#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
TSTD3	100130890	genome.wustl.edu	37	6	99968898	99968899	+	RNA	INS	-	-	GCGCC			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr6:99968898_99968899insGCGCC	ENST00000452647.2	+	0	330_331							H0UI37	TSTD3_HUMAN	thiosulfate sulfurtransferase (rhodanese)-like domain containing 3																		GCCGGAGCAGGAGGAGAAGGAG	0.683											OREG0017579	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000228439																																			TSTD3			0				HGNC			6q16.2	2012-07-04			ENSG00000228439	ENSG00000228439			40910	protein-coding gene	gene with protein product							Standard	NM_001195131		Approved		uc021zde.1	H0UI37	OTTHUMG00000015265		6.37:g.99968898_99968899insGCGCC		Somatic	NA	NA	NA	1347	0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000452647.2	37	NULL		6																																																																																			-	-		0.683	TSTD3-001	KNOWN	basic	antisense	TSTD3	antisense	OTTHUMT00000041605.2	-	NM_001195131			99968899	+1	no_errors	ENST00000452647	ensembl	human	known	74_37	rna	INS	0.000:0.000	GCGCC
SAR1A	56681	genome.wustl.edu	37	10	71921382	71921382	+	Silent	SNP	T	T	C			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr10:71921382T>C	ENST00000373242.2	-	4	367	c.171A>G	c.(169-171)ctA>ctG	p.L57L	SAR1A_ENST00000431664.2_Silent_p.L57L|SAR1A_ENST00000373241.4_Silent_p.L57L|SAR1A_ENST00000458634.2_Silent_p.L14L|SAR1A_ENST00000373238.1_Silent_p.L57L|SAR1A_ENST00000373236.1_Silent_p.L57L|SAR1A_ENST00000477464.1_5'UTR	NM_001142648.1	NP_001136120.1	Q9NR31	SAR1A_HUMAN	secretion associated, Ras related GTPase 1A	57					intracellular protein transport (GO:0006886)|negative regulation of cargo loading into COPII-coated vesicle (GO:1901303)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)			NS(1)|endometrium(1)|large_intestine(1)|lung(3)	6						TACTCGGATGTAGTGTTGGAA	0.398																																																	0								ENSG00000079332						103.0	94.0	97.0					10																	71921382		2203	4300	6503	SAR1A	SO:0001819	synonymous_variant	0			-	HGNC		CCDS7298.1	10q22.1	2014-03-07	2014-03-07	2005-10-21	ENSG00000079332	ENSG00000079332			10534	protein-coding gene	gene with protein product		607691	"""SAR1a gene homolog (S. cerevisiae) 1"", ""SAR1a gene homolog 1 (S. cerevisiae)"", ""SAR1 homolog A (S. cerevisiae)"""	SARA1		10871277	Standard	NM_020150		Approved	SAR1, Sara	uc010qji.2	Q9NR31	OTTHUMG00000018400	ENST00000373242.2:c.171A>G	10.37:g.71921382T>C		Somatic	0	55	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	26	25.71	B4DQ19	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gprotein_alpha_su,pfam_MIRO-like,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.L57	ENST00000373242.2	37	c.171	CCDS7298.1	10																																																																																			-	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gprotein_alpha_su,pfam_MIRO-like,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom		0.398	SAR1A-007	KNOWN	basic|appris_principal|CCDS	protein_coding	SAR1A	protein_coding	OTTHUMT00000048500.2	T		-		71921382	-1	no_errors	ENST00000373238	ensembl	human	known	74_37	silent	SNP	0.893	C
PKN2	5586	genome.wustl.edu	37	1	89206944	89206944	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr1:89206944G>T	ENST00000370521.3	+	2	681	c.322G>T	c.(322-324)Gtt>Ttt	p.V108F	PKN2_ENST00000370513.5_Missense_Mutation_p.V108F|PKN2_ENST00000316005.7_Missense_Mutation_p.V108F|PKN2_ENST00000370505.3_Intron	NM_006256.2	NP_006247.1	Q16513	PKN2_HUMAN	protein kinase N2	108					apical junction assembly (GO:0043297)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|epithelial cell migration (GO:0010631)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	apical junction complex (GO:0043296)|centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium (GO:0030027)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(1)	33		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		TGCACATATTGTTGTATCAGA	0.249																																																	0								ENSG00000065243						44.0	42.0	42.0					1																	89206944		1806	4069	5875	PKN2	SO:0001583	missense	0			-	HGNC	U33052	CCDS714.1	1p22	2014-04-23	2004-07-01	2004-07-01	ENSG00000065243	ENSG00000065243			9406	protein-coding gene	gene with protein product	"""cardiolipin-activated protein kinase Pak2"""	602549	"""protein kinase C-like 2"""	PRKCL2		7988719, 7851406	Standard	NM_006256		Approved	PRK2, Pak-2, STK7	uc001dmn.3	Q16513	OTTHUMG00000010074	ENST00000370521.3:c.322G>T	1.37:g.89206944G>T	ENSP00000359552:p.Val108Phe	Somatic	0	37	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B4DQ21|B4DTP5|B4DVG1|D3DT24|Q08AF4|Q9H1W4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_HR1_rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,superfamily_C2_dom,smart_HR1_rho-bd,smart_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom	p.V108F	ENST00000370521.3	37	c.322	CCDS714.1	1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.693117	0.88735	.	.	ENSG00000065243	ENST00000370521;ENST00000316005;ENST00000370513	T;T;T	0.18338	2.22;2.22;2.22	5.58	5.58	0.84498	.	0.000000	0.40469	U	0.001086	T	0.35885	0.0947	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.89917	0.999;0.996;1.0;1.0	D;D;D;D	0.91635	0.995;0.989;0.999;0.989	T	0.09907	-1.0653	10	0.72032	D	0.01	.	19.5748	0.95438	0.0:0.0:1.0:0.0	.	108;108;108;108	B4DTP5;E7ESL7;Q16513;B1AL79	.;.;PKN2_HUMAN;.	F	108	ENSP00000359552:V108F;ENSP00000317851:V108F;ENSP00000359544:V108F	ENSP00000317851:V108F	V	+	1	0	PKN2	88979532	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.622000	0.88805	0.557000	0.71058	GTT	-	pfam_HR1_rho-bd,smart_HR1_rho-bd		0.249	PKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKN2	protein_coding	OTTHUMT00000027828.3	G	NM_006256	-		89206944	+1	no_errors	ENST00000370521	ensembl	human	known	74_37	missense	SNP	1.000	T
SRSF3	6428	genome.wustl.edu	37	6	36564553	36564553	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr6:36564553C>A	ENST00000373715.6	+	2	130	c.14C>A	c.(13-15)tCc>tAc	p.S5Y	SRSF3_ENST00000339436.7_Missense_Mutation_p.S5Y	NM_003017.4	NP_003008.1	P84103	SRSF3_HUMAN	serine/arginine-rich splicing factor 3	5	Sufficiernt for interaction with NXF1.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(2)	7						CATCGTGATTCCTGTCCATTG	0.383																																																	0								ENSG00000112081						128.0	125.0	126.0					6																	36564553		2203	4300	6503	SRSF3	SO:0001583	missense	0			-	HGNC	L10838	CCDS4823.1	6p21	2013-02-12	2010-06-22	2010-06-22	ENSG00000112081	ENSG00000112081		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10785	protein-coding gene	gene with protein product		603364	"""splicing factor, arginine/serine-rich 3"""	SFRS3		1577277, 20516191	Standard	NM_003017		Approved	SRp20	uc003omj.3	P84103	OTTHUMG00000014599	ENST00000373715.6:c.14C>A	6.37:g.36564553C>A	ENSP00000362820:p.Ser5Tyr	Somatic	0	54	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B4E241|O08831|P23152|Q5R3K0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S5Y	ENST00000373715.6	37	c.14	CCDS4823.1	6	.	.	.	.	.	.	.	.	.	.	C	21.5	4.164826	0.78339	.	.	ENSG00000112081	ENST00000373715;ENST00000339436	T;T	0.13089	2.83;2.62	5.32	5.32	0.75619	.	0.100532	0.64402	D	0.000002	T	0.19846	0.0477	L	0.54323	1.7	0.58432	D	0.999994	D;D	0.61697	0.979;0.99	P;P	0.59357	0.605;0.856	T	0.01182	-1.1426	10	0.22706	T	0.39	.	19.363	0.94448	0.0:1.0:0.0:0.0	.	5;5	B4E241;P84103	.;SRSF3_HUMAN	Y	5	ENSP00000362820:S5Y;ENSP00000344762:S5Y	ENSP00000344762:S5Y	S	+	2	0	SRSF3	36672531	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.720000	0.54933	2.648000	0.89879	0.561000	0.74099	TCC	-	NULL		0.383	SRSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRSF3	protein_coding	OTTHUMT00000040347.2	C	NM_003017	-		36564553	+1	no_errors	ENST00000373715	ensembl	human	known	74_37	missense	SNP	1.000	A
JAK1	3716	genome.wustl.edu	37	1	65305469	65305469	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr1:65305469C>A	ENST00000342505.4	-	20	2907	c.2659G>T	c.(2659-2661)Ggg>Tgg	p.G887W	JAK1_ENST00000465376.1_5'Flank	NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	887	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	TCAACCTTCCCAAAGTGGCCC	0.552			Mis		ALL																																			Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	0								ENSG00000162434						59.0	56.0	57.0					1																	65305469		1932	4145	6077	JAK1	SO:0001583	missense	0			-	HGNC	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.2659G>T	1.37:g.65305469C>A	ENSP00000343204:p.Gly887Trp	Somatic	0	33	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	7	69.57	Q59GQ2|Q9UD26	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak1,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_SH2,pfscan_Prot_kinase_dom	p.G887W	ENST00000342505.4	37	c.2659	CCDS41346.1	1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.553702	0.86231	.	.	ENSG00000162434	ENST00000342505	D	0.95137	-3.62	4.88	4.88	0.63580	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.98469	0.9490	H	0.97940	4.11	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99771	1.1024	9	0.87932	D	0	-6.7415	18.2322	0.89937	0.0:1.0:0.0:0.0	.	887	P23458	JAK1_HUMAN	W	887	ENSP00000343204:G887W	ENSP00000343204:G887W	G	-	1	0	JAK1	65078057	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.273000	0.78527	2.527000	0.85204	0.563000	0.77884	GGG	-	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.552	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK1	protein_coding	OTTHUMT00000025791.1	C	NM_002227	-		65305469	-1	no_errors	ENST00000342505	ensembl	human	known	74_37	missense	SNP	1.000	A
LSR	51599	genome.wustl.edu	37	19	35739793	35739793	+	Silent	SNP	C	C	T	rs376521122		TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr19:35739793C>T	ENST00000361790.3	+	1	171	c.12C>T	c.(10-12)gaC>gaT	p.D4D	LSR_ENST00000602122.1_Silent_p.D4D|LSR_ENST00000347609.4_Silent_p.D4D|AC002128.5_ENST00000604161.1_RNA|LSR_ENST00000597933.1_Intron|LSR_ENST00000360798.3_Silent_p.D4D|LSR_ENST00000354900.3_Silent_p.D4D|LSR_ENST00000427250.1_5'Flank	NM_205834.3	NP_991403.1	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	4					embryo development (GO:0009790)|liver development (GO:0001889)	chylomicron (GO:0042627)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			TGCAACAGGACGGACTTGGAG	0.587																																																	0								ENSG00000105699	C	,,	0,4406		0,0,2203	60.0	60.0	60.0		12,12,12	-6.4	0.0	19		60	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	LSR	NM_015925.5,NM_205834.2,NM_205835.2	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	4/631,4/650,4/582	35739793	1,13005	2203	4300	6503	LSR	SO:0001819	synonymous_variant	0			-	HGNC	AF130366	CCDS12449.1, CCDS12450.1, CCDS12451.1, CCDS59376.1	19q13.12	2013-01-11			ENSG00000105699	ENSG00000105699		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29572	protein-coding gene	gene with protein product	"""lipolysis-stimulated remnant"", ""immunoglobulin-like domain containing receptor 3"""					10224102	Standard	NM_015925		Approved	LISCH7, ILDR3	uc002nyl.3	Q86X29		ENST00000361790.3:c.12C>T	19.37:g.35739793C>T		Somatic	0	36	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A6NDW3|B4DKL4|E9PHD4|O00112|O00426|Q6ZT80|Q8NBM0|Q9BT33|Q9UQL3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_LISCH7,smart_Ig_sub,pfscan_Ig-like_dom	p.D4	ENST00000361790.3	37	c.12	CCDS12450.1	19																																																																																			-	NULL		0.587	LSR-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LSR	protein_coding	OTTHUMT00000465513.2	C	NM_015925	-		35739793	+1	no_errors	ENST00000361790	ensembl	human	known	74_37	silent	SNP	0.000	T
AMER1	139285	genome.wustl.edu	37	X	63410105	63410105	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chrX:63410105G>A	ENST00000330258.3	-	2	3334	c.3062C>T	c.(3061-3063)gCt>gTt	p.A1021V	AMER1_ENST00000374869.3_Intron|AMER1_ENST00000403336.1_Intron	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	1021	Pro-rich.				adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									TGAGGGACGAGCTAGTTGAGG	0.572																																																	67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)						ENSG00000184675						53.0	60.0	57.0					X																	63410105		2122	4215	6337	AMER1	SO:0001583	missense	0			-	HGNC	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.3062C>T	X.37:g.63410105G>A	ENSP00000329117:p.Ala1021Val	Somatic	0	75	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	8	78.95	A2IB86|Q8N885	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Uncharacterised_FAM123	p.A1021V	ENST00000330258.3	37	c.3062	CCDS14377.2	X	.	.	.	.	.	.	.	.	.	.	G	7.983	0.751674	0.15778	.	.	ENSG00000184675	ENST00000330258	T	0.43688	0.94	4.93	3.16	0.36331	.	.	.	.	.	T	0.25382	0.0617	N	0.24115	0.695	0.54753	D	0.999987	B	0.12013	0.005	B	0.12837	0.008	T	0.05131	-1.0904	8	.	.	.	-1.2796	8.1759	0.31281	0.2017:0.0:0.7983:0.0	.	1021	Q5JTC6	F123B_HUMAN	V	1021	ENSP00000329117:A1021V	.	A	-	2	0	FAM123B	63326830	0.014000	0.17966	0.951000	0.38953	0.210000	0.24377	0.610000	0.24253	1.221000	0.43506	0.529000	0.55759	GCT	-	NULL		0.572	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AMER1	protein_coding	OTTHUMT00000316584.1	G	NM_152424	-		63410105	-1	no_errors	ENST00000330258	ensembl	human	known	74_37	missense	SNP	0.852	A
KRT77	374454	genome.wustl.edu	37	12	53086631	53086631	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr12:53086631C>T	ENST00000341809.3	-	6	1142	c.1114G>A	c.(1114-1116)Gga>Aga	p.G372R	RP11-641A6.3_ENST00000547533.1_RNA|KRT77_ENST00000537195.1_Missense_Mutation_p.G139R	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	372	Coil 2.|Rod.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						AGGTCGTCTCCATGTCTCCCT	0.587																																																	0								ENSG00000189182						182.0	128.0	146.0					12																	53086631		2202	4272	6474	KRT77	SO:0001583	missense	0			-	HGNC	BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.1114G>A	12.37:g.53086631C>T	ENSP00000342710:p.Gly372Arg	Somatic	0	34	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	22	40.54	Q7RTS8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.G372R	ENST00000341809.3	37	c.1114	CCDS8837.1	12	.	.	.	.	.	.	.	.	.	.	C	24.4	4.524148	0.85600	.	.	ENSG00000189182	ENST00000341809;ENST00000537195	T;T	0.76839	-0.78;-1.05	3.44	2.53	0.30540	Filament (1);	.	.	.	.	D	0.88437	0.6436	M	0.88377	2.95	0.39453	D	0.967431	D	0.76494	0.999	D	0.75020	0.985	D	0.90665	0.4593	9	0.72032	D	0.01	.	13.0875	0.59149	0.1617:0.8383:0.0:0.0	.	372	Q7Z794	K2C1B_HUMAN	R	372;139	ENSP00000342710:G372R;ENSP00000440803:G139R	ENSP00000342710:G372R	G	-	1	0	KRT77	51372898	0.998000	0.40836	0.128000	0.21923	0.469000	0.32828	4.767000	0.62286	1.009000	0.39289	0.456000	0.33151	GGA	-	pfam_IF,superfamily_Prefoldin,prints_Keratin_II		0.587	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT77	protein_coding	OTTHUMT00000404111.1	C	NM_175078	-		53086631	-1	no_errors	ENST00000341809	ensembl	human	known	74_37	missense	SNP	0.999	T
TET2	54790	genome.wustl.edu	37	4	106196793	106196793	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:106196793G>A	ENST00000540549.1	+	11	5986	c.5126G>A	c.(5125-5127)tGt>tAt	p.C1709Y	TET2_ENST00000545826.1_3'UTR|TET2_ENST00000380013.4_Missense_Mutation_p.C1709Y|TET2_ENST00000513237.1_Missense_Mutation_p.C1730Y			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1709					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TTCAGCAGTTGTACCATTAGA	0.428			"""Mis N, F"""		MDS																																			Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0								ENSG00000168769						140.0	115.0	122.0					4																	106196793		692	1591	2283	TET2	SO:0001583	missense	0			-	HGNC	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.5126G>A	4.37:g.106196793G>A	ENSP00000442788:p.Cys1709Tyr	Somatic	0	35	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	25	41.86	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C1709Y	ENST00000540549.1	37	c.5126	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	G	6.243	0.412933	0.11812	.	.	ENSG00000168769	ENST00000540549;ENST00000513237;ENST00000380013	T;T;T	0.02787	4.17;4.16;4.17	5.16	3.38	0.38709	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	.	.	.	.	T	0.05960	0.0155	M	0.67953	2.075	0.80722	D	1	B;B	0.21688	0.059;0.059	B;B	0.26094	0.066;0.066	T	0.15983	-1.0418	9	0.40728	T	0.16	-5.1426	15.7582	0.78054	0.0:0.2314:0.7686:0.0	.	1730;1709	E7EQS8;Q6N021	.;TET2_HUMAN	Y	1709;1730;1709	ENSP00000442788:C1709Y;ENSP00000425443:C1730Y;ENSP00000369351:C1709Y	ENSP00000369351:C1709Y	C	+	2	0	TET2	106416242	1.000000	0.71417	0.009000	0.14445	0.274000	0.26718	5.729000	0.68538	0.515000	0.28320	0.467000	0.42956	TGT	-	NULL		0.428	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	protein_coding	OTTHUMT00000253952.2	G	NM_017628	-		106196793	+1	no_errors	ENST00000380013	ensembl	human	known	74_37	missense	SNP	1.000	A
EGF	1950	genome.wustl.edu	37	4	110897337	110897337	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:110897337G>C	ENST00000265171.5	+	13	2444	c.1999G>C	c.(1999-2001)Gaa>Caa	p.E667Q	EGF_ENST00000503392.1_Missense_Mutation_p.E667Q|EGF_ENST00000509793.1_Missense_Mutation_p.E625Q	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	667					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	GTCTGTGATTGAAATGGCCAA	0.448																																																	0								ENSG00000138798						126.0	107.0	113.0					4																	110897337		2203	4300	6503	EGF	SO:0001583	missense	0			-	HGNC	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.1999G>C	4.37:g.110897337G>C	ENSP00000265171:p.Glu667Gln	Somatic	0	54	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	48	22.58	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt	p.E667Q	ENST00000265171.5	37	c.1999	CCDS3689.1	4	.	.	.	.	.	.	.	.	.	.	G	29.8	5.041147	0.93685	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	D;D;D	0.95885	-3.84;-3.84;-3.84	5.77	5.77	0.91146	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.98018	0.9347	M	0.85373	2.75	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.996;1.0	D	0.98183	1.0458	10	0.62326	D	0.03	.	19.9915	0.97366	0.0:0.0:1.0:0.0	.	667;625;667	E7EVD2;P01133-2;P01133	.;.;EGF_HUMAN	Q	625;667;667	ENSP00000424316:E625Q;ENSP00000265171:E667Q;ENSP00000421384:E667Q	ENSP00000265171:E667Q	E	+	1	0	EGF	111116786	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.302000	0.89953	2.723000	0.93209	0.655000	0.94253	GAA	-	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.448	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EGF	protein_coding	OTTHUMT00000255065.1	G		-		110897337	+1	no_errors	ENST00000265171	ensembl	human	known	74_37	missense	SNP	1.000	C
NKD1	85407	genome.wustl.edu	37	16	50641010	50641010	+	Intron	SNP	C	C	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr16:50641010C>A	ENST00000268459.3	+	4	416				RP11-401P9.6_ENST00000379963.1_RNA|NKD1_ENST00000564336.1_Intron	NM_033119.4	NP_149110.1	Q969G9	NKD1_HUMAN	naked cuticle homolog 1 (Drosophila)						eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of convergent extension involved in axis elongation (GO:1901233)|positive regulation of non-canonical Wnt signaling pathway via JNK cascade (GO:1901231)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|prostate(1)|urinary_tract(2)	23		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		AATGGGACACCGGAGTCTGAA	0.413																																																	0								ENSG00000205414																																			RP11-401P9.6	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AF358135	CCDS10743.1	16q12.1	2013-01-10			ENSG00000140807	ENSG00000140807		"""EF-hand domain containing"""	17045	protein-coding gene	gene with protein product		607851				11356022	Standard	NM_033119		Approved		uc002egg.2	Q969G9	OTTHUMG00000133169	ENST00000268459.3:c.193-1195C>A	16.37:g.50641010C>A		Somatic	0	25	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	B2RC39|Q8WZ08	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000268459.3	37	NULL	CCDS10743.1	16	.	.	.	.	.	.	.	.	.	.	C	14.24	2.476183	0.44044	.	.	ENSG00000205414	ENST00000379963	.	.	.	4.27	-0.288	0.12855	.	.	.	.	.	T	0.35307	0.0927	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38779	-0.9645	5	0.87932	D	0	.	3.2299	0.06745	0.1841:0.5037:0.0:0.3122	.	.	.	.	L	7	.	ENSP00000369297:R7L	R	-	2	0	AC007608.1	49198511	0.000000	0.05858	0.002000	0.10522	0.929000	0.56500	-0.968000	0.03817	0.175000	0.19841	-0.225000	0.12378	CGG	-	-		0.413	NKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000205414	protein_coding	OTTHUMT00000256873.1	C		-		50641010	-1	no_errors	ENST00000379963	ensembl	human	known	74_37	rna	SNP	0.000	A
IRX1	79192	genome.wustl.edu	37	5	3600753	3600753	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr5:3600753C>A	ENST00000302006.3	+	3	1395	c.1343C>A	c.(1342-1344)cCg>cAg	p.P448Q	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	448					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						CCAGATTCGCCGGCACAGCAG	0.622																																																	0								ENSG00000170549						53.0	57.0	56.0					5																	3600753		2203	4300	6503	IRX1	SO:0001583	missense	0			-	HGNC	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.1343C>A	5.37:g.3600753C>A	ENSP00000305244:p.Pro448Gln	Somatic	0	48	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q7Z2F8|Q8N312	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,smart_Iroquois_homeo,pfscan_Homeobox_dom	p.P448Q	ENST00000302006.3	37	c.1343	CCDS34132.1	5	.	.	.	.	.	.	.	.	.	.	C	15.08	2.725982	0.48833	.	.	ENSG00000170549	ENST00000302006	T	0.59364	0.27	4.3	4.3	0.51218	.	0.376676	0.29119	N	0.013082	T	0.73590	0.3606	M	0.64997	1.995	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	T	0.77191	-0.2678	10	0.62326	D	0.03	.	16.7596	0.85508	0.0:1.0:0.0:0.0	.	448	P78414	IRX1_HUMAN	Q	448	ENSP00000305244:P448Q	ENSP00000305244:P448Q	P	+	2	0	IRX1	3653753	0.984000	0.35163	0.026000	0.17262	0.023000	0.10783	3.924000	0.56476	1.918000	0.55548	0.563000	0.77884	CCG	-	NULL		0.622	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRX1	protein_coding	OTTHUMT00000365546.1	C	NM_024337	-		3600753	+1	no_errors	ENST00000302006	ensembl	human	known	74_37	missense	SNP	0.996	A
TET2	54790	genome.wustl.edu	37	4	106196802	106196802	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:106196802G>A	ENST00000540549.1	+	11	5995	c.5135G>A	c.(5134-5136)aGa>aAa	p.R1712K	TET2_ENST00000545826.1_3'UTR|TET2_ENST00000380013.4_Missense_Mutation_p.R1712K|TET2_ENST00000513237.1_Missense_Mutation_p.R1733K			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1712					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TGTACCATTAGACCAAATGTA	0.433			"""Mis N, F"""		MDS																																			Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0								ENSG00000168769						127.0	105.0	112.0					4																	106196802		692	1591	2283	TET2	SO:0001583	missense	0			-	HGNC	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.5135G>A	4.37:g.106196802G>A	ENSP00000442788:p.Arg1712Lys	Somatic	0	35	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	24	40.00	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R1712K	ENST00000540549.1	37	c.5135	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	G	6.914	0.538352	0.13250	.	.	ENSG00000168769	ENST00000540549;ENST00000513237;ENST00000380013	T;T;T	0.02709	4.2;4.19;4.2	5.16	2.47	0.30058	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	.	.	.	.	T	0.01592	0.0051	N	0.11201	0.11	0.80722	D	1	B;B	0.13594	0.003;0.008	B;B	0.16289	0.015;0.011	T	0.50224	-0.8853	9	0.09084	T	0.74	-7.0319	8.3984	0.32570	0.2474:0.0:0.7526:0.0	.	1733;1712	E7EQS8;Q6N021	.;TET2_HUMAN	K	1712;1733;1712	ENSP00000442788:R1712K;ENSP00000425443:R1733K;ENSP00000369351:R1712K	ENSP00000369351:R1712K	R	+	2	0	TET2	106416251	1.000000	0.71417	0.001000	0.08648	0.328000	0.28507	3.873000	0.56093	0.185000	0.20105	0.467000	0.42956	AGA	-	NULL		0.433	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	protein_coding	OTTHUMT00000253952.2	G	NM_017628	-		106196802	+1	no_errors	ENST00000380013	ensembl	human	known	74_37	missense	SNP	0.993	A
PDGFC	56034	genome.wustl.edu	37	4	157892061	157892061	+	5'UTR	SNP	T	T	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:157892061T>A	ENST00000502773.1	-	0	485				PDGFC_ENST00000422544.2_5'Flank|PDGFC_ENST00000541126.1_5'UTR	NM_016205.2	NP_057289.1	Q9NRA1	PDGFC_HUMAN	platelet derived growth factor C						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cellular response to amino acid stimulus (GO:0071230)|central nervous system development (GO:0007417)|organ morphogenesis (GO:0009887)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)		CTCATTTGGCTGACTGGGGTG	0.607											OREG0016375	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000145431						40.0	43.0	42.0					4																	157892061		2203	4300	6503	PDGFC	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF091434	CCDS3795.1	4q32	2008-02-05			ENSG00000145431	ENSG00000145431			8801	protein-coding gene	gene with protein product		608452				10858496, 10858548	Standard	NM_016205		Approved	SCDGF, fallotein	uc003iph.2	Q9NRA1	OTTHUMG00000161803	ENST00000502773.1:c.-6A>T	4.37:g.157892061T>A		Somatic	0	28	0.00	1789	0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	13	35.00	B4DU34|B9EGR8|Q4W5M9|Q9UL22	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000502773.1	37	NULL	CCDS3795.1	4																																																																																			-	-		0.607	PDGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFC	protein_coding	OTTHUMT00000366123.1	T		-		157892061	-1	no_errors	ENST00000513664	ensembl	human	known	74_37	rna	SNP	1.000	A
TMEM14B	81853	genome.wustl.edu	37	6	10756863	10756864	+	3'UTR	INS	-	-	A	rs57806113|rs398065562		TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr6:10756863_10756864insA	ENST00000379542.5	+	0	624_625				SYCP2L_ENST00000543878.1_Intron|RP11-637O19.3_ENST00000480294.1_Intron|TMEM14B_ENST00000481240.1_Intron|TMEM14B_ENST00000467317.1_Intron|TMEM14B_ENST00000491103.1_3'UTR|TMEM14B_ENST00000379530.3_3'UTR|TMEM14B_ENST00000473276.1_3'UTR	NM_030969.3	NP_112231.3	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B							integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(2)|skin(2)	11	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				ACATTTTACCTAAAAAAAAAAA	0.366																																																	0								ENSG00000137210																																			TMEM14B	SO:0001624	3_prime_UTR_variant	0				HGNC	AL024498	CCDS4515.1, CCDS47372.1, CCDS75395.1, CCDS75396.1, CCDS75397.1	6p25.1-p23	2008-08-12			ENSG00000137210	ENSG00000137210			21384	protein-coding gene	gene with protein product							Standard	NM_030969		Approved	MGC1223	uc003mzk.4	Q9NUH8	OTTHUMG00000014246	ENST00000379542.5:c.*113->A	6.37:g.10756874_10756874dupA		Somatic	0	24	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53	Q5THN7|Q5THN8|Q96IX7|Q9BVN8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000379542.5	37	NULL	CCDS4515.1	6																																																																																			-	-		0.366	TMEM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM14B	protein_coding	OTTHUMT00000039836.1	-	NM_030969			10756864	+1	no_errors	ENST00000486421	ensembl	human	known	74_37	rna	INS	0.029:0.005	A
CLOCK	9575	genome.wustl.edu	37	4	56304530	56304532	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	CTG	CTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:56304530_56304532delCTG	ENST00000309964.4	-	21	2528_2530	c.2278_2280delCAG	c.(2278-2280)cagdel	p.Q760del	CLOCK_ENST00000513440.1_In_Frame_Del_p.Q760del|CLOCK_ENST00000381322.1_In_Frame_Del_p.Q760del	NM_004898.3	NP_004889.1	O15516	CLOCK_HUMAN	clock circadian regulator	760	Gln-rich.|Interaction with NR3C1. {ECO:0000250|UniProtKB:O08785}.				cellular response to ionizing radiation (GO:0071479)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA damage checkpoint (GO:0000077)|histone acetylation (GO:0016573)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription, DNA-templated (GO:0045892)|photoperiodism (GO:0009648)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|chromosome (GO:0005694)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone acetyltransferase activity (GO:0004402)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(8)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			cctgggagctctgctgctgctgc	0.512																																																	0								ENSG00000134852																																			CLOCK	SO:0001651	inframe_deletion	0				HGNC	AF011568	CCDS3500.1	4q12	2012-12-07	2012-12-07		ENSG00000134852	ENSG00000134852		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	2082	protein-coding gene	gene with protein product		601851	"""clock (mouse) homolog"", ""clock homolog (mouse)"""			10198158	Standard	NM_001267843		Approved	KIAA0334, KAT13D, bHLHe8	uc003hba.2	O15516	OTTHUMG00000102141	ENST00000309964.4:c.2278_2280delCAG	4.37:g.56304539_56304541delCTG	ENSP00000308741:p.Gln760del	Somatic	0	27	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	7	22.22	A0AV01|A2I2N9|O14516|Q9UIT8	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PAS_fold_3,pfam_PAS_fold,pfam_bHLH_dom,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,pfscan_PAS,pfscan_bHLH_dom,prints_Nuc_translocat	p.Q760in_frame_del	ENST00000309964.4	37	c.2280_2278	CCDS3500.1	4																																																																																			-	NULL		0.512	CLOCK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CLOCK	protein_coding	OTTHUMT00000361993.2	CTG	NM_004898			56304532	-1	no_errors	ENST00000309964	ensembl	human	known	74_37	in_frame_del	DEL	0.944:0.945:1.000	-
HEBP1	50865	genome.wustl.edu	37	12	13153388	13153389	+	5'Flank	INS	-	-	GCAGCAGTGCAGCAGT	rs147879664|rs77117939	byFrequency	TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr12:13153388_13153389insGCAGCAGTGCAGCAGT	ENST00000014930.4	-	0	0				RP11-377D9.3_ENST00000543321.1_lincRNA|HEBP1_ENST00000536942.1_5'Flank	NM_015987.4	NP_057071.2	Q9NRV9	HEBP1_HUMAN	heme binding protein 1						circadian rhythm (GO:0007623)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	heme binding (GO:0020037)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	7		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.153)		CGGgcagcagggcagcagtgca	0.748														896	0.178914	0.0658	0.2205	5008	,	,		10542	0.2956		0.17	False		,,,				2504	0.1912																0								ENSG00000255621																																			RP11-377D9.3	SO:0001631	upstream_gene_variant	0				Clone_based_vega_gene	AF117615	CCDS31749.1	12p13.2	2014-01-30			ENSG00000013583	ENSG00000013583		"""Endogenous ligands"""	17176	protein-coding gene	gene with protein product		605826				10640688	Standard	NM_015987		Approved	HEBP, HBP	uc001rbd.3	Q9NRV9	OTTHUMG00000168771		12.37:g.13153388_13153389insGCAGCAGTGCAGCAGT	Exception_encountered	Somatic	NA	NA	NA		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K1G2|Q9Y5Z5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000014930.4	37	NULL	CCDS31749.1	12																																																																																			-	-		0.748	HEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000255621	protein_coding	OTTHUMT00000401001.1	-				13153389	+1	no_errors	ENST00000543321	ensembl	human	known	74_37	rna	INS	0.055:0.003	GCAGCAGTGCAGCAGT
PRRC2A	7916	genome.wustl.edu	37	6	31604303	31604303	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr6:31604303C>T	ENST00000376033.2	+	27	6086	c.5852C>T	c.(5851-5853)cCa>cTa	p.P1951L	PRRC2A_ENST00000376007.4_Missense_Mutation_p.P1951L	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1951	3 X 50 AA type C repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CAGGATCTGCCATCCCCTTCG	0.512																																																	0								ENSG00000204469						145.0	164.0	157.0					6																	31604303		1510	2709	4219	PRRC2A	SO:0001583	missense	0			-	HGNC	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.5852C>T	6.37:g.31604303C>T	ENSP00000365201:p.Pro1951Leu	Somatic	0	73	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	28	36.36	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BAT2_N	p.P1951L	ENST00000376033.2	37	c.5852	CCDS4708.1	6	.	.	.	.	.	.	.	.	.	.	C	11.67	1.707209	0.30322	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033;ENST00000376010	T;T	0.01572	4.76;4.76	5.35	5.35	0.76521	.	0.000000	0.51477	D	0.000096	T	0.01800	0.0057	L	0.36672	1.1	0.51767	D	0.999934	D	0.54207	0.965	P	0.48598	0.583	T	0.63681	-0.6582	10	0.87932	D	0	-7.0082	16.1031	0.81201	0.0:1.0:0.0:0.0	.	1951	P48634	PRC2A_HUMAN	L	1943;1932;1951;1951;1176	ENSP00000365175:P1951L;ENSP00000365201:P1951L	ENSP00000365175:P1951L	P	+	2	0	PRRC2A	31712282	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	1.840000	0.39230	2.784000	0.95788	0.551000	0.68910	CCA	-	NULL		0.512	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2A	protein_coding	OTTHUMT00000259319.1	C	NM_080686	-		31604303	+1	no_errors	ENST00000376007	ensembl	human	known	74_37	missense	SNP	1.000	T
SAFB2	9667	genome.wustl.edu	37	19	5592842	5592842	+	Missense_Mutation	SNP	C	C	T	rs547264084		TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr19:5592842C>T	ENST00000252542.4	-	16	2528	c.2264G>A	c.(2263-2265)cGt>cAt	p.R755H		NM_014649.2	NP_055464.1	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	755	Arg-rich.|Interacts with SAFB1.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		AAAGTCTGCACGATATCGGTC	0.502																																					Ovarian(127;888 1728 23957 44128 52668)												0								ENSG00000130254						158.0	119.0	132.0					19																	5592842		2203	4300	6503	SAFB2	SO:0001583	missense	0			-	HGNC	D50928	CCDS32879.1	19p13.3	2013-02-12				ENSG00000130254		"""RNA binding motif (RRM) containing"""	21605	protein-coding gene	gene with protein product		608066				12660241	Standard	NM_014649		Approved	KIAA0138	uc002mcd.3	Q14151		ENST00000252542.4:c.2264G>A	19.37:g.5592842C>T	ENSP00000252542:p.Arg755His	Somatic	0	43	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B4DKG3|Q8TB13	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,pfam_SAP_dom,smart_SAP_dom,smart_RRM_dom,pfscan_SAP_dom,pfscan_RRM_dom	p.R755H	ENST00000252542.4	37	c.2264	CCDS32879.1	19	.	.	.	.	.	.	.	.	.	.	C	6.959	0.546912	0.13312	.	.	ENSG00000130254	ENST00000252542	T	0.09723	2.95	4.7	3.67	0.42095	.	0.357092	0.24076	N	0.041769	T	0.08268	0.0206	L	0.38175	1.15	0.54753	D	0.999981	B	0.15473	0.013	B	0.08055	0.003	T	0.21381	-1.0247	10	0.24483	T	0.36	-7.8794	7.9751	0.30151	0.0:0.7567:0.0:0.2433	.	755	Q14151	SAFB2_HUMAN	H	755	ENSP00000252542:R755H	ENSP00000252542:R755H	R	-	2	0	SAFB2	5543842	0.935000	0.31712	0.668000	0.29813	0.049000	0.14656	1.888000	0.39708	0.969000	0.38237	0.561000	0.74099	CGT	-	NULL		0.502	SAFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAFB2	protein_coding	OTTHUMT00000451016.1	C	NM_014649	-		5592842	-1	no_errors	ENST00000252542	ensembl	human	known	74_37	missense	SNP	0.981	T
MCC	4163	genome.wustl.edu	37	5	112437570	112437570	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr5:112437570C>A	ENST00000302475.4	-	6	1257	c.694G>T	c.(694-696)Gag>Tag	p.E232*	MCC_ENST00000514701.3_5'UTR|MCC_ENST00000515367.2_Nonsense_Mutation_p.E169*|MCC_ENST00000408903.3_Nonsense_Mutation_p.E422*	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	232					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		AGCTCCTTCTCCCACCGAGAC	0.557																																																	0								ENSG00000171444						106.0	105.0	105.0					5																	112437570		2202	4300	6502	MCC	SO:0001587	stop_gained	0			-	HGNC		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.694G>T	5.37:g.112437570C>A	ENSP00000305617:p.Glu232*	Somatic	0	22	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	D3DT05|Q6ZR04	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_USH1C-bd_PDZ_domain,superfamily_tRNA-bd_arm	p.E232*	ENST00000302475.4	37	c.694	CCDS4111.1	5	.	.	.	.	.	.	.	.	.	.	C	42	9.735662	0.99251	.	.	ENSG00000171444	ENST00000302475;ENST00000515367;ENST00000408903	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-29.7723	19.596	0.95538	0.0:1.0:0.0:0.0	.	.	.	.	X	232;169;422	.	ENSP00000305617:E232X	E	-	1	0	MCC	112465469	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.180000	0.71981	2.711000	0.92665	0.655000	0.94253	GAG	-	superfamily_tRNA-bd_arm		0.557	MCC-001	KNOWN	basic|CCDS	protein_coding	MCC	protein_coding	OTTHUMT00000250736.3	C	NM_001085377	-		112437570	-1	no_errors	ENST00000302475	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ANPEP	290	genome.wustl.edu	37	15	90349396	90349396	+	Missense_Mutation	SNP	C	C	T	rs145360414	byFrequency	TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr15:90349396C>T	ENST00000300060.6	-	2	732	c.419G>A	c.(418-420)cGt>cAt	p.R140H		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	140	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	TCCCACACCACGCAGGACCAC	0.617																																					NSCLC(30;827 977 2459 19669 26125)												0								ENSG00000166825	C	HIS/ARG	2,4398	4.2+/-10.8	0,2,2198	79.0	68.0	72.0		419	2.1	0.1	15	dbSNP_134	72	0,8598		0,0,4299	no	missense	ANPEP	NM_001150.2	29	0,2,6497	TT,TC,CC		0.0,0.0455,0.0154	benign	140/968	90349396	2,12996	2200	4299	6499	ANPEP	SO:0001583	missense	0			-	HGNC	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.419G>A	15.37:g.90349396C>T	ENSP00000300060:p.Arg140His	Somatic	0	38	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	25	32.43	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.R140H	ENST00000300060.6	37	c.419	CCDS10356.1	15	.	.	.	.	.	.	.	.	.	.	C	8.150	0.787103	0.16189	4.55E-4	0.0	ENSG00000166825	ENST00000300060	T	0.02737	4.18	5.07	2.09	0.27110	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	1.705140	0.02757	N	0.118153	T	0.04363	0.0120	L	0.50919	1.6	0.09310	N	1	B	0.22909	0.077	B	0.22386	0.039	T	0.40776	-0.9545	10	0.42905	T	0.14	.	4.5329	0.12013	0.0:0.5844:0.187:0.2287	.	140	P15144	AMPN_HUMAN	H	140	ENSP00000300060:R140H	ENSP00000300060:R140H	R	-	2	0	ANPEP	88150400	0.000000	0.05858	0.115000	0.21578	0.159000	0.22180	-0.669000	0.05262	1.113000	0.41760	0.563000	0.77884	CGT	-	pfam_Peptidase_M1_N		0.617	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANPEP	protein_coding	OTTHUMT00000313425.1	C		rs145360414		90349396	-1	no_errors	ENST00000300060	ensembl	human	known	74_37	missense	SNP	0.042	T
NTM	50863	genome.wustl.edu	37	11	132206566	132206566	+	3'UTR	DEL	T	T	-	rs61142048|rs368958484	byFrequency	TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr11:132206566delT	ENST00000374786.1	+	0	3040				NTM_ENST00000374791.3_3'UTR|NTM_ENST00000474900.1_3'UTR	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin						cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						TTAGGTAATCTTTTTTTTTTT	0.458													|||unknown(HR)	1219	0.243411	0.2564	0.1729	5008	,	,		17993	0.2639		0.1282	False		,,,				2504	0.3732																0								ENSG00000182667																																			NTM	SO:0001624	3_prime_UTR_variant	0				HGNC	AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.*1526T>-	11.37:g.132206566delT		Somatic	0	22	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	25	19.35	A0MTT2|Q6UXJ3|Q86VJ9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000374786.1	37	NULL	CCDS8491.1	11																																																																																			-	-		0.458	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTM	protein_coding	OTTHUMT00000141937.1	T	NM_016522			132206566	+1	no_errors	ENST00000474900	ensembl	human	known	74_37	rna	DEL	0.131	-
VSIG10L	147645	genome.wustl.edu	37	19	51845231	51845231	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr19:51845231G>A	ENST00000335624.4	-	2	70	c.71C>T	c.(70-72)gCc>gTc	p.A24V	CTD-2616J11.16_ENST00000601148.1_RNA|CTD-2616J11.16_ENST00000594311.1_RNA	NM_001163922.1	NP_001157394.1	Q86VR7	VS10L_HUMAN	V-set and immunoglobulin domain containing 10 like	24						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)	4						TCCAGAAGAGGCTCTGAGGGT	0.567																																																	0								ENSG00000186806						96.0	104.0	101.0					19																	51845231		692	1591	2283	VSIG10L	SO:0001583	missense	0			-	HGNC		CCDS54300.1	19q13.41	2013-01-11				ENSG00000186806		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27111	protein-coding gene	gene with protein product						12477932	Standard	NM_001163922		Approved		uc002pwf.3	Q86VR7		ENST00000335624.4:c.71C>T	19.37:g.51845231G>A	ENSP00000335623:p.Ala24Val	Somatic	0	21	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	13	48.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A24V	ENST00000335624.4	37	c.71	CCDS54300.1	19	.	.	.	.	.	.	.	.	.	.	G	15.17	2.752745	0.49362	.	.	ENSG00000186806	ENST00000335624;ENST00000542561	T	0.29142	1.58	2.88	1.84	0.25277	.	.	.	.	.	T	0.13114	0.0318	N	0.08118	0	0.09310	N	1	B	0.33694	0.421	B	0.25291	0.059	T	0.14172	-1.0482	9	0.59425	D	0.04	.	6.0454	0.19758	0.1453:0.0:0.8547:0.0	.	24	Q86VR7	VS10L_HUMAN	V	24	ENSP00000335623:A24V	ENSP00000335623:A24V	A	-	2	0	VSIG10L	56537043	0.148000	0.22702	0.003000	0.11579	0.058000	0.15608	1.237000	0.32695	0.778000	0.33520	-0.216000	0.12614	GCC	-	NULL		0.567	VSIG10L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VSIG10L	protein_coding	OTTHUMT00000464535.1	G	NM_001163922	-		51845231	-1	no_errors	ENST00000335624	ensembl	human	novel	74_37	missense	SNP	0.015	A
TGM7	116179	genome.wustl.edu	37	15	43579632	43579632	+	Silent	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr15:43579632G>A	ENST00000452443.2	-	6	715	c.711C>T	c.(709-711)ggC>ggT	p.G237G		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	237					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	CCTGCAGCACGCCATTGTCAT	0.607																																																	0								ENSG00000159495						93.0	81.0	85.0					15																	43579632		2202	4299	6501	TGM7	SO:0001819	synonymous_variant	0			-	HGNC	AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.711C>T	15.37:g.43579632G>A		Somatic	0	44	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Transglutaminase_N,pfam_Transglutaminase_C,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.G237	ENST00000452443.2	37	c.711	CCDS32213.1	15																																																																																			-	NULL		0.607	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM7	protein_coding	OTTHUMT00000432489.1	G	NM_052955	-		43579632	-1	no_errors	ENST00000452443	ensembl	human	known	74_37	silent	SNP	0.680	A
PLD1	5337	genome.wustl.edu	37	3	171320971	171320971	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr3:171320971C>T	ENST00000351298.4	-	27	3248	c.3122G>A	c.(3121-3123)cGt>cAt	p.R1041H	PLD1_ENST00000356327.5_Missense_Mutation_p.R1003H|PLD1_ENST00000342215.6_3'UTR	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	1041					chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	CAAAAATCCACGGATCTTCTT	0.438																																					NSCLC(149;2174 3517 34058)												0								ENSG00000075651						119.0	115.0	116.0					3																	171320971		2203	4300	6503	PLD1	SO:0001583	missense	0			-	HGNC	U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.3122G>A	3.37:g.171320971C>T	ENSP00000342793:p.Arg1041His	Somatic	0	70	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Phox,pfam_PLipase_D/transphosphatidylase,pfam_Pleckstrin_homology,superfamily_Phox,smart_Phox,smart_Pleckstrin_homology,smart_PLipase_D/transphosphatidylase,pirsf_PLipase_D_euk,pfscan_Phox,pfscan_PLipase_D/transphosphatidylase	p.R1041H	ENST00000351298.4	37	c.3122	CCDS3216.1	3	.	.	.	.	.	.	.	.	.	.	C	18.20	3.571245	0.65765	.	.	ENSG00000075651	ENST00000356327;ENST00000351298	T;T	0.07444	3.2;3.19	6.07	6.07	0.98685	.	0.106957	0.64402	D	0.000007	T	0.13329	0.0323	M	0.74389	2.26	0.80722	D	1	B;B	0.28291	0.206;0.109	B;B	0.22753	0.041;0.02	T	0.00651	-1.1626	10	0.62326	D	0.03	-13.3744	13.793	0.63152	0.0:0.9304:0.0:0.0696	.	1026;1041	Q59EA4;Q13393	.;PLD1_HUMAN	H	1003;1041	ENSP00000348681:R1003H;ENSP00000342793:R1041H	ENSP00000342793:R1041H	R	-	2	0	PLD1	172803665	0.996000	0.38824	1.000000	0.80357	0.958000	0.62258	3.240000	0.51368	2.890000	0.99128	0.650000	0.86243	CGT	-	pirsf_PLipase_D_euk		0.438	PLD1-001	KNOWN	basic|CCDS	protein_coding	PLD1	protein_coding	OTTHUMT00000346730.2	C	NM_002662	-		171320971	-1	no_errors	ENST00000351298	ensembl	human	known	74_37	missense	SNP	1.000	T
PLBD1	79887	genome.wustl.edu	37	12	14656854	14656854	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr12:14656854G>T	ENST00000240617.5	-	11	2166	c.1514C>A	c.(1513-1515)tCc>tAc	p.S505Y		NM_024829.5	NP_079105.4	Q6P4A8	PLBL1_HUMAN	phospholipase B domain containing 1	505					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16						TATGGCATAGGATGTGTACTG	0.468																																																	0								ENSG00000121316						125.0	109.0	114.0					12																	14656854		2203	4300	6503	PLBD1	SO:0001583	missense	0			-	HGNC	BC000909	CCDS31751.1	12p13.1	2013-10-11			ENSG00000121316	ENSG00000121316			26215	protein-coding gene	gene with protein product	"""PLB homolog 1 (Dictyostelium)"""					15193148, 19019078	Standard	NM_024829		Approved	FLJ22662	uc001rcc.1	Q6P4A8	OTTHUMG00000168821	ENST00000240617.5:c.1514C>A	12.37:g.14656854G>T	ENSP00000240617:p.Ser505Tyr	Somatic	0	35	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	40	20.00	A8K4E9|Q9BVV3|Q9H625	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PLipase_B-like	p.S505Y	ENST00000240617.5	37	c.1514	CCDS31751.1	12	.	.	.	.	.	.	.	.	.	.	G	18.44	3.623812	0.66901	.	.	ENSG00000121316	ENST00000240617	T	0.17213	2.29	5.87	4.98	0.66077	.	0.098892	0.64402	D	0.000001	T	0.39172	0.1068	M	0.65498	2.005	0.32654	N	0.519048	D	0.56521	0.976	D	0.63703	0.917	T	0.55829	-0.8079	10	0.87932	D	0	-15.9511	15.8279	0.78727	0.0:0.1349:0.8651:0.0	.	505	Q6P4A8	PLBL1_HUMAN	Y	505	ENSP00000240617:S505Y	ENSP00000240617:S505Y	S	-	2	0	PLBD1	14548121	1.000000	0.71417	0.990000	0.47175	0.380000	0.30137	9.434000	0.97515	1.616000	0.50265	-0.165000	0.13383	TCC	-	pfam_PLipase_B-like		0.468	PLBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLBD1	protein_coding	OTTHUMT00000401203.1	G	NM_024829	-		14656854	-1	no_errors	ENST00000240617	ensembl	human	known	74_37	missense	SNP	1.000	T
EGF	1950	genome.wustl.edu	37	4	110897208	110897208	+	Missense_Mutation	SNP	G	G	A	rs567044142		TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:110897208G>A	ENST00000265171.5	+	13	2315	c.1870G>A	c.(1870-1872)Gaa>Aaa	p.E624K	EGF_ENST00000503392.1_Missense_Mutation_p.E624K|EGF_ENST00000509793.1_Missense_Mutation_p.E582K	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	624					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	TCCACGAATTGAAAGTTCTTC	0.383																																																	0								ENSG00000138798						185.0	200.0	195.0					4																	110897208		2203	4300	6503	EGF	SO:0001583	missense	0			-	HGNC	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.1870G>A	4.37:g.110897208G>A	ENSP00000265171:p.Glu624Lys	Somatic	0	74	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	59	32.18	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt	p.E624K	ENST00000265171.5	37	c.1870	CCDS3689.1	4	.	.	.	.	.	.	.	.	.	.	G	34	5.400318	0.96030	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	D;D;D	0.93604	-3.25;-3.25;-3.25	5.66	5.66	0.87406	Six-bladed beta-propeller, TolB-like (1);	0.047963	0.85682	D	0.000000	D	0.97393	0.9147	M	0.90082	3.085	0.58432	D	0.999998	D;P;D	0.76494	0.998;0.941;0.999	D;P;D	0.74023	0.96;0.738;0.982	D	0.97417	1.0006	10	0.56958	D	0.05	.	19.756	0.96291	0.0:0.0:1.0:0.0	.	624;582;624	E7EVD2;P01133-2;P01133	.;.;EGF_HUMAN	K	582;624;624	ENSP00000424316:E582K;ENSP00000265171:E624K;ENSP00000421384:E624K	ENSP00000265171:E624K	E	+	1	0	EGF	111116657	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.302000	0.89953	2.665000	0.90641	0.655000	0.94253	GAA	-	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.383	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EGF	protein_coding	OTTHUMT00000255065.1	G		-		110897208	+1	no_errors	ENST00000265171	ensembl	human	known	74_37	missense	SNP	1.000	A
FSIP2	401024	genome.wustl.edu	37	2	186671383	186671383	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr2:186671383G>A	ENST00000424728.1	+	17	17350	c.17350G>A	c.(17350-17352)Gct>Act	p.A5784T	FSIP2_ENST00000343098.5_Missense_Mutation_p.A5873T			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5784										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						AATTTTTCCCGCTAAGTTTTT	0.333																																																	0								ENSG00000188738						72.0	68.0	69.0					2																	186671383		1804	4072	5876	FSIP2	SO:0001583	missense	0			-	HGNC	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.17350G>A	2.37:g.186671383G>A	ENSP00000401306:p.Ala5784Thr	Somatic	0	74	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	50	30.56	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A5873T	ENST00000424728.1	37	c.17617		2	.	.	.	.	.	.	.	.	.	.	G	11.81	1.748834	0.30955	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.62364	0.03;0.04	5.06	2.27	0.28462	.	.	.	.	.	T	0.50667	0.1629	L	0.34521	1.04	0.09310	N	1	.	.	.	.	.	.	T	0.44817	-0.9303	7	0.51188	T	0.08	.	4.4373	0.11557	0.1844:0.0:0.6388:0.1768	.	.	.	.	T	5873;5784	ENSP00000344403:A5873T;ENSP00000401306:A5784T	ENSP00000344403:A5873T	A	+	1	0	FSIP2	186379628	0.151000	0.22747	0.096000	0.21009	0.298000	0.27526	0.723000	0.25939	0.299000	0.22661	-0.194000	0.12790	GCT	-	NULL		0.333	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	protein_coding	OTTHUMT00000332778.3	G	NM_173651	-		186671383	+1	no_errors	ENST00000343098	ensembl	human	known	74_37	missense	SNP	0.143	A
KRT10	3858	genome.wustl.edu	37	17	38975103	38975104	+	In_Frame_Ins	INS	-	-	GCT			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr17:38975103_38975104insGCT	ENST00000269576.5	-	7	1692_1693	c.1683_1684insAGC	c.(1681-1686)agctcc>agcAGCtcc	p.561_562SS>SSS	TMEM99_ENST00000301665.3_5'Flank	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	561	Gly-rich.|Ser-rich.|Tail.				cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				CCTCCGCTGGAgctgccgccgc	0.683																																																	0								ENSG00000186395																																			KRT10	SO:0001652	inframe_insertion	0				HGNC	J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1681_1683dupAGC	17.37:g.38975104_38975106dupGCT	ENSP00000269576:p.Ser562_Ser563dup	Somatic	0	29	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	Q14664|Q8N175	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.563in_frame_insS	ENST00000269576.5	37	c.1684_1683	CCDS11377.1	17																																																																																			-	NULL		0.683	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT10	protein_coding	OTTHUMT00000257875.1	-	NM_000421			38975104	-1	no_errors	ENST00000269576	ensembl	human	known	74_37	in_frame_ins	INS	0.124:0.323	GCT
C10orf12	26148	genome.wustl.edu	37	10	98740602	98740602	+	5'Flank	SNP	C	C	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr10:98740602C>A	ENST00000286067.2	+	0	0				LCOR_ENST00000498444.1_3'UTR	NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12											NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		GTCGAAGTCCCCACTGGAGAA	0.403																																																	0								ENSG00000196233																																			LCOR	SO:0001631	upstream_gene_variant	0			-	HGNC	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840		10.37:g.98740602C>A	Exception_encountered	Somatic	0	30	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	Q9H945|Q9Y457	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000286067.2	37	NULL	CCDS7452.1	10																																																																																			-	-		0.403	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCOR	protein_coding	OTTHUMT00000049627.1	C	NM_015652	-		98740602	+1	no_errors	ENST00000498444	ensembl	human	known	74_37	rna	SNP	0.995	A
IGDCC3	9543	genome.wustl.edu	37	15	65624330	65624330	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr15:65624330delT	ENST00000327987.4	-	7	1348	c.1097delA	c.(1096-1098)aatfs	p.N366fs	IGDCC3_ENST00000559231.1_5'UTR	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	366	Ig-like C2-type 4.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CACCTGTCCATTTTTCAGCCA	0.602																																																	0								ENSG00000174498						103.0	88.0	93.0					15																	65624330		2201	4299	6500	IGDCC3	SO:0001589	frameshift_variant	0				HGNC	AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.1097delA	15.37:g.65624330delT	ENSP00000332773:p.Asn366fs	Somatic	0	24	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	O95215	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.N366fs	ENST00000327987.4	37	c.1097	CCDS10205.1	15																																																																																			-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.602	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGDCC3	protein_coding	OTTHUMT00000256826.1	T	NM_004884			65624330	-1	no_errors	ENST00000327987	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
UTP3	57050	genome.wustl.edu	37	4	71554691	71554693	+	In_Frame_Del	DEL	GGA	GGA	-	rs146575538|rs61104402	byFrequency	TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	GGA	GGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:71554691_71554693delGGA	ENST00000254803.2	+	1	496_498	c.297_299delGGA	c.(295-300)ggggag>ggg	p.E105del		NM_020368.2	NP_065101.1	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)	105	Glu-rich.				brain development (GO:0007420)|chromatin modification (GO:0016568)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(4)	18			Lung(101;0.235)			ggaatgcgggggaggaggaggag	0.576														35	0.00698882	0.0197	0.0043	5008	,	,		23033	0.002		0.001	False		,,,				2504	0.0031																0								ENSG00000132467			0,251,4015		0,0,0,0,251,1882						-0.6	0.0		dbSNP_134	50	1,543,7710		0,0,1,6,531,3589	no	codingComplex	UTP3	NM_020368.2		0,0,1,6,782,5471	A1A1,A1A2,A1R,A2A2,A2R,RR		6.5907,5.8837,6.3498				1,794,11725				UTP3	SO:0001651	inframe_deletion	0				HGNC	AL136590	CCDS3546.1	4q13.3	2008-02-05			ENSG00000132467	ENSG00000132467			24477	protein-coding gene	gene with protein product	"""disrupter of silencing 10"""	611614				12477932	Standard	NM_020368		Approved	FLJ23256, DKFZp761F222, SAS10, CRLZ1	uc003hfo.3	Q9NQZ2	OTTHUMG00000129911	ENST00000254803.2:c.297_299delGGA	4.37:g.71554700_71554702delGGA	ENSP00000254803:p.Glu105del	Somatic	0	30	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	Q6FI82	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Sas10_C_dom,pfam_Sas10/Utp3/C1D	p.E103in_frame_del	ENST00000254803.2	37	c.297_299	CCDS3546.1	4																																																																																			-	NULL		0.576	UTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP3	protein_coding	OTTHUMT00000252163.2	GGA	NM_020368			71554693	+1	no_errors	ENST00000254803	ensembl	human	known	74_37	in_frame_del	DEL	0.002:0.002:0.002	-
CLUH	23277	genome.wustl.edu	37	17	2603734	2603734	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr17:2603734C>A	ENST00000570628.2	-	9	1199	c.1094G>T	c.(1093-1095)aGg>aTg	p.R365M	CLUH_ENST00000435359.1_Missense_Mutation_p.R365M|CLUH_ENST00000538975.1_Missense_Mutation_p.R365M			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	365					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											AGGCAGCTCCCTCGTCGTCTG	0.622																																																	0								ENSG00000132361						31.0	35.0	34.0					17																	2603734		2034	4184	6218	CLUH	SO:0001583	missense	0			-	HGNC	AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.1094G>T	17.37:g.2603734C>A	ENSP00000458986:p.Arg365Met	Somatic	0	56	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_GSKIP_dom	p.R365M	ENST00000570628.2	37	c.1094	CCDS45572.1	17	.	.	.	.	.	.	.	.	.	.	C	16.42	3.117841	0.56505	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	D;D	0.83250	-1.7;-1.7	5.4	4.43	0.53597	.	0.123171	0.64402	D	0.000001	D	0.91570	0.7337	M	0.87381	2.88	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.92729	0.6198	10	0.87932	D	0	.	13.4179	0.60979	0.0:0.9241:0.0:0.0759	.	365;365	O75153;C9J6D7	K0664_HUMAN;.	M	365	ENSP00000388872:R365M;ENSP00000439628:R365M	ENSP00000320468:R365M	R	-	2	0	KIAA0664	2550484	1.000000	0.71417	0.944000	0.38274	0.003000	0.03518	7.464000	0.80887	1.290000	0.44636	-0.300000	0.09419	AGG	-	NULL		0.622	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLUH	protein_coding	OTTHUMT00000437807.2	C	NM_015229	-		2603734	-1	no_errors	ENST00000435359	ensembl	human	known	74_37	missense	SNP	1.000	A
PRR34	55267	genome.wustl.edu	37	22	46449708	46449708	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr22:46449708G>C	ENST00000396008.2	-	1	316	c.266C>G	c.(265-267)gCc>gGc	p.A89G	RP6-109B7.2_ENST00000439423.1_lincRNA|RP6-109B7.3_ENST00000445441.1_RNA|C22orf26_ENST00000333761.1_Missense_Mutation_p.A89G|FLJ27365_ENST00000381051.2_5'Flank|RP6-109B7.5_ENST00000608644.1_RNA|RP6-109B7.3_ENST00000416202.1_RNA|RP6-109B7.3_ENST00000451166.1_RNA			Q9NV39	PRR34_HUMAN		89													Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.0784)|LUAD - Lung adenocarcinoma(64;0.247)		CCGAGCTCGGGCAGCAGGGTG	0.746																																																	0								ENSG00000182257						3.0	4.0	4.0					22																	46449708		1674	3579	5253	C22orf26	SO:0001583	missense	0			-	HGNC																												ENST00000396008.2:c.266C>G	22.37:g.46449708G>C	ENSP00000379329:p.Ala89Gly	Somatic	0	8	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	4	66.67	B0QZ24	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A89G	ENST00000396008.2	37	c.266	CCDS14071.1	22	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033869	0.54896	.	.	ENSG00000182257	ENST00000396008;ENST00000333761	T;T	0.38722	1.12;1.12	3.25	3.25	0.37280	.	.	.	.	.	T	0.42063	0.1186	N	0.08118	0	0.25091	N	0.990854	D	0.76494	0.999	D	0.79108	0.992	T	0.27706	-1.0066	9	0.87932	D	0	.	10.2769	0.43515	0.0:0.0:1.0:0.0	.	89	Q9NV39	CV026_HUMAN	G	89	ENSP00000379329:A89G;ENSP00000327764:A89G	ENSP00000327764:A89G	A	-	2	0	C22orf26	44828372	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.742000	0.55097	2.119000	0.64992	0.650000	0.86243	GCC	-	NULL		0.746	C22orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C22orf26	protein_coding	OTTHUMT00000317994.1	G		-		46449708	-1	no_errors	ENST00000333761	ensembl	human	known	74_37	missense	SNP	1.000	C
CRX	1406	genome.wustl.edu	37	19	48339521	48339521	+	Missense_Mutation	SNP	G	G	A	rs61748436		TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr19:48339521G>A	ENST00000221996.7	+	3	328	c.122G>A	c.(121-123)cGg>cAg	p.R41Q	TPRX2P_ENST00000535362.1_Intron|CRX_ENST00000539067.1_Missense_Mutation_p.R41Q	NM_000554.4	NP_000545.1	O43186	CRX_HUMAN	cone-rod homeobox	41			R -> Q (in RP). {ECO:0000269|PubMed:9427255, ECO:0000269|PubMed:9792858}.|R -> W (in CORD2; exhibits reduced DNA binding, transcriptional synergy and interaction with NRL). {ECO:0000269|PubMed:9427255}.		circadian rhythm (GO:0007623)|organ morphogenesis (GO:0009887)|positive regulation of photoreceptor cell differentiation (GO:0046534)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|leucine zipper domain binding (GO:0043522)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|urinary_tract(1)	23		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)		AAGCAGCGGCGGGAGCGCACC	0.652																																					Pancreas(57;461 1196 22201 40716 47188)												0			GRCh37	CM970396	CRX	M	rs61748436	ENSG00000105392						53.0	62.0	59.0					19																	48339521		2203	4300	6503	CRX	SO:0001583	missense	0			-	HGNC	AF024711	CCDS12706.1	19q13.3	2013-01-08				ENSG00000105392		"""Homeoboxes / PRD class"""	2383	protein-coding gene	gene with protein product	"""orthodenticle homeobox 3"""	602225		CORD2		9390563, 9537410	Standard	NM_000554		Approved	CRD, LCA7, OTX3	uc002phq.4	O43186		ENST00000221996.7:c.122G>A	19.37:g.48339521G>A	ENSP00000221996:p.Arg41Gln	Somatic	0	38	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	26	18.75	Q0QD45	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,pfam_Otx_TF_C,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.R41Q	ENST00000221996.7	37	c.122	CCDS12706.1	19	.	.	.	.	.	.	.	.	.	.	G	17.35	3.368074	0.61513	.	.	ENSG00000105392	ENST00000221996;ENST00000539067	D;D	0.97066	-4.23;-4.23	3.67	3.67	0.42095	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	D	0.000001	D	0.98239	0.9417	M	0.84511	2.7	0.80722	A	1	D	0.71674	0.998	D	0.76575	0.988	D	0.99921	1.1255	9	0.59425	D	0.04	-18.357	12.8982	0.58111	0.0:0.0:1.0:0.0	rs61748436	41	O43186	CRX_HUMAN	Q	41	ENSP00000221996:R41Q;ENSP00000445565:R41Q	ENSP00000221996:R41Q	R	+	2	0	CRX	53031333	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	8.973000	0.93428	1.883000	0.54544	0.205000	0.17691	CGG	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.652	CRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRX	protein_coding	OTTHUMT00000409812.4	G	NM_000554	rs61748436		48339521	+1	no_errors	ENST00000221996	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC16A4	9122	genome.wustl.edu	37	1	110906426	110906427	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr1:110906426_110906427insA	ENST00000369779.4	-	9	1674_1675	c.1425_1426insT	c.(1423-1428)tttgtafs	p.V476fs	SLC16A4_ENST00000369781.4_Frame_Shift_Ins_p.V308fs|SLC16A4_ENST00000472422.2_Frame_Shift_Ins_p.V428fs|SLC16A4_ENST00000437429.2_Frame_Shift_Ins_p.L372fs|SLC16A4_ENST00000541986.1_Frame_Shift_Ins_p.V414fs	NM_001201547.1|NM_004696.2	NP_001188476.1|NP_004687.1	O15374	MOT5_HUMAN	solute carrier family 16, member 4	476					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)	p.F475fs*12(1)		breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(2)|ovary(3)|prostate(1)|stomach(2)	16		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	Pyruvic acid(DB00119)	GCCAATGGTACAAAAAAAAAGG	0.391																																																	1	Deletion - Frameshift(1)	large_intestine(1)						ENSG00000168679																																			SLC16A4	SO:0001589	frameshift_variant	0				HGNC	U59185	CCDS823.1, CCDS55621.1, CCDS55622.1, CCDS55623.1, CCDS55624.1	1p13.3	2013-07-18	2013-07-18		ENSG00000168679	ENSG00000168679		"""Solute carriers"""	10925	protein-coding gene	gene with protein product		603878	"""solute carrier family 16 (monocarboxylic acid transporters), member 4"", ""solute carrier family 16, member 4 (monocarboxylic acid transporter 5)"""			9425115	Standard	NM_004696		Approved	MCT4, MCT5	uc001dzo.2	O15374	OTTHUMG00000011285	ENST00000369779.4:c.1426dupT	1.37:g.110906435_110906435dupA	ENSP00000358794:p.Val476fs	Somatic	0	21	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	A8K3V5|B2R9C9|B4DJ67|B4DPX7|E7EPY8|G3V175|Q5T612|Q8WU09	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.V475fs	ENST00000369779.4	37	c.1426_1425	CCDS823.1	1																																																																																			-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.391	SLC16A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A4	protein_coding	OTTHUMT00000031115.3	-	NM_004696			110906427	-1	no_errors	ENST00000369779	ensembl	human	known	74_37	frame_shift_ins	INS	0.998:0.998	A
OCSTAMP	128506	genome.wustl.edu	37	20	45170491	45170491	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr20:45170491G>A	ENST00000279028.2	-	3	1136	c.1123C>T	c.(1123-1125)Cac>Tac	p.H375Y		NM_080721.1	NP_542452.1	Q9BR26	OCSTP_HUMAN	osteoclast stimulatory transmembrane protein	375					cellular response to estrogen stimulus (GO:0071391)|cellular response to tumor necrosis factor (GO:0071356)|multinuclear osteoclast differentiation (GO:0072674)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of osteoclast proliferation (GO:0090290)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)	2						TAGGAGCTGTGGACGGAGAGG	0.677																																																	0								ENSG00000149635						9.0	11.0	10.0					20																	45170491		687	1587	2274	OCSTAMP	SO:0001583	missense	0			-	HGNC	AL034424	CCDS54468.1	20q13.12	2012-03-27	2012-03-27	2012-03-27	ENSG00000149635	ENSG00000149635			16116	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 123"""	C20orf123		18064667	Standard	NM_080721		Approved	dJ257E24.3	uc010zxu.2	Q9BR26	OTTHUMG00000032652	ENST00000279028.2:c.1123C>T	20.37:g.45170491G>A	ENSP00000279028:p.His375Tyr	Somatic	0	23	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DC_STAMP-like	p.H375Y	ENST00000279028.2	37	c.1123	CCDS54468.1	20	.	.	.	.	.	.	.	.	.	.	G	14.83	2.652381	0.47362	.	.	ENSG00000149635	ENST00000279028	T	0.30182	1.54	4.95	2.92	0.33932	Dendritic cell-specific transmembrane protein-like (1);	0.418104	0.25236	N	0.032123	T	0.20251	0.0487	L	0.27053	0.805	0.09310	N	1	D	0.57257	0.979	P	0.49192	0.602	T	0.07693	-1.0759	10	0.11182	T	0.66	-11.5243	3.3519	0.07155	0.084:0.1437:0.4391:0.3332	.	375	Q9BR26	CT123_HUMAN	Y	375	ENSP00000279028:H375Y	ENSP00000279028:H375Y	H	-	1	0	C20orf123	44603898	0.027000	0.19231	0.005000	0.12908	0.002000	0.02628	1.275000	0.33144	0.606000	0.29965	0.655000	0.94253	CAC	-	pfam_DC_STAMP-like		0.677	OCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCSTAMP	protein_coding	OTTHUMT00000079573.2	G	XM_496476	-		45170491	-1	no_errors	ENST00000279028	ensembl	human	known	74_37	missense	SNP	0.002	A
HCN2	610	genome.wustl.edu	37	19	616057	616057	+	Silent	SNP	G	G	C	rs201222040	byFrequency	TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr19:616057G>C	ENST00000251287.2	+	8	2306	c.2253G>C	c.(2251-2253)gcG>gcC	p.A751A	AC005559.2_ENST00000591847.1_RNA	NM_001194.3	NP_001185.3	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 2	751	Pro-rich.				cell-cell signaling (GO:0007267)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	cAMP binding (GO:0030552)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			endometrium(5)|lung(4)	9		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCCGCTGGCGCTCGGCTCGC	0.851													G|||	1035	0.206669	0.1634	0.1571	5008	,	,		3853	0.25		0.2356	False		,,,				2504	0.226				Melanoma(145;1175 2427 8056 36306)												0								ENSG00000099822						1.0	1.0	1.0					19																	616057		152	300	452	HCN2	SO:0001819	synonymous_variant	0			-	HGNC	AF064877	CCDS12035.1	19p13	2011-07-05				ENSG00000099822		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4846	protein-coding gene	gene with protein product		602781		BCNG2		9405696, 9630217, 16382102	Standard	NM_001194		Approved	BCNG-2, HAC-1	uc002lpe.3	Q9UL51		ENST00000251287.2:c.2253G>C	19.37:g.616057G>C		Somatic	0	8	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	7	50.00	O60742|O60743|O75267|Q9UBS2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.A751	ENST00000251287.2	37	c.2253	CCDS12035.1	19																																																																																			-	NULL		0.851	HCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN2	protein_coding	OTTHUMT00000452100.1	G	NM_001194	rs201222040		616057	+1	no_errors	ENST00000251287	ensembl	human	known	74_37	silent	SNP	0.061	C
FAM221A	340277	genome.wustl.edu	37	7	23737906	23737906	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr7:23737906A>C	ENST00000344962.4	+	5	822	c.733A>C	c.(733-735)Acg>Ccg	p.T245P	FAM221A_ENST00000409994.3_Intron|FAM221A_ENST00000409192.3_Intron|FAM221A_ENST00000409653.1_Missense_Mutation_p.T187P	NM_199136.3	NP_954587.2	A4D161	F221A_HUMAN	family with sequence similarity 221, member A	245																	TTCTCCAGAAACGTTAACAGA	0.358																																																	0								ENSG00000188732						119.0	120.0	120.0					7																	23737906		2203	4299	6502	FAM221A	SO:0001583	missense	0			-	HGNC		CCDS5385.1, CCDS47561.1, CCDS47562.1, CCDS75570.1	7p15.3	2012-04-02	2012-04-02	2012-04-02	ENSG00000188732	ENSG00000188732			27977	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 46"""	C7orf46		12477932	Standard	XR_242080		Approved	FLJ45875, MGC72075, DKFZp686F0810	uc003swo.4	A4D161	OTTHUMG00000128463	ENST00000344962.4:c.733A>C	7.37:g.23737906A>C	ENSP00000342576:p.Thr245Pro	Somatic	0	40	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	35	32.69	Q05CG4|Q4G0Q7|Q6P519	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T245P	ENST00000344962.4	37	c.733	CCDS5385.1	7	.	.	.	.	.	.	.	.	.	.	A	3.672	-0.067351	0.07273	.	.	ENSG00000188732	ENST00000344962;ENST00000409653	T;T	0.14640	2.49;2.49	5.66	3.27	0.37495	.	0.677862	0.14992	N	0.286632	T	0.09818	0.0241	L	0.33485	1.01	0.09310	N	0.999998	B	0.06786	0.001	B	0.04013	0.001	T	0.35251	-0.9796	10	0.23891	T	0.37	-0.6925	7.352	0.26697	0.5496:0.3712:0.0792:0.0	.	245	A4D161	CG046_HUMAN	P	245;187	ENSP00000342576:T245P;ENSP00000386900:T187P	ENSP00000342576:T245P	T	+	1	0	C7orf46	23704431	0.021000	0.18746	0.566000	0.28421	0.129000	0.20672	2.068000	0.41471	0.500000	0.27991	-0.250000	0.11733	ACG	-	NULL		0.358	FAM221A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM221A	protein_coding	OTTHUMT00000250261.1	A	NM_199136	-		23737906	+1	no_errors	ENST00000344962	ensembl	human	known	74_37	missense	SNP	0.092	C
PDE9A	5152	genome.wustl.edu	37	21	44195538	44195538	+	3'UTR	DEL	A	A	-			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr21:44195538delA	ENST00000291539.6	+	0	1977				PDE9A_ENST00000335512.4_3'UTR|PDE9A_ENST00000470987.1_3'UTR|PDE9A_ENST00000398229.3_3'UTR|PDE9A_ENST00000398234.3_3'UTR|PDE9A_ENST00000349112.3_3'UTR|PDE9A_ENST00000398225.3_3'UTR|PDE9A_ENST00000398227.3_3'UTR|PDE9A_ENST00000380328.2_3'UTR|PDE9A_ENST00000398232.3_3'UTR|PDE9A_ENST00000398224.3_3'UTR|PDE9A_ENST00000335440.6_3'UTR|PDE9A_ENST00000398236.3_3'UTR|PDE9A_ENST00000539837.1_3'UTR|PDE9A_ENST00000328862.6_3'UTR	NM_002606.2	NP_002597.1	O76083	PDE9A_HUMAN	phosphodiesterase 9A						blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|metabolic process (GO:0008152)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(6)|lung(8)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Caffeine(DB00201)	TCACTGATACAAAAAAAAAAA	0.398																																																	0								ENSG00000160191																																			PDE9A	SO:0001624	3_prime_UTR_variant	0				HGNC	AF048837	CCDS13690.1, CCDS33567.1, CCDS33568.1, CCDS33569.1, CCDS33570.1, CCDS33571.1, CCDS42941.1, CCDS42942.1, CCDS42943.1, CCDS42944.1, CCDS42945.1, CCDS42946.1, CCDS42947.1	21q22.3	2005-11-29			ENSG00000160191	ENSG00000160191	3.1.4.17	"""Phosphodiesterases"""	8795	protein-coding gene	gene with protein product		602973				9624146	Standard	NM_001001584		Approved		uc002zbm.3	O76083	OTTHUMG00000086825	ENST00000291539.6:c.*135A>-	21.37:g.44195538delA		Somatic	0	13	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	B2RBI5|B4DFI5|D3DSJ8|D3DSJ9|O75490|O75491|O95225|Q53Y40|Q5QD39|Q86SF7|Q86SI6|Q86SJ3|Q86WN3|Q86WN4|Q86WN5|Q86WN6|Q86WN7|Q86WN8|Q86WN9|Q86WP0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000291539.6	37	NULL	CCDS13690.1	21																																																																																			-	-		0.398	PDE9A-016	KNOWN	basic|CCDS	protein_coding	PDE9A	protein_coding	OTTHUMT00000195466.1	A				44195538	+1	no_errors	ENST00000460989	ensembl	human	known	74_37	rna	DEL	0.000	-
TET2	54790	genome.wustl.edu	37	4	106197126	106197126	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:106197126G>C	ENST00000540549.1	+	11	6319	c.5459G>C	c.(5458-5460)aGt>aCt	p.S1820T	TET2_ENST00000545826.1_3'UTR|TET2_ENST00000380013.4_Missense_Mutation_p.S1820T|TET2_ENST00000513237.1_Missense_Mutation_p.S1841T			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1820					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		CACAAATTAAGTGATGCTAAT	0.483			"""Mis N, F"""		MDS																																			Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0								ENSG00000168769						49.0	45.0	46.0					4																	106197126		692	1591	2283	TET2	SO:0001583	missense	0			-	HGNC	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.5459G>C	4.37:g.106197126G>C	ENSP00000442788:p.Ser1820Thr	Somatic	0	13	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	15	36.00	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S1820T	ENST00000540549.1	37	c.5459	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.679821	0.00751	.	.	ENSG00000168769	ENST00000540549;ENST00000513237;ENST00000380013	T;T;T	0.02050	4.49;4.48;4.49	5.33	-3.88	0.04205	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	.	.	.	.	T	0.00784	0.0026	N	0.02011	-0.69	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.11329	0.001;0.006	T	0.46303	-0.9201	9	0.07325	T	0.83	.	4.5271	0.11986	0.2578:0.4717:0.1794:0.0912	.	1841;1820	E7EQS8;Q6N021	.;TET2_HUMAN	T	1820;1841;1820	ENSP00000442788:S1820T;ENSP00000425443:S1841T;ENSP00000369351:S1820T	ENSP00000369351:S1820T	S	+	2	0	TET2	106416575	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.092000	0.11129	-0.803000	0.04415	-0.218000	0.12543	AGT	-	NULL		0.483	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	protein_coding	OTTHUMT00000253952.2	G	NM_017628	-		106197126	+1	no_errors	ENST00000380013	ensembl	human	known	74_37	missense	SNP	0.000	C
MAOA	4128	genome.wustl.edu	37	X	43602982	43602982	+	Intron	SNP	C	C	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chrX:43602982C>T	ENST00000338702.3	+	13	1385				MAOA_ENST00000542639.1_Intron	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A						cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	CAGTGATTGGCTCATTTACCC	0.483																																																	0								ENSG00000189221																																			MAOA	SO:0001627	intron_variant	0			-	HGNC		CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.1263-59C>T	X.37:g.43602982C>T		Somatic	0	14	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	6	45.45	B4DF46|Q16426	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000338702.3	37	NULL	CCDS14260.1	X																																																																																			-	-		0.483	MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAOA	protein_coding	OTTHUMT00000056300.1	C	NM_000240	-		43602982	+1	no_errors	ENST00000490604	ensembl	human	known	74_37	rna	SNP	0.001	T
SNX2	6643	genome.wustl.edu	37	5	122135524	122135524	+	Missense_Mutation	SNP	G	G	A	rs138514194		TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr5:122135524G>A	ENST00000379516.2	+	3	472	c.364G>A	c.(364-366)Gtg>Atg	p.V122M	SNX2_ENST00000514949.1_Missense_Mutation_p.V5M|SNX2_ENST00000510372.1_3'UTR	NM_003100.2	NP_003091.2	O60749	SNX2_HUMAN	sorting nexin 2	122					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)	p.V122M(1)		NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(2)|prostate(1)|skin(1)	19		all_cancers(142;1.14e-44)|all_lung(232;1.03e-13)|Lung NSC(810;2.5e-13)|Breast(839;0.000812)|Myeloproliferative disorder(839;0.0122)|Prostate(80;0.0235)|all_hematologic(541;0.0592)|all_neural(839;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	all cancers(49;2.13e-24)|Epithelial(69;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(64;5.6e-11)|BRCA - Breast invasive adenocarcinoma(61;0.00013)|GBM - Glioblastoma multiforme(465;0.000357)|COAD - Colon adenocarcinoma(49;0.000887)|Lung(113;0.0109)		GTCTGCTCCCGTGATCTTTGA	0.413																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000205302	G	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	125.0	120.0	122.0		364	5.3	1.0	5	dbSNP_134	122	1,8599	1.2+/-3.3	0,1,4299	no	missense	SNX2	NM_003100.2	21	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	122/520	122135524	2,13004	2203	4300	6503	SNX2	SO:0001583	missense	0			-	HGNC	AF043453	CCDS34217.1, CCDS64234.1	5q23.2	2011-05-03			ENSG00000205302	ENSG00000205302		"""Sorting nexins"""	11173	protein-coding gene	gene with protein product		605929				9819414	Standard	NM_003100		Approved		uc003kte.4	O60749	OTTHUMG00000163020	ENST00000379516.2:c.364G>A	5.37:g.122135524G>A	ENSP00000368831:p.Val122Met	Somatic	0	30	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	B3KN44|B4DEK4|B7Z408|O43650|P82862|Q53XK8|Q597H6|Q9BTS8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Vps5_C,pfam_Sorting_nexin_N,pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.V122M	ENST00000379516.2	37	c.364	CCDS34217.1	5	.	.	.	.	.	.	.	.	.	.	G	18.44	3.623781	0.66901	2.27E-4	1.16E-4	ENSG00000205302	ENST00000379516;ENST00000505934;ENST00000514949	T;T;T	0.37411	2.06;1.2;1.77	5.35	5.35	0.76521	.	0.208459	0.41823	D	0.000815	T	0.42675	0.1213	L	0.36672	1.1	0.33634	D	0.60642	P	0.47034	0.889	P	0.50109	0.631	T	0.52335	-0.8589	10	0.46703	T	0.11	-17.0144	19.0659	0.93110	0.0:0.0:1.0:0.0	.	122	O60749	SNX2_HUMAN	M	122;121;5	ENSP00000368831:V122M;ENSP00000422413:V121M;ENSP00000421663:V5M	ENSP00000368831:V122M	V	+	1	0	SNX2	122163423	1.000000	0.71417	0.982000	0.44146	0.966000	0.64601	4.204000	0.58460	2.522000	0.85027	0.650000	0.86243	GTG	-	pfam_Sorting_nexin_N		0.413	SNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX2	protein_coding	OTTHUMT00000371392.1	G	NM_003100	rs138514194		122135524	+1	no_errors	ENST00000379516	ensembl	human	known	74_37	missense	SNP	0.998	A
EGF	1950	genome.wustl.edu	37	4	110897311	110897311	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:110897311G>A	ENST00000265171.5	+	13	2418	c.1973G>A	c.(1972-1974)tGg>tAg	p.W658*	EGF_ENST00000503392.1_Nonsense_Mutation_p.W658*|EGF_ENST00000509793.1_Nonsense_Mutation_p.W616*	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	658					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	AAGTTGTACTGGTGCGATGCC	0.493																																																	0								ENSG00000138798						145.0	129.0	135.0					4																	110897311		2203	4300	6503	EGF	SO:0001587	stop_gained	0			-	HGNC	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.1973G>A	4.37:g.110897311G>A	ENSP00000265171:p.Trp658*	Somatic	0	63	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	57	21.92	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt	p.W658*	ENST00000265171.5	37	c.1973	CCDS3689.1	4	.	.	.	.	.	.	.	.	.	.	G	40	8.147415	0.98678	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	.	.	.	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.9915	0.97366	0.0:0.0:1.0:0.0	.	.	.	.	X	616;658;658	.	ENSP00000265171:W658X	W	+	2	0	EGF	111116760	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	8.302000	0.89953	2.723000	0.93209	0.655000	0.94253	TGG	-	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.493	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EGF	protein_coding	OTTHUMT00000255065.1	G		-		110897311	+1	no_errors	ENST00000265171	ensembl	human	known	74_37	nonsense	SNP	1.000	A
VDAC1	7416	genome.wustl.edu	37	5	133316708	133316708	+	Intron	DEL	T	T	-	rs76032174|rs76341281		TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr5:133316708delT	ENST00000265333.3	-	6	568				VDAC1_ENST00000395047.2_Intron|VDAC1_ENST00000395044.3_Intron	NM_003374.2	NP_003365.1	P21796	VDAC1_HUMAN	voltage-dependent anion channel 1						anion transport (GO:0006820)|apoptotic process (GO:0006915)|behavioral fear response (GO:0001662)|epithelial cell differentiation (GO:0030855)|learning (GO:0007612)|neuron-neuron synaptic transmission (GO:0007270)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pore complex (GO:0046930)	porin activity (GO:0015288)|protein kinase binding (GO:0019901)|voltage-gated anion channel activity (GO:0008308)			endometrium(1)|large_intestine(1)|lung(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)		Dihydroxyaluminium(DB01375)	GCAAGTTGTCTTTTTTTTTTT	0.413																																					NSCLC(127;1776 1806 35523 41489 48154)												0								ENSG00000213585																																			VDAC1	SO:0001627	intron_variant	0				HGNC		CCDS4168.1	5q31	2011-11-15			ENSG00000213585	ENSG00000213585		"""Voltage-dependent anion channels"""	12669	protein-coding gene	gene with protein product		604492				7517385	Standard	NM_003374		Approved	MGC111064, PORIN	uc003kyr.2	P21796	OTTHUMG00000129118	ENST00000265333.3:c.324-61A>-	5.37:g.133316708delT		Somatic	0	10	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08	B3KVK4|D3DQ93|Q5FVE7|Q9UIQ5|Q9UPL0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000265333.3	37	NULL	CCDS4168.1	5																																																																																			-	-		0.413	VDAC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VDAC1	protein_coding	OTTHUMT00000259208.1	T				133316708	-1	no_errors	ENST00000492324	ensembl	human	known	74_37	rna	DEL	0.001	-
ZBED4	9889	genome.wustl.edu	37	22	50279664	50279664	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr22:50279664A>G	ENST00000216268.5	+	2	2831	c.2354A>G	c.(2353-2355)cAg>cGg	p.Q785R		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	785						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		AACAGCATTCAGAAGCAGCTG	0.642																																																	0								ENSG00000100426						34.0	33.0	33.0					22																	50279664		2203	4300	6503	ZBED4	SO:0001583	missense	0			-	HGNC	AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.2354A>G	22.37:g.50279664A>G	ENSP00000216268:p.Gln785Arg	Somatic	0	28	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	24	33.33	B2RZH1|Q1ECU0|Q9UGG8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_BED_prd,pfam_HATC_dom_C,superfamily_RNaseH-like_dom,smart_Znf_BED_prd,pfscan_Znf_BED_prd	p.Q785R	ENST00000216268.5	37	c.2354	CCDS33677.1	22	.	.	.	.	.	.	.	.	.	.	A	5.513	0.279699	0.10458	.	.	ENSG00000100426	ENST00000216268	T	0.21932	1.98	5.57	2.25	0.28309	Ribonuclease H-like (1);	0.194552	0.44688	N	0.000439	T	0.17280	0.0415	L	0.53729	1.69	0.40891	D	0.984078	B	0.06786	0.001	B	0.04013	0.001	T	0.11203	-1.0597	10	0.16896	T	0.51	-11.8791	8.75	0.34609	0.7752:0.0:0.2248:0.0	.	785	O75132	ZBED4_HUMAN	R	785	ENSP00000216268:Q785R	ENSP00000216268:Q785R	Q	+	2	0	ZBED4	48665668	1.000000	0.71417	0.526000	0.27913	0.706000	0.40770	3.786000	0.55431	0.078000	0.16900	0.533000	0.62120	CAG	-	superfamily_RNaseH-like_dom		0.642	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBED4	protein_coding	OTTHUMT00000317408.2	A	NM_014838	-		50279664	+1	no_errors	ENST00000216268	ensembl	human	known	74_37	missense	SNP	0.998	G
ATG9B	285973	genome.wustl.edu	37	7	150721484	150721484	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr7:150721484delC	ENST00000377974.2	-	1	102	c.27delG	c.(25-27)gggfs	p.G9fs	ATG9B_ENST00000605938.1_Frame_Shift_Del_p.G9fs|ATG9B_ENST00000605952.1_Frame_Shift_Del_p.G9fs|ATG9B_ENST00000444312.1_5'UTR|ATG9B_ENST00000494791.1_5'UTR			Q674R7	ATG9B_HUMAN	autophagy related 9B	9					autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCCTTCTTCTCCCCCCCCAGC	0.642																																																	0								ENSG00000181652			28,31,2877		1,0,26,2,27,1412	3.0	4.0	4.0			3.1	0.2	7		4	45,83,6418		2,0,41,3,77,3150	no	codingComplex	ATG9B	NM_173681.5		3,0,67,5,104,4562	A1A1,A1A2,A1R,A2A2,A2R,RR		1.9554,2.0095,1.9722			150721484	73,114,9295	1659	3688	5347	ATG9B	SO:0001589	frameshift_variant	0				HGNC	AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000377974.2:c.27delG	7.37:g.150721484delC	ENSP00000475005:p.Gly9fs	Somatic	0	15	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	A1A5D3|Q6JRW5|Q8N8I8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Autophagy-rel_prot_9	p.R10fs	ENST00000377974.2	37	c.27		7																																																																																			-	NULL		0.642	ATG9B-201	KNOWN	basic|appris_principal	protein_coding	ATG9B	protein_coding		C	NM_173681			150721484	-1	no_errors	ENST00000377974	ensembl	human	known	74_37	frame_shift_del	DEL	0.511	-
ANKRD17	26057	genome.wustl.edu	37	4	73941998	73941998	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:73941998C>T	ENST00000358602.4	-	34	7878	c.7762G>A	c.(7762-7764)Gga>Aga	p.G2588R	ANKRD17_ENST00000330838.6_Missense_Mutation_p.G2337R|ANKRD17_ENST00000509867.2_Missense_Mutation_p.G2475R	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	2588					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GCCCAGGGTCCAGTCCACACC	0.368																																																	0								ENSG00000132466						69.0	62.0	65.0					4																	73941998		2203	4300	6503	ANKRD17	SO:0001583	missense	0			-	HGNC	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.7762G>A	4.37:g.73941998C>T	ENSP00000351416:p.Gly2588Arg	Somatic	0	36	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_KH_dom_type_1,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_KH_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_KH_dom_type_1,prints_Ankyrin_rpt	p.G2588R	ENST00000358602.4	37	c.7762	CCDS34004.1	4	.	.	.	.	.	.	.	.	.	.	C	19.72	3.880908	0.72294	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867	D;D;D	0.86769	-2.17;-2.15;-2.07	5.34	5.34	0.76211	.	0.000000	0.64402	D	0.000016	D	0.92021	0.7472	L	0.52573	1.65	0.54753	D	0.999987	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	D	0.92667	0.6146	10	0.87932	D	0	.	19.0464	0.93020	0.0:1.0:0.0:0.0	.	2587;2337;2588;2475	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	R	2588;1995;2337;2475	ENSP00000351416:G2588R;ENSP00000332265:G2337R;ENSP00000427151:G2475R	ENSP00000332265:G2337R	G	-	1	0	ANKRD17	74160862	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.294000	0.78760	2.514000	0.84764	0.655000	0.94253	GGA	-	NULL		0.368	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD17	protein_coding	OTTHUMT00000362475.1	C	NM_032217	-		73941998	-1	no_errors	ENST00000358602	ensembl	human	known	74_37	missense	SNP	1.000	T
TDRD12	91646	genome.wustl.edu	37	19	33281462	33281462	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr19:33281462C>T	ENST00000444215.2	+	12	1467	c.1147C>T	c.(1147-1149)Cct>Tct	p.P383S	TDRD12_ENST00000421545.2_Missense_Mutation_p.P383S			Q587J7	TDR12_HUMAN	tudor domain containing 12	383					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			NS(1)|breast(1)|endometrium(3)|lung(2)|prostate(1)|skin(1)	9	Esophageal squamous(110;0.137)					AAATCCTGATCCTTTGAGAGC	0.328																																																	0								ENSG00000173809						135.0	111.0	118.0					19																	33281462		692	1591	2283	TDRD12	SO:0001583	missense	0			-	HGNC	AK023134	CCDS46038.1	19q13.11	2013-01-23				ENSG00000173809		"""Tudor domain containing"""	25044	protein-coding gene	gene with protein product						11441184	Standard	NM_001110822		Approved	ECAT8, FLJ13072	uc002ntq.2	Q587J7		ENST00000444215.2:c.1147C>T	19.37:g.33281462C>T	ENSP00000416248:p.Pro383Ser	Somatic	0	16	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	13	31.58		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tudor,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase	p.P383S	ENST00000444215.2	37	c.1147		19	.	.	.	.	.	.	.	.	.	.	C	19.84	3.901702	0.72754	.	.	ENSG00000173809	ENST00000444215;ENST00000421545	T	0.26810	1.71	5.47	5.47	0.80525	.	0.000000	0.56097	D	0.000034	T	0.41696	0.1170	L	0.34521	1.04	0.36910	D	0.890832	D;D	0.89917	1.0;0.964	D;P	0.83275	0.996;0.466	T	0.46978	-0.9152	10	0.87932	D	0	-13.0856	16.2372	0.82381	0.0:1.0:0.0:0.0	.	383;383	E9PAY0;Q587J7	.;TDR12_HUMAN	S	383	ENSP00000416248:P383S	ENSP00000390621:P383S	P	+	1	0	TDRD12	37973302	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.441000	0.44864	2.566000	0.86566	0.563000	0.77884	CCT	-	NULL		0.328	TDRD12-001	KNOWN	basic|appris_principal	protein_coding	TDRD12	protein_coding	OTTHUMT00000435933.1	C	NM_001015890	-		33281462	+1	no_errors	ENST00000444215	ensembl	human	known	74_37	missense	SNP	1.000	T
CEP250	11190	genome.wustl.edu	37	20	34078472	34078472	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr20:34078472C>T	ENST00000397527.1	+	21	3316	c.2596C>T	c.(2596-2598)Cgc>Tgc	p.R866C	RP3-477O4.14_ENST00000444933.1_RNA|CEP250_ENST00000342580.4_Intron|RP3-477O4.14_ENST00000416260.1_RNA|RP3-477O4.14_ENST00000453914.1_RNA	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	866	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			GGAGAAGGAGCGCTCCTGGCA	0.507																																																	0								ENSG00000126001						51.0	57.0	55.0					20																	34078472		2203	4300	6503	CEP250	SO:0001583	missense	0			-	HGNC	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.2596C>T	20.37:g.34078472C>T	ENSP00000380661:p.Arg866Cys	Somatic	0	32	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin	p.R866C	ENST00000397527.1	37	c.2596	CCDS13255.1	20	.	.	.	.	.	.	.	.	.	.	C	13.61	2.288911	0.40494	.	.	ENSG00000126001	ENST00000397527	T	0.13089	2.62	4.69	2.76	0.32466	.	0.360941	0.23941	N	0.043053	T	0.12433	0.0302	L	0.52364	1.645	0.37884	D	0.930497	B	0.19706	0.038	B	0.17098	0.017	T	0.07065	-1.0792	10	0.49607	T	0.09	.	7.3103	0.26471	0.0:0.7998:0.0:0.2002	.	866	Q9BV73	CP250_HUMAN	C	866	ENSP00000380661:R866C	ENSP00000380661:R866C	R	+	1	0	CEP250	33541886	0.424000	0.25490	0.860000	0.33809	0.933000	0.57130	0.228000	0.17814	0.719000	0.32188	0.555000	0.69702	CGC	-	NULL		0.507	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP250	protein_coding	OTTHUMT00000078877.7	C	NM_007186	-		34078472	+1	no_errors	ENST00000397527	ensembl	human	known	74_37	missense	SNP	0.618	T
MET	4233	genome.wustl.edu	37	7	116340270	116340270	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr7:116340270G>A	ENST00000318493.6	+	2	1319	c.1132G>A	c.(1132-1134)Gtc>Atc	p.V378I	MET_ENST00000397752.3_Missense_Mutation_p.V378I|MET_ENST00000436117.2_Missense_Mutation_p.V378I			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			CAACAAGATCGTCAACAAAAA	0.433			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																															Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	0								ENSG00000105976						104.0	96.0	99.0					7																	116340270		1925	4140	6065	MET	SO:0001583	missense	0	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	-	HGNC	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.1132G>A	7.37:g.116340270G>A	ENSP00000317272:p.Val378Ile	Somatic	0	31	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	28	33.33	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Semap_dom,pfscan_Prot_kinase_dom	p.V378I	ENST00000318493.6	37	c.1132	CCDS47689.1	7	.	.	.	.	.	.	.	.	.	.	G	11.70	1.715979	0.30413	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	T;T;T	0.04406	3.63;3.63;3.63	6.04	6.04	0.98038	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.217393	0.48286	D	0.000198	T	0.14960	0.0361	L	0.56396	1.775	0.80722	D	1	P;B;D;B;B;B;B;B;P;B;B;D;D	0.61697	0.916;0.43;0.987;0.032;0.032;0.032;0.057;0.057;0.945;0.276;0.032;0.99;0.99	B;B;P;B;B;B;B;B;P;B;B;P;P	0.54460	0.298;0.116;0.713;0.021;0.021;0.016;0.031;0.031;0.476;0.104;0.025;0.753;0.753	T	0.00173	-1.1957	10	0.35671	T	0.21	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	378;378;378;378;378;378;378;378;378;378;378;378;378	B5A929;E7EQ94;B5A930;B5A934;B5A936;B5A937;B5A939;B5A941;B5A940;P08581-2;B5A942;P08581;A1L467	.;.;.;.;.;.;.;.;.;.;.;MET_HUMAN;.	I	378	ENSP00000380860:V378I;ENSP00000317272:V378I;ENSP00000410980:V378I	ENSP00000317272:V378I	V	+	1	0	MET	116127506	1.000000	0.71417	0.992000	0.48379	0.974000	0.67602	6.696000	0.74598	2.873000	0.98535	0.563000	0.77884	GTC	-	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.433	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MET	protein_coding	OTTHUMT00000059620.3	G		-		116340270	+1	no_errors	ENST00000318493	ensembl	human	known	74_37	missense	SNP	1.000	A
TSHZ3	57616	genome.wustl.edu	37	19	31768099	31768099	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr19:31768099C>T	ENST00000240587.4	-	2	2927	c.2600G>A	c.(2599-2601)aGc>aAc	p.S867N		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	867					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					CTCGGAGATGCTGGAAGGAGT	0.557																																																	0								ENSG00000121297						95.0	91.0	92.0					19																	31768099		2203	4300	6503	TSHZ3	SO:0001583	missense	0			-	HGNC	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2600G>A	19.37:g.31768099C>T	ENSP00000240587:p.Ser867Asn	Somatic	0	31	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q9H0G6|Q9P254	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.S867N	ENST00000240587.4	37	c.2600	CCDS12421.2	19	.	.	.	.	.	.	.	.	.	.	C	17.83	3.486646	0.63962	.	.	ENSG00000121297	ENST00000240587	T	0.13307	2.6	5.09	5.09	0.68999	.	0.040486	0.85682	D	0.000000	T	0.19167	0.0460	L	0.46157	1.445	0.80722	D	1	P	0.51791	0.948	P	0.45610	0.487	T	0.00978	-1.1493	10	0.41790	T	0.15	-23.5578	18.4995	0.90876	0.0:1.0:0.0:0.0	.	867	Q63HK5	TSH3_HUMAN	N	867	ENSP00000240587:S867N	ENSP00000240587:S867N	S	-	2	0	TSHZ3	36459939	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.455000	0.80726	2.351000	0.79841	0.591000	0.81541	AGC	-	NULL		0.557	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	protein_coding	OTTHUMT00000316743.2	C	NM_020856	-		31768099	-1	no_errors	ENST00000240587	ensembl	human	known	74_37	missense	SNP	1.000	T
EGF	1950	genome.wustl.edu	37	4	110897298	110897298	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:110897298G>A	ENST00000265171.5	+	13	2405	c.1960G>A	c.(1960-1962)Gac>Aac	p.D654N	EGF_ENST00000503392.1_Missense_Mutation_p.D654N|EGF_ENST00000509793.1_Missense_Mutation_p.D612N	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	654					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	CTTCTTAACTGACAAGTTGTA	0.478																																																	0								ENSG00000138798						148.0	136.0	140.0					4																	110897298		2203	4300	6503	EGF	SO:0001583	missense	0			-	HGNC	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.1960G>A	4.37:g.110897298G>A	ENSP00000265171:p.Asp654Asn	Somatic	0	65	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	55	24.66	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt	p.D654N	ENST00000265171.5	37	c.1960	CCDS3689.1	4	.	.	.	.	.	.	.	.	.	.	G	18.92	3.726547	0.69074	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	D;D;D	0.93426	-3.22;-3.22;-3.22	5.77	5.77	0.91146	Six-bladed beta-propeller, TolB-like (1);	0.138414	0.64402	D	0.000005	D	0.92945	0.7755	L	0.39020	1.185	0.44956	D	0.997973	P;P;P	0.49307	0.65;0.513;0.922	P;B;P	0.54060	0.465;0.261;0.741	D	0.92066	0.5660	10	0.39692	T	0.17	.	15.1628	0.72798	0.0692:0.0:0.9308:0.0	.	654;612;654	E7EVD2;P01133-2;P01133	.;.;EGF_HUMAN	N	612;654;654	ENSP00000424316:D612N;ENSP00000265171:D654N;ENSP00000421384:D654N	ENSP00000265171:D654N	D	+	1	0	EGF	111116747	0.999000	0.42202	0.979000	0.43373	0.993000	0.82548	2.813000	0.48002	2.723000	0.93209	0.655000	0.94253	GAC	-	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.478	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EGF	protein_coding	OTTHUMT00000255065.1	G		-		110897298	+1	no_errors	ENST00000265171	ensembl	human	known	74_37	missense	SNP	0.992	A
MDGA2	161357	genome.wustl.edu	37	14	47324254	47324254	+	Silent	SNP	A	A	C			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr14:47324254A>C	ENST00000399232.2	-	15	3013	c.2649T>G	c.(2647-2649)gtT>gtG	p.V883V	MDGA2_ENST00000357362.3_Silent_p.V654V|MDGA2_ENST00000426342.1_Silent_p.V654V|MDGA2_ENST00000399222.3_Silent_p.V85V|MDGA2_ENST00000439988.3_Silent_p.V952V	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	883	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						GGTATATATTAACATGAGCCT	0.328																																																	0								ENSG00000272781						140.0	129.0	132.0					14																	47324254		1824	4075	5899	MDGA2	SO:0001819	synonymous_variant	0			-	Uniprot_gn	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.2649T>G	14.37:g.47324254A>C		Somatic	0	40	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	37	36.67	F6W3S7|J3KPX6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like_dom	p.V952	ENST00000399232.2	37	c.2856		14																																																																																			-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom		0.328	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	protein_coding	OTTHUMT00000073352.5	A	NM_182830	-		47324254	-1	no_errors	ENST00000439988	ensembl	human	known	74_37	silent	SNP	0.999	C
RIN1	9610	genome.wustl.edu	37	11	66102588	66102588	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr11:66102588G>T	ENST00000311320.4	-	6	808	c.682C>A	c.(682-684)Ctg>Atg	p.L228M	RIN1_ENST00000524804.1_5'Flank|RIN1_ENST00000424433.2_Missense_Mutation_p.L123M|RIN1_ENST00000530056.1_Missense_Mutation_p.L123M|RP11-867G23.12_ENST00000526655.1_RNA	NM_004292.2	NP_004283.2	Q13671	RIN1_HUMAN	Ras and Rab interactor 1	228					associative learning (GO:0008306)|endocytosis (GO:0006897)|memory (GO:0007613)|negative regulation of synaptic plasticity (GO:0031914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(1)	14						CCCGGGAACAGGGGGTTGAAG	0.662																																																	0								ENSG00000174791						50.0	52.0	51.0					11																	66102588		2200	4294	6494	RIN1	SO:0001583	missense	0			-	HGNC	L36463	CCDS31614.1	11q13.2	2005-09-18				ENSG00000174791			18749	protein-coding gene	gene with protein product		605965				9144171, 1849280	Standard	NM_004292		Approved		uc001ohn.1	Q13671		ENST00000311320.4:c.682C>A	11.37:g.66102588G>T	ENSP00000310406:p.Leu228Met	Somatic	0	27	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	O15010|Q00427|Q96CC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VPS9,pfam_Ras-assoc,smart_SH2,smart_VPS9_subgr,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.L228M	ENST00000311320.4	37	c.682	CCDS31614.1	11	.	.	.	.	.	.	.	.	.	.	G	19.27	3.795669	0.70452	.	.	ENSG00000174791	ENST00000311320;ENST00000424433;ENST00000530056	T;T;T	0.23147	2.47;2.36;1.92	4.43	2.47	0.30058	.	0.000000	0.56097	D	0.000023	T	0.41650	0.1168	L	0.59436	1.845	0.30885	N	0.731035	D;D	0.89917	0.999;1.0	D;D	0.83275	0.996;0.988	T	0.40156	-0.9578	10	0.72032	D	0.01	-17.4522	7.8454	0.29422	0.2141:0.0:0.7858:0.0	.	123;228	E9PNR2;Q13671	.;RIN1_HUMAN	M	228;123;123	ENSP00000310406:L228M;ENSP00000400560:L123M;ENSP00000432798:L123M	ENSP00000310406:L228M	L	-	1	2	RIN1	65859164	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.037000	0.41174	0.980000	0.38523	0.462000	0.41574	CTG	-	NULL		0.662	RIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN1	protein_coding	OTTHUMT00000392980.2	G	NM_004292	-		66102588	-1	no_errors	ENST00000311320	ensembl	human	known	74_37	missense	SNP	1.000	T
DCAF8L2	347442	genome.wustl.edu	37	X	27766328	27766328	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chrX:27766328C>T	ENST00000451261.2	+	5	1715	c.1316C>T	c.(1315-1317)gCc>gTc	p.A439V		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	439								p.A406V(1)		central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						GAGCTGCTAGCCAGCTACAAT	0.443																																																	1	Substitution - Missense(1)	skin(1)						ENSG00000189186						156.0	105.0	120.0					X																	27766328		692	1591	2283	DCAF8L2	SO:0001583	missense	0			-	HGNC		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.1316C>T	X.37:g.27766328C>T	ENSP00000462745:p.Ala439Val	Somatic	0	44	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	50	16.67	B2RXH9|J3KT06	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A439V	ENST00000451261.2	37	c.1316	CCDS59162.1	X																																																																																			-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.443	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L2	protein_coding	OTTHUMT00000056143.4	C	XM_293354	-		27766328	+1	no_errors	ENST00000451261	ensembl	human	known	74_37	missense	SNP	1.000	T
EIF2D	1939	genome.wustl.edu	37	1	206778849	206778849	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr1:206778849G>T	ENST00000271764.2	-	5	642	c.434C>A	c.(433-435)gCc>gAc	p.A145D	EIF2D_ENST00000367114.3_Missense_Mutation_p.A145D	NM_006893.2	NP_008824.2	P41214	EIF2D_HUMAN	eukaryotic translation initiation factor 2D	145	PUA. {ECO:0000255|PROSITE- ProRule:PRU00161}.				formation of translation preinitiation complex (GO:0001731)|intracellular protein transport (GO:0006886)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor activity (GO:0004872)|translation initiation factor activity (GO:0003743)			autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						AACTCCAATGGCTACAGGGGC	0.517																																																	0								ENSG00000143486						73.0	58.0	63.0					1																	206778849		2203	4300	6503	EIF2D	SO:0001583	missense	0			-	HGNC	BC001585	CCDS1465.1, CCDS55680.1	1q32.1	2014-05-06	2011-01-19	2011-01-19	ENSG00000143486	ENSG00000143486			6583	protein-coding gene	gene with protein product		613709				20566627	Standard	NM_001201478		Approved	LGTN	uc001heh.2	P41214	OTTHUMG00000184619	ENST00000271764.2:c.434C>A	1.37:g.206778849G>T	ENSP00000271764:p.Ala145Asp	Somatic	0	25	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	Q5SY40|Q8IXV3|Q96DG3|Q96TG7|Q9NR27|Q9NSN0|Q9NV18|Q9NZ21	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TIF_SUI1,superfamily_TIF_SUI1,superfamily_SWIB_MDM2_domain,superfamily_PUA-like_domain,smart_PUA,pfscan_PUA,pfscan_TIF_SUI1	p.A145D	ENST00000271764.2	37	c.434	CCDS1465.1	1	.	.	.	.	.	.	.	.	.	.	G	19.14	3.770155	0.69992	.	.	ENSG00000143486	ENST00000367114;ENST00000271764;ENST00000367111;ENST00000437518	T;T;T	0.47869	0.83;0.83;0.83	5.65	5.65	0.86999	Pseudouridine synthase/archaeosine transglycosylase (2);PUA-like domain (1);	0.045197	0.85682	D	0.000000	T	0.78342	0.4268	H	0.94771	3.58	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.80764	0.994;0.983	D	0.83573	0.0113	10	0.87932	D	0	-14.7038	18.4694	0.90767	0.0:0.0:1.0:0.0	.	145;145	P41214-2;P41214	.;EIF2D_HUMAN	D	145;145;117;117	ENSP00000356081:A145D;ENSP00000271764:A145D;ENSP00000394685:A117D	ENSP00000271764:A145D	A	-	2	0	EIF2D	204845472	1.000000	0.71417	0.342000	0.25602	0.469000	0.32828	6.068000	0.71201	2.941000	0.99782	0.655000	0.94253	GCC	-	superfamily_PUA-like_domain,smart_PUA,pfscan_PUA		0.517	EIF2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2D	protein_coding	OTTHUMT00000088475.1	G	NM_006893	-		206778849	-1	no_errors	ENST00000271764	ensembl	human	known	74_37	missense	SNP	0.999	T
FAT2	2196	genome.wustl.edu	37	5	150920164	150920164	+	Silent	SNP	G	G	C			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr5:150920164G>C	ENST00000261800.5	-	10	9015	c.9003C>G	c.(9001-9003)gtC>gtG	p.V3001V		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3001	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGACGTCCAGGACAAAGATCT	0.547																																																	0								ENSG00000086570						98.0	82.0	87.0					5																	150920164		2203	4300	6503	FAT2	SO:0001819	synonymous_variant	0			-	HGNC	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.9003C>G	5.37:g.150920164G>C		Somatic	0	43	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	30	18.92	O75091|Q9NSR7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.V3001	ENST00000261800.5	37	c.9003	CCDS4317.1	5																																																																																			-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.547	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	protein_coding	OTTHUMT00000252434.1	G	NM_001447	-		150920164	-1	no_errors	ENST00000261800	ensembl	human	known	74_37	silent	SNP	0.860	C
FTCD	10841	genome.wustl.edu	37	21	47575384	47575384	+	Splice_Site	SNP	C	C	A	rs200172430		TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr21:47575384C>A	ENST00000291670.5	-	1	97	c.54G>T	c.(52-54)gaG>gaT	p.E18D	FTCD_ENST00000498355.2_5'UTR|FTCD-AS1_ENST00000446649.1_RNA|FTCD_ENST00000397746.3_Splice_Site_p.E18D|FTCD_ENST00000397743.1_Splice_Site_p.E18D|FTCD_ENST00000397748.1_Splice_Site_p.E18D|FTCD_ENST00000355384.2_Splice_Site_p.E18D|FTCD_ENST00000359679.2_Splice_Site_p.E18D	NM_006657.2	NP_006648.1	O95954	FTCD_HUMAN	formimidoyltransferase cyclodeaminase	18	Formiminotransferase N-subdomain. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|cytoskeleton organization (GO:0007010)|folic acid-containing compound metabolic process (GO:0006760)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	folic acid binding (GO:0005542)|formimidoyltetrahydrofolate cyclodeaminase activity (GO:0030412)|glutamate formimidoyltransferase activity (GO:0030409)			endometrium(1)|large_intestine(2)|lung(9)|pancreas(1)|prostate(3)|skin(3)	19	Breast(49;0.214)			Colorectal(79;0.235)	Tetrahydrofolic acid(DB00116)	CGGGCCTCACCTCCTGGTTCT	0.617																																																	0								ENSG00000160282						111.0	81.0	91.0					21																	47575384		2200	4299	6499	FTCD	SO:0001630	splice_region_variant	0			-	HGNC	U91541	CCDS13731.1	21q22.3	2013-06-10	2013-06-10		ENSG00000160282	ENSG00000160282	2.1.2.5, 4.3.1.4		3974	protein-coding gene	gene with protein product		606806	"""formiminotransferase cyclodeaminase"""			10029623, 10773664	Standard	NM_006657		Approved		uc002zif.3	O95954	OTTHUMG00000090488	ENST00000291670.5:c.54+1G>T	21.37:g.47575384C>A		Somatic	0	35	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	B9EGD0|Q86V03|Q9HCT4|Q9HCT5|Q9HCT6|Q9UHJ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Formiminotransferase_N,pfam_Formiminotransferase_C,pfam_Cyclodeamin/CycHdrlase,superfamily_FormiminoTrfase_N/C_subdom,superfamily_Cyclodeamin/CycHdrlase,tigrfam_Formiminotransferase_cat	p.E18D	ENST00000291670.5	37	c.54	CCDS13731.1	21	.	.	.	.	.	.	.	.	.	.	C	17.51	3.407818	0.62399	.	.	ENSG00000160282	ENST00000291670;ENST00000397748;ENST00000359679;ENST00000355384;ENST00000397746;ENST00000397743	T;T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17;-1.17	5.22	5.22	0.72569	Formiminotransferas, N- and C-terminal subdomains (1);Formiminotransferase catalytic domain (1);Formiminotransferase, N-terminal subdomain (2);	0.293423	0.37304	N	0.002141	T	0.74733	0.3755	L	0.55481	1.735	0.80722	D	1	B;B;B	0.11235	0.002;0.004;0.004	B;B;B	0.11329	0.006;0.005;0.005	T	0.69191	-0.5210	9	.	.	.	-10.9055	18.7565	0.91835	0.0:1.0:0.0:0.0	.	18;18;18	B7WPK3;O95954-2;O95954	.;.;FTCD_HUMAN	D	18	ENSP00000291670:E18D;ENSP00000380856:E18D;ENSP00000352707:E18D;ENSP00000347545:E18D;ENSP00000380854:E18D;ENSP00000380851:E18D	.	E	-	3	2	FTCD	46399812	1.000000	0.71417	1.000000	0.80357	0.707000	0.40811	7.453000	0.80700	2.434000	0.82447	0.591000	0.81541	GAG	-	pfam_Formiminotransferase_N,superfamily_FormiminoTrfase_N/C_subdom,tigrfam_Formiminotransferase_cat		0.617	FTCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FTCD	protein_coding	OTTHUMT00000206962.1	C	NM_006657	-	Missense_Mutation	47575384	-1	no_errors	ENST00000359679	ensembl	human	known	74_37	missense	SNP	1.000	A
FMO2	2327	genome.wustl.edu	37	1	171178127	171178127	+	3'UTR	SNP	C	C	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr1:171178127C>T	ENST00000209929.7	+	0	1609				RP1-127D3.4_ENST00000422841.1_RNA|RP1-127D3.4_ENST00000445909.1_RNA|RP1-127D3.4_ENST00000445290.1_RNA|FMO2_ENST00000529935.1_3'UTR|FMO2_ENST00000441535.1_3'UTR			P31512	FMO4_HUMAN	flavin containing monooxygenase 2 (non-functional)						drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	22	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TGGGAAGGAGCCAGAAATGCC	0.458																																																	0								ENSG00000094963						80.0	83.0	82.0					1																	171178127		2203	4300	6503	FMO2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC005894	CCDS1293.1	1q24.3	2011-08-04	2006-07-17		ENSG00000094963	ENSG00000094963			3770	protein-coding gene	gene with protein product		603955	"""flavin containing monooxygenase 2"""			1417778, 9804831	Standard	XR_426768		Approved		uc001ghk.1	Q99518	OTTHUMG00000035504	ENST00000209929.7:c.*35C>T	1.37:g.171178127C>T		Somatic	0	65	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q53XR0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000209929.7	37	NULL	CCDS1293.1	1																																																																																			-	-		0.458	FMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO2	protein_coding	OTTHUMT00000086216.2	C	NM_001460	-		171178127	+1	no_errors	ENST00000529935	ensembl	human	known	74_37	rna	SNP	1.000	T
RHAG	6005	genome.wustl.edu	37	6	49604429	49604429	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr6:49604429G>A	ENST00000371175.4	-	1	123	c.97C>T	c.(97-99)Ctc>Ttc	p.L33F	RHAG_ENST00000229810.7_Missense_Mutation_p.L33F	NM_000324.2	NP_000315.2	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	33					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|carbon dioxide transport (GO:0015670)|cellular ion homeostasis (GO:0006873)|erythrocyte development (GO:0048821)|multicellular organismal iron ion homeostasis (GO:0060586)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	39	Lung NSC(77;0.0255)					AGCTGCTCGAGAACAGTCTGG	0.393																																					Ovarian(176;476 2003 7720 43408 44749)												0								ENSG00000112077						196.0	185.0	189.0					6																	49604429		2203	4300	6503	RHAG	SO:0001583	missense	0			-	HGNC		CCDS4927.1	6p12.3	2014-07-19	2006-02-23		ENSG00000112077	ENSG00000112077		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	10006	protein-coding gene	gene with protein product		180297	"""Rhesus blood group-associated glycoprotein"""			9479501	Standard	NM_000324		Approved	RH50A, CD241, SLC42A1	uc003ozk.4	Q02094	OTTHUMG00000016377	ENST00000371175.4:c.97C>T	6.37:g.49604429G>A	ENSP00000360217:p.Leu33Phe	Somatic	0	40	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	21	44.74	B2R8T8|O43514|O43515|Q7L8L3|Q9H454	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom,prints_RhesusRHD	p.L33F	ENST00000371175.4	37	c.97	CCDS4927.1	6	.	.	.	.	.	.	.	.	.	.	G	5.143	0.211964	0.09757	.	.	ENSG00000112077	ENST00000371175;ENST00000229810;ENST00000418071;ENST00000539403	T;T	0.26373	1.74;1.74	5.32	-10.6	0.00265	Ammonium transporter AmtB-like (1);	5.215190	0.00166	N	0.000000	T	0.05456	0.0144	L	0.39245	1.2	0.09310	N	1	B;B;B	0.20261	0.043;0.001;0.043	B;B;B	0.32022	0.038;0.009;0.139	T	0.17198	-1.0377	10	0.54805	T	0.06	13.3027	1.0411	0.01559	0.1995:0.1106:0.3261:0.3639	.	33;33;33	O43515;Q9UHG9;Q02094	.;.;RHAG_HUMAN	F	33	ENSP00000360217:L33F;ENSP00000229810:L33F	ENSP00000229810:L33F	L	-	1	0	RHAG	49712388	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.511000	0.00446	-3.726000	0.00115	-0.218000	0.12543	CTC	-	pfam_NH4_transpt_AmtB-like_dom		0.393	RHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHAG	protein_coding	OTTHUMT00000043806.1	G		-		49604429	-1	no_errors	ENST00000371175	ensembl	human	known	74_37	missense	SNP	0.000	A
EP400	57634	genome.wustl.edu	37	12	132547087	132547087	+	Silent	SNP	G	G	A	rs12366766	byFrequency	TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr12:132547087G>A	ENST00000333577.4	+	48	8392	c.8283G>A	c.(8281-8283)caG>caA	p.Q2761Q	EP400_ENST00000332482.4_Silent_p.Q2688Q|EP400_ENST00000330386.6_Silent_p.Q2644Q|EP400_ENST00000389561.2_Silent_p.Q2725Q|EP400_ENST00000389562.2_Silent_p.Q2724Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2761	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2724Q(16)|p.Q2725Q(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcagcaacaacagc	0.562													G|||	37	0.00738818	0.0038	0.0072	5008	,	,		15585	0.002		0.0149	False		,,,				2504	0.0102																17	Substitution - coding silent(17)	prostate(4)|kidney(4)|central_nervous_system(3)|lung(3)|endometrium(2)|urinary_tract(1)						ENSG00000183495						28.0	31.0	30.0					12																	132547087		2199	4282	6481	EP400	SO:0001819	synonymous_variant	0			-	HGNC	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8283G>A	12.37:g.132547087G>A		Somatic	0	18	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	21	25.00	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q2761	ENST00000333577.4	37	c.8283		12																																																																																			-	NULL		0.562	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	protein_coding		G	NM_015409	rs12366766		132547087	+1	no_errors	ENST00000333577	ensembl	human	known	74_37	silent	SNP	1.000	A
SLC39A3	29985	genome.wustl.edu	37	19	2737421	2737421	+	Intron	DEL	T	T	-	rs567070163	byFrequency	TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr19:2737421delT	ENST00000269740.4	-	2	208				SLC39A3_ENST00000545664.1_Intron|SLC39A3_ENST00000455372.2_Intron|SLC39A3_ENST00000590875.1_5'UTR|AC006538.4_ENST00000586572.1_Intron	NM_144564.4	NP_653165.2	Q9BRY0	S39A3_HUMAN	solute carrier family 39 (zinc transporter), member 3						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ttcttttttcttttttttttt	0.488																																																	0								ENSG00000141873																																			SLC39A3	SO:0001627	intron_variant	0				HGNC	AF052125	CCDS12093.1, CCDS45909.1	19p13.3	2013-05-22			ENSG00000141873	ENSG00000141873		"""Solute carriers"""	17128	protein-coding gene	gene with protein product		612168				10681536	Standard	NM_144564		Approved	ZIP3	uc002lwg.3	Q9BRY0		ENST00000269740.4:c.122-44A>-	19.37:g.2737421delT		Somatic	0	16	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	15	25.00	B3KMJ3|Q8WUG1	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000269740.4	37	NULL	CCDS12093.1	19																																																																																			-	-		0.488	SLC39A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC39A3	protein_coding	OTTHUMT00000451354.2	T				2737421	-1	no_errors	ENST00000590875	ensembl	human	known	74_37	rna	DEL	0.018	-
RAI1	10743	genome.wustl.edu	37	17	17682037	17682037	+	Intron	SNP	T	T	C			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr17:17682037T>C	ENST00000353383.1	+	3	453				SMCR5_ENST00000543475.1_RNA|RP1-253P7.1_ENST00000583598.1_RNA	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1						circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		AGCAGAGGCCTGCGATTCTCC	0.572																																																	0								ENSG00000226746																																			SMCR5	SO:0001627	intron_variant	0			-	HGNC	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.-16-14210T>C	17.37:g.17682037T>C		Somatic	0	64	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	24	22.58	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000353383.1	37	NULL	CCDS11188.1	17	.	.	.	.	.	.	.	.	.	.	T	12.24	1.877312	0.33162	.	.	ENSG00000226746	ENST00000543475	.	.	.	4.02	-0.648	0.11464	.	.	.	.	.	T	0.28995	0.0720	.	.	.	0.09310	N	1	B	0.14012	0.009	B	0.09377	0.004	T	0.28459	-1.0043	7	0.87932	D	0	.	6.977	0.24681	0.0:0.4337:0.0:0.5663	.	119	Q8TEV8	SMCR5_HUMAN	G	119	.	ENSP00000438627:R119G	R	-	1	2	SMCR5	17622762	0.000000	0.05858	0.000000	0.03702	0.484000	0.33280	-0.005000	0.12855	-0.046000	0.13446	0.459000	0.35465	AGG	-	-		0.572	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR5	protein_coding	OTTHUMT00000131775.1	T	NM_030665	-		17682037	-1	no_errors	ENST00000543475	ensembl	human	known	74_37	rna	SNP	0.000	C
OR1L6	392390	genome.wustl.edu	37	9	125512914	125512914	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr9:125512914C>T	ENST00000373684.1	+	1	896	c.896C>T	c.(895-897)cCc>cTc	p.P299L	OR1L6_ENST00000304720.2_Missense_Mutation_p.P263L			Q8NGR2	OR1L6_HUMAN	olfactory receptor, family 1, subfamily L, member 6	299						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	12						TATTTTAGGCCCCTGTCCATG	0.507																																																	0								ENSG00000171459						106.0	90.0	96.0					9																	125512914		2203	4300	6503	OR1L6	SO:0001583	missense	0			-	HGNC		CCDS35130.1, CCDS35130.2	9q33.2	2013-09-20			ENSG00000171459	ENSG00000171459		"""GPCR / Class A : Olfactory receptors"""	8218	protein-coding gene	gene with protein product				OR1L7			Standard	NM_001004453		Approved		uc022bna.1	Q8NGR2	OTTHUMG00000020621	ENST00000373684.1:c.896C>T	9.37:g.125512914C>T	ENSP00000362788:p.Pro299Leu	Somatic	0	59	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	63	25.88	Q6IFM8|Q96R80	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P299L	ENST00000373684.1	37	c.896		9	.	.	.	.	.	.	.	.	.	.	C	16.17	3.047569	0.55110	.	.	ENSG00000171459	ENST00000373684;ENST00000304720	T;T	0.00279	8.33;8.33	4.32	4.32	0.51571	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000044	T	0.00906	0.0030	M	0.90650	3.135	0.39774	D	0.972202	D	0.89917	1.0	D	0.97110	1.0	T	0.64761	-0.6331	10	0.72032	D	0.01	-35.1133	16.0696	0.80914	0.0:1.0:0.0:0.0	.	299	Q8NGR2	OR1L6_HUMAN	L	299;263	ENSP00000362788:P299L;ENSP00000304235:P263L	ENSP00000304235:P263L	P	+	2	0	OR1L6	124552735	0.873000	0.30073	0.998000	0.56505	0.993000	0.82548	2.294000	0.43567	2.392000	0.81423	0.655000	0.94253	CCC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.507	OR1L6-201	KNOWN	basic	protein_coding	OR1L6	protein_coding		C		-		125512914	+1	no_errors	ENST00000373684	ensembl	human	known	74_37	missense	SNP	0.589	T
EVX2	344191	genome.wustl.edu	37	2	176945342	176945368	+	In_Frame_Del	DEL	AGCCGCGGCCGCCGCGCCTGAGGCTGC	AGCCGCGGCCGCCGCGCCTGAGGCTGC	-			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	AGCCGCGGCCGCCGCGCCTGAGGCTGC	AGCCGCGGCCGCCGCGCCTGAGGCTGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr2:176945342_176945368delAGCCGCGGCCGCCGCGCCTGAGGCTGC	ENST00000308618.4	-	3	1034_1060	c.898_924delGCAGCCTCAGGCGCGGCGGCCGCGGCT	c.(898-924)gcagcctcaggcgcggcggccgcggctdel	p.AASGAAAAA300del		NM_001080458.1	NP_001073927.1	Q03828	EVX2_HUMAN	even-skipped homeobox 2	300	Poly-Ala.				limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(3)	16			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)		AGGGCGACGAAgccgcggccgccgcgcctgaggctgcagccgcggcc	0.731																																																	0								ENSG00000174279																																			EVX2	SO:0001651	inframe_deletion	0				HGNC		CCDS33333.1	2q31.1	2012-03-09	2007-02-15		ENSG00000174279	ENSG00000174279		"""Homeoboxes / ANTP class : HOXL subclass"""	3507	protein-coding gene	gene with protein product		142991	"""eve, even-skipped homeobox homolog 2 (Drosophila)"""			1675198	Standard	NM_001080458		Approved		uc010zeu.2	Q03828	OTTHUMG00000154173	ENST00000308618.4:c.898_924delGCAGCCTCAGGCGCGGCGGCCGCGGCT	2.37:g.176945342_176945368delAGCCGCGGCCGCCGCGCCTGAGGCTGC	ENSP00000312385:p.Ala300_Ala308del	Somatic	NA	NA	NA		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Antifreeze_1,prints_Homeobox_metazoa	p.AASGAAAAA300in_frame_del	ENST00000308618.4	37	c.924_898	CCDS33333.1	2																																																																																			-	NULL		0.731	EVX2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	EVX2	protein_coding	OTTHUMT00000359252.1	AGCCGCGGCCGCCGCGCCTGAGGCTGC				176945368	-1	no_errors	ENST00000308618	ensembl	human	known	74_37	in_frame_del	DEL	0.106:0.803:0.815:0.426:0.829:0.835:0.247:0.369:0.386:0.333:0.342:0.346:0.005:0.096:0.112:0.036:0.927:0.933:0.157:0.969:0.991:0.996:1.000:1.000:0.993:1.000:0.999	-
CRACR2A	84766	genome.wustl.edu	37	12	3768815	3768815	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr12:3768815A>C	ENST00000252322.1	-	8	1145	c.677T>G	c.(676-678)aTt>aGt	p.I226S	EFCAB4B_ENST00000440314.2_Missense_Mutation_p.I226S|EFCAB4B_ENST00000444507.1_Missense_Mutation_p.I226S	NM_032680.3	NP_116069.1	Q9BSW2	EFC4B_HUMAN		226					activation of store-operated calcium channel activity (GO:0032237)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			ATAAGCAGCAATTTTCCTACA	0.483																																																	0								ENSG00000130038						154.0	133.0	140.0					12																	3768815		2203	4300	6503	EFCAB4B	SO:0001583	missense	0			-	HGNC																												ENST00000252322.1:c.677T>G	12.37:g.3768815A>C	ENSP00000252322:p.Ile226Ser	Somatic	0	39	0.00		0.6827726671047611	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	18	57.14	B4E1X0|B9EK63	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_EF_hand_dom,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,pfscan_EF_hand_dom,tigrfam_Small_GTP-bd_dom	p.I226S	ENST00000252322.1	37	c.677	CCDS8522.1	12	.	.	.	.	.	.	.	.	.	.	A	15.93	2.978614	0.53720	.	.	ENSG00000130038	ENST00000440314;ENST00000444507;ENST00000252322	T;T;T	0.21361	2.01;2.65;2.66	4.86	3.7	0.42460	.	0.169109	0.52532	D	0.000066	T	0.33731	0.0873	L	0.48362	1.52	0.39417	D	0.966845	P;D;D	0.76494	0.852;0.988;0.999	B;P;D	0.83275	0.177;0.852;0.996	T	0.07770	-1.0755	10	0.18276	T	0.48	-6.5727	10.2851	0.43562	0.8339:0.1661:0.0:0.0	.	226;226;226	D7UEQ6;Q9BSW2-2;Q9BSW2	.;.;EFC4B_HUMAN	S	226	ENSP00000409382:I226S;ENSP00000412496:I226S;ENSP00000252322:I226S	ENSP00000252322:I226S	I	-	2	0	EFCAB4B	3639076	1.000000	0.71417	0.981000	0.43875	0.882000	0.50991	5.206000	0.65192	0.800000	0.34041	0.533000	0.62120	ATT	-	NULL		0.483	EFCAB4B-005	KNOWN	basic|CCDS	protein_coding	EFCAB4B	protein_coding	OTTHUMT00000398673.1	A		-		3768815	-1	no_errors	ENST00000440314	ensembl	human	known	74_37	missense	SNP	0.992	C
