#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
HHIP	64399	genome.wustl.edu	37	4	145573925	145573925	+	Missense_Mutation	SNP	T	T	C	rs199573517		TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr4:145573925T>C	ENST00000296575.3	+	2	1103	c.448T>C	c.(448-450)Tac>Cac	p.Y150H	HHIP_ENST00000434550.2_Missense_Mutation_p.Y150H|HHIP_ENST00000511314.1_3'UTR|HHIP-AS1_ENST00000512359.1_RNA	NM_022475.2	NP_071920.1	Q96QV1	HHIP_HUMAN	hedgehog interacting protein	150					carbohydrate metabolic process (GO:0005975)|dorsal/ventral pattern formation (GO:0009953)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|negative regulation of signal transduction (GO:0009968)|negative regulation of smoothened signaling pathway (GO:0045879)|neuroblast proliferation (GO:0007405)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|skeletal system morphogenesis (GO:0048705)|smoothened signaling pathway (GO:0007224)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	hedgehog family protein binding (GO:0097108)|oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		AGAATTCTTTTACACTTGCCG	0.378																																																	0								ENSG00000164161						99.0	107.0	105.0					4																	145573925		2203	4300	6503	HHIP	SO:0001583	missense	0			-	HGNC	AK024645	CCDS3762.1	4q31.21-q31.3	2008-08-29	2001-11-29		ENSG00000164161	ENSG00000164161			14866	protein-coding gene	gene with protein product		606178	"""hedgehog-interacting protein"""			11435703, 11731473	Standard	NM_022475		Approved	HIP, FLJ20992	uc003ijs.2	Q96QV1	OTTHUMG00000161428	ENST00000296575.3:c.448T>C	4.37:g.145573925T>C	ENSP00000296575:p.Tyr150His	Somatic	0	36	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	18	43.75	Q6PK09|Q8NCI7|Q9BXK3|Q9H1J4|Q9H7E7	Missense_Mutation	SNP	45	0.00	0	45	43.04	34	pfam_Folate_rcpt-like,superfamily_Quinoprot_gluc/sorb_DH,smart_EG-like_dom,pfscan_EG-like_dom	p.Y150H	ENST00000296575.3	37	c.448	CCDS3762.1	4	.	.	.	.	.	.	.	.	.	.	T	17.55	3.416550	0.62511	.	.	ENSG00000164161	ENST00000296575;ENST00000434550	T;T	0.76448	-1.02;-1.02	5.83	4.66	0.58398	Folate receptor-like (1);	0.055575	0.85682	N	0.000000	T	0.79828	0.4513	L	0.50333	1.59	0.58432	D	0.999999	B;D	0.67145	0.018;0.996	B;P	0.58520	0.046;0.84	T	0.75181	-0.3408	10	0.17369	T	0.5	-18.6961	11.5715	0.50836	0.0:0.0693:0.0:0.9307	.	150;150	Q96QV1;Q96QV1-2	HHIP_HUMAN;.	H	150	ENSP00000296575:Y150H;ENSP00000408587:Y150H	ENSP00000296575:Y150H	Y	+	1	0	HHIP	145793375	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.043000	0.64208	1.049000	0.40321	0.533000	0.62120	TAC	-	pfam_Folate_rcpt-like		0.378	HHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHIP	protein_coding	OTTHUMT00000364887.2	T		-		145573925	+1	no_errors	ENST00000296575	ensembl	human	known	74_37	missense	SNP	1.000	C
FZD2	2535	genome.wustl.edu	37	17	42636675	42636675	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr17:42636675G>C	ENST00000315323.3	+	1	1751	c.1619G>C	c.(1618-1620)tGg>tCg	p.W540S		NM_001466.3	NP_001457.1	Q14332	FZD2_HUMAN	frizzled class receptor 2	540					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cell-cell signaling (GO:0007267)|cochlea morphogenesis (GO:0090103)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|inner ear receptor cell development (GO:0060119)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|sensory perception of smell (GO:0007608)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(8)	33		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		TTCTGGATCTGGTCGGGCAAG	0.622																																																	0								ENSG00000180340						32.0	31.0	31.0					17																	42636675		2203	4300	6503	FZD2	SO:0001583	missense	0			-	HGNC	L37882	CCDS11484.1	17q21.1	2014-01-29	2014-01-29			ENSG00000180340		"""GPCR / Class F : Frizzled receptors"""	4040	protein-coding gene	gene with protein product		600667	"""frizzled (Drosophila) homolog 2"", ""frizzled homolog 2 (Drosophila)"", ""frizzled 2, seven transmembrane spanning receptor"", ""frizzled family receptor 2"""			7558010, 9813155	Standard	NM_001466		Approved		uc002igx.2	Q14332		ENST00000315323.3:c.1619G>C	17.37:g.42636675G>C	ENSP00000323901:p.Trp540Ser	Somatic	0	78	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	103	18.90	Q0VG82	Missense_Mutation	SNP	32	0.00	0	68	12.82	10	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.W540S	ENST00000315323.3	37	c.1619	CCDS11484.1	17	.	.	.	.	.	.	.	.	.	.	g	18.93	3.728276	0.69074	.	.	ENSG00000180340	ENST00000541149;ENST00000315323	D	0.83837	-1.77	4.86	4.86	0.63082	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	D	0.92990	0.7769	M	0.93328	3.405	0.80722	D	1	P	0.50528	0.936	P	0.62885	0.908	D	0.94896	0.8052	10	0.87932	D	0	.	17.6599	0.88189	0.0:0.0:1.0:0.0	.	540	Q14332	FZD2_HUMAN	S	616;540	ENSP00000323901:W540S	ENSP00000323901:W540S	W	+	2	0	FZD2	39992201	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.866000	0.99616	2.236000	0.73375	0.555000	0.69702	TGG	-	pfam_Frizzled,pfscan_GPCR_2-like,prints_Frizzled		0.622	FZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD2	protein_coding	OTTHUMT00000457806.1	G	NM_001466	-		42636675	+1	no_errors	ENST00000315323	ensembl	human	known	74_37	missense	SNP	1.000	C
RP11-274B21.1	0	genome.wustl.edu	37	7	128263652	128263652	+	RNA	SNP	G	G	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr7:128263652G>A	ENST00000605862.1	+	0	1351																											TCGTATCGCTGATCTACGTAA	0.328																																																	0								ENSG00000242588																																			RP11-274B21.1			0			-	Clone_based_vega_gene																													7.37:g.128263652G>A		Somatic	0	35	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	31	16.22		RNA	SNP	35	0.00	0	69	15.85	13	-	NULL	ENST00000605862.1	37	NULL		7																																																																																			-	-		0.328	RP11-274B21.1-002	KNOWN	basic	processed_transcript	LOC101930494	pseudogene	OTTHUMT00000468355.1	G		-		128263652	+1	no_errors	ENST00000605862	ensembl	human	known	74_37	rna	SNP	0.029	A
TMOD3	29766	genome.wustl.edu	37	15	52201131	52201131	+	3'UTR	DEL	T	T	-			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr15:52201131delT	ENST00000308580.7	+	0	1464				TMOD3_ENST00000544199.1_3'UTR|RP11-56B16.4_ENST00000559302.1_RNA|U6_ENST00000606352.1_RNA	NM_014547.4	NP_055362.1	Q9NYL9	TMOD3_HUMAN	tropomodulin 3 (ubiquitous)							striated muscle thin filament (GO:0005865)	tropomyosin binding (GO:0005523)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|stomach(1)	14				all cancers(107;0.00194)		GTGACATGCATTTTTTTTTTA	0.279																																					Colon(122;1837 2251 18387 22826)												0								ENSG00000259185																																			RP11-56B16.4	SO:0001624	3_prime_UTR_variant	0				Clone_based_vega_gene	AF177171	CCDS10145.1	15q21.1-q21.2	2008-05-14			ENSG00000138594	ENSG00000138594			11873	protein-coding gene	gene with protein product		605112				10662549	Standard	NM_014547		Approved	UTMOD	uc002abn.3	Q9NYL9	OTTHUMG00000131803	ENST00000308580.7:c.*124T>-	15.37:g.52201131delT		Somatic	0	17	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	20	20.00	B2R6G7|Q9NT43|Q9NZR0	RNA	DEL	55	3.51	2	59	1.67	1	-	NULL	ENST00000308580.7	37	NULL	CCDS10145.1	15																																																																																			-	-		0.279	TMOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000259185	protein_coding	OTTHUMT00000254740.3	T				52201131	-1	no_errors	ENST00000559302	ensembl	human	known	74_37	rna	DEL	0.001	-
KIF21A	55605	genome.wustl.edu	37	12	39745740	39745740	+	Silent	SNP	T	T	C			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr12:39745740T>C	ENST00000361418.5	-	11	1527	c.1512A>G	c.(1510-1512)cgA>cgG	p.R504R	KIF21A_ENST00000541463.2_Silent_p.R504R|KIF21A_ENST00000361961.3_Silent_p.R504R|KIF21A_ENST00000395670.3_Silent_p.R504R|KIF21A_ENST00000544797.2_Silent_p.R504R			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	504					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				TCAAGTTTTTTCGAAGGTTCT	0.343																																																	0								ENSG00000139116						154.0	152.0	153.0					12																	39745740		2203	4300	6503	KIF21A	SO:0001819	synonymous_variant	0			-	HGNC	AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.1512A>G	12.37:g.39745740T>C		Somatic	0	36	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	27	44.90	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Silent	SNP	23	0.00	0	43	30.65	19	pfam_Kinesin_motor_dom,pfam_WD40_repeat,superfamily_P-loop_NTPase,superfamily_WD40_repeat_dom,superfamily_Prefoldin,superfamily_ARM-type_fold,smart_Kinesin_motor_dom,smart_WD40_repeat,pfscan_Kinesin_motor_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Kinesin_motor_dom	p.R504	ENST00000361418.5	37	c.1512	CCDS53776.1	12																																																																																			-	superfamily_ARM-type_fold		0.343	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF21A	protein_coding	OTTHUMT00000403581.1	T	NM_017641	-		39745740	-1	no_errors	ENST00000395670	ensembl	human	known	74_37	silent	SNP	0.766	C
ADAMTSL3	57188	genome.wustl.edu	37	15	84651157	84651157	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr15:84651157C>T	ENST00000286744.5	+	21	3001	c.2777C>T	c.(2776-2778)cCc>cTc	p.P926L	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.P926L	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	926	Ig-like C2-type 1.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			TATTTGCTGCCCAACACATCC	0.517																																																	0								ENSG00000156218						168.0	150.0	156.0					15																	84651157		2203	4300	6503	ADAMTSL3	SO:0001583	missense	0			-	HGNC	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.2777C>T	15.37:g.84651157C>T	ENSP00000286744:p.Pro926Leu	Somatic	0	44	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	44	12.00	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	34	0.00	0	41	12.77	6	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom,prints_Peptidase_M12B_ADAM-TS	p.P926L	ENST00000286744.5	37	c.2777	CCDS10326.1	15	.	.	.	.	.	.	.	.	.	.	C	17.00	3.277368	0.59758	.	.	ENSG00000156218	ENST00000286744	T	0.75821	-0.97	5.05	4.13	0.48395	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.42964	D	0.000637	T	0.67534	0.2903	L	0.41632	1.29	0.80722	D	1	P;B	0.41784	0.762;0.085	B;B	0.41412	0.356;0.072	T	0.68349	-0.5432	10	0.51188	T	0.08	.	12.5006	0.55953	0.0:0.9181:0.0:0.0819	.	926;926	P82987-2;P82987	.;ATL3_HUMAN	L	926	ENSP00000286744:P926L	ENSP00000286744:P926L	P	+	2	0	ADAMTSL3	82442161	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.162000	0.64942	1.092000	0.41356	0.563000	0.77884	CCC	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.517	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL3	protein_coding	OTTHUMT00000304007.2	C	NM_207517	-		84651157	+1	no_errors	ENST00000286744	ensembl	human	known	74_37	missense	SNP	1.000	T
DNM1P47	100216544	genome.wustl.edu	37	15	102299878	102299878	+	RNA	SNP	C	C	A	rs200606529	byFrequency	TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr15:102299878C>A	ENST00000561463.1	+	0	7924									DNM1 pseudogene 47																		TGCTGTCCAACCTGTACTCGC	0.582																																																	0								ENSG00000259660																																			DNM1P47			0			-	HGNC	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102299878C>A		Somatic	0	41	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	30	18.92		RNA	SNP	38	9.52	4	49	9.26	5	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	-		0.582	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	pseudogene	OTTHUMT00000417589.1	C	NG_009149	rs200606529		102299878	+1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	SNP	1.000	A
RORB	6096	genome.wustl.edu	37	9	77249620	77249620	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr9:77249620G>A	ENST00000396204.2	+	3	200	c.200G>A	c.(199-201)aGa>aAa	p.R67K	RORB_ENST00000376896.3_Missense_Mutation_p.R56K			Q92753	RORB_HUMAN	RAR-related orphan receptor B	67					amacrine cell differentiation (GO:0035881)|cellular response to retinoic acid (GO:0071300)|eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(2)|large_intestine(4)|lung(1)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	12					Melatonin(DB01065)	TTAATTGACAGAACGAACAGA	0.458																																																	0								ENSG00000198963						78.0	73.0	75.0					9																	77249620		2203	4300	6503	RORB	SO:0001583	missense	0			-	HGNC	Y08639	CCDS6646.1	9q22	2013-01-16			ENSG00000198963	ENSG00000198963		"""Nuclear hormone receptors"""	10259	protein-coding gene	gene with protein product		601972				7926749	Standard	NM_006914		Approved	RZRB, NR1F2, ROR-BETA	uc004ajh.3	Q92753	OTTHUMG00000020026	ENST00000396204.2:c.200G>A	9.37:g.77249620G>A	ENSP00000379507:p.Arg67Lys	Somatic	0	51	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	28	39.13	Q8WX73	Missense_Mutation	SNP	28	0.00	0	36	44.62	29	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_ROR_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_ThyrH_rcpt,pfscan_Znf_hrmn_rcpt	p.R67K	ENST00000396204.2	37	c.200		9	.	.	.	.	.	.	.	.	.	.	G	36	5.775832	0.96922	.	.	ENSG00000198963	ENST00000376896;ENST00000396204	D;D	0.96365	-3.99;-3.99	5.82	5.82	0.92795	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (3);	0.000000	0.85682	D	0.000000	D	0.95990	0.8694	N	0.13371	0.34	0.80722	D	1	D;P	0.89917	1.0;0.95	D;P	0.91635	0.999;0.863	D	0.95039	0.8176	10	0.27082	T	0.32	.	20.099	0.97865	0.0:0.0:1.0:0.0	.	67;56	Q92753;Q58EY0	RORB_HUMAN;.	K	56;67	ENSP00000366093:R56K;ENSP00000379507:R67K	ENSP00000366093:R56K	R	+	2	0	RORB	76439440	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.860000	0.99555	2.752000	0.94435	0.655000	0.94253	AGA	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt		0.458	RORB-201	KNOWN	basic	protein_coding	RORB	protein_coding		G		-		77249620	+1	no_errors	ENST00000396204	ensembl	human	known	74_37	missense	SNP	1.000	A
MYO1E	4643	genome.wustl.edu	37	15	59443210	59443215	+	Intron	DEL	ACACAC	ACACAC	-	rs551911622|rs377573502|rs60541381|rs71119434|rs371576539|rs71751195|rs368258578		TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	ACACAC	ACACAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr15:59443210_59443215delACACAC	ENST00000288235.4	-	26	3480				AC092757.1_ENST00000408169.1_RNA	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE						actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		GAGGAGAGGGacacacacacacacac	0.553																																																	0								ENSG00000221096																																			AC092757.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.3080+2573GTGTGT>-	15.37:g.59443216_59443221delACACAC		Somatic	NA	NA	NA		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q14778	RNA	DEL	29	14.71	5	33	13.16	5	-	NULL	ENST00000288235.4	37	NULL	CCDS32254.1	15																																																																																			-	-		0.553	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221096	protein_coding	OTTHUMT00000416024.1	ACACAC	NM_004998			59443215	-1	no_errors	ENST00000408169	ensembl	human	novel	74_37	rna	DEL	0.007:0.003:0.001:0.000:0.000:0.001	-
HECA	51696	genome.wustl.edu	37	6	139487930	139487930	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr6:139487930G>A	ENST00000367658.2	+	2	1066	c.781G>A	c.(781-783)Ggt>Agt	p.G261S	RP1-225E12.2_ENST00000586229.1_RNA|RP1-225E12.2_ENST00000588529.1_RNA|RP1-225E12.3_ENST00000585874.1_RNA|RP1-225E12.2_ENST00000591102.1_RNA|RP1-225E12.2_ENST00000586266.1_RNA|RP1-225E12.2_ENST00000415194.2_RNA|RP1-225E12.2_ENST00000588638.1_RNA|RP1-225E12.2_ENST00000590679.1_RNA|RP1-225E12.2_ENST00000589192.1_RNA|RP1-225E12.2_ENST00000587577.1_RNA	NM_016217.2	NP_057301.1	Q9UBI9	HDC_HUMAN	headcase homolog (Drosophila)	261					respiratory tube development (GO:0030323)	membrane (GO:0016020)				endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(68;0.000252)|OV - Ovarian serous cystadenocarcinoma(155;0.000387)		CGCAGCCTACGGTGCCCGTTC	0.682																																																	0								ENSG00000112406						15.0	18.0	17.0					6																	139487930		2203	4297	6500	HECA	SO:0001583	missense	0			-	HGNC	AB033492	CCDS5194.1	6q23-q24	2010-11-25			ENSG00000112406	ENSG00000112406			21041	protein-coding gene	gene with protein product		607977				11696983, 19643820	Standard	NM_016217		Approved	HDCL, hHDC, HDC, dJ225E12.1	uc003qin.3	Q9UBI9	OTTHUMG00000015686	ENST00000367658.2:c.781G>A	6.37:g.139487930G>A	ENSP00000356630:p.Gly261Ser	Somatic	0	21	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	8	57.89		Missense_Mutation	SNP	30	0.00	0	19	51.28	20	superfamily_Glycoside_hydrolase_SF	p.G261S	ENST00000367658.2	37	c.781	CCDS5194.1	6	.	.	.	.	.	.	.	.	.	.	G	7.780	0.709254	0.15239	.	.	ENSG00000112406	ENST00000367658	.	.	.	5.2	4.33	0.51752	.	0.314021	0.38217	N	0.001770	T	0.15046	0.0363	N	0.14661	0.345	0.43259	D	0.995194	B	0.25809	0.135	B	0.19946	0.027	T	0.08027	-1.0742	9	0.15499	T	0.54	.	10.0585	0.42259	0.1518:0.0:0.8482:0.0	.	261	Q9UBI9	HDC_HUMAN	S	261	.	ENSP00000356630:G261S	G	+	1	0	HECA	139529623	1.000000	0.71417	0.407000	0.26434	0.021000	0.10359	2.196000	0.42686	1.437000	0.47472	0.655000	0.94253	GGT	-	NULL		0.682	HECA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECA	protein_coding	OTTHUMT00000042456.1	G	NM_016217	-		139487930	+1	no_errors	ENST00000367658	ensembl	human	known	74_37	missense	SNP	0.928	A
GDAP2	54834	genome.wustl.edu	37	1	118412824	118412824	+	3'UTR	SNP	C	C	G			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr1:118412824C>G	ENST00000369443.5	-	0	2110					NM_017686.3	NP_060156.1	Q9NXN4	GDAP2_HUMAN	ganglioside induced differentiation associated protein 2						response to retinoic acid (GO:0032526)	lysosomal membrane (GO:0005765)				kidney(2)|large_intestine(3)|lung(9)|ovary(2)	16		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)		CTTAAGTACACAAAGGAAGCG	0.358																																																	0								ENSG00000196505																																			GDAP2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK000149	CCDS897.1, CCDS44201.1	1q11	2011-10-20			ENSG00000196505	ENSG00000196505			18010	protein-coding gene	gene with protein product						1021725	Standard	NM_017686		Approved	FLJ20142, dJ776P7.1, MACROD3	uc001ehf.3	Q9NXN4	OTTHUMG00000012199	ENST00000369443.5:c.*367G>C	1.37:g.118412824C>G		Somatic	0	10	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	12	29.41	Q96DZ0	RNA	SNP	38	0.00	0	53	25.35	18	-	NULL	ENST00000369443.5	37	NULL	CCDS897.1	1																																																																																			-	-		0.358	GDAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDAP2	protein_coding	OTTHUMT00000033732.2	C	NM_017686	-		118412824	-1	no_errors	ENST00000491626	ensembl	human	known	74_37	rna	SNP	0.967	G
PCDHB7	56129	genome.wustl.edu	37	5	140553993	140553993	+	Missense_Mutation	SNP	C	C	T	rs373682476		TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr5:140553993C>T	ENST00000231137.3	+	1	1751	c.1577C>T	c.(1576-1578)gCg>gTg	p.A526V		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	526	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A526E(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCCTGCAGGCGTTCGAGTTC	0.706																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000113212						63.0	69.0	67.0					5																	140553993		2203	4300	6503	PCDHB7	SO:0001583	missense	0			-	HGNC	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1577C>T	5.37:g.140553993C>T	ENSP00000231137:p.Ala526Val	Somatic	0	180	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	134	20.24	A1L3Y8	Missense_Mutation	SNP	33	0.00	0	37	21.28	10	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A526V	ENST00000231137.3	37	c.1577	CCDS4249.1	5	.	.	.	.	.	.	.	.	.	.	c	11.79	1.745104	0.30955	.	.	ENSG00000113212	ENST00000231137;ENST00000543636	T	0.03181	4.02	4.34	3.39	0.38822	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.06280	0.0162	N	0.17312	0.475	0.09310	N	1	D	0.59767	0.986	P	0.59487	0.858	T	0.44590	-0.9318	9	0.40728	T	0.16	.	10.0871	0.42425	0.4003:0.5997:0.0:0.0	.	526	Q9Y5E2	PCDB7_HUMAN	V	526;309	ENSP00000231137:A526V	ENSP00000231137:A526V	A	+	2	0	PCDHB7	140534177	0.000000	0.05858	0.435000	0.26784	0.622000	0.37654	-0.132000	0.10467	2.112000	0.64535	0.552000	0.68991	GCG	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.706	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	protein_coding	OTTHUMT00000251803.2	C	NM_018940	-		140553993	+1	no_errors	ENST00000231137	ensembl	human	known	74_37	missense	SNP	0.030	T
RAB6A	5870	genome.wustl.edu	37	11	73441811	73441811	+	Splice_Site	SNP	T	T	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr11:73441811T>A	ENST00000336083.3	-	2	583	c.128A>T	c.(127-129)cAg>cTg	p.Q43L	RAB6A_ENST00000536566.1_Splice_Site_p.Q10L|RAB6A_ENST00000310653.6_Splice_Site_p.Q43L|RAB6A_ENST00000541588.1_Splice_Site_p.Q43L	NM_198896.1	NP_942599.1	P20340	RAB6A_HUMAN	RAB6A, member RAS oncogene family	43					antigen processing and presentation (GO:0019882)|early endosome to Golgi transport (GO:0034498)|GTP catabolic process (GO:0006184)|minus-end-directed organelle transport along microtubule (GO:0072385)|peptidyl-cysteine methylation (GO:0018125)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)|protein domain specific binding (GO:0019904)			large_intestine(2)|lung(2)	4						ACAAAATACCTGATAGGTGTT	0.284																																																	0								ENSG00000175582						91.0	93.0	92.0					11																	73441811		2200	4293	6493	RAB6A	SO:0001630	splice_region_variant	0			-	HGNC	AF130986	CCDS8223.1, CCDS8224.1, CCDS58155.1, CCDS58156.1	11q13.3	2008-08-08			ENSG00000175582	ENSG00000175582		"""RAB, member RAS oncogene"""	9786	protein-coding gene	gene with protein product		179513		RAB6			Standard	NM_001243718		Approved		uc001ouf.3	P20340	OTTHUMG00000134308	ENST00000336083.3:c.129+1A>T	11.37:g.73441811T>A		Somatic	0	41	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	25	50.00	A8K133|B7Z772|F5H668|Q1W5D8|Q5U0A8|Q9UBE4	Missense_Mutation	SNP	44	0.00	0	51	50.00	51	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,pfam_SRP_receptor_beta_su,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.Q43L	ENST00000336083.3	37	c.128	CCDS8224.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.7|21.7	4.190804|4.190804	0.78789|0.78789	.|.	.|.	ENSG00000175582|ENSG00000175582	ENST00000310653;ENST00000336083;ENST00000393571;ENST00000536566;ENST00000541588;ENST00000540771;ENST00000539750;ENST00000535748;ENST00000542366|ENST00000541973;ENST00000400470	T;T;T;T;T|.	0.76709|.	-1.04;-1.04;-1.04;-1.04;-1.04|.	4.59|4.59	4.59|4.59	0.56863|0.56863	Small GTP-binding protein domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.48822|0.48822	0.1521|0.1521	N|N	0.21617|0.21617	0.685|0.685	0.50632|0.50632	D|D	0.999888|0.999888	P;D;B;B|.	0.76494|.	0.947;0.999;0.236;0.015|.	P;D;B;B|.	0.80764|.	0.908;0.994;0.121;0.064|.	T|T	0.42531|0.42531	-0.9446|-0.9446	10|5	0.87932|.	D|.	0|.	-1.6668|-1.6668	11.4519|11.4519	0.50158|0.50158	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	43;43;43;43|.	Q1W5D8;F5H3K7;P20340;P20340-2|.	.;.;RAB6A_HUMAN;.|.	L|W	43;43;43;10;43;43;43;43;43|36;35	ENSP00000311449:Q43L;ENSP00000336850:Q43L;ENSP00000437863:Q10L;ENSP00000445350:Q43L;ENSP00000438842:Q43L|.	ENSP00000311449:Q43L|.	Q|R	-|-	2|1	0|2	RAB6A|RAB6A	73119459|73119459	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	6.411000|6.411000	0.73298|0.73298	1.927000|1.927000	0.55829|0.55829	0.455000|0.455000	0.32223|0.32223	CAG|AGG	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,pfam_SRP_receptor_beta_su,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.284	RAB6A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAB6A	protein_coding	OTTHUMT00000259241.2	T		-	Missense_Mutation	73441811	-1	no_errors	ENST00000310653	ensembl	human	known	74_37	missense	SNP	1.000	A
KRTAP16-1	100505753	genome.wustl.edu	37	17	39465423	39465423	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr17:39465423G>T	ENST00000391352.1	-	1	82	c.83C>A	c.(82-84)cCc>cAc	p.P28H		NM_001146182.1	NP_001139654.1	A8MUX0	KR161_HUMAN	keratin associated protein 16-1	28						keratin filament (GO:0045095)				haematopoietic_and_lymphoid_tissue(1)	1						CAGGCAGATGGGGCCTCCACA	0.607																																																	0								ENSG00000212657																																			KRTAP16-1	SO:0001583	missense	0			-	HGNC	AP001708	CCDS56032.1	17q21.2	2012-07-04			ENSG00000212657	ENSG00000212657		"""Keratin associated proteins"""	18916	protein-coding gene	gene with protein product							Standard	NM_001146182		Approved	KAP16.1	uc021txi.1	A8MUX0	OTTHUMG00000133640	ENST00000391352.1:c.83C>A	17.37:g.39465423G>T	ENSP00000375147:p.Pro28His	Somatic	0	57	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	87	10.31		Missense_Mutation	SNP	35	0.00	0	113	10.32	13	NULL	p.P28H	ENST00000391352.1	37	c.83	CCDS56032.1	17	.	.	.	.	.	.	.	.	.	.	G	12.96	2.095736	0.36952	.	.	ENSG00000212657	ENST00000391352	T	0.00700	5.82	5.87	5.87	0.94306	.	.	.	.	.	T	0.01421	0.0046	L	0.31664	0.95	0.27745	N	0.944364	.	.	.	.	.	.	T	0.58493	-0.7627	7	0.40728	T	0.16	.	15.6948	0.77488	0.0:0.0:1.0:0.0	.	.	.	.	H	28	ENSP00000375147:P28H	ENSP00000375147:P28H	P	-	2	0	KRTAP16-1	36718949	0.994000	0.37717	0.537000	0.28052	0.143000	0.21401	5.124000	0.64709	2.780000	0.95670	0.561000	0.74099	CCC	-	NULL		0.607	KRTAP16-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP16-1	protein_coding	OTTHUMT00000257785.1	G	NM_001146182	-		39465423	-1	no_errors	ENST00000391352	ensembl	human	known	74_37	missense	SNP	0.559	T
SLC30A6	55676	genome.wustl.edu	37	2	32417472	32417472	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr2:32417472A>C	ENST00000282587.5	+	6	389	c.352A>C	c.(352-354)Ata>Cta	p.I118L	SLC30A6_ENST00000538303.1_Missense_Mutation_p.I89L|SLC30A6_ENST00000357055.3_5'UTR|SLC30A6_ENST00000406369.1_Missense_Mutation_p.I44L|SLC30A6_ENST00000379343.2_Missense_Mutation_p.I158L|SLC30A6_ENST00000435660.1_Missense_Mutation_p.I118L	NM_017964.3	NP_060434.2	Q6NXT4	ZNT6_HUMAN	solute carrier family 30 (zinc transporter), member 6	118					cellular protein metabolic process (GO:0044267)|Golgi to endosome transport (GO:0006895)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(4)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					AGCTCTCTTTATATTAAAAGA	0.378																																																	0								ENSG00000152683						90.0	90.0	90.0					2																	32417472		2203	4300	6503	SLC30A6	SO:0001583	missense	0			-	HGNC	AK055663	CCDS1780.1, CCDS54341.1, CCDS54342.1, CCDS54343.1	2p22.3	2013-05-22			ENSG00000152683	ENSG00000152683		"""Solute carriers"""	19305	protein-coding gene	gene with protein product		611148					Standard	NM_017964		Approved	FLJ31101, ZNT6	uc002rof.2	Q6NXT4	OTTHUMG00000128456	ENST00000282587.5:c.352A>C	2.37:g.32417472A>C	ENSP00000282587:p.Ile118Leu	Somatic	0	60	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	25	47.92	A5YM45|B7Z901|Q8N5C9|Q96NC3	Missense_Mutation	SNP	32	0.00	0	39	43.48	30	pfam_Cation_efflux,tigrfam_Cation_efflux	p.I118L	ENST00000282587.5	37	c.352	CCDS1780.1	2	.	.	.	.	.	.	.	.	.	.	A	14.55	2.570030	0.45798	.	.	ENSG00000152683	ENST00000379343;ENST00000440718;ENST00000282587;ENST00000435660;ENST00000538303;ENST00000406369	T;T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1;-0.1;-0.1	5.66	5.66	0.87406	.	0.088458	0.85682	D	0.000000	T	0.49508	0.1561	N	0.21240	0.645	0.80722	D	1	B;B;B;B	0.12013	0.001;0.004;0.001;0.005	B;B;B;B	0.15484	0.013;0.006;0.008;0.013	T	0.41466	-0.9507	10	0.34782	T	0.22	-9.6286	15.1835	0.72978	1.0:0.0:0.0:0.0	.	89;118;158;118	B7Z901;Q6NXT4-3;Q6NXT4-2;Q6NXT4	.;.;.;ZNT6_HUMAN	L	158;89;118;118;89;44	ENSP00000368648:I158L;ENSP00000393946:I89L;ENSP00000282587:I118L;ENSP00000399005:I118L;ENSP00000440678:I89L;ENSP00000384041:I44L	ENSP00000282587:I118L	I	+	1	0	SLC30A6	32270976	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.008000	0.76341	2.285000	0.76669	0.533000	0.62120	ATA	-	pfam_Cation_efflux,tigrfam_Cation_efflux		0.378	SLC30A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A6	protein_coding	OTTHUMT00000250254.2	A		-		32417472	+1	no_errors	ENST00000282587	ensembl	human	known	74_37	missense	SNP	1.000	C
KRTAP4-9	100132386	genome.wustl.edu	37	17	39261912	39261912	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr17:39261912G>C	ENST00000391415.1	+	1	329	c.272G>C	c.(271-273)aGg>aCg	p.R91T		NM_001146041.1	NP_001139513.1	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	91	29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|urinary_tract(3)	14						AGCTGCTGCAGGCCCCAGTGC	0.652																																																	0								ENSG00000212722						11.0	19.0	16.0					17																	39261912		687	1588	2275	KRTAP4-9	SO:0001583	missense	0			-	HGNC	AJ406941	CCDS54124.1	17q21.2	2013-06-25			ENSG00000212722	ENSG00000212722		"""Keratin associated proteins"""	18910	protein-coding gene	gene with protein product							Standard	NM_001146041		Approved	KAP4.9	uc010wfp.2	Q9BYQ8	OTTHUMG00000133584	ENST00000391415.1:c.272G>C	17.37:g.39261912G>C	ENSP00000375234:p.Arg91Thr	Somatic	0	251	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	99	196	33.45		Missense_Mutation	SNP	36	0.00	0	48	30.43	21	pfam_Keratin-assoc	p.R91T	ENST00000391415.1	37	c.272	CCDS54124.1	17	.	.	.	.	.	.	.	.	.	.	.	11.96	1.793846	0.31777	.	.	ENSG00000212722	ENST00000391415;ENST00000333994	T	0.46819	0.86	3.34	0.805	0.18703	.	1.564990	0.05107	U	0.488202	T	0.46889	0.1416	M	0.72576	2.205	0.20764	N	0.999856	P	0.51791	0.948	P	0.46208	0.507	T	0.44236	-0.9341	10	0.22706	T	0.39	.	2.3211	0.04211	0.1886:0.0:0.5077:0.3037	.	91	Q9BYQ8	KRA49_HUMAN	T	91	ENSP00000375234:R91T	ENSP00000334461:R91T	R	+	2	0	KRTAP4-9	36515438	0.000000	0.05858	0.983000	0.44433	0.372000	0.29890	-0.064000	0.11636	1.398000	0.46701	0.205000	0.17691	AGG	-	pfam_Keratin-assoc		0.652	KRTAP4-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-9	protein_coding	OTTHUMT00000257688.1	G	NM_001146041	-		39261912	+1	no_errors	ENST00000391415	ensembl	human	known	74_37	missense	SNP	0.436	C
FKBP10	60681	genome.wustl.edu	37	17	39974736	39974736	+	Silent	SNP	G	G	A	rs369189363		TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr17:39974736G>A	ENST00000321562.4	+	4	788	c.684G>A	c.(682-684)aaG>aaA	p.K228K	FKBP10_ENST00000544340.1_5'Flank	NM_021939.3	NP_068758.3	Q96AY3	FKB10_HUMAN	FK506 binding protein 10, 65 kDa	228	PPIase FKBP-type 2. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			cervix(1)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)		AGAGAAGGAAGATTATCATCC	0.557																																																	0								ENSG00000141756	G		1,4405	2.1+/-5.4	0,1,2202	117.0	96.0	103.0		684	4.6	1.0	17		103	0,8600		0,0,4300	no	coding-synonymous	FKBP10	NM_021939.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		228/583	39974736	1,13005	2203	4300	6503	FKBP10	SO:0001819	synonymous_variant	0			-	HGNC	AB045981	CCDS11409.1	17q21.2	2014-09-17	2002-08-29		ENSG00000141756	ENSG00000141756		"""EF-hand domain containing"""	18169	protein-coding gene	gene with protein product		607063	"""FK506 binding protein 10 (65 kDa)"""			11071917, 18786928	Standard	NM_021939		Approved	hFKBP65, FLJ22041, FKBP6, FLJ20683, FLJ23833	uc002hxv.2	Q96AY3	OTTHUMG00000133497	ENST00000321562.4:c.684G>A	17.37:g.39974736G>A		Somatic	0	45	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	61	17.57	Q7Z3R4|Q9H3N3|Q9H6J3|Q9H6N5|Q9UF89	Silent	SNP	40	0.00	0	56	15.15	10	pfam_PPIase_FKBP_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_PPIase_FKBP_dom	p.K228	ENST00000321562.4	37	c.684	CCDS11409.1	17																																																																																			-	pfam_PPIase_FKBP_dom,pfscan_PPIase_FKBP_dom		0.557	FKBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP10	protein_coding	OTTHUMT00000257410.2	G	NM_021939	-		39974736	+1	no_errors	ENST00000321562	ensembl	human	known	74_37	silent	SNP	1.000	A
AQP3	360	genome.wustl.edu	37	9	33443824	33443824	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr9:33443824T>C	ENST00000297991.4	-	2	255	c.175A>G	c.(175-177)Atc>Gtc	p.I59V	AQP3_ENST00000493581.1_5'UTR	NM_004925.4	NP_004916.1	Q92482	AQP3_HUMAN	aquaporin 3 (Gill blood group)	59					excretion (GO:0007588)|odontogenesis (GO:0042476)|positive regulation of immune system process (GO:0002684)|regulation of keratinocyte differentiation (GO:0045616)|renal water absorption (GO:0070295)|response to calcium ion (GO:0051592)|response to retinoic acid (GO:0032526)|response to vitamin D (GO:0033280)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urea transport (GO:0015840)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|transporter activity (GO:0005215)|water channel activity (GO:0015250)			endometrium(2)|large_intestine(3)|lung(2)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.0899)		GCCAGGTTGATGGTGAGGAAA	0.607																																																	0								ENSG00000165272						58.0	51.0	53.0					9																	33443824		2203	4300	6503	AQP3	SO:0001583	missense	0			-	HGNC		CCDS6542.1	9p13	2014-07-18	2006-02-23		ENSG00000165272	ENSG00000165272		"""Ion channels / Aquaporins"", ""Blood group antigens"""	636	protein-coding gene	gene with protein product	"""Gill blood group"""	600170	"""aquaporin 3"", ""aquaporin 3 (GIL blood group)"""			7558005	Standard	NM_004925		Approved	GIL	uc003zsx.3	Q92482	OTTHUMG00000019769	ENST00000297991.4:c.175A>G	9.37:g.33443824T>C	ENSP00000297991:p.Ile59Val	Somatic	0	56	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	29	29.27	A8K843|B2RE16|D3DRL3|O00108|Q6FGT2|Q6FGW6	Missense_Mutation	SNP	41	0.00	0	33	28.26	13	pfam_MIP,superfamily_Aquaporin-like,prints_Aquaporin_3,prints_MIP,tigrfam_MIP	p.I59V	ENST00000297991.4	37	c.175	CCDS6542.1	9	.	.	.	.	.	.	.	.	.	.	T	9.351	1.065407	0.20067	.	.	ENSG00000165272	ENST00000297991;ENST00000343952	D	0.83992	-1.79	5.69	4.5	0.54988	Aquaporin-like (2);	0.048424	0.85682	D	0.000000	T	0.66645	0.2810	N	0.15975	0.35	0.37090	D	0.899392	B;B;B	0.32526	0.374;0.001;0.01	B;B;B	0.37091	0.241;0.004;0.014	T	0.64765	-0.6330	10	0.22109	T	0.4	1.5056	4.0518	0.09798	0.0:0.1751:0.1899:0.6349	.	59;59;59	C9JAH5;Q92482;B4E034	.;AQP3_HUMAN;.	V	59	ENSP00000297991:I59V	ENSP00000297991:I59V	I	-	1	0	AQP3	33433824	1.000000	0.71417	1.000000	0.80357	0.699000	0.40488	4.069000	0.57541	2.164000	0.68074	0.523000	0.50628	ATC	-	pfam_MIP,superfamily_Aquaporin-like,tigrfam_MIP		0.607	AQP3-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	AQP3	protein_coding	OTTHUMT00000052055.1	T	NM_004925	-		33443824	-1	no_errors	ENST00000297991	ensembl	human	known	74_37	missense	SNP	1.000	C
ST6GALNAC4	27090	genome.wustl.edu	37	9	130678404	130678404	+	Intron	SNP	G	G	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr9:130678404G>A	ENST00000335791.5	-	2	288				ST6GALNAC4_ENST00000495983.1_5'Flank|ST6GALNAC4_ENST00000343609.2_Intron	NM_175039.3	NP_778204.1	Q9H4F1	SIA7D_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4						cellular protein metabolic process (GO:0044267)|glycolipid metabolic process (GO:0006664)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	(alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl-galactosaminide 6-alpha-sialyltransferase activity (GO:0047290)|sialyltransferase activity (GO:0008373)			endometrium(1)|large_intestine(2)|lung(2)|prostate(2)	7						CGGCTGAACTGAACTTCACAA	0.547																																																	0								ENSG00000136840																																			ST6GALNAC4	SO:0001627	intron_variant	0			-	HGNC	AB035172	CCDS6883.1	9q34	2013-03-01	2005-02-07	2005-02-07	ENSG00000136840	ENSG00000136840	2.4.99.7	"""Sialyltransferases"""	17846	protein-coding gene	gene with protein product		606378	"""sialyltransferase 7D ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase)"""	SIAT7D		10207017, 11062056	Standard	XM_005251922		Approved	ST6GALNACIV, SIAT3C	uc004bss.3	Q9H4F1	OTTHUMG00000020724	ENST00000335791.5:c.12+282C>T	9.37:g.130678404G>A		Somatic	0	9	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	39	27.78	Q5T9D0|Q9NWU6|Q9UKU1|Q9ULB9|Q9Y3G3|Q9Y3G4	RNA	SNP	42	0.00	0	352	20.18	89	-	NULL	ENST00000335791.5	37	NULL	CCDS6883.1	9																																																																																			-	-		0.547	ST6GALNAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALNAC4	protein_coding	OTTHUMT00000054317.2	G	NM_175040	-		130678404	-1	no_errors	ENST00000479747	ensembl	human	known	74_37	rna	SNP	0.000	A
HEPHL1	341208	genome.wustl.edu	37	11	93819316	93819316	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr11:93819316C>G	ENST00000315765.9	+	11	2049	c.2041C>G	c.(2041-2043)Cac>Gac	p.H681D		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	681	Plastocyanin-like 4.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				CCTGTTTCCCCACATGGCCAC	0.517																																																	0								ENSG00000181333						77.0	75.0	75.0					11																	93819316		2014	4188	6202	HEPHL1	SO:0001583	missense	0			-	HGNC	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.2041C>G	11.37:g.93819316C>G	ENSP00000313699:p.His681Asp	Somatic	0	80	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	27	64.00	Q3C1W7	Missense_Mutation	SNP	39	0.00	0	35	57.32	47	pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Cupredoxin	p.H681D	ENST00000315765.9	37	c.2041	CCDS44710.1	11	.	.	.	.	.	.	.	.	.	.	C	25.0	4.590509	0.86851	.	.	ENSG00000181333	ENST00000315765	D	0.99751	-6.63	5.94	5.94	0.96194	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.99746	0.9899	M	0.80982	2.52	0.54753	D	0.999987	D	0.76494	0.999	D	0.73380	0.98	D	0.98908	1.0779	10	0.34782	T	0.22	.	20.3736	0.98901	0.0:1.0:0.0:0.0	.	681	Q6MZM0	HPHL1_HUMAN	D	681	ENSP00000313699:H681D	ENSP00000313699:H681D	H	+	1	0	HEPHL1	93458964	1.000000	0.71417	0.995000	0.50966	0.847000	0.48162	7.332000	0.79203	2.820000	0.97059	0.650000	0.86243	CAC	-	superfamily_Cupredoxin		0.517	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	HEPHL1	protein_coding	OTTHUMT00000396103.2	C	XM_291947	-		93819316	+1	no_errors	ENST00000315765	ensembl	human	known	74_37	missense	SNP	1.000	G
KCNA5	3741	genome.wustl.edu	37	12	5154464	5154464	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr12:5154464G>T	ENST00000252321.3	+	1	1380	c.1151G>T	c.(1150-1152)gGa>gTa	p.G384V		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	384	Poly-Gly.				atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	CCAGGGGGTGGAGGAGGCGGC	0.627																																																	0								ENSG00000130037						55.0	51.0	53.0					12																	5154464		2203	4300	6503	KCNA5	SO:0001583	missense	0			-	HGNC	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1151G>T	12.37:g.5154464G>T	ENSP00000252321:p.Gly384Val	Somatic	0	48	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	44	22.81	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	40	0.00	0	41	18.00	9	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.G384V	ENST00000252321.3	37	c.1151	CCDS8536.1	12	.	.	.	.	.	.	.	.	.	.	G	9.567	1.119901	0.20877	.	.	ENSG00000130037	ENST00000252321	D	0.97731	-4.51	4.62	4.62	0.57501	Ion transport (1);	2.171590	0.03002	U	0.148348	D	0.97529	0.9191	L	0.39245	1.2	0.28833	N	0.897056	P	0.47604	0.898	P	0.55667	0.781	D	0.91902	0.5532	10	0.42905	T	0.14	.	10.2779	0.43521	0.0896:0.0:0.9104:0.0	.	384	P22460	KCNA5_HUMAN	V	384	ENSP00000252321:G384V	ENSP00000252321:G384V	G	+	2	0	KCNA5	5024725	0.028000	0.19301	0.118000	0.21660	0.211000	0.24417	0.987000	0.29603	2.390000	0.81377	0.561000	0.74099	GGA	-	pfam_Ion_trans_dom		0.627	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	protein_coding	OTTHUMT00000398925.2	G	NM_002234	-		5154464	+1	no_errors	ENST00000252321	ensembl	human	known	74_37	missense	SNP	0.088	T
APLP1	333	genome.wustl.edu	37	19	36365487	36365487	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr19:36365487G>A	ENST00000221891.4	+	9	1330	c.1138G>A	c.(1138-1140)Gtc>Atc	p.V380I	APLP1_ENST00000537454.2_Missense_Mutation_p.V341I|APLP1_ENST00000589298.2_3'UTR|APLP1_ENST00000586861.1_Missense_Mutation_p.V374I	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	380					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)			breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CGCCACCCGCGTCATCGCCCT	0.677																																																	0								ENSG00000105290						62.0	66.0	65.0					19																	36365487		2203	4300	6503	APLP1	SO:0001583	missense	0			-	HGNC	U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.1138G>A	19.37:g.36365487G>A	ENSP00000221891:p.Val380Ile	Somatic	0	35	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	29	27.50	O00113|Q96A92	Missense_Mutation	SNP	35	0.00	0	21	53.33	24	pfam_Amyloid_glyco_heparin-bd,pfam_APP_amyloid_C,superfamily_Amyloid_glyco_E2_domain,superfamily_Amyloid_glyco_heparin-bd,superfamily_Amyloid_glyco_Cu-bd,smart_Amyloid_glyco_extra,prints_Amyloid_glyco	p.V380I	ENST00000221891.4	37	c.1138	CCDS32997.1	19	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400826	0.62177	.	.	ENSG00000105290	ENST00000537454;ENST00000221891	T;T	0.51071	0.72;0.72	4.51	4.51	0.55191	Amyloidogenic glycoprotein, E2 domain (2);	0.159512	0.29459	N	0.012096	T	0.59514	0.2199	M	0.71036	2.16	0.58432	D	0.999999	P;P;D;D	0.71674	0.899;0.946;0.998;0.998	B;B;P;P	0.54312	0.339;0.368;0.633;0.748	T	0.62072	-0.6931	10	0.40728	T	0.16	-14.8541	14.718	0.69284	0.0:0.0:1.0:0.0	.	374;341;380;380	B7Z4G8;F5GZ08;P51693-2;P51693	.;.;.;APLP1_HUMAN	I	341;380	ENSP00000441501:V341I;ENSP00000221891:V380I	ENSP00000221891:V380I	V	+	1	0	APLP1	41057327	1.000000	0.71417	0.993000	0.49108	0.677000	0.39632	8.949000	0.93012	2.058000	0.61347	0.555000	0.69702	GTC	-	superfamily_Amyloid_glyco_E2_domain		0.677	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	APLP1	protein_coding	OTTHUMT00000452564.1	G	NM_001024807	-		36365487	+1	no_errors	ENST00000221891	ensembl	human	known	74_37	missense	SNP	1.000	A
IL17RC	84818	genome.wustl.edu	37	3	9972614	9972614	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr3:9972614C>A	ENST00000295981.3	+	16	1805	c.1587C>A	c.(1585-1587)tgC>tgA	p.C529*	CRELD1_ENST00000397170.3_5'Flank|IL17RC_ENST00000413608.1_Nonsense_Mutation_p.C458*|CRELD1_ENST00000383811.3_5'Flank|CRELD1_ENST00000452070.1_5'Flank|IL17RC_ENST00000383812.4_Nonsense_Mutation_p.C443*|IL17RC_ENST00000455057.1_Nonsense_Mutation_p.C426*|CRELD1_ENST00000326434.5_5'Flank|IL17RC_ENST00000403601.3_Nonsense_Mutation_p.C458*|IL17RC_ENST00000498214.1_3'UTR|IL17RC_ENST00000416074.2_Nonsense_Mutation_p.C297*	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	529					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						TATGGGCCTGCCCCATGGACA	0.507																																																	0								ENSG00000163702						285.0	266.0	272.0					3																	9972614		2203	4300	6503	IL17RC	SO:0001587	stop_gained	0			-	HGNC	BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.1587C>A	3.37:g.9972614C>A	ENSP00000295981:p.Cys529*	Somatic	0	51	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	30	25.00	E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	Nonsense_Mutation	SNP	39	0.00	0	38	26.92	14	pfam_SEFIR	p.C529*	ENST00000295981.3	37	c.1587	CCDS2590.1	3	.	.	.	.	.	.	.	.	.	.	C	38	7.098638	0.98063	.	.	ENSG00000163702	ENST00000383812;ENST00000295981;ENST00000403601;ENST00000416074;ENST00000455057;ENST00000413608	.	.	.	4.55	2.75	0.32379	.	0.000000	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.9941	7.7129	0.28688	0.0:0.8024:0.0:0.1976	.	.	.	.	X	443;529;458;297;426;458	.	ENSP00000295981:C529X	C	+	3	2	IL17RC	9947614	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	0.880000	0.28159	0.623000	0.30267	0.462000	0.41574	TGC	-	NULL		0.507	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL17RC	protein_coding	OTTHUMT00000250526.2	C	NM_032732	-		9972614	+1	no_errors	ENST00000295981	ensembl	human	known	74_37	nonsense	SNP	1.000	A
PHLDB1	23187	genome.wustl.edu	37	11	118513072	118513072	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr11:118513072C>G	ENST00000361417.2	+	14	3248	c.2837C>G	c.(2836-2838)tCt>tGt	p.S946C	PHLDB1_ENST00000356063.5_Intron|PHLDB1_ENST00000527898.1_Intron|PHLDB1_ENST00000524713.1_Missense_Mutation_p.S89C|PHLDB1_ENST00000534672.1_Intron	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	946										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CCTCACTCTTCTCCCCCGCCT	0.637																																																	0								ENSG00000019144						65.0	68.0	67.0					11																	118513072		2200	4295	6495	PHLDB1	SO:0001583	missense	0			-	HGNC		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.2837C>G	11.37:g.118513072C>G	ENSP00000354498:p.Ser946Cys	Somatic	0	80	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	23	60.34	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	28	0.00	0	13	63.89	23	pfam_Pleckstrin_homology,superfamily_SMAD_FHA_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S946C	ENST00000361417.2	37	c.2837	CCDS8401.1	11	.	.	.	.	.	.	.	.	.	.	C	12.08	1.830333	0.32329	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000358191;ENST00000524713	T;T	0.49720	0.88;0.77	4.89	4.89	0.63831	.	0.649472	0.14224	N	0.333196	T	0.44664	0.1304	L	0.38838	1.175	0.32842	D	0.505447	B;B;P	0.44877	0.184;0.05;0.845	B;B;B	0.43754	0.083;0.022;0.43	T	0.57505	-0.7800	10	0.49607	T	0.09	-9.4348	14.7972	0.69886	0.0:1.0:0.0:0.0	.	84;89;946	B7Z2B9;B4DK17;Q86UU1	.;.;PHLB1_HUMAN	C	946;705;310;89	ENSP00000354498:S946C;ENSP00000434905:S89C	ENSP00000350921:S310C	S	+	2	0	PHLDB1	118018282	0.997000	0.39634	0.997000	0.53966	0.915000	0.54546	4.652000	0.61454	2.254000	0.74563	0.455000	0.32223	TCT	-	NULL		0.637	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	protein_coding	OTTHUMT00000389279.1	C	NM_015157	-		118513072	+1	no_errors	ENST00000361417	ensembl	human	known	74_37	missense	SNP	0.966	G
LZTS1	11178	genome.wustl.edu	37	8	20110991	20110991	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr8:20110991G>C	ENST00000381569.1	-	3	808	c.451C>G	c.(451-453)Ccc>Gcc	p.P151A	LZTS1_ENST00000522290.1_Missense_Mutation_p.P151A|LZTS1_ENST00000265801.6_Missense_Mutation_p.P151A			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	151					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		GGAGGGGCGGGGTGCAGCTGG	0.672																																																	0								ENSG00000061337						21.0	21.0	21.0					8																	20110991		2201	4298	6499	LZTS1	SO:0001583	missense	0			-	HGNC	AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.451C>G	8.37:g.20110991G>C	ENSP00000370981:p.Pro151Ala	Somatic	0	95	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	58	40.82	D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Missense_Mutation	SNP	32	0.00	0	25	50.98	26	NULL	p.P151A	ENST00000381569.1	37	c.451	CCDS6015.1	8	.	.	.	.	.	.	.	.	.	.	G	3.437	-0.114808	0.06881	.	.	ENSG00000061337	ENST00000381569;ENST00000265801;ENST00000522290;ENST00000360248	T;T;T	0.22134	2.3;2.3;1.97	5.79	4.9	0.64082	.	0.647894	0.16662	N	0.204726	T	0.12263	0.0298	N	0.14661	0.345	0.42913	D	0.994262	P;B	0.43662	0.814;0.029	B;B	0.38985	0.287;0.008	T	0.04255	-1.0965	10	0.06757	T	0.87	-25.5428	15.5009	0.75698	0.0:0.139:0.861:0.0	.	151;151	Q9Y250-4;Q9Y250	.;LZTS1_HUMAN	A	151	ENSP00000370981:P151A;ENSP00000265801:P151A;ENSP00000429263:P151A	ENSP00000265801:P151A	P	-	1	0	LZTS1	20155271	1.000000	0.71417	0.928000	0.36995	0.962000	0.63368	3.404000	0.52623	1.403000	0.46800	0.561000	0.74099	CCC	-	NULL		0.672	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTS1	protein_coding	OTTHUMT00000214122.1	G	NM_021020	-		20110991	-1	no_errors	ENST00000265801	ensembl	human	known	74_37	missense	SNP	0.999	C
SLC25A3	5250	genome.wustl.edu	37	12	98993839	98993839	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr12:98993839C>T	ENST00000228318.3	+	6	871	c.751C>T	c.(751-753)Cct>Tct	p.P251S	SLC25A3_ENST00000401722.3_Missense_Mutation_p.P250S|SNORA53_ENST00000391141.1_RNA|SLC25A3_ENST00000188376.5_Missense_Mutation_p.P250S|SLC25A3_ENST00000549338.1_Missense_Mutation_p.P250S|SLC25A3_ENST00000551917.1_Missense_Mutation_p.P251S|SLC25A3_ENST00000552981.1_Missense_Mutation_p.P250S|SLC25A3_ENST00000548847.1_Missense_Mutation_p.P250S	NM_005888.3	NP_005879.1	Q00325	MPCP_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3	251					generation of precursor metabolites and energy (GO:0006091)|phosphate ion transmembrane transport (GO:0035435)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	phosphate ion carrier activity (GO:0015320)|protein complex binding (GO:0032403)|symporter activity (GO:0015293)			breast(1)|endometrium(2)|large_intestine(4)|lung(8)|prostate(1)	16		Lung NSC(355;4.08e-05)|Breast(359;0.00191)|Colorectal(145;0.00205)|Myeloproliferative disorder(1001;0.0255)		GBM - Glioblastoma multiforme(134;1.36e-23)|BRCA - Breast invasive adenocarcinoma(302;0.000115)		GTTTGTGGTTCCTAAGCCCCG	0.448																																																	0								ENSG00000075415						151.0	124.0	133.0					12																	98993839		2203	4300	6503	SLC25A3	SO:0001583	missense	0			-	HGNC		CCDS9065.1, CCDS9066.1	12q23.1	2013-05-22			ENSG00000075415	ENSG00000075415		"""Solute carriers"""	10989	protein-coding gene	gene with protein product		600370		PHC		8168843	Standard	NM_213611		Approved		uc001tfo.3	Q00325	OTTHUMG00000170212	ENST00000228318.3:c.751C>T	12.37:g.98993839C>T	ENSP00000228318:p.Pro251Ser	Somatic	0	53	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	270	44	85.99	B3KS34|Q7Z7N7|Q96A03	Missense_Mutation	SNP	30	0.00	0	45	90.13	411	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.P251S	ENST00000228318.3	37	c.751	CCDS9066.1	12	.	.	.	.	.	.	.	.	.	.	C	19.46	3.831718	0.71258	.	.	ENSG00000075415	ENST00000401722;ENST00000188376;ENST00000228318;ENST00000551917;ENST00000552981;ENST00000549338;ENST00000548847	T;T;T;T;T;T;T	0.79247	-1.25;-1.25;-1.03;-1.03;-1.25;-1.25;-1.15	5.49	5.49	0.81192	Mitochondrial carrier domain (2);	0.157467	0.64402	D	0.000020	T	0.80352	0.4607	M	0.67953	2.075	0.80722	D	1	B;B;B;P	0.35793	0.09;0.114;0.246;0.521	B;B;B;B	0.40410	0.086;0.058;0.058;0.328	T	0.81618	-0.0851	10	0.66056	D	0.02	-19.2098	17.9155	0.88948	0.0:1.0:0.0:0.0	.	250;250;251;250	F8VVM2;B2RE88;Q00325;Q00325-2	.;.;MPCP_HUMAN;.	S	250;250;251;251;250;250;250	ENSP00000383898:P250S;ENSP00000188376:P250S;ENSP00000228318:P251S;ENSP00000447310:P251S;ENSP00000448708:P250S;ENSP00000447740:P250S;ENSP00000449166:P250S	ENSP00000188376:P250S	P	+	1	0	SLC25A3	97517970	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.265000	0.78442	2.743000	0.94032	0.655000	0.94253	CCT	-	superfamily_Mt_carrier_dom		0.448	SLC25A3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A3	protein_coding	OTTHUMT00000407989.1	C	NM_005888	-		98993839	+1	no_errors	ENST00000228318	ensembl	human	known	74_37	missense	SNP	1.000	T
PPARA	5465	genome.wustl.edu	37	22	46611070	46611070	+	Splice_Site	SNP	A	A	G			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr22:46611070A>G	ENST00000396000.2	+	4	474	c.209A>G	c.(208-210)gAc>gGc	p.D70G	PPARA_ENST00000407236.1_Splice_Site_p.D70G|PPARA_ENST00000434345.2_Splice_Site_p.D70G|PPARA_ENST00000402126.1_Splice_Site_p.D70G|PPARA_ENST00000262735.5_Splice_Site_p.D70G			Q07869	PPARA_HUMAN	peroxisome proliferator-activated receptor alpha	70					behavioral response to nicotine (GO:0035095)|cellular lipid metabolic process (GO:0044255)|circadian regulation of gene expression (GO:0032922)|enamel mineralization (GO:0070166)|epidermis development (GO:0008544)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|negative regulation of appetite (GO:0032099)|negative regulation of blood pressure (GO:0045776)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of glycolytic process (GO:0045820)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular ketone metabolic process by positive regulation of transcription from RNA polymerase II promoter (GO:0072366)|regulation of circadian rhythm (GO:0042752)|regulation of glycolytic by positive regulation of transcription from RNA polymerase II promoter (GO:0072363)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|lipid binding (GO:0008289)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	15		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00522)	Bezafibrate(DB01393)|Clofibrate(DB00636)|Fenofibrate(DB01039)|Gemfibrozil(DB01241)|Indomethacin(DB00328)	TTTTCCCCAGACACGCTTTCA	0.532																																																	0								ENSG00000186951						81.0	72.0	75.0					22																	46611070		2203	4300	6503	PPARA	SO:0001630	splice_region_variant	0			-	HGNC	L02932	CCDS33669.1	22q12-q13.1	2013-01-16	2006-10-17		ENSG00000186951	ENSG00000186951		"""Nuclear hormone receptors"""	9232	protein-coding gene	gene with protein product		170998	"""peroxisome proliferative activated receptor, alpha"""	PPAR		7684926, 10591208	Standard	XM_005261655		Approved	hPPAR, NR1C1	uc003bgx.1	Q07869	OTTHUMG00000150443	ENST00000396000.2:c.209-1A>G	22.37:g.46611070A>G		Somatic	0	78	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	21	46.15	B0G0X3|Q16241|Q6I9S0|Q92486|Q92689|Q9Y3N1	Missense_Mutation	SNP	44	0.00	0	21	38.24	13	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_1Cnucl_rcpt_A,prints_1Cnucl_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.D70G	ENST00000396000.2	37	c.209	CCDS33669.1	22	.	.	.	.	.	.	.	.	.	.	A	18.64	3.667060	0.67814	.	.	ENSG00000186951	ENST00000396000;ENST00000262735;ENST00000420804;ENST00000407236;ENST00000402126;ENST00000434345	D;D;D;D;D;D	0.97404	-3.35;-3.35;-4.37;-3.35;-3.35;-3.18	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.97498	0.9181	M	0.69823	2.125	0.58432	D	0.999999	D;D	0.64830	0.994;0.994	P;P	0.56865	0.808;0.808	D	0.97358	0.9968	9	.	.	.	.	14.5571	0.68109	1.0:0.0:0.0:0.0	.	70;70	F1D8S4;Q07869	.;PPARA_HUMAN	G	70	ENSP00000379322:D70G;ENSP00000262735:D70G;ENSP00000414752:D70G;ENSP00000385523:D70G;ENSP00000385246:D70G;ENSP00000408149:D70G	.	D	+	2	0	PPARA	44989734	1.000000	0.71417	0.823000	0.32752	0.254000	0.26022	6.850000	0.75420	2.088000	0.63022	0.482000	0.46254	GAC	-	prints_1Cnucl_rcpt_A		0.532	PPARA-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PPARA	protein_coding	OTTHUMT00000318129.3	A	NM_001001928	-	Missense_Mutation	46611070	+1	no_errors	ENST00000262735	ensembl	human	known	74_37	missense	SNP	1.000	G
CELA1	1990	genome.wustl.edu	37	12	51740415	51740416	+	Frame_Shift_Del	DEL	AC	AC	-	rs370927847|rs386762976|rs61761206|rs55827519|rs148235680	byFrequency	TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr12:51740415_51740416delAC	ENST00000293636.1	-	1	47_48	c.7_8delGT	c.(7-9)gtcfs	p.V3fs		NM_001971.5	NP_001962.3	Q9UNI1	CELA1_HUMAN	chymotrypsin-like elastase family, member 1	3					exocrine pancreas development (GO:0031017)|inflammatory response (GO:0006954)|multicellular organism growth (GO:0035264)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas morphogenesis (GO:0061113)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.V3fs*21(1)		NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15						ACCATAAAGGACCAGCATGTTG	0.515														1840	0.367412	0.2988	0.451	5008	,	,		16016	0.5546		0.3211	False		,,,				2504	0.2556																1	Deletion - Frameshift(1)	large_intestine(1)						ENSG00000139610																																			CELA1	SO:0001589	frameshift_variant	0				HGNC		CCDS8812.1	12q13	2012-10-02	2009-05-05	2009-05-05	ENSG00000139610	ENSG00000139610			3308	protein-coding gene	gene with protein product		130120	"""elastase 1, pancreatic"""	ELA1			Standard	NM_001971		Approved		uc001ryi.1	Q9UNI1	OTTHUMG00000167523	ENST00000293636.1:c.7_8delGT	12.37:g.51740415_51740416delAC	ENSP00000293636:p.Val3fs	Somatic	0	38	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	38	20.83	Q5MLF0|Q6DJT0|Q6ISM6	Frame_Shift_Del	DEL	22	15.38	4	34	30.61	15	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.V3fs	ENST00000293636.1	37	c.8_7	CCDS8812.1	12																																																																																			-	NULL		0.515	CELA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELA1	protein_coding	OTTHUMT00000394901.1	AC	NM_001971			51740416	-1	no_errors	ENST00000293636	ensembl	human	known	74_37	frame_shift_del	DEL	0.534:0.591	-
GRIK3	2899	genome.wustl.edu	37	1	37271806	37271806	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr1:37271806A>G	ENST00000373091.3	-	14	2229	c.2213T>C	c.(2212-2214)aTg>aCg	p.M738T	GRIK3_ENST00000373093.4_Missense_Mutation_p.M738T	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	738					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				GGTGGACTCCATGAGCAGCGC	0.617																																																	0								ENSG00000163873						180.0	134.0	150.0					1																	37271806		2203	4300	6503	GRIK3	SO:0001583	missense	0			-	HGNC	U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2213T>C	1.37:g.37271806A>G	ENSP00000362183:p.Met738Thr	Somatic	0	121	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	63	39.05	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	39	0.00	0	42	34.38	22	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.M738T	ENST00000373091.3	37	c.2213	CCDS416.1	1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.274523	0.80580	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.10573	2.86;2.86	5.48	5.48	0.80851	Ionotropic glutamate receptor (2);	0.100954	0.64402	D	0.000003	T	0.17577	0.0422	L	0.47190	1.495	0.80722	D	1	B;B	0.29037	0.231;0.231	B;B	0.39706	0.307;0.307	T	0.02705	-1.1121	10	0.87932	D	0	.	15.5527	0.76167	1.0:0.0:0.0:0.0	.	738;738	A9Z1Z8;Q13003	.;GRIK3_HUMAN	T	738	ENSP00000362183:M738T;ENSP00000362185:M738T	ENSP00000362183:M738T	M	-	2	0	GRIK3	37044393	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.197000	0.72100	2.074000	0.62210	0.448000	0.29417	ATG	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt		0.617	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	protein_coding	OTTHUMT00000012053.1	A	NM_000831	-		37271806	-1	no_errors	ENST00000373091	ensembl	human	known	74_37	missense	SNP	1.000	G
MYH3	4621	genome.wustl.edu	37	17	10537376	10537376	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr17:10537376C>G	ENST00000583535.1	-	32	4567	c.4480G>C	c.(4480-4482)Gat>Cat	p.D1494H	MYH3_ENST00000226209.7_Missense_Mutation_p.D1494H	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1494					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)	p.D1494Y(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TCAAGTTGATCTAAGGCTTCC	0.483																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000109063						168.0	149.0	155.0					17																	10537376		2203	4300	6503	MYH3	SO:0001583	missense	0			-	HGNC		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.4480G>C	17.37:g.10537376C>G	ENSP00000464317:p.Asp1494His	Somatic	0	70	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	13	71.11	Q15492	Missense_Mutation	SNP	54	0.00	0	15	61.54	24	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.D1494H	ENST00000583535.1	37	c.4480	CCDS11157.1	17	.	.	.	.	.	.	.	.	.	.	C	27.8	4.860845	0.91433	.	.	ENSG00000109063	ENST00000226209	D	0.83992	-1.79	5.31	5.31	0.75309	Myosin tail (1);	.	.	.	.	D	0.93828	0.8026	H	0.94886	3.595	0.54753	D	0.999988	D	0.76494	0.999	D	0.74023	0.982	D	0.95189	0.8306	9	0.87932	D	0	.	19.3282	0.94273	0.0:1.0:0.0:0.0	.	1494	P11055	MYH3_HUMAN	H	1494	ENSP00000226209:D1494H	ENSP00000226209:D1494H	D	-	1	0	MYH3	10478101	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.003000	0.70701	2.623000	0.88846	0.655000	0.94253	GAT	-	pfam_Myosin_tail		0.483	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	protein_coding	OTTHUMT00000252734.2	C	NM_002470	-		10537376	-1	no_errors	ENST00000226209	ensembl	human	known	74_37	missense	SNP	1.000	G
ADAMTS15	170689	genome.wustl.edu	37	11	130319823	130319823	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr11:130319823C>T	ENST00000299164.2	+	1	955	c.955C>T	c.(955-957)Cag>Tag	p.Q319*		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	319	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		CTTCACCAGGCAGGTGAGTTG	0.562											OREG0021518	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000166106						59.0	55.0	57.0					11																	130319823		2181	4265	6446	ADAMTS15	SO:0001587	stop_gained	0			-	HGNC	AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.955C>T	11.37:g.130319823C>T	ENSP00000299164:p.Gln319*	Somatic	0	53	0.00	1579	0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	11	64.52	Q32MI6	Nonsense_Mutation	SNP	36	0.00	0	15	65.12	28	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS,prints_Pept_M12B_ADAM-TS8	p.Q319*	ENST00000299164.2	37	c.955	CCDS8488.1	11	.	.	.	.	.	.	.	.	.	.	C	38	7.147789	0.98096	.	.	ENSG00000166106	ENST00000299164	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	14.7459	0.69490	0.1446:0.8554:0.0:0.0	.	.	.	.	X	319	.	ENSP00000299164:Q319X	Q	+	1	0	ADAMTS15	129825033	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.930000	0.70104	2.720000	0.93068	0.655000	0.94253	CAG	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B		0.562	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS15	protein_coding	OTTHUMT00000385638.1	C	NM_139055	-		130319823	+1	no_errors	ENST00000299164	ensembl	human	known	74_37	nonsense	SNP	1.000	T
SVEP1	79987	genome.wustl.edu	37	9	113170710	113170710	+	Silent	SNP	A	A	T			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr9:113170710A>T	ENST00000401783.2	-	38	7506	c.7170T>A	c.(7168-7170)ggT>ggA	p.G2390G	SVEP1_ENST00000297826.5_Silent_p.G316G|SVEP1_ENST00000374469.1_Silent_p.G2367G	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2390	Sushi 17. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GAATGGGGACACCAAAGGAAA	0.458																																																	0								ENSG00000165124						57.0	56.0	56.0					9																	113170710		1875	4115	5990	SVEP1	SO:0001819	synonymous_variant	0			-	HGNC	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.7170T>A	9.37:g.113170710A>T		Somatic	0	23	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	28	60.56	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Silent	SNP	29	0.00	0	67	78.53	245	pfam_Sushi_SCR_CCP,pfam_EG-like_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_Hyalin,pfam_VWF_A,pfam_Pentaxin,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Growth_fac_rcpt_N_dom,smart_VWF_A,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Pentaxin,pfscan_EG-like_dom,pfscan_Hyalin,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,prints_Pentaxin	p.G2390	ENST00000401783.2	37	c.7170	CCDS48004.1	9																																																																																			-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.458	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	protein_coding		A		-		113170710	-1	no_errors	ENST00000401783	ensembl	human	known	74_37	silent	SNP	0.928	T
TLE2	7089	genome.wustl.edu	37	19	3019293	3019293	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr19:3019293C>T	ENST00000262953.6	-	7	800	c.538G>A	c.(538-540)Gag>Aag	p.E180K	TLE2_ENST00000455444.2_Intron|TLE2_ENST00000586422.1_Intron|TLE2_ENST00000590536.1_Missense_Mutation_p.E181K|TLE2_ENST00000587217.1_5'UTR|TLE2_ENST00000591529.1_Missense_Mutation_p.E194K|TLE2_ENST00000443826.3_Intron|TLE2_ENST00000426948.2_Missense_Mutation_p.E194K|TLE2_ENST00000447365.2_5'UTR	NM_003260.4	NP_003251.2	Q04725	TLE2_HUMAN	transducin-like enhancer of split 2	180	Gly/Pro-rich.				negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGGACCCCTCGGCCTCCACG	0.697																																																	0								ENSG00000065717						6.0	8.0	7.0					19																	3019293		2028	4111	6139	TLE2	SO:0001583	missense	0			-	HGNC	M99436	CCDS45911.1, CCDS45912.1, CCDS45913.1, CCDS74255.1	19p13.3	2014-03-07	2014-03-07					"""WD repeat domain containing"""	11838	protein-coding gene	gene with protein product	"""enhancer of split groucho 2"""	601041	"""transducin-like enhancer of split 2, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)"""			8808280	Standard	NM_003260		Approved	ESG2, GRG2, ESG, FLJ41188	uc002lww.3	Q04725		ENST00000262953.6:c.538G>A	19.37:g.3019293C>T	ENSP00000262953:p.Glu180Lys	Somatic	0	68	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	51	29.73	B4DE03|E9PEV7|F8WCH2|Q8WVY0|Q9Y6S0	Missense_Mutation	SNP	39	0.00	0	32	21.95	9	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_Groucho_enhance,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E180K	ENST00000262953.6	37	c.538	CCDS45911.1	19	.	.	.	.	.	.	.	.	.	.	C	7.016	0.557652	0.13436	.	.	ENSG00000065717	ENST00000262953;ENST00000450017;ENST00000426948	T;T	0.53857	0.6;0.84	4.43	2.13	0.27403	.	0.218848	0.39146	N	0.001452	T	0.24547	0.0595	N	0.08118	0	0.22562	N	0.998988	B;B	0.21821	0.061;0.027	B;B	0.15052	0.012;0.011	T	0.14008	-1.0488	10	0.13853	T	0.58	-0.0066	6.4082	0.21676	0.0:0.6992:0.191:0.1098	.	194;180	F8WCH2;Q04725	.;TLE2_HUMAN	K	180;174;194	ENSP00000262953:E180K;ENSP00000392869:E194K	ENSP00000262953:E180K	E	-	1	0	TLE2	2970293	0.994000	0.37717	0.880000	0.34516	0.204000	0.24138	3.252000	0.51461	0.926000	0.37118	0.491000	0.48974	GAG	-	NULL		0.697	TLE2-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	TLE2	protein_coding	OTTHUMT00000452194.2	C	NM_003260	-		3019293	-1	no_errors	ENST00000262953	ensembl	human	known	74_37	missense	SNP	0.679	T
TRPV3	162514	genome.wustl.edu	37	17	3436043	3436043	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr17:3436043G>C	ENST00000576742.1	-	8	1294	c.973C>G	c.(973-975)Cta>Gta	p.L325V	TRPV3_ENST00000572519.1_Missense_Mutation_p.L325V|TRPV3_ENST00000301365.4_Missense_Mutation_p.L325V	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	325					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	CTCCGCAGTAGGATCATGTCG	0.617																																																	0								ENSG00000167723						202.0	139.0	161.0					17																	3436043		2203	4300	6503	TRPV3	SO:0001583	missense	0			-	HGNC	AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.973C>G	17.37:g.3436043G>C	ENSP00000461518:p.Leu325Val	Somatic	0	71	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	36	35.71	Q8NDW7|Q8NET9|Q8NFH2	Missense_Mutation	SNP	40	0.00	0	44	31.25	20	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel	p.L325V	ENST00000576742.1	37	c.973	CCDS11029.1	17	.	.	.	.	.	.	.	.	.	.	G	14.03	2.414071	0.42817	.	.	ENSG00000167723	ENST00000381913;ENST00000301365;ENST00000430263	T	0.56103	0.48	5.31	2.05	0.26809	Ankyrin repeat-containing domain (3);	0.000000	0.51477	D	0.000082	T	0.62270	0.2414	L	0.49350	1.555	0.38444	D	0.946782	P;D;D;D;D;D;D	0.71674	0.846;0.975;0.997;0.975;0.998;0.997;0.998	P;P;D;P;D;D;D	0.83275	0.754;0.751;0.991;0.751;0.996;0.991;0.996	T	0.63651	-0.6589	10	0.56958	D	0.05	-7.1888	9.2703	0.37668	0.326:0.0:0.674:0.0	.	309;309;325;309;325;325;325	E7EV24;B7ZKP9;Q2M3L1;B7ZKP6;Q8NET8-3;Q8NET8;Q8NET8-2	.;.;.;.;.;TRPV3_HUMAN;.	V	325;325;309	ENSP00000301365:L325V	ENSP00000301365:L325V	L	-	1	2	TRPV3	3382793	0.000000	0.05858	0.972000	0.41901	0.025000	0.11179	-0.018000	0.12568	0.642000	0.30620	0.561000	0.74099	CTA	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel		0.617	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPV3	protein_coding	OTTHUMT00000207379.2	G	NM_145068	-		3436043	-1	no_errors	ENST00000301365	ensembl	human	known	74_37	missense	SNP	0.999	C
PCLO	27445	genome.wustl.edu	37	7	82581204	82581204	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr7:82581204G>T	ENST00000333891.9	-	5	9402	c.9065C>A	c.(9064-9066)gCa>gAa	p.A3022E	PCLO_ENST00000437081.1_5'Flank|PCLO_ENST00000423517.2_Missense_Mutation_p.A3022E	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CAGATCTACTGCTGTGTCAGT	0.393																																																	0								ENSG00000186472						67.0	67.0	67.0					7																	82581204		1864	4109	5973	PCLO	SO:0001583	missense	0			-	HGNC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.9065C>A	7.37:g.82581204G>T	ENSP00000334319:p.Ala3022Glu	Somatic	0	42	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04		Missense_Mutation	SNP	38	0.00	0	23	0.00	0	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.A3022E	ENST00000333891.9	37	c.9065	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	G	13.63	2.294579	0.40594	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.28255	1.62;1.62	5.84	5.84	0.93424	.	.	.	.	.	T	0.57710	0.2072	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.57528	-0.7796	9	0.87932	D	0	.	20.1396	0.98055	0.0:0.0:1.0:0.0	.	3022;3022	Q9Y6V0-5;Q9Y6V0-6	.;.	E	2953;3022;3022	ENSP00000334319:A3022E;ENSP00000388393:A3022E	ENSP00000334319:A3022E	A	-	2	0	PCLO	82419140	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	9.785000	0.99042	2.756000	0.94617	0.557000	0.71058	GCA	-	NULL		0.393	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	protein_coding	OTTHUMT00000337368.5	G	NM_014510	-		82581204	-1	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	SNP	1.000	T
DNASE2B	58511	genome.wustl.edu	37	1	84878060	84878060	+	Silent	SNP	C	C	T			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr1:84878060C>T	ENST00000370665.3	+	5	609	c.576C>T	c.(574-576)aaC>aaT	p.N192N	DNASE2B_ENST00000370662.3_5'UTR	NM_021233.2	NP_067056.2	Q8WZ79	DNS2B_HUMAN	deoxyribonuclease II beta	192					apoptotic DNA fragmentation (GO:0006309)	extracellular region (GO:0005576)|intracellular (GO:0005622)|lysosome (GO:0005764)	deoxyribonuclease II activity (GO:0004531)			endometrium(1)|lung(4)|skin(1)	6				all cancers(265;0.00303)|Epithelial(280;0.0112)|OV - Ovarian serous cystadenocarcinoma(397;0.0808)		GCAACCCCAACGTCTATAGCT	0.478																																					Pancreas(54;788 1175 11852 16034 30034)												0								ENSG00000137976						81.0	82.0	82.0					1																	84878060		2203	4300	6503	DNASE2B	SO:0001819	synonymous_variant	0			-	HGNC	AF274571	CCDS694.1, CCDS44167.1	1p22.3	2008-02-05			ENSG00000137976	ENSG00000137976			28875	protein-coding gene	gene with protein product		608057				12594037, 11376952	Standard	NM_021233		Approved	DLAD	uc001djt.1	Q8WZ79	OTTHUMG00000009860	ENST00000370665.3:c.576C>T	1.37:g.84878060C>T		Somatic	0	31	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	20	45.95	Q5VXD0|Q5VXD1|Q8WZ80|Q9NQW3	Silent	SNP	25	0.00	0	37	43.08	28	pfam_DNase_II	p.N192	ENST00000370665.3	37	c.576	CCDS44167.1	1																																																																																			-	pfam_DNase_II		0.478	DNASE2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNASE2B	protein_coding	OTTHUMT00000027248.1	C	NM_021233	-		84878060	+1	no_errors	ENST00000370665	ensembl	human	known	74_37	silent	SNP	0.030	T
UGT1A6	54578	genome.wustl.edu	37	2	234652338	234652338	+	Intron	SNP	G	G	A	rs184388078		TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr2:234652338G>A	ENST00000305139.6	+	2	1000				UGT1A1_ENST00000609767.1_Intron|DNAJB3_ENST00000449667.1_RNA|UGT1A6_ENST00000406651.1_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A3_ENST00000482026.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6						cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	CTGTGCAGCCGCCCTCCGCCC	0.652													G|||	1	0.000199681	0.0	0.0	5008	,	,		14629	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000227802	G	,,,,,,,,,	0,4006		0,0,2003	79.0	92.0	88.0		225,,,,,,,,,	-5.4	0.0	2		88	3,8325		0,3,4161	no	coding-synonymous,intron,intron,intron,intron,intron,intron,intron,intron,intron	UGT1A10,UGT1A8,UGT1A7,UGT1A6,UGT1A5,UGT1A9,UGT1A4,UGT1A3,DNAJB3	NM_001001394.3,NM_001072.3,NM_007120.2,NM_019075.2,NM_019076.4,NM_019077.2,NM_019078.1,NM_019093.2,NM_021027.2,NM_205862.1	,,,,,,,,,	0,3,6164	AA,AG,GG		0.036,0.0,0.0243	,,,,,,,,,	75/146,,,,,,,,,	234652338	3,12331	2003	4164	6167	DNAJB3	SO:0001627	intron_variant	0			GMAF=0.0005	HGNC	M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.862-23342G>A	2.37:g.234652338G>A		Somatic	0	105	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	13	68.09	A6NKK6|B8K289|Q96TE7	RNA	SNP	45	0.00	0	6	81.25	26	-	NULL	ENST00000305139.6	37	NULL	CCDS2507.1	2																																																																																			-	-		0.652	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB3	protein_coding	OTTHUMT00000130988.1	G	NM_205862	rs184388078		234652338	-1	no_errors	ENST00000449667	ensembl	human	known	74_37	rna	SNP	0.000	A
CALN1	83698	genome.wustl.edu	37	7	71571178	71571178	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr7:71571178C>T	ENST00000329008.5	-	3	518	c.220G>A	c.(220-222)Gag>Aag	p.E74K	CALN1_ENST00000395276.2_Missense_Mutation_p.E74K|CALN1_ENST00000395275.2_Missense_Mutation_p.E116K|CALN1_ENST00000431984.1_Missense_Mutation_p.E74K|CALN1_ENST00000412588.1_Missense_Mutation_p.E116K|CALN1_ENST00000405452.2_Missense_Mutation_p.E74K	NM_001017440.2	NP_001017440.1	Q9BXU9	CABP8_HUMAN	calneuron 1	74	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(6)|lung(19)|skin(2)	32		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				AGCTCCACCTCGCTTGGCATG	0.597																																																	0								ENSG00000183166						77.0	59.0	65.0					7																	71571178		2203	4300	6503	CALN1	SO:0001583	missense	0			-	HGNC	AF282250	CCDS5541.1, CCDS47603.1	7q11	2013-01-10			ENSG00000183166	ENSG00000183166		"""EF-hand domain containing"""	13248	protein-coding gene	gene with protein product	"""calcium-binding protein CABP8"""	607176				11286509	Standard	NM_031468		Approved		uc003twb.4	Q9BXU9	OTTHUMG00000023787	ENST00000329008.5:c.220G>A	7.37:g.71571178C>T	ENSP00000332498:p.Glu74Lys	Somatic	0	44	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	29	38.30	J3KQA7	Missense_Mutation	SNP	31	0.00	0	35	45.31	29	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.E116K	ENST00000329008.5	37	c.346	CCDS5541.1	7	.	.	.	.	.	.	.	.	.	.	C	21.6	4.175195	0.78564	.	.	ENSG00000183166	ENST00000329008;ENST00000395275;ENST00000395276;ENST00000431984;ENST00000412588;ENST00000405452;ENST00000446128	T;T;T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56;-0.56;-0.56	5.69	5.69	0.88448	EF-hand-like domain (1);	0.046735	0.85682	D	0.000000	T	0.69797	0.3151	L	0.45228	1.405	0.58432	D	0.999999	P;P	0.48089	0.905;0.905	P;P	0.44811	0.461;0.461	T	0.73591	-0.3934	10	0.72032	D	0.01	-24.4953	18.8514	0.92232	0.0:1.0:0.0:0.0	.	74;74	A4D1Z1;Q9BXU9	.;CABP8_HUMAN	K	74;116;74;74;116;74;74	ENSP00000332498:E74K;ENSP00000378690:E116K;ENSP00000378691:E74K;ENSP00000410704:E74K;ENSP00000391882:E116K;ENSP00000384354:E74K;ENSP00000411806:E74K	ENSP00000332498:E74K	E	-	1	0	CALN1	71209114	1.000000	0.71417	0.963000	0.40424	0.595000	0.36748	7.474000	0.81024	2.713000	0.92767	0.644000	0.83932	GAG	-	pfscan_EF_hand_dom		0.597	CALN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CALN1	protein_coding	OTTHUMT00000320044.2	C	NM_031468	-		71571178	-1	no_errors	ENST00000395275	ensembl	human	known	74_37	missense	SNP	1.000	T
RIMBP2	23504	genome.wustl.edu	37	12	130919312	130919312	+	Silent	SNP	G	G	A	rs377575822		TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr12:130919312G>A	ENST00000261655.4	-	11	2332	c.2169C>T	c.(2167-2169)gaC>gaT	p.D723D	RIMBP2_ENST00000535703.1_Silent_p.D631D|RIMBP2_ENST00000536002.1_Silent_p.D631D	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	723					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TCAGGAAGTCGTCCACCGAGG	0.667													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14673	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000060709	G		0,4406		0,0,2203	74.0	82.0	80.0		2169	-6.2	0.9	12		80	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	RIMBP2	NM_015347.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		723/1053	130919312	1,13005	2203	4300	6503	RIMBP2	SO:0001819	synonymous_variant	0			-	HGNC	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.2169C>T	12.37:g.130919312G>A		Somatic	0	74	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	36	12.20	Q96ID2	Silent	SNP	33	0.00	0	41	18.00	9	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain,prints_SH3_domain	p.D723	ENST00000261655.4	37	c.2169	CCDS31925.1	12																																																																																			-	NULL		0.667	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	protein_coding	OTTHUMT00000399520.1	G	NM_015347	-		130919312	-1	no_errors	ENST00000261655	ensembl	human	known	74_37	silent	SNP	0.781	A
DCC	1630	genome.wustl.edu	37	18	50592510	50592510	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr18:50592510G>T	ENST00000442544.2	+	7	1851	c.1235G>T	c.(1234-1236)aGt>aTt	p.S412I	DCC_ENST00000580146.1_3'UTR|DCC_ENST00000412726.1_Missense_Mutation_p.S260I|DCC_ENST00000581580.1_Missense_Mutation_p.S67I	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	412	Ig-like C2-type 4.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GCCCAGACCAGTGCACAGCTC	0.448																																																	0								ENSG00000187323						148.0	134.0	139.0					18																	50592510		2203	4300	6503	DCC	SO:0001583	missense	0			-	HGNC	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.1235G>T	18.37:g.50592510G>T	ENSP00000389140:p.Ser412Ile	Somatic	0	89	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	30	25.00		Missense_Mutation	SNP	19	0.00	0	26	16.13	5	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S412I	ENST00000442544.2	37	c.1235	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	G	12.46	1.945701	0.34377	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T	0.69040	-0.37;-0.37	5.31	5.31	0.75309	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.119195	0.56097	D	0.000024	T	0.76884	0.4050	M	0.72479	2.2	0.41925	D	0.990533	P;D;P	0.56287	0.82;0.975;0.705	B;P;P	0.60173	0.376;0.87;0.479	T	0.79305	-0.1858	10	0.66056	D	0.02	.	11.2813	0.49197	0.085:0.0:0.915:0.0	.	260;260;412	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	I	412;345;260	ENSP00000389140:S412I;ENSP00000397322:S260I	ENSP00000304146:S345I	S	+	2	0	DCC	48846508	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	3.256000	0.51492	2.497000	0.84241	0.650000	0.86243	AGT	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom		0.448	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	protein_coding	OTTHUMT00000255996.3	G	NM_005215	-		50592510	+1	no_errors	ENST00000442544	ensembl	human	known	74_37	missense	SNP	1.000	T
KPRP	448834	genome.wustl.edu	37	1	152732093	152732093	+	Missense_Mutation	SNP	G	G	A	rs77368440		TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr1:152732093G>A	ENST00000606109.1	+	1	57	c.29G>A	c.(28-30)cGc>cAc	p.R10H	KPRP_ENST00000368773.1_Missense_Mutation_p.R10H			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	10	Gln-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATCCAGTGCCGCCTGCCGCTC	0.592																																																	0								ENSG00000203786	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	62.0	62.0	62.0		29	3.7	0.4	1	dbSNP_131	62	1,8599	1.2+/-3.3	0,1,4299	no	missense	KPRP	NM_001025231.1	29	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	10/580	152732093	2,13004	2203	4300	6503	KPRP	SO:0001583	missense	0			-	HGNC	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.29G>A	1.37:g.152732093G>A	ENSP00000475216:p.Arg10His	Somatic	0	89	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	52	12.70		Missense_Mutation	SNP	36	0.00	0	31	31.11	14	NULL	p.R10H	ENST00000606109.1	37	c.29	CCDS30862.1	1	.	.	.	.	.	.	.	.	.	.	G	9.751	1.167358	0.21621	2.27E-4	1.16E-4	ENSG00000203786	ENST00000368773	T	0.11821	2.74	5.54	3.66	0.41972	.	0.577262	0.15899	N	0.239152	T	0.02230	0.0069	N	0.08118	0	0.09310	N	0.999994	B	0.09022	0.002	B	0.04013	0.001	T	0.42582	-0.9443	10	0.56958	D	0.05	-2.0206	8.2067	0.31458	0.0844:0.157:0.7586:0.0	.	10	Q5T749	KPRP_HUMAN	H	10	ENSP00000357762:R10H	ENSP00000357762:R10H	R	+	2	0	KPRP	150998717	0.003000	0.15002	0.358000	0.25811	0.697000	0.40408	0.027000	0.13621	0.827000	0.34685	0.655000	0.94253	CGC	-	NULL		0.592	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPRP	protein_coding	OTTHUMT00000034522.2	G	NM_001025231	-		152732093	+1	no_errors	ENST00000368773	ensembl	human	known	74_37	missense	SNP	0.849	A
COG5	10466	genome.wustl.edu	37	7	107002523	107002523	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr7:107002523C>G	ENST00000347053.3	-	10	1124	c.1074G>C	c.(1072-1074)aaG>aaC	p.K358N	COG5_ENST00000297135.3_Missense_Mutation_p.K358N|COG5_ENST00000393603.2_Missense_Mutation_p.K358N	NM_181733.2	NP_859422.2	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5	358					intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|skin(4)|stomach(1)	40						CAGGATCTCTCTTCTTGGCCA	0.308																																																	0								ENSG00000164597						87.0	84.0	85.0					7																	107002523		2201	4297	6498	COG5	SO:0001583	missense	0			-	HGNC	AF058718	CCDS5742.1, CCDS5743.1, CCDS55152.1	7q31	2010-06-24	2001-12-07	2002-05-10	ENSG00000164597	ENSG00000164597		"""Components of oligomeric golgi complex"""	14857	protein-coding gene	gene with protein product		606821	"""golgi transport complex 1 (90 kDa subunit)"""	GOLTC1		9792665, 11980916	Standard	NM_006348		Approved	GTC90	uc003vec.2	Q9UP83	OTTHUMG00000023895	ENST00000347053.3:c.1074G>C	7.37:g.107002523C>G	ENSP00000334703:p.Lys358Asn	Somatic	0	63	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	21	44.74	A4D0R6|A4D0R7|O14555|O95008|Q6NUL5	Missense_Mutation	SNP	37	0.00	0	37	32.73	18	pfam_Cog5	p.K358N	ENST00000347053.3	37	c.1074	CCDS5743.1	7	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062920	0.76187	.	.	ENSG00000164597	ENST00000347053;ENST00000297135;ENST00000393603	T;T;T	0.32515	1.45;1.45;1.45	5.58	4.69	0.59074	.	0.000000	0.85682	D	0.000000	T	0.57755	0.2075	M	0.88310	2.945	0.52099	D	0.999949	D;D	0.89917	1.0;1.0	D;D	0.76071	0.973;0.987	T	0.62091	-0.6927	10	0.48119	T	0.1	-13.994	9.4378	0.38650	0.0:0.7955:0.0:0.2045	.	358;358	Q9UP83;Q9UP83-2	COG5_HUMAN;.	N	358	ENSP00000334703:K358N;ENSP00000297135:K358N;ENSP00000377228:K358N	ENSP00000297135:K358N	K	-	3	2	COG5	106789759	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	0.656000	0.24948	1.468000	0.48064	0.655000	0.94253	AAG	-	NULL		0.308	COG5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COG5	protein_coding	OTTHUMT00000060216.4	C		-		107002523	-1	no_errors	ENST00000297135	ensembl	human	known	74_37	missense	SNP	1.000	G
MYH3	4621	genome.wustl.edu	37	17	10533632	10533632	+	Silent	SNP	C	C	T			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr17:10533632C>T	ENST00000583535.1	-	37	5517	c.5430G>A	c.(5428-5430)aaG>aaA	p.K1810K	MYH3_ENST00000226209.7_Silent_p.K1810K	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1810					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						GGATCTGCTTCTTCCCGCCCT	0.597																																																	0								ENSG00000109063						122.0	117.0	119.0					17																	10533632		2203	4300	6503	MYH3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.5430G>A	17.37:g.10533632C>T		Somatic	0	139	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	39	52.44	Q15492	Silent	SNP	22	0.00	0	22	50.00	22	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K1810	ENST00000583535.1	37	c.5430	CCDS11157.1	17																																																																																			-	pfam_Myosin_tail		0.597	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	protein_coding	OTTHUMT00000252734.2	C	NM_002470	-		10533632	-1	no_errors	ENST00000226209	ensembl	human	known	74_37	silent	SNP	1.000	T
IGSF3	3321	genome.wustl.edu	37	1	117122058	117122058	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr1:117122058G>A	ENST00000369486.3	-	10	4055	c.3290C>T	c.(3289-3291)aCg>aTg	p.T1097M	IGSF3_ENST00000318837.6_Missense_Mutation_p.T1117M|IGSF3_ENST00000369483.1_Missense_Mutation_p.T1117M	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	1097	Ig-like C2-type 8.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		CTCCTCCTCCGTCAGCCGGTA	0.567																																																	0								ENSG00000143061						56.0	57.0	57.0					1																	117122058		2203	4300	6503	IGSF3	SO:0001583	missense	0			-	HGNC	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.3290C>T	1.37:g.117122058G>A	ENSP00000358498:p.Thr1097Met	Somatic	0	54	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	20	53.49	A6NJZ6|A6NMC7	Missense_Mutation	SNP	36	0.00	0	27	48.08	25	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.T1117M	ENST00000369486.3	37	c.3350	CCDS30813.1	1	.	.	.	.	.	.	.	.	.	.	G	13.69	2.311492	0.40895	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.03496	3.91;3.92;3.92	4.61	3.7	0.42460	Immunoglobulin subtype (1);Immunoglobulin-like (1);	0.210282	0.42548	D	0.000685	T	0.03178	0.0093	L	0.36672	1.1	0.37236	D	0.905897	D;D	0.67145	0.996;0.996	P;P	0.53689	0.732;0.655	T	0.48163	-0.9059	10	0.72032	D	0.01	-5.5263	10.5599	0.45140	0.0952:0.0:0.9048:0.0	.	1097;1117	O75054;A6NJZ6	IGSF3_HUMAN;.	M	1097;1117;1117	ENSP00000358498:T1097M;ENSP00000358495:T1117M;ENSP00000321184:T1117M	ENSP00000321184:T1117M	T	-	2	0	IGSF3	116923581	1.000000	0.71417	0.617000	0.29091	0.164000	0.22412	6.598000	0.74122	1.154000	0.42482	0.462000	0.41574	ACG	-	smart_Ig_sub,pfscan_Ig-like_dom		0.567	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF3	protein_coding	OTTHUMT00000059040.1	G	NM_001542	-		117122058	-1	no_errors	ENST00000318837	ensembl	human	known	74_37	missense	SNP	0.983	A
FEM1A	55527	genome.wustl.edu	37	19	4794948	4794949	+	3'UTR	INS	-	-	AACCTCAC	rs3214271|rs140617521	byFrequency	TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr19:4794948_4794949insAACCTCAC	ENST00000269856.3	+	0	3221_3222				AC005523.2_ENST00000601192.1_RNA|AC005523.2_ENST00000596170.1_RNA	NM_018708.2	NP_061178.1	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a (C. elegans)						negative regulation of inflammatory response (GO:0050728)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)	EP4 subtype prostaglandin E2 receptor binding (GO:0031867)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	17		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		TCTGCCTTGCAGTGGCCTCTGA	0.52														3201	0.639177	0.7163	0.5778	5008	,	,		18444	0.6171		0.6471	False		,,,				2504	0.593																0								ENSG00000269604																																			AC005523.2	SO:0001624	3_prime_UTR_variant	0				Clone_based_vega_gene	BC004988	CCDS12135.1	19p13.3	2013-01-10	2006-11-08		ENSG00000141965	ENSG00000141965		"""Ankyrin repeat domain containing"""	16934	protein-coding gene	gene with protein product		613538				11441184	Standard	NM_018708		Approved		uc002mbf.3	Q9BSK4		ENST00000269856.3:c.*1073->AACCTCAC	19.37:g.4794948_4794949insAACCTCAC		Somatic	NA	NA	NA		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RDI3|Q711P8|Q9NPN7|Q9NPW8	RNA	INS	6	79.31	23	16	69.23	36	-	NULL	ENST00000269856.3	37	NULL	CCDS12135.1	19																																																																																			-	-		0.520	FEM1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000269604	protein_coding	OTTHUMT00000459000.1	-				4794949	-1	no_errors	ENST00000601192	ensembl	human	known	74_37	rna	INS	0.000:0.000	AACCTCAC
CDX4	1046	genome.wustl.edu	37	X	72667297	72667297	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chrX:72667297G>A	ENST00000373514.2	+	1	208	c.208G>A	c.(208-210)Gga>Aga	p.G70R		NM_005193.1	NP_005184.1	O14627	CDX4_HUMAN	caudal type homeobox 4	70					anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|labyrinthine layer development (GO:0060711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|skin(1)	18	Renal(35;0.156)					GCCGTCTCTGGGAGTCTGGGG	0.602																																																	0								ENSG00000131264						57.0	47.0	51.0					X																	72667297		2203	4300	6503	CDX4	SO:0001583	missense	0			-	HGNC	AF029879	CCDS14424.1	Xq13.2	2012-03-09	2007-07-09		ENSG00000131264	ENSG00000131264		"""Homeoboxes / ANTP class : HOXL subclass"""	1808	protein-coding gene	gene with protein product		300025	"""caudal type homeo box transcription factor 4"""			7655457	Standard	NM_005193		Approved		uc011mqk.2	O14627	OTTHUMG00000021831	ENST00000373514.2:c.208G>A	X.37:g.72667297G>A	ENSP00000362613:p.Gly70Arg	Somatic	0	32	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	58	39	59.79	A1A513|Q5JS20	Missense_Mutation	SNP	10	0.00	0	31	48.33	29	pfam_Caudal_activation_dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.G70R	ENST00000373514.2	37	c.208	CCDS14424.1	X	.	.	.	.	.	.	.	.	.	.	.	12.15	1.852487	0.32699	.	.	ENSG00000131264	ENST00000373514	T	0.51325	0.71	2.57	2.57	0.30868	Caudal-like activation domain (1);	0.310656	0.30676	N	0.009108	T	0.53126	0.1777	M	0.78637	2.42	0.52501	D	0.999956	D	0.58620	0.983	P	0.52793	0.709	T	0.56245	-0.8011	10	0.10111	T	0.7	-4.1599	10.3984	0.44214	0.0:0.0:1.0:0.0	.	70	O14627	CDX4_HUMAN	R	70	ENSP00000362613:G70R	ENSP00000362613:G70R	G	+	1	0	CDX4	72584022	1.000000	0.71417	0.024000	0.17045	0.108000	0.19459	4.570000	0.60872	1.561000	0.49584	0.436000	0.28706	GGA	-	pfam_Caudal_activation_dom		0.602	CDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDX4	protein_coding	OTTHUMT00000057229.2	G	NM_005193	-		72667297	+1	no_errors	ENST00000373514	ensembl	human	known	74_37	missense	SNP	0.880	A
POM121L2	94026	genome.wustl.edu	37	6	27279851	27279851	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr6:27279851C>A	ENST00000444565.1	-	1	98	c.99G>T	c.(97-99)caG>caT	p.Q33H	POM121L2_ENST00000377451.2_Missense_Mutation_p.Q33H	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	33										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						GGTGAAGGGGCTGAGGTGGCC	0.632																																																	0								ENSG00000158553						22.0	27.0	26.0					6																	27279851		692	1591	2283	POM121L2	SO:0001583	missense	0			-	HGNC	AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.99G>T	6.37:g.27279851C>A	ENSP00000392726:p.Gln33His	Somatic	0	131	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	41	34.92	C9J1I7	Missense_Mutation	SNP	39	0.00	0	15	37.50	9	NULL	p.Q33H	ENST00000444565.1	37	c.99	CCDS59497.1	6	.	.	.	.	.	.	.	.	.	.	C	8.550	0.875338	0.17395	.	.	ENSG00000158553	ENST00000377451;ENST00000444565	T;T	0.14766	2.48;2.49	3.19	2.32	0.28847	.	.	.	.	.	T	0.10723	0.0262	L	0.46157	1.445	0.09310	N	1	D	0.59767	0.986	P	0.59825	0.864	T	0.11324	-1.0592	9	0.44086	T	0.13	.	6.3857	0.21559	0.0:0.8645:0.0:0.1355	.	33	C9J1I7	.	H	33	ENSP00000366671:Q33H;ENSP00000392726:Q33H	ENSP00000366671:Q33H	Q	-	3	2	POM121L2	27387830	0.422000	0.25473	0.004000	0.12327	0.005000	0.04900	0.383000	0.20651	0.926000	0.37118	-0.258000	0.10820	CAG	-	NULL		0.632	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L2	protein_coding	OTTHUMT00000040143.2	C	NM_033482	-		27279851	-1	no_errors	ENST00000444565	ensembl	human	known	74_37	missense	SNP	0.004	A
ZUFSP	221302	genome.wustl.edu	37	6	116973247	116973247	+	Missense_Mutation	SNP	C	C	T	rs145316791		TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr6:116973247C>T	ENST00000368576.3	-	6	1313	c.1070G>A	c.(1069-1071)gGt>gAt	p.G357D	ZUFSP_ENST00000471919.1_5'UTR|ZUFSP_ENST00000368573.1_3'UTR	NM_145062.2	NP_659499.2	Q96AP4	ZUFSP_HUMAN	zinc finger with UFM1-specific peptidase domain	357							metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(6)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)		ACAACCCCAACCTTTGTCGCC	0.393																																																	0								ENSG00000153975						138.0	136.0	137.0					6																	116973247		2203	4300	6503	ZUFSP	SO:0001583	missense	0			-	HGNC	AK054582	CCDS5110.1	6q22.31	2013-01-28	2008-03-25	2008-03-25	ENSG00000153975	ENSG00000153975		"""Zinc fingers, C2H2-type"""	21224	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 113"""	C6orf113			Standard	NM_145062		Approved	dJ412I7.3	uc003pxf.2	Q96AP4	OTTHUMG00000015445	ENST00000368576.3:c.1070G>A	6.37:g.116973247C>T	ENSP00000357565:p.Gly357Asp	Somatic	0	47	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	8	63.64	Q5TD92|Q6PJH7|Q96NV6	Missense_Mutation	SNP	41	0.00	0	31	51.56	33	pfam_Peptidase_C78_UfSP1/2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G357D	ENST00000368576.3	37	c.1070	CCDS5110.1	6	.	.	.	.	.	.	.	.	.	.	C	32	5.161684	0.94727	.	.	ENSG00000153975	ENST00000368576	D	0.82081	-1.57	5.54	5.54	0.83059	.	0.045838	0.85682	D	0.000000	D	0.92496	0.7617	M	0.91510	3.215	0.80722	D	1	D	0.67145	0.996	D	0.69654	0.965	D	0.93176	0.6570	10	0.72032	D	0.01	0.3691	19.8403	0.96679	0.0:1.0:0.0:0.0	.	357	Q96AP4	ZUFSP_HUMAN	D	357	ENSP00000357565:G357D	ENSP00000357565:G357D	G	-	2	0	ZUFSP	117079940	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.980000	0.76160	2.771000	0.95319	0.655000	0.94253	GGT	-	pfam_Peptidase_C78_UfSP1/2		0.393	ZUFSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZUFSP	protein_coding	OTTHUMT00000041961.1	C	NM_145062	-		116973247	-1	no_errors	ENST00000368576	ensembl	human	known	74_37	missense	SNP	1.000	T
PEG3	5178	genome.wustl.edu	37	19	57334999	57334999	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr19:57334999C>A	ENST00000326441.9	-	5	806	c.443G>T	c.(442-444)aGa>aTa	p.R148I	ZIM2_ENST00000599935.1_Missense_Mutation_p.R22I|ZIM2_ENST00000221722.5_Missense_Mutation_p.R22I|ZIM2_ENST00000593711.1_Missense_Mutation_p.R22I|PEG3_ENST00000423103.2_Missense_Mutation_p.R148I|PEG3_ENST00000594706.1_5'Flank|PEG3_ENST00000593695.1_Missense_Mutation_p.R22I|PEG3_ENST00000598410.1_Missense_Mutation_p.R22I|ZIM2_ENST00000391708.3_Missense_Mutation_p.R22I|ZIM2_ENST00000601070.1_Missense_Mutation_p.R22I|ZIM2_ENST00000593931.1_Missense_Mutation_p.R22I	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	148					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GGACTCTCTTCTGTTCCGGGT	0.552																																																	0								ENSG00000198300						301.0	216.0	245.0					19																	57334999		2203	4300	6503	PEG3	SO:0001583	missense	0			-	HGNC	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.443G>T	19.37:g.57334999C>A	ENSP00000326581:p.Arg148Ile	Somatic	0	151	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	101	9.01	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	46	0.00	0	35	14.63	6	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R148I	ENST00000326441.9	37	c.443	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	C	16.12	3.032106	0.54790	.	.	ENSG00000198300	ENST00000391708;ENST00000221722;ENST00000326441;ENST00000423103;ENST00000292074	T;T;T;T	0.04502	3.61;3.61;4.2;4.2	4.07	0.727	0.18254	Transcription regulator SCAN (1);	0.737030	0.11801	N	0.528126	T	0.02571	0.0078	N	0.14661	0.345	.	.	.	B;B;B;B	0.26002	0.08;0.08;0.035;0.139	B;B;B;B	0.21151	0.011;0.016;0.007;0.033	T	0.39800	-0.9596	9	0.46703	T	0.11	-2.0347	2.418	0.04441	0.1907:0.4962:0.2053:0.1078	.	22;148;81;22	A7E2B8;Q9GZU2;Q96Q96;Q9NZV7	.;PEG3_HUMAN;.;ZIM2_HUMAN	I	22;22;148;148;148	ENSP00000375589:R22I;ENSP00000221722:R22I;ENSP00000326581:R148I;ENSP00000403051:R148I	ENSP00000221722:R22I	R	-	2	0	ZIM2	62026811	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.096000	0.11059	0.270000	0.21984	0.655000	0.94253	AGA	-	smart_Tscrpt_reg_SCAN		0.552	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	protein_coding	OTTHUMT00000416099.2	C		-		57334999	-1	no_errors	ENST00000326441	ensembl	human	known	74_37	missense	SNP	0.000	A
ZFC3H1	196441	genome.wustl.edu	37	12	72026677	72026677	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr12:72026677C>A	ENST00000378743.3	-	14	3164	c.2806G>T	c.(2806-2808)Gat>Tat	p.D936Y		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	936					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						CCAAAGCGATCTTGTTCCAGT	0.343																																																	0								ENSG00000133858						139.0	132.0	134.0					12																	72026677		1812	4072	5884	ZFC3H1	SO:0001583	missense	0			-	HGNC	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.2806G>T	12.37:g.72026677C>A	ENSP00000368017:p.Asp936Tyr	Somatic	0	25	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	79	14.13	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	32	0.00	0	223	24.92	74	pfam_Putative_zinc-finger_domain,smart_HAT,pfscan_TPR-contain_dom	p.D936Y	ENST00000378743.3	37	c.2806	CCDS41813.1	12	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703770	0.48412	.	.	ENSG00000133858	ENST00000378743	T	0.33216	1.42	5.29	5.29	0.74685	.	0.351800	0.28847	N	0.013954	T	0.20820	0.0501	N	0.19112	0.55	0.80722	D	1	P	0.46277	0.875	B	0.41510	0.359	T	0.02004	-1.1231	10	0.66056	D	0.02	.	9.6167	0.39696	0.0:0.8449:0.0:0.1551	.	936	O60293	ZC3H1_HUMAN	Y	936	ENSP00000368017:D936Y	ENSP00000368017:D936Y	D	-	1	0	ZFC3H1	70312944	0.960000	0.32886	1.000000	0.80357	0.924000	0.55760	1.986000	0.40677	2.490000	0.84030	0.484000	0.47621	GAT	-	NULL		0.343	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFC3H1	protein_coding	OTTHUMT00000404751.1	C	NM_144982	-		72026677	-1	no_errors	ENST00000378743	ensembl	human	known	74_37	missense	SNP	0.998	A
UTP23	84294	genome.wustl.edu	37	8	117783742	117783742	+	Silent	SNP	C	C	T			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr8:117783742C>T	ENST00000309822.2	+	3	512	c.411C>T	c.(409-411)ctC>ctT	p.L137L	UTP23_ENST00000357148.3_Intron|UTP23_ENST00000517820.1_Intron|UTP23_ENST00000520733.1_Intron	NM_032334.2	NP_115710.2	Q9BRU9	UTP23_HUMAN	UTP23, small subunit (SSU) processome component, homolog (yeast)	137					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	12						GAGTTCCTCTCATGTTTATTA	0.353																																																	0								ENSG00000147679						71.0	78.0	75.0					8																	117783742		2203	4300	6503	UTP23	SO:0001819	synonymous_variant	0			-	HGNC		CCDS6320.1	8q24.11	2008-06-12	2008-06-12	2008-06-12		ENSG00000147679			28224	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 53"""	C8orf53		16769905	Standard	NM_032334		Approved	MGC14595	uc003yoc.3	Q9BRU9		ENST00000309822.2:c.411C>T	8.37:g.117783742C>T		Somatic	0	38	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	41	35.94	B2RE25|Q96NJ8	Silent	SNP	25	0.00	0	68	42.37	50	pfam_Fcf1/Utp23	p.L137	ENST00000309822.2	37	c.411	CCDS6320.1	8																																																																																			-	pfam_Fcf1/Utp23		0.353	UTP23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP23	protein_coding	OTTHUMT00000381173.1	C	NM_032334	-		117783742	+1	no_errors	ENST00000309822	ensembl	human	known	74_37	silent	SNP	0.985	T
SLC41A2	84102	genome.wustl.edu	37	12	105260245	105260245	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr12:105260245delG	ENST00000258538.3	-	6	1267	c.1140delC	c.(1138-1140)ggcfs	p.G380fs		NM_032148.3	NP_115524.3	Q96JW4	S41A2_HUMAN	solute carrier family 41 (magnesium transporter), member 2	380					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	22						CAGGCTCCCAGCCTGAGTGGA	0.413																																					Esophageal Squamous(195;176 2919 4272 35572)												0								ENSG00000136052						74.0	76.0	75.0					12																	105260245		2203	4300	6503	SLC41A2	SO:0001589	frameshift_variant	0				HGNC	BC036734	CCDS9100.2	12q24.11	2013-07-17	2013-07-17		ENSG00000136052	ENSG00000136052		"""Solute carriers"""	31045	protein-coding gene	gene with protein product		610802	"""solute carrier family 41, member 2"""				Standard	NM_032148		Approved	DKFZP434K0427	uc001tla.3	Q96JW4	OTTHUMG00000156965	ENST00000258538.3:c.1140delC	12.37:g.105260245delG	ENSP00000258538:p.Gly380fs	Somatic	0	66	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	61	77	44.20	Q3KP68|Q9H0E5	Frame_Shift_Del	DEL	33	0.00	0	60	53.12	68	pfam_SLC41_membr_dom	p.W381fs	ENST00000258538.3	37	c.1140	CCDS9100.2	12																																																																																			-	NULL		0.413	SLC41A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC41A2	protein_coding	OTTHUMT00000346850.3	G	NM_032148			105260245	-1	no_errors	ENST00000258538	ensembl	human	known	74_37	frame_shift_del	DEL	0.998	-
HEPHL1	341208	genome.wustl.edu	37	11	93819353	93819353	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr11:93819353C>T	ENST00000315765.9	+	11	2086	c.2078C>T	c.(2077-2079)gCa>gTa	p.A693V		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	693	Plastocyanin-like 4.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				CCAGACCATGCAGGTAAACTT	0.512																																																	0								ENSG00000181333						52.0	50.0	51.0					11																	93819353		1986	4170	6156	HEPHL1	SO:0001583	missense	0			-	HGNC	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.2078C>T	11.37:g.93819353C>T	ENSP00000313699:p.Ala693Val	Somatic	0	68	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	49	24	67.12	Q3C1W7	Missense_Mutation	SNP	38	0.00	0	33	57.69	45	pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Cupredoxin	p.A693V	ENST00000315765.9	37	c.2078	CCDS44710.1	11	.	.	.	.	.	.	.	.	.	.	C	9.087	1.000825	0.19121	.	.	ENSG00000181333	ENST00000315765	D	0.99762	-6.67	5.64	5.64	0.86602	Cupredoxin (2);	0.382639	0.30401	N	0.009717	D	0.97820	0.9284	N	0.11131	0.1	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	D	0.95369	0.8462	10	0.25751	T	0.34	.	7.7022	0.28630	0.0:0.8067:0.0:0.1933	.	693	Q6MZM0	HPHL1_HUMAN	V	693	ENSP00000313699:A693V	ENSP00000313699:A693V	A	+	2	0	HEPHL1	93459001	0.903000	0.30736	1.000000	0.80357	0.277000	0.26821	1.010000	0.29898	2.820000	0.97059	0.650000	0.86243	GCA	-	superfamily_Cupredoxin		0.512	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	HEPHL1	protein_coding	OTTHUMT00000396103.2	C	XM_291947	-		93819353	+1	no_errors	ENST00000315765	ensembl	human	known	74_37	missense	SNP	0.998	T
CEACAM4	1089	genome.wustl.edu	37	19	42133313	42133313	+	Missense_Mutation	SNP	C	C	T	rs112325334		TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr19:42133313C>T	ENST00000221954.2	-	1	129	c.19G>A	c.(19-21)Gct>Act	p.A7T	CEACAM4_ENST00000600925.1_Missense_Mutation_p.A7T	NM_001817.2	NP_001808.2	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 4	7						integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				NS(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|skin(3)|urinary_tract(1)	16						CCACGGGGAGCGGCTGAGGGG	0.652													C|||	1	0.000199681	0.0	0.0	5008	,	,		16213	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000105352						26.0	28.0	28.0					19																	42133313		2203	4300	6503	CEACAM4	SO:0001583	missense	0			-	HGNC	D90276	CCDS33033.1	19q13.2	2013-01-11			ENSG00000105352	ENSG00000105352		"""Immunoglobulin superfamily / V-set domain containing"""	1816	protein-coding gene	gene with protein product				CGM7		2050678	Standard	XM_005258434		Approved		uc002orh.1	O75871	OTTHUMG00000151065	ENST00000221954.2:c.19G>A	19.37:g.42133313C>T	ENSP00000221954:p.Ala7Thr	Somatic	0	53	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	18	51.35	Q03715|Q7LDZ7	Missense_Mutation	SNP	47	0.00	0	24	47.83	22	pfam_Ig_V-set,pfscan_Ig-like_dom	p.A7T	ENST00000221954.2	37	c.19	CCDS33033.1	19	.	.	.	.	.	.	.	.	.	.	C	11.64	1.700281	0.30142	.	.	ENSG00000105352	ENST00000221954	T	0.01221	5.15	2.28	-4.56	0.03431	.	.	.	.	.	T	0.00637	0.0021	N	0.08118	0	0.09310	N	1	B;B	0.32188	0.359;0.11	B;B	0.21546	0.035;0.026	T	0.49204	-0.8964	9	0.15499	T	0.54	.	3.871	0.09036	0.3055:0.4072:0.2873:0.0	.	7;7	E7EMX3;O75871	.;CEAM4_HUMAN	T	7	ENSP00000221954:A7T	ENSP00000221954:A7T	A	-	1	0	CEACAM4	46825153	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-3.436000	0.00471	-0.545000	0.06224	0.195000	0.17529	GCT	-	NULL		0.652	CEACAM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEACAM4	protein_coding	OTTHUMT00000321148.1	C	NM_001817	rs112325334		42133313	-1	no_errors	ENST00000221954	ensembl	human	known	74_37	missense	SNP	0.000	T
DNAH2	146754	genome.wustl.edu	37	17	7640498	7640498	+	Silent	SNP	G	G	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr17:7640498G>A	ENST00000572933.1	+	8	2552	c.1092G>A	c.(1090-1092)ctG>ctA	p.L364L	DNAH2_ENST00000082259.3_Silent_p.L364L|DNAH2_ENST00000570791.1_Silent_p.L364L|DNAH2_ENST00000389173.2_Silent_p.L364L			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	364	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TCCCTAAGCTGATCAGTCTCA	0.512																																																	0								ENSG00000183914						129.0	111.0	117.0					17																	7640498		2203	4300	6503	DNAH2	SO:0001819	synonymous_variant	0			-	HGNC	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.1092G>A	17.37:g.7640498G>A		Somatic	0	45	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	21	50.00	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	41	0.00	0	30	50.00	30	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L364	ENST00000572933.1	37	c.1092	CCDS32551.1	17																																																																																			-	pfam_Dynein_heavy_dom-1		0.512	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	protein_coding	OTTHUMT00000440241.1	G	NM_020877	-		7640498	+1	no_errors	ENST00000389173	ensembl	human	known	74_37	silent	SNP	0.942	A
HEPHL1	341208	genome.wustl.edu	37	11	93819313	93819313	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr11:93819313C>T	ENST00000315765.9	+	11	2046	c.2038C>T	c.(2038-2040)Ccc>Tcc	p.P680S		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	680	Plastocyanin-like 4.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				GGCCCTGTTTCCCCACATGGC	0.517																																																	0								ENSG00000181333						79.0	77.0	78.0					11																	93819313		2014	4185	6199	HEPHL1	SO:0001583	missense	0			-	HGNC	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.2038C>T	11.37:g.93819313C>T	ENSP00000313699:p.Pro680Ser	Somatic	0	77	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	30	60.53	Q3C1W7	Missense_Mutation	SNP	39	0.00	0	37	55.95	47	pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Cupredoxin	p.P680S	ENST00000315765.9	37	c.2038	CCDS44710.1	11	.	.	.	.	.	.	.	.	.	.	C	29.7	5.028495	0.93518	.	.	ENSG00000181333	ENST00000315765	D	0.99948	-8.65	5.94	5.94	0.96194	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.99943	0.9975	M	0.80028	2.48	0.58432	D	0.999995	D	0.89917	1.0	D	0.81914	0.995	D	0.95813	0.8843	10	0.72032	D	0.01	.	20.3736	0.98901	0.0:1.0:0.0:0.0	.	680	Q6MZM0	HPHL1_HUMAN	S	680	ENSP00000313699:P680S	ENSP00000313699:P680S	P	+	1	0	HEPHL1	93458961	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	7.332000	0.79203	2.820000	0.97059	0.650000	0.86243	CCC	-	superfamily_Cupredoxin		0.517	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	HEPHL1	protein_coding	OTTHUMT00000396103.2	C	XM_291947	-		93819313	+1	no_errors	ENST00000315765	ensembl	human	known	74_37	missense	SNP	1.000	T
MYH3	4621	genome.wustl.edu	37	17	10539137	10539137	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr17:10539137C>G	ENST00000583535.1	-	29	3977	c.3890G>C	c.(3889-3891)aGc>aCc	p.S1297T	MYH3_ENST00000226209.7_Missense_Mutation_p.S1297T	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1297					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						GGATACTATGCTTTCTTTTTC	0.433																																																	0								ENSG00000109063						184.0	181.0	182.0					17																	10539137		2203	4300	6503	MYH3	SO:0001583	missense	0			-	HGNC		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.3890G>C	17.37:g.10539137C>G	ENSP00000464317:p.Ser1297Thr	Somatic	0	62	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	15	53.12	Q15492	Missense_Mutation	SNP	50	0.00	0	22	64.52	40	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.S1297T	ENST00000583535.1	37	c.3890	CCDS11157.1	17	.	.	.	.	.	.	.	.	.	.	C	13.58	2.279717	0.40294	.	.	ENSG00000109063	ENST00000226209	D	0.83250	-1.7	5.13	5.13	0.70059	Myosin tail (1);	.	.	.	.	T	0.82240	0.4994	M	0.64404	1.975	0.23616	N	0.997284	B	0.12630	0.006	B	0.23852	0.049	T	0.71692	-0.4516	9	0.44086	T	0.13	.	14.7739	0.69703	0.0:0.7398:0.2602:0.0	.	1297	P11055	MYH3_HUMAN	T	1297	ENSP00000226209:S1297T	ENSP00000226209:S1297T	S	-	2	0	MYH3	10479862	0.701000	0.27806	1.000000	0.80357	0.933000	0.57130	4.636000	0.61339	2.813000	0.96785	0.655000	0.94253	AGC	-	pfam_Myosin_tail,superfamily_Prefoldin		0.433	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	protein_coding	OTTHUMT00000252734.2	C	NM_002470	-		10539137	-1	no_errors	ENST00000226209	ensembl	human	known	74_37	missense	SNP	0.888	G
C6orf165	154313	genome.wustl.edu	37	6	88125496	88125496	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr6:88125496G>C	ENST00000507897.1	+	5	459	c.376G>C	c.(376-378)Gaa>Caa	p.E126Q	C6ORF165_ENST00000369562.4_Missense_Mutation_p.E126Q			Q8IYR0	CF165_HUMAN	chromosome 6 open reading frame 165	126								p.E126*(2)		NS(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		TGCTAAAGAAGAATTGGAAAG	0.438																																																	2	Substitution - Nonsense(2)	lung(2)						ENSG00000272514						115.0	116.0	115.0					6																	88125496		2203	4300	6503	C6ORF165	SO:0001583	missense	0			-	Uniprot_gn	BC035083	CCDS34498.1	6q15	2012-02-07			ENSG00000213204	ENSG00000213204			21405	protein-coding gene	gene with protein product							Standard	NM_001031743		Approved	FLJ25974, dJ382I10.1	uc003plv.3	Q8IYR0	OTTHUMG00000015173	ENST00000507897.1:c.376G>C	6.37:g.88125496G>C	ENSP00000426769:p.Glu126Gln	Somatic	0	49	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	7	74.07	A8K969|E1P507|Q8N9U4	Missense_Mutation	SNP	43	0.00	0	4	89.47	34	pfam_DUF3508	p.E126Q	ENST00000507897.1	37	c.376	CCDS34498.1	6	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672361	0.88348	.	.	ENSG00000213204	ENST00000369562;ENST00000480123	T;T	0.29655	1.56;1.56	5.6	5.6	0.85130	.	0.110886	0.64402	D	0.000016	T	0.51126	0.1656	M	0.79475	2.455	0.49582	D	0.999809	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.974	T	0.45454	-0.9260	10	0.39692	T	0.17	.	19.2026	0.93717	0.0:0.0:1.0:0.0	.	126;126	Q8IYR0;E1P509	CF165_HUMAN;.	Q	126	ENSP00000358575:E126Q;ENSP00000422494:E126Q	ENSP00000358575:E126Q	E	+	1	0	C6orf165	88182215	1.000000	0.71417	0.964000	0.40570	0.877000	0.50540	8.650000	0.91073	2.640000	0.89533	0.585000	0.79938	GAA	-	NULL		0.438	C6orf165-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	C6orf165	protein_coding	OTTHUMT00000470406.1	G	NM_178823	-		88125496	+1	no_errors	ENST00000369562	ensembl	human	known	74_37	missense	SNP	1.000	C
MAP4K4	9448	genome.wustl.edu	37	2	102493602	102493602	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr2:102493602A>G	ENST00000347699.4	+	24	2944	c.2944A>G	c.(2944-2946)Ata>Gta	p.I982V	MAP4K4_ENST00000413150.2_Missense_Mutation_p.I897V|MAP4K4_ENST00000456652.1_Missense_Mutation_p.I781V|MAP4K4_ENST00000350878.4_Missense_Mutation_p.I1022V|MAP4K4_ENST00000425019.1_Missense_Mutation_p.I1015V|MAP4K4_ENST00000302217.5_Missense_Mutation_p.I785V|MAP4K4_ENST00000324219.4_Missense_Mutation_p.I1063V|MAP4K4_ENST00000350198.4_Missense_Mutation_p.I901V	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4	982	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.|Mediates interaction with RAP2A.				intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						CTTGGTGACAATATCTGGTGA	0.408																																																	0								ENSG00000071054						170.0	163.0	165.0					2																	102493602		1963	4155	6118	MAP4K4	SO:0001583	missense	0			-	HGNC	AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.2944A>G	2.37:g.102493602A>G	ENSP00000314363:p.Ile982Val	Somatic	0	95	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	54	19.40	O75172|Q9NST7	Missense_Mutation	SNP	51	0.00	0	39	25.00	13	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.I1063V	ENST00000347699.4	37	c.3187	CCDS56130.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.3|24.3	4.514416|4.514416	0.85389|0.85389	.|.	.|.	ENSG00000071054|ENSG00000071054	ENST00000425019;ENST00000324219;ENST00000350198;ENST00000302217;ENST00000413150;ENST00000456652;ENST00000347699;ENST00000417294;ENST00000350878|ENST00000421882	T;T;T;T;T;T;T;T;T|.	0.06528|.	3.29;3.29;3.29;3.29;3.29;3.29;3.29;3.29;3.29|.	5.48|5.48	5.48|5.48	0.80851|0.80851	Citron-like (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77082|0.77082	0.4078|0.4078	M|M	0.80508|0.80508	2.5|2.5	0.80722|0.80722	D|D	1|1	P;P;P;D;P;P;B;P;D;D|.	0.89917|.	0.856;0.699;0.937;0.984;0.65;0.768;0.21;0.65;1.0;0.96|.	P;P;D;D;P;P;B;P;D;D|.	0.87578|.	0.881;0.833;0.921;0.986;0.743;0.627;0.345;0.743;0.998;0.931|.	T|T	0.78661|0.78661	-0.2117|-0.2117	10|5	0.87932|.	D|.	0|.	.|.	15.8622|15.8622	0.79035|0.79035	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1022;978;781;785;900;982;1015;901;954;1063|.	B7Z388;B7Z3V5;E7EX83;C9J840;O95819-4;O95819;E7EN19;G3XAA2;O95819-2;G5E948|.	.;.;.;.;.;M4K4_HUMAN;.;.;.;.|.	V|S	1015;1063;901;785;897;781;982;913;1022|798	ENSP00000392830:I1015V;ENSP00000313644:I1063V;ENSP00000281111:I901V;ENSP00000303600:I785V;ENSP00000389752:I897V;ENSP00000387370:I781V;ENSP00000314363:I982V;ENSP00000409720:I913V;ENSP00000343658:I1022V|.	ENSP00000303600:I785V|.	I|N	+|+	1|2	0|0	MAP4K4|MAP4K4	101860034|101860034	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.287000|9.287000	0.95975|0.95975	2.194000|2.194000	0.70268|0.70268	0.533000|0.533000	0.62120|0.62120	ATA|AAT	-	pfam_Citron,smart_Citron		0.408	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	MAP4K4	protein_coding	OTTHUMT00000339839.1	A	NM_004834	-		102493602	+1	no_errors	ENST00000324219	ensembl	human	known	74_37	missense	SNP	1.000	G
SCN1A	6323	genome.wustl.edu	37	2	166912969	166912969	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr2:166912969C>T	ENST00000303395.4	-	3	424	c.425G>A	c.(424-426)tGt>tAt	p.C142Y	AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000595268.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.C142Y|SCN1A_ENST00000409050.1_Missense_Mutation_p.C142Y|SCN1A_ENST00000423058.2_Missense_Mutation_p.C142Y			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	142					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CATAAACACACAGTTTGTCAA	0.289																																																	0								ENSG00000144285						106.0	106.0	106.0					2																	166912969		2203	4300	6503	SCN1A	SO:0001583	missense	0			-	HGNC	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.425G>A	2.37:g.166912969C>T	ENSP00000303540:p.Cys142Tyr	Somatic	0	46	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	7	65.00	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	24	0.00	0	21	63.16	36	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.C142Y	ENST00000303395.4	37	c.425	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	C	25.6	4.654605	0.88056	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.97505	-4.41;-4.41;-4.41;-4.41	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.99108	0.9693	H	0.97186	3.955	0.80722	D	1	D;D;D	0.71674	0.998;0.993;0.998	D;D;D	0.80764	0.959;0.939;0.994	D	0.99041	1.0824	10	0.87932	D	0	.	20.1115	0.97913	0.0:1.0:0.0:0.0	.	142;142;142	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	Y	142	ENSP00000407030:C142Y;ENSP00000303540:C142Y;ENSP00000364554:C142Y;ENSP00000386312:C142Y	ENSP00000303540:C142Y	C	-	2	0	SCN1A	166621215	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.648000	0.83479	2.814000	0.96858	0.655000	0.94253	TGT	-	NULL		0.289	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	protein_coding	OTTHUMT00000102661.1	C	NM_006920	-		166912969	-1	no_errors	ENST00000303395	ensembl	human	known	74_37	missense	SNP	1.000	T
SHANK2	22941	genome.wustl.edu	37	11	70331623	70331623	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr11:70331623C>A	ENST00000423696.2	-	15	3674	c.3638G>T	c.(3637-3639)gGg>gTg	p.G1213V	SHANK2_ENST00000338508.4_Missense_Mutation_p.G1593V|SHANK2_ENST00000449833.2_Missense_Mutation_p.G997V|SHANK2_ENST00000409161.1_Missense_Mutation_p.G996V			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	1213					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			CTTGGCCATCCCAGGCTGGGC	0.577																																																	0								ENSG00000162105						54.0	61.0	58.0					11																	70331623		2200	4294	6494	SHANK2	SO:0001583	missense	0			-	HGNC	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.3638G>T	11.37:g.70331623C>A	ENSP00000394536:p.Gly1213Val	Somatic	0	27	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	13	38.10	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	36	0.00	0	26	31.58	12	pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.G1593V	ENST00000423696.2	37	c.4778		11	.	.	.	.	.	.	.	.	.	.	C	13.00	2.106547	0.37145	.	.	ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018	T;T;T;T;T;T	0.41400	2.29;2.29;3.02;1.0;2.42;2.42	5.32	3.39	0.38822	.	0.868159	0.10212	N	0.701961	T	0.44456	0.1294	L	0.53249	1.67	0.23150	N	0.998218	B;P;P	0.42757	0.134;0.789;0.604	B;P;B	0.45428	0.07;0.48;0.268	T	0.20505	-1.0273	10	0.39692	T	0.17	.	9.6796	0.40061	0.0:0.6556:0.2667:0.0777	.	1213;1592;997	Q9UPX8;Q9UPX8-3;Q9UPX8-4	SHAN2_HUMAN;.;.	V	997;996;871;1593;1213;1231;1216	ENSP00000399423:G997V;ENSP00000386491:G996V;ENSP00000402944:G871V;ENSP00000345193:G1593V;ENSP00000394536:G1213V;ENSP00000294018:G1216V	ENSP00000294018:G1216V	G	-	2	0	SHANK2	70009271	0.052000	0.20516	0.017000	0.16124	0.989000	0.77384	1.466000	0.35310	0.578000	0.29487	0.655000	0.94253	GGG	-	NULL		0.577	SHANK2-203	KNOWN	basic	protein_coding	SHANK2	protein_coding		C	NM_012309	-		70331623	-1	no_errors	ENST00000338508	ensembl	human	known	74_37	missense	SNP	0.038	A
RP11-274B21.1	0	genome.wustl.edu	37	7	128263709	128263709	+	RNA	SNP	G	G	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr7:128263709G>A	ENST00000605862.1	+	0	1408																											GTCTAAACTGGAAAAGTCCTG	0.398																																																	0								ENSG00000242588																																			RP11-274B21.1			0			-	Clone_based_vega_gene																													7.37:g.128263709G>A		Somatic	0	55	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	58	12.12		RNA	SNP	47	0.00	0	68	16.05	13	-	NULL	ENST00000605862.1	37	NULL		7																																																																																			-	-		0.398	RP11-274B21.1-002	KNOWN	basic	processed_transcript	LOC101930494	pseudogene	OTTHUMT00000468355.1	G		-		128263709	+1	no_errors	ENST00000605862	ensembl	human	known	74_37	rna	SNP	0.212	A
TRIM49C	642612	genome.wustl.edu	37	11	89768577	89768577	+	Silent	SNP	C	C	T	rs61903674	byFrequency	TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr11:89768577C>T	ENST00000448984.1	+	3	527	c.198C>T	c.(196-198)acC>acT	p.T66T	TRIM49C_ENST00000432771.1_Silent_p.T66T	NM_001195234.1	NP_001182163.1	P0CI26	TR49C_HUMAN	tripartite motif containing 49C	66						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|lung(4)	8						ACCTCAAAACCAACATTCATT	0.458													c|||	231	0.0461262	0.003	0.0605	5008	,	,		16161	0.002		0.1054	False		,,,				2504	0.0787																0								ENSG00000204449																																			TRIM49C	SO:0001819	synonymous_variant	0			-	HGNC	BC126470	CCDS53694.1	11q14.3	2014-02-17	2012-05-18	2012-05-18	ENSG00000204449	ENSG00000204449		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	38877	protein-coding gene	gene with protein product			"""tripartite motif containing 49-like 2"""	TRIM49L2			Standard	NM_001195234		Approved		uc010rua.2	P0CI26		ENST00000448984.1:c.198C>T	11.37:g.89768577C>T		Somatic	0	65	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	6	45.45	A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Silent	SNP	23	0.00	0	5	0.00	0	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.T66	ENST00000448984.1	37	c.198	CCDS53694.1	11																																																																																			-	NULL		0.458	TRIM49C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM49C	protein_coding	OTTHUMT00000395455.1	C	NM_001195234	rs201628038		89768577	+1	no_errors	ENST00000448984	ensembl	human	known	74_37	silent	SNP	0.001	T
ZNF683	257101	genome.wustl.edu	37	1	26691499	26691499	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr1:26691499A>T	ENST00000436292.1	-	4	658	c.538T>A	c.(538-540)Tcc>Acc	p.S180T	ZNF683_ENST00000374204.1_Missense_Mutation_p.S180T|ZNF683_ENST00000349618.3_Missense_Mutation_p.S180T|ZNF683_ENST00000403843.1_Missense_Mutation_p.S180T			Q8IZ20	ZN683_HUMAN	zinc finger protein 683	180					natural killer cell differentiation (GO:0001779)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(1)	15		all_cancers(24;2.39e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.76e-26)|Colorectal(126;1.38e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00793)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.159)|LUSC - Lung squamous cell carcinoma(448;0.233)		TTGGAGATGGAGTTGACAGGG	0.597																																																	0								ENSG00000176083						50.0	52.0	52.0					1																	26691499		2203	4300	6503	ZNF683	SO:0001583	missense	0			-	HGNC	BC029505	CCDS279.2	1p36.11	2013-01-08			ENSG00000176083	ENSG00000176083		"""Zinc fingers, C2H2-type"""	28495	protein-coding gene	gene with protein product	"""hypothetical protein MGC33414"""					12477932	Standard	NM_173574		Approved	MGC33414	uc009vsj.1	Q8IZ20	OTTHUMG00000003521	ENST00000436292.1:c.538T>A	1.37:g.26691499A>T	ENSP00000388792:p.Ser180Thr	Somatic	0	65	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	33	36.54	Q5T141|Q5T146|Q5T147|Q5T149|Q8NEN4	Missense_Mutation	SNP	33	0.00	0	29	40.82	20	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S180T	ENST00000436292.1	37	c.538		1	.	.	.	.	.	.	.	.	.	.	A	10.73	1.432967	0.25813	.	.	ENSG00000176083	ENST00000403843;ENST00000436292;ENST00000374204;ENST00000349618;ENST00000455900;ENST00000451801;ENST00000454975;ENST00000423508;ENST00000416125	T;T;T;T;T;T;T;T;T	0.30981	3.08;3.08;3.0;3.0;2.22;2.22;1.51;1.87;1.88	4.71	0.558	0.17266	.	0.736185	0.11764	N	0.531839	T	0.13798	0.0334	N	0.14661	0.345	0.09310	N	1	B;B	0.29805	0.257;0.167	B;B	0.29077	0.098;0.045	T	0.31052	-0.9957	10	0.15499	T	0.54	-2.2335	4.109	0.10050	0.3047:0.1727:0.5225:0.0	.	180;180	Q8IZ20-2;Q8IZ20	.;ZN683_HUMAN	T	180;180;180;180;188;180;130;188;180	ENSP00000384782:S180T;ENSP00000388792:S180T;ENSP00000363320:S180T;ENSP00000344095:S180T;ENSP00000411289:S188T;ENSP00000411290:S180T;ENSP00000412881:S130T;ENSP00000391584:S188T;ENSP00000401961:S180T	ENSP00000344095:S180T	S	-	1	0	ZNF683	26564086	0.000000	0.05858	0.001000	0.08648	0.027000	0.11550	-0.143000	0.10296	-0.048000	0.13401	-0.366000	0.07423	TCC	-	NULL		0.597	ZNF683-202	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF683	protein_coding	OTTHUMT00000009794.2	A	NM_173574	-		26691499	-1	no_errors	ENST00000403843	ensembl	human	known	74_37	missense	SNP	0.043	T
CEP290	80184	genome.wustl.edu	37	12	88508231	88508231	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr12:88508231G>A	ENST00000552810.1	-	20	2361	c.2018C>T	c.(2017-2019)tCt>tTt	p.S673F	CEP290_ENST00000397838.3_5'UTR|CEP290_ENST00000309041.7_Missense_Mutation_p.S675F	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	673					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						GATAATTAGAGATGTTTCTCC	0.318																																																	0								ENSG00000198707						165.0	147.0	152.0					12																	88508231		1656	3710	5366	CEP290	SO:0001583	missense	0			-	HGNC	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.2018C>T	12.37:g.88508231G>A	ENSP00000448012:p.Ser673Phe	Somatic	0	50	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	182	146	55.49	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	33	0.00	0	260	65.01	483	NULL	p.S675F	ENST00000552810.1	37	c.2024	CCDS55858.1	12	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705418	0.48412	.	.	ENSG00000198707	ENST00000552810;ENST00000309041;ENST00000536998	T;T	0.81078	-1.45;-1.45	6.06	5.18	0.71444	.	0.390399	0.26951	N	0.021674	T	0.68522	0.3010	N	0.22421	0.69	0.80722	D	1	P;B	0.44380	0.834;0.296	B;B	0.39258	0.295;0.079	T	0.71823	-0.4476	10	0.56958	D	0.05	.	11.4358	0.50068	0.137:0.0:0.863:0.0	.	673;673	Q05BJ6;O15078	.;CE290_HUMAN	F	673;675;673	ENSP00000448012:S673F;ENSP00000308021:S675F	ENSP00000308021:S675F	S	-	2	0	CEP290	87032362	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	3.588000	0.53964	1.582000	0.49881	0.650000	0.86243	TCT	-	NULL		0.318	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP290	protein_coding	OTTHUMT00000406344.1	G	NM_025114	-		88508231	-1	no_errors	ENST00000309041	ensembl	human	known	74_37	missense	SNP	0.983	A
MAP3K5	4217	genome.wustl.edu	37	6	137015432	137015432	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr6:137015432C>T	ENST00000359015.4	-	7	1459	c.1099G>A	c.(1099-1101)Gac>Aac	p.D367N		NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	367					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		TTTGCTCTGTCACCAGGGAGA	0.348																																																	0								ENSG00000197442						63.0	56.0	58.0					6																	137015432		2203	4300	6503	MAP3K5	SO:0001583	missense	0			-	HGNC	U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.1099G>A	6.37:g.137015432C>T	ENSP00000351908:p.Asp367Asn	Somatic	0	45	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	32	20.00	A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	49	0.00	0	58	17.14	12	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D367N	ENST00000359015.4	37	c.1099	CCDS5179.1	6	.	.	.	.	.	.	.	.	.	.	C	33	5.228993	0.95173	.	.	ENSG00000197442	ENST00000359015;ENST00000367768	T	0.12879	2.64	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.38506	0.1043	M	0.85197	2.74	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;0.999;0.997	T	0.27157	-1.0082	10	0.62326	D	0.03	.	20.109	0.97906	0.0:1.0:0.0:0.0	.	447;212;367	Q59GL6;B4DF67;Q99683	.;.;M3K5_HUMAN	N	367;447	ENSP00000351908:D367N	ENSP00000351908:D367N	D	-	1	0	MAP3K5	137057125	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.400000	0.79949	2.829000	0.97493	0.591000	0.81541	GAC	-	NULL		0.348	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K5	protein_coding	OTTHUMT00000042383.1	C		-		137015432	-1	no_errors	ENST00000359015	ensembl	human	known	74_37	missense	SNP	1.000	T
APBA3	9546	genome.wustl.edu	37	19	3759868	3759868	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr19:3759868A>C	ENST00000316757.3	-	2	595	c.395T>G	c.(394-396)cTa>cGa	p.L132R	MRPL54_ENST00000330133.4_5'Flank	NM_004886.3	NP_004877.1	O96018	APBA3_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 3	132					in utero embryonic development (GO:0001701)|negative regulation of catalytic activity (GO:0043086)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	perinuclear region of cytoplasm (GO:0048471)	beta-amyloid binding (GO:0001540)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)			endometrium(1)|large_intestine(1)|skin(1)	3		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCAGGCTCTAGAGGCTCTTC	0.662																																																	0								ENSG00000011132						31.0	39.0	36.0					19																	3759868		2201	4297	6498	APBA3	SO:0001583	missense	0			-	HGNC	AB021638	CCDS12110.1	19p13.3	2008-07-18	2008-07-18			ENSG00000011132			580	protein-coding gene	gene with protein product	"""X11-like 2"""	604262				10049767	Standard	NM_004886		Approved	X11L2, mint3	uc002lyp.1	O96018		ENST00000316757.3:c.395T>G	19.37:g.3759868A>C	ENSP00000315136:p.Leu132Arg	Somatic	0	57	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	31	38.00	O60483|Q9UPZ2	Missense_Mutation	SNP	59	0.00	0	31	46.55	27	pfam_PTB/PI_dom,pfam_PDZ,superfamily_PDZ,smart_PTB/PI_dom,smart_PDZ,pfscan_PDZ,pfscan_PTB/PI_dom	p.L132R	ENST00000316757.3	37	c.395	CCDS12110.1	19	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.463034	0.01062	.	.	ENSG00000011132	ENST00000316757	T	0.06528	3.29	4.8	1.02	0.19986	.	1.177780	0.06287	N	0.698437	T	0.04272	0.0118	N	0.24115	0.695	0.09310	N	1	B	0.20671	0.047	B	0.14578	0.011	T	0.46527	-0.9185	10	0.16420	T	0.52	.	4.3894	0.11332	0.3095:0.0:0.5188:0.1716	.	132	O96018	APBA3_HUMAN	R	132	ENSP00000315136:L132R	ENSP00000315136:L132R	L	-	2	0	APBA3	3710868	0.000000	0.05858	0.001000	0.08648	0.025000	0.11179	-0.456000	0.06754	0.446000	0.26666	-0.375000	0.07067	CTA	-	NULL		0.662	APBA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA3	protein_coding	OTTHUMT00000453634.2	A		-		3759868	-1	no_errors	ENST00000316757	ensembl	human	known	74_37	missense	SNP	0.000	C
COL7A1	1294	genome.wustl.edu	37	3	48603732	48603732	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr3:48603732delC	ENST00000328333.8	-	113	8482	c.8375delG	c.(8374-8376)ggcfs	p.G2792fs	COL7A1_ENST00000470076.1_5'Flank|UCN2_ENST00000273610.3_5'Flank|COL7A1_ENST00000454817.1_Frame_Shift_Del_p.G2760fs	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2792	Nonhelical region (NC2).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GCGCACAAAGCCCCGGATGTC	0.597																																																	0			GRCh37	CD072388	COL7A1	D		ENSG00000114270						42.0	40.0	41.0					3																	48603732		2202	4300	6502	COL7A1	SO:0001589	frameshift_variant	0				HGNC	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.8375delG	3.37:g.48603732delC	ENSP00000332371:p.Gly2792fs	Somatic	0	37	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	35	38.60	Q14054|Q16507	Frame_Shift_Del	DEL	41	0.00	0	63	24.10	20	pfam_Collagen,pfam_Fibronectin_type3,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.G2792fs	ENST00000328333.8	37	c.8375	CCDS2773.1	3																																																																																			-	NULL		0.597	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	protein_coding	OTTHUMT00000257519.1	C	NM_000094			48603732	-1	no_errors	ENST00000328333	ensembl	human	known	74_37	frame_shift_del	DEL	0.596	-
PDHX	8050	genome.wustl.edu	37	11	35006133	35006133	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr11:35006133A>G	ENST00000227868.4	+	9	1124	c.1040A>G	c.(1039-1041)aAt>aGt	p.N347S	PDHX_ENST00000430469.2_Missense_Mutation_p.N120S|PDHX_ENST00000448838.3_Missense_Mutation_p.N332S			O00330	ODPX_HUMAN	pyruvate dehydrogenase complex, component X	347					cellular metabolic process (GO:0044237)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	transferase activity, transferring acyl groups (GO:0016746)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)	16	all_epithelial(35;0.115)|Lung NSC(22;0.218)|all_lung(20;0.242)	all_hematologic(20;0.124)	STAD - Stomach adenocarcinoma(6;0.00113)			CCAGATGTTAATGTAAGCTGG	0.363																																																	0								ENSG00000110435						67.0	64.0	65.0					11																	35006133		2202	4298	6500	PDHX	SO:0001583	missense	0			-	HGNC	U82328	CCDS7896.1, CCDS44569.1, CCDS53616.1	11p13	2008-02-05			ENSG00000110435	ENSG00000110435			21350	protein-coding gene	gene with protein product		608769				9467010, 12372595	Standard	NM_003477		Approved	E3BP, proX, PDX1, OPDX, DLDBP	uc001mvt.3	O00330	OTTHUMG00000166491	ENST00000227868.4:c.1040A>G	11.37:g.35006133A>G	ENSP00000227868:p.Asn347Ser	Somatic	0	45	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	16	38.46	B4DW62|D3DR11|E9PB14|E9PBP7|O60221|Q96FV8|Q99783	Missense_Mutation	SNP	54	0.00	0	39	39.06	25	pfam_2-oxoacid_DH_actylTfrase,pfam_Biotin_lipoyl,pfam_E3-bd,superfamily_Single_hybrid_motif,superfamily_E3-bd,pfscan_Biotin_lipoyl	p.N347S	ENST00000227868.4	37	c.1040	CCDS7896.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.6|21.6	4.175722|4.175722	0.78564|0.78564	.|.	.|.	ENSG00000110435|ENSG00000110435	ENST00000526309|ENST00000448838;ENST00000227868;ENST00000430469	.|T;T;T	.|0.58797	.|0.31;0.31;0.31	5.55|5.55	5.55|5.55	0.83447|0.83447	.|2-oxoacid dehydrogenase acyltransferase, catalytic domain (1);Chloramphenicol acetyltransferase-like domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.84763|0.84763	0.5544|0.5544	H|H	0.97918|0.97918	4.105|4.105	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|0.999;1.0;1.0	.|D;D;D	.|0.87578	.|0.996;0.997;0.998	D|D	0.90300|0.90300	0.4329|0.4329	5|10	.|0.72032	.|D	.|0.01	-30.8015|-30.8015	14.8789|14.8789	0.70516|0.70516	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|120;332;347	.|E9PBP7;E9PB14;O00330	.|.;.;ODPX_HUMAN	V|S	35|332;347;120	.|ENSP00000389404:N332S;ENSP00000227868:N347S;ENSP00000415695:N120S	.|ENSP00000227868:N347S	M|N	+|+	1|2	0|0	PDHX|PDHX	34962709|34962709	1.000000|1.000000	0.71417|0.71417	0.882000|0.882000	0.34594|0.34594	0.923000|0.923000	0.55619|0.55619	8.543000|8.543000	0.90651|0.90651	2.107000|2.107000	0.64212|0.64212	0.482000|0.482000	0.46254|0.46254	ATG|AAT	-	pfam_2-oxoacid_DH_actylTfrase		0.363	PDHX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDHX	protein_coding	OTTHUMT00000390017.1	A	NM_003477	-		35006133	+1	no_errors	ENST00000227868	ensembl	human	known	74_37	missense	SNP	1.000	G
KRT18P55	284085	genome.wustl.edu	37	17	26603750	26603750	+	RNA	SNP	T	T	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr17:26603750T>A	ENST00000577198.1	-	0	1211				AC061975.8_ENST00000385109.1_RNA	NR_028334.1				keratin 18 pseudogene 55																		CAGCTTCTCCTTGAGAGCCTT	0.517																																																	0								ENSG00000265480						22.0	23.0	23.0					17																	26603750		2195	4296	6491	KRT18P55			0			-	HGNC			17q11.2	2013-06-25			ENSG00000265480	ENSG00000265480			26874	pseudogene	pseudogene							Standard	NR_028334		Approved		uc002has.3		OTTHUMG00000179422		17.37:g.26603750T>A		Somatic	0	25	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	17	26.09		RNA	SNP	43	0.00	0	54	14.29	9	-	NULL	ENST00000577198.1	37	NULL		17																																																																																			-	-		0.517	KRT18P55-002	KNOWN	basic	processed_transcript	KRT18P55	pseudogene	OTTHUMT00000446194.1	T	NR_028334	-		26603750	-1	no_errors	ENST00000577198	ensembl	human	known	74_37	rna	SNP	1.000	A
RNF212	285498	genome.wustl.edu	37	4	1087327	1087328	+	Intron	INS	-	-	CTGCCCAGGCTGGAGCCAGCC	rs376912904|rs386670461|rs142232513|rs539986150|rs138488801	byFrequency	TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr4:1087327_1087328insCTGCCCAGGCTGGAGCCAGCC	ENST00000433731.2	-	4	308				RNF212_ENST00000333673.5_In_Frame_Ins_p.241_241S>WLAPAWAA|RNF212_ENST00000382968.5_Intron			Q495C1	RN212_HUMAN	ring finger protein 212						chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		CAGAGCCTGTGACCTCCACGGC	0.619																																																	0								ENSG00000178222																																			RNF212	SO:0001627	intron_variant	0				HGNC	AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.247-2701->GGCTGGCTCCAGCCTGGGCAG	4.37:g.1087327_1087328insCTGCCCAGGCTGGAGCCAGCC		Somatic	NA	NA	NA		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	In_Frame_Ins	INS	31	29.55	13	56	24.32	18	pfscan_Znf_RING	p.S241in_frame_insWLAPAWAA	ENST00000433731.2	37	c.722_721	CCDS46996.1	4																																																																																			-	NULL		0.619	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF212	protein_coding	OTTHUMT00000359124.2	-	NM_194439			1087328	-1	no_errors	ENST00000333673	ensembl	human	known	74_37	in_frame_ins	INS	0.085:0.000	CTGCCCAGGCTGGAGCCAGCC
CEP290	80184	genome.wustl.edu	37	12	88508256	88508256	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr12:88508256G>A	ENST00000552810.1	-	20	2336	c.1993C>T	c.(1993-1995)Cct>Tct	p.P665S	CEP290_ENST00000397838.3_5'UTR|CEP290_ENST00000309041.7_Missense_Mutation_p.P667S	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	665					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						TTAACATCAGGATCTTTCTGC	0.303																																																	0								ENSG00000198707						163.0	146.0	151.0					12																	88508256		1741	3863	5604	CEP290	SO:0001583	missense	0			-	HGNC	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.1993C>T	12.37:g.88508256G>A	ENSP00000448012:p.Pro665Ser	Somatic	0	56	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	216	166	56.54	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	35	0.00	0	258	65.42	488	NULL	p.P667S	ENST00000552810.1	37	c.1999	CCDS55858.1	12	.	.	.	.	.	.	.	.	.	.	G	0.655	-0.807873	0.02819	.	.	ENSG00000198707	ENST00000552810;ENST00000309041;ENST00000536998	T;T	0.79653	-1.29;-1.29	5.87	3.06	0.35304	.	0.337668	0.32386	N	0.006178	T	0.58264	0.2110	N	0.10874	0.06	0.80722	D	1	B;B	0.10296	0.001;0.003	B;B	0.09377	0.004;0.004	T	0.47446	-0.9117	10	0.06494	T	0.89	.	10.2179	0.43179	0.2753:0.0:0.7246:0.0	.	665;665	Q05BJ6;O15078	.;CE290_HUMAN	S	665;667;665	ENSP00000448012:P665S;ENSP00000308021:P667S	ENSP00000308021:P667S	P	-	1	0	CEP290	87032387	1.000000	0.71417	0.985000	0.45067	0.471000	0.32888	1.152000	0.31663	0.387000	0.25024	-0.145000	0.13849	CCT	-	NULL		0.303	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP290	protein_coding	OTTHUMT00000406344.1	G	NM_025114	-		88508256	-1	no_errors	ENST00000309041	ensembl	human	known	74_37	missense	SNP	0.909	A
PRMT2	3275	genome.wustl.edu	37	21	48084213	48084214	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr21:48084213_48084214insAA	ENST00000397637.1	+	11	2230_2231	c.1276_1277insAA	c.(1276-1278)gaafs	p.E426fs	PRMT2_ENST00000355680.3_Frame_Shift_Ins_p.E426fs|PRMT2_ENST00000451211.2_Frame_Shift_Ins_p.K280fs|PRMT2_ENST00000291705.6_Frame_Shift_Ins_p.E221fs|PRMT2_ENST00000397638.2_Frame_Shift_Ins_p.E426fs|PRMT2_ENST00000440086.1_Frame_Shift_Ins_p.E324fs|PRMT2_ENST00000458387.2_Frame_Shift_Ins_p.RK278fs			P55345	ANM2_HUMAN	protein arginine methyltransferase 2	426	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		TCAGGTTGGAGAAAAAGTCTTC	0.371																																																	0								ENSG00000160310																																			PRMT2	SO:0001589	frameshift_variant	0				HGNC	U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.1279_1280dupAA	21.37:g.48084216_48084217dupAA	ENSP00000380759:p.Glu426fs	Somatic	0	50	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	50	10.71	B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Frame_Shift_Ins	INS	39	0.00	0	80	13.04	12	pfam_SH3_domain,pfam_Arg_MeTrfase,pfam_SH3_2,pfam_Small_mtfrase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_tRNA_Trfase_Trm5/Tyw2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	p.V428fs	ENST00000397637.1	37	c.1276_1277	CCDS13737.1	21																																																																																			-	NULL		0.371	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRMT2	protein_coding	OTTHUMT00000207401.1	-	NM_001535			48084214	+1	no_errors	ENST00000355680	ensembl	human	known	74_37	frame_shift_ins	INS	0.999:0.995	AA
RAI1	10743	genome.wustl.edu	37	17	17697099	17697100	+	Frame_Shift_Del	DEL	GC	GC	-	rs35068024|rs587780431|rs587780429|rs398124422|rs11078398|rs144872134	byFrequency	TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	GC	GC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr17:17697099_17697100delGC	ENST00000353383.1	+	3	1306_1307	c.837_838delGC	c.(835-840)cagcagfs	p.QQ279fs	RAI1_ENST00000261641.6_Frame_Shift_Del_p.QQ279fs	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	279	Gln-rich.|Poly-Gln.				circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		ATGACcagcagcagcagcagca	0.634																																																	0								ENSG00000108557																																			RAI1	SO:0001589	frameshift_variant	0				HGNC	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.837_838delGC	17.37:g.17697099_17697100delGC	ENSP00000323074:p.Gln279fs	Somatic	0	20	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	8	65.22	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Frame_Shift_Del	DEL	16	58.97	23	15	50.00	15	smart_Znf_PHD	p.Q280fs	ENST00000353383.1	37	c.837_838	CCDS11188.1	17																																																																																			-	NULL		0.634	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAI1	protein_coding	OTTHUMT00000131775.1	GC	NM_030665			17697100	+1	no_errors	ENST00000353383	ensembl	human	known	74_37	frame_shift_del	DEL	0.891:0.907	-
COG5	10466	genome.wustl.edu	37	7	107002489	107002489	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr7:107002489delC	ENST00000347053.3	-	10	1158	c.1108delG	c.(1108-1110)gaafs	p.E370fs	COG5_ENST00000297135.3_Frame_Shift_Del_p.E370fs|COG5_ENST00000393603.2_Frame_Shift_Del_p.E370fs	NM_181733.2	NP_859422.2	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5	370					intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|skin(4)|stomach(1)	40						TTAACTATTTCTTCAATGAAA	0.303																																																	0								ENSG00000164597						76.0	74.0	74.0					7																	107002489		2200	4299	6499	COG5	SO:0001589	frameshift_variant	0				HGNC	AF058718	CCDS5742.1, CCDS5743.1, CCDS55152.1	7q31	2010-06-24	2001-12-07	2002-05-10	ENSG00000164597	ENSG00000164597		"""Components of oligomeric golgi complex"""	14857	protein-coding gene	gene with protein product		606821	"""golgi transport complex 1 (90 kDa subunit)"""	GOLTC1		9792665, 11980916	Standard	NM_006348		Approved	GTC90	uc003vec.2	Q9UP83	OTTHUMG00000023895	ENST00000347053.3:c.1108delG	7.37:g.107002489delC	ENSP00000334703:p.Glu370fs	Somatic	0	59	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	22	40.54	A4D0R6|A4D0R7|O14555|O95008|Q6NUL5	Frame_Shift_Del	DEL	42	0.00	0	33	37.74	20	pfam_Cog5	p.E370fs	ENST00000347053.3	37	c.1108	CCDS5743.1	7																																																																																			-	NULL		0.303	COG5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COG5	protein_coding	OTTHUMT00000060216.4	C				107002489	-1	no_errors	ENST00000297135	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
NARS2	79731	genome.wustl.edu	37	11	78154810	78154811	+	Intron	INS	-	-	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr11:78154810_78154811insA	ENST00000281038.5	-	12	1540				RP11-452H21.1_ENST00000534168.1_RNA|NARS2_ENST00000528850.1_Intron	NM_001243251.1|NM_024678.5	NP_001230180.1|NP_078954.4	Q96I59	SYNM_HUMAN	asparaginyl-tRNA synthetase 2, mitochondrial (putative)						asparaginyl-tRNA aminoacylation (GO:0006421)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	asparagine-tRNA ligase activity (GO:0004816)|ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)	27	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)	GCAACCTAAGGAAAAAAAAAAA	0.396																																																	0								ENSG00000254420																																			RP11-452H21.1	SO:0001627	intron_variant	0				Clone_based_vega_gene	BC007800	CCDS8261.1, CCDS58164.1	11q14.1	2011-07-01	2007-02-23		ENSG00000137513	ENSG00000137513	6.1.1.22	"""Aminoacyl tRNA synthetases / Class II"""	26274	protein-coding gene	gene with protein product	"""asparagine tRNA ligase 2, mitochondrial (putative)"""	612803				15779907	Standard	NM_024678		Approved	FLJ23441, SLM5	uc001ozi.3	Q96I59	OTTHUMG00000166702	ENST00000281038.5:c.1165-6->T	11.37:g.78154821_78154821dupA		Somatic	0	24	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	G3V178	RNA	INS	35	2.78	1	80	2.44	2	-	NULL	ENST00000281038.5	37	NULL	CCDS8261.1	11																																																																																			-	-		0.396	NARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000254420	protein_coding	OTTHUMT00000391138.2	-	NM_024678			78154811	+1	no_errors	ENST00000534168	ensembl	human	known	74_37	rna	INS	0.247:0.000	A
MUC20	200958	genome.wustl.edu	37	3	195452960	195452960	+	Missense_Mutation	SNP	G	G	A	rs4093817	byFrequency	TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr3:195452960G>A	ENST00000447234.2	+	2	1612	c.1486G>A	c.(1486-1488)Gtt>Att	p.V496I	MUC20_ENST00000436408.1_Missense_Mutation_p.V496I|MUC20_ENST00000445522.2_Missense_Mutation_p.V461I|MUC20_ENST00000320736.6_Missense_Mutation_p.V325I	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	496	Involved in oligomerization.		Missing. {ECO:0000269|PubMed:14702039}.	V -> I (in Ref. 5; AAH29267). {ECO:0000305}.	activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		TGATGCCACGGTTGGGACCCC	0.597																																																	0								ENSG00000176945						57.0	51.0	53.0					3																	195452960		2183	4280	6463	MUC20	SO:0001583	missense	0			-	HGNC	AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.1486G>A	3.37:g.195452960G>A	ENSP00000414350:p.Val496Ile	Somatic	0	63	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	58	9.38	Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	Missense_Mutation	SNP	39	11.36	5	46	8.00	4	NULL	p.V496I	ENST00000447234.2	37	c.1486		3	.	.	.	.	.	.	.	.	.	.	G	9.647	1.140515	0.21205	.	.	ENSG00000176945	ENST00000447234;ENST00000320736;ENST00000436408;ENST00000445522	T;T;T;T	0.15718	2.82;2.84;2.99;2.4	3.86	-0.128	0.13506	.	0.860472	0.09679	N	0.770091	T	0.10981	0.0268	L	0.32530	0.975	0.09310	N	1	B	0.23891	0.093	B	0.17433	0.018	T	0.36359	-0.9751	10	0.27785	T	0.31	0.7218	5.1463	0.14987	0.2242:0.4104:0.3653:0.0	rs4093817	325	E9PH32	.	I	496;325;496;461	ENSP00000414350:V496I;ENSP00000325431:V325I;ENSP00000396774:V496I;ENSP00000405629:V461I	ENSP00000325431:V325I	V	+	1	0	MUC20	196938631	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.098000	0.15189	-0.151000	0.11176	-0.351000	0.07748	GTT	-	NULL		0.597	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	MUC20	protein_coding	OTTHUMT00000341835.1	G	NM_152673	rs4093817		195452960	+1	no_errors	ENST00000447234	ensembl	human	known	74_37	missense	SNP	0.003	A
DNAH2	146754	genome.wustl.edu	37	17	7642332	7642332	+	Intron	SNP	G	G	C			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr17:7642332G>C	ENST00000572933.1	+	9	2630				DNAH2_ENST00000082259.3_Splice_Site_p.E472D|DNAH2_ENST00000570791.1_Splice_Site_p.E472D|DNAH2_ENST00000389173.2_Intron			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				ACCTTATTGAGGTGGGAAGAC	0.552																																																	0								ENSG00000183914																																			DNAH2	SO:0001627	intron_variant	0			-	HGNC	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.1171-719G>C	17.37:g.7642332G>C		Somatic	0	75	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	41	39.71	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	26	0.00	0	37	37.29	22	pfam_Dynein_heavy_dom-1	p.E472D	ENST00000572933.1	37	c.1416	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	G	28.2	4.899306	0.91962	.	.	ENSG00000183914	ENST00000082259	T	0.55760	0.5	5.17	5.17	0.71159	.	.	.	.	.	T	0.68686	0.3028	.	.	.	0.42906	D	0.994246	D	0.76494	0.999	D	0.77557	0.99	T	0.61763	-0.6996	8	0.20519	T	0.43	.	17.949	0.89046	0.0:0.0:1.0:0.0	.	472	Q9P225-3	.	D	472	ENSP00000082259:E472D	ENSP00000082259:E472D	E	+	3	2	DNAH2	7583057	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.791000	0.69045	2.853000	0.98044	0.655000	0.94253	GAG	-	pfam_Dynein_heavy_dom-1		0.552	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	protein_coding	OTTHUMT00000440241.1	G	NM_020877	-		7642332	+1	no_errors	ENST00000082259	ensembl	human	known	74_37	missense	SNP	1.000	C
HERC2P4	100289574	genome.wustl.edu	37	16	32186906	32186906	+	IGR	SNP	A	A	G			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr16:32186906A>G								HERC2P4 (4018 upstream) : RP11-17M15.1 (12747 downstream)																							TTCAAACTCGAAAGCAGCTTC	0.488																																																	0								ENSG00000230267																																			HERC2P4	SO:0001628	intergenic_variant	0			-	HGNC																													16.37:g.32186906A>G		Somatic	0	40	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	33	19.51		RNA	SNP	9	0.00	0	13	13.33	2	-	NULL		37	NULL		16																																																																																			-	-	0	0.488					HERC2P4			A		-		32186906	-1	no_errors	ENST00000566591	ensembl	human	known	74_37	rna	SNP	1.000	G
SCN5A	6331	genome.wustl.edu	37	3	38601888	38601888	+	Missense_Mutation	SNP	G	G	A	rs199473225		TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr3:38601888G>A	ENST00000333535.4	-	23	4144	c.3995C>T	c.(3994-3996)cCg>cTg	p.P1332L	SCN5A_ENST00000414099.2_Missense_Mutation_p.P1332L|SCN5A_ENST00000455624.2_Missense_Mutation_p.P1331L|SCN5A_ENST00000443581.1_Missense_Mutation_p.P1331L|SCN5A_ENST00000425664.1_Missense_Mutation_p.P1332L|SCN5A_ENST00000450102.2_Missense_Mutation_p.P1278L|SCN5A_ENST00000449557.2_Missense_Mutation_p.P1278L|SCN5A_ENST00000451551.2_Missense_Mutation_p.P1278L|SCN5A_ENST00000413689.1_Missense_Mutation_p.P1332L|SCN5A_ENST00000423572.2_Missense_Mutation_p.P1331L			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1332			P -> L (in LQT3).		AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CATGATGGACGGGATGGCGCC	0.577																																																	0			GRCh37	CM043869	SCN5A	M		ENSG00000183873						89.0	85.0	87.0					3																	38601888		2203	4300	6503	SCN5A	SO:0001583	missense	0			-	HGNC	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.3995C>T	3.37:g.38601888G>A	ENSP00000328968:p.Pro1332Leu	Somatic	0	45	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	41	14.58	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	40	0.00	0	57	17.39	12	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,prints_Na_channel_a5su,prints_Na_channel_asu	p.P1332L	ENST00000333535.4	37	c.3995	CCDS46796.1	3	.	.	.	.	.	.	.	.	.	.	G	27.2	4.805716	0.90623	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.97378	-4.36;-4.36;-4.36;-4.36;-4.36;-4.36;-4.36;-4.36;-4.36;-4.36	4.25	4.25	0.50352	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98918	0.9633	H	0.95402	3.665	0.80722	D	1	D;D;D;D;D;D;P	0.89917	0.998;1.0;1.0;1.0;1.0;1.0;0.931	D;D;D;D;D;D;P	0.97110	0.957;1.0;0.997;0.998;0.99;1.0;0.518	D	0.99474	1.0946	10	0.87932	D	0	.	17.2234	0.86963	0.0:0.0:1.0:0.0	.	1278;1331;1332;1332;1332;1331;1332	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	L	1332;1331;1332;1278;1331;1332;1332;1331;1278;1278	ENSP00000398962:P1332L;ENSP00000398266:P1331L;ENSP00000410257:P1332L;ENSP00000388797:P1278L;ENSP00000397915:P1331L;ENSP00000416634:P1332L;ENSP00000328968:P1332L;ENSP00000399524:P1331L;ENSP00000403355:P1278L;ENSP00000413996:P1278L	ENSP00000328968:P1332L	P	-	2	0	SCN5A	38576892	1.000000	0.71417	0.946000	0.38457	0.998000	0.95712	9.564000	0.98151	2.355000	0.79922	0.655000	0.94253	CCG	-	pfam_Ion_trans_dom		0.577	SCN5A-014	KNOWN	basic|CCDS	protein_coding	SCN5A	protein_coding	OTTHUMT00000377958.1	G	NM_198056	rs199473225		38601888	-1	no_errors	ENST00000333535	ensembl	human	known	74_37	missense	SNP	1.000	A
CCNL1	57018	genome.wustl.edu	37	3	156867129	156867129	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr3:156867129A>C	ENST00000295926.3	-	10	1297	c.1179T>G	c.(1177-1179)agT>agG	p.S393R	CCNL1_ENST00000479052.1_5'Flank|CCNL1_ENST00000461804.1_Missense_Mutation_p.S393R	NM_020307.2	NP_064703.1	Q9UK58	CCNL1_HUMAN	cyclin L1	393	RS.				regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|nucleus (GO:0005634)				NS(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0295)|Lung(72;0.0308)			ACCTCGATCGACTTGCACTTC	0.343																																																	0								ENSG00000163660						248.0	223.0	232.0					3																	156867129		2203	4300	6503	CCNL1	SO:0001583	missense	0			-	HGNC	AF180920	CCDS3178.1	3q25.31	2008-02-05			ENSG00000163660	ENSG00000163660			20569	protein-coding gene	gene with protein product		613384				11980906	Standard	NM_020307		Approved	ania-6a	uc003fbf.3	Q9UK58	OTTHUMG00000158713	ENST00000295926.3:c.1179T>G	3.37:g.156867129A>C	ENSP00000295926:p.Ser393Arg	Somatic	0	68	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	25	43.18	B3KMY3|Q6NVY9|Q6UWS7|Q8NI48|Q96QT0|Q9NZF3	Missense_Mutation	SNP	27	0.00	0	24	51.02	25	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_L	p.S393R	ENST00000295926.3	37	c.1179	CCDS3178.1	3	.	.	.	.	.	.	.	.	.	.	A	19.08	3.758054	0.69648	.	.	ENSG00000163660	ENST00000461804;ENST00000295926	T;T	0.26518	1.73;2.17	5.68	2.01	0.26516	.	0.000000	0.85682	D	0.000000	T	0.23727	0.0574	L	0.48642	1.525	0.80722	D	1	P;D	0.56521	0.845;0.976	B;P	0.46479	0.348;0.518	T	0.02893	-1.1097	10	0.22706	T	0.39	-20.7775	9.9402	0.41576	0.7362:0.0:0.2638:0.0	.	393;393	Q9UK58;C9JPL0	CCNL1_HUMAN;.	R	393	ENSP00000420277:S393R;ENSP00000295926:S393R	ENSP00000295926:S393R	S	-	3	2	CCNL1	158349823	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	1.247000	0.32815	0.452000	0.26830	0.533000	0.62120	AGT	-	pirsf_Cyclin_L		0.343	CCNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNL1	protein_coding	OTTHUMT00000351859.1	A	NM_020307	-		156867129	-1	no_errors	ENST00000295926	ensembl	human	known	74_37	missense	SNP	1.000	C
COG5	10466	genome.wustl.edu	37	7	107002492	107002492	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr7:107002492delC	ENST00000347053.3	-	10	1155	c.1105delG	c.(1105-1107)gaafs	p.E370fs	COG5_ENST00000297135.3_Frame_Shift_Del_p.E370fs|COG5_ENST00000393603.2_Frame_Shift_Del_p.E370fs	NM_181733.2	NP_859422.2	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5	370					intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|skin(4)|stomach(1)	40						ACTATTTCTTCAATGAAACAA	0.299																																																	0								ENSG00000164597						77.0	75.0	76.0					7																	107002492		2200	4298	6498	COG5	SO:0001589	frameshift_variant	0				HGNC	AF058718	CCDS5742.1, CCDS5743.1, CCDS55152.1	7q31	2010-06-24	2001-12-07	2002-05-10	ENSG00000164597	ENSG00000164597		"""Components of oligomeric golgi complex"""	14857	protein-coding gene	gene with protein product		606821	"""golgi transport complex 1 (90 kDa subunit)"""	GOLTC1		9792665, 11980916	Standard	NM_006348		Approved	GTC90	uc003vec.2	Q9UP83	OTTHUMG00000023895	ENST00000347053.3:c.1105delG	7.37:g.107002492delC	ENSP00000334703:p.Glu370fs	Somatic	0	58	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	22	40.54	A4D0R6|A4D0R7|O14555|O95008|Q6NUL5	Frame_Shift_Del	DEL	42	0.00	0	35	36.36	20	pfam_Cog5	p.E369fs	ENST00000347053.3	37	c.1105	CCDS5743.1	7																																																																																			-	NULL		0.299	COG5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COG5	protein_coding	OTTHUMT00000060216.4	C				107002492	-1	no_errors	ENST00000297135	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
AQR	9716	genome.wustl.edu	37	15	35189162	35189162	+	Missense_Mutation	SNP	G	G	A	rs369825498		TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr15:35189162G>A	ENST00000156471.5	-	22	2621	c.2396C>T	c.(2395-2397)aCg>aTg	p.T799M		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	799					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		GAACTGAATCGTATTACTGCA	0.358													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20381	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000021776	G	MET/THR	0,3738		0,0,1869	79.0	76.0	77.0		2396	5.5	1.0	15		77	1,8191		0,1,4095	no	missense	AQR	NM_014691.2	81	0,1,5964	AA,AG,GG		0.0122,0.0,0.0084	possibly-damaging	799/1486	35189162	1,11929	1869	4096	5965	AQR	SO:0001583	missense	0			-	HGNC	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.2396C>T	15.37:g.35189162G>A	ENSP00000156471:p.Thr799Met	Somatic	0	22	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	11	45.00	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	42	0.00	0	36	46.27	31	superfamily_P-loop_NTPase	p.T799M	ENST00000156471.5	37	c.2396	CCDS42013.1	15	.	.	.	.	.	.	.	.	.	.	G	18.56	3.650246	0.67472	0.0	1.22E-4	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.81739	-1.53	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.80757	0.4684	M	0.82323	2.585	0.58432	D	0.999999	P	0.40083	0.702	B	0.28139	0.086	T	0.83180	-0.0089	10	0.46703	T	0.11	-17.0767	19.766	0.96342	0.0:0.0:1.0:0.0	.	799	O60306	AQR_HUMAN	M	799	ENSP00000156471:T799M	ENSP00000156471:T799M	T	-	2	0	AQR	32976454	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.858000	0.86971	2.743000	0.94032	0.585000	0.79938	ACG	-	superfamily_P-loop_NTPase		0.358	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQR	protein_coding	OTTHUMT00000417526.2	G	NM_014691	-		35189162	-1	no_errors	ENST00000156471	ensembl	human	known	74_37	missense	SNP	1.000	A
CEP290	80184	genome.wustl.edu	37	12	88508221	88508221	+	Silent	SNP	G	G	A			TCGA-DX-A3M1-01A-11D-A228-09	TCGA-DX-A3M1-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	72f0a49a-aec8-47e5-846a-956c4da1507c	d732488f-aa89-4ee1-8915-c6ba1c5a5c44	g.chr12:88508221G>A	ENST00000552810.1	-	20	2371	c.2028C>T	c.(2026-2028)atC>atT	p.I676I	CEP290_ENST00000397838.3_5'UTR|CEP290_ENST00000309041.7_Silent_p.I678I	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	676					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						CAAGGCTAGGGATAATTAGAG	0.323																																																	0								ENSG00000198707						158.0	142.0	147.0					12																	88508221		1634	3620	5254	CEP290	SO:0001819	synonymous_variant	0			-	HGNC	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.2028C>T	12.37:g.88508221G>A		Somatic	0	49	0.00		0.731762716347244	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	172	137	55.66	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Silent	SNP	35	0.00	0	265	64.43	480	NULL	p.I678	ENST00000552810.1	37	c.2034	CCDS55858.1	12																																																																																			-	NULL		0.323	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP290	protein_coding	OTTHUMT00000406344.1	G	NM_025114	-		88508221	-1	no_errors	ENST00000309041	ensembl	human	known	74_37	silent	SNP	0.962	A
