#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
FRG2B	441581	genome.wustl.edu	37	10	135438937	135438937	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr10:135438937G>A	ENST00000425520.1	-	4	555	c.503C>T	c.(502-504)aCa>aTa	p.T168I	FRG2B_ENST00000443774.1_Missense_Mutation_p.T169I	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	168						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		AATTGACGGTGTTTGGACTCC	0.557																																																	0								ENSG00000225899						126.0	152.0	143.0					10																	135438937		2193	4291	6484	FRG2B	SO:0001583	missense	0			-	HGNC	AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.503C>T	10.37:g.135438937G>A	ENSP00000401310:p.Thr168Ile	Somatic	0	97	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	100	27.54	Q5VSQ1	Missense_Mutation	SNP	50	0.00	0	58	27.50	22	NULL	p.T168I	ENST00000425520.1	37	c.503	CCDS44502.1	10	.	.	.	.	.	.	.	.	.	.	.	7.036	0.561550	0.13498	.	.	ENSG00000225899	ENST00000443774;ENST00000425520	T;T	0.43688	0.94;0.94	.	.	.	.	1.278750	0.05806	N	0.613188	T	0.22781	0.0550	N	0.08118	0	0.09310	N	1	P	0.47677	0.899	B	0.42062	0.374	T	0.15206	-1.0445	8	0.38643	T	0.18	-0.105	.	.	.	.	168	Q96QU4	FRG2B_HUMAN	I	169;168	ENSP00000408343:T169I;ENSP00000401310:T168I	ENSP00000401310:T168I	T	-	2	0	FRG2B	135288927	0.005000	0.15991	0.136000	0.22124	0.137000	0.21094	0.308000	0.19314	0.119000	0.18210	0.121000	0.15741	ACA	-	NULL		0.557	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FRG2B	protein_coding	OTTHUMT00000467780.1	G	NM_001080998	-		135438937	-1	no_errors	ENST00000425520	ensembl	human	known	74_37	missense	SNP	0.147	A
LOXHD1	125336	genome.wustl.edu	37	18	44114401	44114401	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr18:44114401C>T	ENST00000398722.4	-	20	3274	c.3275G>A	c.(3274-3276)gGa>gAa	p.G1092E	LOXHD1_ENST00000579038.1_Missense_Mutation_p.G163E|LOXHD1_ENST00000300591.6_Missense_Mutation_p.G259E|LOXHD1_ENST00000582408.1_Missense_Mutation_p.G259E|LOXHD1_ENST00000441893.2_Missense_Mutation_p.G303E|LOXHD1_ENST00000536736.1_Missense_Mutation_p.G1370E|LOXHD1_ENST00000441551.2_Missense_Mutation_p.G1164E			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1092	PLAT 8. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						AATGATTTCTCCCACATCTTC	0.488																																																	0								ENSG00000167210						175.0	147.0	156.0					18																	44114401		692	1591	2283	LOXHD1	SO:0001583	missense	0			-	HGNC	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.3275G>A	18.37:g.44114401C>T	ENSP00000381707:p.Gly1092Glu	Somatic	0	40	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	34	41.38	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	33	0.00	0	40	27.27	15	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.G1370E	ENST00000398722.4	37	c.4109		18	.	.	.	.	.	.	.	.	.	.	C	15.60	2.882590	0.51908	.	.	ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000536736;ENST00000441893;ENST00000335730;ENST00000536111	T;T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01;-1.01	5.16	5.16	0.70880	Lipoxygenase, LH2 (3);Lipase/lipooxygenase, PLAT/LH2 (1);	0.000000	0.85682	D	0.000000	D	0.91901	0.7436	H	0.95504	3.68	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.93911	0.7197	10	0.59425	D	0.04	.	18.6417	0.91398	0.0:1.0:0.0:0.0	.	1370;303;1092;1092	F5GZB4;F8WA52;Q8IVV2-2;Q8IVV2	.;.;.;LOXH1_HUMAN	E	259;1092;1370;303;1092;272	ENSP00000300591:G259E;ENSP00000381707:G1092E;ENSP00000444586:G1370E;ENSP00000409062:G303E;ENSP00000440060:G272E	ENSP00000300591:G259E	G	-	2	0	LOXHD1	42368399	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.370000	0.79589	2.394000	0.81467	0.561000	0.74099	GGA	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,pfscan_PLAT/LH2_dom		0.488	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	protein_coding		C	NM_144612	-		44114401	-1	no_errors	ENST00000536736	ensembl	human	known	74_37	missense	SNP	1.000	T
GPRIN3	285513	genome.wustl.edu	37	4	90169946	90169946	+	Missense_Mutation	SNP	C	C	G	rs74653642	byFrequency	TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr4:90169946C>G	ENST00000609438.1	-	2	1834	c.1316G>C	c.(1315-1317)aGg>aCg	p.R439T	GPRIN3_ENST00000333209.4_Missense_Mutation_p.R439T	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	439										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		TCCTGCTAACCTCCCATCTTC	0.468																																																	0								ENSG00000185477						94.0	95.0	94.0					4																	90169946		2203	4300	6503	GPRIN3	SO:0001583	missense	0			-	HGNC	AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.1316G>C	4.37:g.90169946C>G	ENSP00000476603:p.Arg439Thr	Somatic	0	22	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	27	30.77	Q8IVE4	Missense_Mutation	SNP	37	0.00	0	35	25.53	12	NULL	p.R439T	ENST00000609438.1	37	c.1316	CCDS34030.1	4	.	.	.	.	.	.	.	.	.	.	C	12.37	1.918495	0.33908	.	.	ENSG00000185477	ENST00000333209	T	0.13778	2.56	5.38	-5.14	0.02875	.	0.723950	0.11256	N	0.583158	T	0.07863	0.0197	L	0.32530	0.975	0.09310	N	1	B	0.21225	0.053	B	0.18561	0.022	T	0.31392	-0.9945	10	0.40728	T	0.16	-0.9778	5.1907	0.15209	0.1109:0.1615:0.1098:0.6178	.	439	Q6ZVF9	GRIN3_HUMAN	T	439	ENSP00000328672:R439T	ENSP00000328672:R439T	R	-	2	0	GPRIN3	90388969	0.000000	0.05858	0.000000	0.03702	0.241000	0.25554	-0.897000	0.04110	-0.734000	0.04843	-0.748000	0.03510	AGG	-	NULL		0.468	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN3	protein_coding	OTTHUMT00000363540.2	C	NM_198281	-		90169946	-1	no_errors	ENST00000333209	ensembl	human	known	74_37	missense	SNP	0.000	G
IRGC	56269	genome.wustl.edu	37	19	44223484	44223484	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr19:44223484G>C	ENST00000244314.5	+	2	973	c.774G>C	c.(772-774)aaG>aaC	p.K258N		NM_019612.3	NP_062558.1	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	258						membrane (GO:0016020)	GTP binding (GO:0005525)|hydrolase activity, acting on acid anhydrides (GO:0016817)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(2)	25		Prostate(69;0.0435)				CCTTGCAGAAGAAGAAGGCCA	0.667																																					Colon(189;350 2037 11447 13433 38914)												0								ENSG00000124449						39.0	35.0	36.0					19																	44223484		2203	4300	6503	IRGC	SO:0001583	missense	0			-	HGNC	BC066939	CCDS12629.1	19q13.32	2008-02-05	2005-10-31	2005-10-31	ENSG00000124449	ENSG00000124449			28835	protein-coding gene	gene with protein product			"""immunity-related GTPase family, cinema 1"""	IRGC1		12477932	Standard	NM_019612		Approved	Iigp5, CINEMA	uc002oxh.3	Q6NXR0	OTTHUMG00000154587	ENST00000244314.5:c.774G>C	19.37:g.44223484G>C	ENSP00000244314:p.Lys258Asn	Somatic	0	22	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	13	75.93	Q05BR8	Missense_Mutation	SNP	18	0.00	0	11	81.97	50	pfam_Interferon-induced_GTPase,superfamily_P-loop_NTPase	p.K258N	ENST00000244314.5	37	c.774	CCDS12629.1	19	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835168	0.71373	.	.	ENSG00000124449	ENST00000244314	T	0.10860	2.83	5.23	5.23	0.72850	.	0.061993	0.64402	D	0.000007	T	0.15262	0.0368	L	0.47190	1.495	0.51012	D	0.999902	P	0.38335	0.627	P	0.46172	0.506	T	0.01496	-1.1340	10	0.40728	T	0.16	.	9.8483	0.41041	0.0934:0.0:0.9066:0.0	.	258	Q6NXR0	IIGP5_HUMAN	N	258	ENSP00000244314:K258N	ENSP00000244314:K258N	K	+	3	2	IRGC	48915324	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.089000	0.41672	2.440000	0.82611	0.655000	0.94253	AAG	-	pfam_Interferon-induced_GTPase,superfamily_P-loop_NTPase		0.667	IRGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRGC	protein_coding	OTTHUMT00000336191.1	G	NM_019612	-		44223484	+1	no_errors	ENST00000244314	ensembl	human	known	74_37	missense	SNP	1.000	C
GLYATL1	92292	genome.wustl.edu	37	11	58722681	58722681	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr11:58722681G>T	ENST00000317391.4	+	7	686	c.346G>T	c.(346-348)Gtg>Ttg	p.V116L	GLYATL1_ENST00000300079.5_Missense_Mutation_p.V147L|RP11-142C4.6_ENST00000533954.1_RNA	NM_001220494.1	NP_001207423.1	Q969I3	GLYL1_HUMAN	glycine-N-acyltransferase-like 1	116						mitochondrion (GO:0005739)	glutamine N-acyltransferase activity (GO:0047946)|glycine N-acyltransferase activity (GO:0047961)			NS(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|skin(4)|urinary_tract(1)	34					Glycine(DB00145)	GGGGATAAGAGTGGCTACATT	0.443																																																	0								ENSG00000166840						123.0	123.0	123.0					11																	58722681		2201	4295	6496	GLYATL1	SO:0001583	missense	0			-	HGNC	AK091965	CCDS31556.1, CCDS55768.1	11q12.1	2014-08-12			ENSG00000166840	ENSG00000166840			30519	protein-coding gene	gene with protein product		614761				12477932	Standard	NM_080661		Approved	MGC15397, FLJ34646	uc001nnh.2	Q969I3	OTTHUMG00000167221	ENST00000317391.4:c.346G>T	11.37:g.58722681G>T	ENSP00000322223:p.Val116Leu	Somatic	0	63	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	56	22.22	A6NDT0|Q7Z510|Q8NAW8	Missense_Mutation	SNP	21	0.00	0	36	25.00	12	pfam_Glycine_N-acyltransferase_N,pfam_Glycine_N-acyltransferase_C,superfamily_Acyl_CoA_acyltransferase	p.V147L	ENST00000317391.4	37	c.439	CCDS55768.1	11	.	.	.	.	.	.	.	.	.	.	.	5.360	0.251678	0.10185	.	.	ENSG00000166840	ENST00000526351;ENST00000444580;ENST00000317391;ENST00000300079	T;T;T	0.16897	2.31;2.31;2.31	1.78	0.477	0.16784	Acyl-CoA N-acyltransferase (1);Glycine N-acyltransferase, N-terminal (1);	3.070580	0.03687	U	0.246440	T	0.12987	0.0315	L	0.34521	1.04	0.09310	N	1	B;B	0.10296	0.001;0.003	B;B	0.12156	0.004;0.007	T	0.27123	-1.0083	10	0.24483	T	0.36	.	3.9488	0.09360	0.3412:0.0:0.6588:0.0	.	147;116	Q969I3-2;Q969I3	.;GLYL1_HUMAN	L	139;93;116;147	ENSP00000434652:V139L;ENSP00000322223:V116L;ENSP00000300079:V147L	ENSP00000300079:V147L	V	+	1	0	GLYATL1	58479257	0.001000	0.12720	0.000000	0.03702	0.010000	0.07245	0.430000	0.21428	-0.150000	0.11195	0.411000	0.27672	GTG	-	pfam_Glycine_N-acyltransferase_N,superfamily_Acyl_CoA_acyltransferase		0.443	GLYATL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLYATL1	protein_coding	OTTHUMT00000393783.1	G	NM_080661	-		58722681	+1	no_errors	ENST00000300079	ensembl	human	known	74_37	missense	SNP	0.000	T
C19orf57	79173	genome.wustl.edu	37	19	14000051	14000051	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr19:14000051G>A	ENST00000586783.1	-	5	1617	c.1618C>T	c.(1618-1620)Cag>Tag	p.Q540*	C19orf57_ENST00000591586.1_Intron|C19orf57_ENST00000454313.1_Nonsense_Mutation_p.Q540*|C19orf57_ENST00000346736.2_Nonsense_Mutation_p.Q540*			Q0VDD7	CS057_HUMAN	chromosome 19 open reading frame 57	540					multicellular organismal development (GO:0007275)					breast(2)|kidney(1)|lung(3)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			TCCTGTATCTGGCTGTCCAGC	0.612																																																	0								ENSG00000132016						41.0	42.0	42.0					19																	14000051		2203	4300	6503	C19orf57	SO:0001587	stop_gained	0			-	HGNC	BC012945	CCDS12299.1	19p13.12	2012-10-26			ENSG00000132016	ENSG00000132016			28153	protein-coding gene	gene with protein product						8228263	Standard	NM_024323		Approved	MGC11271	uc002mxl.1	Q0VDD7	OTTHUMG00000181851	ENST00000586783.1:c.1618C>T	19.37:g.14000051G>A	ENSP00000465822:p.Gln540*	Somatic	0	48	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	68	17.07	Q13411|Q8N825|Q96D63|Q9BU49	Nonsense_Mutation	SNP	24	0.00	0	42	23.64	13	NULL	p.Q540*	ENST00000586783.1	37	c.1618		19	.	.	.	.	.	.	.	.	.	.	G	18.57	3.651655	0.67472	.	.	ENSG00000132016	ENST00000454313;ENST00000346736	.	.	.	4.99	2.8	0.32819	.	0.567257	0.14807	N	0.297256	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-6.7456	11.5729	0.50845	0.0:0.3478:0.6522:0.0	.	.	.	.	X	540	.	ENSP00000254336:Q540X	Q	-	1	0	C19orf57	13861051	1.000000	0.71417	0.715000	0.30552	0.018000	0.09664	2.069000	0.41481	0.665000	0.31066	-0.196000	0.12772	CAG	-	NULL		0.612	C19orf57-003	NOVEL	basic	protein_coding	C19orf57	protein_coding	OTTHUMT00000457947.1	G	NM_024323	-		14000051	-1	no_errors	ENST00000454313	ensembl	human	known	74_37	nonsense	SNP	0.896	A
IGDCC4	57722	genome.wustl.edu	37	15	65674744	65674744	+	3'UTR	SNP	T	T	A			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr15:65674744T>A	ENST00000352385.2	-	0	5565				IGDCC4_ENST00000558048.1_5'UTR	NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						TTCCACCATTTaaaaaaaaaa	0.403																																																	0								ENSG00000103742																																			IGDCC4	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.*1603A>T	15.37:g.65674744T>A		Somatic	0	33	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	53	10.17	Q9HCE4	RNA	SNP	23	0.00	0	69	6.76	5	-	NULL	ENST00000352385.2	37	NULL	CCDS10206.1	15																																																																																			-	-		0.403	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	IGDCC4	protein_coding	OTTHUMT00000256825.2	T	NM_020962	-		65674744	-1	no_errors	ENST00000558048	ensembl	human	known	74_37	rna	SNP	0.000	A
CD48	962	genome.wustl.edu	37	1	160651093	160651093	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr1:160651093G>A	ENST00000368046.3	-	3	638	c.551C>T	c.(550-552)aCc>aTc	p.T184I	RP11-404F10.2_ENST00000588034.1_RNA|RP11-404F10.2_ENST00000598917.2_RNA|RP11-404F10.2_ENST00000443928.2_RNA	NM_001778.3	NP_001769.2	P09326	CD48_HUMAN	CD48 molecule	184	Ig-like C2-type 2.				blood coagulation (GO:0007596)|defense response (GO:0006952)|leukocyte migration (GO:0050900)|mast cell activation (GO:0045576)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	anchored component of plasma membrane (GO:0046658)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(2)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|stomach(1)	10	all_cancers(52;2.18e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			TGGCATAAGGGTGGTTTCAAG	0.498																																																	0								ENSG00000117091						171.0	152.0	159.0					1																	160651093		2203	4300	6503	CD48	SO:0001583	missense	0			-	HGNC	BC016182	CCDS1208.1, CCDS72955.1	1q21.3-q22	2013-01-29	2006-03-31		ENSG00000117091	ENSG00000117091		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1683	protein-coding gene	gene with protein product		109530	"""CD48 antigen (B-cell membrane protein)"", ""CD48 molecule """	BCM1		2828034	Standard	NM_001256030		Approved	BLAST, mCD48, hCD48, SLAMF2	uc001fwo.2	P09326	OTTHUMG00000024009	ENST00000368046.3:c.551C>T	1.37:g.160651093G>A	ENSP00000357025:p.Thr184Ile	Somatic	0	69	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	133	15.82	Q5U055|Q8MGR0	Missense_Mutation	SNP	29	0.00	0	94	12.84	14	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.T184I	ENST00000368046.3	37	c.551	CCDS1208.1	1	.	.	.	.	.	.	.	.	.	.	G	8.145	0.786134	0.16189	.	.	ENSG00000117091	ENST00000368046	T	0.12774	2.65	3.57	-2.13	0.07144	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.085050	0.06941	N	0.812766	T	0.03305	0.0096	L	0.29908	0.895	0.09310	N	0.999998	P;P	0.47484	0.573;0.896	B;P	0.44394	0.23;0.448	T	0.35425	-0.9789	10	0.16896	T	0.51	-0.0682	7.8823	0.29629	0.5811:0.0:0.4189:0.0	.	184;184	Q6IAZ2;P09326	.;CD48_HUMAN	I	184	ENSP00000357025:T184I	ENSP00000357025:T184I	T	-	2	0	CD48	158917717	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.625000	0.02036	-0.441000	0.07201	-0.345000	0.07892	ACC	-	pfscan_Ig-like_dom		0.498	CD48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD48	protein_coding	OTTHUMT00000060471.1	G	NM_001778	-		160651093	-1	no_errors	ENST00000368046	ensembl	human	known	74_37	missense	SNP	0.000	A
VPS13C	54832	genome.wustl.edu	37	15	62261524	62261524	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr15:62261524A>C	ENST00000261517.5	-	28	2958	c.2885T>G	c.(2884-2886)aTc>aGc	p.I962S	VPS13C_ENST00000249837.3_Missense_Mutation_p.I919S|VPS13C_ENST00000395896.4_Missense_Mutation_p.I962S|VPS13C_ENST00000395898.3_Missense_Mutation_p.I919S	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						ATCCAAGCTGATTTTCTTTAA	0.289																																																	0								ENSG00000129003						59.0	56.0	57.0					15																	62261524		2198	4286	6484	VPS13C	SO:0001583	missense	0			-	HGNC	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.2885T>G	15.37:g.62261524A>C	ENSP00000261517:p.Ile962Ser	Somatic	0	39	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	37	52.56		Missense_Mutation	SNP	26	0.00	0	36	55.95	47	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.I962S	ENST00000261517.5	37	c.2885	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	A	21.7	4.184215	0.78677	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.21031	2.03;2.03;2.03	4.91	4.91	0.64330	.	0.076259	0.52532	D	0.000070	T	0.46288	0.1385	M	0.77103	2.36	0.58432	D	0.999995	D;D;D;D	0.69078	0.996;0.996;0.997;0.984	D;P;D;P	0.65874	0.918;0.9;0.939;0.899	T	0.51593	-0.8686	10	0.72032	D	0.01	.	14.8396	0.70214	1.0:0.0:0.0:0.0	.	919;962;919;962	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	S	919;962;962;962	ENSP00000249837:I919S;ENSP00000261517:I962S;ENSP00000379233:I962S	ENSP00000249837:I919S	I	-	2	0	VPS13C	60048816	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.538000	0.82048	1.963000	0.57068	0.459000	0.35465	ATC	-	NULL		0.289	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	protein_coding	OTTHUMT00000415997.1	A	NM_017684	-		62261524	-1	no_errors	ENST00000261517	ensembl	human	known	74_37	missense	SNP	1.000	C
MCCC1	56922	genome.wustl.edu	37	3	182735048	182735048	+	Intron	SNP	C	C	G			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr3:182735048C>G	ENST00000265594.4	-	18	2196				MCCC1-AS1_ENST00000471731.2_RNA|MCCC1_ENST00000492597.1_Intron|MCCC1_ENST00000539926.1_Intron	NM_020166.3	NP_064551.3	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-CoA carboxylase 1 (alpha)						biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(17)|ovary(1)|pancreas(2)|prostate(1)|skin(2)	40	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	CTCATGATTTCCTTACCTCCA	0.398																																																	0								ENSG00000243368						178.0	158.0	165.0					3																	182735048		2203	4300	6503	MCCC1-AS1	SO:0001627	intron_variant	0			-	HGNC	AF310972	CCDS3241.1	3q27.1	2010-04-30	2010-04-30		ENSG00000078070	ENSG00000078070	6.4.1.4		6936	protein-coding gene	gene with protein product		609010	"""methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)"""			11170888	Standard	XR_241502		Approved	MCCA	uc003fle.3	Q96RQ3	OTTHUMG00000158355	ENST00000265594.4:c.2049+5G>C	3.37:g.182735048C>G		Somatic	0	43	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	43	29.51	Q59ES4|Q9H959|Q9NS97	RNA	SNP	33	0.00	0	42	46.15	36	-	NULL	ENST00000265594.4	37	NULL	CCDS3241.1	3																																																																																			-	-		0.398	MCCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCCC1-AS1	protein_coding	OTTHUMT00000350775.1	C	NM_020166	-		182735048	+1	no_errors	ENST00000471731	ensembl	human	known	74_37	rna	SNP	0.104	G
DERL1	79139	genome.wustl.edu	37	8	124031520	124031520	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr8:124031520G>C	ENST00000259512.4	-	7	832	c.532C>G	c.(532-534)Ctg>Gtg	p.L178V	RP11-557C18.3_ENST00000521258.1_RNA|DERL1_ENST00000519018.1_Missense_Mutation_p.L78V|DERL1_ENST00000405944.3_Intron|DERL1_ENST00000419562.2_Missense_Mutation_p.L78V|DERL1_ENST00000523036.1_Missense_Mutation_p.L78V	NM_001134671.2|NM_024295.5	NP_001128143.1|NP_077271.1	Q9BUN8	DERL1_HUMAN	derlin 1	178					endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|intracellular transport of viral protein in host cell (GO:0019060)|response to unfolded protein (GO:0006986)|retrograde protein transport, ER to cytosol (GO:0030970)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)	MHC class I protein binding (GO:0042288)|receptor activity (GO:0004872)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	8	Lung NSC(37;1.06e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			TGTCCAACCAGATTTCCAATA	0.358																																																	0								ENSG00000136986						80.0	77.0	78.0					8																	124031520		2203	4300	6503	DERL1	SO:0001583	missense	0			-	HGNC	BC002457	CCDS6337.1, CCDS47915.1	8q24.13	2012-02-01	2012-02-01		ENSG00000136986	ENSG00000136986			28454	protein-coding gene	gene with protein product		608813	"""Der1-like domain family, member 1"""			12975309, 15215855	Standard	NM_024295		Approved	MGC3067, PRO2577, FLJ13784, DER1, DER-1, derlin-1	uc003ypl.3	Q9BUN8	OTTHUMG00000165080	ENST00000259512.4:c.532C>G	8.37:g.124031520G>C	ENSP00000259512:p.Leu178Val	Somatic	0	27	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	30	18.92	B3KW41|E9PH19	Missense_Mutation	SNP	31	0.00	0	51	28.17	20	pfam_DER1	p.L178V	ENST00000259512.4	37	c.532	CCDS6337.1	8	.	.	.	.	.	.	.	.	.	.	G	15.45	2.838191	0.51057	.	.	ENSG00000136986	ENST00000259512;ENST00000419562;ENST00000519018;ENST00000523036	T;T;T;T	0.31247	2.64;1.5;2.64;2.64	5.61	5.61	0.85477	.	0.061546	0.64402	D	0.000003	T	0.26593	0.0650	N	0.25485	0.75	0.80722	D	1	P;B	0.38223	0.623;0.22	B;B	0.40659	0.336;0.163	T	0.02282	-1.1183	10	0.09590	T	0.72	.	19.6373	0.95740	0.0:0.0:1.0:0.0	.	78;178	B4E1G1;Q9BUN8	.;DERL1_HUMAN	V	178;78;78;78	ENSP00000259512:L178V;ENSP00000389965:L78V;ENSP00000430086:L78V;ENSP00000429199:L78V	ENSP00000259512:L178V	L	-	1	2	DERL1	124100701	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	5.121000	0.64691	2.636000	0.89361	0.655000	0.94253	CTG	-	pfam_DER1		0.358	DERL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DERL1	protein_coding	OTTHUMT00000381714.2	G	NM_024295	-		124031520	-1	no_errors	ENST00000259512	ensembl	human	known	74_37	missense	SNP	1.000	C
USP24	23358	genome.wustl.edu	37	1	55537558	55537559	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr1:55537558_55537559insT	ENST00000294383.6	-	67	7727_7728	c.7728_7729insA	c.(7726-7731)aaagagfs	p.E2577fs	USP24_ENST00000407756.1_Frame_Shift_Ins_p.E2417fs|USP24_ENST00000484447.1_5'UTR	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	2577					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						CCTGATTGCTCTTTTTCATTCA	0.495											OREG0013507	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000162402																																			USP24	SO:0001589	frameshift_variant	0				HGNC	AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.7729dupA	1.37:g.55537563_55537563dupT	ENSP00000294383:p.Glu2577fs	Somatic	0	48	0.00	1008	0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	58	26.58	Q6ZSY2|Q8N2Y4|Q9NXD1	Frame_Shift_Ins	INS	26	0.00	0	49	18.33	11	pfam_Peptidase_C19/C67,superfamily_UBA-like,superfamily_ARM-type_fold,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19/C67	p.E2416fs	ENST00000294383.6	37	c.7249_7248	CCDS44154.2	1																																																																																			-	NULL		0.495	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP24	protein_coding	OTTHUMT00000022275.2	-				55537559	-1	no_errors	ENST00000407756	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:0.920	T
CGB8	94115	genome.wustl.edu	37	19	49551016	49551016	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr19:49551016C>T	ENST00000448456.3	-	3	760	c.394G>A	c.(394-396)Gac>Aac	p.D132N	CGB8_ENST00000355414.2_Missense_Mutation_p.D130N|CGB1_ENST00000391869.3_Intron	NM_033183.2	NP_149439.1	P01233	CGHB_HUMAN	chorionic gonadotropin, beta polypeptide 8	132					apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|female gamete generation (GO:0007292)|peptide hormone processing (GO:0016486)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			pancreas(1)	1		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		AAGCGGGGGTCATCACAGGTC	0.662																																																	0								ENSG00000213030						1.0	1.0	1.0					19																	49551016		287	814	1101	CGB8	SO:0001583	missense	0			-	HGNC	BG435249	CCDS12753.1	19q13.32	2011-05-26							16453	protein-coding gene	gene with protein product		608827				6194155	Standard	NM_033183		Approved		uc002pmb.4	P01233		ENST00000448456.3:c.394G>A	19.37:g.49551016C>T	ENSP00000403649:p.Asp132Asn	Somatic	0	17	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	6	72.73	A1A5E0|B9ZVP5|Q13991|Q14000|Q3KPI3|Q3SY41|Q8WTT5|Q8WXL1|Q8WXL2|Q8WXL3|Q8WXL4	Missense_Mutation	SNP	6	0.00	0	2	80.00	8	pfam_Cys_knot,smart_Gonadotropin_bsu	p.D132N	ENST00000448456.3	37	c.394	CCDS12753.1	19	.	.	.	.	.	.	.	.	.	.	c	7.229	0.599021	0.13939	.	.	ENSG00000213030	ENST00000448456;ENST00000355414	T;T	0.39056	1.1;1.1	1.34	-2.68	0.06041	.	1.451340	0.04141	N	0.319616	T	0.14141	0.0342	N	0.02916	-0.46	0.20074	N	0.999936	.	.	.	.	.	.	T	0.21861	-1.0233	8	0.02654	T	1	-0.4209	3.1709	0.06551	0.0:0.2986:0.4199:0.2815	.	.	.	.	N	132;130	ENSP00000403649:D132N;ENSP00000347582:D130N	ENSP00000347582:D130N	D	-	1	0	CGB1	54242828	0.024000	0.19004	0.122000	0.21767	0.118000	0.20060	-0.387000	0.07361	-0.379000	0.07906	0.194000	0.17425	GAC	-	NULL		0.662	CGB8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CGB8	protein_coding	OTTHUMT00000452168.1	C	NM_033183	-		49551016	-1	no_errors	ENST00000448456	ensembl	human	known	74_37	missense	SNP	0.915	T
ZNF215	7762	genome.wustl.edu	37	11	6977273	6977273	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr11:6977273T>A	ENST00000278319.5	+	7	1653	c.1065T>A	c.(1063-1065)taT>taA	p.Y355*	ZNF215_ENST00000527171.1_3'UTR|ZNF215_ENST00000529903.1_Intron|ZNF215_ENST00000414517.2_Nonsense_Mutation_p.Y355*	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	355					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		ATTCAGAATATGAATATGGGA	0.333																																																	0								ENSG00000149054						55.0	56.0	56.0					11																	6977273		2201	4296	6497	ZNF215	SO:0001587	stop_gained	0			-	HGNC	AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.1065T>A	11.37:g.6977273T>A	ENSP00000278319:p.Tyr355*	Somatic	0	13	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	13	40.91	Q96C84	Nonsense_Mutation	SNP	34	0.00	0	19	45.71	16	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.Y355*	ENST00000278319.5	37	c.1065	CCDS7775.1	11	.	.	.	.	.	.	.	.	.	.	T	26.2	4.711530	0.89112	.	.	ENSG00000149054	ENST00000278319;ENST00000414517	.	.	.	4.05	-1.39	0.08997	.	0.420768	0.17713	N	0.164540	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-1.4907	1.2726	0.02024	0.1456:0.1794:0.1502:0.5249	.	.	.	.	X	355	.	ENSP00000278319:Y355X	Y	+	3	2	ZNF215	6933849	0.001000	0.12720	0.000000	0.03702	0.026000	0.11368	-0.237000	0.08990	-0.243000	0.09653	0.533000	0.62120	TAT	-	NULL		0.333	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF215	protein_coding	OTTHUMT00000384550.1	T		-		6977273	+1	no_errors	ENST00000278319	ensembl	human	known	74_37	nonsense	SNP	0.013	A
FAT4	79633	genome.wustl.edu	37	4	126328179	126328179	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr4:126328179G>T	ENST00000394329.3	+	3	5465	c.5452G>T	c.(5452-5454)Gat>Tat	p.D1818Y	FAT4_ENST00000335110.5_Missense_Mutation_p.D116Y	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1818	Cadherin 17. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TCGTGCTGATGATGGTCTTCA	0.463																																																	0								ENSG00000196159						159.0	148.0	152.0					4																	126328179		2203	4300	6503	FAT4	SO:0001583	missense	0			-	HGNC	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.5452G>T	4.37:g.126328179G>T	ENSP00000377862:p.Asp1818Tyr	Somatic	0	46	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	43	24.56	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	33	0.00	0	30	40.00	20	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.D1818Y	ENST00000394329.3	37	c.5452	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	G	26.3	4.721259	0.89205	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.68903	-0.36;-0.36	5.37	5.37	0.77165	Cadherin (4);Cadherin-like (1);	0.000000	0.35320	U	0.003289	D	0.89347	0.6689	H	0.98238	4.18	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93001	0.6423	10	0.87932	D	0	.	19.484	0.95022	0.0:0.0:1.0:0.0	.	116;1818	Q6V0I7-2;Q6V0I7	.;FAT4_HUMAN	Y	1818;116	ENSP00000377862:D1818Y;ENSP00000335169:D116Y	ENSP00000335169:D116Y	D	+	1	0	FAT4	126547629	1.000000	0.71417	0.935000	0.37517	0.994000	0.84299	9.365000	0.97139	2.669000	0.90835	0.650000	0.86243	GAT	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.463	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	protein_coding	OTTHUMT00000256765.2	G	NM_024582	-		126328179	+1	no_errors	ENST00000394329	ensembl	human	known	74_37	missense	SNP	1.000	T
CCDC157	550631	genome.wustl.edu	37	22	30768185	30768185	+	Silent	SNP	G	G	A			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr22:30768185G>A	ENST00000405659.1	+	7	1954	c.1245G>A	c.(1243-1245)cgG>cgA	p.R415R	RP1-130H16.16_ENST00000332468.4_RNA|CCDC157_ENST00000338306.3_Silent_p.R415R			Q569K6	CC157_HUMAN	coiled-coil domain containing 157	415										central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(1)	15						TGGTGGGTCGGCTGGAGGGCG	0.682																																																	0								ENSG00000187860						15.0	16.0	16.0					22																	30768185		2184	4284	6468	CCDC157	SO:0001819	synonymous_variant	0			-	HGNC	BC018040	CCDS33632.2	22q12.2	2009-03-05			ENSG00000187860	ENSG00000187860			33854	protein-coding gene	gene with protein product							Standard	NM_001017437		Approved		uc011aku.2	Q569K6	OTTHUMG00000151007	ENST00000405659.1:c.1245G>A	22.37:g.30768185G>A		Somatic	0	71	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	35	47.76	Q0VD76|Q9BYA4	Silent	SNP	13	0.00	0	10	62.96	17	superfamily_Prefoldin,superfamily_t-SNARE	p.R415	ENST00000405659.1	37	c.1245	CCDS33632.2	22																																																																																			-	NULL		0.682	CCDC157-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC157	protein_coding	OTTHUMT00000320936.1	G	NM_001017437	-		30768185	+1	no_errors	ENST00000338306	ensembl	human	known	74_37	silent	SNP	1.000	A
KCNH8	131096	genome.wustl.edu	37	3	19556882	19556882	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr3:19556882G>A	ENST00000328405.2	+	14	2770	c.2504G>A	c.(2503-2505)cGa>cAa	p.R835Q		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	835					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						GGCTCTGAACGAATCAGATCA	0.358																																					NSCLC(124;1625 1765 8018 24930 42026)												0								ENSG00000183960						68.0	70.0	69.0					3																	19556882		2203	4300	6503	KCNH8	SO:0001583	missense	0			-	HGNC	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2504G>A	3.37:g.19556882G>A	ENSP00000328813:p.Arg835Gln	Somatic	0	48	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	26	36.59	B7Z2I7|Q59GQ6	Missense_Mutation	SNP	42	0.00	0	37	27.45	14	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,pfam_PAS_4,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,superfamily_tRNA-bd_arm,smart_PAC,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_EAG,tigrfam_PAS	p.R835Q	ENST00000328405.2	37	c.2504	CCDS2632.1	3	.	.	.	.	.	.	.	.	.	.	G	8.865	0.947815	0.18356	.	.	ENSG00000183960	ENST00000328405	D	0.98313	-4.86	5.59	3.43	0.39272	.	0.329251	0.15498	N	0.259168	D	0.94689	0.8287	L	0.36672	1.1	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	D	0.90796	0.4690	9	.	.	.	.	6.4638	0.21970	0.3284:0.0:0.6716:0.0	.	835	Q96L42	KCNH8_HUMAN	Q	835	ENSP00000328813:R835Q	.	R	+	2	0	KCNH8	19531886	0.997000	0.39634	0.993000	0.49108	0.984000	0.73092	2.091000	0.41691	1.332000	0.45431	0.650000	0.86243	CGA	-	NULL		0.358	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH8	protein_coding	OTTHUMT00000252139.2	G	NM_144633	-		19556882	+1	no_errors	ENST00000328405	ensembl	human	known	74_37	missense	SNP	0.970	A
UNC13C	440279	genome.wustl.edu	37	15	54542514	54542514	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr15:54542514C>T	ENST00000260323.11	+	7	3320	c.3320C>T	c.(3319-3321)aCa>aTa	p.T1107I	UNC13C_ENST00000537900.1_Missense_Mutation_p.T1105I|UNC13C_ENST00000545554.1_Missense_Mutation_p.T1107I	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1107					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		ACGGCTACCACACCCACCTAC	0.498																																																	0								ENSG00000137766						109.0	104.0	106.0					15																	54542514		2109	4266	6375	UNC13C	SO:0001583	missense	0			-	HGNC	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.3320C>T	15.37:g.54542514C>T	ENSP00000260323:p.Thr1107Ile	Somatic	0	58	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	71	28.28	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	37	0.00	0	43	24.56	14	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.T1107I	ENST00000260323.11	37	c.3320	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	C	19.82	3.897670	0.72639	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.92965	-3.14;-3.14;-3.14	5.56	5.56	0.83823	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.167509	0.52532	D	0.000065	D	0.90310	0.6969	L	0.45581	1.43	0.47778	D	0.999517	B	0.24043	0.096	B	0.24701	0.055	D	0.87559	0.2470	10	0.87932	D	0	.	18.5213	0.90954	0.0:1.0:0.0:0.0	.	1107	Q8NB66	UN13C_HUMAN	I	1107;1107;1105	ENSP00000260323:T1107I;ENSP00000438156:T1107I;ENSP00000442569:T1105I	ENSP00000260323:T1107I	T	+	2	0	UNC13C	52329806	1.000000	0.71417	0.686000	0.30086	0.993000	0.82548	7.800000	0.85949	2.626000	0.88956	0.650000	0.86243	ACA	-	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd		0.498	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	protein_coding	OTTHUMT00000419028.3	C	NM_173166	-		54542514	+1	no_errors	ENST00000260323	ensembl	human	known	74_37	missense	SNP	0.911	T
DCBLD2	131566	genome.wustl.edu	37	3	98536625	98536625	+	Silent	SNP	C	C	T			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr3:98536625C>T	ENST00000326840.6	-	9	1562	c.1200G>A	c.(1198-1200)gtG>gtA	p.V400V	DCBLD2_ENST00000326857.9_Silent_p.V400V	NM_080927.3	NP_563615.3	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	400	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell growth (GO:0030308)|wound healing (GO:0042060)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|stomach(2)	25						TATCTTGCTCCACACCAGGCT	0.413																																																	0								ENSG00000057019						124.0	111.0	115.0					3																	98536625		1886	4108	5994	DCBLD2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS46878.1	3q12.2	2006-04-12			ENSG00000057019	ENSG00000057019			24627	protein-coding gene	gene with protein product		608698				11447234	Standard	NM_080927		Approved	CLCP1, ESDN	uc003dtd.3	Q96PD2	OTTHUMG00000151985	ENST00000326840.6:c.1200G>A	3.37:g.98536625C>T		Somatic	0	63	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	76	22.45	B7WNL1|D3DN41|Q8N6M4|Q8TDX2	Silent	SNP	30	0.00	0	56	17.65	12	pfam_Coagulation_fac_5/8-C_type_dom,pfam_CUB_dom,pfam_LCCL,superfamily_Galactose-bd-like,superfamily_CUB_dom,superfamily_LCCL,smart_CUB_dom,smart_LCCL,smart_Coagulation_fac_5/8-C_type_dom,pfscan_CUB_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_LCCL	p.V400	ENST00000326840.6	37	c.1200	CCDS46878.1	3	.	.	.	.	.	.	.	.	.	.	C	8.710	0.911793	0.17907	.	.	ENSG00000057019	ENST00000404023	.	.	.	5.72	3.66	0.41972	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.1497	0.42784	0.1849:0.6858:0.1292:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DCBLD2	100019315	0.959000	0.32827	1.000000	0.80357	0.989000	0.77384	0.372000	0.20467	1.550000	0.49438	0.655000	0.94253	.	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom		0.413	DCBLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCBLD2	protein_coding	OTTHUMT00000324675.2	C	NM_080927	-		98536625	-1	no_errors	ENST00000326857	ensembl	human	known	74_37	silent	SNP	0.999	T
FSTL5	56884	genome.wustl.edu	37	4	162463768	162463768	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr4:162463768C>G	ENST00000306100.5	-	9	1529	c.1093G>C	c.(1093-1095)Gag>Cag	p.E365Q	FSTL5_ENST00000379164.4_Missense_Mutation_p.E364Q|FSTL5_ENST00000511170.1_5'UTR|FSTL5_ENST00000536695.1_Missense_Mutation_p.E364Q|FSTL5_ENST00000427802.2_Missense_Mutation_p.E364Q	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	365	Ig-like 2.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		GGTATGCCCTCTGCATGGCAC	0.463																																																	0								ENSG00000168843						84.0	83.0	83.0					4																	162463768		2203	4300	6503	FSTL5	SO:0001583	missense	0			-	HGNC	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.1093G>C	4.37:g.162463768C>G	ENSP00000305334:p.Glu365Gln	Somatic	0	32	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	31	38.00	E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	37	0.00	0	26	33.33	13	pfam_Ig_I-set,pfam_Kazal_dom,pfam_Ig_V-set,smart_Kazal_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_EF_hand_dom,pfscan_Ig-like_dom	p.E365Q	ENST00000306100.5	37	c.1093	CCDS3802.1	4	.	.	.	.	.	.	.	.	.	.	C	24.7	4.558361	0.86231	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	4.88	4.88	0.63580	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.049784	0.85682	D	0.000000	T	0.69904	0.3163	N	0.22421	0.69	0.58432	D	0.999999	D;D;D	0.69078	0.997;0.966;0.988	D;P;P	0.65323	0.934;0.735;0.828	T	0.69862	-0.5030	10	0.35671	T	0.21	.	17.4015	0.87461	0.0:1.0:0.0:0.0	.	364;364;365	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	Q	365;364;364;364	ENSP00000305334:E365Q;ENSP00000368462:E364Q;ENSP00000389270:E364Q;ENSP00000440409:E364Q	ENSP00000305334:E365Q	E	-	1	0	FSTL5	162683218	1.000000	0.71417	0.964000	0.40570	0.994000	0.84299	5.710000	0.68392	2.422000	0.82143	0.462000	0.41574	GAG	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.463	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FSTL5	protein_coding	OTTHUMT00000364773.2	C	NM_020116	-		162463768	-1	no_errors	ENST00000306100	ensembl	human	known	74_37	missense	SNP	1.000	G
RET	5979	genome.wustl.edu	37	10	43615578	43615578	+	Missense_Mutation	SNP	G	G	A	rs373594744		TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr10:43615578G>A	ENST00000355710.3	+	15	2889	c.2657G>A	c.(2656-2658)cGg>cAg	p.R886Q	RET_ENST00000340058.5_Missense_Mutation_p.R886Q	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	886	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	GCTGAGGGGCGGAAGATGAAG	0.572		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)		yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	0								ENSG00000165731	G	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	88.0	76.0	80.0		2657,2657	5.6	1.0	10		80	0,8600		0,0,4300	no	missense,missense	RET	NM_020630.4,NM_020975.4	43,43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	886/1073,886/1115	43615578	1,13005	2203	4300	6503	RET	SO:0001583	missense	0	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	-	HGNC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.2657G>A	10.37:g.43615578G>A	ENSP00000347942:p.Arg886Gln	Somatic	0	59	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	29	38.30	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	28	0.00	0	24	33.33	12	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Cadherin,superfamily_Kinase-like_dom,superfamily_Cadherin-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Cadherin	p.R886Q	ENST00000355710.3	37	c.2657	CCDS7200.1	10	.	.	.	.	.	.	.	.	.	.	G	35	5.557926	0.96514	2.27E-4	0.0	ENSG00000165731	ENST00000355710;ENST00000340058	D;D	0.89123	-2.47;-2.47	5.58	5.58	0.84498	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91181	0.7222	N	0.25426	0.745	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.995;0.997;0.998	D	0.90729	0.4641	10	0.40728	T	0.16	.	19.5746	0.95436	0.0:0.0:1.0:0.0	.	632;886;886	B4DGX8;P07949;P07949-2	.;RET_HUMAN;.	Q	886	ENSP00000347942:R886Q;ENSP00000344798:R886Q	ENSP00000344798:R886Q	R	+	2	0	RET	42935584	1.000000	0.71417	0.985000	0.45067	0.900000	0.52787	8.007000	0.88571	2.638000	0.89438	0.655000	0.94253	CGG	-	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.572	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RET	protein_coding	OTTHUMT00000047694.2	G	NM_020975	-		43615578	+1	no_errors	ENST00000355710	ensembl	human	known	74_37	missense	SNP	0.997	A
WDR66	144406	genome.wustl.edu	37	12	122359397	122359398	+	In_Frame_Ins	INS	-	-	GAGGAGGAGGAGAAA	rs142042908|rs386767074|rs58098972|rs142971083|rs377641095|rs71082910		TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr12:122359397_122359398insGAGGAGGAGGAGAAA	ENST00000288912.4	+	2	1040_1041	c.186_187insGAGGAGGAGGAGAAA	c.(187-189)gag>GAGGAGGAGGAGAAAgag	p.63_63E>EEEEKE	WDR66_ENST00000397454.2_In_Frame_Ins_p.63_63E>EEEEKE	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	63	Glu-rich.						calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		aggaggaaggggaggaggaggg	0.465																																					Esophageal Squamous(85;849 1794 49757 52143)												0								ENSG00000158023																																			WDR66	SO:0001652	inframe_insertion	0				HGNC	AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	Exception_encountered	12.37:g.122359397_122359398insGAGGAGGAGGAGAAA	Exception_encountered	Somatic	NA	NA	NA		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	In_Frame_Ins	INS	14	26.32	5	23	14.81	4	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.65in_frame_insEKEEE	ENST00000288912.4	37	c.186_187	CCDS41853.1	12																																																																																			-	NULL		0.465	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	protein_coding	OTTHUMT00000401700.1	-	NM_144668			122359398	+1	no_errors	ENST00000288912	ensembl	human	known	74_37	in_frame_ins	INS	0.000:0.000	GAGGAGGAGGAGAAA
COLEC12	81035	genome.wustl.edu	37	18	357461	357461	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr18:357461G>C	ENST00000400256.3	-	3	327	c.120C>G	c.(118-120)atC>atG	p.I40M		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	40					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				ATAATAATATGATAGAAAACT	0.318																																																	0								ENSG00000158270						119.0	116.0	117.0					18																	357461		2203	4298	6501	COLEC12	SO:0001583	missense	0			-	HGNC	AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.120C>G	18.37:g.357461G>C	ENSP00000383115:p.Ile40Met	Somatic	0	29	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	65	24.42	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	26	0.00	0	100	13.04	15	pfam_C-type_lectin,pfam_Collagen,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.I40M	ENST00000400256.3	37	c.120	CCDS32782.1	18	.	.	.	.	.	.	.	.	.	.	G	10.83	1.461353	0.26248	.	.	ENSG00000158270	ENST00000400256	D	0.91237	-2.81	5.89	5.01	0.66863	.	0.044947	0.85682	D	0.000000	D	0.90338	0.6977	L	0.34521	1.04	0.48040	D	0.999574	P	0.50710	0.938	P	0.54499	0.754	D	0.91340	0.5096	10	0.87932	D	0	-21.7678	14.1462	0.65351	0.0726:0.0:0.9274:0.0	.	40	Q5KU26	COL12_HUMAN	M	40	ENSP00000383115:I40M	ENSP00000383115:I40M	I	-	3	3	COLEC12	347461	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.876000	0.48498	1.463000	0.47967	0.655000	0.94253	ATC	-	NULL		0.318	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLEC12	protein_coding	OTTHUMT00000440746.1	G		-		357461	-1	no_errors	ENST00000400256	ensembl	human	known	74_37	missense	SNP	1.000	C
GANAB	23193	genome.wustl.edu	37	11	62414079	62414080	+	5'UTR	DEL	AG	AG	-			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr11:62414079_62414080delAG	ENST00000356638.3	-	0	8_9				GANAB_ENST00000534779.1_5'UTR|GANAB_ENST00000346178.4_5'UTR|GANAB_ENST00000540933.1_5'UTR	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB						cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	CATCTTGTGCAGAGTTTGCTCC	0.678																																					Melanoma(23;1005 1074 15747 18937)												0								ENSG00000089597																																			GANAB	SO:0001623	5_prime_UTR_variant	0				HGNC	AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.-9CT>-	11.37:g.62414081_62414082delAG		Somatic	0	58	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	56	21.13	A6NC20|Q8WTS9|Q9P0X0	RNA	DEL	24	0.00	0	21	36.36	12	-	NULL	ENST00000356638.3	37	NULL	CCDS8026.1	11																																																																																			-	-		0.678	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GANAB	protein_coding	OTTHUMT00000395689.1	AG	NM_198334			62414080	-1	no_errors	ENST00000534419	ensembl	human	known	74_37	rna	DEL	1.000:1.000	-
FAM87A	157693	genome.wustl.edu	37	8	327671	327671	+	lincRNA	SNP	G	G	C	rs368807142		TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr8:327671G>C	ENST00000330148.2	-	0	2790					NR_103537.1		P0C7U9	FA87A_HUMAN	family with sequence similarity 87, member A							integral component of membrane (GO:0016021)											gtctacggctgcccctggaca	0.597																																																	0								ENSG00000182366																																			FAM87A			0			-	HGNC	BC037297		8p23.3	2013-02-15				ENSG00000182366		"""Long non-coding RNAs"""	27233	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_103537		Approved			P0C7U9			8.37:g.327671G>C		Somatic	0	26	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	14	25.00		RNA	SNP	26	3.70	1	29	6.45	2	-	NULL	ENST00000330148.2	37	NULL		8																																																																																			-	-		0.597	FAM87A-001	KNOWN	basic	lincRNA	FAM87A	lincRNA	OTTHUMT00000384563.2	G		-		327671	-1	no_errors	ENST00000330148	ensembl	human	known	74_37	rna	SNP	0.003	C
ERVMER34-1	100288413	genome.wustl.edu	37	4	53611579	53611579	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr4:53611579T>C	ENST00000443173.1	-	3	969	c.109A>G	c.(109-111)Atc>Gtc	p.I37V	ERVMER34-1_ENST00000454756.2_Intron|SNORA26_ENST00000391188.1_RNA|ERVMER34-1_ENST00000440542.1_Missense_Mutation_p.I37V|ERVMER34-1_ENST00000540758.1_Missense_Mutation_p.I37V	NM_001242690.1	NP_001229619.1	Q9H9K5	MER34_HUMAN	endogenous retrovirus group MER34, member 1	37						integral component of membrane (GO:0016021)|viral envelope (GO:0019031)				endometrium(3)|kidney(1)	4						ttagtcaagatagatagtgtc	0.433																																																	0								ENSG00000226887						120.0	103.0	108.0					4																	53611579		692	1591	2283	ERVMER34-1	SO:0001583	missense	0			-	HGNC			4q12	2011-10-20			ENSG00000226887	ENSG00000226887			42970	other	endogenous retrovirus							Standard	NM_024534		Approved		uc003gzs.3	Q9H9K5	OTTHUMG00000150366	ENST00000443173.1:c.109A>G	4.37:g.53611579T>C	ENSP00000460602:p.Ile37Val	Somatic	0	37	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	57	13.64	B3KTB4|Q0P5R3|Q6NWN0	Missense_Mutation	SNP	30	0.00	0	67	22.99	20	pfam_TLV/ENV_coat_polyprotein	p.I37V	ENST00000443173.1	37	c.109		4																																																																																			-	NULL		0.433	ERVMER34-1-002	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	ERVMER34-1	protein_coding	OTTHUMT00000317860.2	T	NM_024534	-		53611579	-1	no_errors	ENST00000440542	ensembl	human	known	74_37	missense	SNP	0.008	C
MMP1	4312	genome.wustl.edu	37	11	102666020	102666020	+	Missense_Mutation	SNP	G	G	T	rs12282811	byFrequency	TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr11:102666020G>T	ENST00000315274.6	-	6	851	c.784C>A	c.(784-786)Cgt>Agt	p.R262S	WTAPP1_ENST00000525739.2_RNA	NM_001145938.1|NM_002421.3	NP_001139410.1|NP_002412.1	P03956	MMP1_HUMAN	matrix metallopeptidase 1 (interstitial collagenase)	262	Metalloprotease.		R -> S (in dbSNP:rs12282811).		blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|proteolysis (GO:0006508)|viral process (GO:0016032)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(2)|lung(18)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	30	all_epithelial(12;0.0127)	all_neural(303;0.000318)|all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.072)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.233)	OV - Ovarian serous cystadenocarcinoma(223;1.82e-07)|Epithelial(105;1.51e-06)|BRCA - Breast invasive adenocarcinoma(274;0.014)	Marimastat(DB00786)	TTTTGGGAACGTCCTAAGGAA	0.413													G|||	6	0.00119808	0.003	0.0014	5008	,	,		21019	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000196611	G	SER/ARG,SER/ARG	22,4384	29.9+/-59.1	0,22,2181	87.0	78.0	81.0		586,784	2.1	0.1	11	dbSNP_120	81	0,8598		0,0,4299	yes	missense,missense	MMP1	NM_001145938.1,NM_002421.3	110,110	0,22,6480	TT,TG,GG		0.0,0.4993,0.1692	benign,benign	196/404,262/470	102666020	22,12982	2203	4299	6502	MMP1	SO:0001583	missense	0			GMAF=0.0005	HGNC	X54925	CCDS8322.1	11q21-q22	2014-01-30	2005-08-08		ENSG00000196611	ENSG00000196611	3.4.24.7	"""Endogenous ligands"""	7155	protein-coding gene	gene with protein product		120353	"""matrix metalloproteinase 1 (interstitial collagenase)"""	CLG			Standard	NM_002421		Approved		uc001phi.2	P03956	OTTHUMG00000048192	ENST00000315274.6:c.784C>A	11.37:g.102666020G>T	ENSP00000322788:p.Arg262Ser	Somatic	0	9	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	7	68.18	P08156	Missense_Mutation	SNP	30	0.00	0	23	56.60	30	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	p.R262S	ENST00000315274.6	37	c.784	CCDS8322.1	11	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	g	0.807	-0.753376	0.03041	0.004993	0.0	ENSG00000196611	ENST00000315274	T	0.21543	2.0	6.03	2.08	0.27032	Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	.	.	.	.	T	0.08980	0.0222	N	0.03608	-0.345	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.34650	-0.9820	9	0.36615	T	0.2	.	7.0656	0.25149	0.0989:0.1958:0.6059:0.0995	rs12282811;rs12282811	262	P03956	MMP1_HUMAN	S	262	ENSP00000322788:R262S	ENSP00000322788:R262S	R	-	1	0	MMP1	102171230	0.022000	0.18835	0.104000	0.21259	0.025000	0.11179	0.071000	0.14594	-0.056000	0.13221	-0.795000	0.03280	CGT	-	smart_Peptidase_Metallo,pirsf_Pept_M10A_Metazoans		0.413	MMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP1	protein_coding	OTTHUMT00000109632.1	G	NM_002421	rs12282811		102666020	-1	no_errors	ENST00000315274	ensembl	human	known	74_37	missense	SNP	0.285	T
ADAMTS17	170691	genome.wustl.edu	37	15	100516423	100516423	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr15:100516423G>A	ENST00000268070.4	-	21	3059	c.2954C>T	c.(2953-2955)tCg>tTg	p.S985L	CTD-3076O17.1_ENST00000528696.3_RNA|CTD-3076O17.2_ENST00000559400.1_RNA	NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	985	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		GCAGGTCGACGAGCACTGCAG	0.652																																																	0								ENSG00000140470						22.0	20.0	20.0					15																	100516423		1994	3824	5818	ADAMTS17	SO:0001583	missense	0			-	HGNC	AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.2954C>T	15.37:g.100516423G>A	ENSP00000268070:p.Ser985Leu	Somatic	0	23	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	50	55	47.62	Q2I7G4|Q6ZN75	Missense_Mutation	SNP	26	0.00	0	58	48.25	55	pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.S985L	ENST00000268070.4	37	c.2954	CCDS10383.1	15	.	.	.	.	.	.	.	.	.	.	G	20.9	4.062262	0.76187	.	.	ENSG00000140470	ENST00000268070	T	0.68479	-0.33	5.14	5.14	0.70334	Zinc finger, C2H2 (1);	0.000000	0.64402	D	0.000004	D	0.85630	0.5741	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86371	0.1723	10	0.37606	T	0.19	.	18.9544	0.92653	0.0:0.0:1.0:0.0	.	985	Q8TE56	ATS17_HUMAN	L	985	ENSP00000268070:S985L	ENSP00000268070:S985L	S	-	2	0	ADAMTS17	98333946	1.000000	0.71417	0.950000	0.38849	0.246000	0.25737	9.187000	0.94912	2.528000	0.85240	0.563000	0.77884	TCG	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.652	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS17	protein_coding	OTTHUMT00000313595.1	G	NM_139057	-		100516423	-1	no_errors	ENST00000268070	ensembl	human	known	74_37	missense	SNP	1.000	A
MCCC1	56922	genome.wustl.edu	37	3	182789076	182789076	+	Silent	SNP	T	T	A	rs374255867		TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr3:182789076T>A	ENST00000265594.4	-	6	707	c.561A>T	c.(559-561)tcA>tcT	p.S187S	MCCC1_ENST00000492597.1_Silent_p.S78S|MCCC1_ENST00000539926.1_Silent_p.S52S	NM_020166.3	NP_064551.3	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-CoA carboxylase 1 (alpha)	187	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(17)|ovary(1)|pancreas(2)|prostate(1)|skin(2)	40	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	GGCACTGGTCTGATTGGTCCT	0.493																																																	0								ENSG00000078070						110.0	105.0	107.0					3																	182789076		2203	4300	6503	MCCC1	SO:0001819	synonymous_variant	0			-	HGNC	AF310972	CCDS3241.1	3q27.1	2010-04-30	2010-04-30		ENSG00000078070	ENSG00000078070	6.4.1.4		6936	protein-coding gene	gene with protein product		609010	"""methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)"""			11170888	Standard	XR_241502		Approved	MCCA	uc003fle.3	Q96RQ3	OTTHUMG00000158355	ENST00000265594.4:c.561A>T	3.37:g.182789076T>A		Somatic	0	46	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	45	26.23	Q59ES4|Q9H959|Q9NS97	Silent	SNP	33	0.00	0	55	16.67	11	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_carboxylate-amine,pfam_ATP-grasp_RimK-type,pfam_ATP-grasp_DUF201-type,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_Biotin_lipoyl	p.S187	ENST00000265594.4	37	c.561	CCDS3241.1	3																																																																																			-	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_carboxylate-amine,pfam_ATP-grasp_RimK-type,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom		0.493	MCCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCCC1	protein_coding	OTTHUMT00000350775.1	T	NM_020166	-		182789076	-1	no_errors	ENST00000265594	ensembl	human	known	74_37	silent	SNP	0.238	A
DYNC2LI1	51626	genome.wustl.edu	37	2	44028001	44028001	+	Silent	SNP	C	C	T	rs373318313		TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr2:44028001C>T	ENST00000260605.8	+	9	776	c.676C>T	c.(676-678)Cta>Tta	p.L226L	DYNC2LI1_ENST00000443170.3_Silent_p.L100L|DYNC2LI1_ENST00000489222.2_3'UTR|DYNC2LI1_ENST00000605786.1_Silent_p.L227L	NM_001193464.1|NM_016008.3	NP_001180393.1|NP_057092.2	Q8TCX1	DC2L1_HUMAN	dynein, cytoplasmic 2, light intermediate chain 1	226					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)	apical part of cell (GO:0045177)|axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytosol (GO:0005829)|intraciliary transport particle (GO:0030990)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|primary cilium (GO:0072372)	motor activity (GO:0003774)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|skin(1)	26		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				ATCAGAAGCTCTATTACTAAA	0.303																																																	0								ENSG00000138036						84.0	89.0	87.0					2																	44028001		2203	4298	6501	DYNC2LI1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS1813.1, CCDS46270.1, CCDS62903.1	2p25.1-p24.1	2008-02-05			ENSG00000138036	ENSG00000138036		"""Cytoplasmic dyneins"""	24595	protein-coding gene	gene with protein product						10810093, 11907264	Standard	NM_016008		Approved	D2LIC, LIC3, CGI-60, DKFZP564A033	uc002rtl.3	Q8TCX1	OTTHUMG00000128656	ENST00000260605.8:c.676C>T	2.37:g.44028001C>T		Somatic	0	51	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	52	26	66.67	A8MVJ5|Q53F57|Q6PDB2|Q8IWA3|Q96B03|Q96J00|Q9Y370|Q9Y3S9	Silent	SNP	44	0.00	0	20	61.54	32	pfam_Dynein_light_int_chain,superfamily_P-loop_NTPase	p.L227	ENST00000260605.8	37	c.679	CCDS1813.1	2																																																																																			-	NULL		0.303	DYNC2LI1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYNC2LI1	protein_coding	OTTHUMT00000250536.2	C	NM_016008	-		44028001	+1	no_errors	ENST00000605786	ensembl	human	known	74_37	silent	SNP	0.987	T
OR8B2	26595	genome.wustl.edu	37	11	124253100	124253100	+	Missense_Mutation	SNP	G	G	A	rs71491826	byFrequency	TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr11:124253100G>A	ENST00000375013.2	-	1	158	c.140C>T	c.(139-141)aCt>aTt	p.T47I		NM_001005468.1	NP_001005468.1	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B, member 2	47						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(13)|ovary(1)	23		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		ACCGAAAAGAGTGATCAAGCC	0.433																																																	0								ENSG00000204293						205.0	189.0	195.0					11																	124253100		2201	4299	6500	OR8B2	SO:0001583	missense	0			-	HGNC	AB065826	CCDS31708.1	11q24.1	2012-08-09			ENSG00000204293	ENSG00000204293		"""GPCR / Class A : Olfactory receptors"""	8471	protein-coding gene	gene with protein product							Standard	XM_005271500		Approved		uc010sai.2	Q96RD0	OTTHUMG00000165982	ENST00000375013.2:c.140C>T	11.37:g.124253100G>A	ENSP00000364152:p.Thr47Ile	Somatic	0	43	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	64	14.67	Q8NGH2	Missense_Mutation	SNP	27	15.62	5	24	31.43	11	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T47I	ENST00000375013.2	37	c.140	CCDS31708.1	11	.	.	.	.	.	.	.	.	.	.	g	4.976	0.181303	0.09495	.	.	ENSG00000204293	ENST00000375013	T	0.00995	5.46	4.2	-6.64	0.01801	GPCR, rhodopsin-like superfamily (1);	0.578377	0.16537	N	0.210134	T	0.00524	0.0017	N	0.12831	0.26	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44682	-0.9312	10	0.09843	T	0.71	.	9.4235	0.38565	0.6255:0.1003:0.2741:0.0	.	47	Q96RD0	OR8B2_HUMAN	I	47	ENSP00000364152:T47I	ENSP00000364152:T47I	T	-	2	0	OR8B2	123758310	0.000000	0.05858	0.000000	0.03702	0.198000	0.23893	-0.066000	0.11598	-1.389000	0.02090	0.400000	0.26472	ACT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.433	OR8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B2	protein_coding	OTTHUMT00000387290.1	G	NM_001005468	rs71491826		124253100	-1	no_errors	ENST00000375013	ensembl	human	known	74_37	missense	SNP	0.000	A
CCNYL2	414194	genome.wustl.edu	37	10	42924593	42924594	+	RNA	INS	-	-	C	rs372503885|rs74262004|rs6143878	byFrequency	TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr10:42924593_42924594insC	ENST00000483242.3	-	0	804_805					NR_103829.1		Q5T2Q4	CCYL2_HUMAN	cyclin Y-like 2						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)			p.?(4)		breast(2)|endometrium(1)|lung(3)|ovary(1)	7						ATAGTGCCAAGGTCACACTGTG	0.347																																																	4	Unknown(4)	breast(4)						ENSG00000182632																																			CCNYL2			0				HGNC	BC039000		10q11.21	2007-02-09	2007-02-09	2007-02-09	ENSG00000182632	ENSG00000182632			23495	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 21"""	C10orf21			Standard	NR_103829		Approved	bA178A10.2		Q5T2Q4	OTTHUMG00000018009		10.37:g.42924593_42924594insC		Somatic	1	101	0.98		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79		RNA	INS	17	0.00	0	8	0.00	0	-	NULL	ENST00000483242.3	37	NULL		10																																																																																			-	-		0.347	CCNYL2-002	KNOWN	basic	processed_transcript	CCNYL2	pseudogene	OTTHUMT00000047670.5	-	XM_936368			42924594	-1	no_errors	ENST00000483242	ensembl	human	known	74_37	rna	INS	0.996:0.999	C
CNTN5	53942	genome.wustl.edu	37	11	99690376	99690376	+	Nonsense_Mutation	SNP	C	C	T	rs12292659	byFrequency	TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr11:99690376C>T	ENST00000524871.1	+	4	447	c.157C>T	c.(157-159)Cga>Tga	p.R53*	CNTN5_ENST00000418526.2_Intron|CNTN5_ENST00000528682.1_Nonsense_Mutation_p.R53*|CNTN5_ENST00000279463.3_Nonsense_Mutation_p.R53*|CNTN5_ENST00000527185.1_Nonsense_Mutation_p.R53*	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	53					cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		AACCAGACCACGATACAGCAG	0.428																																																	0								ENSG00000149972	C	stop/ARG,	827,2987		0,827,1080	115.0	115.0	115.0		157,	3.0	0.9	11	dbSNP_120	115	2016,6260		0,2016,2122	yes	stop-gained,intron	CNTN5	NM_014361.3,NM_175566.2	,	0,2843,3202	TT,TC,CC		24.3596,21.6833,23.5153	,	53/1101,	99690376	2843,9247	1907	4138	6045	CNTN5	SO:0001587	stop_gained	0			-	HGNC	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.157C>T	11.37:g.99690376C>T	ENSP00000435637:p.Arg53*	Somatic	0	24	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	30	25.00	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Nonsense_Mutation	SNP	44	18.52	10	69	20.69	18	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R53*	ENST00000524871.1	37	c.157	CCDS53696.1	11	.	.	.	.	.	.	.	.	.	.	C	23.8	4.456071	0.84209	0.216833	0.243596	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000279463	.	.	.	5.06	2.96	0.34315	.	0.104565	0.37483	N	0.002068	.	.	.	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.0077	0.47644	0.1446:0.7156:0.1398:0.0	rs12292659;rs12292659	.	.	.	X	53	.	ENSP00000279463:R53X	R	+	1	2	CNTN5	99195586	0.798000	0.28890	0.915000	0.36163	0.672000	0.39443	1.290000	0.33319	1.385000	0.46445	0.650000	0.86243	CGA	-	NULL		0.428	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNTN5	protein_coding	OTTHUMT00000395148.2	C	NM_014361	rs12292659		99690376	+1	no_errors	ENST00000279463	ensembl	human	known	74_37	nonsense	SNP	0.982	T
COL17A1	1308	genome.wustl.edu	37	10	105798854	105798854	+	Silent	SNP	A	A	T			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr10:105798854A>T	ENST00000353479.5	-	44	3212	c.2922T>A	c.(2920-2922)ctT>ctA	p.L974L	COL17A1_ENST00000369733.3_Silent_p.L929L	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	974	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TAGGAATGCCAAGAGCCCCTG	0.483																																																	0								ENSG00000065618						136.0	112.0	120.0					10																	105798854		2203	4300	6503	COL17A1	SO:0001819	synonymous_variant	0			-	HGNC	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.2922T>A	10.37:g.105798854A>T		Somatic	0	32	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	40	13.04	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Silent	SNP	30	0.00	0	36	20.00	9	pfam_Collagen	p.L974	ENST00000353479.5	37	c.2922	CCDS7554.1	10																																																																																			-	NULL		0.483	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL17A1	protein_coding	OTTHUMT00000050181.1	A	NM_130778, NM_000494	-		105798854	-1	no_errors	ENST00000353479	ensembl	human	known	74_37	silent	SNP	0.973	T
RPGRIP1	57096	genome.wustl.edu	37	14	21789428	21789428	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr14:21789428C>T	ENST00000400017.2	+	12	1478	c.1478C>T	c.(1477-1479)cCc>cTc	p.P493L	RPGRIP1_ENST00000553500.1_3'UTR|RPGRIP1_ENST00000382933.4_Missense_Mutation_p.P135L|RPGRIP1_ENST00000206660.6_Missense_Mutation_p.P493L|RPGRIP1_ENST00000556336.1_Missense_Mutation_p.P466L|RPGRIP1_ENST00000557771.1_Missense_Mutation_p.P466L	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	493					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)				breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		CCAAGTGAACCCAAAAACCAA	0.398																																																	0								ENSG00000092200						76.0	69.0	71.0					14																	21789428		1860	4096	5956	RPGRIP1	SO:0001583	missense	0			-	HGNC	AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.1478C>T	14.37:g.21789428C>T	ENSP00000382895:p.Pro493Leu	Somatic	0	57	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	112	15.79	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Missense_Mutation	SNP	37	0.00	0	61	30.68	27	pfam_DUF3250,superfamily_C2_dom	p.P493L	ENST00000400017.2	37	c.1478	CCDS45080.1	14	.	.	.	.	.	.	.	.	.	.	C	10.57	1.386919	0.25031	.	.	ENSG00000092200	ENST00000556336;ENST00000557771;ENST00000400017;ENST00000206660;ENST00000382933;ENST00000557351	T;T;T;T;T	0.74106	-0.02;-0.79;-0.81;-0.81;-0.35	5.12	3.23	0.37069	.	0.378663	0.27778	N	0.017900	T	0.64735	0.2625	M	0.72118	2.19	0.18873	N	0.999988	B;P;P	0.39282	0.004;0.666;0.544	B;B;B	0.33454	0.018;0.164;0.122	T	0.57236	-0.7846	10	0.31617	T	0.26	-0.0875	5.5397	0.17031	0.3926:0.5147:0.0:0.0927	.	135;109;493	Q96KN7-4;Q96KN7-5;Q96KN7	.;.;RPGR1_HUMAN	L	466;466;493;493;135;160	ENSP00000450445:P466L;ENSP00000451219:P466L;ENSP00000382895:P493L;ENSP00000206660:P493L;ENSP00000372391:P135L	ENSP00000206660:P493L	P	+	2	0	RPGRIP1	20859268	0.007000	0.16637	0.172000	0.22920	0.043000	0.13939	0.078000	0.14761	1.451000	0.47736	0.650000	0.86243	CCC	-	NULL		0.398	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPGRIP1	protein_coding	OTTHUMT00000410258.1	C	NM_020366	-		21789428	+1	no_errors	ENST00000206660	ensembl	human	known	74_37	missense	SNP	0.030	T
ANKRD62	342850	genome.wustl.edu	37	18	12125943	12125943	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr18:12125943A>T	ENST00000587848.2	+	13	2288	c.2123A>T	c.(2122-2124)aAa>aTa	p.K708I	ANKRD62_ENST00000418274.2_3'UTR|ANKRD62_ENST00000314074.8_Missense_Mutation_p.K694I			A6NC57	ANR62_HUMAN	ankyrin repeat domain 62	708										breast(2)|haematopoietic_and_lymphoid_tissue(1)	3						CAACTTTCTAAAGCTGAGAGT	0.418																																																	0								ENSG00000181626																																			ANKRD62	SO:0001583	missense	0			-	HGNC	BX648696	CCDS67439.1	18p11.21	2014-01-21			ENSG00000181626	ENSG00000181626		"""Ankyrin repeat domain containing"""	35241	protein-coding gene	gene with protein product							Standard	XM_003959949		Approved	DKFZp779B1634	uc031rhk.1	A6NC57	OTTHUMG00000180673	ENST00000587848.2:c.2123A>T	18.37:g.12125943A>T	ENSP00000467740:p.Lys708Ile	Somatic	0	71	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	89	14.42		Missense_Mutation	SNP	41	0.00	0	53	10.17	6	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.K694I	ENST00000587848.2	37	c.2081		18	.	.	.	.	.	.	.	.	.	.	.	6.664	0.491064	0.12702	.	.	ENSG00000181626	ENST00000314074;ENST00000418274	T;T	0.18016	2.24;2.24	1.85	0.564	0.17302	.	.	.	.	.	T	0.23846	0.0577	M	0.72894	2.215	0.09310	N	1	P	0.52842	0.956	P	0.50970	0.655	T	0.15954	-1.0419	9	0.87932	D	0	.	2.4185	0.04442	0.5141:0.3035:0.1824:0.0	.	708	A6NC57	ANR62_HUMAN	I	694;430	ENSP00000326572:K694I;ENSP00000405628:K430I	ENSP00000326572:K694I	K	+	2	0	ANKRD62	12115943	0.807000	0.29009	0.022000	0.16811	0.006000	0.05464	1.366000	0.34193	0.153000	0.19213	0.247000	0.18012	AAA	-	NULL		0.418	ANKRD62-003	PUTATIVE	basic|appris_candidate_longest	protein_coding	ANKRD62	protein_coding	OTTHUMT00000452521.2	A	XM_001715728	-		12125943	+1	no_errors	ENST00000314074	ensembl	human	known	74_37	missense	SNP	0.133	T
TMCO6	55374	genome.wustl.edu	37	5	140024571	140024571	+	Splice_Site	SNP	C	C	G			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr5:140024571C>G	ENST00000394671.3	+	12	1471	c.1370C>G	c.(1369-1371)gCt>gGt	p.A457G	TMCO6_ENST00000537378.1_Splice_Site_p.A217G|NDUFA2_ENST00000510680.1_Intron|MIR3655_ENST00000581765.1_RNA|TMCO6_ENST00000252100.6_Splice_Site_p.A463G|IK_ENST00000417647.2_5'Flank	NM_018502.3	NP_060972.3	Q96DC7	TMCO6_HUMAN	transmembrane and coiled-coil domains 6	457					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|urinary_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCCCCTAGGCTGTTCAGGTC	0.562																																																	0								ENSG00000113119						85.0	84.0	84.0					5																	140024571		1913	4136	6049	TMCO6	SO:0001630	splice_region_variant	0			-	HGNC	BC001910	CCDS4233.2, CCDS75320.1	5q31.3	2008-11-06			ENSG00000113119	ENSG00000113119			28814	protein-coding gene	gene with protein product						12477932	Standard	XM_005268476		Approved	FLJ39769, PRO1580	uc003lgl.3	Q96DC7	OTTHUMG00000129497	ENST00000394671.3:c.1369-1C>G	5.37:g.140024571C>G		Somatic	0	22	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	19	32.14	Q9BUU0|Q9P198	Missense_Mutation	SNP	22	0.00	0	35	27.08	13	superfamily_ARM-type_fold,smart_Armadillo,pfscan_Importin-a_IBB	p.A463G	ENST00000394671.3	37	c.1388	CCDS4233.2	5	.	.	.	.	.	.	.	.	.	.	C	4.019	0.000959	0.07819	.	.	ENSG00000113119	ENST00000394671;ENST00000537378;ENST00000252100	T;T;T	0.72051	-0.62;-0.62;-0.62	5.51	5.51	0.81932	Armadillo-like helical (1);Armadillo-type fold (1);	0.186769	0.35349	N	0.003268	T	0.53981	0.1830	N	0.17082	0.46	0.30455	N	0.774863	P;B	0.37330	0.59;0.447	B;B	0.37304	0.246;0.179	T	0.59397	-0.7462	10	0.38643	T	0.18	-6.1129	10.4824	0.44702	0.0:0.9112:0.0:0.0888	.	463;457	Q96DC7-2;Q96DC7	.;TMCO6_HUMAN	G	457;217;463	ENSP00000378166:A457G;ENSP00000444474:A217G;ENSP00000252100:A463G	ENSP00000252100:A463G	A	+	2	0	TMCO6	140004755	1.000000	0.71417	1.000000	0.80357	0.401000	0.30781	2.060000	0.41394	2.575000	0.86900	0.655000	0.94253	GCT	-	superfamily_ARM-type_fold		0.562	TMCO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO6	protein_coding	OTTHUMT00000251666.2	C	NM_018502	-	Missense_Mutation	140024571	+1	no_errors	ENST00000252100	ensembl	human	known	74_37	missense	SNP	0.998	G
EMP2	2013	genome.wustl.edu	37	16	10625606	10625613	+	3'UTR	DEL	ATGAATGA	ATGAATGA	-	rs151287012|rs111364972|rs149380057		TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	ATGAATGA	ATGAATGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr16:10625606_10625613delATGAATGA	ENST00000359543.3	-	0	1862_1869				EMP2_ENST00000566033.1_5'UTR|RP11-27M24.1_ENST00000535363.1_RNA	NM_001424.4	NP_001415.1	P54851	EMP2_HUMAN	epithelial membrane protein 2						cell proliferation (GO:0008283)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|regulation of glomerular filtration (GO:0003093)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	integrin binding (GO:0005178)			NS(1)|endometrium(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6						ATTTATGTTGatgaatgaatgaatgaat	0.471																																					GBM(158;2021 2691 14714 39478)												0								ENSG00000213853																																			EMP2	SO:0001624	3_prime_UTR_variant	0				HGNC	U52100	CCDS10541.1	16p13.2	2008-08-01			ENSG00000213853	ENSG00000213853			3334	protein-coding gene	gene with protein product		602334				8996089, 10331954, 16216233	Standard	NM_001424		Approved	XMP	uc002czx.3	P54851	OTTHUMG00000129752	ENST00000359543.3:c.*1156TCATTCAT>-	16.37:g.10625614_10625621delATGAATGA		Somatic	NA	NA	NA		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2R7V6|D3DUF8	RNA	DEL	18	25.00	6	15	46.43	13	-	NULL	ENST00000359543.3	37	NULL	CCDS10541.1	16																																																																																			-	-		0.471	EMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMP2	protein_coding	OTTHUMT00000251965.1	ATGAATGA	NM_001424			10625613	-1	no_errors	ENST00000566033	ensembl	human	putative	74_37	rna	DEL	0.092:0.092:0.091:0.090:0.088:0.085:0.082:0.078	-
CBX4	8535	genome.wustl.edu	37	17	77807917	77807918	+	In_Frame_Ins	INS	-	-	GCCGCC			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr17:77807917_77807918insGCCGCC	ENST00000269397.4	-	5	1700_1701	c.1523_1524insGGCGGC	c.(1522-1524)gca>gcGGCGGCa	p.508_508A>AAA		NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	508	Interaction with BMI1.|Poly-Ala.				chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			TGGGTgccgctgccgccgccac	0.683																																																	0								ENSG00000141582			245,2867		49,147,1360						-4.3	0.0			21	468,6186		62,344,2921	no	coding	CBX4	NM_003655.2		111,491,4281	A1A1,A1R,RR		7.0334,7.8728,7.3008				713,9053				CBX4	SO:0001652	inframe_insertion	0				HGNC	AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.1518_1523dupGGCGGC	17.37:g.77807918_77807923dupGCCGCC	ENSP00000269397:p.AlaAla510dup	Somatic	NA	NA	NA		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B1PJR7|Q6TPI8|Q96C04	In_Frame_Ins	INS	15	16.67	3	23	17.86	5	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,prints_Chromo_dom_subgr,pfscan_Chromo_domain/shadow	p.511in_frame_insAA	ENST00000269397.4	37	c.1524_1523	CCDS32758.1	17																																																																																			-	NULL		0.683	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBX4	protein_coding	OTTHUMT00000318007.1	-	NM_003655			77807918	-1	no_errors	ENST00000269397	ensembl	human	known	74_37	in_frame_ins	INS	0.000:0.003	GCCGCC
OR8A1	390275	genome.wustl.edu	37	11	124440664	124440664	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr11:124440664T>C	ENST00000284287.3	+	1	772	c.700T>C	c.(700-702)Tac>Cac	p.Y234H		NM_001005194.1	NP_001005194.1	Q8NGG7	OR8A1_HUMAN	olfactory receptor, family 8, subfamily A, member 1	234					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			haematopoietic_and_lymphoid_tissue(1)|lung(16)|ovary(2)|prostate(1)|skin(2)	22		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0214)		TCTTGTTTCTTACACCTTCAT	0.498																																																	0								ENSG00000196119						113.0	109.0	110.0					11																	124440664		2201	4299	6500	OR8A1	SO:0001583	missense	0			-	HGNC	BK004495	CCDS31712.1	11q24.2	2012-08-09			ENSG00000196119	ENSG00000196119		"""GPCR / Class A : Olfactory receptors"""	8469	protein-coding gene	gene with protein product							Standard	NM_001005194		Approved	OST025	uc010san.2	Q8NGG7	OTTHUMG00000165923	ENST00000284287.3:c.700T>C	11.37:g.124440664T>C	ENSP00000284287:p.Tyr234His	Somatic	0	44	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q6IEW7|Q96RC6	Missense_Mutation	SNP	32	0.00	0	35	0.00	0	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y234H	ENST00000284287.3	37	c.700	CCDS31712.1	11	.	.	.	.	.	.	.	.	.	.	T	14.50	2.553571	0.45487	.	.	ENSG00000196119	ENST00000284287	T	0.00515	6.87	5.03	5.03	0.67393	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42172	D	0.000749	T	0.03871	0.0109	H	0.97918	4.105	0.39209	D	0.96328	D	0.89917	1.0	D	0.97110	1.0	T	0.01909	-1.1249	10	0.87932	D	0	.	14.5791	0.68274	0.0:0.0:0.0:1.0	.	234	Q8NGG7	OR8A1_HUMAN	H	234	ENSP00000284287:Y234H	ENSP00000284287:Y234H	Y	+	1	0	OR8A1	123945874	0.995000	0.38212	0.996000	0.52242	0.241000	0.25554	3.647000	0.54403	2.098000	0.63641	0.528000	0.53228	TAC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.498	OR8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8A1	protein_coding	OTTHUMT00000387062.1	T	NM_001005194	-		124440664	+1	no_errors	ENST00000284287	ensembl	human	known	74_37	missense	SNP	0.995	C
PEX7	5191	genome.wustl.edu	37	6	137147605	137147605	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr6:137147605G>C	ENST00000318471.4	+	3	418	c.337G>C	c.(337-339)Gag>Cag	p.E113Q	PEX7_ENST00000541292.1_Missense_Mutation_p.E113Q|PEX7_ENST00000367756.4_Missense_Mutation_p.E113Q	NM_000288.3	NP_000279.1	O00628	PEX7_HUMAN	peroxisomal biogenesis factor 7	113					endochondral ossification (GO:0001958)|ether lipid biosynthetic process (GO:0008611)|fatty acid beta-oxidation (GO:0006635)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	enzyme binding (GO:0019899)|peroxisome matrix targeting signal-2 binding (GO:0005053)|protein homodimerization activity (GO:0042803)	p.E113Q(1)		lung(7)|prostate(1)	8	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000257)|OV - Ovarian serous cystadenocarcinoma(155;0.00492)		ACACGCTCAGGAGGTAGGAGG	0.493																																																	1	Substitution - Missense(1)	prostate(1)						ENSG00000112357						72.0	67.0	68.0					6																	137147605		2203	4300	6503	PEX7	SO:0001583	missense	0			-	HGNC	AF180814	CCDS5180.1	6q21-q22.2	2013-01-10			ENSG00000112357	ENSG00000112357		"""WD repeat domain containing"""	8860	protein-coding gene	gene with protein product	"""Refsum disease"""	601757				9090381, 10673331	Standard	NM_000288		Approved	PTS2R, RD	uc003qhd.3	O00628	OTTHUMG00000015650	ENST00000318471.4:c.337G>C	6.37:g.137147605G>C	ENSP00000315680:p.Glu113Gln	Somatic	0	48	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	42	30.00	C0H5X6	Missense_Mutation	SNP	37	0.00	0	23	39.47	15	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.E113Q	ENST00000318471.4	37	c.337	CCDS5180.1	6	.	.	.	.	.	.	.	.	.	.	G	32	5.156466	0.94686	.	.	ENSG00000112357	ENST00000367756;ENST00000541292;ENST00000318471	D;D;D	0.95918	-3.85;-2.03;-2.03	5.52	5.52	0.82312	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.97188	0.9081	M	0.71871	2.18	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96165	0.9118	10	0.39692	T	0.17	.	19.4383	0.94807	0.0:0.0:1.0:0.0	.	113	O00628	PEX7_HUMAN	Q	113	ENSP00000356730:E113Q;ENSP00000441004:E113Q;ENSP00000315680:E113Q	ENSP00000315680:E113Q	E	+	1	0	PEX7	137189298	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.961000	0.93122	2.589000	0.87451	0.655000	0.94253	GAG	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.493	PEX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX7	protein_coding	OTTHUMT00000042387.2	G	NM_000288	-		137147605	+1	no_errors	ENST00000318471	ensembl	human	known	74_37	missense	SNP	1.000	C
SLC8A2	6543	genome.wustl.edu	37	19	47941209	47941209	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr19:47941209G>C	ENST00000236877.6	-	7	2302	c.1907C>G	c.(1906-1908)aCa>aGa	p.T636R	SLC8A2_ENST00000542837.1_Missense_Mutation_p.T392R|SLC8A2_ENST00000539381.1_Missense_Mutation_p.T99R|SLC8A2_ENST00000601757.1_5'UTR	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	636					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		CTCCTCGGCTGTTAGCTTCCT	0.572																																																	0								ENSG00000118160						103.0	102.0	102.0					19																	47941209		2203	4300	6503	SLC8A2	SO:0001583	missense	0			-	HGNC	AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.1907C>G	19.37:g.47941209G>C	ENSP00000236877:p.Thr636Arg	Somatic	0	22	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	3	80.00	B4DYQ9	Missense_Mutation	SNP	30	0.00	0	2	89.47	17	pfam_Calx_beta,pfam_NaCa_Exmemb,smart_Calx_beta,prints_Na_Ca_Ex,tigrfam_Na_Ca_Ex	p.T636R	ENST00000236877.6	37	c.1907	CCDS33065.1	19	.	.	.	.	.	.	.	.	.	.	G	9.442	1.088396	0.20390	.	.	ENSG00000118160	ENST00000391903;ENST00000236877;ENST00000539381;ENST00000542837	T;T;T	0.28454	1.61;1.61;1.61	2.54	2.54	0.30619	.	0.160513	0.40554	U	0.001074	T	0.31263	0.0791	M	0.75447	2.3	0.38017	D	0.934733	P;P	0.46142	0.873;0.513	B;B	0.36959	0.237;0.137	T	0.53872	-0.8377	10	0.62326	D	0.03	.	12.953	0.58411	0.0:0.0:1.0:0.0	.	464;636	E9PGS7;Q9UPR5	.;NAC2_HUMAN	R	464;636;99;392	ENSP00000236877:T636R;ENSP00000440588:T99R;ENSP00000437536:T392R	ENSP00000236877:T636R	T	-	2	0	SLC8A2	52633021	0.082000	0.21442	0.814000	0.32528	0.658000	0.38924	2.816000	0.48026	1.751000	0.51876	0.456000	0.33151	ACA	-	tigrfam_Na_Ca_Ex		0.572	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC8A2	protein_coding	OTTHUMT00000466997.1	G		-		47941209	-1	no_errors	ENST00000236877	ensembl	human	known	74_37	missense	SNP	0.924	C
KCNQ1	3784	genome.wustl.edu	37	11	2683460	2683460	+	Intron	SNP	G	G	A			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr11:2683460G>A	ENST00000155840.5	+	11	1622				KCNQ1OT1_ENST00000597346.1_RNA|KCNQ1_ENST00000335475.5_Intron	NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1						atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	GCCCCAACACGGAGGCACCAG	0.552																																																	0								ENSG00000269821																																			KCNQ1OT1	SO:0001627	intron_variant	0			-	HGNC	AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.1514+149G>A	11.37:g.2683460G>A		Somatic	0	9	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	8	50.00	O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	RNA	SNP	27	0.00	0	10	54.55	12	-	NULL	ENST00000155840.5	37	NULL	CCDS7736.1	11																																																																																			-	-		0.552	KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ1OT1	protein_coding	OTTHUMT00000027382.2	G	NM_000218	-		2683460	-1	no_errors	ENST00000597346	ensembl	human	known	74_37	rna	SNP	0.000	A
SCGB1D4	404552	genome.wustl.edu	37	11	62066450	62066450	+	Silent	SNP	C	C	G	rs377708746		TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr11:62066450C>G	ENST00000358585.1	-	1	86	c.33G>C	c.(31-33)tcG>tcC	p.S11S		NM_206998.1	NP_996881.1	Q6XE38	SG1D4_HUMAN	secretoglobin, family 1D, member 4	11						extracellular region (GO:0005576)				lung(1)|prostate(1)	2						AAAGGGCCAGCGAGACCATCA	0.537																																																	0								ENSG00000197745						171.0	120.0	137.0					11																	62066450		2202	4299	6501	SCGB1D4	SO:0001819	synonymous_variant	0			-	HGNC	AY236538	CCDS31583.1	11q12.3	2011-12-14			ENSG00000197745	ENSG00000197745		"""Secretoglobins"""	31748	protein-coding gene	gene with protein product		615062				15034037, 15340161, 22155607	Standard	NM_206998		Approved	IIS	uc001ntd.1	Q6XE38	OTTHUMG00000167510	ENST00000358585.1:c.33G>C	11.37:g.62066450C>G		Somatic	0	68	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	48	35.14	A1L4Q8	Silent	SNP	23	0.00	0	41	26.79	15	pfam_Secretoglobin,superfamily_Secretoglobin	p.S11	ENST00000358585.1	37	c.33	CCDS31583.1	11																																																																																			-	pfam_Secretoglobin		0.537	SCGB1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCGB1D4	protein_coding	OTTHUMT00000394862.1	C	NM_206998	-		62066450	-1	no_errors	ENST00000358585	ensembl	human	known	74_37	silent	SNP	0.540	G
PBX2P1	5088	genome.wustl.edu	37	3	142897185	142897202	+	RNA	DEL	TGTTTTTGTTGTTGTTGT	TGTTTTTGTTGTTGTTGT	-	rs1661132|rs563887110|rs560371216|rs545625049|rs551947183	byFrequency	TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	TGTTTTTGTTGTTGTTGT	TGTTTTTGTTGTTGTTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr3:142897185_142897202delTGTTTTTGTTGTTGTTGT	ENST00000560287.1	+	0	2059_2076									pre-B-cell leukemia homeobox 2 pseudogene 1																		GGGATCCATCtgtttttgttgttgttgttgtttttgtt	0.303														62	0.0123802	0.0	0.013	5008	,	,		12557	0.002		0.0169	False		,,,				2504	0.0348																0								ENSG00000244171																																			PBX2P1			0				HGNC			3q24	2014-03-25	2007-01-30	2007-01-30	ENSG00000244171	ENSG00000244171		"""Homeoboxes / TALE class"""	8635	pseudogene	pseudogene			"""pre-B-cell leukemia transcription factor pseudogene 1"""	PBX2, PBXP1		1682799	Standard	NG_002434		Approved				OTTHUMG00000159350		3.37:g.142897185_142897202delTGTTTTTGTTGTTGTTGT		Somatic	NA	NA	NA		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	12	42.86	9	39	30.36	17	-	NULL	ENST00000560287.1	37	NULL		3																																																																																			-	-		0.303	PBX2P1-002	KNOWN	basic	processed_transcript	PBX2P1	pseudogene	OTTHUMT00000417717.1	TGTTTTTGTTGTTGTTGT	NG_002434			142897202	+1	no_errors	ENST00000560287	ensembl	human	known	74_37	rna	DEL	0.639:0.474:0.235:0.119:0.110:0.097:0.077:0.050:0.050:0.048:0.043:0.034:0.032:0.028:0.024:0.019:0.015:0.009	-
OR7E24	26648	genome.wustl.edu	37	19	9362102	9362102	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr19:9362102T>A	ENST00000456448.1	+	1	497	c.383T>A	c.(382-384)aTg>aAg	p.M128K		NM_001079935.1	NP_001073404.1	Q6IFN5	O7E24_HUMAN	olfactory receptor, family 7, subfamily E, member 24	128						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)	16						TTTGCATGTATGGATGACATG	0.502																																																	0								ENSG00000237521						114.0	115.0	115.0					19																	9362102		2198	4298	6496	OR7E24	SO:0001583	missense	0			-	HGNC	Y10529	CCDS45955.1	19p13.2	2012-08-09	2004-03-04	2004-03-05		ENSG00000237521		"""GPCR / Class A : Olfactory receptors"""	8396	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily E, member 24 pseudogene"""	OR7E24P		9268701	Standard	NM_001079935		Approved	OR19-8, HSHT2, OR7E24Q	uc002mlb.1	Q6IFN5		ENST00000456448.1:c.383T>A	19.37:g.9362102T>A	ENSP00000387523:p.Met128Lys	Somatic	1	106	0.93		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	61	98	38.36	B9EJD9|Q9UPJ1	Missense_Mutation	SNP	26	0.00	0	39	40.91	27	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M128K	ENST00000456448.1	37	c.383	CCDS45955.1	19	.	.	.	.	.	.	.	.	.	.	t	12.55	1.970973	0.34754	.	.	ENSG00000237521	ENST00000456448	T	0.00848	5.62	2.39	1.35	0.21983	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01940	0.0061	M	0.78916	2.43	0.09310	N	1	P	0.36683	0.565	B	0.41088	0.347	T	0.36696	-0.9737	9	0.87932	D	0	.	4.803	0.13307	0.0:0.2584:0.0:0.7416	.	128	Q6IFN5	O7E24_HUMAN	K	128	ENSP00000387523:M128K	ENSP00000387523:M128K	M	+	2	0	OR7E24	9223102	0.001000	0.12720	0.016000	0.15963	0.006000	0.05464	0.306000	0.19279	1.112000	0.41740	0.358000	0.22013	ATG	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.502	OR7E24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7E24	protein_coding	OTTHUMT00000449006.1	T		-		9362102	+1	no_errors	ENST00000456448	ensembl	human	known	74_37	missense	SNP	0.000	A
MXRA7	439921	genome.wustl.edu	37	17	74684274	74684274	+	Intron	SNP	A	A	T			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr17:74684274A>T	ENST00000355797.3	-	2	351				MXRA7_ENST00000449428.2_Intron|MXRA7_ENST00000589082.1_Intron|MXRA7_ENST00000375036.2_Intron|MXRA7_ENST00000592148.1_Silent_p.P152P|MXRA7_ENST00000585519.1_Intron|MXRA7_ENST00000588114.1_Intron	NM_001008528.1	NP_001008528.1	P84157	MXRA7_HUMAN	matrix-remodelling associated 7							integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(2)|skin(1)	6						AGACAAGGACAGGGTCAGTGC	0.637																																																	0								ENSG00000182534						112.0	75.0	87.0					17																	74684274		2203	4300	6503	MXRA7	SO:0001627	intron_variant	0			-	HGNC	BC053983	CCDS32745.1, CCDS32746.1, CCDS45786.1	17q25.1	2007-08-01				ENSG00000182534			7541	protein-coding gene	gene with protein product							Standard	XM_005257382		Approved	FLJ46603, TMAP1, PS1TP1	uc002jsk.1	P84157		ENST00000355797.3:c.343-16T>A	17.37:g.74684274A>T		Somatic	0	60	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	58	12.12	Q0P5W3	Silent	SNP	18	0.00	0	30	0.00	0	NULL	p.P152	ENST00000355797.3	37	c.456	CCDS32745.1	17																																																																																			-	NULL		0.637	MXRA7-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MXRA7	protein_coding	OTTHUMT00000450983.1	A	NM_001008529	-		74684274	-1	no_errors	ENST00000592148	ensembl	human	putative	74_37	silent	SNP	0.711	T
FOXD4	2298	genome.wustl.edu	37	9	118004	118005	+	In_Frame_Ins	INS	-	-	CCTCGTCTTCCA			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr9:118004_118005insCCTCGTCTTCCA	ENST00000382500.2	-	1	412_413	c.115_116insTGGAAGACGAGG	c.(115-117)gag>gTGGAAGACGAGGag	p.38_39insVEDE		NM_207305.4	NP_997188.2	Q12950	FOXD4_HUMAN	forkhead box D4	38					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	14	all_lung(41;0.218)	all_cancers(5;0.0395)|Acute lymphoblastic leukemia(5;1.91e-07)|all_hematologic(5;1.95e-06)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		CGCCGCCTCCTCCTCGTCTTCA	0.668																																																	0								ENSG00000170122																																			FOXD4	SO:0001652	inframe_insertion	0				HGNC	U13223	CCDS34975.1	9p24.3	2014-09-17			ENSG00000170122	ENSG00000170122		"""Forkhead boxes"""	3805	protein-coding gene	gene with protein product		601092		FKHL9		7957066, 8825632, 12234674	Standard	NM_207305		Approved	FREAC5, FOXD4a	uc003zfz.4	Q12950	OTTHUMG00000021015	ENST00000382500.2:c.115_116insTGGAAGACGAGG	9.37:g.118004_118005insCCTCGTCTTCCA	ENSP00000371940:p.Glu38_Glu39insValGluAspGlu	Somatic	NA	NA	NA		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RN05|B9EGL7|Q5VVK1|Q8WXT6	In_Frame_Ins	INS	12	0.00	0	17	0.00	0	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.39in_frame_insVEDE	ENST00000382500.2	37	c.116_115	CCDS34975.1	9																																																																																			-	NULL		0.668	FOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD4	protein_coding	OTTHUMT00000055433.1	-	NM_207305			118005	-1	no_errors	ENST00000382500	ensembl	human	known	74_37	in_frame_ins	INS	0.429:0.475	CCTCGTCTTCCA
COL18A1	80781	genome.wustl.edu	37	21	46888236	46888236	+	Missense_Mutation	SNP	G	G	A	rs377002382		TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr21:46888236G>A	ENST00000359759.4	+	2	1453	c.1432G>A	c.(1432-1434)Gac>Aac	p.D478N	COL18A1_ENST00000400337.2_Missense_Mutation_p.D63N|COL18A1_ENST00000355480.5_Missense_Mutation_p.D243N			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	478	Laminin G-like.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		GGATGACCCCGACGTCGGGCT	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		17164	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000182871	G	ASN/ASP,ASN/ASP	0,3970		0,0,1985	51.0	59.0	56.0		187,727	2.9	0.4	21		56	2,8304		0,2,4151	no	missense,missense	COL18A1	NM_130445.2,NM_030582.3	23,23	0,2,6136	AA,AG,GG		0.0241,0.0,0.0163	benign,benign	63/1340,243/1520	46888236	2,12274	1985	4153	6138	COL18A1	SO:0001583	missense	0			-	HGNC		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.1432G>A	21.37:g.46888236G>A	ENSP00000352798:p.Asp478Asn	Somatic	0	49	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	54	19.40	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	23	0.00	0	39	22.00	11	pfam_Collagenase_NC10/endostatin,pfam_DUF959_COL18_N,pfam_Collagen,pfam_Frizzled_dom,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl_sf,superfamily_Frizzled_dom,smart_Frizzled_dom,smart_Laminin_G,pfscan_Frizzled_dom	p.D478N	ENST00000359759.4	37	c.1432		21	.	.	.	.	.	.	.	.	.	.	G	9.365	1.069021	0.20147	0.0	2.41E-4	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645	T;T;T	0.02280	4.36;4.36;4.36	4.79	2.93	0.34026	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.755390	0.12396	N	0.472587	T	0.03011	0.0089	M	0.61703	1.905	0.29345	N	0.865753	B;B;B	0.33494	0.291;0.414;0.414	B;B;B	0.18263	0.014;0.021;0.021	T	0.19811	-1.0294	10	0.62326	D	0.03	.	8.7566	0.34650	0.0861:0.1583:0.7556:0.0	.	478;243;63	P39060;P39060-1;P39060-2	COIA1_HUMAN;.;.	N	63;63;243;478;478	ENSP00000383191:D63N;ENSP00000347665:D243N;ENSP00000352798:D478N	ENSP00000347665:D243N	D	+	1	0	COL18A1	45712664	0.997000	0.39634	0.397000	0.26308	0.019000	0.09904	2.758000	0.47565	0.524000	0.28502	0.655000	0.94253	GAC	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G		0.627	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	COL18A1	protein_coding	OTTHUMT00000206827.1	G		-		46888236	+1	no_errors	ENST00000359759	ensembl	human	known	74_37	missense	SNP	0.975	A
F13A1	2162	genome.wustl.edu	37	6	6174956	6174956	+	Missense_Mutation	SNP	T	T	A	rs151032137		TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr6:6174956T>A	ENST00000264870.3	-	12	1869	c.1604A>T	c.(1603-1605)aAg>aTg	p.K535M		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	535					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	GATGGAGAGCTTGAAGTCTTT	0.493																																																	0								ENSG00000124491						287.0	228.0	248.0					6																	6174956		2203	4300	6503	F13A1	SO:0001583	missense	0			-	HGNC	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.1604A>T	6.37:g.6174956T>A	ENSP00000264870:p.Lys535Met	Somatic	0	118	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	92	29.23	Q59HA7|Q8N6X2|Q96P24|Q9BX29	Missense_Mutation	SNP	22	0.00	0	30	40.00	20	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.K535M	ENST00000264870.3	37	c.1604	CCDS4496.1	6	.	.	.	.	.	.	.	.	.	.	T	12.79	2.045008	0.36085	.	.	ENSG00000124491	ENST00000264870;ENST00000441301	T	0.69435	-0.4	5.78	4.59	0.56863	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.162465	0.56097	D	0.000036	T	0.61937	0.2387	M	0.72479	2.2	0.43994	D	0.996696	P;P	0.52692	0.955;0.853	P;P	0.51516	0.662;0.672	T	0.63189	-0.6693	10	0.36615	T	0.2	.	11.3081	0.49347	0.0:0.0717:0.0:0.9283	.	472;535	F5H080;P00488	.;F13A_HUMAN	M	535;472	ENSP00000264870:K535M	ENSP00000264870:K535M	K	-	2	0	F13A1	6119955	0.998000	0.40836	0.895000	0.35142	0.270000	0.26580	1.185000	0.32065	0.972000	0.38314	0.523000	0.50628	AAG	-	pfam_Transglutaminase_C,superfamily_Transglutaminase_C		0.493	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F13A1	protein_coding	OTTHUMT00000039756.3	T	NM_000129	-		6174956	-1	no_errors	ENST00000264870	ensembl	human	known	74_37	missense	SNP	1.000	A
PYGM	5837	genome.wustl.edu	37	11	64518715	64518715	+	Intron	SNP	A	A	G			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr11:64518715A>G	ENST00000164139.3	-	16	2368				PYGM_ENST00000377432.3_Intron|PYGM_ENST00000462303.1_5'UTR	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle						carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AAGTACAAGTATCCCAGGAAG	0.547																																																	0								ENSG00000068976																																			PYGM	SO:0001627	intron_variant	0			-	HGNC		CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.1969+81T>C	11.37:g.64518715A>G		Somatic	0	9	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	12	45.45	A0AVK1|A6NDY6	RNA	SNP	15	57.14	20	32	31.91	15	-	NULL	ENST00000164139.3	37	NULL	CCDS8079.1	11																																																																																			-	-		0.547	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGM	protein_coding	OTTHUMT00000143254.2	A	NM_005609	-		64518715	-1	no_errors	ENST00000462303	ensembl	human	putative	74_37	rna	SNP	0.000	G
FAM87A	157693	genome.wustl.edu	37	8	327684	327684	+	lincRNA	SNP	A	A	G	rs372301088		TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr8:327684A>G	ENST00000330148.2	-	0	2777					NR_103537.1		P0C7U9	FA87A_HUMAN	family with sequence similarity 87, member A							integral component of membrane (GO:0016021)											cctggacacaactgcagagct	0.602																																																	0								ENSG00000182366																																			FAM87A			0			-	HGNC	BC037297		8p23.3	2013-02-15				ENSG00000182366		"""Long non-coding RNAs"""	27233	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_103537		Approved			P0C7U9			8.37:g.327684A>G		Somatic	0	26	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	21	19.23		RNA	SNP	27	3.57	1	27	6.90	2	-	NULL	ENST00000330148.2	37	NULL		8																																																																																			-	-		0.602	FAM87A-001	KNOWN	basic	lincRNA	FAM87A	lincRNA	OTTHUMT00000384563.2	A		-		327684	-1	no_errors	ENST00000330148	ensembl	human	known	74_37	rna	SNP	0.000	G
KRTAP4-5	85289	genome.wustl.edu	37	17	39305800	39305814	+	In_Frame_Del	DEL	TGGATTCACAGCAAT	TGGATTCACAGCAAT	-	rs141998775|rs377168597		TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	TGGATTCACAGCAAT	TGGATTCACAGCAAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr17:39305800_39305814delTGGATTCACAGCAAT	ENST00000343246.4	-	1	240_254	c.206_220delATTGCTGTGAATCCA	c.(205-222)tattgctgtgaatccagc>tgc	p.69_74YCCESS>C		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	69	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			cggcagcagctggattcacagcaataggggcggca	0.665																																																	0								ENSG00000198271																																			KRTAP4-5	SO:0001651	inframe_deletion	0				HGNC	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.206_220delATTGCTGTGAATCCA	17.37:g.39305800_39305814delTGGATTCACAGCAAT	ENSP00000340546:p.Tyr69_Ser74delinsCys	Somatic	NA	NA	NA		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Del	DEL	32	0.00	0	35	0.00	0	NULL	p.YCCESS69in_frame_delC	ENST00000343246.4	37	c.220_206	CCDS32650.1	17																																																																																			-	NULL		0.665	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-5	protein_coding	OTTHUMT00000257783.1	TGGATTCACAGCAAT				39305814	-1	no_errors	ENST00000343246	ensembl	human	known	74_37	in_frame_del	DEL	0.689:0.524:0.472:0.042:0.004:0.003:0.006:0.126:0.849:0.943:0.982:0.981:0.896:0.000:0.000	-
ZNF106	64397	genome.wustl.edu	37	15	42727686	42727686	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3U7-01A-11D-A29N-09	TCGA-DX-A3U7-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9e7b51fb-2249-451a-bf23-bb2a3d935928	d4b86f75-b56f-404f-b88d-20adf47e17dd	g.chr15:42727686G>T	ENST00000263805.4	-	11	5034	c.4708C>A	c.(4708-4710)Cat>Aat	p.H1570N	ZNF106_ENST00000565380.1_Missense_Mutation_p.H798N|ZNF106_ENST00000565611.1_Missense_Mutation_p.H755N	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	1570					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										TTGGAGGTATGACCCTCAAAG	0.428																																																	0								ENSG00000103994						140.0	132.0	135.0					15																	42727686		2203	4299	6502	ZNF106	SO:0001583	missense	0			-	HGNC	AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.4708C>A	15.37:g.42727686G>T	ENSP00000263805:p.His1570Asn	Somatic	0	33	0.00		0.6614207212423738	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	31	50.79	B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Missense_Mutation	SNP	36	0.00	0	32	53.62	37	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_Znf_C2H2-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.H1570N	ENST00000263805.4	37	c.4708	CCDS32208.1	15	.	.	.	.	.	.	.	.	.	.	G	23.6	4.434958	0.83885	.	.	ENSG00000103994	ENST00000263805;ENST00000434903	T	0.81078	-1.45	4.86	4.86	0.63082	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.051473	0.85682	D	0.000000	D	0.93409	0.7898	H	0.96889	3.9	0.80722	D	1	D;D;D	0.89917	0.997;1.0;0.999	D;D;D	0.91635	0.98;0.999;0.995	D	0.95556	0.8625	10	0.87932	D	0	-15.3849	18.191	0.89807	0.0:0.0:1.0:0.0	.	798;1570;798	E9PE29;Q9H2Y7;B4DZ40	.;ZF106_HUMAN;.	N	1570;798	ENSP00000263805:H1570N	ENSP00000263805:H1570N	H	-	1	0	ZFP106	40514978	1.000000	0.71417	0.990000	0.47175	0.798000	0.45092	9.069000	0.93967	2.524000	0.85096	0.655000	0.94253	CAT	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.428	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF106	protein_coding	OTTHUMT00000422587.1	G	NM_022473	-		42727686	-1	no_errors	ENST00000263805	ensembl	human	known	74_37	missense	SNP	1.000	T
