#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
LEO1	123169	genome.wustl.edu	37	15	52239560	52239560	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr15:52239560C>G	ENST00000299601.5	-	11	1885	c.1825G>C	c.(1825-1827)Gac>Cac	p.D609H	LEO1_ENST00000315141.5_Missense_Mutation_p.D549H	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	609					endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		TCATCACTGTCTGATGAATAG	0.403																																					Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)												0								ENSG00000166477						194.0	177.0	183.0					15																	52239560		2195	4293	6488	LEO1	SO:0001583	missense	0			-	HGNC	AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.1825G>C	15.37:g.52239560C>G	ENSP00000299601:p.Asp609His	Somatic	0	40	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	49	20.97	Q96N99	Missense_Mutation	SNP	15	0.00	0	38	19.15	9	pfam_Leo1	p.D609H	ENST00000299601.5	37	c.1825	CCDS10146.1	15	.	.	.	.	.	.	.	.	.	.	.	27.9	4.872133	0.91587	.	.	ENSG00000166477	ENST00000299601;ENST00000538386;ENST00000315141	.	.	.	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.79616	0.4476	M	0.71206	2.165	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.989;0.998	T	0.81274	-0.1007	9	0.87932	D	0	.	18.9711	0.92715	0.0:1.0:0.0:0.0	.	549;609	Q8WVC0-2;Q8WVC0	.;LEO1_HUMAN	H	609;587;549	.	ENSP00000299601:D609H	D	-	1	0	LEO1	50026852	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.593000	0.82686	2.596000	0.87737	0.555000	0.69702	GAC	-	pfam_Leo1		0.403	LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEO1	protein_coding	OTTHUMT00000254791.2	C	NM_138792	-		52239560	-1	no_errors	ENST00000299601	ensembl	human	known	74_37	missense	SNP	1.000	G
CXADRP3	440224	genome.wustl.edu	37	18	14479052	14479052	+	lincRNA	SNP	A	A	G			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr18:14479052A>G	ENST00000581457.1	-	0	856					NR_024076.1				coxsackie virus and adenovirus receptor pseudogene 3																		AGAATATAAAATCATCACTTG	0.393																																																	0								ENSG00000265766																																			CXADRP3			0			-	HGNC			18p11.21	2013-09-19			ENSG00000265766	ENSG00000265766			33974	pseudogene	pseudogene							Standard	NR_024076		Approved		uc010xai.2		OTTHUMG00000178700		18.37:g.14479052A>G		Somatic	0	35	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	19	24.00		RNA	SNP	33	0.00	0	42	25.00	14	-	NULL	ENST00000581457.1	37	NULL		18																																																																																			-	-		0.393	CXADRP3-001	KNOWN	basic	lincRNA	CXADRP3	lincRNA	OTTHUMT00000443008.1	A	NR_024076	-		14479052	-1	no_errors	ENST00000581457	ensembl	human	known	74_37	rna	SNP	0.999	G
HIST1H4C	8364	genome.wustl.edu	37	6	26104378	26104378	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr6:26104378G>C	ENST00000377803.2	+	1	275	c.203G>C	c.(202-204)cGa>cCa	p.R68P		NM_003542.3	NP_003533.1	P62805	H4_HUMAN	histone cluster 1, H4c	68					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.R68P(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)	7						AACGTTATTCGAGACGCCGTC	0.527																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000197061						74.0	66.0	69.0					6																	26104378		2203	4300	6503	HIST1H4C	SO:0001583	missense	0			-	HGNC	X60486	CCDS4583.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000197061	ENSG00000197061		"""Histones / Replication-dependent"""	4787	protein-coding gene	gene with protein product		602827	"""H4 histone family, member G"", ""histone 1, H4c"""	H4FG		9119399, 12408966	Standard	NM_003542		Approved	H4/g, dJ221C16.1	uc003ngi.3	P62805	OTTHUMG00000014429	ENST00000377803.2:c.203G>C	6.37:g.26104378G>C	ENSP00000367034:p.Arg68Pro	Somatic	0	43	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	30	18.92	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	38	0.00	0	40	14.89	7	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.R68P	ENST00000377803.2	37	c.203	CCDS4583.1	6	.	.	.	.	.	.	.	.	.	.	.	17.67	3.445966	0.63178	.	.	ENSG00000197061	ENST00000377803	T	0.69306	-0.39	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	T	0.75332	0.3835	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.78981	-0.1989	7	0.87932	D	0	.	16.8557	0.86005	0.0:0.0:1.0:0.0	.	.	.	.	P	68	ENSP00000367034:R68P	ENSP00000367034:R68P	R	+	2	0	HIST1H4C	26212357	1.000000	0.71417	1.000000	0.80357	0.008000	0.06430	9.657000	0.98554	2.533000	0.85409	0.555000	0.69702	CGA	-	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4		0.527	HIST1H4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4C	protein_coding	OTTHUMT00000040092.2	G	NM_003542	-		26104378	+1	no_errors	ENST00000377803	ensembl	human	known	74_37	missense	SNP	1.000	C
PLCE1	51196	genome.wustl.edu	37	10	96022444	96022444	+	Silent	SNP	C	C	T			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr10:96022444C>T	ENST00000371380.3	+	13	4243	c.4008C>T	c.(4006-4008)tgC>tgT	p.C1336C	PLCE1_ENST00000260766.3_Silent_p.C1336C|PLCE1_ENST00000371375.1_Silent_p.C1028C|PLCE1_ENST00000371385.3_Silent_p.C1028C			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	1336					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				TCGTGAATTGCCAAGGAGAAC	0.468																																																	0								ENSG00000138193						173.0	168.0	170.0					10																	96022444		2003	4178	6181	PLCE1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.4008C>T	10.37:g.96022444C>T		Somatic	0	48	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	53	37.65	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Silent	SNP	29	0.00	0	37	33.93	19	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_Ras-assoc,pfam_RasGRF_CDC25,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_Ras_GEF_dom,superfamily_C2_dom,smart_RasGRF_CDC25,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,smart_Ras-assoc,pfscan_C2_dom,pfscan_Ras-assoc,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,pfscan_RasGRF_CDC25,prints_Pinositol_PLipase_C	p.C1336	ENST00000371380.3	37	c.4008	CCDS41552.1	10																																																																																			-	pfam_PLipase_C_EF-hand-like		0.468	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCE1	protein_coding	OTTHUMT00000049469.3	C	NM_016341	-		96022444	+1	no_errors	ENST00000260766	ensembl	human	known	74_37	silent	SNP	1.000	T
ITGAL	3683	genome.wustl.edu	37	16	30490513	30490513	+	Silent	SNP	G	G	T			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr16:30490513G>T	ENST00000356798.6	+	5	609	c.429G>T	c.(427-429)ggG>ggT	p.G143G	ITGAL_ENST00000358164.5_Intron|ITGAL_ENST00000433423.2_Intron|ITGAL_ENST00000454514.2_Silent_p.G143G|RP11-297C4.3_ENST00000562525.1_RNA|RP11-297C4.2_ENST00000569459.1_RNA	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	143					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	TGCTGCAGGGGCGCCCTGGTT	0.557																																					NSCLC(110;1462 1641 3311 33990 49495)												0								ENSG00000005844						70.0	68.0	69.0					16																	30490513		2197	4300	6497	ITGAL	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.429G>T	16.37:g.30490513G>T		Somatic	0	49	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	48	25.00	O43746|Q45H73|Q96HB1|Q9UBC8	Silent	SNP	27	0.00	0	25	21.88	7	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.G143	ENST00000356798.6	37	c.429	CCDS32433.1	16																																																																																			-	NULL		0.557	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAL	protein_coding	OTTHUMT00000434508.2	G		-		30490513	+1	no_errors	ENST00000356798	ensembl	human	known	74_37	silent	SNP	0.000	T
UGCG	7357	genome.wustl.edu	37	9	114677047	114677051	+	Intron	DEL	TTTTG	TTTTG	-	rs371084650|rs542480646|rs73658008|rs368801835|rs140717465		TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	TTTTG	TTTTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr9:114677047_114677051delTTTTG	ENST00000374279.3	+	2	690				UGCG_ENST00000495085.1_Intron	NM_003358.1	NP_003349.1	Q16739	CEGT_HUMAN	UDP-glucose ceramide glucosyltransferase						epidermis development (GO:0008544)|glucosylceramide biosynthetic process (GO:0006679)|glycosphingolipid biosynthetic process (GO:0006688)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ceramide glucosyltransferase activity (GO:0008120)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|ovary(1)|urinary_tract(1)	12				OV - Ovarian serous cystadenocarcinoma(323;0.0433)	Miglustat(DB00419)	TGTTACGGTTttttgttttgttttg	0.337														2574	0.513978	0.6725	0.4885	5008	,	,		20824	0.5744		0.3857	False		,,,				2504	0.3875																0								ENSG00000148154																																			UGCG	SO:0001627	intron_variant	0				HGNC	D50840	CCDS6782.1	9q31	2014-03-13			ENSG00000148154	ENSG00000148154	2.4.1.80	"""Glycosyltransferase family 2 domain containing"""	12524	protein-coding gene	gene with protein product	"""glucosylceramide synthase"", ""ceramide glucosyltransferase"""	602874				8643456, 9605861	Standard	NM_003358		Approved	GCS	uc004bft.3	Q16739	OTTHUMG00000020498	ENST00000374279.3:c.240+21TTTTG>-	9.37:g.114677057_114677061delTTTTG		Somatic	NA	NA	NA		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5T258	RNA	DEL	40	0.00	0	52	0.00	0	-	NULL	ENST00000374279.3	37	NULL	CCDS6782.1	9																																																																																			-	-		0.337	UGCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGCG	protein_coding	OTTHUMT00000053661.1	TTTTG	NM_003358			114677051	+1	no_errors	ENST00000489355	ensembl	human	known	74_37	rna	DEL	0.000:0.002:0.000:0.000:0.000	-
PCDHGA9	56107	genome.wustl.edu	37	5	140784397	140784397	+	Silent	SNP	G	G	A			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr5:140784397G>A	ENST00000573521.1	+	1	1878	c.1878G>A	c.(1876-1878)gtG>gtA	p.V626V	PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_018921.2|NM_032089.1	NP_061744.1|NP_114478.1	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9	626	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGTGAAGTGCGCACAGCTC	0.612																																																	0								ENSG00000261934						43.0	50.0	48.0					5																	140784397		2185	4300	6485	PCDHGA9	SO:0001819	synonymous_variant	0			-	HGNC	AF152516	CCDS58981.1, CCDS75341.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8707	other	protocadherin		606296				10380929	Standard	NM_018921		Approved	PCDH-GAMMA-A9		Q9Y5G4		ENST00000573521.1:c.1878G>A	5.37:g.140784397G>A		Somatic	0	110	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	95	17.39	A2RU65|Q9Y5C9	Silent	SNP	33	0.00	0	43	15.69	8	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V626	ENST00000573521.1	37	c.1878	CCDS58981.1	5																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.612	PCDHGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA9	protein_coding	OTTHUMT00000437105.1	G	NM_018921	-		140784397	+1	no_errors	ENST00000573521	ensembl	human	known	74_37	silent	SNP	1.000	A
LRBA	987	genome.wustl.edu	37	4	151849733	151849733	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr4:151849733A>G	ENST00000357115.3	-	4	727	c.484T>C	c.(484-486)Tat>Cat	p.Y162H	LRBA_ENST00000510413.1_Missense_Mutation_p.Y162H|LRBA_ENST00000507224.1_Missense_Mutation_p.Y162H|LRBA_ENST00000535741.1_Missense_Mutation_p.Y162H	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	162						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					GTCAAATTATAGCTAGCCAGC	0.328																																																	0								ENSG00000198589						57.0	57.0	57.0					4																	151849733		2203	4300	6503	LRBA	SO:0001583	missense	0			-	HGNC	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.484T>C	4.37:g.151849733A>G	ENSP00000349629:p.Tyr162His	Somatic	0	24	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	27	15.62	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	37	0.00	0	52	16.13	10	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom	p.Y162H	ENST00000357115.3	37	c.484	CCDS3773.1	4	.	.	.	.	.	.	.	.	.	.	A	24.0	4.478924	0.84747	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	4.97	4.97	0.65823	.	0.180655	0.37669	N	0.001991	T	0.74959	0.3785	L	0.61036	1.89	0.80722	D	1	D;D;D	0.89917	0.999;0.998;1.0	D;D;D	0.87578	0.994;0.99;0.998	T	0.72633	-0.4234	10	0.26408	T	0.33	.	14.6786	0.69001	1.0:0.0:0.0:0.0	.	162;162;162	E9PEM5;P50851;P50851-2	.;LRBA_HUMAN;.	H	162	ENSP00000446299:Y162H;ENSP00000421552:Y162H;ENSP00000349629:Y162H;ENSP00000422180:Y162H	ENSP00000349629:Y162H	Y	-	1	0	LRBA	152069183	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.024000	0.93689	1.875000	0.54330	0.533000	0.62120	TAT	-	superfamily_ARM-type_fold		0.328	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	protein_coding	OTTHUMT00000364939.1	A		-		151849733	-1	no_errors	ENST00000357115	ensembl	human	known	74_37	missense	SNP	1.000	G
NCAM1	4684	genome.wustl.edu	37	11	113144349	113144349	+	Intron	SNP	G	G	C			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr11:113144349G>C	ENST00000397957.4	+	20	2667				NCAM1-AS1_ENST00000533638.1_RNA|NCAM1-AS1_ENST00000526229.1_RNA|NCAM1_ENST00000316851.7_Intron			P13591	NCAM1_HUMAN	neural cell adhesion molecule 1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		TATTGACCTTGCAAAGGATGT	0.582																																																	0								ENSG00000227487																																			NCAM1-AS1	SO:0001627	intron_variant	0			-	HGNC		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000397957.4:c.2668-1640G>C	11.37:g.113144349G>C		Somatic	0	24	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	27	15.62	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	RNA	SNP	24	0.00	0	30	26.83	11	-	NULL	ENST00000397957.4	37	NULL		11																																																																																			-	-		0.582	NCAM1-001	KNOWN	basic	processed_transcript	NCAM1-AS1	protein_coding	OTTHUMT00000393677.2	G	NM_000615	-		113144349	-1	no_errors	ENST00000526229	ensembl	human	known	74_37	rna	SNP	1.000	C
MCC	4163	genome.wustl.edu	37	5	112389545	112389545	+	Silent	SNP	C	C	T			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr5:112389545C>T	ENST00000302475.4	-	13	2318	c.1755G>A	c.(1753-1755)ctG>ctA	p.L585L	MCC_ENST00000408903.3_Silent_p.L775L|MCC_ENST00000514701.3_5'UTR|MCC_ENST00000515367.2_Silent_p.L522L	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	585					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		CCAGCATGGTCAGCTTGACCG	0.537																																																	0								ENSG00000171444						113.0	100.0	105.0					5																	112389545		2202	4300	6502	MCC	SO:0001819	synonymous_variant	0			-	HGNC		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.1755G>A	5.37:g.112389545C>T		Somatic	0	45	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	41	34.92	D3DT05|Q6ZR04	Silent	SNP	29	0.00	0	33	46.77	29	pfam_USH1C-bd_PDZ_domain,superfamily_tRNA-bd_arm	p.L585	ENST00000302475.4	37	c.1755	CCDS4111.1	5																																																																																			-	NULL		0.537	MCC-001	KNOWN	basic|CCDS	protein_coding	MCC	protein_coding	OTTHUMT00000250736.3	C	NM_001085377	-		112389545	-1	no_errors	ENST00000302475	ensembl	human	known	74_37	silent	SNP	1.000	T
PRLHR	2834	genome.wustl.edu	37	10	120354681	120354681	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr10:120354681C>T	ENST00000369169.1	-	1	75	c.76G>A	c.(76-78)Gcc>Acc	p.A26T	PRLHR_ENST00000239032.2_Missense_Mutation_p.A26T			P49683	PRLHR_HUMAN	prolactin releasing hormone receptor	26					feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone metabolic process (GO:0042445)|neuropeptide signaling pathway (GO:0007218)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)|neuropeptide Y receptor activity (GO:0004983)			large_intestine(2)|lung(8)|ovary(1)|skin(1)	12		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		CTCTGGTTGGCGGGAGTTGTG	0.647																																																	0								ENSG00000119973						24.0	31.0	29.0					10																	120354681		2164	4254	6418	PRLHR	SO:0001583	missense	0			-	HGNC	AB048946	CCDS7606.1	10q25.3-q26	2014-02-21	2005-11-24	2005-11-24	ENSG00000119973	ENSG00000119973		"""GPCR / Class A : RF amide peptide receptors"""	4464	protein-coding gene	gene with protein product		600895	"""G protein-coupled receptor 10"""	GPR10		8666380, 15885496	Standard	NM_004248		Approved	PrRPR	uc001ldp.1	P49683	OTTHUMG00000019136	ENST00000369169.1:c.76G>A	10.37:g.120354681C>T	ENSP00000358167:p.Ala26Thr	Somatic	0	58	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	56	16.18	O75194|Q502U8|Q5VXR9	Missense_Mutation	SNP	21	0.00	0	36	24.49	12	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Prolrel_pep_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.A26T	ENST00000369169.1	37	c.76	CCDS7606.1	10	.	.	.	.	.	.	.	.	.	.	C	9.021	0.984950	0.18889	.	.	ENSG00000119973	ENST00000239032;ENST00000369169	T;T	0.61980	0.06;0.06	4.56	3.63	0.41609	.	1.235040	0.06032	N	0.653199	T	0.40040	0.1101	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.21586	-1.0241	10	0.14656	T	0.56	.	7.4681	0.27332	0.0:0.8176:0.0:0.1824	.	26	P49683	PRLHR_HUMAN	T	26	ENSP00000239032:A26T;ENSP00000358167:A26T	ENSP00000239032:A26T	A	-	1	0	PRLHR	120344671	0.420000	0.25457	0.539000	0.28077	0.218000	0.24690	0.753000	0.26376	2.376000	0.81061	0.650000	0.86243	GCC	-	prints_Prolrel_pep_rcpt		0.647	PRLHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLHR	protein_coding	OTTHUMT00000050610.1	C	NM_004248	-		120354681	-1	no_errors	ENST00000239032	ensembl	human	known	74_37	missense	SNP	0.014	T
MICA	100507436	genome.wustl.edu	37	6	31380161	31380161	+	Frame_Shift_Del	DEL	G	G	-	rs41293539|rs547446871|rs138201170	byFrequency	TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr6:31380161delG	ENST00000449934.2	+	5	1006	c.952delG	c.(952-954)ggcfs	p.G318fs	HCP5_ENST00000414046.2_RNA	NM_001177519.1	NP_001170990.1			MHC class I polypeptide-related sequence A											breast(1)|endometrium(3)|kidney(1)	5		Ovarian(999;0.0253)				TGTTGCTGCTGGCTGCTGCTA	0.453													?|GG|G|unsure	1026	0.204872	0.0537	0.2824	5008	,	,		19280	0.3869		0.1272	False		,,,				2504	0.2464																0								ENSG00000204520						218.0	178.0	190.0					6																	31380161		692	1576	2268	MICA	SO:0001589	frameshift_variant	0				HGNC	L14848	CCDS56412.1, CCDS75421.1	6p21.3	2013-01-11			ENSG00000204520	ENSG00000204520		"""Immunoglobulin superfamily / C1-set domain containing"""	7090	protein-coding gene	gene with protein product		600169				8022771	Standard	NM_000247		Approved	PERB11.1	uc003ntk.1	Q29983	OTTHUMG00000031073	ENST00000449934.2:c.952delG	6.37:g.31380161delG	ENSP00000413079:p.Gly318fs	Somatic	0	27	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	30	18.92		Frame_Shift_Del	DEL	19	0.00	0	21	0.00	0	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.G318fs	ENST00000449934.2	37	c.952	CCDS56412.1	6																																																																																			-	NULL		0.453	MICA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	MICA	protein_coding	OTTHUMT00000076101.7	G	NM_001177519			31380161	+1	no_errors	ENST00000449934	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
RNASEL	6041	genome.wustl.edu	37	1	182544665	182544665	+	Silent	SNP	A	A	G			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr1:182544665A>G	ENST00000367559.3	-	7	2341	c.2088T>C	c.(2086-2088)ttT>ttC	p.F696F	RNASEL_ENST00000444138.1_Silent_p.F696F	NM_021133.3	NP_066956.1	Q05823	RN5A_HUMAN	ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)	696	KEN. {ECO:0000255|PROSITE- ProRule:PRU00725}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mRNA processing (GO:0006397)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(1)	27						CCAGATCTGGAAATGTCTTCT	0.398																																																	0								ENSG00000135828						115.0	108.0	110.0					1																	182544665		2203	4300	6503	RNASEL	SO:0001819	synonymous_variant	0			-	HGNC	L10381	CCDS1347.1	1q25	2013-01-10			ENSG00000135828	ENSG00000135828	3.1.26.-	"""Ankyrin repeat domain containing"""	10050	protein-coding gene	gene with protein product		180435	"""prostate cancer 1"""	RNS4, PRCA1		7514564	Standard	NM_021133		Approved		uc009wxz.2	Q05823	OTTHUMG00000035213	ENST00000367559.3:c.2088T>C	1.37:g.182544665A>G		Somatic	0	88	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	69	18.82	Q5W0L2|Q6AI46	Silent	SNP	45	0.00	0	53	25.35	18	pfam_Ankyrin_rpt,pfam_KEN_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_PUG-dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt	p.F696	ENST00000367559.3	37	c.2088	CCDS1347.1	1																																																																																			-	pfam_KEN_dom,smart_PUG-dom		0.398	RNASEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEL	protein_coding	OTTHUMT00000085189.1	A	NM_021133	-		182544665	-1	no_errors	ENST00000367559	ensembl	human	known	74_37	silent	SNP	1.000	G
RNASEL	6041	genome.wustl.edu	37	1	182549124	182549124	+	Intron	SNP	T	T	C			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr1:182549124T>C	ENST00000367559.3	-	5	2159				RNASEL_ENST00000444138.1_Intron|RNASEL_ENST00000539397.1_Missense_Mutation_p.R642G	NM_021133.3	NP_066956.1	Q05823	RN5A_HUMAN	ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)						cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mRNA processing (GO:0006397)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(1)	27						attatttgtctgtgcctcagc	0.433																																																	0								ENSG00000135828																																			RNASEL	SO:0001627	intron_variant	0			-	HGNC	L10381	CCDS1347.1	1q25	2013-01-10			ENSG00000135828	ENSG00000135828	3.1.26.-	"""Ankyrin repeat domain containing"""	10050	protein-coding gene	gene with protein product		180435	"""prostate cancer 1"""	RNS4, PRCA1		7514564	Standard	NM_021133		Approved		uc009wxz.2	Q05823	OTTHUMG00000035213	ENST00000367559.3:c.1905+1235A>G	1.37:g.182549124T>C		Somatic	0	93	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	73	21.51	Q5W0L2|Q6AI46	Missense_Mutation	SNP	36	0.00	0	51	17.74	11	pfam_Ankyrin_rpt,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KEN_dom,pfam_LipoPS_kinase,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt	p.R642G	ENST00000367559.3	37	c.1924	CCDS1347.1	1	.	.	.	.	.	.	.	.	.	.	T	10.12	1.263830	0.23136	.	.	ENSG00000135828	ENST00000539397	T	0.32272	1.46	2.61	1.4	0.22301	.	.	.	.	.	T	0.42200	0.1192	.	.	.	0.09310	N	1	D	0.69078	0.997	D	0.81914	0.995	T	0.19679	-1.0298	8	0.28530	T	0.3	.	4.7446	0.13031	0.2788:0.0:0.0:0.7212	.	642	Q6AI46	.	G	642	ENSP00000440844:R642G	ENSP00000440844:R642G	R	-	1	2	RNASEL	180815747	0.271000	0.24162	0.092000	0.20876	0.229000	0.25112	0.832000	0.27490	0.385000	0.24970	0.482000	0.46254	AGA	-	NULL		0.433	RNASEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEL	protein_coding	OTTHUMT00000085189.1	T	NM_021133	-		182549124	-1	no_errors	ENST00000539397	ensembl	human	known	74_37	missense	SNP	0.107	C
BBS9	27241	genome.wustl.edu	37	7	33397493	33397493	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr7:33397493T>G	ENST00000242067.6	+	16	2100	c.1579T>G	c.(1579-1581)Ttt>Gtt	p.F527V	BBS9_ENST00000396127.2_Missense_Mutation_p.F492V|BBS9_ENST00000355070.2_Missense_Mutation_p.F522V|BBS9_ENST00000354265.4_Missense_Mutation_p.F492V|BBS9_ENST00000350941.3_Missense_Mutation_p.F487V	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	527					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			CCAATGTAAATTTAGACTTCC	0.333									Bardet-Biedl syndrome																																								0								ENSG00000122507						106.0	113.0	110.0					7																	33397493		2203	4299	6502	BBS9	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	-	HGNC		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.1579T>G	7.37:g.33397493T>G	ENSP00000242067:p.Phe527Val	Somatic	0	31	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	45	0.00	0	33	21.43	9	NULL	p.F527V	ENST00000242067.6	37	c.1579	CCDS43566.1	7	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	11.66|11.66|11.66	1.705951|1.705951|1.705951	0.30232|0.30232|0.30232	.|.|.	.|.|.	ENSG00000122507|ENSG00000122507|ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132|ENST00000434373|ENST00000537775	T;T;T;T;T|.|.	0.09255|.|.	3.0;3.0;3.0;3.0;3.0|.|.	5.94|5.94|5.94	5.94|5.94|5.94	0.96194|0.96194|0.96194	.|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|T	0.47783|0.47783|0.47783	0.1464|0.1464|0.1464	L|L|L	0.28344|0.28344|0.28344	0.845|0.845|0.845	0.80722|0.80722|0.80722	D|D|D	1|1|1	B;B;B;B;B|.|.	0.10296|.|.	0.001;0.001;0.001;0.003;0.001|.|.	B;B;B;B;B|.|.	0.20184|.|.	0.021;0.028;0.011;0.028;0.011|.|.	T|T|T	0.41016|0.41016|0.41016	-0.9532|-0.9532|-0.9532	10|5|6	0.02654|.|0.02654	T|.|T	1|.|1	-28.7424|-28.7424|-28.7424	16.0762|16.0762|16.0762	0.80969|0.80969|0.80969	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	527;487;522;492;527|.|.	Q3SYG4-3;Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4|.|.	.;.;.;.;PTHB1_HUMAN|.|.	V|S|K	527;487;492;522;492;527|93|404	ENSP00000242067:F527V;ENSP00000313122:F487V;ENSP00000379433:F492V;ENSP00000347182:F522V;ENSP00000346214:F492V|.|.	ENSP00000242067:F527V|.|ENSP00000441763:N404K	F|I|N	+|+|+	1|2|3	0|0|2	BBS9|BBS9|BBS9	33364018|33364018|33364018	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	5.996000|5.996000|5.996000	0.70639|0.70639|0.70639	2.278000|2.278000|2.278000	0.76064|0.76064|0.76064	0.523000|0.523000|0.523000	0.50628|0.50628|0.50628	TTT|ATT|AAT	-	NULL		0.333	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BBS9	protein_coding	OTTHUMT00000329064.1	T		-		33397493	+1	no_errors	ENST00000242067	ensembl	human	known	74_37	missense	SNP	1.000	G
LIG4	3981	genome.wustl.edu	37	13	108862125	108862125	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr13:108862125A>G	ENST00000356922.4	-	2	1764	c.1492T>C	c.(1492-1494)Tct>Cct	p.S498P	LIG4_ENST00000405925.1_Missense_Mutation_p.S498P|LIG4_ENST00000442234.1_Missense_Mutation_p.S498P	NM_002312.3|NM_206937.1	NP_002303.2|NP_996820.1	P49917	DNLI4_HUMAN	ligase IV, DNA, ATP-dependent	498					cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|chromosome organization (GO:0051276)|DNA biosynthetic process (GO:0071897)|DNA ligation (GO:0006266)|DNA ligation involved in DNA recombination (GO:0051102)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|lagging strand elongation (GO:0006273)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|single strand break repair (GO:0000012)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|focal adhesion (GO:0005925)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					TGAAACACAGATGGCTTCTCA	0.458								Non-homologous end-joining																																									0								ENSG00000174405						133.0	136.0	135.0					13																	108862125		2203	4300	6503	LIG4	SO:0001583	missense	0			-	HGNC	X83441	CCDS9508.1	13q33-q34	2014-09-17			ENSG00000174405	ENSG00000174405	6.5.1.1		6601	protein-coding gene	gene with protein product	"""polydeoxyribonucleotide synthase [ATP] 4"", ""polynucleotide ligase"", ""sealase"", ""DNA repair enzyme"", ""DNA joinase"""	601837				7760816	Standard	NM_001098268		Approved		uc001vqo.3	P49917	OTTHUMG00000017328	ENST00000356922.4:c.1492T>C	13.37:g.108862125A>G	ENSP00000349393:p.Ser498Pro	Somatic	0	27	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	Q8IY66|Q8TEU5	Missense_Mutation	SNP	23	0.00	0	34	32.00	16	pfam_DNA_ligase_ATP-dep_cent,pfam_DNA_ligase_ATP-dep_N,pfam_DNA_ligase_IV,pfam_BRCT_dom,pfam_DNA_ligase_ATP-dep_C,superfamily_NA-bd_OB-fold,superfamily_BRCT_dom,superfamily_DNA_ligase_ATP-dep_N,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	p.S498P	ENST00000356922.4	37	c.1492	CCDS9508.1	13	.	.	.	.	.	.	.	.	.	.	A	9.078	0.998626	0.19121	.	.	ENSG00000174405	ENST00000405925;ENST00000442234;ENST00000356922	T;T;T	0.63255	-0.03;-0.03;-0.03	5.06	3.85	0.44370	DNA ligase, ATP-dependent, C-terminal (1);Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.118767	0.64402	D	0.000015	T	0.49541	0.1563	L	0.35793	1.09	0.41166	D	0.986138	B	0.12013	0.005	B	0.19666	0.026	T	0.39901	-0.9591	10	0.33940	T	0.23	.	9.2792	0.37718	0.696:0.0:0.0:0.304	.	498	P49917	DNLI4_HUMAN	P	498	ENSP00000385955:S498P;ENSP00000402030:S498P;ENSP00000349393:S498P	ENSP00000349393:S498P	S	-	1	0	LIG4	107660126	0.779000	0.28652	0.725000	0.30721	0.968000	0.65278	1.583000	0.36579	0.830000	0.34757	0.450000	0.29827	TCT	-	pfam_DNA_ligase_ATP-dep_C,superfamily_NA-bd_OB-fold,tigrfam_DNA_ligase_ATP-dep		0.458	LIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG4	protein_coding	OTTHUMT00000045738.4	A	NM_002312	-		108862125	-1	no_errors	ENST00000356922	ensembl	human	known	74_37	missense	SNP	0.644	G
PIEZO2	63895	genome.wustl.edu	37	18	10773521	10773521	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr18:10773521G>T	ENST00000503781.3	-	18	2598	c.2599C>A	c.(2599-2601)Ctt>Att	p.L867I	PIEZO2_ENST00000580640.1_Missense_Mutation_p.L892I|PIEZO2_ENST00000302079.6_Missense_Mutation_p.L867I|PIEZO2_ENST00000383408.2_Missense_Mutation_p.L155I	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	867	Glu-rich.				cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										TAGCCCTCAAGCTTCTCCTCC	0.592																																																	0								ENSG00000154864						80.0	70.0	73.0					18																	10773521		692	1591	2283	PIEZO2	SO:0001583	missense	0			-	HGNC	AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.2599C>A	18.37:g.10773521G>T	ENSP00000421377:p.Leu867Ile	Somatic	0	18	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	22	18.52	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Missense_Mutation	SNP	24	0.00	0	41	19.61	10	NULL	p.L881I	ENST00000503781.3	37	c.2641		18	.	.	.	.	.	.	.	.	.	.	G	7.253	0.603618	0.14002	.	.	ENSG00000154864	ENST00000302079;ENST00000383408	T;T	0.76839	-1.05;-1.05	5.5	-1.46	0.08800	.	7.370860	0.02223	U	0.064186	T	0.51143	0.1657	N	0.02011	-0.69	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.44390	-0.9331	10	0.33141	T	0.24	.	4.0107	0.09621	0.0766:0.1855:0.2072:0.5307	.	892	Q9H5I5-4	.	I	867;155	ENSP00000303316:L867I;ENSP00000372900:L155I	ENSP00000303316:L867I	L	-	1	0	FAM38B	10763521	0.001000	0.12720	0.000000	0.03702	0.372000	0.29890	0.789000	0.26886	-0.007000	0.14345	0.591000	0.81541	CTT	-	NULL		0.592	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	PIEZO2	protein_coding	OTTHUMT00000442385.4	G	NM_022068	-		10773521	-1	no_errors	ENST00000582913	ensembl	human	known	74_37	missense	SNP	0.000	T
PLXDC1	57125	genome.wustl.edu	37	17	37226190	37226190	+	Silent	SNP	G	G	A			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr17:37226190G>A	ENST00000315392.4	-	13	1513	c.1302C>T	c.(1300-1302)gtC>gtT	p.V434V	PLXDC1_ENST00000444911.2_Silent_p.V394V|PLXDC1_ENST00000539608.1_3'UTR|PLXDC1_ENST00000493200.1_5'UTR|CTD-2206N4.4_ENST00000583447.1_RNA	NM_020405.4	NP_065138.2	Q8IUK5	PLDX1_HUMAN	plexin domain containing 1	434					angiogenesis (GO:0001525)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)	receptor activity (GO:0004872)			kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						CCACGAGGAGGACTGCCAGCA	0.582											OREG0024368	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000161381						114.0	96.0	102.0					17																	37226190		2203	4300	6503	PLXDC1	SO:0001819	synonymous_variant	0			-	HGNC	AF279144	CCDS11333.1	17q21.1	2006-04-12			ENSG00000161381	ENSG00000161381			20945	protein-coding gene	gene with protein product	"""tumor endothelial marker 7 precursor"""	606826				10947988, 11559528	Standard	NM_020405		Approved	TEM3, TEM7	uc002hrg.2	Q8IUK5	OTTHUMG00000133183	ENST00000315392.4:c.1302C>T	17.37:g.37226190G>A		Somatic	0	50	0.00	869	0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	37	17.78	B2R7I8|Q5QCZ7|Q5QCZ8|Q5QCZ9|Q9HCT9	Silent	SNP	26	0.00	0	31	26.19	11	pfam_Plexin_repeat,superfamily_Plexin-like_fold	p.V434	ENST00000315392.4	37	c.1302	CCDS11333.1	17																																																																																			-	NULL		0.582	PLXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXDC1	protein_coding	OTTHUMT00000256892.2	G	NM_020405	-		37226190	-1	no_errors	ENST00000315392	ensembl	human	known	74_37	silent	SNP	0.938	A
GPR158	57512	genome.wustl.edu	37	10	25890212	25890212	+	3'UTR	SNP	T	T	C			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr10:25890212T>C	ENST00000376351.3	+	0	6016				GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158						protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						ATTACTCAGGTTGGTGGGGTC	0.373																																																	0								ENSG00000151025																																			GPR158	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.*2009T>C	10.37:g.25890212T>C		Somatic	0	50	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	54	34.94	Q6QR81|Q9ULT3	RNA	SNP	37	0.00	0	49	24.62	16	-	NULL	ENST00000376351.3	37	NULL	CCDS31166.1	10																																																																																			-	-		0.373	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	protein_coding	OTTHUMT00000047248.2	T	XM_166110	-		25890212	+1	no_errors	ENST00000490549	ensembl	human	known	74_37	rna	SNP	1.000	C
HHLA3	11147	genome.wustl.edu	37	1	70820566	70820566	+	5'UTR	SNP	G	G	A	rs191179772		TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr1:70820566G>A	ENST00000359875.5	+	0	72				HHLA3_ENST00000370940.5_5'UTR|HHLA3_ENST00000486110.1_3'UTR|HHLA3_ENST00000531950.1_5'UTR|ANKRD13C_ENST00000370944.4_5'Flank|HHLA3_ENST00000361764.4_5'UTR|HHLA3_ENST00000432224.1_5'Flank|ANKRD13C_ENST00000262346.6_5'Flank	NM_001036645.1	NP_001031722.1	Q9XRX5	HHLA3_HUMAN	HERV-H LTR-associating 3											large_intestine(3)|lung(1)	4						GCTGCCAGCCGACCCCGAACC	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		15332	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000197568																																			HHLA3	SO:0001623	5_prime_UTR_variant	0			GMAF=0.0005	HGNC	AF126164	CCDS649.1, CCDS30752.1, CCDS30753.1	1p31.1	2008-02-05			ENSG00000197568	ENSG00000197568			4906	protein-coding gene	gene with protein product		604372				10444326	Standard	NR_027404		Approved		uc001dfa.3	Q9XRX5	OTTHUMG00000009346	ENST00000359875.5:c.-69G>A	1.37:g.70820566G>A		Somatic	0	27	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	22	21.43	D3DQ74|Q5VZP2|Q96FH5|Q9XRX4	RNA	SNP	12	0.00	0	30	21.05	8	-	NULL	ENST00000359875.5	37	NULL	CCDS30753.1	1																																																																																			-	-		0.607	HHLA3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	HHLA3	protein_coding	OTTHUMT00000025911.2	G	NM_007071	rs191179772		70820566	+1	no_errors	ENST00000486110	ensembl	human	putative	74_37	rna	SNP	0.000	A
SHISA2	387914	genome.wustl.edu	37	13	26621170	26621170	+	Silent	SNP	G	G	A	rs139266835	byFrequency	TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr13:26621170G>A	ENST00000319420.3	-	2	424	c.369C>T	c.(367-369)tcC>tcT	p.S123S		NM_001007538.1	NP_001007539.1	Q6UWI4	SHSA2_HUMAN	shisa family member 2	123					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)|skin(1)	17						CGACAAACACGGAGCCAACAA	0.547																																																	0								ENSG00000180730	A		6,4400	11.4+/-27.6	0,6,2197	86.0	70.0	75.0		369	-9.4	0.2	13	dbSNP_134	75	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SHISA2	NM_001007538.1		0,7,6496	AA,AG,GG		0.0116,0.1362,0.0538		123/296	26621170	7,12999	2203	4300	6503	SHISA2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS31951.1	13q12.13	2013-07-31	2013-07-31	2008-04-01	ENSG00000180730	ENSG00000180730		"""Shisa homologs"""	20366	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 13"", ""transmembrane protein 46"", ""shisa homolog 2 (Xenopus laevis)"""	C13orf13, TMEM46			Standard	NM_001007538		Approved	bA398O19.2, PRO28631, WGAR9166, hShisa	uc001uqm.1	Q6UWI4	OTTHUMG00000016612	ENST00000319420.3:c.369C>T	13.37:g.26621170G>A		Somatic	0	22	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	15	28.57	B9EH70|Q5W0G8	Silent	SNP	35	0.00	0	32	21.95	9	NULL	p.S123	ENST00000319420.3	37	c.369	CCDS31951.1	13																																																																																			-	NULL		0.547	SHISA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHISA2	protein_coding	OTTHUMT00000044239.2	G	NM_001007538	rs139266835		26621170	-1	no_errors	ENST00000319420	ensembl	human	known	74_37	silent	SNP	0.001	A
WNK1	65125	genome.wustl.edu	37	12	970296	970297	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr12:970296_970297insA	ENST00000315939.6	+	7	2381_2382	c.1738_1739insA	c.(1738-1740)gaafs	p.E580fs	WNK1_ENST00000340908.4_Frame_Shift_Ins_p.E173fs|WNK1_ENST00000535572.1_Frame_Shift_Ins_p.E580fs|WNK1_ENST00000530271.2_Frame_Shift_Ins_p.E580fs|WNK1_ENST00000540360.1_3'UTR|WNK1_ENST00000537687.1_Frame_Shift_Ins_p.E580fs	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	580					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			GGAGGAGCAAGAAAAAAAAAAG	0.47																																					Colon(19;451 567 6672 12618 28860)												1	Unknown(1)	skin(1)						ENSG00000060237																																			WNK1	SO:0001589	frameshift_variant	0				HGNC	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.1748dupA	12.37:g.970306_970306dupA	ENSP00000313059:p.Glu580fs	Somatic	0	21	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Frame_Shift_Ins	INS	22	0.00	0	35	2.78	1	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K584fs	ENST00000315939.6	37	c.1738_1739	CCDS8506.1	12																																																																																			-	NULL		0.470	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	protein_coding	OTTHUMT00000206683.1	-	NM_018979			970297	+1	no_errors	ENST00000530271	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
SIPA1L1	26037	genome.wustl.edu	37	14	72055964	72055964	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr14:72055964G>A	ENST00000555818.1	+	2	1723	c.1375G>A	c.(1375-1377)Gga>Aga	p.G459R	SIPA1L1_ENST00000381232.3_Missense_Mutation_p.G459R|SIPA1L1_ENST00000358550.2_Missense_Mutation_p.G459R	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	459					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		CACAAATGCAGGAGTGGCAGT	0.443																																																	0								ENSG00000197555						93.0	85.0	88.0					14																	72055964		2203	4300	6503	SIPA1L1	SO:0001583	missense	0			-	HGNC	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.1375G>A	14.37:g.72055964G>A	ENSP00000450832:p.Gly459Arg	Somatic	0	34	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	25	30.56	J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	13	0.00	0	42	20.75	11	pfam_DUF3401,pfam_Rap_GAP_dom,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.G459R	ENST00000555818.1	37	c.1375	CCDS9807.1	14	.	.	.	.	.	.	.	.	.	.	G	24.5	4.535451	0.85812	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550	T;T;T	0.80480	-1.38;-1.36;-1.38	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.91202	0.7228	M	0.83012	2.62	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.965;0.998;0.96	D	0.91169	0.4967	10	0.87932	D	0	-24.28	20.6593	0.99626	0.0:0.0:1.0:0.0	.	459;459;459	A6H8W6;O43166-2;O43166	.;.;SI1L1_HUMAN	R	459	ENSP00000370630:G459R;ENSP00000450832:G459R;ENSP00000351352:G459R	ENSP00000351352:G459R	G	+	1	0	SIPA1L1	71125717	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	9.869000	0.99810	2.885000	0.99019	0.655000	0.94253	GGA	-	NULL		0.443	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIPA1L1	protein_coding	OTTHUMT00000412806.1	G	NM_015556	-		72055964	+1	no_errors	ENST00000555818	ensembl	human	known	74_37	missense	SNP	1.000	A
KIAA1109	84162	genome.wustl.edu	37	4	123245583	123245583	+	Splice_Site	SNP	C	C	A			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr4:123245583C>A	ENST00000264501.4	+	64	11169	c.10796C>A	c.(10795-10797)gCt>gAt	p.A3599D	KIAA1109_ENST00000388738.3_Splice_Site_p.A3599D|KIAA1109_ENST00000455637.1_Splice_Site_p.A3599D			Q2LD37	K1109_HUMAN	KIAA1109	3599					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TTTTGTTAGGCTGCTTCCCTA	0.348																																																	0								ENSG00000138688						88.0	78.0	81.0					4																	123245583		1828	4084	5912	KIAA1109	SO:0001630	splice_region_variant	0			-	HGNC	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.10795-1C>A	4.37:g.123245583C>A		Somatic	0	31	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	44	0.00	0	29	17.14	6	pfam_Fragile_site-assoc_C	p.A3599D	ENST00000264501.4	37	c.10796	CCDS43267.1	4	.	.	.	.	.	.	.	.	.	.	C	29.3	4.995212	0.93167	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637;ENST00000438707	T;T;T;T	0.35421	2.3;2.3;1.72;1.31	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000002	T	0.58278	0.2111	L	0.53249	1.67	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.994	T	0.57688	-0.7768	10	0.62326	D	0.03	.	19.6536	0.95828	0.0:1.0:0.0:0.0	.	3599;3599	Q2LD37-6;Q2LD37	.;K1109_HUMAN	D	3599;3599;3599;282	ENSP00000264501:A3599D;ENSP00000373390:A3599D;ENSP00000389925:A3599D;ENSP00000410874:A282D	ENSP00000264501:A3599D	A	+	2	0	KIAA1109	123465033	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.424000	0.80242	2.631000	0.89168	0.655000	0.94253	GCT	-	NULL		0.348	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	protein_coding	OTTHUMT00000316415.1	C	NM_020797	-	Missense_Mutation	123245583	+1	no_errors	ENST00000264501	ensembl	human	known	74_37	missense	SNP	1.000	A
GUCY1A3	2982	genome.wustl.edu	37	4	156643228	156643228	+	Silent	SNP	C	C	T	rs571318059		TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr4:156643228C>T	ENST00000296518.7	+	9	1964	c.1755C>T	c.(1753-1755)ggC>ggT	p.G585G	GUCY1A3_ENST00000511507.1_Silent_p.G585G|GUCY1A3_ENST00000506455.1_Silent_p.G585G|GUCY1A3_ENST00000393832.3_Silent_p.G327G|GUCY1A3_ENST00000455639.2_Silent_p.G585G|GUCY1A3_ENST00000511108.1_Silent_p.G585G|GUCY1A3_ENST00000513574.1_Silent_p.G585G			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	585	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		TTTTTGCTGGCGTCGTTGGAG	0.423													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18351	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000164116						277.0	264.0	268.0					4																	156643228		2203	4300	6503	GUCY1A3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.1755C>T	4.37:g.156643228C>T		Somatic	0	70	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	60	17.81	D3DP19|D6RDW3|O43843|Q8TAH3	Silent	SNP	28	0.00	0	31	26.19	11	pfam_A/G_cyclase,pfam_Haem_no_assoc-bd,pfam_Heme_NO-bd,superfamily_A/G_cyclase,superfamily_NO_sig/Golgi_transp_ligand-bd,smart_A/G_cyclase,pfscan_A/G_cyclase	p.G585	ENST00000296518.7	37	c.1755	CCDS34085.1	4																																																																																			-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase		0.423	GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GUCY1A3	protein_coding	OTTHUMT00000365786.2	C		-		156643228	+1	no_errors	ENST00000296518	ensembl	human	known	74_37	silent	SNP	0.985	T
ZNF705G	100131980	genome.wustl.edu	37	8	7215694	7215694	+	Missense_Mutation	SNP	A	A	G	rs9693671	byFrequency	TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr8:7215694A>G	ENST00000400156.4	-	7	988	c.707T>C	c.(706-708)gTc>gCc	p.V236A	FAM66B_ENST00000606573.1_lincRNA|ZNF705G_ENST00000400078.2_Missense_Mutation_p.V236A			A8MUZ8	Z705G_HUMAN	zinc finger protein 705G	236					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(9)	9						TTGAATAAAGACTTTCCCATA	0.383																																																	0								ENSG00000215372						130.0	176.0	162.0					8																	7215694		671	1591	2262	ZNF705G	SO:0001583	missense	0			-	HGNC		CCDS47773.1	8p23.1	2013-01-08			ENSG00000215372	ENSG00000215372		"""Zinc fingers, C2H2-type"", ""-"""	37134	protein-coding gene	gene with protein product							Standard	NM_001164457		Approved		uc022are.1	A8MUZ8	OTTHUMG00000165384	ENST00000400156.4:c.707T>C	8.37:g.7215694A>G	ENSP00000383020:p.Val236Ala	Somatic	0	62	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	73	8.75		Missense_Mutation	SNP	15	0.00	0	24	0.00	0	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V236A	ENST00000400156.4	37	c.707		8	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.447359	0.00178	.	.	ENSG00000215372	ENST00000400156;ENST00000400078	T;T	0.16324	2.35;2.35	1.0	0.0489	0.14287	.	.	.	.	.	T	0.05410	0.0143	N	0.04787	-0.16	0.58432	P	1.0000000000287557E-6	.	.	.	.	.	.	T	0.44190	-0.9344	6	0.02654	T	1	.	4.1841	0.10390	0.1795:0.4491:0.3714:0.0	rs9693671;rs61387799	.	.	.	A	236	ENSP00000383020:V236A;ENSP00000445477:V236A	ENSP00000445477:V236A	V	-	2	0	ZNF705G	7203104	0.000000	0.05858	0.071000	0.20095	0.016000	0.09150	0.108000	0.15396	-0.499000	0.06623	-3.359000	0.00041	GTC	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.383	ZNF705G-001	KNOWN	basic|appris_principal	protein_coding	ZNF705G	protein_coding	OTTHUMT00000383776.1	A	XM_001720517	rs9693671		7215694	-1	no_errors	ENST00000400078	ensembl	human	known	74_37	missense	SNP	0.871	G
RP11-184E9.1	0	genome.wustl.edu	37	5	25190664	25190664	+	lincRNA	SNP	G	G	A			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr5:25190664G>A	ENST00000502100.2	+	0	0				RP11-549K20.1_ENST00000507600.1_lincRNA																							CTCCGTGGCCGAAAGAGGCGG	0.672																																																	0								ENSG00000251273																																			RP11-549K20.1			0			-	Clone_based_vega_gene																													5.37:g.25190664G>A		Somatic	0	43	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63		RNA	SNP	29	0.00	0	36	26.53	13	-	NULL	ENST00000502100.2	37	NULL		5																																																																																			-	-		0.672	RP11-184E9.1-001	KNOWN	basic	lincRNA	ENSG00000251273	lincRNA	OTTHUMT00000366522.1	G		-		25190664	-1	no_errors	ENST00000507600	ensembl	human	known	74_37	rna	SNP	0.025	A
ZNF271	10778	genome.wustl.edu	37	18	32888075	32888075	+	RNA	DEL	A	A	-			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr18:32888075delA	ENST00000399070.3	+	0	2469					NR_024565.1|NR_024566.1		Q14591	ZN271_HUMAN	zinc finger protein 271						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|lung(9)	12						ctgtctatttaaaaaaaaaaa	0.388																																																	0								ENSG00000257267																																			ZNF271			0				HGNC	X78930		18q12.2	2013-04-03			ENSG00000257267	ENSG00000257267		"""Zinc fingers, C2H2-type"""	13065	other	unknown		604754				7865130, 11777961	Standard	NR_024565		Approved	HZF7, ZNFEB	uc002kyp.4	Q14591	OTTHUMG00000132563		18.37:g.32888075delA		Somatic	0	29	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	28	9.68	B3KN34|Q96T29|Q9BSX2|Q9UN33|Q9Y5B7	RNA	DEL	23	0.00	0	41	0.00	0	-	NULL	ENST00000399070.3	37	NULL		18																																																																																			-	-		0.388	ZNF271-002	KNOWN	basic	processed_transcript	ZNF271	pseudogene	OTTHUMT00000255767.2	A	NR_024565			32888075	+1	no_errors	ENST00000399070	ensembl	human	known	74_37	rna	DEL	0.019	-
GPR88	54112	genome.wustl.edu	37	1	101004644	101004644	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr1:101004644delT	ENST00000315033.4	+	2	561	c.122delT	c.(121-123)ctgfs	p.L41fs		NM_022049.2	NP_071332.2	Q9GZN0	GPR88_HUMAN	G protein-coupled receptor 88	41					G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuronal action potential (GO:0019228)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			large_intestine(2)|skin(1)	3		all_epithelial(167;1.19e-05)|all_lung(203;0.00159)|Lung NSC(277;0.00171)		Epithelial(280;0.0372)|all cancers(265;0.0558)|COAD - Colon adenocarcinoma(174;0.141)|Colorectal(144;0.156)|Lung(183;0.189)		TATTCGGGCCTGGCCATCGGG	0.652																																																	0								ENSG00000181656						39.0	34.0	36.0					1																	101004644		2201	4299	6500	GPR88	SO:0001589	frameshift_variant	0				HGNC	AB042411	CCDS772.1	1p21.3	2012-08-21	2006-02-15		ENSG00000181656	ENSG00000181656		"""GPCR / Class A : Orphans"""	4539	protein-coding gene	gene with protein product		607468	"""G-protein coupled receptor 88"", ""G protein coupled receptor 88"""				Standard	NM_022049		Approved		uc001dth.3	Q9GZN0	OTTHUMG00000010981	ENST00000315033.4:c.122delT	1.37:g.101004644delT	ENSP00000314223:p.Leu41fs	Somatic	0	40	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q29S24|Q6VN48	Frame_Shift_Del	DEL	14	0.00	0	41	0.00	0	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.L41fs	ENST00000315033.4	37	c.122	CCDS772.1	1																																																																																			-	prints_GPCR_Rhodpsn		0.652	GPR88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR88	protein_coding	OTTHUMT00000030212.1	T	NM_022049			101004644	+1	no_errors	ENST00000315033	ensembl	human	known	74_37	frame_shift_del	DEL	0.996	-
HSD3B2	3284	genome.wustl.edu	37	1	119964751	119964751	+	Silent	SNP	G	G	T			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr1:119964751G>T	ENST00000543831.1	+	4	876	c.627G>T	c.(625-627)ggG>ggT	p.G209G	HSD3B2_ENST00000369416.3_Silent_p.G209G	NM_001166120.1	NP_001159592.1	P26439	3BHS2_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2	209					androgen biosynthetic process (GO:0006702)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(19)|ovary(2)|skin(1)	27	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	Corticotropin(DB01285)|Medroxyprogesterone Acetate(DB00603)|Trilostane(DB01108)	ACAACAATGGGATCCTGTCAA	0.512																																																	0								ENSG00000203859						76.0	74.0	75.0					1																	119964751		2203	4300	6503	HSD3B2	SO:0001819	synonymous_variant	0			-	HGNC	BC038419	CCDS902.1	1p12	2014-06-03			ENSG00000203859	ENSG00000203859	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5218	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 2"""	613890				1363812, 19027726	Standard	NM_000198		Approved	SDR11E2	uc001eht.3	P26439	OTTHUMG00000012526	ENST00000543831.1:c.627G>T	1.37:g.119964751G>T		Somatic	0	64	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	58	17.14	A2RRA5|Q16010|Q53GD4|Q6AI10|Q6LDB9|Q99890|Q9UD08	Silent	SNP	32	0.00	0	35	16.67	7	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_dTDP_dehydrorham_reduct,pfam_NmrA,pfam_PKS_KR	p.G209	ENST00000543831.1	37	c.627	CCDS902.1	1																																																																																			-	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_dTDP_dehydrorham_reduct		0.512	HSD3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD3B2	protein_coding	OTTHUMT00000034994.1	G	NM_000198	-		119964751	+1	no_errors	ENST00000369416	ensembl	human	known	74_37	silent	SNP	0.020	T
CAMSAP2	23271	genome.wustl.edu	37	1	200817855	200817855	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr1:200817855G>T	ENST00000236925.4	+	12	2040	c.1991G>T	c.(1990-1992)cGa>cTa	p.R664L	CAMSAP2_ENST00000413307.2_Missense_Mutation_p.R637L|CAMSAP2_ENST00000358823.2_Missense_Mutation_p.R653L			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	664					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										TATGATATTCGAACTGGCAAC	0.423																																																	0								ENSG00000118200						92.0	93.0	92.0					1																	200817855		2203	4300	6503	CAMSAP2	SO:0001583	missense	0			-	HGNC	AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.1991G>T	1.37:g.200817855G>T	ENSP00000236925:p.Arg664Leu	Somatic	0	33	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Missense_Mutation	SNP	26	0.00	0	67	0.00	0	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrel-like,superfamily_CH-domain	p.R664L	ENST00000236925.4	37	c.1991		1	.	.	.	.	.	.	.	.	.	.	G	11.73	1.727239	0.30593	.	.	ENSG00000118200	ENST00000358823;ENST00000413307;ENST00000236925	T;T;T	0.41758	0.99;0.99;0.99	5.55	5.55	0.83447	.	0.067711	0.56097	D	0.000023	T	0.34048	0.0884	L	0.46157	1.445	0.19575	N	0.999966	P;P;P	0.42620	0.785;0.678;0.785	B;B;B	0.34991	0.193;0.137;0.193	T	0.43343	-0.9397	10	0.51188	T	0.08	-17.2662	12.8033	0.57598	0.0746:0.0:0.9254:0.0	.	637;664;653	Q08AD1-2;Q08AD1;Q08AD1-3	.;CAMP2_HUMAN;.	L	653;637;664	ENSP00000351684:R653L;ENSP00000416800:R637L;ENSP00000236925:R664L	ENSP00000236925:R664L	R	+	2	0	CAMSAP1L1	199084478	0.451000	0.25705	0.008000	0.14137	0.699000	0.40488	3.529000	0.53532	2.597000	0.87782	0.655000	0.94253	CGA	-	NULL		0.423	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	CAMSAP2	protein_coding	OTTHUMT00000086956.2	G	NM_203459	-		200817855	+1	no_errors	ENST00000236925	ensembl	human	known	74_37	missense	SNP	0.071	T
OR10G7	390265	genome.wustl.edu	37	11	123909182	123909182	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr11:123909182T>A	ENST00000330487.5	-	1	535	c.527A>T	c.(526-528)tAc>tTc	p.Y176F		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GTCACAGAAGTAGTGCTGGAT	0.562																																																	0								ENSG00000182634						207.0	200.0	202.0					11																	123909182		2200	4296	6496	OR10G7	SO:0001583	missense	0			-	HGNC	AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.527A>T	11.37:g.123909182T>A	ENSP00000329689:p.Tyr176Phe	Somatic	0	157	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	129	25.43	Q6IFE8	Missense_Mutation	SNP	22	0.00	0	37	21.28	10	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y176F	ENST00000330487.5	37	c.527	CCDS31705.1	11	.	.	.	.	.	.	.	.	.	.	T	0.198	-1.047675	0.01981	.	.	ENSG00000182634	ENST00000330487	T	0.00011	9.38	3.24	3.24	0.37175	GPCR, rhodopsin-like superfamily (1);	0.172945	0.27901	N	0.017397	T	0.00039	0.0001	N	0.00272	-1.73	0.24129	N	0.995774	B	0.20887	0.049	B	0.30782	0.12	T	0.30995	-0.9959	10	0.02654	T	1	.	7.5217	0.27633	0.2467:0.0:0.0:0.7533	.	176	Q8NGN6	O10G7_HUMAN	F	176	ENSP00000329689:Y176F	ENSP00000329689:Y176F	Y	-	2	0	OR10G7	123414392	0.006000	0.16342	1.000000	0.80357	0.927000	0.56198	-0.114000	0.10757	1.490000	0.48466	0.374000	0.22700	TAC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.562	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G7	protein_coding	OTTHUMT00000387271.1	T	NM_001004463	-		123909182	-1	no_errors	ENST00000330487	ensembl	human	known	74_37	missense	SNP	0.824	A
NSMAF	8439	genome.wustl.edu	37	8	59548025	59548025	+	Splice_Site	SNP	A	A	G			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr8:59548025A>G	ENST00000038176.3	-	3	441		c.e3+1		NSMAF_ENST00000427130.2_Splice_Site	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor						ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				AAATGTATTTACCTTGATGAT	0.308																																																	0								ENSG00000035681						89.0	99.0	95.0					8																	59548025		2203	4299	6502	NSMAF	SO:0001630	splice_region_variant	0			-	HGNC	X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.228+1T>C	8.37:g.59548025A>G		Somatic	0	35	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	41	19.61	B4DFB0|E9PCH0|Q8IW26	Splice_Site	SNP	49	0.00	0	65	18.52	15	-	e3+2	ENST00000038176.3	37	c.321+2	CCDS6173.1	8	.	.	.	.	.	.	.	.	.	.	A	18.83	3.707996	0.68615	.	.	ENSG00000035681	ENST00000038176;ENST00000427130	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3708	0.66838	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NSMAF	59710579	1.000000	0.71417	0.998000	0.56505	0.901000	0.52897	6.386000	0.73186	2.130000	0.65690	0.477000	0.44152	.	-	-		0.308	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSMAF	protein_coding	OTTHUMT00000378384.1	A	NM_003580	-	Intron	59548025	-1	no_errors	ENST00000427130	ensembl	human	known	74_37	splice_site	SNP	1.000	G
RASL10A	10633	genome.wustl.edu	37	22	29708008	29708008	+	IGR	SNP	A	A	C			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr22:29708008A>C	ENST00000216101.6	-	0	1490				GAS2L1_ENST00000360113.2_3'UTR|GAS2L1_ENST00000407647.2_Silent_p.R523R|GAS2L1_ENST00000471961.1_Silent_p.R523R|RASL10A_ENST00000608559.1_5'Flank|GAS2L1_ENST00000406549.3_Intron|GAS2L1_ENST00000407854.1_Silent_p.R523R|GAS2L1_ENST00000341313.6_3'UTR|GAS2L1_ENST00000403764.1_Silent_p.R523R	NM_006477.4	NP_006468.1	Q92737	RSLAA_HUMAN	RAS-like, family 10, member A						small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)	1						CGCCTGGAAGAGGAGTTCCTG	0.687																																																	0								ENSG00000185340						46.0	59.0	55.0					22																	29708008		2034	4184	6218	GAS2L1	SO:0001628	intergenic_variant	0			-	HGNC	Y07847	CCDS13854.1	22q12.2	2014-05-09			ENSG00000100276	ENSG00000100276			16954	protein-coding gene	gene with protein product		602220				8975699, 15731001	Standard	NM_006477		Approved	RRP22	uc031rxl.1	Q92737	OTTHUMG00000151106		22.37:g.29708008A>C		Somatic	0	46	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	39	11.36	Q49AU5|Q6PI03	Silent	SNP	27	0.00	0	27	12.90	4	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.R523	ENST00000216101.6	37	c.1567	CCDS13854.1	22	.	.	.	.	.	.	.	.	.	.	A	8.205	0.799106	0.16397	.	.	ENSG00000185340	ENST00000333679	.	.	.	3.68	3.68	0.42216	.	0.373012	0.21691	U	0.070580	T	0.42471	0.1204	.	.	.	0.80722	D	1	B;B	0.25521	0.128;0.128	B;B	0.19666	0.026;0.026	T	0.36286	-0.9754	8	0.40728	T	0.16	-11.5917	6.6194	0.22794	0.8874:0.0:0.1126:0.0	.	523;523	A0A5E8;Q99501	.;GA2L1_HUMAN	A	522	.	ENSP00000332834:E522A	E	+	2	0	GAS2L1	28038008	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	2.593000	0.46180	1.540000	0.49301	0.402000	0.26972	GAG	-	NULL		0.687	RASL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS2L1	protein_coding	OTTHUMT00000321342.1	A		-		29708008	+1	no_errors	ENST00000403764	ensembl	human	known	74_37	silent	SNP	1.000	C
AC112721.2	0	genome.wustl.edu	37	2	238341757	238341757	+	lincRNA	SNP	G	G	C			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr2:238341757G>C	ENST00000409910.1	-	0	208																											AAGCAATGGTGAAGTCCTTTT	0.512																																																	0								ENSG00000222032																																			AC112721.2			0			-	Clone_based_vega_gene																													2.37:g.238341757G>C		Somatic	0	71	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	59	19.18		RNA	SNP	30	0.00	0	46	24.59	15	-	NULL	ENST00000409910.1	37	NULL		2																																																																																			-	-		0.512	AC112721.2-001	KNOWN	basic	lincRNA	ENSG00000222032	lincRNA	OTTHUMT00000328876.2	G		-		238341757	-1	no_errors	ENST00000409910	ensembl	human	known	74_37	rna	SNP	0.975	C
DUXAP8	503637	genome.wustl.edu	37	22	16151010	16151010	+	RNA	SNP	T	T	C	rs8137415		TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr22:16151010T>C	ENST00000447898.1	-	0	1104																											AGTTGTTCTCTGGAATCAATC	0.393																																																	0								ENSG00000206195																																			AP000525.9			0			-	Clone_based_vega_gene																													22.37:g.16151010T>C		Somatic	0	11	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	6	45.45		RNA	SNP	41	10.87	5	82	19.61	20	-	NULL	ENST00000447898.1	37	NULL		22																																																																																			-	-		0.393	AP000525.9-002	KNOWN	basic	lincRNA	ENSG00000206195	processed_transcript	OTTHUMT00000276780.1	T		-		16151010	-1	no_errors	ENST00000413768	ensembl	human	known	74_37	rna	SNP	0.448	C
CSMD1	64478	genome.wustl.edu	37	8	3245037	3245037	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr8:3245037G>C	ENST00000520002.1	-	19	3319	c.2764C>G	c.(2764-2766)Cac>Gac	p.H922D	CSMD1_ENST00000400186.3_Missense_Mutation_p.H922D|CSMD1_ENST00000542608.1_Missense_Mutation_p.H921D|CSMD1_ENST00000539096.1_Missense_Mutation_p.H921D|CSMD1_ENST00000602557.1_Missense_Mutation_p.H922D|CSMD1_ENST00000537824.1_Missense_Mutation_p.H921D|CSMD1_ENST00000602723.1_Missense_Mutation_p.H922D			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	922	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GGCAAGGCGTGGTTCCACTGG	0.582																																																	0								ENSG00000183117						40.0	46.0	44.0					8																	3245037		2112	4223	6335	CSMD1	SO:0001583	missense	0			-	HGNC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.2764C>G	8.37:g.3245037G>C	ENSP00000430733:p.His922Asp	Somatic	0	33	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	63	8.70	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	24	0.00	0	35	14.63	6	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.H922D	ENST00000520002.1	37	c.2764		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.7|24.7	4.555622|4.555622	0.86231|0.86231	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	T;T;T;T;T|.	0.22336|.	1.96;1.96;1.96;1.96;1.96|.	5.11|5.11	5.11|5.11	0.69529|0.69529	Complement control module (2);Sushi/SCR/CCP (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.53449|0.53449	0.1797|0.1797	N|N	0.20328|0.20328	0.56|0.56	0.58432|0.58432	D|D	0.999996|0.999996	D;P;D|.	0.65815|.	0.995;0.862;0.993|.	D;P;D|.	0.77557|.	0.99;0.734;0.92|.	T|T	0.49688|0.49688	-0.8913|-0.8913	10|5	0.07030|.	T|.	0.85|.	.|.	18.5306|18.5306	0.90990|0.90990	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	922;922;922|.	E5RIG2;Q96PZ7;Q96PZ7-4|.	.;CSMD1_HUMAN;.|.	D|R	922;922;784;921;921;921|401	ENSP00000383047:H922D;ENSP00000430733:H922D;ENSP00000441462:H921D;ENSP00000446243:H921D;ENSP00000441675:H921D|.	ENSP00000320445:H784D|.	H|P	-|-	1|2	0|0	CSMD1|CSMD1	3232444|3232444	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.855000|0.855000	0.48748|0.48748	7.781000|7.781000	0.85668|0.85668	2.374000|2.374000	0.81015|0.81015	0.650000|0.650000	0.86243|0.86243	CAC|CCA	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.582	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	protein_coding	OTTHUMT00000374500.2	G	NM_033225	-		3245037	-1	no_errors	ENST00000520002	ensembl	human	known	74_37	missense	SNP	1.000	C
BCLAF1	9774	genome.wustl.edu	37	6	136582194	136582195	+	3'UTR	INS	-	-	AAA	rs141067744	byFrequency	TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr6:136582194_136582195insAAA	ENST00000531224.1	-	0	3068_3069				BCLAF1_ENST00000529917.1_5'UTR|BCLAF1_ENST00000527759.1_3'UTR|BCLAF1_ENST00000031135.9_3'UTR|BCLAF1_ENST00000530767.1_3'UTR|BCLAF1_ENST00000353331.4_3'UTR|BCLAF1_ENST00000527536.1_3'UTR	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1						apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		AAAAATCAGGTAAAAAAAATGG	0.267																																					Colon(142;1534 1789 5427 7063 28491)												0								ENSG00000029363																																			BCLAF1	SO:0001624	3_prime_UTR_variant	0				HGNC	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.*54->TTT	6.37:g.136582198_136582200dupAAA		Somatic	0	35	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	37	15.91	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	RNA	INS	50	13.79	8	84	6.67	6	-	NULL	ENST00000531224.1	37	NULL	CCDS5177.1	6																																																																																			-	-		0.267	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCLAF1	protein_coding	OTTHUMT00000042375.2	-	NM_014739			136582195	-1	no_errors	ENST00000529917	ensembl	human	known	74_37	rna	INS	0.920:0.995	AAA
CTD-2090I13.1	0	genome.wustl.edu	37	1	227618623	227618623	+	lincRNA	SNP	C	C	T			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr1:227618623C>T	ENST00000445817.1	+	0	1858																											GTCTTGAGGCCAGCACAGCAA	0.502																																																	0								ENSG00000234277																																			CTD-2090I13.1			0			-	Clone_based_vega_gene																													1.37:g.227618623C>T		Somatic	0	24	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67		RNA	SNP	26	0.00	0	46	11.54	6	-	NULL	ENST00000445817.1	37	NULL		1																																																																																			-	-		0.502	CTD-2090I13.1-001	KNOWN	basic	lincRNA	ENSG00000234277	lincRNA	OTTHUMT00000091688.1	C		-		227618623	+1	no_errors	ENST00000445817	ensembl	human	known	74_37	rna	SNP	1.000	T
CFAP53	220136	genome.wustl.edu	37	18	47778111	47778111	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr18:47778111G>A	ENST00000398545.4	-	4	634	c.517C>T	c.(517-519)Cag>Tag	p.Q173*		NM_145020.3	NP_659457.2														endometrium(1)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|pancreas(1)|skin(1)	20				STAD - Stomach adenocarcinoma(97;2.66e-05)|Colorectal(21;7.57e-05)|Lung(128;0.00932)|READ - Rectum adenocarcinoma(32;0.164)		ACCTTCTTCTGATGGATAGAT	0.458																																																	0								ENSG00000172361						244.0	238.0	240.0					18																	47778111		1977	4159	6136	CCDC11	SO:0001587	stop_gained	0			-	HGNC																												ENST00000398545.4:c.517C>T	18.37:g.47778111G>A	ENSP00000381553:p.Gln173*	Somatic	0	29	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	18	28.00		Nonsense_Mutation	SNP	28	0.00	0	54	15.62	10	NULL	p.Q173*	ENST00000398545.4	37	c.517	CCDS11940.2	18	.	.	.	.	.	.	.	.	.	.	G	16.50	3.139369	0.56936	.	.	ENSG00000172361	ENST00000398545	.	.	.	5.32	-2.58	0.06228	.	1.008970	0.07950	N	0.980733	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-0.6293	15.5166	0.75830	0.0:0.6237:0.2833:0.093	.	.	.	.	X	173	.	ENSP00000381553:Q173X	Q	-	1	0	CCDC11	46032109	0.428000	0.25522	0.542000	0.28115	0.492000	0.33523	0.213000	0.17521	-0.104000	0.12154	-0.165000	0.13383	CAG	-	NULL		0.458	CCDC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC11	protein_coding	OTTHUMT00000255922.3	G		-		47778111	-1	no_errors	ENST00000398545	ensembl	human	known	74_37	nonsense	SNP	0.017	A
PGM5	5239	genome.wustl.edu	37	9	70993134	70993134	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr9:70993134G>C	ENST00000396396.1	+	2	510	c.281G>C	c.(280-282)gGa>gCa	p.G94A	PGM5_ENST00000604870.2_3'UTR|PGM5_ENST00000396392.1_Missense_Mutation_p.G94A	NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	94					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)			endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						CTGATTATTGGACAGAATGGC	0.463																																																	0								ENSG00000154330						37.0	40.0	39.0					9																	70993134		2194	4285	6479	PGM5	SO:0001583	missense	0			-	HGNC	L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.281G>C	9.37:g.70993134G>C	ENSP00000379678:p.Gly94Ala	Somatic	0	62	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	43	23.73	B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Missense_Mutation	SNP	25	0.00	0	26	10.34	3	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-III,pfam_A-D-PHexomutase_a/b/a-II,superfamily_A-D-PHexomutase_a/b/a-I/II/III,prints_Alpha-D-phosphohexomutase_SF	p.G94A	ENST00000396396.1	37	c.281	CCDS6622.2	9	.	.	.	.	.	.	.	.	.	.	.	18.75	3.689579	0.68271	.	.	ENSG00000154330	ENST00000396396;ENST00000396392;ENST00000377314;ENST00000431583	T;T;T	0.69175	-0.38;-0.38;-0.38	4.37	3.44	0.39384	Alpha-D-phosphohexomutase, alpha/beta/alpha domain I (1);Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);	0.058594	0.64402	N	0.000002	T	0.81235	0.4780	M	0.80847	2.515	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83385	0.0014	10	0.72032	D	0.01	.	13.2343	0.59961	0.0:0.1619:0.8381:0.0	.	94	Q15124	PGM5_HUMAN	A	94;94;94;60	ENSP00000379678:G94A;ENSP00000379674:G94A;ENSP00000394864:G60A	ENSP00000366531:G94A	G	+	2	0	PGM5	70182954	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.818000	0.86416	0.912000	0.36772	0.544000	0.68410	GGA	-	pfam_A-D-PHexomutase_a/b/a-I,superfamily_A-D-PHexomutase_a/b/a-I/II/III		0.463	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PGM5	protein_coding	OTTHUMT00000052548.2	G	NM_021965	-		70993134	+1	no_errors	ENST00000396396	ensembl	human	known	74_37	missense	SNP	1.000	C
IQCA1	79781	genome.wustl.edu	37	2	237247013	237247013	+	Missense_Mutation	SNP	G	G	A	rs186626813	byFrequency	TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr2:237247013G>A	ENST00000409907.3	-	17	2243	c.1969C>T	c.(1969-1971)Cgc>Tgc	p.R657C	IQCA1_ENST00000431676.2_Missense_Mutation_p.R616C|IQCA1_ENST00000309507.5_Missense_Mutation_p.R654C	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	657							ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						TTTTTCAGGCGTTTAGGTTCA	0.413													G|||	14	0.00279553	0.0	0.0	5008	,	,		17507	0.0129		0.0	False		,,,				2504	0.001																0								ENSG00000132321	G	CYS/ARG	0,3606		0,0,1803	109.0	108.0	108.0		1969	5.5	1.0	2		108	2,8142		0,2,4070	yes	missense	IQCA1	NM_024726.3	180	0,2,5873	AA,AG,GG		0.0246,0.0,0.017	probably-damaging	657/823	237247013	2,11748	1803	4072	5875	IQCA1	SO:0001583	missense	0			GMAF=0.0005	HGNC	AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.1969C>T	2.37:g.237247013G>A	ENSP00000387347:p.Arg657Cys	Somatic	0	41	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	43	10.42	B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Missense_Mutation	SNP	46	0.00	0	45	15.09	8	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,pfscan_IQ_motif_EF-hand-BS	p.R657C	ENST00000409907.3	37	c.1969	CCDS46549.1	2	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	21.5	4.160662	0.78226	0.0	2.46E-4	ENSG00000132321	ENST00000409907;ENST00000457693;ENST00000309507;ENST00000431676	D;D;D	0.94138	-3.36;-3.36;-3.36	5.47	5.47	0.80525	ATPase, AAA-type, core (1);	0.000000	0.64402	D	0.000003	D	0.97974	0.9333	H	0.96015	3.755	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99072	1.0834	10	0.87932	D	0	.	18.9625	0.92681	0.0:0.0:1.0:0.0	.	616;665;657	E7EWQ0;E9PH78;Q86XH1	.;.;IQCA1_HUMAN	C	657;665;654;616	ENSP00000387347:R657C;ENSP00000311951:R654C;ENSP00000407213:R616C	ENSP00000311951:R654C	R	-	1	0	IQCA1	236911752	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	6.128000	0.71650	2.567000	0.86603	0.650000	0.86243	CGC	-	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase		0.413	IQCA1-001	KNOWN	basic|CCDS	protein_coding	IQCA1	protein_coding	OTTHUMT00000329266.1	G	NM_024726	rs186626813		237247013	-1	no_errors	ENST00000409907	ensembl	human	known	74_37	missense	SNP	1.000	A
QRICH2	84074	genome.wustl.edu	37	17	74283966	74283966	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr17:74283966G>A	ENST00000262765.5	-	6	3492	c.3313C>T	c.(3313-3315)Cag>Tag	p.Q1105*		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	1105										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						AGGATCCTCTGCAGCCTTTCC	0.577																																																	0								ENSG00000129646						167.0	121.0	137.0					17																	74283966		2203	4300	6503	QRICH2	SO:0001587	stop_gained	0			-	HGNC	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.3313C>T	17.37:g.74283966G>A	ENSP00000262765:p.Gln1105*	Somatic	0	67	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	49	20.97	A2RRE1|Q96LM3	Nonsense_Mutation	SNP	27	0.00	0	37	9.76	4	NULL	p.Q1105*	ENST00000262765.5	37	c.3313	CCDS32741.1	17	.	.	.	.	.	.	.	.	.	.	G	16.43	3.121572	0.56613	.	.	ENSG00000129646	ENST00000262765;ENST00000447564;ENST00000301613	.	.	.	4.48	3.5	0.40072	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	1.0478	7.4485	0.27225	0.0:0.1761:0.6229:0.201	.	.	.	.	X	1105;113;1105	.	ENSP00000262765:Q1105X	Q	-	1	0	QRICH2	71795561	0.025000	0.19082	0.004000	0.12327	0.081000	0.17604	1.233000	0.32648	0.828000	0.34709	0.462000	0.41574	CAG	-	NULL		0.577	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	QRICH2	protein_coding	OTTHUMT00000395140.1	G	NM_032134	-		74283966	-1	no_errors	ENST00000262765	ensembl	human	known	74_37	nonsense	SNP	0.008	A
CCNC	892	genome.wustl.edu	37	6	100006296	100006296	+	Intron	DEL	A	A	-			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr6:100006296delA	ENST00000520429.1	-	5	792				CCNC_ENST00000523799.1_Intron|CCNC_ENST00000369220.4_Intron|CCNC_ENST00000523985.1_Intron|CCNC_ENST00000482541.2_Frame_Shift_Del_p.F141fs|CCNC_ENST00000520371.1_Intron|CCNC_ENST00000518714.1_Intron|CCNC_ENST00000521017.1_Intron	NM_001013399.1|NM_005190.3	NP_001013417.1|NP_005181.2	P24863	CCNC_HUMAN	cyclin C						gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|mediator complex (GO:0016592)|nucleoplasm (GO:0005654)							all_cancers(76;8.46e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.064)		CTCATAAACTAAAAAAAAAAA	0.299																																					GBM(57;273 1020 40094 44454 49348)												0								ENSG00000112237																																			CCNC	SO:0001627	intron_variant	0				HGNC		CCDS34502.1, CCDS47461.1	6q21	2008-02-05			ENSG00000112237	ENSG00000112237			1581	protein-coding gene	gene with protein product		123838				1833066	Standard	XM_005267202		Approved	CycC	uc003pqe.3	P24863	OTTHUMG00000015268	ENST00000520429.1:c.346+76T>-	6.37:g.100006296delA		Somatic	0	21	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	B4DPZ1|Q9H543	Frame_Shift_Del	DEL	31	0.00	0	37	0.00	0	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.F141fs	ENST00000520429.1	37	c.423	CCDS34502.1	6																																																																																			-	superfamily_Cyclin-like		0.299	CCNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCNC	protein_coding	OTTHUMT00000041613.2	A	NM_005190			100006296	-1	no_errors	ENST00000482541	ensembl	human	putative	74_37	frame_shift_del	DEL	0.007	-
TRIM11	81559	genome.wustl.edu	37	1	228582509	228582509	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr1:228582509G>A	ENST00000284551.6	-	6	1582	c.1304C>T	c.(1303-1305)tCg>tTg	p.S435L	RP11-245P10.8_ENST00000602963.1_RNA|TRIM11_ENST00000460651.1_5'UTR|TRIM11_ENST00000493030.2_Missense_Mutation_p.S310L	NM_145214.2	NP_660215.1	Q96F44	TRI11_HUMAN	tripartite motif containing 11	435	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of neurogenesis (GO:0050768)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of viral entry into host cell (GO:0046598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	18		Prostate(94;0.0724)				CAGCGTCCCCGAGAAGGGGAT	0.627																																																	0								ENSG00000154370						54.0	61.0	59.0					1																	228582509		2203	4300	6503	TRIM11	SO:0001583	missense	0			-	HGNC	AF220125	CCDS31048.1	1q42.13	2013-01-09	2011-01-25		ENSG00000154370	ENSG00000154370		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16281	protein-coding gene	gene with protein product		607868	"""tripartite motif-containing 11"""			11331580	Standard	NM_145214		Approved	RNF92, BIA1	uc001hss.3	Q96F44	OTTHUMG00000039773	ENST00000284551.6:c.1304C>T	1.37:g.228582509G>A	ENSP00000284551:p.Ser435Leu	Somatic	0	23	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	32	20.00	A6NKE2|B2RB82|B3KUS3|B4DX88|Q5VSU1|Q8NCA6|Q9C022	Missense_Mutation	SNP	23	0.00	0	34	30.61	15	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.S435L	ENST00000284551.6	37	c.1304	CCDS31048.1	1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.739873	0.49045	.	.	ENSG00000154370	ENST00000284551	T	0.63417	-0.04	4.76	4.76	0.60689	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.44688	D	0.000433	T	0.74794	0.3763	M	0.75264	2.295	0.80722	D	1	P;D	0.69078	0.951;0.997	B;P	0.57846	0.222;0.828	T	0.78114	-0.2330	10	0.56958	D	0.05	.	15.6526	0.77110	0.0:0.0:1.0:0.0	.	434;435	Q96F44-3;Q96F44	.;TRI11_HUMAN	L	435	ENSP00000284551:S435L	ENSP00000284551:S435L	S	-	2	0	TRIM11	226649132	0.994000	0.37717	0.938000	0.37757	0.058000	0.15608	3.032000	0.49736	2.370000	0.80446	0.609000	0.83330	TCG	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin		0.627	TRIM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM11	protein_coding	OTTHUMT00000095995.3	G	NM_145214	-		228582509	-1	no_errors	ENST00000284551	ensembl	human	known	74_37	missense	SNP	0.966	A
PRKCA	5578	genome.wustl.edu	37	17	64770113	64770113	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr17:64770113delT	ENST00000413366.3	+	14	1559	c.1533delT	c.(1531-1533)gctfs	p.A511fs		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	511	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	AGATAATCGCTTATCAGCCGT	0.428																																																	0								ENSG00000154229						263.0	247.0	252.0					17																	64770113		2203	4300	6503	PRKCA	SO:0001589	frameshift_variant	0				HGNC		CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.1533delT	17.37:g.64770113delT	ENSP00000408695:p.Ala511fs	Somatic	0	62	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	53	17.19	B5BU22|Q15137|Q32M72|Q96RE4	Frame_Shift_Del	DEL	39	0.00	0	41	0.00	0	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd,prints_C2_dom	p.Y512fs	ENST00000413366.3	37	c.1533	CCDS11664.1	17																																																																																			-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Protein_kinase_C_a/b/g,pfscan_Prot_kinase_dom		0.428	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCA	protein_coding	OTTHUMT00000446976.1	T				64770113	+1	no_errors	ENST00000413366	ensembl	human	known	74_37	frame_shift_del	DEL	0.955	-
RAPGEF1	2889	genome.wustl.edu	37	9	134463181	134463181	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr9:134463181C>T	ENST00000372189.3	-	19	2740	c.2617G>A	c.(2617-2619)Gag>Aag	p.E873K	RAPGEF1_ENST00000372195.1_Missense_Mutation_p.E890K|RAPGEF1_ENST00000372190.3_Missense_Mutation_p.E891K	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	873	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		CTCTTCTCCTCATTCTGCTCT	0.537																																																	0								ENSG00000107263						78.0	84.0	82.0					9																	134463181		1935	4135	6070	RAPGEF1	SO:0001583	missense	0			-	HGNC	BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.2617G>A	9.37:g.134463181C>T	ENSP00000361263:p.Glu873Lys	Somatic	0	37	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	25	34.21	Q5JUE4|Q8IV73	Missense_Mutation	SNP	31	0.00	0	27	20.59	7	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.E891K	ENST00000372189.3	37	c.2671	CCDS48047.1	9	.	.	.	.	.	.	.	.	.	.	C	34	5.372869	0.95923	.	.	ENSG00000107263	ENST00000266110;ENST00000372195;ENST00000429421;ENST00000372189;ENST00000372190;ENST00000411834;ENST00000337036;ENST00000398415;ENST00000357686	T;T;T	0.28895	1.59;1.59;1.59	4.89	4.89	0.63831	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.49201	0.1543	L	0.45137	1.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.995;0.999	T	0.51325	-0.8720	10	0.72032	D	0.01	.	17.0282	0.86453	0.0:1.0:0.0:0.0	.	873;891	Q13905;Q13905-3	RPGF1_HUMAN;.	K	873;890;819;873;891;853;851;318;890	ENSP00000361269:E890K;ENSP00000361263:E873K;ENSP00000361264:E891K	ENSP00000266110:E873K	E	-	1	0	RAPGEF1	133453002	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.439000	0.80444	2.233000	0.73108	0.561000	0.74099	GAG	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25		0.537	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	RAPGEF1	protein_coding	OTTHUMT00000054759.2	C	NM_005312	-		134463181	-1	no_errors	ENST00000372190	ensembl	human	known	74_37	missense	SNP	1.000	T
ERBB4	2066	genome.wustl.edu	37	2	212522509	212522509	+	Missense_Mutation	SNP	G	G	A	rs532377012		TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr2:212522509G>A	ENST00000342788.4	-	16	2226	c.1916C>T	c.(1915-1917)aCg>aTg	p.T639M	ERBB4_ENST00000436443.1_Missense_Mutation_p.T639M|ERBB4_ENST00000402597.1_Intron	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	639					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	GGAATGGCCCGTCCATGGGTA	0.428										TSP Lung(8;0.080)			G|||	0	0.0	0.0	0.0	5008	,	,		17193	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000178568						272.0	212.0	233.0					2																	212522509		2203	4300	6503	ERBB4	SO:0001583	missense	0			-	HGNC	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.1916C>T	2.37:g.212522509G>A	ENSP00000342235:p.Thr639Met	Somatic	0	58	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	67	17.28	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	22	4.35	1	36	34.55	19	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.T639M	ENST00000342788.4	37	c.1916	CCDS2394.1	2	.	.	.	.	.	.	.	.	.	.	G	14.67	2.605524	0.46527	.	.	ENSG00000178568	ENST00000342788;ENST00000436443	T;T	0.76186	-1.0;-1.0	5.14	4.25	0.50352	.	0.295154	0.37053	N	0.002267	T	0.51092	0.1654	N	0.04959	-0.14	0.80722	D	1	B;B;B	0.18968	0.032;0.018;0.011	B;B;B	0.08055	0.003;0.001;0.001	T	0.53070	-0.8490	10	0.62326	D	0.03	.	8.4722	0.32993	0.0778:0.0:0.7684:0.1539	.	498;639;639	Q53QS8;Q15303-3;Q15303	.;.;ERBB4_HUMAN	M	639	ENSP00000342235:T639M;ENSP00000403204:T639M	ENSP00000342235:T639M	T	-	2	0	ERBB4	212230754	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.103000	0.57783	2.557000	0.86248	0.650000	0.86243	ACG	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,smart_Furin_repeat		0.428	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	protein_coding	OTTHUMT00000256597.1	G	NM_001042599	-		212522509	-1	no_errors	ENST00000342788	ensembl	human	known	74_37	missense	SNP	1.000	A
ATP10A	57194	genome.wustl.edu	37	15	25940132	25940132	+	Silent	SNP	G	G	A			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr15:25940132G>A	ENST00000356865.6	-	14	3033	c.2922C>T	c.(2920-2922)atC>atT	p.I974I		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	974					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TTCTCCCATCGATCACGAGGC	0.607																																																	0								ENSG00000206190						102.0	96.0	98.0					15																	25940132		2203	4300	6503	ATP10A	SO:0001819	synonymous_variant	0			-	HGNC	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.2922C>T	15.37:g.25940132G>A		Somatic	0	53	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	56	12.50	Q4G0S9|Q969I4	Silent	SNP	32	0.00	0	22	33.33	11	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.I974	ENST00000356865.6	37	c.2922	CCDS32178.1	15																																																																																			-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transp		0.607	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	protein_coding	OTTHUMT00000414830.1	G	NM_024490	-		25940132	-1	no_errors	ENST00000356865	ensembl	human	known	74_37	silent	SNP	0.113	A
C9orf78	51759	genome.wustl.edu	37	9	132596001	132596001	+	Intron	DEL	A	A	-			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr9:132596001delA	ENST00000372447.3	-	3	197				C9orf78_ENST00000461762.1_5'UTR|USP20_ENST00000315480.4_5'Flank|USP20_ENST00000372429.3_5'Flank|USP20_ENST00000358355.1_5'Flank	NM_016520.2	NP_057604.1	Q9NZ63	CI078_HUMAN	chromosome 9 open reading frame 78							cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)	13		Ovarian(14;0.00556)				GAGCAAAACCAAAAAAAAAAG	0.478																																																	0								ENSG00000136819						28.0	25.0	26.0					9																	132596001		2203	4299	6502	C9orf78	SO:0001627	intron_variant	0				HGNC	BC017570	CCDS6931.1	9q34.2	2012-03-16			ENSG00000136819	ENSG00000136819			24932	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 59"""					11042152, 12097419	Standard	NM_016520		Approved	HSPC220, HCA59	uc004byp.3	Q9NZ63	OTTHUMG00000020796	ENST00000372447.3:c.144-13T>-	9.37:g.132596001delA		Somatic	0	23	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	20	9.09	B3KPX8|Q8WVU6|Q9NT39	RNA	DEL	35	0.00	0	35	0.00	0	-	NULL	ENST00000372447.3	37	NULL	CCDS6931.1	9																																																																																			-	-		0.478	C9orf78-007	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf78	protein_coding	OTTHUMT00000054625.1	A	NM_016520			132596001	-1	no_errors	ENST00000461762	ensembl	human	known	74_37	rna	DEL	0.115	-
KIF15	56992	genome.wustl.edu	37	3	44816813	44816813	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr3:44816813G>C	ENST00000326047.4	+	3	279	c.130G>C	c.(130-132)Gat>Cat	p.D44H		NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	44	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		TGGGTCAGCTGATGGAGAGCA	0.458																																																	0								ENSG00000163808						159.0	136.0	144.0					3																	44816813		2203	4300	6503	KIF15	SO:0001583	missense	0			-	HGNC	AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.130G>C	3.37:g.44816813G>C	ENSP00000324020:p.Asp44His	Somatic	0	29	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	33	17.50	Q17RV9|Q69YL6|Q96JX7|Q9H280	Missense_Mutation	SNP	20	0.00	0	60	9.09	6	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.D44H	ENST00000326047.4	37	c.130	CCDS33744.1	3	.	.	.	.	.	.	.	.	.	.	G	25.9	4.681878	0.88542	.	.	ENSG00000163808	ENST00000326047;ENST00000396031	T	0.75260	-0.92	5.77	5.77	0.91146	Kinesin, motor domain (4);	0.248472	0.28026	N	0.016895	T	0.79793	0.4507	L	0.42487	1.325	0.80722	D	1	D	0.56746	0.977	P	0.61800	0.894	T	0.79198	-0.1902	10	0.52906	T	0.07	.	14.5261	0.67890	0.07:0.0:0.93:0.0	.	44	Q9NS87	KIF15_HUMAN	H	44;43	ENSP00000324020:D44H	ENSP00000324020:D44H	D	+	1	0	KIF15	44791817	1.000000	0.71417	0.990000	0.47175	0.980000	0.70556	6.572000	0.74005	2.885000	0.99019	0.655000	0.94253	GAT	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom		0.458	KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF15	protein_coding	OTTHUMT00000343831.2	G		-		44816813	+1	no_errors	ENST00000326047	ensembl	human	known	74_37	missense	SNP	1.000	C
GPSM1	26086	genome.wustl.edu	37	9	139252558	139252558	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr9:139252558G>C	ENST00000440944.1	+	14	2134	c.1914G>C	c.(1912-1914)caG>caC	p.Q638H	GPSM1_ENST00000429455.1_Missense_Mutation_p.Q129H|GPSM1_ENST00000392944.1_Missense_Mutation_p.Q129H	NM_001145638.1	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1	638	GoLoco 4. {ECO:0000255|PROSITE- ProRule:PRU00097}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GDP-dissociation inhibitor activity (GO:0005092)			biliary_tract(1)|endometrium(1)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		GCCTCATTCAGAGGGTGCAGG	0.711																																																	0								ENSG00000160360						48.0	42.0	44.0					9																	139252558		2203	4300	6503	GPSM1	SO:0001583	missense	0			-	HGNC	AI272212	CCDS6996.2, CCDS48055.1, CCDS48056.1	9q34.3	2013-01-10	2010-06-24		ENSG00000160360	ENSG00000160360		"""Tetratricopeptide (TTC) repeat domain containing"""	17858	protein-coding gene	gene with protein product	"""AGS3 homolog (C. elegans)"""	609491	"""G-protein signalling modulator 1 (AGS3-like, C. elegans)"""			11278352, 10969064	Standard	NM_001145639		Approved	AGS3, DKFZP727I051	uc004chd.2	Q86YR5	OTTHUMG00000020930	ENST00000440944.1:c.1914G>C	9.37:g.139252558G>C	ENSP00000392828:p.Gln638His	Somatic	0	65	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	38	32.14	A9Z1X4|B1B0W3|Q86SR5|Q969T1|Q9UFS8	Missense_Mutation	SNP	25	0.00	0	27	20.59	7	pfam_GoLoco_motif,pfam_TPR_1,smart_TPR_repeat,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Q638H	ENST00000440944.1	37	c.1914	CCDS48055.1	9	.	.	.	.	.	.	.	.	.	.	G	20.9	4.071357	0.76301	.	.	ENSG00000160360	ENST00000440944;ENST00000354753;ENST00000429455;ENST00000392944;ENST00000291775	D;D	0.91124	-2.79;-2.78	4.58	1.53	0.23141	GoLoco motif (3);	0.000000	0.85682	D	0.000000	D	0.92779	0.7704	M	0.65498	2.005	0.53688	D	0.999978	D	0.89917	1.0	D	0.97110	1.0	D	0.89936	0.4069	10	0.72032	D	0.01	-13.4905	6.3897	0.21579	0.1448:0.0:0.7085:0.1467	.	638	Q86YR5	GPSM1_HUMAN	H	638;615;129;129;129	ENSP00000392828:Q638H;ENSP00000346797:Q615H	ENSP00000291775:Q129H	Q	+	3	2	GPSM1	138372379	1.000000	0.71417	0.980000	0.43619	0.828000	0.46876	6.274000	0.72587	0.003000	0.14656	0.313000	0.20887	CAG	-	pfam_GoLoco_motif,smart_GoLoco_motif,pfscan_GoLoco_motif		0.711	GPSM1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	GPSM1	protein_coding		G	NM_015597	-		139252558	+1	no_errors	ENST00000440944	ensembl	human	known	74_37	missense	SNP	1.000	C
ICAM4	3386	genome.wustl.edu	37	19	10397718	10397719	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr19:10397718_10397719insT	ENST00000380770.3	+	1	76_77	c.30_31insT	c.(31-33)tttfs	p.F11fs	ICAM5_ENST00000221980.4_5'Flank|CTD-2369P2.8_ENST00000589379.1_RNA|ICAM4_ENST00000340992.4_Frame_Shift_Ins_p.F11fs|ICAM4_ENST00000393717.2_Frame_Shift_Ins_p.F11fs|CTD-2369P2.5_ENST00000592893.1_RNA	NM_001544.4	NP_001535.1	Q14773	ICAM4_HUMAN	intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)	11					extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)	p.L13fs*40(1)		breast(1)|large_intestine(3)|lung(2)|pancreas(1)	7			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			TGTCGCTGCTGTTTTTTTTGGC	0.673																																																	1	Deletion - Frameshift(1)	large_intestine(1)						ENSG00000105371																																			ICAM4	SO:0001589	frameshift_variant	0				HGNC	X93093	CCDS12232.1, CCDS32904.1, CCDS42500.1	19p13.2	2014-07-19	2006-02-23		ENSG00000105371	ENSG00000105371		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5347	protein-coding gene	gene with protein product		614088	"""intercellular adhesion molecule 4, Landsteiner-Wiener blood group"", ""Landsteiner-Wiener blood group"", ""intercellular adhesion molecule 4 (LW blood group)"""	LW		8639917, 6431896	Standard	NM_001039132		Approved	CD242	uc002mnr.2	Q14773	OTTHUMG00000180405	ENST00000380770.3:c.38dupT	19.37:g.10397726_10397726dupT	ENSP00000370147:p.Phe11fs	Somatic	0	23	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29	A0M8X2|Q14771|Q14772|Q16375|Q9BWR0	Frame_Shift_Ins	INS	25	0.00	0	50	0.00	0	pfam_ICAM_N	p.L12fs	ENST00000380770.3	37	c.30_31	CCDS12232.1	19																																																																																			-	NULL		0.673	ICAM4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ICAM4	protein_coding	OTTHUMT00000451214.1	-	NM_001544			10397719	+1	no_errors	ENST00000340992	ensembl	human	known	74_37	frame_shift_ins	INS	0.002:0.004	T
PTPN11	5781	genome.wustl.edu	37	12	112915797	112915797	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr12:112915797C>T	ENST00000351677.2	+	9	1268	c.1070C>T	c.(1069-1071)aCg>aTg	p.T357M	PTPN11_ENST00000392597.1_Missense_Mutation_p.T357M	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	357	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						GTCATGACAACGAAAGAAGTG	0.408			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																															Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	0								ENSG00000179295						67.0	64.0	65.0					12																	112915797		2203	4300	6503	PTPN11	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	-	HGNC	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.1070C>T	12.37:g.112915797C>T	ENSP00000340944:p.Thr357Met	Somatic	0	42	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	26	29.73	A8K1D9|Q96HD7	Missense_Mutation	SNP	24	0.00	0	42	24.56	14	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_SH2,smart_SH2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-6/11,pfscan_SH2,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_SH2	p.T357M	ENST00000351677.2	37	c.1070	CCDS9163.1	12	.	.	.	.	.	.	.	.	.	.	C	34	5.328274	0.95733	.	.	ENSG00000179295	ENST00000392597;ENST00000351677	D;D	0.99436	-5.9;-5.9	5.94	5.94	0.96194	.	0.045103	0.85682	D	0.000000	D	0.99680	0.9880	H	0.96269	3.795	0.80722	D	1	D;D	0.63880	0.993;0.992	P;P	0.60345	0.754;0.873	D	0.97896	1.0300	10	0.87932	D	0	.	20.417	0.99027	0.0:1.0:0.0:0.0	.	357;357	Q06124-2;Q06124-3	.;.	M	357	ENSP00000376376:T357M;ENSP00000340944:T357M	ENSP00000340944:T357M	T	+	2	0	PTPN11	111400180	1.000000	0.71417	0.991000	0.47740	0.990000	0.78478	7.423000	0.80229	2.839000	0.97877	0.580000	0.79431	ACG	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pirsf_Tyr_Pase_non-rcpt_typ-6/11,pfscan_Tyr_Pase_rcpt/non-rcpt		0.408	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN11	protein_coding	OTTHUMT00000259496.2	C		-		112915797	+1	no_errors	ENST00000351677	ensembl	human	known	74_37	missense	SNP	1.000	T
RP11-725P16.2	0	genome.wustl.edu	37	2	133103682	133103687	+	lincRNA	DEL	CATTTT	CATTTT	-	rs200045528|rs559211792|rs201666245|rs370794909|rs139976531	byFrequency	TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	CATTTT	CATTTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr2:133103682_133103687delCATTTT	ENST00000608279.1	-	0	1183_1188																											ATTTTCCTTTCATTTTTTTCAAAAAA	0.272																																																	0								ENSG00000272769																																			RP11-725P16.2			0				Clone_based_vega_gene																													2.37:g.133103682_133103687delCATTTT		Somatic	NA	NA	NA		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	85	0.00	0	104	0.00	0	-	NULL	ENST00000608279.1	37	NULL		2																																																																																			-	-		0.272	RP11-725P16.2-001	KNOWN	basic	lincRNA	ENSG00000272769	lincRNA	OTTHUMT00000472122.1	CATTTT				133103687	-1	no_errors	ENST00000608279	ensembl	human	known	74_37	rna	DEL	0.117:0.123:0.125:0.127:0.125:0.120	-
DNAJC15	29103	genome.wustl.edu	37	13	43659903	43659903	+	Splice_Site	SNP	G	G	T			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr13:43659903G>T	ENST00000379221.2	+	5	735		c.e5-1			NM_013238.2	NP_037370.2	Q9Y5T4	DJC15_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 15						cellular response to starvation (GO:0009267)|negative regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902957)|negative regulation of protein complex assembly (GO:0031333)|protein transport (GO:0015031)|regulation of lipid metabolic process (GO:0019216)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|kidney(1)|urinary_tract(1)	4		Lung NSC(96;4.3e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0737)		TCTTTTTACAGCCCATCTGCT	0.308																																																	0								ENSG00000120675						68.0	68.0	68.0					13																	43659903		2203	4298	6501	DNAJC15	SO:0001630	splice_region_variant	0			-	HGNC	AF126743	CCDS9388.1	13q14.1	2011-09-02	2005-06-30	2005-06-30	ENSG00000120675	ENSG00000120675		"""Heat shock proteins / DNAJ (HSP40)"""	20325	protein-coding gene	gene with protein product		615339	"""DnaJ (Hsp40) homolog, subfamily D, member 1"""	DNAJD1		11358853	Standard	NM_013238		Approved	MCJ	uc001uyy.3	Q9Y5T4	OTTHUMG00000016813	ENST00000379221.2:c.312-1G>T	13.37:g.43659903G>T		Somatic	0	17	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	B2R4L0|Q5T219|Q6X963	Splice_Site	SNP	37	0.00	0	55	0.00	0	-	e5-1	ENST00000379221.2	37	c.312-1	CCDS9388.1	13	.	.	.	.	.	.	.	.	.	.	G	9.015	0.983515	0.18889	.	.	ENSG00000120675	ENST00000379221	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9678	0.92702	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAJC15	42557903	1.000000	0.71417	1.000000	0.80357	0.037000	0.13140	8.005000	0.88553	2.711000	0.92665	0.655000	0.94253	.	-	-		0.308	DNAJC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC15	protein_coding	OTTHUMT00000044709.2	G	NM_013238	-	Intron	43659903	+1	no_errors	ENST00000379221	ensembl	human	known	74_37	splice_site	SNP	1.000	T
PCDHB14	56122	genome.wustl.edu	37	5	140603414	140603414	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr5:140603414C>G	ENST00000239449.4	+	1	337	c.337C>G	c.(337-339)Cct>Gct	p.P113A	PCDHB14_ENST00000515856.2_Intron	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	113	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTTGGAAAACCCTTTACAGTT	0.428																																					Ovarian(141;50 1831 27899 33809 37648)												0								ENSG00000120327						99.0	111.0	107.0					5																	140603414		2203	4300	6503	PCDHB14	SO:0001583	missense	0			-	HGNC	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.337C>G	5.37:g.140603414C>G	ENSP00000239449:p.Pro113Ala	Somatic	0	55	0.00		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	76	10.59	B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	41	0.00	0	58	13.43	9	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P113A	ENST00000239449.4	37	c.337	CCDS4256.1	5	.	.	.	.	.	.	.	.	.	.	-	22.9	4.353000	0.82132	.	.	ENSG00000120327	ENST00000239449	T	0.55930	0.49	4.92	4.92	0.64577	Cadherin (1);Cadherin-like (1);	.	.	.	.	T	0.79040	0.4379	H	0.96943	3.91	0.80722	D	1	P	0.52316	0.952	P	0.55455	0.776	D	0.87051	0.2147	9	0.87932	D	0	.	18.0965	0.89492	0.0:1.0:0.0:0.0	.	113	Q9Y5E9	PCDBE_HUMAN	A	113	ENSP00000239449:P113A	ENSP00000239449:P113A	P	+	1	0	PCDHB14	140583598	0.697000	0.27767	1.000000	0.80357	0.991000	0.79684	2.622000	0.46427	2.434000	0.82447	0.650000	0.86243	CCT	-	superfamily_Cadherin-like		0.428	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB14	protein_coding	OTTHUMT00000251814.2	C	NM_018934	-		140603414	+1	no_errors	ENST00000239449	ensembl	human	known	74_37	missense	SNP	1.000	G
PPP2R2B	5521	genome.wustl.edu	37	5	146258290	146258291	+	5'UTR	INS	-	-	GCTGCTGCT	rs142461655|rs57408722|rs10591869	byFrequency	TCGA-DX-A3U8-01A-11D-A29N-09	TCGA-DX-A3U8-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729229fe-92b9-439b-acd2-b49159116a41	de98db7b-81ee-4500-ab0a-80894271d467	g.chr5:146258290_146258291insGCTGCTGCT	ENST00000453001.1	-	0	166_167				PPP2R2B_ENST00000394413.3_5'Flank|PPP2R2B_ENST00000336640.6_Intron|PPP2R2B_ENST00000508545.2_Intron|PPP2R2B_ENST00000394414.1_Intron|PPP2R2B_ENST00000530902.1_5'UTR|PPP2R2B_ENST00000394410.2_Intron|PPP2R2B_ENST00000504198.1_Intron|PPP2R2B_ENST00000394411.4_5'UTR|PPP2R2B_ENST00000394409.3_Intron|PPP2R2B_ENST00000356826.3_Intron			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta						apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCGCACTCGCAgctgctgctgc	0.718														1222	0.24401	0.2375	0.2262	5008	,	,		13292	0.3562		0.1421	False		,,,				2504	0.2546																0								ENSG00000156475																																			PPP2R2B	SO:0001623	5_prime_UTR_variant	0				HGNC	M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000453001.1:c.-152->AGCAGCAGC	5.37:g.146258291_146258299dupGCTGCTGCT		Somatic	NA	NA	NA		0.5364044346077164	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	RNA	INS	18	14.29	3	40	9.09	4	-	NULL	ENST00000453001.1	37	NULL	CCDS4284.1	5																																																																																			-	-		0.718	PPP2R2B-204	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R2B	protein_coding	OTTHUMT00000388939.2	-	NM_181678			146258291	-1	no_errors	ENST00000530902	ensembl	human	known	74_37	rna	INS	0.975:0.996	GCTGCTGCT
