#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
RGMA	56963	genome.wustl.edu	37	15	93595319	93595319	+	Silent	SNP	C	C	T			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr15:93595319C>T	ENST00000329082.7	-	3	820	c.549G>A	c.(547-549)gtG>gtA	p.V183V	RGMA_ENST00000556087.1_Silent_p.V167V|RGMA_ENST00000538818.1_Silent_p.V74V|RGMA_ENST00000542321.2_Silent_p.V167V|RGMA_ENST00000543599.1_Silent_p.V167V|RGMA_ENST00000556658.1_Silent_p.V74V|RGMA_ENST00000425933.2_Silent_p.V167V|RGMA_ENST00000555584.1_5'Flank|RGMA_ENST00000557420.1_Intron|RGMA_ENST00000557301.1_Silent_p.V191V	NM_020211.2	NP_064596	Q96B86	RGMA_HUMAN	repulsive guidance molecule family member a	183					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|neural tube closure (GO:0001843)|regulation of BMP signaling pathway (GO:0030510)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	9	Lung NSC(78;0.0542)|all_lung(78;0.0786)		BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)			AGGCGCCCTGCACCTTGCAGG	0.617																																																	0								ENSG00000182175						46.0	56.0	52.0					15																	93595319		2073	4193	6266	RGMA	SO:0001819	synonymous_variant	0			-	HGNC	AL390083	CCDS45357.1, CCDS53973.1, CCDS53974.1	15q26.1	2013-11-06	2013-11-06			ENSG00000182175			30308	protein-coding gene	gene with protein product		607362	"""RGM domain family, member A"""			15975920	Standard	NM_020211		Approved	RGM, RGMa	uc010urc.2	Q96B86		ENST00000329082.7:c.549G>A	15.37:g.93595319C>T		Somatic	0	28	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	B2RTW1|B7Z5S8|F5GXQ7|F5GZU6|G3V518|Q0JV97|Q8NC80|Q9H0E6|Q9NPM3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RGM_N,pfam_RGM_C	p.V183	ENST00000329082.7	37	c.549	CCDS45357.1	15																																																																																			-	pfam_RGM_N		0.617	RGMA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RGMA	protein_coding	OTTHUMT00000415091.1	C	NM_020211	-		93595319	-1	no_errors	ENST00000329082	ensembl	human	known	74_37	silent	SNP	1.000	T
ANP32E	81611	genome.wustl.edu	37	1	150199040	150199045	+	In_Frame_Del	DEL	TCCTCT	TCCTCT	-	rs56692627|rs28594165|rs68136184|rs28460085	byFrequency	TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	TCCTCT	TCCTCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr1:150199040_150199045delTCCTCT	ENST00000314136.8	-	5	945_950	c.576_581delAGAGGA	c.(574-582)gaagaggag>gag	p.192_194EEE>E	ANP32E_ENST00000369119.3_In_Frame_Del_p.144_146EEE>E|ANP32E_ENST00000533654.1_In_Frame_Del_p.KR137del|ANP32E_ENST00000369116.4_In_Frame_Del_p.60_62EEE>E|ANP32E_ENST00000369114.5_Intron|ANP32E_ENST00000369115.2_In_Frame_Del_p.60_62EEE>E|ANP32E_ENST00000436748.2_In_Frame_Del_p.151_153EEE>E	NM_001136478.2|NM_001280559.1|NM_030920.3	NP_001129950.1|NP_001267488.1|NP_112182.1	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member E	192	Asp/Glu-rich (highly acidic).				histone exchange (GO:0043486)|negative regulation of catalytic activity (GO:0043086)	cytoplasmic membrane-bounded vesicle (GO:0016023)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	histone binding (GO:0042393)|phosphatase inhibitor activity (GO:0019212)			breast(3)|endometrium(3)|lung(7)|skin(1)|urinary_tract(1)	15	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			atcctcatcctcctcttcctcttcct	0.437														1756	0.350639	0.1596	0.3559	5008	,	,		19419	0.5446		0.2753	False		,,,				2504	0.4826																0								ENSG00000143401		,,	627,3639		79,469,1585					,,	-6.5	0.0		dbSNP_130	261	1908,6340		294,1320,2510	no	coding,coding,coding	ANP32E	NM_030920.3,NM_001136479.1,NM_001136478.2	,,	373,1789,4095	A1A1,A1R,RR		23.1329,14.6976,20.2573	,,	,,		2535,9979				ANP32E	SO:0001651	inframe_deletion	0				HGNC	AK092672	CCDS946.1, CCDS44214.1, CCDS44215.1, CCDS60245.1	1q22	2008-02-05			ENSG00000143401	ENSG00000143401		"""ANP32 acidic nuclear phosphoproteins"""	16673	protein-coding gene	gene with protein product		609611				12438741	Standard	NM_030920		Approved	LANPL, MGC5350, LANP-L	uc001etw.3	Q9BTT0	OTTHUMG00000012547	ENST00000314136.8:c.576_581delAGAGGA	1.37:g.150199046_150199051delTCCTCT	ENSP00000324074:p.Glu192_Glu193del	Somatic	NA	NA	NA		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4E0I6|E9PEA6|Q5TB18|Q5TB20|Q8N1S4|Q8WWW9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt	p.EE193in_frame_del	ENST00000314136.8	37	c.581_576	CCDS946.1	1																																																																																			-	NULL		0.437	ANP32E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANP32E	protein_coding	OTTHUMT00000035056.1	TCCTCT	NM_030920			150199045	-1	no_errors	ENST00000314136	ensembl	human	known	74_37	in_frame_del	DEL	0.001:0.006:0.000:0.058:0.106:0.091	-
TMEM45A	55076	genome.wustl.edu	37	3	100295909	100295910	+	3'UTR	INS	-	-	TTGTCT	rs199733796|rs5851214	byFrequency	TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr3:100295909_100295910insTTGTCT	ENST00000323523.4	+	0	1188_1189				TMEM45A_ENST00000403410.1_3'UTR	NM_018004.1	NP_060474.1	Q9NWC5	TM45A_HUMAN	transmembrane protein 45A							integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)	11						TCTTTTTTACATTGTTCTTGGT	0.347														1253	0.2502	0.3843	0.2493	5008	,	,		18917	0.3185		0.1213	False		,,,				2504	0.1319																0								ENSG00000181458			1436,2816		258,920,948						2.1	0.0		dbSNP_114	38	989,7257		60,869,3194	no	utr-3	TMEM45A	NM_018004.1		318,1789,4142	A1A1,A1R,RR		11.9937,33.7723,19.4031				2425,10073				TMEM45A	SO:0001624	3_prime_UTR_variant	0				HGNC	AK000996	CCDS2937.1	3q12.2	2005-02-04			ENSG00000181458	ENSG00000181458			25480	protein-coding gene	gene with protein product						12477932	Standard	XM_005247568		Approved	FLJ10134, DERP7	uc003dtz.1	Q9NWC5	OTTHUMG00000150327	ENST00000323523.4:c.*48->TTGTCT	3.37:g.100295909_100295910insTTGTCT		Somatic	NA	NA	NA		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q53YW5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000323523.4	37	NULL	CCDS2937.1	3																																																																																			-	-		0.347	TMEM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM45A	protein_coding	OTTHUMT00000317571.1	-	NM_018004			100295910	+1	no_errors	ENST00000488904	ensembl	human	known	74_37	rna	INS	0.000:0.031	TTGTCT
VWA8	23078	genome.wustl.edu	37	13	42273392	42273392	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr13:42273392T>C	ENST00000379310.3	-	29	3447	c.3379A>G	c.(3379-3381)Act>Gct	p.T1127A		NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	1127						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										ACATAGAGAGTATTTTGCTCA	0.373																																																	0								ENSG00000102763						77.0	74.0	75.0					13																	42273392		1841	4090	5931	VWA8	SO:0001583	missense	0			-	HGNC	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.3379A>G	13.37:g.42273392T>C	ENSP00000368612:p.Thr1127Ala	Somatic	0	21	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	65	18.75	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_dyneun-rel_AAA,pfam_VWF_A,superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_VWF_A,pfscan_VWF_A	p.T1127A	ENST00000379310.3	37	c.3379	CCDS41881.1	13	.	.	.	.	.	.	.	.	.	.	T	0.061	-1.224201	0.01530	.	.	ENSG00000102763	ENST00000251030;ENST00000379310	T	0.09538	2.97	5.5	3.09	0.35607	.	0.471642	0.22627	N	0.057627	T	0.08179	0.0204	L	0.50333	1.59	0.26384	N	0.97669	B	0.02656	0.0	B	0.01281	0.0	T	0.41161	-0.9524	10	0.11182	T	0.66	.	4.4746	0.11729	0.1355:0.234:0.0:0.6304	.	1127	A3KMH1	K0564_HUMAN	A	1031;1127	ENSP00000368612:T1127A	ENSP00000251030:T1031A	T	-	1	0	KIAA0564	41171392	0.003000	0.15002	0.123000	0.21794	0.062000	0.15995	0.123000	0.15708	0.484000	0.27630	0.477000	0.44152	ACT	-	NULL		0.373	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA8	protein_coding	OTTHUMT00000354828.2	T	NM_015058	-		42273392	-1	no_errors	ENST00000379310	ensembl	human	known	74_37	missense	SNP	0.418	C
ARPC2	10109	genome.wustl.edu	37	2	219118832	219118832	+	3'UTR	DEL	A	A	-	rs376913304		TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr2:219118832delA	ENST00000295685.10	+	0	1358				RP11-378A13.1_ENST00000562328.1_RNA|ARPC2_ENST00000315717.5_3'UTR	NM_005731.2	NP_005722.1	O15144	ARPC2_HUMAN	actin related protein 2/3 complex, subunit 2, 34kDa						Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	6		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		CCCAAGAATTAAAAAAAAAAA	0.368																																																	0								ENSG00000163466																																			ARPC2	SO:0001624	3_prime_UTR_variant	0				HGNC	AF006085	CCDS2410.1	2q36.1	2011-07-06	2002-08-29		ENSG00000163466	ENSG00000163466		"""Actin related protein 2/3 complex subunits"""	705	protein-coding gene	gene with protein product		604224	"""actin related protein 2/3 complex, subunit 2 (34 kD)"""			9359840, 9230079	Standard	NM_005731		Approved	p34-Arc, ARC34	uc002vhd.4	O15144	OTTHUMG00000133618	ENST00000295685.10:c.*194A>-	2.37:g.219118832delA		Somatic	0	33	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	42	19.23	Q92801|Q9P1D4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000295685.10	37	NULL	CCDS2410.1	2																																																																																			-	-		0.368	ARPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPC2	protein_coding	OTTHUMT00000256777.2	A	NM_005731			219118832	+1	no_errors	ENST00000487321	ensembl	human	putative	74_37	rna	DEL	0.933	-
ESRP1	54845	genome.wustl.edu	37	8	95658450	95658450	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr8:95658450delA	ENST00000433389.2	+	4	620	c.430delA	c.(430-432)aagfs	p.K145fs	ESRP1_ENST00000358397.5_Frame_Shift_Del_p.K145fs|ESRP1_ENST00000454170.2_Frame_Shift_Del_p.K145fs|ESRP1_ENST00000423620.2_Frame_Shift_Del_p.K145fs	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	145					mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						AAAAGAATTCAAGAAATGTTG	0.353																																																	0								ENSG00000104413						159.0	150.0	153.0					8																	95658450		1869	4096	5965	ESRP1	SO:0001589	frameshift_variant	0				HGNC	AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.430delA	8.37:g.95658450delA	ENSP00000405738:p.Lys145fs	Somatic	0	71	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	53	43.62	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_RNaseH-like_dom,smart_RRM_dom,pfscan_RRM_dom	p.K144fs	ENST00000433389.2	37	c.430	CCDS47897.1	8																																																																																			-	superfamily_RNaseH-like_dom		0.353	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ESRP1	protein_coding	OTTHUMT00000379326.1	A	NM_017697			95658450	+1	no_errors	ENST00000433389	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
FASN	2194	genome.wustl.edu	37	17	80038035	80038035	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr17:80038035G>A	ENST00000306749.2	-	41	7345	c.7127C>T	c.(7126-7128)aCg>aTg	p.T2376M	FASN_ENST00000579758.1_Intron	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	2376	Thioesterase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	CTCCATGTCCGTGAACTGCTG	0.622																																					Colon(59;314 1043 11189 28578 32273)												0								ENSG00000169710						130.0	114.0	120.0					17																	80038035		2203	4299	6502	FASN	SO:0001583	missense	0			-	HGNC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.7127C>T	17.37:g.80038035G>A	ENSP00000304592:p.Thr2376Met	Somatic	0	25	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	39	11.36	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Acyl_transferase,pfam_Ketoacyl_synth_N,pfam_Thioesterase,pfam_PKS_KR,pfam_DH_sc/Rdtase_SDR,pfam_Ketoacyl_synth_C,pfam_ADH_C,pfam_Acyl_carrier_prot-like,pfam_Methyltransf_12,pfam_Methyltransf_11,superfamily_Thiolase-like,superfamily_Acyl_Trfase/lysoPLipase,superfamily_GroES-like,superfamily_Acyl_carrier_prot-like,superfamily_Malonyl_transacylase_ACP-bd,smart_PKS_Beta-ketoAc_synthase_dom,smart_PKS_acyl_transferase,smart_PKS_dehydratase,smart_PKS_ER,smart_PKS/FAS_KR,smart_PKS_PP-bd,pfscan_Acyl_carrier_prot-like	p.T2376M	ENST00000306749.2	37	c.7127	CCDS11801.1	17	.	.	.	.	.	.	.	.	.	.	G	11.78	1.739439	0.30774	.	.	ENSG00000169710	ENST00000306749	T	0.26810	1.71	4.68	0.737	0.18314	Fatty acid synthase, domain 2 (1);Thioesterase (1);	0.190337	0.44483	N	0.000442	T	0.22166	0.0534	L	0.50333	1.59	0.43637	D	0.99603	P	0.48589	0.912	B	0.43052	0.406	T	0.02138	-1.1207	10	0.39692	T	0.17	-7.312	8.6943	0.34287	0.3077:0.0:0.6923:0.0	.	2376	P49327	FAS_HUMAN	M	2376	ENSP00000304592:T2376M	ENSP00000304592:T2376M	T	-	2	0	FASN	77631324	0.950000	0.32346	0.163000	0.22734	0.312000	0.27988	1.503000	0.35715	0.013000	0.14918	0.591000	0.81541	ACG	-	pfam_Thioesterase		0.622	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASN	protein_coding	OTTHUMT00000442369.1	G	NM_004104	-		80038035	-1	no_errors	ENST00000306749	ensembl	human	known	74_37	missense	SNP	0.881	A
FLJ37453	729614	genome.wustl.edu	37	1	16162412	16162413	+	RNA	INS	-	-	GC	rs35098215|rs368250925|rs554075159|rs71574140	byFrequency	TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr1:16162412_16162413insGC	ENST00000317122.1	-	0	1028_1029				RP11-169K16.9_ENST00000535249.1_RNA	NR_024279.1																						GTGGTGCGTGAGCGCGCGCGCG	0.644																																																	0								ENSG00000179743																																			RP11-169K16.9			0				Clone_based_vega_gene																													1.37:g.16162421_16162422dupGC		Somatic	0	10	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	9	43.75		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000317122.1	37	NULL		1																																																																																			-	-		0.644	RP11-169K16.9-001	KNOWN	basic	antisense	FLJ37453	antisense	OTTHUMT00000025992.1	-				16162413	-1	no_errors	ENST00000317122	ensembl	human	known	74_37	rna	INS	0.091:0.173	GC
AZU1	566	genome.wustl.edu	37	19	831755	831755	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr19:831755C>T	ENST00000233997.2	+	5	655	c.634C>T	c.(634-636)Cac>Tac	p.H212Y		NM_001700.3	NP_001691.1	P20160	CAP7_HUMAN	azurocidin 1	212	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular extravasation (GO:0045123)|defense response to Gram-negative bacterium (GO:0050829)|glial cell migration (GO:0008347)|induction of positive chemotaxis (GO:0050930)|inflammatory response (GO:0006954)|macrophage chemotaxis (GO:0048246)|microglial cell activation (GO:0001774)|monocyte activation (GO:0042117)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell adhesion (GO:0045785)|positive regulation of fractalkine biosynthetic process (GO:0050754)|positive regulation of interleukin-1 beta biosynthetic process (GO:0050725)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of phagocytosis (GO:0050766)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of vascular permeability (GO:0043114)	azurophil granule (GO:0042582)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)|toxic substance binding (GO:0015643)			NS(1)|endometrium(1)|kidney(1)|lung(4)|pancreas(1)|upper_aerodigestive_tract(2)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGCCTGGCCCACGGCGTGGC	0.692																																																	0								ENSG00000172232						17.0	20.0	19.0					19																	831755		2197	4291	6488	AZU1	SO:0001583	missense	0			-	HGNC	X58794	CCDS12044.1	19p13.3	2012-03-30	2008-08-01		ENSG00000172232	ENSG00000172232			913	protein-coding gene	gene with protein product	"""cationic antimicrobial protein 37"", ""heparin-binding protein"", ""neutrophil azurocidin"""	162815				1919011	Standard	NM_001700		Approved	AZU, CAP37, AZAMP, HBP, NAZC, HUMAZUR	uc002lpz.1	P20160		ENST00000233997.2:c.634C>T	19.37:g.831755C>T	ENSP00000233997:p.His212Tyr	Somatic	0	38	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	67	24.72	P80014|Q52LG4|Q9UCM1|Q9UCT5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.H212Y	ENST00000233997.2	37	c.634	CCDS12044.1	19	.	.	.	.	.	.	.	.	.	.	C	11.93	1.786812	0.31593	.	.	ENSG00000172232	ENST00000233997	D	0.88431	-2.38	1.87	-0.307	0.12777	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.78483	0.4290	N	0.13043	0.29	0.09310	N	1	D	0.58620	0.983	P	0.46110	0.504	T	0.69636	-0.5092	9	0.52906	T	0.07	.	3.909	0.09194	0.0:0.5796:0.0:0.4204	.	212	P20160	CAP7_HUMAN	Y	212	ENSP00000233997:H212Y	ENSP00000233997:H212Y	H	+	1	0	AZU1	782755	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.236000	0.17967	-0.021000	0.14009	0.561000	0.74099	CAC	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.692	AZU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZU1	protein_coding	OTTHUMT00000457472.2	C	NM_001700	-		831755	+1	no_errors	ENST00000233997	ensembl	human	known	74_37	missense	SNP	0.000	T
PIM1	5292	genome.wustl.edu	37	6	37139016	37139025	+	Frame_Shift_Del	DEL	TCCTGGAGAG	TCCTGGAGAG	-			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	TCCTGGAGAG	TCCTGGAGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr6:37139016_37139025delTCCTGGAGAG	ENST00000373509.5	+	4	729_738	c.356_365delTCCTGGAGAG	c.(355-366)atcctggagaggfs	p.ILER119fs		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	210					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	TTCGTCCTGATCCTGGAGAGGCCCGAGCCG	0.614			T	BCL6	NHL																																			Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	0								ENSG00000137193																																			PIM1	SO:0001589	frameshift_variant	0				HGNC		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.356_365delTCCTGGAGAG	6.37:g.37139016_37139025delTCCTGGAGAG	ENSP00000362608:p.Ile119fs	Somatic	NA	NA	NA		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q38RT9|Q5T7H7|Q96RG3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.I119fs	ENST00000373509.5	37	c.356_365	CCDS4830.1	6																																																																																			-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.614	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PIM1	protein_coding	OTTHUMT00000043903.1	TCCTGGAGAG				37139025	+1	no_errors	ENST00000373509	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.944:1.000	-
TPM3	7170	genome.wustl.edu	37	1	154144673	154144674	+	Intron	INS	-	-	A			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr1:154144673_154144674insA	ENST00000368530.2	-	5	759				TPM3_ENST00000368533.3_Intron|TPM3_ENST00000341485.5_Intron|TPM3_ENST00000330188.9_Intron|TPM3_ENST00000323144.7_Intron|TPM3_ENST00000469717.1_5'UTR|TPM3_ENST00000271850.7_Intron|TPM3_ENST00000302206.5_Intron|TPM3_ENST00000341372.3_Intron|TPM3_ENST00000328159.4_Intron|TPM3_ENST00000368531.2_Intron	NM_152263.2	NP_689476.2	P06753	TPM3_HUMAN	tropomyosin 3						cellular component movement (GO:0006928)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle thin filament tropomyosin (GO:0005862)|stress fiber (GO:0001725)			TPM3/NTRK1_ENST00000392302(70)|TPM3/ALK(33)	breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)					GCAGCAAAACGAAAAAAAAAAA	0.441			T	"""NTRK1, ALK, ROS1"""	"""papillary thyroid, ALCL, NSCLC"""																																			Dom	yes		1	1q22-q23	7170	tropomyosin 3		"""E, L"""	0								ENSG00000143549																																			TPM3	SO:0001627	intron_variant	0				HGNC	BC008425	CCDS1060.1, CCDS41400.1, CCDS41401.1, CCDS41402.1, CCDS41403.1, CCDS60274.1, CCDS60275.1, CCDS72922.1	1q21.2	2014-09-17			ENSG00000143549	ENSG00000143549		"""Tropomyosins"""	12012	protein-coding gene	gene with protein product		191030		NEM1		1829807	Standard	NM_153649		Approved	TRK	uc001fec.2	P06753	OTTHUMG00000035853	ENST00000368530.2:c.566+709->T	1.37:g.154144684_154144684dupA		Somatic	0	22	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	52	8.77	D3DV71|P12324|Q2QD06|Q5VU58|Q5VU63|Q5VU66|Q5VU71|Q5VU72|Q8TCG3|Q969Q2|Q9NQH8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368530.2	37	NULL	CCDS41403.1	1																																																																																			-	-		0.441	TPM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPM3	protein_coding	OTTHUMT00000087271.2	-	NM_152263			154144674	-1	no_errors	ENST00000469717	ensembl	human	known	74_37	rna	INS	0.012:0.000	A
LINC00266-1	140849	genome.wustl.edu	37	20	62934863	62934864	+	RNA	INS	-	-	TT	rs370163240|rs4057443		TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr20:62934863_62934864insTT	ENST00000279067.3	+	0	879_880					NR_040415.1				long intergenic non-protein coding RNA 266-1																		GTAATTTTAACTGTGATTTATT	0.332																																																	0								ENSG00000149656																																			LINC00266-1			0				HGNC	BC118988		20q13.33	2012-10-12	2011-08-11	2011-08-11	ENSG00000149656	ENSG00000149656		"""Long non-coding RNAs"""	16202	non-coding RNA	RNA, long non-coding			"""chromosome 20 open reading frame 69"", ""non-protein coding RNA 266"", ""non-protein coding RNA 266-1"""	C20orf69, NCRNA00266, NCRNA00266-1			Standard	NR_040415		Approved	bA476I15.3	uc002yio.1		OTTHUMG00000033036		20.37:g.62934863_62934864insTT		Somatic	0	20	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	37	17.78		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000279067.3	37	NULL		20																																																																																			-	-		0.332	LINC00266-1-001	KNOWN	basic	processed_transcript	LINC00266-1	processed_transcript	OTTHUMT00000080304.2	-				62934864	+1	no_errors	ENST00000279067	ensembl	human	known	74_37	rna	INS	0.448:0.498	TT
ZDHHC11	79844	genome.wustl.edu	37	5	833915	833915	+	Missense_Mutation	SNP	G	G	T	rs605088	byFrequency	TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr5:833915G>T	ENST00000283441.8	-	7	1291	c.908C>A	c.(907-909)gCt>gAt	p.A303D	ZDHHC11_ENST00000424784.2_Missense_Mutation_p.A303D|ZDHHC11_ENST00000503758.2_5'UTR	NM_024786.2	NP_079062.1	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11	303						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.A303D(10)		haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			CAGGGCGCCAGCTCCTTGCTG	0.438																																																	10	Substitution - Missense(10)	prostate(8)|liver(2)						ENSG00000188818						8.0	8.0	8.0					5																	833915		2154	4191	6345	ZDHHC11	SO:0001583	missense	0			-	HGNC	AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000283441.8:c.908C>A	5.37:g.833915G>T	ENSP00000283441:p.Ala303Asp	Somatic	0	33	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	39	13.33	Q6UWR9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.A303D	ENST00000283441.8	37	c.908	CCDS3857.1	5	515	0.2358058608058608	134	0.27235772357723576	83	0.2292817679558011	145	0.2534965034965035	153	0.20184696569920843	t	0.056	-1.237364	0.01493	.	.	ENSG00000188818	ENST00000424784;ENST00000283441	T;T	0.32023	1.47;1.47	1.32	-2.64	0.06114	.	159.412000	0.01375	U	0.012736	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.24333	-1.0163	9	0.30854	T	0.27	.	0.5085	0.00591	0.2028:0.3259:0.2042:0.267	rs605088;rs4045358;rs59272565	303	Q9H8X9	ZDH11_HUMAN	D	303	ENSP00000397719:A303D;ENSP00000283441:A303D	ENSP00000283441:A303D	A	-	2	0	ZDHHC11	886915	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-2.877000	0.00717	-2.317000	0.00644	-1.448000	0.01049	GCT	-	NULL		0.438	ZDHHC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC11	protein_coding	OTTHUMT00000206681.3	G	NM_024786	rs605088		833915	-1	no_errors	ENST00000283441	ensembl	human	known	74_37	missense	SNP	0.000	T
CCDC150	284992	genome.wustl.edu	37	2	197531519	197531519	+	Frame_Shift_Del	DEL	A	A	-	rs75642251|rs376590781		TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr2:197531519delA	ENST00000389175.4	+	7	974	c.839delA	c.(838-840)caafs	p.Q280fs	CCDC150_ENST00000423093.2_Intron|CCDC150_ENST00000272831.7_Intron|CCDC150_ENST00000472405.2_Intron	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	280										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						GCCCAGGAACAAAAAAAAAAA	0.373																																																	0								ENSG00000144395			178,205,3109		1,0,176,1,203,1365	43.0	43.0	43.0			4.6	0.7	2		34	430,361,7013		2,0,426,2,357,3115	no	codingComplex	CCDC150	NM_001080539.1		3,0,602,3,560,4480	A1A1,A1A2,A1R,A2A2,A2R,RR		10.1358,10.9679,10.3931			197531519	608,566,10122	1807	4072	5879	CCDC150	SO:0001589	frameshift_variant	0				HGNC		CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.839delA	2.37:g.197531519delA	ENSP00000373827:p.Gln280fs	Somatic	0	36	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	54	12.90	Q6P5U6|Q6P663|Q8N8V5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.K283fs	ENST00000389175.4	37	c.839	CCDS46478.1	2																																																																																			-	NULL		0.373	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	CCDC150	protein_coding	OTTHUMT00000335377.2	A	NM_001080539			197531519	+1	no_errors	ENST00000389175	ensembl	human	known	74_37	frame_shift_del	DEL	0.374	-
ISY1	57461	genome.wustl.edu	37	3	128864635	128864635	+	Missense_Mutation	SNP	C	C	G	rs368170673		TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr3:128864635C>G	ENST00000393295.3	-	6	586	c.269G>C	c.(268-270)cGg>cCg	p.R90P	ISY1_ENST00000273541.8_Missense_Mutation_p.R90P|ISY1_ENST00000393292.3_Missense_Mutation_p.R90P|ISY1_ENST00000471497.1_5'UTR|ISY1-RAB43_ENST00000418265.1_Missense_Mutation_p.R90P	NM_001199469.1|NM_020701.3	NP_001186398.1|NP_065752.1	Q9ULR0	ISY1_HUMAN	ISY1 splicing factor homolog (S. cerevisiae)	90					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|skin(1)	15						CTCCTTTATCCGGACCTCCCA	0.478																																																	0								ENSG00000261796						117.0	119.0	118.0					3																	128864635		1961	4157	6118	ISY1-RAB43	SO:0001583	missense	0			-	HGNC		CCDS43149.1, CCDS56277.1	3q21.3	2008-11-25			ENSG00000240682	ENSG00000240682			29201	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 33"""	612764				16103217	Standard	NM_020701		Approved	KIAA1160, fSAP33		Q9ULR0	OTTHUMG00000137365	ENST00000393295.3:c.269G>C	3.37:g.128864635C>G	ENSP00000376973:p.Arg90Pro	Somatic	0	48	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	73	15.12	Q96IL2|Q9BT05	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Isy1	p.R90P	ENST00000393295.3	37	c.269	CCDS43149.1	3	.	.	.	.	.	.	.	.	.	.	C	23.4	4.414475	0.83449	.	.	ENSG00000240682	ENST00000418265;ENST00000393295;ENST00000273541;ENST00000496163;ENST00000393292	T	0.37584	1.19	5.31	4.43	0.53597	.	0.054844	0.85682	D	0.000000	T	0.65760	0.2722	M	0.91510	3.215	0.80722	D	1	D;D;D	0.76494	0.995;0.976;0.999	D;P;D	0.77004	0.952;0.894;0.989	T	0.73180	-0.4064	10	0.87932	D	0	.	11.8615	0.52469	0.0:0.9147:0.0:0.0853	.	90;90;90	Q9ULR0-2;Q9ULR0;Q9ULR0-1	.;ISY1_HUMAN;.	P	90;90;90;28;90	ENSP00000273541:R90P	ENSP00000273541:R90P	R	-	2	0	ISY1	130347325	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.542000	0.67218	1.241000	0.43820	0.591000	0.81541	CGG	-	pfam_Isy1		0.478	ISY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISY1-RAB43	protein_coding	OTTHUMT00000267856.1	C	NM_020701	-		128864635	-1	no_errors	ENST00000418265	ensembl	human	known	74_37	missense	SNP	1.000	G
MTSS1	9788	genome.wustl.edu	37	8	125592413	125592414	+	Intron	INS	-	-	TGTTT	rs397788099|rs34200500|rs4007922	byFrequency	TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr8:125592413_125592414insTGTTT	ENST00000518547.1	-	6	934				RP11-532M24.1_ENST00000606244.1_RNA|MTSS1_ENST00000325064.5_Intron|MTSS1_ENST00000354184.4_Intron|MTSS1_ENST00000378017.3_Intron	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1						actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			GCTTGCAGCTCTGTTTGTGGca	0.337														2880	0.57508	0.5938	0.4481	5008	,	,		18049	0.499		0.6938	False		,,,				2504	0.5961				Esophageal Squamous(160;622 1893 3862 8546 12509)												0								ENSG00000272486																																			RP11-532M24.1	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.460+4913->AAACA	8.37:g.125592414_125592418dupTGTTT		Somatic	NA	NA	NA		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	J3KNK6|Q8TCA2|Q96RX2	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000518547.1	37	NULL	CCDS6353.1	8																																																																																			-	-		0.337	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000272486	protein_coding	OTTHUMT00000109625.3	-	NM_014751			125592414	+1	no_errors	ENST00000606244	ensembl	human	known	74_37	rna	INS	0.000:0.000	TGTTT
SH3BP5	9467	genome.wustl.edu	37	3	15297083	15297083	+	3'UTR	DEL	T	T	-			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr3:15297083delT	ENST00000383791.3	-	0	2098				SH3BP5-AS1_ENST00000413977.1_RNA|SH3BP5-AS1_ENST00000420195.1_RNA|SH3BP5-AS1_ENST00000436602.1_RNA	NM_004844.4	NP_004835.2	O60239	3BP5_HUMAN	SH3-domain binding protein 5 (BTK-associated)						intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	protein kinase inhibitor activity (GO:0004860)			NS(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	12						TGTTCTTGGATTTTTTTTTTT	0.363																																																	0								ENSG00000224660																																			SH3BP5-AS1	SO:0001624	3_prime_UTR_variant	0				HGNC	AB005047	CCDS2625.2, CCDS43055.1	3p24.3	2008-07-10			ENSG00000131370	ENSG00000131370			10827	protein-coding gene	gene with protein product	"""SH3 binding protein"""	605612				9571151, 10339589	Standard	NM_004844		Approved	Sab	uc003bzp.2	O60239	OTTHUMG00000129859	ENST00000383791.3:c.*510A>-	3.37:g.15297083delT		Somatic	0	9	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	B3KQW6|Q5JWV9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000383791.3	37	NULL	CCDS2625.2	3																																																																																			-	-		0.363	SH3BP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP5-AS1	protein_coding	OTTHUMT00000340740.2	T	NM_004844			15297083	+1	no_errors	ENST00000420195	ensembl	human	known	74_37	rna	DEL	0.010	-
CABLES1	91768	genome.wustl.edu	37	18	20716015	20716023	+	In_Frame_Del	DEL	GGCGCCGGC	GGCGCCGGC	-	rs201595073|rs139352344	byFrequency	TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	GGCGCCGGC	GGCGCCGGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr18:20716015_20716023delGGCGCCGGC	ENST00000256925.7	+	1	289_297	c.289_297delGGCGCCGGC	c.(289-297)ggcgccggcdel	p.GAG97del	AC105247.1_ENST00000411067.1_RNA|CABLES1_ENST00000400473.2_Intron	NM_001100619.2	NP_001094089.1	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1	97	Ala-rich.|Interacts with TDRD7. {ECO:0000250}.				blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|nervous system development (GO:0007399)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)	cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)	11	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ggccaagccgggcgccggcggcgcctgcg	0.785														1123	0.224241	0.2602	0.17	5008	,	,		3844	0.244		0.2048	False		,,,				2504	0.2137																0								ENSG00000134508																																			CABLES1	SO:0001651	inframe_deletion	0				HGNC	BC037218	CCDS42417.1, CCDS42418.1, CCDS58615.1	18q11.2	2005-08-16				ENSG00000134508			25097	protein-coding gene	gene with protein product		609194				12477932	Standard	NM_138375		Approved	HsT2563, FLJ35924	uc002kuc.2	Q8TDN4		ENST00000256925.7:c.289_297delGGCGCCGGC	18.37:g.20716015_20716023delGGCGCCGGC	ENSP00000256925:p.Gly97_Gly99del	Somatic	NA	NA	NA		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DK60|Q8N3Y8|Q8NA22|Q9BTG1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Cyclin_N,superfamily_Cyclin-like,pirsf_Cdk5/c-Abl_linker_Cables	p.GGA99in_frame_del	ENST00000256925.7	37	c.289_297	CCDS42417.1	18																																																																																			-	pirsf_Cdk5/c-Abl_linker_Cables		0.785	CABLES1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CABLES1	protein_coding	OTTHUMT00000445198.2	GGCGCCGGC	NM_138375			20716023	+1	no_errors	ENST00000256925	ensembl	human	known	74_37	in_frame_del	DEL	0.983:0.981:0.990:0.998:0.999:0.997:0.999:0.999:0.997	-
OTOR	56914	genome.wustl.edu	37	20	16729574	16729574	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr20:16729574G>T	ENST00000246081.2	+	2	222	c.178G>T	c.(178-180)Gtt>Ttt	p.V60F		NM_020157.2	NP_064542.1	Q9NRC9	OTOR_HUMAN	otoraplin	60	SH3.				cartilage condensation (GO:0001502)|sensory perception of sound (GO:0007605)	extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(1)|liver(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	10						ATTCATTAACGTTAAAAAAGG	0.353																																																	0								ENSG00000125879						76.0	79.0	78.0					20																	16729574		2203	4300	6503	OTOR	SO:0001583	missense	0			-	HGNC	AF233261	CCDS13124.1	20p12.1-p11.23	2005-11-14			ENSG00000125879	ENSG00000125879			8517	protein-coding gene	gene with protein product		606067				10873378	Standard	NM_020157		Approved	MIAL, MIAL1, FDP	uc002wpj.3	Q9NRC9	OTTHUMG00000031931	ENST00000246081.2:c.178G>T	20.37:g.16729574G>T	ENSP00000246081:p.Val60Phe	Somatic	0	32	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	50	9.09	D3DW22|Q3MIU6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain	p.V60F	ENST00000246081.2	37	c.178	CCDS13124.1	20	.	.	.	.	.	.	.	.	.	.	G	10.03	1.238970	0.22711	.	.	ENSG00000125879	ENST00000246081	T	0.09255	3.0	5.93	-1.59	0.08453	Src homology-3 domain (2);Variant SH3 (1);	0.225856	0.43747	N	0.000537	T	0.03178	0.0093	N	0.08118	0	0.23962	N	0.99633	B	0.14438	0.01	B	0.15052	0.012	T	0.40813	-0.9543	10	0.08381	T	0.77	-39.7388	3.2565	0.06834	0.457:0.0:0.2209:0.3221	.	60	Q9NRC9	OTOR_HUMAN	F	60	ENSP00000246081:V60F	ENSP00000246081:V60F	V	+	1	0	OTOR	16677574	0.161000	0.22892	0.005000	0.12908	0.850000	0.48378	0.203000	0.17315	-0.102000	0.12197	0.655000	0.94253	GTT	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain		0.353	OTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOR	protein_coding	OTTHUMT00000078108.2	G		-		16729574	+1	no_errors	ENST00000246081	ensembl	human	known	74_37	missense	SNP	0.141	T
ZNF76	7629	genome.wustl.edu	37	6	35255451	35255451	+	Silent	SNP	C	C	T	rs376706823		TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr6:35255451C>T	ENST00000373953.3	+	5	527	c.261C>T	c.(259-261)gcC>gcT	p.A87A	ZNF76_ENST00000339411.5_Silent_p.A87A|ZNF76_ENST00000440666.2_Silent_p.A61A	NM_003427.3	NP_003418.2	P36508	ZNF76_HUMAN	zinc finger protein 76	87	3 X 12 AA approximate repeats.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						CCCTGGAAGCCGTCCAACTGG	0.587																																					Esophageal Squamous(52;92 1039 20612 23956 34676)												0								ENSG00000065029	C		0,4406		0,0,2203	98.0	87.0	91.0		261	-4.9	0.9	6		91	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ZNF76	NM_003427.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		87/571	35255451	1,13005	2203	4300	6503	ZNF76	SO:0001819	synonymous_variant	0			-	HGNC	M91592	CCDS4801.1, CCDS75435.1	6p21.31	2013-01-08	2011-02-25		ENSG00000065029	ENSG00000065029		"""Zinc fingers, C2H2-type"""	13149	protein-coding gene	gene with protein product		194549	"""zinc finger protein 76 (expressed in testis)"""	D6S229E		1427894	Standard	XM_005249364		Approved	Zfp523, ZNF523	uc003oki.1	P36508	OTTHUMG00000014564	ENST00000373953.3:c.261C>T	6.37:g.35255451C>T		Somatic	0	13	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	11	31.25	Q9BQB2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A87	ENST00000373953.3	37	c.261	CCDS4801.1	6																																																																																			-	NULL		0.587	ZNF76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF76	protein_coding	OTTHUMT00000040279.2	C	NM_003427	-		35255451	+1	no_errors	ENST00000373953	ensembl	human	known	74_37	silent	SNP	0.896	T
TDG	6996	genome.wustl.edu	37	12	104378945	104378954	+	Intron	DEL	ACACACACAC	ACACACACAC	-	rs2722186|rs527868730	byFrequency	TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	ACACACACAC	ACACACACAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr12:104378945_104378954delACACACACAC	ENST00000392872.3	+	8	1198				TDG_ENST00000266775.9_Intron|AC078819.1_ENST00000401157.1_RNA|TDG_ENST00000544861.1_Intron|TDG_ENST00000542036.1_Intron	NM_003211.4	NP_003202.3	Q13569	TDG_HUMAN	thymine-DNA glycosylase						base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|chromatin modification (GO:0016568)|depyrimidination (GO:0045008)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|embryo development (GO:0009790)|mismatch repair (GO:0006298)|negative regulation of chromatin binding (GO:0035562)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression, epigenetic (GO:0040029)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|double-stranded DNA binding (GO:0003690)|mismatched DNA binding (GO:0030983)|protein homodimerization activity (GO:0042803)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|RNA polymerase II transcription cofactor activity (GO:0001104)|structure-specific DNA binding (GO:0043566)			large_intestine(2)|lung(14)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(302;0.00114)		ATAGacacatacacacacacacacacacac	0.329								Base excision repair (BER), DNA glycosylases																																									0								ENSG00000215976																																			AC078819.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	U51166	CCDS9095.1	12q24.1	2014-05-14			ENSG00000139372	ENSG00000139372	3.2.2.29		11700	protein-coding gene	gene with protein product	"""G/T mismatch-specific thymine DNA glycosylase"""	601423				8662714, 9299239	Standard	NM_003211		Approved		uc001tkg.3	Q13569	OTTHUMG00000168418	ENST00000392872.3:c.964+247ACACACACAC>-	12.37:g.104378955_104378964delACACACACAC		Somatic	NA	NA	NA		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q8IUZ6|Q8IZM3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392872.3	37	NULL	CCDS9095.1	12																																																																																			-	-		0.329	TDG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215976	protein_coding	OTTHUMT00000399673.2	ACACACACAC				104378954	+1	no_errors	ENST00000401157	ensembl	human	novel	74_37	rna	DEL	0.022:0.023:0.025:0.026:0.026:0.026:0.026:0.025:0.024:0.023	-
LINC00665	100506930	genome.wustl.edu	37	19	36806598	36806598	+	IGR	SNP	A	A	G	rs200746265		TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr19:36806598A>G								CTD-3162L10.1 (3034 upstream) : LINC00665 (9240 downstream)																							ATGTTCACATAAACATTTATC	0.398																																																	0								ENSG00000232677																																			LINC00665	SO:0001628	intergenic_variant	0			-	HGNC																													19.37:g.36806598A>G		Somatic	0	25	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	67	12.99		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		19																																																																																			-	-	0	0.398					LINC00665			A		rs200746265		36806598	-1	no_errors	ENST00000427868	ensembl	human	known	74_37	rna	SNP	0.011	G
MIEF2	125170	genome.wustl.edu	37	17	18167708	18167708	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr17:18167708A>G	ENST00000323019.4	+	4	1206	c.995A>G	c.(994-996)cAg>cGg	p.Q332R	MIEF2_ENST00000395706.2_Missense_Mutation_p.Q343R|MIEF2_ENST00000395704.4_3'UTR	NM_001144900.1|NM_139162.3	NP_001138372.1|NP_631901.2	Q96C03	MID49_HUMAN	mitochondrial elongation factor 2	332					mitochondrion organization (GO:0007005)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)											CTCTGGCTGCAGGACCTGTAT	0.677																																																	0								ENSG00000177427						41.0	48.0	46.0					17																	18167708		2202	4297	6499	MIEF2	SO:0001583	missense	0			-	HGNC	BC014973	CCDS11193.1, CCDS45624.1, CCDS45625.1	17p11.2	2013-09-23	2013-09-23	2013-09-23	ENSG00000177427	ENSG00000177427			17920	protein-coding gene	gene with protein product		615498	"""Smith-Magenis syndrome chromosome region, candidate 7"""	SMCR7		11997338, 21508961	Standard	NM_001144900		Approved	MGC23130, MiD49	uc010vxq.2	Q96C03	OTTHUMG00000059392	ENST00000323019.4:c.995A>G	17.37:g.18167708A>G	ENSP00000323591:p.Gln332Arg	Somatic	0	19	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	26	33.33	J3KPT3|Q6ZRD4|Q96N07	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q332R	ENST00000323019.4	37	c.995	CCDS11193.1	17	.	.	.	.	.	.	.	.	.	.	A	7.159	0.585239	0.13749	.	.	ENSG00000177427	ENST00000323019;ENST00000395706	T;T	0.08193	3.12;3.12	5.45	5.45	0.79879	.	0.177118	0.49916	D	0.000121	T	0.17195	0.0413	L	0.52759	1.655	0.48087	D	0.999582	D	0.54772	0.968	P	0.52909	0.713	T	0.00398	-1.1764	10	0.48119	T	0.1	-27.4493	15.5101	0.75772	1.0:0.0:0.0:0.0	.	332	Q96C03	MID49_HUMAN	R	332;343	ENSP00000323591:Q332R;ENSP00000379057:Q343R	ENSP00000323591:Q332R	Q	+	2	0	SMCR7	18108433	1.000000	0.71417	0.997000	0.53966	0.586000	0.36452	3.394000	0.52551	2.073000	0.62155	0.379000	0.24179	CAG	-	NULL		0.677	MIEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIEF2	protein_coding	OTTHUMT00000132060.2	A	NM_139162	-		18167708	+1	no_errors	ENST00000323019	ensembl	human	known	74_37	missense	SNP	1.000	G
MAFA	389692	genome.wustl.edu	37	8	144511954	144511959	+	In_Frame_Del	DEL	TGGTGG	TGGTGG	-	rs552049497|rs141816879		TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	TGGTGG	TGGTGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr8:144511954_144511959delTGGTGG	ENST00000333480.2	-	1	617_622	c.618_623delCCACCA	c.(616-624)caccaccat>cat	p.206_208HHH>H	MAFA_ENST00000528185.1_5'UTR	NM_201589.3	NP_963883.2	Q8NHW3	MAFA_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog A	206	His-rich.				insulin secretion (GO:0030073)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H208delH(3)		breast(1)|lung(1)|upper_aerodigestive_tract(2)	4	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.237)			CGCGCCGCCAtggtggtggtggtggt	0.748										HNSCC(29;0.082)																																							3	Deletion - In frame(3)	upper_aerodigestive_tract(2)|breast(1)						ENSG00000182759																																			MAFA	SO:0001651	inframe_deletion	0				HGNC	AY083269	CCDS34955.1	8q24.3	2013-07-09	2013-07-09			ENSG00000182759			23145	protein-coding gene	gene with protein product		610303					Standard	NM_201589		Approved	RIPE3b1, hMafA	uc003yyc.2	Q8NHW3		ENST00000333480.2:c.618_623delCCACCA	8.37:g.144511960_144511965delTGGTGG	ENSP00000328364:p.His206_His207del	Somatic	NA	NA	NA		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_bZIP_Maf,pfam_Maf_TF_N,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.HH207in_frame_del	ENST00000333480.2	37	c.623_618	CCDS34955.1	8																																																																																			-	NULL		0.748	MAFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAFA	protein_coding	OTTHUMT00000381511.2	TGGTGG	NM_201589			144511959	-1	no_errors	ENST00000333480	ensembl	human	known	74_37	in_frame_del	DEL	0.945:0.962:0.980:0.999:1.000:1.000	-
VPS45	11311	genome.wustl.edu	37	1	150082514	150082514	+	Intron	DEL	A	A	-			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr1:150082514delA	ENST00000369130.3	+	14	2039				VPS45_ENST00000484306.1_3'UTR|VPS45_ENST00000535106.1_Intron|VPS45_ENST00000369128.5_Intron	NM_001279354.1|NM_007259.3	NP_001266283.1|NP_009190.2	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45 homolog (S. cerevisiae)						blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|vesicle docking involved in exocytosis (GO:0006904)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTCCTCCACCAAAAAAAAAAG	0.303																																																	0								ENSG00000136631																																			VPS45	SO:0001627	intron_variant	0				HGNC	U35246	CCDS944.1, CCDS60244.1, CCDS72904.1	1q21.2	2008-02-05	2006-12-19	2006-12-19	ENSG00000136631	ENSG00000136631			14579	protein-coding gene	gene with protein product		610035	"""vacuolar protein sorting 45A (yeast homolog)"", ""vacuolar protein sorting 45A (yeast)"""	VPS45B, VPS45A		8996080	Standard	NM_007259		Approved	h-vps45, H1	uc001etp.3	Q9NRW7	OTTHUMG00000012511	ENST00000369130.3:c.1494-97A>-	1.37:g.150082514delA		Somatic	0	18	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	31	13.89	D3DUZ9|F5H8K1|Q15715|Q53FR8|Q5T4P6|Q9Y4Z6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369130.3	37	NULL	CCDS944.1	1																																																																																			-	-		0.303	VPS45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS45	protein_coding	OTTHUMT00000034964.1	A	NM_007259			150082514	+1	no_errors	ENST00000484306	ensembl	human	known	74_37	rna	DEL	0.965	-
CENPE	1062	genome.wustl.edu	37	4	104061060	104061060	+	Silent	SNP	G	G	A			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr4:104061060G>A	ENST00000265148.3	-	38	6179	c.6090C>T	c.(6088-6090)agC>agT	p.S2030S	CENPE_ENST00000380026.3_Intron	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	2030					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TTTCTTCAAGGCTTTCATGAA	0.363																																																	0								ENSG00000138778						146.0	139.0	141.0					4																	104061060		2203	4300	6503	CENPE	SO:0001819	synonymous_variant	0			-	HGNC	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.6090C>T	4.37:g.104061060G>A		Somatic	0	79	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	96	30.94	A6NKY9|A8K2U7|Q4LE75	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S2030	ENST00000265148.3	37	c.6090	CCDS34042.1	4																																																																																			-	NULL		0.363	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	protein_coding		G		-		104061060	-1	no_errors	ENST00000265148	ensembl	human	known	74_37	silent	SNP	0.019	A
TPM3	7170	genome.wustl.edu	37	1	154144674	154144674	+	Intron	DEL	A	A	-			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr1:154144674delA	ENST00000368530.2	-	5	759				TPM3_ENST00000368533.3_Intron|TPM3_ENST00000341485.5_Intron|TPM3_ENST00000330188.9_Intron|TPM3_ENST00000323144.7_Intron|TPM3_ENST00000469717.1_5'UTR|TPM3_ENST00000271850.7_Intron|TPM3_ENST00000302206.5_Intron|TPM3_ENST00000341372.3_Intron|TPM3_ENST00000328159.4_Intron|TPM3_ENST00000368531.2_Intron	NM_152263.2	NP_689476.2	P06753	TPM3_HUMAN	tropomyosin 3						cellular component movement (GO:0006928)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle thin filament tropomyosin (GO:0005862)|stress fiber (GO:0001725)			TPM3/NTRK1_ENST00000392302(70)|TPM3/ALK(33)	breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)					CAGCAAAACGAAAAAAAAAAA	0.438			T	"""NTRK1, ALK, ROS1"""	"""papillary thyroid, ALCL, NSCLC"""																																			Dom	yes		1	1q22-q23	7170	tropomyosin 3		"""E, L"""	0								ENSG00000143549																																			TPM3	SO:0001627	intron_variant	0				HGNC	BC008425	CCDS1060.1, CCDS41400.1, CCDS41401.1, CCDS41402.1, CCDS41403.1, CCDS60274.1, CCDS60275.1, CCDS72922.1	1q21.2	2014-09-17			ENSG00000143549	ENSG00000143549		"""Tropomyosins"""	12012	protein-coding gene	gene with protein product		191030		NEM1		1829807	Standard	NM_153649		Approved	TRK	uc001fec.2	P06753	OTTHUMG00000035853	ENST00000368530.2:c.566+709T>-	1.37:g.154144674delA		Somatic	0	22	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	51	8.93	D3DV71|P12324|Q2QD06|Q5VU58|Q5VU63|Q5VU66|Q5VU71|Q5VU72|Q8TCG3|Q969Q2|Q9NQH8	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368530.2	37	NULL	CCDS41403.1	1																																																																																			-	-		0.438	TPM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPM3	protein_coding	OTTHUMT00000087271.2	A	NM_152263			154144674	-1	no_errors	ENST00000469717	ensembl	human	known	74_37	rna	DEL	0.000	-
RPL14	9045	genome.wustl.edu	37	3	40503520	40503521	+	In_Frame_Ins	INS	-	-	CTGCTGCTGCTGCTG	rs370958149|rs369485042|rs200018880|rs147295890|rs57354599|rs111899316	byFrequency	TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr3:40503520_40503521insCTGCTGCTGCTGCTG	ENST00000396203.2	+	6	577_578	c.445_446insCTGCTGCTGCTGCTG	c.(445-447)act>aCTGCTGCTGCTGCTGct	p.159_160insAAAAA	RPL14_ENST00000416518.1_3'UTR|RPL14_ENST00000338970.6_In_Frame_Ins_p.159_160insAAAAA	NM_001034996.2	NP_001030168.1	P50914	RL14_HUMAN	ribosomal protein L14	159			A -> AA.|A -> AAA.|A -> AAAA.|A -> AAAAA.|A -> AAAAAA. {ECO:0000269|PubMed:11875025, ECO:0000269|PubMed:9480843, ECO:0000269|Ref.5}.|A -> AAAAAAAA.|Missing. {ECO:0000269|PubMed:8549859, ECO:0000269|Ref.10}.		cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)								KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TACTAAGGGTActgctgctgct	0.47														948	0.189297	0.0855	0.2248	5008	,	,		14209	0.1548		0.3012	False		,,,				2504	0.2249																0								ENSG00000188846																																			RPL14	SO:0001652	inframe_insertion	0				HGNC	D87735	CCDS33739.1, CCDS43070.1	3p22-p21.2	2008-07-18			ENSG00000188846	ENSG00000188846		"""L ribosomal proteins"""	10305	protein-coding gene	gene with protein product	"""CAG-ISL 7"", ""60S ribosomal protein L14"""					9480843	Standard	NM_003973		Approved	L14, hRL14, RL14, CTG-B33	uc003ckg.4	P50914	OTTHUMG00000156046	ENST00000396203.2:c.461_475dupCTGCTGCTGCTGCTG	3.37:g.40503520_40503521insCTGCTGCTGCTGCTG	ENSP00000379506:p.Ala155_Ala159dup	Somatic	NA	NA	NA		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q45RF0|Q53G20|Q8TBD5|Q8WUT0|Q92579|Q96GR0|Q9BSB8|Q9BW65|Q9BYF6	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Ribosomal_L14	p.153in_frame_insAAAAA	ENST00000396203.2	37	c.445_446	CCDS43070.1	3																																																																																			-	NULL		0.470	RPL14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPL14	protein_coding	OTTHUMT00000342889.2	-	NM_003973			40503521	+1	no_errors	ENST00000338970	ensembl	human	known	74_37	in_frame_ins	INS	0.019:0.022	CTGCTGCTGCTGCTG
GABBR2	9568	genome.wustl.edu	37	9	101304191	101304191	+	Silent	SNP	C	C	T			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr9:101304191C>T	ENST00000259455.2	-	3	1053	c.594G>A	c.(592-594)gtG>gtA	p.V198V	GABBR2_ENST00000477471.1_5'UTR	NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	198					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)		NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	TCAGCGTGCCCACGCGCTTCC	0.517																																																	0								ENSG00000136928						156.0	112.0	127.0					9																	101304191		2203	4300	6503	GABBR2	SO:0001819	synonymous_variant	0			-	HGNC	AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.594G>A	9.37:g.101304191C>T		Somatic	0	28	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3_GABA_rcpt_B2,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,prints_GPCR_3,pfscan_GPCR_3_C	p.V198	ENST00000259455.2	37	c.594	CCDS6736.1	9																																																																																			-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3		0.517	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR2	protein_coding	OTTHUMT00000053373.1	C		-		101304191	-1	no_errors	ENST00000259455	ensembl	human	known	74_37	silent	SNP	1.000	T
DDX3Y	8653	genome.wustl.edu	37	Y	15026659	15026659	+	Intron	DEL	T	T	-			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chrY:15026659delT	ENST00000336079.3	+	8	865				DDX3Y_ENST00000360160.4_Intron|DDX3Y_ENST00000463199.1_Intron	NM_001122665.1|NM_004660.3	NP_001116137.1|NP_004651.2	O15523	DDX3Y_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, Y-linked							cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|RNA binding (GO:0003723)			kidney(1)|liver(2)|lung(1)|upper_aerodigestive_tract(1)	5						CTTATTTTCATTTTTTTTTTT	0.284																																																	0								ENSG00000067048																																			DDX3Y	SO:0001627	intron_variant	0				HGNC	AF000984	CCDS14782.1	Yq11	2013-07-16	2013-07-16	2003-06-20	ENSG00000067048	ENSG00000067048		"""DEAD-boxes"""	2699	protein-coding gene	gene with protein product		400010	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide, Y chromosome"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked"""	DBY		9381176	Standard	NM_004660		Approved		uc004fsv.2	O15523	OTTHUMG00000036324	ENST00000336079.3:c.759+98T>-	Y.37:g.15026659delT		Somatic	0	9	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	19	20.83	B4DK29|B4DXX7|Q8IYV7	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000336079.3	37	NULL	CCDS14782.1	Y																																																																																			-	-		0.284	DDX3Y-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX3Y	protein_coding	OTTHUMT00000088407.1	T	NM_004660			15026659	+1	no_errors	ENST00000472510	ensembl	human	putative	74_37	rna	DEL	0.001	-
SCN11A	11280	genome.wustl.edu	37	3	38948802	38948811	+	Intron	DEL	TGTGTGTGTG	TGTGTGTGTG	-	rs141158768		TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	TGTGTGTGTG	TGTGTGTGTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr3:38948802_38948811delTGTGTGTGTG	ENST00000302328.3	-	10	1672				SCN11A_ENST00000444237.2_Intron|AC116038.1_ENST00000401122.1_RNA|SCN11A_ENST00000450244.1_Intron|SCN11A_ENST00000456224.3_Intron	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit						cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ccAACATATAtgtgtgtgtgtgtgtgtgtg	0.367																																																	0								ENSG00000215941																																			AC116038.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.1473+628CACACACACA>-	3.37:g.38948812_38948821delTGTGTGTGTG		Somatic	NA	NA	NA		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000302328.3	37	NULL	CCDS33737.1	3																																																																																			-	-		0.367	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215941	protein_coding	OTTHUMT00000109746.4	TGTGTGTGTG	NM_014139			38948811	+1	no_errors	ENST00000401122	ensembl	human	novel	74_37	rna	DEL	0.000:0.001:0.005:0.007:0.015:0.028:0.021:0.020:0.022:0.022	-
STARD13	90627	genome.wustl.edu	37	13	33684840	33684840	+	Missense_Mutation	SNP	C	C	T	rs368225953		TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr13:33684840C>T	ENST00000336934.5	-	11	2928	c.2812G>A	c.(2812-2814)Gat>Aat	p.D938N	STARD13_ENST00000399365.3_Missense_Mutation_p.D820N|STARD13_ENST00000255486.4_Missense_Mutation_p.D930N	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	938	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		AAAGCAAGATCTGTATTGTCC	0.448																																																	0								ENSG00000133121	C	ASN/ASP,ASN/ASP,ASN/ASP	0,4406		0,0,2203	156.0	146.0	149.0		2788,2812,2458	5.5	0.9	13		149	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	STARD13	NM_178007.2,NM_178006.3,NM_052851.2	23,23,23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	930/1106,938/1114,820/996	33684840	1,13005	2203	4300	6503	STARD13	SO:0001583	missense	0			-	HGNC	AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.2812G>A	13.37:g.33684840C>T	ENSP00000338785:p.Asp938Asn	Somatic	0	31	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	45	29.69	A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_START_lipid-bd_dom,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_RhoGAP_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom,pfscan_RhoGAP_dom	p.D938N	ENST00000336934.5	37	c.2812	CCDS9348.1	13	.	.	.	.	.	.	.	.	.	.	C	21.9	4.216430	0.79352	0.0	1.16E-4	ENSG00000133121	ENST00000399365;ENST00000255486;ENST00000336934	T;T;T	0.80480	-1.38;-1.38;-1.38	5.49	5.49	0.81192	Lipid-binding START (3);START-like domain (1);	0.290468	0.42420	D	0.000701	T	0.80292	0.4596	L	0.41573	1.285	0.80722	D	1	P;B;B	0.34757	0.467;0.168;0.01	B;B;B	0.41202	0.302;0.35;0.04	T	0.80946	-0.1155	10	0.87932	D	0	.	19.7343	0.96195	0.0:1.0:0.0:0.0	.	903;938;930	Q9Y3M8-4;Q9Y3M8;Q9Y3M8-2	.;STA13_HUMAN;.	N	820;930;938	ENSP00000382300:D820N;ENSP00000255486:D930N;ENSP00000338785:D938N	ENSP00000255486:D930N	D	-	1	0	STARD13	32582840	1.000000	0.71417	0.862000	0.33874	0.910000	0.53928	7.681000	0.84073	2.728000	0.93425	0.561000	0.74099	GAT	-	pfam_START_lipid-bd_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom		0.448	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD13	protein_coding	OTTHUMT00000276118.2	C	NM_001243466	-		33684840	-1	no_errors	ENST00000336934	ensembl	human	known	74_37	missense	SNP	1.000	T
MYH1	4619	genome.wustl.edu	37	17	10404621	10404621	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr17:10404621G>T	ENST00000226207.5	-	27	3638	c.3544C>A	c.(3544-3546)Ctg>Atg	p.L1182M	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1182					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GCCTCCTCCAGGTCCCTGCGC	0.597																																																	0								ENSG00000109061						84.0	89.0	88.0					17																	10404621		2203	4300	6503	MYH1	SO:0001583	missense	0			-	HGNC		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3544C>A	17.37:g.10404621G>T	ENSP00000226207:p.Leu1182Met	Somatic	0	65	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	97	36.18	Q14CA4|Q9Y622	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L1182M	ENST00000226207.5	37	c.3544	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	G	26.9	4.783963	0.90282	.	.	ENSG00000109061	ENST00000226207	D	0.90844	-2.74	5.51	5.51	0.81932	Myosin tail (1);	0.000000	0.35525	U	0.003154	D	0.95758	0.8620	M	0.90542	3.125	0.80722	D	1	D	0.55385	0.971	P	0.59546	0.859	D	0.95149	0.8271	10	0.44086	T	0.13	.	19.7865	0.96442	0.0:0.0:1.0:0.0	.	1182	P12882	MYH1_HUMAN	M	1182	ENSP00000226207:L1182M	ENSP00000226207:L1182M	L	-	1	2	MYH1	10345346	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.572000	0.74005	2.751000	0.94390	0.650000	0.86243	CTG	-	pfam_Myosin_tail		0.597	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	protein_coding	OTTHUMT00000252725.1	G	NM_005963	-		10404621	-1	no_errors	ENST00000226207	ensembl	human	known	74_37	missense	SNP	1.000	T
NEUROG2	63973	genome.wustl.edu	37	4	113436358	113436358	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr4:113436358G>A	ENST00000313341.3	-	2	600	c.274C>T	c.(274-276)Cgg>Tgg	p.R92W	RP11-402J6.1_ENST00000506057.1_RNA|RP11-402J6.1_ENST00000504009.1_RNA	NM_024019.3	NP_076924.1	Q9H2A3	NGN2_HUMAN	neurogenin 2	92					axon guidance (GO:0007411)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|forebrain development (GO:0030900)|neuron migration (GO:0001764)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	E-box binding (GO:0070888)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(3)|lung(6)|skin(2)	12		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.00168)		GCCCGCGCCCGGGAAGGGCGC	0.726																																																	0								ENSG00000178403						14.0	16.0	15.0					4																	113436358		2163	4236	6399	NEUROG2	SO:0001583	missense	0			-	HGNC	AF303002	CCDS3698.1	4q25	2013-05-21			ENSG00000178403	ENSG00000178403		"""Basic helix-loop-helix proteins"""	13805	protein-coding gene	gene with protein product		606624					Standard	NM_024019		Approved	Atoh4, Math4A, ngn-2, bHLHa8, NGN2	uc003ias.3	Q9H2A3	OTTHUMG00000132907	ENST00000313341.3:c.274C>T	4.37:g.113436358G>A	ENSP00000317333:p.Arg92Trp	Somatic	0	33	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	43	35.82	Q8N416	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.R92W	ENST00000313341.3	37	c.274	CCDS3698.1	4	.	.	.	.	.	.	.	.	.	.	G	10.23	1.292469	0.23564	.	.	ENSG00000178403	ENST00000313341	D	0.92048	-2.96	3.5	1.64	0.23874	.	0.177647	0.26560	U	0.023694	D	0.90872	0.7132	N	0.24115	0.695	0.47698	D	0.999499	D	0.89917	1.0	D	0.67231	0.95	D	0.88760	0.3256	10	0.72032	D	0.01	-10.2651	9.3501	0.38133	0.0:0.0:0.5039:0.4961	.	92	Q9H2A3	NGN2_HUMAN	W	92	ENSP00000317333:R92W	ENSP00000317333:R92W	R	-	1	2	NEUROG2	113655807	0.985000	0.35326	0.018000	0.16275	0.023000	0.10783	3.720000	0.54933	0.144000	0.18951	0.313000	0.20887	CGG	-	NULL		0.726	NEUROG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROG2	protein_coding	OTTHUMT00000256414.1	G	NM_024019	-		113436358	-1	no_errors	ENST00000313341	ensembl	human	known	74_37	missense	SNP	0.709	A
ARHGAP29	9411	genome.wustl.edu	37	1	94643143	94643144	+	Intron	INS	-	-	T	rs563927860	byFrequency	TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr1:94643143_94643144insT	ENST00000260526.6	-	22	3088				ARHGAP29_ENST00000482481.1_5'UTR	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29						positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		CAGCAAACATATTTTTTTTTTA	0.376																																																	0								ENSG00000137962																																			ARHGAP29	SO:0001627	intron_variant	0				HGNC		CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.2905+23->A	1.37:g.94643153_94643153dupT		Somatic	0	26	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	41	10.87	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000260526.6	37	NULL	CCDS748.1	1																																																																																			-	-		0.376	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP29	protein_coding	OTTHUMT00000029376.2	-	NM_004815			94643144	-1	no_errors	ENST00000482481	ensembl	human	known	74_37	rna	INS	0.000:0.000	T
OR2T8	343172	genome.wustl.edu	37	1	248084815	248084815	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr1:248084815T>C	ENST00000319968.4	+	1	496	c.496T>C	c.(496-498)Tat>Cat	p.Y166H		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	166						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GAGCTTCCCATATTGCGGTGC	0.567																																																	0								ENSG00000177462						45.0	34.0	37.0					1																	248084815		2198	4273	6471	OR2T8	SO:0001583	missense	0			-	HGNC		CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.496T>C	1.37:g.248084815T>C	ENSP00000326225:p.Tyr166His	Somatic	0	8	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	16	33.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y166H	ENST00000319968.4	37	c.496	CCDS31100.1	1	.	.	.	.	.	.	.	.	.	.	T	15.95	2.983559	0.53827	.	.	ENSG00000177462	ENST00000319968	T	0.00099	8.73	3.56	3.56	0.40772	GPCR, rhodopsin-like superfamily (1);	0.516040	0.14172	U	0.336646	T	0.00468	0.0015	M	0.83223	2.63	0.09310	N	1	D	0.63880	0.993	D	0.68192	0.956	T	0.44314	-0.9336	10	0.87932	D	0	.	11.2197	0.48846	0.0:0.0:0.0:1.0	.	166	A6NH00	OR2T8_HUMAN	H	166	ENSP00000326225:Y166H	ENSP00000326225:Y166H	Y	+	1	0	OR2T8	246151438	0.000000	0.05858	0.003000	0.11579	0.056000	0.15407	0.803000	0.27083	1.481000	0.48307	0.332000	0.21555	TAT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.567	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T8	protein_coding	OTTHUMT00000096862.1	T	NM_001005522	-		248084815	+1	no_errors	ENST00000319968	ensembl	human	known	74_37	missense	SNP	0.124	C
TMEM252	169693	genome.wustl.edu	37	9	71155617	71155617	+	Silent	SNP	C	C	A			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr9:71155617C>A	ENST00000377311.3	-	1	166	c.114G>T	c.(112-114)ggG>ggT	p.G38G	RP11-274B18.2_ENST00000432148.1_lincRNA|RP11-274B18.4_ENST00000413269.3_lincRNA	NM_153237.1	NP_694969.1	Q8N6L7	TM252_HUMAN	transmembrane protein 252	38						integral component of membrane (GO:0016021)											CAATCAGGCTCCCCTGACAGT	0.537																																																	0								ENSG00000181778						64.0	61.0	62.0					9																	71155617		2203	4300	6503	TMEM252	SO:0001819	synonymous_variant	0			-	HGNC	BC029780	CCDS35040.1	9q21.13	2012-07-19	2012-07-19	2012-07-19	ENSG00000181778	ENSG00000181778			28537	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 71"""	C9orf71		12477932	Standard	NM_153237		Approved	MGC34760	uc004agt.3	Q8N6L7	OTTHUMG00000019967	ENST00000377311.3:c.114G>T	9.37:g.71155617C>A		Somatic	0	23	0.00		0.5620157740405862	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	27	27.03		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G38	ENST00000377311.3	37	c.114	CCDS35040.1	9																																																																																			-	NULL		0.537	TMEM252-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM252	protein_coding	OTTHUMT00000052551.1	C	NM_153237	-		71155617	-1	no_errors	ENST00000377311	ensembl	human	known	74_37	silent	SNP	0.000	A
