0001583	missense	0			-	HGNC	AB075852	CCDS10775.1	16q13	2014-02-12			ENSG00000159579	ENSG00000159579		"""RING-type (C3HC4) zinc fingers"""	29420	protein-coding gene	gene with protein product						11853319	Standard	NM_133368		Approved	KIAA1972	uc002elb.3	Q96DX4	OTTHUMG00000133462	ENST00000537866.1:c.1183G>A	16.37:g.57261275G>A	ENSP00000443176:p.Asp395Asn	Somatic	0	32	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	33	13.16	Q6UX21|Q8ND53	Missense_Mutation	SNP	33	0.00	0	27	41.30	19	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_Znf_RING,pfscan_B30.2/SPRY,pfscan_Znf_RING	p.D395N	ENST00000537866.1	37	c.1183	CCDS10775.1	16	.	.	.	.	.	.	.	.	.	.	G	36	5.722385	0.96839	.	.	ENSG00000159579	ENST00000394420;ENST00000537866	T;T	0.74106	-0.81;-0.81	6.16	6.16	0.99307	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	D	0.88291	0.6397	M	0.83312	2.635	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87333	0.2326	10	0.54805	T	0.06	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	395	Q96DX4	RSPRY_HUMAN	N	395	ENSP00000377942:D395N;ENSP00000443176:D395N	ENSP00000377942:D395N	D	+	1	0	RSPRY1	55818776	1.000000	0.71417	0.969000	0.41365	0.995000	0.86356	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	GAT	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY		0.502	RSPRY1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RSPRY1	protein_coding	OTTHUMT00000432953.1	G	NM_133368	-		57261275	+1	no_errors	ENST00000394420	ensembl	human	known	74_37	missense	SNP	1.000	A
KIF4B	285643	genome.wustl.edu	37	5	154395374	154395374	+	Missense_Mutation	SNP	G	G	A	rs199820075		TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr5:154395374G>A	ENST00000435029.4	+	1	2115	c.1955G>A	c.(1954-1956)cGt>cAt	p.R652H		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	652					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)	p.R652H(2)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CAGTTAATGCGTCAAATGAAA	0.408													G|||	1	0.000199681	0.0	0.0	5008	,	,		22303	0.001		0.0	False		,,,				2504	0.0																2	Substitution - Missense(2)	lung(2)						ENSG00000226650						157.0	156.0	156.0					5																	154395374		2203	4300	6503	KIF4B	SO:0001583	missense	0			GMAF=0.0005	HGNC	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.1955G>A	5.37:g.154395374G>A	ENSP00000387875:p.Arg652His	Somatic	0	39	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	31	24.39		Missense_Mutation	SNP	34	0.00	0	51	31.08	23	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R652H	ENST00000435029.4	37	c.1955	CCDS47324.1	5	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	g	12.12	1.842099	0.32513	.	.	ENSG00000226650	ENST00000435029	T	0.18174	2.23	2.54	0.587	0.17439	.	.	.	.	.	T	0.12178	0.0296	L	0.47716	1.5	0.48236	D	0.999614	B	0.31256	0.316	B	0.24269	0.052	T	0.09164	-1.0687	9	0.59425	D	0.04	.	5.0708	0.14606	0.3293:0.0:0.6707:0.0	.	652	Q2VIQ3	KIF4B_HUMAN	H	652	ENSP00000387875:R652H	ENSP00000387875:R652H	R	+	2	0	KIF4B	154375567	1.000000	0.71417	0.985000	0.45067	0.996000	0.88848	4.427000	0.59888	-0.177000	0.10690	0.563000	0.77884	CGT	-	NULL		0.408	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4B	protein_coding	OTTHUMT00000377478.1	G		rs199820075		154395374	+1	no_errors	ENST00000435029	ensembl	human	known	74_37	missense	SNP	1.000	A
ARHGAP9	64333	genome.wustl.edu	37	12	57869320	57869320	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr12:57869320C>T	ENST00000356411.2	-	11	1585	c.1447G>A	c.(1447-1449)Gag>Aag	p.E483K	ARHGAP9_ENST00000430041.2_Missense_Mutation_p.E280K|ARHGAP9_ENST00000393791.3_Missense_Mutation_p.E464K|ARHGAP9_ENST00000550454.1_5'Flank|ARHGAP9_ENST00000393797.2_Missense_Mutation_p.E554K|ARHGAP9_ENST00000550288.1_Missense_Mutation_p.E543K|ARHGAP9_ENST00000424809.2_Missense_Mutation_p.E464K			Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9	483	Lipid binding.				positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			endometrium(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)	30			GBM - Glioblastoma multiforme(3;3.37e-34)			AGCTCCGACTCCTCTTCTTCG	0.721																																																	0								ENSG00000123329						10.0	12.0	11.0					12																	57869320		2188	4284	6472	ARHGAP9	SO:0001583	missense	0			-	HGNC	AB051853	CCDS8941.2, CCDS44928.1, CCDS44929.1	12q13.3	2013-01-10			ENSG00000123329	ENSG00000123329		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	14130	protein-coding gene	gene with protein product		610576				11396949	Standard	NM_032496		Approved	MGC1295, 10C	uc001soc.3	Q9BRR9	OTTHUMG00000150147	ENST00000356411.2:c.1447G>A	12.37:g.57869320C>T	ENSP00000348782:p.Glu483Lys	Somatic	0	27	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	73	19	79.35	B4DVI3|E9PDX9|Q8NAF3|Q8TCJ3|Q8WYR0|Q96EZ2|Q96S74	Missense_Mutation	SNP	26	0.00	0	28	76.47	91	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_WW_dom,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_WW_dom,pfscan_RhoGAP_dom	p.E483K	ENST00000356411.2	37	c.1447		12	.	.	.	.	.	.	.	.	.	.	C	12.20	1.867032	0.32977	.	.	ENSG00000123329	ENST00000393791;ENST00000356411;ENST00000423291;ENST00000424809;ENST00000393797;ENST00000340423;ENST00000430041;ENST00000548139	T;T;T;T;T;T	0.50001	3.16;3.19;1.81;3.16;3.07;0.76	5.05	5.05	0.67936	.	0.237962	0.36555	N	0.002527	T	0.60881	0.2303	L	0.51422	1.61	0.34386	D	0.693675	D;D;D;D;B	0.69078	0.993;0.997;0.996;0.985;0.342	D;D;D;P;B	0.76071	0.971;0.98;0.987;0.643;0.204	T	0.66085	-0.6011	10	0.30078	T	0.28	.	14.2903	0.66273	0.0:1.0:0.0:0.0	.	543;483;464;464;280	Q6ZN13;Q9BRR9;Q9BRR9-2;E9PDX9;B4DVI3	.;RHG09_HUMAN;.;.;.	K	464;483;134;464;554;513;280;280	ENSP00000377380:E464K;ENSP00000348782:E483K;ENSP00000394307:E464K;ENSP00000377386:E554K;ENSP00000397950:E280K;ENSP00000449829:E280K	ENSP00000344852:E513K	E	-	1	0	ARHGAP9	56155587	0.991000	0.36638	0.852000	0.33557	0.324000	0.28378	2.917000	0.48821	2.535000	0.85469	0.455000	0.32223	GAG	-	NULL		0.721	ARHGAP9-201	KNOWN	basic|appris_candidate	protein_coding	ARHGAP9	protein_coding		C	NM_032496	-		57869320	-1	no_errors	ENST00000356411	ensembl	human	known	74_37	missense	SNP	0.923	T
BPIFB6	128859	genome.wustl.edu	37	20	31619530	31619530	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr20:31619530T>G	ENST00000349552.1	+	1	77	c.77T>G	c.(76-78)tTg>tGg	p.L26W		NM_174897.2	NP_777557.1	Q8NFQ5	BPIB6_HUMAN	BPI fold containing family B, member 6	26						extracellular region (GO:0005576)	lipid binding (GO:0008289)										CTGCTGCGGTTGGGCATGGAC	0.652																																																	0								ENSG00000167104						46.0	34.0	38.0					20																	31619530		2203	4299	6502	BPIFB6	SO:0001583	missense	0			-	HGNC	AF465767	CCDS13211.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000167104	ENSG00000167104		"""BPI fold containing"""	16504	protein-coding gene	gene with protein product		614110	"""bactericidal/permeability-increasing protein-like 3"""	BPIL3		12185532, 21787333	Standard	NM_174897		Approved	LPLUNC6	uc010zuc.2	Q8NFQ5	OTTHUMG00000032238	ENST00000349552.1:c.77T>G	20.37:g.31619530T>G	ENSP00000344929:p.Leu26Trp	Somatic	0	126	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	78	25.71		Missense_Mutation	SNP	33	0.00	0	28	34.88	15	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_C	p.L26W	ENST00000349552.1	37	c.77	CCDS13211.1	20	.	.	.	.	.	.	.	.	.	.	T	19.36	3.811921	0.70797	.	.	ENSG00000167104	ENST00000349552	T	0.06608	3.28	5.12	5.12	0.69794	.	0.165039	0.28225	N	0.016138	T	0.21674	0.0522	M	0.68317	2.08	0.33358	D	0.57196	D	0.89917	1.0	D	0.87578	0.998	T	0.22034	-1.0228	10	0.87932	D	0	.	11.308	0.49347	0.0:0.0:0.0:1.0	.	26	Q8NFQ5	BPIB6_HUMAN	W	26	ENSP00000344929:L26W	ENSP00000344929:L26W	L	+	2	0	BPIFB6	31083191	0.997000	0.39634	0.983000	0.44433	0.738000	0.42128	3.915000	0.56409	1.937000	0.56155	0.459000	0.35465	TTG	-	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom		0.652	BPIFB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB6	protein_coding	OTTHUMT00000078658.2	T	NM_174897	-		31619530	+1	no_errors	ENST00000349552	ensembl	human	known	74_37	missense	SNP	0.996	G
SNORD3C	780853	genome.wustl.edu	37	17	19091448	19091448	+	lincRNA	SNP	C	C	T	rs368131524|rs540601598	byFrequency	TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr17:19091448C>T	ENST00000362428.1	-	0	432				SNORD3A_ENST00000365494.1_lincRNA					small nucleolar RNA, C/D box 3C																		gtgaagccggctttctggcgt	0.502														33	0.00658946	0.0227	0.0029	5008	,	,		44370	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000263934	C		56,1692		2,52,820	34.0	19.0	24.0			0.1	0.0	17		24	8,3942		0,8,1967	no	intergenic				2,60,2787	TT,TC,CC		0.2025,3.2037,1.1232			19091448	64,5634	874	1975	2849	SNORD3A			0			-	HGNC			17p11.2	2013-09-05			ENSG00000199298	ENSG00000264940			33191	non-coding RNA	RNA, small nucleolar						9365252	Standard	NR_006881		Approved	U3-3					17.37:g.19091448C>T		Somatic	0	242	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	253	10.60		RNA	SNP	65	0.00	0	89	4.30	4	-	NULL	ENST00000362428.1	37	NULL		17																																																																																			-	-		0.502	SNORD3C-201	KNOWN	basic	snoRNA	SNORD3A	lincRNA		C	NR_006881	-		19091448	+1	no_errors	ENST00000365494	ensembl	human	known	74_37	rna	SNP	0.007	T
RELA	5970	genome.wustl.edu	37	11	65429468	65429468	+	Silent	SNP	G	G	A			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr11:65429468G>A	ENST00000406246.3	-	3	387	c.126C>T	c.(124-126)tcC>tcT	p.S42S	RELA_ENST00000308639.9_Silent_p.S42S|RELA_ENST00000525693.1_Silent_p.S42S	NM_001243984.1|NM_001243985.1|NM_021975.3	NP_001230913.1|NP_001230914.1|NP_068810.3	Q04206	TF65_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog A	42	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				acetaldehyde metabolic process (GO:0006117)|aging (GO:0007568)|cellular defense response (GO:0006968)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|Fc-epsilon receptor signaling pathway (GO:0038095)|hair follicle development (GO:0001942)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|liver development (GO:0001889)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of Schwann cell differentiation (GO:0014040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to amino acid (GO:0043200)|response to cAMP (GO:0051591)|response to cobalamin (GO:0033590)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to interleukin-1 (GO:0070555)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to muramyl dipeptide (GO:0032495)|response to organic substance (GO:0010033)|response to progesterone (GO:0032570)|response to UV-B (GO:0010224)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phosphate ion binding (GO:0042301)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(11)|ovary(1)|urinary_tract(1)	19						TGCTGCCCGCGGAGCGCCCCT	0.662																																																	0								ENSG00000173039						73.0	65.0	68.0					11																	65429468		2201	4297	6498	RELA	SO:0001819	synonymous_variant	0			-	HGNC	Z22951	CCDS31609.1, CCDS44651.1, CCDS73322.1	11q13	2013-07-09	2013-07-09		ENSG00000173039	ENSG00000173039			9955	protein-coding gene	gene with protein product		164014	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells 3"""	NFKB3		2001591	Standard	NM_021975		Approved	p65	uc001ofg.3	Q04206	OTTHUMG00000166566	ENST00000406246.3:c.126C>T	11.37:g.65429468G>A		Somatic	0	50	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	35	20.45	Q6GTV1|Q6SLK1	Silent	SNP	32	0.00	0	21	41.67	15	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NF_Rel_Dor	p.S42	ENST00000406246.3	37	c.126	CCDS31609.1	11																																																																																			-	pfam_RHD,superfamily_p53-like_TF_DNA-bd,pfscan_RHD,prints_NF_Rel_Dor		0.662	RELA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELA	protein_coding	OTTHUMT00000390457.2	G	NM_021975	-		65429468	-1	no_errors	ENST00000406246	ensembl	human	known	74_37	silent	SNP	0.016	A
KIF5A	3798	genome.wustl.edu	37	12	57960960	57960960	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr12:57960960G>C	ENST00000455537.2	+	7	827	c.553G>C	c.(553-555)Gat>Cat	p.D185H	KIF5A_ENST00000286452.5_Missense_Mutation_p.D96H	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	185	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.|Microtubule-binding.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						GGATGTGATTGATGAAGGGAA	0.483																																																	0								ENSG00000155980						165.0	155.0	158.0					12																	57960960		2203	4300	6503	KIF5A	SO:0001583	missense	0			-	HGNC	U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.553G>C	12.37:g.57960960G>C	ENSP00000408979:p.Asp185His	Somatic	0	43	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	38	15.56	A6H8M5|Q4LE26	Missense_Mutation	SNP	27	0.00	0	39	26.42	14	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.D185H	ENST00000455537.2	37	c.553	CCDS8945.1	12	.	.	.	.	.	.	.	.	.	.	G	26.6	4.752695	0.89753	.	.	ENSG00000155980	ENST00000455537;ENST00000286452	T;T	0.75154	-0.91;-0.91	4.48	4.48	0.54585	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	T	0.76198	0.3954	N	0.16037	0.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.987;0.996	T	0.80576	-0.1321	10	0.62326	D	0.03	.	16.4543	0.84008	0.0:0.0:1.0:0.0	.	96;185	B7Z2M7;Q12840	.;KIF5A_HUMAN	H	185;96	ENSP00000408979:D185H;ENSP00000286452:D96H	ENSP00000286452:D96H	D	+	1	0	KIF5A	56247227	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.048000	0.93830	2.481000	0.83766	0.453000	0.30009	GAT	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom		0.483	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5A	protein_coding	OTTHUMT00000407634.1	G	NM_004984	-		57960960	+1	no_errors	ENST00000455537	ensembl	human	known	74_37	missense	SNP	1.000	C
MEMO1	51072	genome.wustl.edu	37	2	32093492	32093492	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr2:32093492G>C	ENST00000295065.5	-	9	1141	c.832C>G	c.(832-834)Cag>Gag	p.Q278E	MEMO1_ENST00000490459.1_5'UTR|MEMO1_ENST00000379383.3_Missense_Mutation_p.Q281E|MEMO1_ENST00000426310.2_Missense_Mutation_p.Q255E|MEMO1_ENST00000404530.1_Missense_Mutation_p.Q278E|DPY30_ENST00000446765.1_5'UTR	NM_015955.2	NP_057039.1	Q9Y316	MEMO1_HUMAN	mediator of cell motility 1	278					regulation of microtubule-based process (GO:0032886)	cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|breast(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|skin(2)	17	Acute lymphoblastic leukemia(172;0.155)					TTTCTACACTGGCTCGACTGG	0.443																																																	0								ENSG00000162959						21.0	20.0	20.0					2																	32093492		2202	4294	6496	MEMO1	SO:0001583	missense	0			-	HGNC	AF132961	CCDS1776.1, CCDS46255.1	2p22-p21	2010-05-24	2007-02-12	2007-02-12	ENSG00000162959	ENSG00000162959			14014	protein-coding gene	gene with protein product		611786	"""chromosome 2 open reading frame 4"""	C2orf4		15156151	Standard	NM_015955		Approved	CGI-27, MEMO	uc002rnx.3	Q9Y316	OTTHUMG00000128453	ENST00000295065.5:c.832C>G	2.37:g.32093492G>C	ENSP00000295065:p.Gln278Glu	Somatic	0	19	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	11	35.29	B4DLS0|D6W575|Q5R2V8|Q5R2V9|Q6NSL5	Missense_Mutation	SNP	28	0.00	0	23	37.84	14	pfam_MEMO1_fam	p.Q281E	ENST00000295065.5	37	c.841	CCDS1776.1	2	.	.	.	.	.	.	.	.	.	.	G	11.89	1.772854	0.31411	.	.	ENSG00000162959	ENST00000295065;ENST00000379383;ENST00000404530;ENST00000426310	.	.	.	5.23	5.23	0.72850	.	0.053891	0.85682	D	0.000000	T	0.65281	0.2676	L	0.53780	1.695	0.80722	D	1	B;B	0.10296	0.002;0.003	B;B	0.10450	0.005;0.004	T	0.61792	-0.6990	9	0.49607	T	0.09	-0.5607	18.7757	0.91911	0.0:0.0:1.0:0.0	.	255;278	Q9Y316-2;Q9Y316	.;MEMO1_HUMAN	E	278;281;278;255	.	ENSP00000295065:Q278E	Q	-	1	0	MEMO1	31946996	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.338000	0.72963	2.608000	0.88229	0.650000	0.86243	CAG	-	pfam_MEMO1_fam		0.443	MEMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEMO1	protein_coding	OTTHUMT00000250251.2	G	NM_015955	-		32093492	-1	no_errors	ENST00000379383	ensembl	human	known	74_37	missense	SNP	1.000	C
TUBAL3	79861	genome.wustl.edu	37	10	5446755	5446755	+	Start_Codon_SNP	SNP	T	T	A			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr10:5446755T>A	ENST00000380419.3	-	1	38	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	TUBAL3_ENST00000479328.1_Start_Codon_SNP_p.M1L	NM_024803.2	NP_079079.1	A6NHL2	TBAL3_HUMAN	tubulin, alpha-like 3	1					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(7)|prostate(2)|skin(3)	25						TCACTTACCATGCTGATGAGA	0.458																																																	0								ENSG00000178462						97.0	78.0	85.0					10																	5446755		2203	4300	6503	TUBAL3	SO:0001582	initiator_codon_variant	0			-	HGNC	AK025318	CCDS7066.2, CCDS53491.1	10p15.1	2007-03-15			ENSG00000178462	ENSG00000178462		"""Tubulins"""	23534	protein-coding gene	gene with protein product							Standard	NM_024803		Approved	FLJ21665	uc001ihy.3	A6NHL2	OTTHUMG00000017595	ENST00000380419.3:c.1A>T	10.37:g.5446755T>A	ENSP00000369784:p.Met1Leu	Somatic	0	19	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	13	35.00	B4DKL2|Q4QQJ5|Q9H6Z0	Missense_Mutation	SNP	29	0.00	0	37	17.78	8	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.M1L	ENST00000380419.3	37	c.1	CCDS7066.2	10	.	.	.	.	.	.	.	.	.	.	T	5.776	0.327582	0.10956	.	.	ENSG00000178462	ENST00000380419;ENST00000479328	T;T	0.78595	-0.45;-1.19	3.58	2.42	0.29668	Tubulin/FtsZ, GTPase domain (2);	0.795085	0.10619	N	0.653504	T	0.68906	0.3052	.	.	.	0.80722	D	1	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.64437	-0.6408	9	0.72032	D	0.01	.	7.051	0.25073	0.0:0.0:0.2322:0.7678	.	1;1	A6NHL2-2;A6NHL2	.;TBAL3_HUMAN	L	1	ENSP00000369784:M1L;ENSP00000418799:M1L	ENSP00000369784:M1L	M	-	1	0	TUBAL3	5436755	1.000000	0.71417	0.998000	0.56505	0.315000	0.28087	1.499000	0.35671	0.730000	0.32425	0.528000	0.53228	ATG	-	superfamily_Tubulin_FtsZ_GTPase		0.458	TUBAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBAL3	protein_coding	OTTHUMT00000046548.2	T	NM_024803	-	Missense_Mutation	5446755	-1	no_errors	ENST00000380419	ensembl	human	known	74_37	missense	SNP	0.998	A
MALAT1	378938	genome.wustl.edu	37	11	65268480	65268480	+	lincRNA	DEL	T	T	-	rs72004824|rs117197658	byFrequency	TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr11:65268480delT	ENST00000534336.1	+	0	3248				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		AGTTTGTGGGTTTTTTTTTTT	0.368																																																	0								ENSG00000251562						83.0	101.0	95.0					11																	65268480		874	1988	2862	MALAT1			0				HGNC	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65268480delT		Somatic	0	29	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63		RNA	DEL	29	14.71	5	50	5.66	3	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			-	-		0.368	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	lincRNA	OTTHUMT00000389143.1	T	NR_002819			65268480	+1	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	DEL	0.000	-
MUC12	10071	genome.wustl.edu	37	7	100638484	100638484	+	Missense_Mutation	SNP	A	A	T	rs199794194	byFrequency	TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr7:100638484A>T	ENST00000379442.3	+	5	5069	c.5069A>T	c.(5068-5070)aAa>aTa	p.K1690I	MUC12_ENST00000536621.1_Missense_Mutation_p.K1547I			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	1690	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CTGAGTGAGAAATCTACCACC	0.532																																																	0								ENSG00000205277																																			MUC12	SO:0001583	missense	0			-	HGNC	AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.5069A>T	7.37:g.100638484A>T	ENSP00000368755:p.Lys1690Ile	Somatic	0	13	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	13	27.78	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	7	22.22	2	13	0.00	0	pfam_SEA_dom	p.K1547I	ENST00000379442.3	37	c.4640		7	.	.	.	.	.	.	.	.	.	.	a	2.371	-0.344380	0.05208	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.13196	2.61;2.61	0.869	-1.74	0.08056	.	.	.	.	.	T	0.05410	0.0143	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.28299	-1.0048	7	0.36615	T	0.2	.	3.1547	0.06500	0.4539:0.3162:0.2299:0.0	.	.	.	.	I	1690;1547	ENSP00000368755:K1690I;ENSP00000441929:K1547I	ENSP00000368755:K1690I	K	+	2	0	MUC12	100425204	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.010000	0.03656	-2.317000	0.00644	-1.341000	0.01249	AAA	-	NULL		0.532	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	protein_coding	OTTHUMT00000347234.1	A	XM_379904	rs199794194		100638484	+1	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	SNP	0.000	T
C12orf56	115749	genome.wustl.edu	37	12	64706467	64706467	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr12:64706467C>G	ENST00000543942.2	-	5	1586	c.960G>C	c.(958-960)aaG>aaC	p.K320N	RPS11P6_ENST00000535684.1_RNA|C12orf56_ENST00000333722.5_Intron	NM_001170633.1	NP_001164104.1	Q8IXR9	CL056_HUMAN	chromosome 12 open reading frame 56	320										NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)	15			GBM - Glioblastoma multiforme(3;0.000582)	GBM - Glioblastoma multiforme(28;0.0259)		ACCTATATGGCTTTTGACTTC	0.358																																																	0								ENSG00000185306						183.0	173.0	176.0					12																	64706467		692	1591	2283	C12orf56	SO:0001583	missense	0			-	HGNC		CCDS44935.1, CCDS61182.1	12q14.2	2012-08-15			ENSG00000185306	ENSG00000185306			26967	protein-coding gene	gene with protein product							Standard	NM_001099676		Approved		uc021qzu.1	Q8IXR9	OTTHUMG00000168782	ENST00000543942.2:c.960G>C	12.37:g.64706467C>G	ENSP00000446101:p.Lys320Asn	Somatic	0	23	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	28	28.21		Missense_Mutation	SNP	33	0.00	0	56	47.17	50	NULL	p.K320N	ENST00000543942.2	37	c.960		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.896|2.896	-0.228551|-0.228551	0.06022|0.06022	.|.	.|.	ENSG00000185306|ENSG00000185306	ENST00000433716|ENST00000543942;ENST00000543259	.|.	.|.	.|.	4.75|4.75	4.75|4.75	0.60458|0.60458	.|.	.|.	.|.	.|.	.|.	T|T	0.54532|0.54532	0.1864|0.1864	L|L	0.57536|0.57536	1.79|1.79	0.26058|0.26058	N|N	0.981395|0.981395	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.48258|0.48258	-0.9051|-0.9051	5|5	.|.	.|.	.|.	.|.	13.4645|13.4645	0.61245|0.61245	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	N|T	323|319;172	.|.	.|.	K|S	-|-	3|2	2|0	C12orf56|C12orf56	62992734|62992734	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.100000|0.100000	0.18952|0.18952	1.847000|1.847000	0.39299|0.39299	2.624000|2.624000	0.88883|0.88883	0.655000|0.655000	0.94253|0.94253	AAG|AGC	-	NULL		0.358	C12orf56-008	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf56	protein_coding	OTTHUMT00000401058.2	C	NM_001099676	-		64706467	-1	no_errors	ENST00000543942	ensembl	human	putative	74_37	missense	SNP	1.000	G
MYO5B	4645	genome.wustl.edu	37	18	47404149	47404149	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr18:47404149G>A	ENST00000285039.7	-	25	3679	c.3380C>T	c.(3379-3381)gCc>gTc	p.A1127V	MYO5B_ENST00000324581.6_Missense_Mutation_p.A268V|MYO5B_ENST00000587895.1_5'Flank	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	1127					endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)	p.A1127D(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		CTGCTGGAGGGCATCCTCAGT	0.502																																																	1	Substitution - Missense(1)	endometrium(1)						ENSG00000167306						166.0	163.0	164.0					18																	47404149		1999	4174	6173	MYO5B	SO:0001583	missense	0			-	HGNC	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.3380C>T	18.37:g.47404149G>A	ENSP00000285039:p.Ala1127Val	Somatic	0	57	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	50	28.57	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	42	0.00	0	48	21.31	13	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A1127V	ENST00000285039.7	37	c.3380	CCDS42436.1	18	.	.	.	.	.	.	.	.	.	.	G	12.91	2.079486	0.36662	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	T;T	0.17370	2.28;2.28	5.67	5.67	0.87782	.	0.307790	0.34603	N	0.003828	T	0.09818	0.0241	N	0.08118	0	0.36340	D	0.859399	B;B	0.33103	0.002;0.397	B;B	0.32465	0.004;0.146	T	0.35649	-0.9780	10	0.28530	T	0.3	.	13.9919	0.64372	0.0745:0.0:0.9255:0.0	.	1127;268	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	V	1127;268	ENSP00000285039:A1127V;ENSP00000315531:A268V	ENSP00000285039:A1127V	A	-	2	0	MYO5B	45658147	1.000000	0.71417	1.000000	0.80357	0.369000	0.29798	5.997000	0.70646	2.681000	0.91329	0.561000	0.74099	GCC	-	NULL		0.502	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	protein_coding	OTTHUMT00000448515.2	G		-		47404149	-1	no_errors	ENST00000285039	ensembl	human	known	74_37	missense	SNP	0.997	A
PDE1B	5153	genome.wustl.edu	37	12	54960762	54960762	+	Missense_Mutation	SNP	C	C	T	rs147900601		TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr12:54960762C>T	ENST00000243052.3	+	3	554	c.118C>T	c.(118-120)Cgc>Tgc	p.R40C	PDE1B_ENST00000538346.1_5'UTR|PDE1B_ENST00000394277.3_3'UTR|PDE1B_ENST00000550620.1_Missense_Mutation_p.R20C	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	40	Calmodulin-binding. {ECO:0000255}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	CTGCAGGCTGCGCTACATGGT	0.463																																																	0								ENSG00000123360	C	CYS/ARG,CYS/ARG	0,4406		0,0,2203	80.0	78.0	79.0		118,58	4.1	1.0	12	dbSNP_134	79	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PDE1B	NM_000924.3,NM_001165975.2	180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	40/537,20/517	54960762	1,13005	2203	4300	6503	PDE1B	SO:0001583	missense	0			-	HGNC	U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.118C>T	12.37:g.54960762C>T	ENSP00000243052:p.Arg40Cys	Somatic	0	24	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	62	234	20.88	Q92825|Q96KP3	Missense_Mutation	SNP	41	0.00	0	493	18.05	109	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.R40C	ENST00000243052.3	37	c.118	CCDS8882.1	12	.	.	.	.	.	.	.	.	.	.	C	19.33	3.806265	0.70682	0.0	1.16E-4	ENSG00000123360	ENST00000243052;ENST00000550620	T;T	0.75477	-0.83;-0.94	4.08	4.08	0.47627	.	1.089120	0.07087	N	0.838080	T	0.81781	0.4895	L	0.48362	1.52	0.58432	D	0.999991	D;D	0.89917	1.0;0.999	D;P	0.70487	0.969;0.88	T	0.75958	-0.3134	10	0.87932	D	0	.	9.4762	0.38873	0.2109:0.7891:0.0:0.0	.	20;40	Q01064-2;Q01064	.;PDE1B_HUMAN	C	40;20	ENSP00000243052:R40C;ENSP00000448519:R20C	ENSP00000243052:R40C	R	+	1	0	PDE1B	53247029	0.967000	0.33354	1.000000	0.80357	0.979000	0.70002	0.744000	0.26245	2.560000	0.86352	0.561000	0.74099	CGC	-	NULL		0.463	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE1B	protein_coding	OTTHUMT00000406203.1	C		rs147900601		54960762	+1	no_errors	ENST00000243052	ensembl	human	known	74_37	missense	SNP	1.000	T
LAMB1	3912	genome.wustl.edu	37	7	107575793	107575805	+	Intron	DEL	TTTTTTTTTTTTT	TTTTTTTTTTTTT	-	rs200599445|rs560552126|rs375320552|rs532164356|rs551910860|rs369537571|rs199891469|rs201843656|rs201373619|rs537372267|rs372331129|rs2701027	byFrequency	TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	TTTTTTTTTTTTT	TTTTTTTTTTTTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr7:107575793_107575805delTTTTTTTTTTTTT	ENST00000222399.6	-	27	4419				LAMB1_ENST00000393561.1_Intron|LAMB1_ENST00000474380.1_Intron	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						tttttctttgttttttttttttttttttttttt	0.408																																																	0								ENSG00000091136																																			LAMB1	SO:0001627	intron_variant	0				HGNC	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.4188+54AAAAAAAAAAAAA>-	7.37:g.107575793_107575805delTTTTTTTTTTTTT		Somatic	NA	NA	NA		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q14D91	RNA	DEL	30	11.76	4	56	9.68	6	-	NULL	ENST00000222399.6	37	NULL	CCDS5750.1	7																																																																																			-	-		0.408	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	protein_coding	OTTHUMT00000314584.1	TTTTTTTTTTTTT	NM_002291			107575805	-1	no_errors	ENST00000491196	ensembl	human	putative	74_37	rna	DEL	0.022:0.021:0.019:0.017:0.014:0.011:0.008:0.004:0.003:0.001:0.001:0.000:0.000	-
TMCO5B	100652857	genome.wustl.edu	37	15	33529018	33529027	+	RNA	DEL	GAGAGAGAGA	GAGAGAGAGA	-	rs547206613|rs372383914|rs374648277|rs56028951	byFrequency	TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	GAGAGAGAGA	GAGAGAGAGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr15:33529018_33529027delGAGAGAGAGA	ENST00000529696.1	-	0	293_302							A8MYB1	TMC5B_HUMAN	transmembrane and coiled-coil domains 5B, pseudogene							integral component of membrane (GO:0016021)											AAAGAGgagggagagagagagagagagaga	0.467														2815	0.562101	0.4395	0.4784	5008	,	,		15080	0.6687		0.6561	False		,,,				2504	0.5808																0								ENSG00000215296																																			TMCO5B			0				HGNC			15q13.3	2013-09-26	2010-09-29		ENSG00000215296	ENSG00000215296			34243	pseudogene	pseudogene			"""transmembrane and coiled-coil domains 5B"""				Standard	NR_046005		Approved		uc031qri.1	A8MYB1	OTTHUMG00000167569		15.37:g.33529028_33529037delGAGAGAGAGA		Somatic	NA	NA	NA		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	24	4.00	1	32	0.00	0	-	NULL	ENST00000529696.1	37	NULL		15																																																																																			-	-		0.467	TMCO5B-001	KNOWN	basic	processed_transcript	TMCO5B	pseudogene	OTTHUMT00000395082.1	GAGAGAGAGA				33529027	-1	no_errors	ENST00000529696	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-
RYR2	6262	genome.wustl.edu	37	1	237551406	237551406	+	Silent	SNP	T	T	C			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr1:237551406T>C	ENST00000366574.2	+	10	1013	c.696T>C	c.(694-696)gaT>gaC	p.D232D	RYR2_ENST00000542537.1_Silent_p.D216D|RYR2_ENST00000360064.6_Silent_p.D230D	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	232	MIR 3. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTGGTGGTGATGTCCTCAGGT	0.488																																																	0								ENSG00000198626						125.0	120.0	122.0					1																	237551406		2032	4198	6230	RYR2	SO:0001819	synonymous_variant	0			-	HGNC	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.696T>C	1.37:g.237551406T>C		Somatic	0	48	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	40	29.82	Q15411|Q546N8|Q5T3P2	Silent	SNP	29	0.00	0	25	45.65	21	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.D230	ENST00000366574.2	37	c.690	CCDS55691.1	1																																																																																			-	pfam_MIR_motif,superfamily_MIR_motif,smart_MIR_motif,pfscan_MIR_motif		0.488	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	T	NM_001035	-		237551406	+1	no_errors	ENST00000360064	ensembl	human	known	74_37	silent	SNP	0.990	C
PAK3	5063	genome.wustl.edu	37	X	110406911	110406912	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chrX:110406911_110406912insA	ENST00000372010.1	+	11	1209_1210	c.767_768insA	c.(766-771)agaaaafs	p.RK256fs	PAK3_ENST00000425146.1_Frame_Shift_Ins_p.RK241fs|PAK3_ENST00000262836.4_Frame_Shift_Ins_p.RK256fs|PAK3_ENST00000417227.1_Frame_Shift_Ins_p.RK262fs|PAK3_ENST00000360648.4_Frame_Shift_Ins_p.RK277fs|PAK3_ENST00000372007.5_Frame_Shift_Ins_p.RK241fs|PAK3_ENST00000519681.1_Frame_Shift_Ins_p.RK262fs|PAK3_ENST00000518291.1_Frame_Shift_Ins_p.RK277fs|PAK3_ENST00000446737.1_Frame_Shift_Ins_p.RK241fs			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	256	Linker.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						GATCGGCAAAGAAAAAAATCCA	0.416										TSP Lung(19;0.15)																																							0								ENSG00000077264																																			PAK3	SO:0001589	frameshift_variant	0				HGNC	AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.774dupA	X.37:g.110406918_110406918dupA	ENSP00000361080:p.Arg256fs	Somatic	0	10	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	9	40.00	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Frame_Shift_Ins	INS	17	0.00	0	15	51.61	16	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CRIB_dom,superfamily_Kinase-like_dom,smart_CRIB_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRIB_dom,pfscan_Prot_kinase_dom	p.S280fs	ENST00000372010.1	37	c.830_831	CCDS48153.1	X																																																																																			-	NULL		0.416	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAK3	protein_coding	OTTHUMT00000057918.1	-	NM_002578			110406912	+1	no_errors	ENST00000360648	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
L1TD1	54596	genome.wustl.edu	37	1	62675988	62675988	+	Silent	SNP	G	G	A			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr1:62675988G>A	ENST00000498273.1	+	4	1837	c.1542G>A	c.(1540-1542)ttG>ttA	p.L514L	Y_RNA_ENST00000363304.1_RNA	NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	514										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						TTAGTTATTTGGTTGGGGACT	0.453																																																	0								ENSG00000240563						38.0	42.0	41.0					1																	62675988		2203	4300	6503	L1TD1	SO:0001819	synonymous_variant	0			-	HGNC	BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.1542G>A	1.37:g.62675988G>A		Somatic	0	19	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	19	51.28	Q8NDA1|Q9NUV8|Q9NV78	Silent	SNP	32	0.00	0	68	51.06	72	pfam_Transposase_22,superfamily_STAT_TF_coiled-coil	p.L514	ENST00000498273.1	37	c.1542	CCDS619.1	1																																																																																			-	NULL		0.453	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L1TD1	protein_coding	OTTHUMT00000024688.1	G	NM_019079	-		62675988	+1	no_errors	ENST00000498273	ensembl	human	known	74_37	silent	SNP	0.000	A
PARP8	79668	genome.wustl.edu	37	5	49962737	49962738	+	Intron	INS	-	-	CCT	rs151280834	byFrequency	TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr5:49962737_49962738insCCT	ENST00000505697.2	+	2	171				PARP8_ENST00000503665.1_5'Flank|PARP8_ENST00000505554.1_5'Flank|PARP8_ENST00000514067.2_5'Flank|PARP8_ENST00000503750.2_Intron|PARP8_ENST00000514342.2_Intron|PARP8_ENST00000511363.2_Intron|PARP8_ENST00000513738.1_5'Flank|PARP8_ENST00000281631.5_5'Flank	NM_001178055.1	NP_001171526.1	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8							intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				GCCGAcctccccctcctcctcc	0.599														4260	0.850639	0.8533	0.8242	5008	,	,		4490	0.9117		0.8419	False		,,,				2504	0.8119																0								ENSG00000151883																																			PARP8	SO:0001627	intron_variant	0				HGNC	AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000505697.2:c.-11-181->CCT	5.37:g.49962744_49962746dupCCT		Somatic	0	34	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	19	32.14	Q3KRB7|Q6DHZ1|Q9H754	RNA	INS	6	14.29	1	7	0.00	0	-	NULL	ENST00000505697.2	37	NULL	CCDS3954.1	5																																																																																			-	-		0.599	PARP8-002	NOVEL	basic|appris_principal|CCDS	protein_coding	PARP8	protein_coding	OTTHUMT00000368401.4	-	NM_024615			49962738	+1	no_errors	ENST00000513414	ensembl	human	putative	74_37	rna	INS	0.994:0.991	CCT
ZNF335	63925	genome.wustl.edu	37	20	44581055	44581055	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr20:44581055G>A	ENST00000322927.2	-	20	3020	c.2920C>T	c.(2920-2922)Ccc>Tcc	p.P974S	ZNF335_ENST00000426788.1_Missense_Mutation_p.P819S	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	974					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				GGAGATGGGGGCTCAGGGCCG	0.657																																																	0								ENSG00000198026						30.0	34.0	33.0					20																	44581055		2203	4300	6503	ZNF335	SO:0001583	missense	0			-	HGNC	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.2920C>T	20.37:g.44581055G>A	ENSP00000325326:p.Pro974Ser	Somatic	0	46	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	26	25.71	B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	38	0.00	0	36	21.74	10	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P974S	ENST00000322927.2	37	c.2920	CCDS13389.1	20	.	.	.	.	.	.	.	.	.	.	G	8.363	0.833491	0.16820	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	T;T	0.08896	3.19;3.04	4.66	2.67	0.31697	.	0.469539	0.20068	N	0.099938	T	0.04543	0.0124	N	0.24115	0.695	0.09310	N	1	B;B	0.24186	0.006;0.099	B;B	0.19391	0.005;0.025	T	0.37174	-0.9717	10	0.34782	T	0.22	-9.9949	1.4709	0.02415	0.1897:0.1776:0.4626:0.1701	.	819;974	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	S	974;751;819	ENSP00000325326:P974S;ENSP00000397098:P819S	ENSP00000243961:P751S	P	-	1	0	ZNF335	44014462	0.739000	0.28196	0.857000	0.33713	0.916000	0.54674	0.840000	0.27600	0.541000	0.28827	0.561000	0.74099	CCC	-	NULL		0.657	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF335	protein_coding	OTTHUMT00000079553.1	G	NM_022095	-		44581055	-1	no_errors	ENST00000322927	ensembl	human	known	74_37	missense	SNP	0.129	A
TCF7L2	6934	genome.wustl.edu	37	10	114710508	114710508	+	5'UTR	DEL	A	A	-			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr10:114710508delA	ENST00000355995.4	+	0	500				TCF7L2_ENST00000536810.1_5'UTR|TCF7L2_ENST00000543371.1_5'UTR|TCF7L2_ENST00000534894.1_5'UTR|TCF7L2_ENST00000369395.1_5'UTR|TCF7L2_ENST00000545257.1_5'UTR|TCF7L2_ENST00000538897.1_5'UTR|TCF7L2_ENST00000349937.2_5'UTR|TCF7L2_ENST00000355717.4_5'UTR|TCF7L2_ENST00000369397.4_5'UTR|TCF7L2_ENST00000542695.1_5'Flank|RP11-57H14.2_ENST00000369391.3_RNA|TCF7L2_ENST00000352065.5_5'UTR			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)						blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		CTGGTGGGTGAAAAAAAAATG	0.473			T	VTI1A	colorectal																																			Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	0								ENSG00000233547		,,,,,,,,,,,,	175,168,3861		7,0,161,1,166,1767	14.0	14.0	14.0		,,,,,,,,,,,,	3.5	1.0	10		14	111,333,7730		2,0,107,8,317,3653	no	utr-5,utr-5,utr-5,utr-5,utr-5,utr-5,utr-5,utr-5,utr-5,utr-5,utr-5,utr-5,utr-5	TCF7L2	NM_030756.4,NM_001198531.1,NM_001198530.1,NM_001198529.1,NM_001198528.1,NM_001198527.1,NM_001198526.1,NM_001198525.1,NM_001146286.1,NM_001146285.1,NM_001146284.1,NM_001146283.1,NM_001146274.1	,,,,,,,,,,,,	9,0,268,9,483,5420	A1A1,A1A2,A1R,A2A2,A2R,RR		5.4319,8.1589,6.3581	,,,,,,,,,,,,	,,,,,,,,,,,,	114710508	286,501,11591	2179	4271	6450	RP11-57H14.2	SO:0001623	5_prime_UTR_variant	0				Clone_based_vega_gene	X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.-8A>-	10.37:g.114710508delA		Somatic	0	29	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	30	9.09	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	RNA	DEL	27	3.57	1	38	0.00	0	-	NULL	ENST00000355995.4	37	NULL		10																																																																																			-	-		0.473	TCF7L2-203	KNOWN	basic	protein_coding	ENSG00000233547	protein_coding		A	NM_030756			114710508	-1	no_errors	ENST00000369391	ensembl	human	known	74_37	rna	DEL	0.999	-
KIF5A	3798	genome.wustl.edu	37	12	57960944	57960944	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr12:57960944G>C	ENST00000455537.2	+	7	811	c.537G>C	c.(535-537)gaG>gaC	p.E179D	KIF5A_ENST00000286452.5_Missense_Mutation_p.E90D	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	179	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.|Microtubule-binding.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						GCCCGGAGGAGATTCTGGATG	0.443																																																	0								ENSG00000155980						162.0	154.0	156.0					12																	57960944		2203	4300	6503	KIF5A	SO:0001583	missense	0			-	HGNC	U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.537G>C	12.37:g.57960944G>C	ENSP00000408979:p.Glu179Asp	Somatic	0	47	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	39	17.02	A6H8M5|Q4LE26	Missense_Mutation	SNP	29	0.00	0	41	24.07	13	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E179D	ENST00000455537.2	37	c.537	CCDS8945.1	12	.	.	.	.	.	.	.	.	.	.	G	15.14	2.745826	0.49151	.	.	ENSG00000155980	ENST00000455537;ENST00000286452	T;T	0.73681	-0.77;-0.77	4.48	4.48	0.54585	Kinesin, motor domain (4);	0.133320	0.53938	D	0.000051	T	0.62208	0.2409	N	0.25060	0.705	0.80722	D	1	B;B	0.26845	0.037;0.161	B;B	0.35510	0.063;0.204	T	0.57499	-0.7801	10	0.24483	T	0.36	.	10.6996	0.45920	0.0935:0.0:0.9065:0.0	.	90;179	B7Z2M7;Q12840	.;KIF5A_HUMAN	D	179;90	ENSP00000408979:E179D;ENSP00000286452:E90D	ENSP00000286452:E90D	E	+	3	2	KIF5A	56247211	0.988000	0.35896	1.000000	0.80357	0.903000	0.53119	0.261000	0.18442	2.481000	0.83766	0.453000	0.30009	GAG	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom		0.443	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5A	protein_coding	OTTHUMT00000407634.1	G	NM_004984	-		57960944	+1	no_errors	ENST00000455537	ensembl	human	known	74_37	missense	SNP	1.000	C
FAM135A	57579	genome.wustl.edu	37	6	71234525	71234525	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3LU-01A-11D-A21Q-09	TCGA-DX-A3LU-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d734d06-f2b1-4924-a201-620ac8084c49	97a68a03-dc99-4ba9-8b81-1b40f2ce32ea	g.chr6:71234525A>G	ENST00000418814.2	+	15	2352	c.1738A>G	c.(1738-1740)Aca>Gca	p.T580A	FAM135A_ENST00000370479.3_Intron|FAM135A_ENST00000457062.2_Intron|FAM135A_ENST00000505769.1_Intron|FAM135A_ENST00000361499.3_Intron|FAM135A_ENST00000505868.1_Missense_Mutation_p.T580A	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A	580										breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						GCCAACTAATACAGAGAGAAC	0.393																																																	0								ENSG00000082269						55.0	54.0	54.0					6																	71234525		692	1591	2283	FAM135A	SO:0001583	missense	0			-	HGNC	AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.1738A>G	6.37:g.71234525A>G	ENSP00000410768:p.Thr580Ala	Somatic	0	16	0.00		0.6829404620316855	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	12	47.83	A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Missense_Mutation	SNP	35	0.00	0	56	21.92	16	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like,pfam_LACT/PDAT_acylTrfase	p.T580A	ENST00000418814.2	37	c.1738	CCDS55028.1	6	.	.	.	.	.	.	.	.	.	.	A	12.29	1.894099	0.33442	.	.	ENSG00000082269	ENST00000418814;ENST00000505868	T;T	0.19394	2.18;2.15	5.39	4.2	0.49525	.	0.294923	0.37857	N	0.001917	T	0.06462	0.0166	L	0.47716	1.5	0.80722	D	1	B	0.14438	0.01	B	0.04013	0.001	T	0.13415	-1.0510	10	0.26408	T	0.33	.	4.9387	0.13954	0.7504:0.0:0.086:0.1637	.	580	Q9P2D6	F135A_HUMAN	A	580	ENSP00000410768:T580A;ENSP00000423307:T580A	ENSP00000410768:T580A	T	+	1	0	FAM135A	71291246	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.551000	0.45820	0.954000	0.37851	0.459000	0.35465	ACA	-	NULL		0.393	FAM135A-001	KNOWN	basic|CCDS	protein_coding	FAM135A	protein_coding	OTTHUMT00000041137.2	A	NM_020819	-		71234525	+1	no_errors	ENST00000418814	ensembl	human	known	74_37	missense	SNP	1.000	G
