#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PROKR1	10887	genome.wustl.edu	37	2	68873136	68873136	+	Silent	SNP	C	C	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr2:68873136C>A	ENST00000303786.3	+	2	603	c.183C>A	c.(181-183)gcC>gcA	p.A61A	PROKR1_ENST00000394342.2_Silent_p.A61A			Q8TCW9	PKR1_HUMAN	prokineticin receptor 1	61					negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)			endometrium(3)|kidney(2)|large_intestine(14)|lung(9)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						TCTTTGCTGCCAAGATTGTCA	0.507																																																	0								ENSG00000169618						226.0	198.0	207.0					2																	68873136		2203	4300	6503	PROKR1	SO:0001819	synonymous_variant	0			-	HGNC	AF506287	CCDS1889.1	2p14	2012-08-08	2006-02-15	2006-02-15	ENSG00000169618	ENSG00000169618		"""GPCR / Class A : Prokineticin receptors"""	4524	protein-coding gene	gene with protein product		607122	"""G protein-coupled receptor 73"""	GPR73		10760605	Standard	NM_138964		Approved	PKR1, ZAQ, GPR73a	uc010yqj.2	Q8TCW9	OTTHUMG00000129567	ENST00000303786.3:c.183C>A	2.37:g.68873136C>A		Somatic	0	31	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	A5JUU2|Q53QT9|Q8NFJ7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.A61	ENST00000303786.3	37	c.183	CCDS1889.1	2																																																																																			-	NULL		0.507	PROKR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROKR1	protein_coding	OTTHUMT00000251760.2	C		-		68873136	+1	no_errors	ENST00000303786	ensembl	human	known	74_37	silent	SNP	1.000	A
ADAMTS14	140766	genome.wustl.edu	37	10	72517795	72517795	+	Silent	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr10:72517795C>T	ENST00000373207.1	+	20	3015	c.3015C>T	c.(3013-3015)tgC>tgT	p.C1005C	ADAMTS14_ENST00000373208.1_Silent_p.C1008C	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	1005	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						TCGGGCATTGCGAGGGGGATA	0.667																																																	0								ENSG00000138316						46.0	43.0	44.0					10																	72517795		2203	4300	6503	ADAMTS14	SO:0001819	synonymous_variant	0			-	HGNC	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.3015C>T	10.37:g.72517795C>T		Somatic	0	18	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.C1008	ENST00000373207.1	37	c.3024	CCDS7306.1	10																																																																																			-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.667	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAMTS14	protein_coding	OTTHUMT00000048522.1	C	NM_080722	-		72517795	+1	no_errors	ENST00000373208	ensembl	human	known	74_37	silent	SNP	0.392	T
FAM193B	54540	genome.wustl.edu	37	5	176952043	176952043	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr5:176952043delT	ENST00000514747.1	-	6	1487	c.1439delA	c.(1438-1440)aacfs	p.N480fs	FAM193B_ENST00000508298.1_5'Flank|FAM193B_ENST00000443375.2_Frame_Shift_Del_p.N447fs|FAM193B_ENST00000329540.5_Frame_Shift_Del_p.N106fs	NM_001190946.1	NP_001177875.1	Q96PV7	F193B_HUMAN	family with sequence similarity 193, member B	560						cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)	4						TTTGACAGTGTTTTTGATCTC	0.597																																																	0								ENSG00000146067						91.0	95.0	94.0					5																	176952043		2028	4195	6223	FAM193B	SO:0001589	frameshift_variant	0				HGNC		CCDS54954.1	5q35	2010-02-17			ENSG00000146067	ENSG00000146067			25524	protein-coding gene	gene with protein product		615813				11572484	Standard	NR_024019		Approved	KIAA1931, FLJ10404	uc003mhu.3	Q96PV7	OTTHUMG00000163396	ENST00000514747.1:c.1439delA	5.37:g.176952043delT	ENSP00000422131:p.Asn480fs	Somatic	0	15	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	15	11.76	E9PET5|Q9NW00	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.N447fs	ENST00000514747.1	37	c.1340	CCDS54954.1	5																																																																																			-	NULL		0.597	FAM193B-003	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM193B	protein_coding	OTTHUMT00000373121.1	T	NM_019057			176952043	-1	no_errors	ENST00000443375	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
TCTA	6988	genome.wustl.edu	37	3	49450616	49450616	+	Intron	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr3:49450616G>T	ENST00000273590.3	+	2	490				TCTA_ENST00000493381.1_Intron|RHOA_ENST00000454011.2_5'Flank|RHOA_ENST00000418115.1_5'Flank|RHOA_ENST00000265538.3_5'Flank|RHOA_ENST00000422781.1_5'Flank	NM_022171.2	NP_071503.1	P57738	TCTA_HUMAN	T-cell leukemia translocation altered							integral component of membrane (GO:0016021)				large_intestine(4)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TGACAGAGAGGGGAGTTCTCA	0.532																																																	0								ENSG00000145022						60.0	47.0	51.0					3																	49450616		692	1591	2283	TCTA	SO:0001627	intron_variant	0			-	HGNC		CCDS2796.1	3p21	2012-02-27	2012-02-27		ENSG00000145022	ENSG00000145022			11692	protein-coding gene	gene with protein product		600690	"""T-cell leukemia translocation altered gene"""			7728759	Standard	NM_022171		Approved		uc003cwv.4	P57738	OTTHUMG00000156846	ENST00000273590.3:c.269+73G>T	3.37:g.49450616G>T		Somatic	0	30	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	B2R4I4|Q6I9U4|Q9BSB0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000273590.3	37	NULL	CCDS2796.1	3																																																																																			-	-		0.532	TCTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCTA	protein_coding	OTTHUMT00000346210.1	G	NM_022171	-		49450616	+1	no_errors	ENST00000482193	ensembl	human	known	74_37	rna	SNP	0.001	T
LRFN3	79414	genome.wustl.edu	37	19	36431082	36431087	+	In_Frame_Del	DEL	ACTGCA	ACTGCA	-			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	ACTGCA	ACTGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr19:36431082_36431087delACTGCA	ENST00000588831.1	+	3	1809_1814	c.755_760delACTGCA	c.(754-762)cactgcaac>cac	p.CN253del	LRFN3_ENST00000246529.3_In_Frame_Del_p.CN253del			Q9BTN0	LRFN3_HUMAN	leucine rich repeat and fibronectin type III domain containing 3	253	LRRCT.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				cervix(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	12	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			AACCCCCTGCACTGCAACTGCGAGCT	0.738																																																	0								ENSG00000126243																																			LRFN3	SO:0001651	inframe_deletion	0				HGNC	BC003578	CCDS12483.1	19q13.13	2013-02-11				ENSG00000126243		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	28370	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 1"""	612809				12975309, 16495444, 16828986	Standard	NM_024509		Approved	MGC2656, SALM4, FIGLER1	uc002oco.3	Q9BTN0		ENST00000588831.1:c.755_760delACTGCA	19.37:g.36431082_36431087delACTGCA	ENSP00000466989:p.Cys253_Asn254del	Somatic	NA	NA	NA		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6UY10	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.NC254in_frame_del	ENST00000588831.1	37	c.755_760	CCDS12483.1	19																																																																																			-	smart_Cys-rich_flank_reg_C		0.738	LRFN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN3	protein_coding	OTTHUMT00000457403.2	ACTGCA	NM_024509			36431087	+1	no_errors	ENST00000246529	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000	-
PDPK2P	653650	genome.wustl.edu	37	16	2692244	2692244	+	lincRNA	SNP	C	C	G			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr16:2692244C>G	ENST00000565111.1	-	0	1144				PDPK2_ENST00000382326.1_RNA																							GAAAAAGAGCCTTCCCCAAGA	0.602																																																	0								ENSG00000205918																																			PDPK2			0			-	Clone_based_vega_gene																													16.37:g.2692244C>G		Somatic	0	52	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	31	40.38		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000565111.1	37	NULL		16	.	.	.	.	.	.	.	.	.	.	.	10.36	1.329236	0.24167	.	.	ENSG00000205918	ENST00000382326	.	.	.	3.18	3.18	0.36537	.	0.000000	0.85682	D	0.000000	T	0.67325	0.2881	.	.	.	0.80722	D	1.000000	.	.	.	.	.	.	T	0.79245	-0.1883	5	0.87932	D	0	-11.1953	13.3911	0.60825	0.0:1.0:0.0:0.0	.	.	.	.	R	83	.	ENSP00000371763:G83R	G	-	1	0	AC141586.1	2632245	1.000000	0.71417	1.000000	0.80357	0.707000	0.40811	7.490000	0.81461	1.786000	0.52430	0.411000	0.27672	GGC	-	-		0.602	CTD-3126B10.4-001	KNOWN	basic	lincRNA	ENSG00000205918	lincRNA	OTTHUMT00000436114.1	C		-		2692244	-1	no_errors	ENST00000382326	ensembl	human	known	74_37	rna	SNP	1.000	G
HMCN2	256158	genome.wustl.edu	37	9	133263837	133263837	+	3'UTR	SNP	C	C	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr9:133263837C>A	ENST00000487727.2	+	0	527							Q8NDA2	HMCN2_HUMAN	hemicentin 2						response to stimulus (GO:0050896)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)										GACAGTGAGCCAGGTGGCTGG	0.577																																																	0								ENSG00000148357																																			HMCN2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK074396		9q34.11	2013-01-29			ENSG00000148357	ENSG00000148357		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21293	protein-coding gene	gene with protein product							Standard	XM_006710218		Approved	DKFZp434P0216, FLJ23816		Q8NDA2	OTTHUMG00000140096	ENST00000487727.2:c.*524C>A	9.37:g.133263837C>A		Somatic	0	23	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	28	33.33	Q8N225|Q8TCI8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000487727.2	37	NULL		9																																																																																			-	-		0.577	HMCN2-006	KNOWN	mRNA_start_NF|basic	processed_transcript	HMCN2	protein_coding	OTTHUMT00000054659.3	C	XM_175125	-		133263837	+1	no_errors	ENST00000487727	ensembl	human	known	74_37	rna	SNP	1.000	A
BMF	90427	genome.wustl.edu	37	15	40400420	40400421	+	Intron	INS	-	-	AC	rs140876953|rs143336176|rs58924044	byFrequency	TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr15:40400420_40400421insAC	ENST00000354670.4	-	2	230				BMF_ENST00000561282.1_5'Flank|BMF_ENST00000561360.1_5'Flank|BMF_ENST00000558774.1_Intron|BMF_ENST00000431415.3_5'Flank|BMF_ENST00000559701.1_Intron|BMF_ENST00000397573.1_5'Flank|BMF_ENST00000558057.1_5'UTR|BMF_ENST00000220446.4_5'Flank	NM_001003940.1	NP_001003940.1	Q96LC9	BMF_HUMAN	Bcl2 modifying factor						anoikis (GO:0043276)|apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of apoptotic signaling pathway (GO:2001234)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(1)|ovary(1)	6		all_cancers(109;4.18e-18)|all_epithelial(112;6.15e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.29e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0516)		AGTGACTAGGAacacacacaca	0.589																																																	0								ENSG00000104081																																			BMF	SO:0001627	intron_variant	0				HGNC	BC060783	CCDS10052.1, CCDS32196.1, CCDS45223.1	15q14	2014-03-07			ENSG00000104081	ENSG00000104081			24132	protein-coding gene	gene with protein product		606266				11546872	Standard	NM_001003943		Approved	FLJ00065	uc001zkw.4	Q96LC9	OTTHUMG00000129875	ENST00000354670.4:c.4+38->GT	15.37:g.40400429_40400430dupAC		Somatic	0	23	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	63	22.22	Q2M396|Q6NT30|Q6NT56|Q6P9F6|Q7Z7D4|Q7Z7D5|Q9H7K7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000354670.4	37	NULL	CCDS10052.1	15																																																																																			-	-		0.589	BMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMF	protein_coding	OTTHUMT00000252119.1	-	NM_033503			40400421	-1	no_errors	ENST00000558057	ensembl	human	known	74_37	rna	INS	0.000:0.001	AC
PHLPP2	23035	genome.wustl.edu	37	16	71748565	71748565	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr16:71748565G>A	ENST00000568954.1	-	2	512	c.134C>T	c.(133-135)aCa>aTa	p.T45I	PHLPP2_ENST00000393524.2_Missense_Mutation_p.T45I|PHLPP2_ENST00000360429.3_Missense_Mutation_p.T45I|PHLPP2_ENST00000356272.3_Missense_Mutation_p.T45I|PHLPP2_ENST00000567016.1_Missense_Mutation_p.T80I			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2	45	Poly-Thr.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						GGTGGTGGTTGTAGTGGCAGT	0.478																																																	0								ENSG00000040199						194.0	130.0	152.0					16																	71748565		2198	4300	6498	PHLPP2	SO:0001583	missense	0			-	HGNC	BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8		ENST00000568954.1:c.134C>T	16.37:g.71748565G>A	ENSP00000457991:p.Thr45Ile	Somatic	0	28	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	1	95.65	A1L374|Q9NV17|Q9Y2E3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PP2C-like_dom,pfam_Leu-rich_rpt,superfamily_PP2C-like_dom,smart_Leu-rich_rpt_typical-subtyp,smart_PP2C-like_dom	p.T45I	ENST00000568954.1	37	c.134	CCDS32479.1	16	.	.	.	.	.	.	.	.	.	.	G	17.23	3.337700	0.60963	.	.	ENSG00000040199	ENST00000360429;ENST00000356272;ENST00000393524;ENST00000538126	T;T;T	0.46063	1.34;1.41;0.88	5.58	5.58	0.84498	.	0.587434	0.18001	N	0.154911	T	0.25901	0.0631	N	0.08118	0	0.27897	N	0.939109	B;B	0.27380	0.096;0.177	B;B	0.26202	0.067;0.049	T	0.13469	-1.0508	10	0.31617	T	0.26	0.2957	15.0563	0.71915	0.0:0.0:1.0:0.0	.	45;45	Q6ZVD8-3;Q6ZVD8	.;PHLP2_HUMAN	I	45	ENSP00000353610:T45I;ENSP00000348611:T45I;ENSP00000377159:T45I	ENSP00000348611:T45I	T	-	2	0	PHLPP2	70306066	0.894000	0.30519	0.609000	0.28983	0.980000	0.70556	3.194000	0.51005	2.622000	0.88805	0.591000	0.81541	ACA	-	NULL		0.478	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHLPP2	protein_coding	OTTHUMT00000434139.1	G	NM_015020	-		71748565	-1	no_errors	ENST00000356272	ensembl	human	known	74_37	missense	SNP	0.688	A
KIAA1804	84451	genome.wustl.edu	37	1	233518139	233518139	+	Silent	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr1:233518139C>T	ENST00000366624.3	+	10	3054	c.2793C>T	c.(2791-2793)gtC>gtT	p.V931V	MLK4_ENST00000366622.1_Silent_p.V377V	NM_032435.2	NP_115811.2																					CAAGGGAGGTCTCACCCAAGA	0.587																																																	0								ENSG00000143674						104.0	92.0	96.0					1																	233518139		2203	4300	6503	MLK4	SO:0001819	synonymous_variant	0			-	Uniprot_gn																												ENST00000366624.3:c.2793C>T	1.37:g.233518139C>T		Somatic	0	23	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	19	42.42		Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.V931	ENST00000366624.3	37	c.2793	CCDS1598.1	1																																																																																			-	pirsf_MAPKKK9/10/11		0.587	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1804	protein_coding	OTTHUMT00000092495.1	C		-		233518139	+1	no_errors	ENST00000366624	ensembl	human	known	74_37	silent	SNP	0.033	T
CYTIP	9595	genome.wustl.edu	37	2	158298116	158298121	+	Intron	DEL	ACACAC	ACACAC	-	rs199974176|rs147795088|rs112695012|rs35513959|rs57074495|rs201904015		TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	ACACAC	ACACAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr2:158298116_158298121delACACAC	ENST00000264192.3	-	1	296				CYTIP_ENST00000540637.1_Intron|CYTIP_ENST00000497432.1_Intron|AC019201.1_ENST00000401235.1_RNA	NM_004288.4	NP_004279.3	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein						regulation of cell adhesion (GO:0030155)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	15						atatgcacatacacacacacacacac	0.403																																																	0								ENSG00000216054																																			AC019201.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	L06633	CCDS2204.1	2q11.2	2011-09-08	2008-08-14	2008-08-19	ENSG00000115165	ENSG00000115165			9506	protein-coding gene	gene with protein product	"""cytohesin binding protein HE"", ""cytohesin binder and regulator"""	604448	"""pleckstrin homology, Sec7 and coiled-coil domains, binding protein"""	PSCDBP		18926288, 10343115, 11867758, 20530790, 21562043	Standard	NM_004288		Approved	B3-1, HE, CYBR, CASP, CYTHIP	uc002tzj.1	O60759	OTTHUMG00000154551	ENST00000264192.3:c.174+2237GTGTGT>-	2.37:g.158298122_158298127delACACAC		Somatic	NA	NA	NA		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DWH9|Q15630|Q8NE32	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000264192.3	37	NULL	CCDS2204.1	2																																																																																			-	-		0.403	CYTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216054	protein_coding	OTTHUMT00000254926.1	ACACAC	NM_004288			158298121	+1	no_errors	ENST00000401235	ensembl	human	novel	74_37	rna	DEL	0.006:0.012:0.018:0.024:0.029:0.033	-
HMCN2	256158	genome.wustl.edu	37	9	133263827	133263827	+	3'UTR	SNP	G	G	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr9:133263827G>A	ENST00000487727.2	+	0	517							Q8NDA2	HMCN2_HUMAN	hemicentin 2						response to stimulus (GO:0050896)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)										CCAAGACAGAGACAGTGAGCC	0.582																																																	0								ENSG00000148357																																			HMCN2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK074396		9q34.11	2013-01-29			ENSG00000148357	ENSG00000148357		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21293	protein-coding gene	gene with protein product							Standard	XM_006710218		Approved	DKFZp434P0216, FLJ23816		Q8NDA2	OTTHUMG00000140096	ENST00000487727.2:c.*514G>A	9.37:g.133263827G>A		Somatic	0	24	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	29	29.27	Q8N225|Q8TCI8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000487727.2	37	NULL		9																																																																																			-	-		0.582	HMCN2-006	KNOWN	mRNA_start_NF|basic	processed_transcript	HMCN2	protein_coding	OTTHUMT00000054659.3	G	XM_175125	-		133263827	+1	no_errors	ENST00000487727	ensembl	human	known	74_37	rna	SNP	0.997	A
ASPH	444	genome.wustl.edu	37	8	62559366	62559366	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr8:62559366T>A	ENST00000379454.4	-	6	749	c.562A>T	c.(562-564)Atg>Ttg	p.M188L	ASPH_ENST00000517847.2_Missense_Mutation_p.M174L|ASPH_ENST00000541428.1_Missense_Mutation_p.M159L|ASPH_ENST00000522919.1_Start_Codon_SNP_p.M1L|ASPH_ENST00000517903.1_Missense_Mutation_p.M174L|ASPH_ENST00000356457.5_Missense_Mutation_p.M188L|ASPH_ENST00000445642.3_Missense_Mutation_p.M174L|ASPH_ENST00000522835.1_Intron|ASPH_ENST00000518068.1_Intron	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase	188	Glu-rich.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	TCAGTCGCCATAAGAAACTCA	0.388																																																	0								ENSG00000198363						383.0	384.0	384.0					8																	62559366		2203	4300	6503	ASPH	SO:0001583	missense	0			-	HGNC	AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.562A>T	8.37:g.62559366T>A	ENSP00000368767:p.Met188Leu	Somatic	0	50	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	57	45	55.88	A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Asp-B-hydro/Triadin_dom,pfam_Asp_Arg_b-Hydrxlase,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.M188L	ENST00000379454.4	37	c.562	CCDS34898.1	8	.	.	.	.	.	.	.	.	.	.	T	11.98	1.801344	0.31869	.	.	ENSG00000198363	ENST00000389213;ENST00000541428;ENST00000379454;ENST00000522919;ENST00000356457;ENST00000519234;ENST00000517903;ENST00000445642;ENST00000517847	T;T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.48	-7.43	0.01383	Aspartyl beta-hydroxylase/Triadin domain (1);	2.338930	0.01311	N	0.010611	T	0.22975	0.0555	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.08055	0.002;0.0;0.001;0.002;0.001;0.0;0.0;0.003	T	0.09885	-1.0654	10	0.17369	T	0.5	1.7494	2.6632	0.05032	0.0996:0.3606:0.2014:0.3385	.	188;174;174;159;188;188;174;188	B8Y0L3;B7ZM95;B7ZM96;F5H667;F8W7A9;Q12797-2;Q9H291;Q12797	.;.;.;.;.;.;.;ASPH_HUMAN	L	188;159;188;1;188;203;174;174;174	ENSP00000437864:M159L;ENSP00000368767:M188L;ENSP00000430516:M1L;ENSP00000348841:M188L;ENSP00000427823:M203L;ENSP00000430245:M174L;ENSP00000394013:M174L;ENSP00000429954:M174L	ENSP00000348841:M188L	M	-	1	0	ASPH	62721920	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.854000	0.04299	-1.443000	0.01953	-0.264000	0.10439	ATG	-	pfam_Asp-B-hydro/Triadin_dom		0.388	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPH	protein_coding	OTTHUMT00000378510.3	T	NM_004318	-		62559366	-1	no_errors	ENST00000379454	ensembl	human	known	74_37	missense	SNP	0.000	A
KCNJ14	3770	genome.wustl.edu	37	19	48968878	48968879	+	3'UTR	INS	-	-	T	rs560775241	byFrequency	TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr19:48968878_48968879insT	ENST00000391884.1	+	0	2631_2632				CTC-273B12.5_ENST00000600529.1_RNA|CTC-273B12.5_ENST00000596497.1_RNA|CTC-273B12.5_ENST00000600650.1_RNA|CTC-273B12.5_ENST00000593476.1_RNA|KCNJ14_ENST00000342291.2_3'UTR|CTC-273B12.7_ENST00000595676.1_5'Flank|CTC-273B12.6_ENST00000597574.1_lincRNA			Q9UNX9	KCJ14_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 14						potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|skin(2)|urinary_tract(1)	10		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000109)|all cancers(93;0.000129)|Epithelial(262;0.0081)|GBM - Glioblastoma multiforme(486;0.0222)	Yohimbine(DB01392)	TGGGTGGGTTGTTTTTTTTTAA	0.421													TTgTTTTTTTTT|TTTTTTTTT|TTTTTTTTTT|cryptic_indel	14	0.00279553	0.0008	0.0	5008	,	,		19681	0.001		0.0	False		,,,				2504	0.0123				NSCLC(148;170 3504 35216)												0								ENSG00000268530																																			CTC-273B12.5	SO:0001624	3_prime_UTR_variant	0				Clone_based_vega_gene	BC042033	CCDS12721.1	19q13	2011-07-05				ENSG00000182324		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6260	protein-coding gene	gene with protein product		603953				9592090, 10723734, 16382105	Standard	NM_013348		Approved	Kir2.4, IRK4	uc002pje.2	Q9UNX9		ENST00000391884.1:c.*845->T	19.37:g.48968887_48968887dupT		Somatic	0	17	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	47	12.96		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000391884.1	37	NULL	CCDS12721.1	19																																																																																			-	-		0.421	KCNJ14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000268530	protein_coding	OTTHUMT00000466127.1	-	NM_013348			48968879	-1	no_errors	ENST00000593476	ensembl	human	known	74_37	rna	INS	0.001:0.000	T
CDCP1	64866	genome.wustl.edu	37	3	45152131	45152131	+	Silent	SNP	C	C	A	rs148271891	byFrequency	TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr3:45152131C>A	ENST00000296129.1	-	4	992	c.858G>T	c.(856-858)ccG>ccT	p.P286P	CDCP1_ENST00000425231.2_Silent_p.P286P|CDCP1_ENST00000490471.1_5'Flank	NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	286						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		TGGTGGAGCCCGGGATGTAGT	0.572																																																	0								ENSG00000163814						146.0	136.0	140.0					3																	45152131		2203	4300	6503	CDCP1	SO:0001819	synonymous_variant	0			-	HGNC	AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.858G>T	3.37:g.45152131C>A		Somatic	0	32	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_CUB_dom	p.P286	ENST00000296129.1	37	c.858	CCDS2727.1	3																																																																																			-	NULL		0.572	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCP1	protein_coding	OTTHUMT00000256748.3	C	NM_022842	-		45152131	-1	no_errors	ENST00000296129	ensembl	human	known	74_37	silent	SNP	0.002	A
LAYN	143903	genome.wustl.edu	37	11	111420356	111420356	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr11:111420356G>T	ENST00000375615.3	+	4	606	c.421G>T	c.(421-423)Gat>Tat	p.D141Y	LAYN_ENST00000436913.2_Intron|LAYN_ENST00000375614.2_Missense_Mutation_p.D133Y|LAYN_ENST00000533265.1_Missense_Mutation_p.D133Y|LAYN_ENST00000525126.1_Missense_Mutation_p.D141Y|LAYN_ENST00000528924.1_Intron	NM_001258390.1	NP_001245319.1	Q6UX15	LAYN_HUMAN	layilin	141	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|ruffle (GO:0001726)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|skin(1)	14		all_cancers(61;9.06e-10)|all_epithelial(67;1.34e-05)|Melanoma(852;1.74e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.086)		Epithelial(105;1.5e-06)|BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|all cancers(92;2.45e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0476)	Hyaluronan(DB08818)	CTGGTATGTGGATGAGCCATC	0.552																																					Ovarian(17;551 586 12136 22082 22900)												0								ENSG00000204381						72.0	64.0	67.0					11																	111420356		2201	4297	6498	LAYN	SO:0001583	missense	0			-	HGNC		CCDS31676.1, CCDS58178.1, CCDS58179.1	11q23.1	2006-02-09			ENSG00000204381	ENSG00000204381			29471	protein-coding gene	gene with protein product						15913605	Standard	NM_001258390		Approved	FLJ30977, FLJ31092	uc001plr.2	Q6UX15	OTTHUMG00000166721	ENST00000375615.3:c.421G>T	11.37:g.111420356G>T	ENSP00000364765:p.Asp141Tyr	Somatic	0	18	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	16	27.27	A6NJB0|B4DJU0|Q8TAY8|Q96NC5|Q96NF3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.D141Y	ENST00000375615.3	37	c.421	CCDS58178.1	11	.	.	.	.	.	.	.	.	.	.	G	25.7	4.663288	0.88251	.	.	ENSG00000204381	ENST00000375614;ENST00000375615;ENST00000525126;ENST00000533265;ENST00000541011	T;T;T;T	0.30448	3.1;1.53;1.53;3.1	5.66	5.66	0.87406	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.85682	D	0.000000	T	0.59004	0.2162	M	0.76328	2.33	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.997	T	0.60505	-0.7250	10	0.66056	D	0.02	-23.7131	19.3539	0.94402	0.0:0.0:1.0:0.0	.	133;141;141;133	E9PMI0;Q6UX15;E9PQU7;Q6UX15-2	.;LAYN_HUMAN;.;.	Y	133;141;141;133;96	ENSP00000364764:D133Y;ENSP00000364765:D141Y;ENSP00000434328:D141Y;ENSP00000434972:D133Y	ENSP00000364764:D133Y	D	+	1	0	LAYN	110925566	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	9.455000	0.97625	2.659000	0.90383	0.563000	0.77884	GAT	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.552	LAYN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAYN	protein_coding	OTTHUMT00000391187.1	G	NM_178834	-		111420356	+1	no_errors	ENST00000375615	ensembl	human	known	74_37	missense	SNP	1.000	T
ONECUT1	3175	genome.wustl.edu	37	15	53081692	53081692	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr15:53081692A>C	ENST00000305901.5	-	1	517	c.390T>G	c.(388-390)caT>caG	p.H130Q	ONECUT1_ENST00000561401.2_Intron	NM_004498.2	NP_004489.1	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	130	Poly-His.				B cell differentiation (GO:0030183)|cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|endoderm development (GO:0007492)|epithelial cell development (GO:0002064)|glucose metabolic process (GO:0006006)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription, DNA-templated (GO:0006355)|spleen development (GO:0048536)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	17				all cancers(107;0.0708)		ggtggtggtgatggtggtggt	0.642																																																	0								ENSG00000169856						52.0	47.0	49.0					15																	53081692		2194	4293	6487	ONECUT1	SO:0001583	missense	0			-	HGNC	U77975	CCDS10150.1	15q21.3	2012-03-09	2007-07-16		ENSG00000169856	ENSG00000169856		"""Homeoboxes / CUT class"""	8138	protein-coding gene	gene with protein product		604164	"""one cut domain, family member 1"""	HNF6, HNF6A		8887657, 8790352	Standard	NM_004498		Approved	HNF-6	uc002aci.2	Q9UBC0	OTTHUMG00000131899	ENST00000305901.5:c.390T>G	15.37:g.53081692A>C	ENSP00000302630:p.His130Gln	Somatic	0	45	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	44	13.73	B2RTV4|Q99744|Q9UMR6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.H130Q	ENST00000305901.5	37	c.390	CCDS10150.1	15	.	.	.	.	.	.	.	.	.	.	A	11.24	1.579621	0.28180	.	.	ENSG00000169856	ENST00000305901	T	0.50548	0.74	3.92	-5.47	0.02600	.	0.126884	0.50627	D	0.000119	T	0.51991	0.1707	L	0.51422	1.61	0.80722	D	1	P	0.44006	0.824	P	0.60886	0.88	T	0.56007	-0.8050	10	0.25106	T	0.35	-9.6666	13.5628	0.61799	0.348:0.0:0.652:0.0	.	130	Q9UBC0	HNF6_HUMAN	Q	130	ENSP00000302630:H130Q	ENSP00000302630:H130Q	H	-	3	2	ONECUT1	50868984	0.982000	0.34865	0.829000	0.32907	0.965000	0.64279	0.174000	0.16743	-1.047000	0.03242	0.352000	0.21897	CAT	-	NULL		0.642	ONECUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ONECUT1	protein_coding	OTTHUMT00000254849.2	A		-		53081692	-1	no_errors	ENST00000305901	ensembl	human	known	74_37	missense	SNP	0.913	C
TMCO6	55374	genome.wustl.edu	37	5	140021484	140021484	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr5:140021484G>T	ENST00000394671.3	+	4	445	c.344G>T	c.(343-345)gGg>gTg	p.G115V	TMCO6_ENST00000511410.1_3'UTR|TMCO6_ENST00000252100.6_Missense_Mutation_p.G115V|NDUFA2_ENST00000510680.1_Intron|TMCO6_ENST00000537378.1_Intron	NM_018502.3	NP_060972.3	Q96DC7	TMCO6_HUMAN	transmembrane and coiled-coil domains 6	115					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|urinary_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCCTGGTCGGGCTCCTGACC	0.637																																																	0								ENSG00000113119						34.0	39.0	37.0					5																	140021484		2050	4181	6231	TMCO6	SO:0001583	missense	0			-	HGNC	BC001910	CCDS4233.2, CCDS75320.1	5q31.3	2008-11-06			ENSG00000113119	ENSG00000113119			28814	protein-coding gene	gene with protein product						12477932	Standard	XM_005268476		Approved	FLJ39769, PRO1580	uc003lgl.3	Q96DC7	OTTHUMG00000129497	ENST00000394671.3:c.344G>T	5.37:g.140021484G>T	ENSP00000378166:p.Gly115Val	Somatic	0	18	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	9	57.14	Q9BUU0|Q9P198	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold,smart_Armadillo,pfscan_Importin-a_IBB	p.G115V	ENST00000394671.3	37	c.344	CCDS4233.2	5	.	.	.	.	.	.	.	.	.	.	G	20.4	3.989905	0.74589	.	.	ENSG00000113119	ENST00000394671;ENST00000252100	T;T	0.30182	1.54;1.54	5.4	5.4	0.78164	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	U	0.000019	T	0.45538	0.1347	L	0.47716	1.5	0.80722	D	1	D;D	0.63046	0.992;0.992	P;P	0.61722	0.893;0.893	T	0.33828	-0.9853	10	0.59425	D	0.04	-14.4106	14.3916	0.66983	0.0:0.1478:0.8522:0.0	.	115;115	Q96DC7-2;Q96DC7	.;TMCO6_HUMAN	V	115	ENSP00000378166:G115V;ENSP00000252100:G115V	ENSP00000252100:G115V	G	+	2	0	TMCO6	140001668	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	7.276000	0.78559	2.542000	0.85734	0.563000	0.77884	GGG	-	superfamily_ARM-type_fold,smart_Armadillo		0.637	TMCO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO6	protein_coding	OTTHUMT00000251666.2	G	NM_018502	-		140021484	+1	no_errors	ENST00000252100	ensembl	human	known	74_37	missense	SNP	1.000	T
ONECUT1	3175	genome.wustl.edu	37	15	53081679	53081693	+	In_Frame_Del	DEL	GGTGGTGGTGGTGAT	GGTGGTGGTGGTGAT	-			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	GGTGGTGGTGGTGAT	GGTGGTGGTGGTGAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr15:53081679_53081693delGGTGGTGGTGGTGAT	ENST00000305901.5	-	1	516_530	c.389_403delATCACCACCACCACC	c.(388-405)catcaccaccaccacccg>ccg	p.HHHHH130del	ONECUT1_ENST00000561401.2_Intron	NM_004498.2	NP_004489.1	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	130	Poly-His.				B cell differentiation (GO:0030183)|cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|endoderm development (GO:0007492)|epithelial cell development (GO:0002064)|glucose metabolic process (GO:0006006)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription, DNA-templated (GO:0006355)|spleen development (GO:0048536)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	17				all cancers(107;0.0708)		tggtggtgcgggtggtggtggtgatggtggtggtg	0.628																																																	0								ENSG00000169856			47,4215		18,11,2102						4.2	1.0			45	58,8196		24,10,4093	no	coding	ONECUT1	NM_004498.1		42,21,6195	A1A1,A1R,RR		0.7027,1.1028,0.8389				105,12411				ONECUT1	SO:0001651	inframe_deletion	0				HGNC	U77975	CCDS10150.1	15q21.3	2012-03-09	2007-07-16		ENSG00000169856	ENSG00000169856		"""Homeoboxes / CUT class"""	8138	protein-coding gene	gene with protein product		604164	"""one cut domain, family member 1"""	HNF6, HNF6A		8887657, 8790352	Standard	NM_004498		Approved	HNF-6	uc002aci.2	Q9UBC0	OTTHUMG00000131899	ENST00000305901.5:c.389_403delATCACCACCACCACC	15.37:g.53081679_53081693delGGTGGTGGTGGTGAT	ENSP00000302630:p.His130_His134del	Somatic	NA	NA	NA		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RTV4|Q99744|Q9UMR6	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.HHHHH130in_frame_del	ENST00000305901.5	37	c.403_389	CCDS10150.1	15																																																																																			-	NULL		0.628	ONECUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ONECUT1	protein_coding	OTTHUMT00000254849.2	GGTGGTGGTGGTGAT				53081693	-1	no_errors	ENST00000305901	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.997:1.000:1.000:1.000:1.000:1.000:0.913:1.000	-
OR4F17	81099	genome.wustl.edu	37	19	111016	111016	+	Missense_Mutation	SNP	T	T	G	rs200336441		TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr19:111016T>G	ENST00000585993.1	+	2	477	c.338T>G	c.(337-339)tTt>tGt	p.F113C	OR4F17_ENST00000318050.3_Missense_Mutation_p.F113C			Q8NGA8	O4F17_HUMAN	olfactory receptor, family 4, subfamily F, member 17	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(2)	2		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCATGGGCTTTGACAGATAT	0.463																																																	0								ENSG00000176695						1.0	1.0	1.0					19																	111016		76	150	226	OR4F17	SO:0001583	missense	0			-	HGNC	AC005605	CCDS32854.1	19p13.3	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	15381	protein-coding gene	gene with protein product				OR4F19, OR4F11P, OR4F18			Standard	NM_001005240		Approved		uc002loc.1	Q8NGA8		ENST00000585993.1:c.338T>G	19.37:g.111016T>G	ENSP00000467301:p.Phe113Cys	Somatic	0	12	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	10	44.44	B2RNE8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.F113C	ENST00000585993.1	37	c.338	CCDS32854.1	19	.	.	.	.	.	.	.	.	.	.	.	9.777	1.174271	0.21704	.	.	ENSG00000176695	ENST00000442916;ENST00000318050	T	0.00520	6.85	2.55	2.55	0.30701	GPCR, rhodopsin-like superfamily (1);	0.156294	0.30193	N	0.010181	T	0.01189	0.0039	M	0.75884	2.315	0.31291	N	0.689393	D	0.76494	0.999	D	0.74674	0.984	T	0.24154	-1.0168	10	0.72032	D	0.01	.	4.9478	0.13999	0.2703:0.0:0.0:0.7297	.	113	Q8NGA8	O4F17_HUMAN	C	161;113	ENSP00000315047:F113C	ENSP00000315047:F113C	F	+	2	0	OR4F17	62016	0.698000	0.27777	1.000000	0.80357	0.325000	0.28411	0.344000	0.19962	1.410000	0.46936	0.346000	0.21813	TTT	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.463	OR4F17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4F17	protein_coding	OTTHUMT00000451410.1	T		rs200336441		111016	+1	no_errors	ENST00000318050	ensembl	human	known	74_37	missense	SNP	0.999	G
MROH2B	133558	genome.wustl.edu	37	5	41042208	41042208	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr5:41042208C>T	ENST00000399564.4	-	19	2389	c.1939G>A	c.(1939-1941)Ggg>Agg	p.G647R	MROH2B_ENST00000506092.2_Missense_Mutation_p.G202R	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	647																	CTTTGATCCCCCAGTTGGTTG	0.428																																																	0								ENSG00000171495						53.0	49.0	50.0					5																	41042208		1831	4086	5917	MROH2B	SO:0001583	missense	0			-	HGNC		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.1939G>A	5.37:g.41042208C>T	ENSP00000382476:p.Gly647Arg	Somatic	0	49	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	30	48.28	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.G647R	ENST00000399564.4	37	c.1939	CCDS47202.1	5	.	.	.	.	.	.	.	.	.	.	C	19.05	3.752217	0.69533	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.01369	4.97;5.21	5.79	5.79	0.91817	Armadillo-type fold (1);	0.000000	0.52532	D	0.000078	T	0.05777	0.0151	L	0.51422	1.61	0.39581	D	0.969437	D	0.89917	1.0	D	0.97110	1.0	T	0.58081	-0.7699	10	0.22109	T	0.4	.	15.5371	0.76013	0.0:1.0:0.0:0.0	.	647	Q7Z745	HTRB2_HUMAN	R	202;352;647	ENSP00000441504:G202R;ENSP00000382476:G647R	ENSP00000296803:G352R	G	-	1	0	HEATR7B2	41077965	0.744000	0.28250	0.743000	0.31040	0.756000	0.42949	3.761000	0.55242	2.746000	0.94184	0.460000	0.39030	GGG	-	superfamily_ARM-type_fold		0.428	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH2B	protein_coding	OTTHUMT00000367558.2	C	NM_173489	-		41042208	-1	no_errors	ENST00000399564	ensembl	human	known	74_37	missense	SNP	0.869	T
LOC441666	441666	genome.wustl.edu	37	10	42832502	42832503	+	RNA	INS	-	-	TATCA	rs368679059		TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr10:42832502_42832503insTATCA	ENST00000609841.1	-	0	1400_1401					NR_024380.1																						CCCCTATCAATTATGTTTAGTA	0.366																																																	0								ENSG00000215146																																			RP11-313J2.1			0				Clone_based_vega_gene																													10.37:g.42832502_42832503insTATCA		Somatic	NA	NA	NA		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000609841.1	37	NULL		10																																																																																			-	-		0.366	RP11-313J2.1-002	KNOWN	basic	processed_transcript	LOC441666	pseudogene	OTTHUMT00000472483.1	-				42832503	-1	no_errors	ENST00000609841	ensembl	human	known	74_37	rna	INS	0.995:0.996	TATCA
ZNF644	84146	genome.wustl.edu	37	1	91406009	91406009	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr1:91406009G>C	ENST00000370440.1	-	3	1119	c.902C>G	c.(901-903)aCt>aGt	p.T301S	ZNF644_ENST00000337393.5_Missense_Mutation_p.T301S|ZNF644_ENST00000347275.5_Intron|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000467231.1_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	301					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		GGTATAACGAGTTATCTTGCT	0.328																																																	0								ENSG00000122482						91.0	88.0	89.0					1																	91406009		2203	4299	6502	ZNF644	SO:0001583	missense	0			-	HGNC	AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.902C>G	1.37:g.91406009G>C	ENSP00000359469:p.Thr301Ser	Somatic	0	25	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	22	56.86	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T301S	ENST00000370440.1	37	c.902	CCDS731.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.88|11.88	1.770608|1.770608	0.31320|0.31320	.|.	.|.	ENSG00000122482|ENSG00000122482	ENST00000541557|ENST00000370440;ENST00000337393	.|T;T	.|0.00591	.|6.35;6.35	5.58|5.58	4.66|4.66	0.58398|0.58398	.|.	.|0.164580	.|0.56097	.|D	.|0.000039	T|T	0.00271|0.00271	0.0008|0.0008	L|L	0.29908|0.29908	0.895|0.895	0.42862|0.42862	D|D	0.994115|0.994115	.|P	.|0.34800	.|0.469	.|B	.|0.32211	.|0.142	T|T	0.79072|0.79072	-0.1953|-0.1953	6|10	0.87932|0.27785	D|T	0|0.31	-11.9515|-11.9515	14.7234|14.7234	0.69326|0.69326	0.0703:0.0:0.9297:0.0|0.0703:0.0:0.9297:0.0	.|.	.|301	.|Q9H582	.|ZN644_HUMAN	K|S	300|301	.|ENSP00000359469:T301S;ENSP00000337008:T301S	ENSP00000442287:N300K|ENSP00000337008:T301S	N|T	-|-	3|2	2|0	ZNF644|ZNF644	91178597|91178597	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	3.987000|3.987000	0.56944|0.56944	2.636000|2.636000	0.89361|0.89361	0.655000|0.655000	0.94253|0.94253	AAC|ACT	-	NULL		0.328	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF644	protein_coding	OTTHUMT00000027846.2	G	NM_032186	-		91406009	-1	no_errors	ENST00000337393	ensembl	human	known	74_37	missense	SNP	1.000	C
LINC00987	100499405	genome.wustl.edu	37	12	9394744	9394745	+	lincRNA	INS	-	-	T	rs77464119|rs71045242|rs386375561|rs71453687		TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr12:9394744_9394745insT	ENST00000427111.3	+	0	1568_1569					NR_036466.1				long intergenic non-protein coding RNA 987																		ATAAGCAAATCTTTTTTTTTTT	0.421																																																	0								ENSG00000237248																																			LINC00987			0				HGNC	AK126248		12p13.31	2013-07-04			ENSG00000237248	ENSG00000237248		"""Long non-coding RNAs"""	48911	non-coding RNA	RNA, long non-coding							Standard	NR_036466		Approved				OTTHUMG00000168332		12.37:g.9394755_9394755dupT		Somatic	0	9	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000427111.3	37	NULL		12																																																																																			-	-		0.421	LINC00987-001	KNOWN	basic	lincRNA	LINC00987	lincRNA	OTTHUMT00000399347.1	-				9394745	+1	no_errors	ENST00000427111	ensembl	human	known	74_37	rna	INS	0.000:0.000	T
AGFG2	3268	genome.wustl.edu	37	7	100163513	100163513	+	3'UTR	DEL	T	T	-	rs56804763|rs145117814	byFrequency	TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr7:100163513delT	ENST00000300176.4	+	0	2467				AGFG2_ENST00000474713.1_3'UTR	NM_006076.4	NP_006067.3	O95081	AGFG2_HUMAN	ArfGAP with FG repeats 2						regulation of ARF GTPase activity (GO:0032312)	membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TTGCCTGGTCTTTTTTTTTTT	0.512													|||unknown(HR)	4333	0.865216	0.8336	0.8444	5008	,	,		14727	0.8552		0.9195	False		,,,				2504	0.8773																0								ENSG00000106351																																			AGFG2	SO:0001624	3_prime_UTR_variant	0				HGNC	AF015042	CCDS5697.1	7q22.1	2008-09-22	2008-09-22	2008-09-22	ENSG00000106351	ENSG00000106351		"""ADP-ribosylation factor GTPase activating proteins"""	5177	protein-coding gene	gene with protein product		604019	"""HIV-1 Rev binding protein-like"""	HRBL		9799793	Standard	XM_005250306		Approved	RABR	uc003uvf.3	O95081	OTTHUMG00000156029	ENST00000300176.4:c.*899T>-	7.37:g.100163513delT		Somatic	0	19	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	O75429|Q96AB9|Q96GL4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000300176.4	37	NULL	CCDS5697.1	7																																																																																			-	-		0.512	AGFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGFG2	protein_coding	OTTHUMT00000342769.1	T	NM_006076			100163513	+1	no_errors	ENST00000474713	ensembl	human	known	74_37	rna	DEL	0.015	-
TTLL2	83887	genome.wustl.edu	37	6	167754600	167754600	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr6:167754600G>C	ENST00000239587.5	+	3	1300	c.1212G>C	c.(1210-1212)aaG>aaC	p.K404N		NM_031949.4	NP_114155.4	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	404	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)		ligase activity (GO:0016874)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		TGTTGGTGAAGAGAAAACTTG	0.398																																																	0								ENSG00000120440						125.0	131.0	129.0					6																	167754600		2203	4300	6503	TTLL2	SO:0001583	missense	0			-	HGNC	AK093039	CCDS5301.1	6q27	2013-02-14		2004-01-14	ENSG00000120440	ENSG00000120440		"""Tubulin tyrosine ligase-like family"""	21211	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 104"""	C6orf104		11054573	Standard	XM_006715572		Approved	NYD-TSPG, dJ366N23.3	uc003qvs.1	Q9BWV7	OTTHUMG00000016023	ENST00000239587.5:c.1212G>C	6.37:g.167754600G>C	ENSP00000239587:p.Lys404Asn	Somatic	0	29	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	23	42.50	B2RB11|B3KS77|Q7Z6R8|Q86X22	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TTL/TTLL_fam	p.K404N	ENST00000239587.5	37	c.1212	CCDS5301.1	6	.	.	.	.	.	.	.	.	.	.	G	14.41	2.525947	0.44969	.	.	ENSG00000120440	ENST00000239587;ENST00000540954	T	0.07114	3.22	3.85	2.97	0.34412	.	0.000000	0.64402	D	0.000002	T	0.29556	0.0737	H	0.98238	4.18	0.37008	D	0.895616	D	0.89917	1.0	D	0.97110	1.0	T	0.39099	-0.9630	10	0.87932	D	0	.	7.855	0.29476	0.2074:0.0:0.7926:0.0	.	404	Q9BWV7	TTLL2_HUMAN	N	404;331	ENSP00000239587:K404N	ENSP00000239587:K404N	K	+	3	2	TTLL2	167674590	1.000000	0.71417	0.786000	0.31890	0.546000	0.35178	1.747000	0.38298	0.956000	0.37904	0.491000	0.48974	AAG	-	pfam_TTL/TTLL_fam		0.398	TTLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL2	protein_coding	OTTHUMT00000043127.3	G	NM_031949	-		167754600	+1	no_errors	ENST00000239587	ensembl	human	known	74_37	missense	SNP	1.000	C
TGM4	7047	genome.wustl.edu	37	3	44943114	44943114	+	Silent	SNP	C	C	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr3:44943114C>A	ENST00000296125.4	+	7	824	c.756C>A	c.(754-756)atC>atA	p.I252I	RP11-272D20.2_ENST00000427258.1_RNA	NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	252					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	GTGCCCCGATCCTGCAGCAGT	0.567																																																	0								ENSG00000163810						122.0	112.0	115.0					3																	44943114		2203	4300	6503	TGM4	SO:0001819	synonymous_variant	0			-	HGNC	BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.756C>A	3.37:g.44943114C>A		Somatic	0	17	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	12	53.85	Q16707|Q96QN4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Transglutaminase_N,pfam_Transglutaminase_C,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.I252	ENST00000296125.4	37	c.756	CCDS2723.1	3																																																																																			-	NULL		0.567	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM4	protein_coding	OTTHUMT00000256755.2	C	NM_003241	-		44943114	+1	no_errors	ENST00000296125	ensembl	human	known	74_37	silent	SNP	1.000	A
LOC644794	644794	genome.wustl.edu	37	7	66369212	66369213	+	lincRNA	INS	-	-	GGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr7:66369212_66369213insGGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC	ENST00000610177.1	+	0	1369_1370																											TGCCTCGTGGCGGCCTTCCCCG	0.738																																																	0								ENSG00000273142																																			RP11-458F8.4			0				Clone_based_vega_gene																													7.37:g.66369212_66369213insGGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC		Somatic	NA	NA	NA		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000610177.1	37	NULL		7																																																																																			-	-		0.738	RP11-458F8.4-001	KNOWN	basic	lincRNA	LOC644794	lincRNA	OTTHUMT00000472525.1	-				66369213	+1	no_errors	ENST00000610177	ensembl	human	known	74_37	rna	INS	0.293:0.454	GGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC
GNAI2	2771	genome.wustl.edu	37	3	50296406	50296406	+	3'UTR	DEL	C	C	-			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr3:50296406delC	ENST00000313601.6	+	0	2083				GNAI2_ENST00000266027.5_3'UTR|GNAI2_ENST00000536647.1_3'UTR|GNAI2_ENST00000491100.1_3'UTR|U73166.2_ENST00000439898.1_lincRNA	NM_002070.2	NP_002061.1	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2						activation of MAPKK activity (GO:0000186)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of synaptic transmission (GO:0050805)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|regulation of calcium ion transport (GO:0051924)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|liver(2)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		GACCAGCAAGCCCCCCCCCAG	0.483																																																	0								ENSG00000114353																																			GNAI2	SO:0001624	3_prime_UTR_variant	0				HGNC	X04828	CCDS2813.1, CCDS54587.1, CCDS63642.1, CCDS63644.1	3p21.31	2010-08-27			ENSG00000114353	ENSG00000114353			4385	protein-coding gene	gene with protein product	"""GTP-binding regulatory protein Gi alpha-2 chain"""	139360		GNAI2B		3100330, 1733849	Standard	NM_001166425		Approved	GIP	uc003cyq.1	P04899	OTTHUMG00000156940	ENST00000313601.6:c.*631C>-	3.37:g.50296406delC		Somatic	0	11	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	B3KTZ0|B4DYA0|B4E2X5|Q6B6N3|Q8IZ71	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000313601.6	37	NULL	CCDS2813.1	3																																																																																			-	-		0.483	GNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAI2	protein_coding	OTTHUMT00000346688.1	C	NM_002070			50296406	+1	no_errors	ENST00000491100	ensembl	human	known	74_37	rna	DEL	0.001	-
CSMD1	64478	genome.wustl.edu	37	8	2986326	2986326	+	5'UTR	DEL	T	T	-			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr8:2986326delT	ENST00000523387.1	-	0	2570				CSMD1_ENST00000520002.1_Intron|CSMD1_ENST00000537824.1_Intron|CSMD1_ENST00000602723.1_Intron|CSMD1_ENST00000400186.3_Intron|CSMD1_ENST00000542608.1_Intron|CSMD1_ENST00000602557.1_Intron			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1							integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CGAGTTTTTGTTTTTTTTTTA	0.328																																																	0								ENSG00000183117																																			CSMD1	SO:0001623	5_prime_UTR_variant	0				HGNC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000523387.1:c.-1419A>-	8.37:g.2986326delT		Somatic	0	25	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	20	9.09	Q0H0J5|Q96QU9|Q96RM4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000523387.1	37	NULL		8																																																																																			-	-		0.328	CSMD1-007	KNOWN	basic	processed_transcript	CSMD1	protein_coding	OTTHUMT00000374659.2	T	NM_033225			2986326	-1	no_errors	ENST00000523387	ensembl	human	known	74_37	rna	DEL	0.001	-
SMARCE1	6605	genome.wustl.edu	37	17	38785087	38785087	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr17:38785087C>T	ENST00000348513.6	-	11	1966	c.1186G>A	c.(1186-1188)Gtg>Atg	p.V396M	SMARCE1_ENST00000580419.1_Missense_Mutation_p.V361M|SMARCE1_ENST00000377808.4_3'UTR|SMARCE1_ENST00000431889.2_Missense_Mutation_p.V378M|SMARCE1_ENST00000544009.1_Missense_Mutation_p.V326M|SMARCE1_ENST00000578044.1_Missense_Mutation_p.V326M|SMARCE1_ENST00000400122.3_3'UTR|KRT222_ENST00000476049.1_3'UTR	NM_003079.4	NP_003070.3	Q969G3	SMCE1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1	396	Glu-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|metabolic process (GO:0008152)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|N-acetyltransferase activity (GO:0008080)|protein N-terminus binding (GO:0047485)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)			large_intestine(1)	1		Breast(137;0.000812)				GGCTCCTCCACTGTTGCACTG	0.448																																																	0								ENSG00000073584						131.0	115.0	120.0					17																	38785087		2203	4300	6503	SMARCE1	SO:0001583	missense	0			-	HGNC	AF035262	CCDS11370.1	17q21.2	2006-09-20			ENSG00000073584	ENSG00000073584			11109	protein-coding gene	gene with protein product		603111				9435219	Standard	NM_003079		Approved	BAF57	uc002hux.2	Q969G3	OTTHUMG00000133367	ENST00000348513.6:c.1186G>A	17.37:g.38785087C>T	ENSP00000323967:p.Val396Met	Somatic	0	33	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	34	24.44	B3KMC1|B4DFR4|C0IMW4|C0IMW5|C0IMW7|H7C3F6|O43539	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.V396M	ENST00000348513.6	37	c.1186	CCDS11370.1	17	.	.	.	.	.	.	.	.	.	.	C	20.5	4.009183	0.75046	.	.	ENSG00000073584	ENST00000348513;ENST00000544009;ENST00000431889	T;T	0.20200	2.09;2.1	5.51	5.51	0.81932	.	0.275539	0.41938	D	0.000783	T	0.19525	0.0469	N	0.24115	0.695	0.41346	D	0.987338	B;B	0.27732	0.187;0.187	B;B	0.32393	0.121;0.145	T	0.04840	-1.0923	10	0.33141	T	0.24	.	19.7872	0.96444	0.0:1.0:0.0:0.0	.	361;396	C0IMW4;Q969G3	.;SMCE1_HUMAN	M	396;326;378	ENSP00000323967:V396M;ENSP00000445370:V378M	ENSP00000323967:V396M	V	-	1	0	SMARCE1	36038613	0.993000	0.37304	0.959000	0.39883	0.998000	0.95712	3.212000	0.51145	2.741000	0.93983	0.655000	0.94253	GTG	-	NULL		0.448	SMARCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCE1	protein_coding	OTTHUMT00000257203.1	C	NM_003079	-		38785087	-1	no_errors	ENST00000348513	ensembl	human	known	74_37	missense	SNP	0.998	T
PTH2	113091	genome.wustl.edu	37	19	49926533	49926533	+	Missense_Mutation	SNP	G	G	C	rs200733272|rs371950649	byFrequency	TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr19:49926533G>C	ENST00000270631.1	-	1	165	c.64C>G	c.(64-66)Ctg>Gtg	p.L22V	CTD-3148I10.1_ENST00000576655.1_5'Flank	NM_178449.3	NP_848544.1	Q96A98	TIP39_HUMAN	parathyroid hormone 2	22					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.L22V(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(262;0.0015)|GBM - Glioblastoma multiforme(486;0.044)|Lung(386;0.0785)|LUSC - Lung squamous cell carcinoma(496;0.0836)		GGCACCACcagcagcagcagc	0.692													g|||	17	0.00339457	0.003	0.0043	5008	,	,		11369	0.004		0.002	False		,,,				2504	0.0041																2	Substitution - Missense(2)	endometrium(2)						ENSG00000142538		VAL/LEU	12,4376		0,12,2182	12.0	16.0	14.0		64	3.3	0.0	19		14	11,8561		0,11,4275	no	missense	PTH2	NM_178449.3	32	0,23,6457	CC,CG,GG		0.1283,0.2735,0.1775	possibly-damaging	22/101	49926533	23,12937	2194	4286	6480	PTH2	SO:0001583	missense	0			-	HGNC	AY037555	CCDS12763.1	19q13.33	2013-02-28				ENSG00000142538		"""Endogenous ligands"""	30828	protein-coding gene	gene with protein product	"""tuberoinfundibular 39 residues"""	608386				11861531	Standard	NM_178449		Approved	TIP39	uc002pnn.1	Q96A98		ENST00000270631.1:c.64C>G	19.37:g.49926533G>C	ENSP00000270631:p.Leu22Val	Somatic	0	29	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.09	Q96DJ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L22V	ENST00000270631.1	37	c.64	CCDS12763.1	19	.	.	.	.	.	.	.	.	.	.	g	6.292	0.421904	0.11928	0.002735	0.001283	ENSG00000142538	ENST00000270631	.	.	.	4.3	3.26	0.37387	.	0.489236	0.15528	U	0.257640	T	0.26521	0.0648	L	0.27053	0.805	0.09310	N	1	P	0.46142	0.873	B	0.39419	0.299	T	0.08066	-1.0740	9	0.87932	D	0	-7.2733	12.3672	0.55234	0.0:0.1717:0.8283:0.0	.	22	Q96A98	TIP39_HUMAN	V	22	.	ENSP00000270631:L22V	L	-	1	2	PTH2	54618345	0.088000	0.21588	0.012000	0.15200	0.011000	0.07611	-0.504000	0.06375	0.947000	0.37659	-0.370000	0.07254	CTG	-	NULL		0.692	PTH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH2	protein_coding	OTTHUMT00000465366.1	G	NM_178449	rs200733272		49926533	-1	no_errors	ENST00000270631	ensembl	human	known	74_37	missense	SNP	0.132	C
NOTCH2	4853	genome.wustl.edu	37	1	120612003	120612004	+	Frame_Shift_Del	DEL	GG	GG	-	rs372504208		TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	GG	GG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr1:120612003_120612004delGG	ENST00000256646.2	-	1	236_237	c.17_18delCC	c.(16-18)cccfs	p.P6fs		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	6					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.P6fs*27(2)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACAGCAGAGCGGGGCGCAGGGC	0.762			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																															Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	2	Deletion - Frameshift(2)	haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)						ENSG00000134250																																			NOTCH2	SO:0001589	frameshift_variant	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome		HGNC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.17_18delCC	1.37:g.120612005_120612006delGG	ENSP00000256646:p.Pro6fs	Somatic	0	10	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	32	20.00	Q5T3X7|Q99734|Q9H240	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.P6fs	ENST00000256646.2	37	c.18_17	CCDS908.1	1																																																																																			-	pirsf_Notch		0.762	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	protein_coding	OTTHUMT00000033679.1	GG	NM_024408			120612004	-1	no_errors	ENST00000256646	ensembl	human	known	74_37	frame_shift_del	DEL	0.101:0.700	-
EFEMP1	2202	genome.wustl.edu	37	2	56108783	56108783	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr2:56108783G>T	ENST00000394555.2	-	5	1039	c.604C>A	c.(604-606)Cct>Act	p.P202T	EFEMP1_ENST00000355426.3_Missense_Mutation_p.P202T|EFEMP1_ENST00000424836.2_Missense_Mutation_p.P144T|EFEMP1_ENST00000394554.1_Missense_Mutation_p.P202T	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	202	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)			NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TATCCAGGAGGGCACTGACAT	0.517																																					GBM(92;934 1319 7714 28760 40110)												0								ENSG00000115380						240.0	177.0	198.0					2																	56108783		2203	4300	6503	EFEMP1	SO:0001583	missense	0			-	HGNC	U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.604C>A	2.37:g.56108783G>T	ENSP00000378058:p.Pro202Thr	Somatic	0	63	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	44	10.20	A8K3I4|B4DW75|D6W5D2|Q541U7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	p.P202T	ENST00000394555.2	37	c.604	CCDS1857.1	2	.	.	.	.	.	.	.	.	.	.	G	4.643	0.119623	0.08881	.	.	ENSG00000115380	ENST00000394555;ENST00000394554;ENST00000405693;ENST00000424836;ENST00000355426	D;D;D;D	0.92249	-3.0;-3.0;-3.0;-3.0	5.9	5.9	0.94986	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.308277	0.28011	N	0.016958	D	0.89097	0.6618	L	0.49699	1.58	0.26777	N	0.969689	B;B	0.22983	0.008;0.078	B;B	0.26969	0.001;0.075	T	0.76397	-0.2974	10	0.17369	T	0.5	.	14.4259	0.67215	0.0701:0.0:0.9299:0.0	.	144;202	B4DW75;Q12805	.;FBLN3_HUMAN	T	202;202;58;144;202	ENSP00000378058:P202T;ENSP00000378057:P202T;ENSP00000399145:P144T;ENSP00000347596:P202T	ENSP00000347596:P202T	P	-	1	0	EFEMP1	55962287	1.000000	0.71417	0.924000	0.36721	0.059000	0.15707	5.106000	0.64597	2.790000	0.95986	0.650000	0.86243	CCT	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.517	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFEMP1	protein_coding	OTTHUMT00000251491.2	G		-		56108783	-1	no_errors	ENST00000355426	ensembl	human	known	74_37	missense	SNP	0.987	T
DNM1P47	100216544	genome.wustl.edu	37	15	102294619	102294619	+	RNA	SNP	C	C	T	rs368844070	byFrequency	TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr15:102294619C>T	ENST00000561463.1	+	0	2665									DNM1 pseudogene 47																		GCAGGCACAGCGGTGCGACGA	0.597													.|||	2	0.000399361	0.0008	0.0	5008	,	,		50050	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000259660																																			DNM1P47			0			-	HGNC	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102294619C>T		Somatic	0	26	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	36	14.29		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	-		0.597	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	pseudogene	OTTHUMT00000417589.1	C	NG_009149	-		102294619	+1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	SNP	1.000	T
PRMT2	3275	genome.wustl.edu	37	21	48083355	48083355	+	Silent	SNP	A	A	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr21:48083355A>T	ENST00000397637.1	+	10	2112	c.1158A>T	c.(1156-1158)ggA>ggT	p.G386G	PRMT2_ENST00000458387.2_Nonsense_Mutation_p.R239*|PRMT2_ENST00000397638.2_Silent_p.G386G|PRMT2_ENST00000440086.1_Silent_p.G284G|PRMT2_ENST00000291705.6_Intron|PRMT2_ENST00000355680.3_Silent_p.G386G|PRMT2_ENST00000451211.2_Intron			P55345	ANM2_HUMAN	protein arginine methyltransferase 2	386	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		TCCATACAGGAGACGTGGTCA	0.572																																																	0								ENSG00000160310						186.0	146.0	159.0					21																	48083355		2203	4300	6503	PRMT2	SO:0001819	synonymous_variant	0			-	HGNC	U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.1158A>T	21.37:g.48083355A>T		Somatic	0	27	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	11	52.17	B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_domain,pfam_SH3_2,pfam_Small_mtfrase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_tRNA_Trfase_Trm5/Tyw2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	p.R239*	ENST00000397637.1	37	c.715	CCDS13737.1	21	.	.	.	.	.	.	.	.	.	.	.	18.48	3.632505	0.67015	.	.	ENSG00000160310	ENST00000458387	.	.	.	5.29	-2.21	0.06973	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-12.0315	1.4573	0.02388	0.4684:0.1365:0.2627:0.1325	.	.	.	.	X	239	.	.	R	+	1	2	PRMT2	46907783	1.000000	0.71417	0.881000	0.34555	0.058000	0.15608	0.667000	0.25112	-0.174000	0.10743	-0.316000	0.08728	AGA	-	NULL		0.572	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRMT2	protein_coding	OTTHUMT00000207401.1	A	NM_001535	-		48083355	+1	no_errors	ENST00000458387	ensembl	human	known	74_37	nonsense	SNP	0.998	T
ZNF32	7580	genome.wustl.edu	37	10	44139490	44139490	+	3'UTR	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr10:44139490G>T	ENST00000395797.1	-	0	1018				ZNF32_ENST00000374433.2_3'UTR|ZNF32-AS3_ENST00000458063.1_RNA|ZNF32-AS1_ENST00000453284.1_RNA|ZNF32-AS2_ENST00000418966.1_RNA|ZNF32_ENST00000485351.1_5'Flank	NM_001005368.1	NP_001005368.1	P17041	ZNF32_HUMAN	zinc finger protein 32						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(1)|pancreas(1)|urinary_tract(1)	14		all_neural(218;0.0182)|Ovarian(717;0.0443)|Renal(717;0.157)		Lung(62;0.179)		TTCTCTTCAGGAAAGTGGTCA	0.468																																																	0								ENSG00000226245						27.0	29.0	28.0					10																	44139490		2203	4300	6503	ZNF32-AS1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U69645	CCDS7206.1	10q22-q25	2013-01-08	2006-05-11		ENSG00000169740	ENSG00000169740		"""Zinc fingers, C2H2-type"""	13095	protein-coding gene	gene with protein product		194539	"""zinc finger protein 32 (KOX 30)"""				Standard	XM_005271822		Approved	KOX30	uc001jbc.3	P17041	OTTHUMG00000018043	ENST00000395797.1:c.*8C>A	10.37:g.44139490G>T		Somatic	0	26	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	10	28.57	Q92951	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000395797.1	37	NULL	CCDS7206.1	10																																																																																			-	-		0.468	ZNF32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF32-AS1	protein_coding	OTTHUMT00000047723.1	G	NM_006973	-		44139490	+1	no_errors	ENST00000453284	ensembl	human	known	74_37	rna	SNP	0.050	T
FREM2	341640	genome.wustl.edu	37	13	39263770	39263770	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr13:39263770G>C	ENST00000280481.7	+	1	2505	c.2289G>C	c.(2287-2289)ttG>ttC	p.L763F		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	763					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CCTTGGTCTTGACTGACAACC	0.532																																																	0								ENSG00000150893						83.0	88.0	86.0					13																	39263770		2203	4300	6503	FREM2	SO:0001583	missense	0			-	HGNC	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.2289G>C	13.37:g.39263770G>C	ENSP00000280481:p.Leu763Phe	Somatic	0	16	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	22	18.52	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.L763F	ENST00000280481.7	37	c.2289	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	G	8.747	0.920371	0.17982	.	.	ENSG00000150893	ENST00000280481	T	0.39406	1.08	5.8	3.05	0.35203	.	0.072531	0.56097	N	0.000030	T	0.32675	0.0837	L	0.58428	1.81	0.54753	D	0.999988	B	0.21309	0.054	B	0.23852	0.049	T	0.08086	-1.0739	10	0.09084	T	0.74	.	6.7643	0.23558	0.0665:0.233:0.5812:0.1193	.	763	Q5SZK8	FREM2_HUMAN	F	763	ENSP00000280481:L763F	ENSP00000280481:L763F	L	+	3	2	FREM2	38161770	0.997000	0.39634	0.972000	0.41901	0.859000	0.49053	0.397000	0.20883	0.335000	0.23614	0.655000	0.94253	TTG	-	NULL		0.532	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	protein_coding	OTTHUMT00000044599.2	G	NM_207361	-		39263770	+1	no_errors	ENST00000280481	ensembl	human	known	74_37	missense	SNP	1.000	C
ZNF462	58499	genome.wustl.edu	37	9	109690005	109690005	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr9:109690005C>T	ENST00000277225.5	+	3	4101	c.3812C>T	c.(3811-3813)tCa>tTa	p.S1271L	ZNF462_ENST00000457913.1_Missense_Mutation_p.S1271L|ZNF462_ENST00000441147.2_Missense_Mutation_p.S116L			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1271					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						AGGCAGTGCTCATATACCTCC	0.522																																																	0								ENSG00000148143						196.0	200.0	198.0					9																	109690005		2203	4300	6503	ZNF462	SO:0001583	missense	0			-	HGNC	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.3812C>T	9.37:g.109690005C>T	ENSP00000277225:p.Ser1271Leu	Somatic	0	19	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	15	51.61	Q5T0T4|Q8N408	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S1271L	ENST00000277225.5	37	c.3812	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	C	26.3	4.722652	0.89298	.	.	ENSG00000148143	ENST00000277225;ENST00000457913;ENST00000374686;ENST00000441147	T;T;T;T	0.06687	3.27;3.69;3.83;3.83	5.35	5.35	0.76521	Zinc finger, C2H2-like (1);	0.250639	0.41500	D	0.000864	T	0.14917	0.0360	L	0.27053	0.805	0.80722	D	1	P;D	0.56287	0.804;0.975	B;P	0.59761	0.307;0.863	T	0.04537	-1.0944	10	0.33940	T	0.23	.	15.6579	0.77158	0.0:0.8532:0.1468:0.0	.	1271;1271	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	L	1271;1271;154;116	ENSP00000277225:S1271L;ENSP00000414570:S1271L;ENSP00000363818:S154L;ENSP00000397306:S116L	ENSP00000277225:S1271L	S	+	2	0	ZNF462	108729826	0.982000	0.34865	0.919000	0.36401	0.943000	0.58893	5.811000	0.69187	2.505000	0.84491	0.555000	0.69702	TCA	-	smart_Znf_C2H2-like		0.522	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	protein_coding	OTTHUMT00000053532.2	C	NM_021224	-		109690005	+1	no_errors	ENST00000457913	ensembl	human	known	74_37	missense	SNP	0.945	T
SEL1L2	80343	genome.wustl.edu	37	20	13850192	13850192	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr20:13850192delT	ENST00000284951.5	-	14	1286	c.1212delA	c.(1210-1212)aaafs	p.K404fs	SEL1L2_ENST00000378072.5_Frame_Shift_Del_p.K404fs|SEL1L2_ENST00000486903.1_5'UTR			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	404						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						CGGGCCACCCTTTTTCCGCAG	0.393																																																	0								ENSG00000101251						106.0	99.0	101.0					20																	13850192		1868	4113	5981	SEL1L2	SO:0001589	frameshift_variant	0				HGNC	AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.1212delA	20.37:g.13850192delT	ENSP00000284951:p.Lys404fs	Somatic	0	18	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	B4DXX5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Sel1-like,smart_Sel1-like	p.W406fs	ENST00000284951.5	37	c.1212		20																																																																																			-	smart_Sel1-like		0.393	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SEL1L2	protein_coding	OTTHUMT00000078067.3	T	NM_025229			13850192	-1	no_errors	ENST00000284951	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
OTOGL	283310	genome.wustl.edu	37	12	80663926	80663926	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr12:80663926C>T	ENST00000547103.1	+	22	2489	c.2483C>T	c.(2482-2484)cCc>cTc	p.P828L	OTOGL_ENST00000458043.2_Missense_Mutation_p.P828L			Q3ZCN5	OTOGL_HUMAN	otogelin-like	828					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TTAGCAACGCCCTCTGCTGGT	0.383											OREG0011204|OREG0022007	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)|type=TRANSCRIPTION FACTOR BINDING SITE|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip); Conservation found by scanning with a motif model																																					0								ENSG00000165899						100.0	97.0	98.0					12																	80663926		1928	4135	6063	OTOGL	SO:0001583	missense	0			-	HGNC	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.2483C>T	12.37:g.80663926C>T	ENSP00000447211:p.Pro828Leu	Somatic	0	44	0.00	1200	0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	34	46.03	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.P828L	ENST00000547103.1	37	c.2483		12	.	.	.	.	.	.	.	.	.	.	C	16.46	3.129502	0.56721	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.17528	2.28;2.27	5.22	5.22	0.72569	.	.	.	.	.	T	0.15305	0.0369	N	0.16307	0.4	0.45648	D	0.99857	.	.	.	.	.	.	T	0.09596	-1.0667	7	0.31617	T	0.26	.	12.1148	0.53860	0.0:0.9161:0.0:0.0839	.	.	.	.	L	828	ENSP00000447211:P828L;ENSP00000400895:P828L	ENSP00000400895:P828L	P	+	2	0	OTOGL	79188057	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	2.305000	0.43664	2.588000	0.87417	0.650000	0.86243	CCC	-	smart_VWC_out		0.383	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	protein_coding	OTTHUMT00000407438.1	C	NM_173591	-		80663926	+1	no_errors	ENST00000458043	ensembl	human	known	74_37	missense	SNP	1.000	T
DICER1	23405	genome.wustl.edu	37	14	95584038	95584038	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr14:95584038T>C	ENST00000526495.1	-	11	1721	c.1430A>G	c.(1429-1431)aAt>aGt	p.N477S	DICER1_ENST00000343455.3_Missense_Mutation_p.N477S|DICER1_ENST00000527414.1_Missense_Mutation_p.N477S|DICER1_ENST00000541352.1_Missense_Mutation_p.N477S|DICER1_ENST00000393063.1_Missense_Mutation_p.N477S			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	477	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Required for interaction with PRKRA and TARBP2.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		AGTTATGAAATTGCTACTGAT	0.363			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																														yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	0								ENSG00000100697						172.0	150.0	157.0					14																	95584038		2203	4300	6503	DICER1	SO:0001583	missense	0	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	-	HGNC	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.1430A>G	14.37:g.95584038T>C	ENSP00000437256:p.Asn477Ser	Somatic	0	30	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	28	44.00	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNase_III_dom,pfam_PAZ_dom,pfam_Dicer_dimerisation_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,superfamily_RNase_III_dom,superfamily_P-loop_NTPase,superfamily_PAZ_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_PAZ_dom,smart_RNase_III_dom,smart_dsRNA-bd_dom,pfscan_PAZ_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_dsRNA-bd_dom,pfscan_RNase_III_dom	p.N477S	ENST00000526495.1	37	c.1430	CCDS9931.1	14	.	.	.	.	.	.	.	.	.	.	T	18.78	3.697429	0.68386	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000541352	T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.8	5.17	5.17	0.71159	Helicase, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.47229	0.1434	N	0.04132	-0.27	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.44019	-0.9355	10	0.07644	T	0.81	-31.9186	15.3439	0.74320	0.0:0.0:0.0:1.0	.	477	Q9UPY3	DICER_HUMAN	S	477	ENSP00000343745:N477S;ENSP00000437256:N477S;ENSP00000376783:N477S;ENSP00000435681:N477S;ENSP00000444719:N477S	ENSP00000343745:N477S	N	-	2	0	DICER1	94653791	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.965000	0.87945	2.078000	0.62432	0.528000	0.53228	AAT	-	superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C		0.363	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	DICER1	protein_coding	OTTHUMT00000387997.1	T		-		95584038	-1	no_errors	ENST00000343455	ensembl	human	known	74_37	missense	SNP	1.000	C
ETV3L	440695	genome.wustl.edu	37	1	157062675	157062675	+	Silent	SNP	T	T	C			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr1:157062675T>C	ENST00000454449.2	-	5	1136	c.852A>G	c.(850-852)ccA>ccG	p.P284P		NM_001004341.2	NP_001004341.1	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	284	Pro-rich.				cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Hepatocellular(266;0.158)	Prostate(1639;0.184)				GAGGAAGCCCTGGAAAATGCC	0.627																																																	0								ENSG00000253831						28.0	31.0	30.0					1																	157062675		2203	4300	6503	ETV3L	SO:0001819	synonymous_variant	0			-	HGNC	AK131392	CCDS30893.1	1q23.1	2013-09-24	2008-09-12		ENSG00000253831	ENSG00000253831			33834	protein-coding gene	gene with protein product			"""ets variant gene 3-like"""				Standard	NM_001004341		Approved	FLJ16478	uc001fqq.2	Q6ZN32	OTTHUMG00000041325	ENST00000454449.2:c.852A>G	1.37:g.157062675T>C		Somatic	0	25	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	17	52.78		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.P284	ENST00000454449.2	37	c.852	CCDS30893.1	1																																																																																			-	NULL		0.627	ETV3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV3L	protein_coding	OTTHUMT00000099024.2	T	NM_001004341	-		157062675	-1	no_errors	ENST00000454449	ensembl	human	known	74_37	silent	SNP	0.003	C
KDELR3	11015	genome.wustl.edu	37	22	38870538	38870538	+	Silent	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr22:38870538G>T	ENST00000216014.4	+	2	274	c.102G>T	c.(100-102)ggG>ggT	p.G34G	KDELR3_ENST00000409006.3_Silent_p.G34G|KDELR3_ENST00000471268.1_3'UTR	NM_006855.2	NP_006846.1	O43731	ERD23_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3	34					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein retention in ER lumen (GO:0006621)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ER retention sequence binding (GO:0046923)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13	Melanoma(58;0.0286)					GCATCTCTGGGAAGAGCCAGA	0.562																																					Ovarian(11;103 529 24120 28493 32980)												0								ENSG00000100196						176.0	134.0	148.0					22																	38870538		2203	4300	6503	KDELR3	SO:0001819	synonymous_variant	0			-	HGNC	AL035081	CCDS13972.1, CCDS46705.1	22q13	2008-05-02			ENSG00000100196	ENSG00000100196			6306	protein-coding gene	gene with protein product							Standard	NM_006855		Approved		uc003avu.3	O43731	OTTHUMG00000153520	ENST00000216014.4:c.102G>T	22.37:g.38870538G>T		Somatic	0	36	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A8K7T7|B8ZZ26|O95557|Q4V750|Q4V767|Q53FP4|Q53GK1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ER_ret_rcpt,superfamily_Cyt_c_oxidase_su2_TM_dom,prints_ER_ret_rcpt	p.G34	ENST00000216014.4	37	c.102	CCDS13972.1	22																																																																																			-	pfam_ER_ret_rcpt,prints_ER_ret_rcpt		0.562	KDELR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELR3	protein_coding	OTTHUMT00000331474.1	G		-		38870538	+1	no_errors	ENST00000409006	ensembl	human	known	74_37	silent	SNP	1.000	T
TMEM132A	54972	genome.wustl.edu	37	11	60704298	60704298	+	Silent	SNP	C	C	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr11:60704298C>A	ENST00000453848.2	+	11	3149	c.2991C>A	c.(2989-2991)atC>atA	p.I997I	TMEM132A_ENST00000005286.4_Silent_p.I998I			Q24JP5	T132A_HUMAN	transmembrane protein 132A	997	Confers cellular localization similar to full-length form. {ECO:0000250}.					endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						AGGAGGACATCCGCTGGGTGT	0.627																																																	0								ENSG00000006118						33.0	41.0	39.0					11																	60704298		2203	4299	6502	TMEM132A	SO:0001819	synonymous_variant	0			-	HGNC	AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.2991C>A	11.37:g.60704298C>A		Somatic	0	43	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I998	ENST00000453848.2	37	c.2994	CCDS44618.1	11																																																																																			-	NULL		0.627	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	TMEM132A	protein_coding	OTTHUMT00000396352.1	C	NM_017870	-		60704298	+1	no_errors	ENST00000005286	ensembl	human	known	74_37	silent	SNP	1.000	A
SLX4	84464	genome.wustl.edu	37	16	3641103	3641103	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr16:3641103C>T	ENST00000294008.3	-	12	3176	c.2536G>A	c.(2536-2538)Gtg>Atg	p.V846M		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	846	Glu-rich.|Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						GCTTCATTCACGTTTTCTTGA	0.483								Direct reversal of damage																																									0								ENSG00000188827						156.0	157.0	156.0					16																	3641103		2197	4300	6497	SLX4	SO:0001583	missense	0			-	HGNC	AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.2536G>A	16.37:g.3641103C>T	ENSP00000294008:p.Val846Met	Somatic	0	65	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	62	41.51	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.V846M	ENST00000294008.3	37	c.2536	CCDS10506.2	16	.	.	.	.	.	.	.	.	.	.	C	8.241	0.806912	0.16467	.	.	ENSG00000188827	ENST00000294008	T	0.01725	4.67	5.57	2.59	0.31030	.	0.094472	0.44483	N	0.000448	T	0.02807	0.0084	L	0.52126	1.63	0.24605	N	0.993758	D	0.69078	0.997	P	0.45913	0.497	T	0.42137	-0.9469	10	0.49607	T	0.09	.	10.1114	0.42565	0.0:0.7828:0.0:0.2172	.	846	Q8IY92	SLX4_HUMAN	M	846	ENSP00000294008:V846M	ENSP00000294008:V846M	V	-	1	0	SLX4	3581104	0.945000	0.32115	0.527000	0.27925	0.154000	0.21943	1.596000	0.36718	0.727000	0.32360	-0.224000	0.12420	GTG	-	NULL		0.483	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLX4	protein_coding	OTTHUMT00000157301.3	C	NM_032444	-		3641103	-1	no_errors	ENST00000294008	ensembl	human	known	74_37	missense	SNP	0.462	T
PDXDC1	23042	genome.wustl.edu	37	16	15221350	15221350	+	Intron	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr16:15221350G>T	ENST00000535621.2	+	17	1587				RP11-1186N24.5_ENST00000605794.1_RNA|PKD1P6_ENST00000424133.2_RNA			Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1						carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ATCCAGAAGAGAAAGAGGATG	0.647																																																	0								ENSG00000250251																																			PKD1P6	SO:0001627	intron_variant	0			-	HGNC	AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000535621.2:c.1400-11386G>T	16.37:g.15221350G>T		Somatic	0	77	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	59	69	46.09	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000535621.2	37	NULL		16																																																																																			-	-		0.647	PDXDC1-016	PUTATIVE	basic	protein_coding	PKD1P6	protein_coding	OTTHUMT00000422421.1	G	NM_015027	-		15221350	-1	no_errors	ENST00000424133	ensembl	human	known	74_37	rna	SNP	0.912	T
GOLGA6C	653641	genome.wustl.edu	37	15	75562507	75562507	+	Silent	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr15:75562507C>T	ENST00000300576.5	+	18	2049	c.2049C>T	c.(2047-2049)atC>atT	p.I683I	RN7SL489P_ENST00000486185.2_RNA	NM_001164404.1	NP_001157876.1	A6NDK9	GOG6C_HUMAN	golgin A6 family, member C	683						Golgi apparatus (GO:0005794)				ovary(1)	1						TACAGCAGATCGTGCAGCTGT	0.592																																																	0								ENSG00000167195						45.0	58.0	54.0					15																	75562507		656	1575	2231	GOLGA6C	SO:0001819	synonymous_variant	0			-	HGNC		CCDS58388.1	15q24.2	2014-02-12	2010-02-12		ENSG00000167195	ENSG00000167195			32206	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6C"""				Standard	NM_001164404		Approved		uc002azs.2	A6NDK9	OTTHUMG00000172671	ENST00000300576.5:c.2049C>T	15.37:g.75562507C>T		Somatic	0	141	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	67	117	36.41		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I683	ENST00000300576.5	37	c.2049	CCDS58388.1	15																																																																																			-	NULL		0.592	GOLGA6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6C	protein_coding	OTTHUMT00000419797.1	C	NM_001164404	-		75562507	+1	no_errors	ENST00000300576	ensembl	human	known	74_37	silent	SNP	1.000	T
CYP4F2	8529	genome.wustl.edu	37	19	16008315	16008315	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr19:16008315G>A	ENST00000221700.6	-	2	202	c.107C>T	c.(106-108)gCc>gTc	p.A36V	CYP4F2_ENST00000011989.7_5'UTR	NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2											NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GTAGGTCCAGGCCAGGACATG	0.647																																																	0								ENSG00000186115						78.0	77.0	78.0					19																	16008315		2203	4300	6503	CYP4F2	SO:0001583	missense	0			-	HGNC	U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.107C>T	19.37:g.16008315G>A	ENSP00000221700:p.Ala36Val	Somatic	0	55	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	66	19.51		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.A36V	ENST00000221700.6	37	c.107	CCDS12336.1	19	.	.	.	.	.	.	.	.	.	.	g	13.91	2.377030	0.42105	.	.	ENSG00000186115	ENST00000221700	D	0.91464	-2.85	2.99	2.99	0.34606	.	0.664063	0.12414	U	0.471052	D	0.88213	0.6376	M	0.69823	2.125	0.58432	D	0.999999	B	0.10296	0.003	B	0.13407	0.009	T	0.82713	-0.0321	10	0.23891	T	0.37	.	9.6204	0.39719	0.0:0.0:1.0:0.0	.	36	P78329	CP4F2_HUMAN	V	36	ENSP00000221700:A36V	ENSP00000221700:A36V	A	-	2	0	CYP4F2	15869315	0.001000	0.12720	0.243000	0.24186	0.583000	0.36354	0.624000	0.24462	1.655000	0.50712	0.479000	0.44913	GCC	-	NULL		0.647	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4F2	protein_coding	OTTHUMT00000460372.3	G	NM_001082	-		16008315	-1	no_errors	ENST00000221700	ensembl	human	known	74_37	missense	SNP	0.791	A
OR5AR1	219493	genome.wustl.edu	37	11	56431291	56431291	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr11:56431291G>T	ENST00000302969.2	+	1	154	c.130G>T	c.(130-132)Ggt>Tgt	p.G44C		NM_001004730.1	NP_001004730.1	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR, member 1 (gene/pseudogene)	44						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(12)|prostate(1)|skin(3)|stomach(1)	26						GGGGAATATTGGTATGATTAT	0.448																																																	0								ENSG00000172459						276.0	271.0	273.0					11																	56431291		2201	4296	6497	OR5AR1	SO:0001583	missense	0			-	HGNC	AB065740	CCDS31535.1	11q11	2013-10-10	2013-10-10		ENSG00000172459	ENSG00000172459		"""GPCR / Class A : Olfactory receptors"""	15260	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AR, member 1"""				Standard	NM_001004730		Approved		uc010rjm.2	Q8NGP9	OTTHUMG00000154213	ENST00000302969.2:c.130G>T	11.37:g.56431291G>T	ENSP00000302639:p.Gly44Cys	Somatic	0	49	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q6IF61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G44C	ENST00000302969.2	37	c.130	CCDS31535.1	11	.	.	.	.	.	.	.	.	.	.	G	9.482	1.098528	0.20552	.	.	ENSG00000172459	ENST00000302969	T	0.01981	4.52	5.25	4.34	0.51931	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000170	T	0.04272	0.0118	L	0.54863	1.705	0.09310	N	1	D	0.57257	0.979	P	0.47206	0.541	T	0.29761	-1.0001	10	0.72032	D	0.01	.	9.5071	0.39053	0.1593:0.0:0.8407:0.0	.	44	Q8NGP9	O5AR1_HUMAN	C	44	ENSP00000302639:G44C	ENSP00000302639:G44C	G	+	1	0	OR5AR1	56187867	0.000000	0.05858	0.479000	0.27329	0.055000	0.15305	0.033000	0.13754	1.454000	0.47793	0.637000	0.83480	GGT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.448	OR5AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AR1	protein_coding	OTTHUMT00000334434.1	G	NM_001004730	-		56431291	+1	no_errors	ENST00000302969	ensembl	human	known	74_37	missense	SNP	0.010	T
ARAP1	116985	genome.wustl.edu	37	11	72410086	72410086	+	Silent	SNP	C	C	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr11:72410086C>A	ENST00000393609.3	-	18	2707	c.2505G>T	c.(2503-2505)gcG>gcT	p.A835A	ARAP1-AS2_ENST00000500163.2_RNA|ARAP1_ENST00000455638.2_Silent_p.A835A|ARAP1_ENST00000429686.1_Silent_p.A529A|ARAP1_ENST00000359373.5_Silent_p.A835A|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000334211.8_Silent_p.A590A|ARAP1_ENST00000426523.1_Silent_p.A590A|ARAP1_ENST00000393605.3_Silent_p.A595A	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	835	PH 3. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						GAGCCTGCTCCGCACTCTCCA	0.592																																					Ovarian(102;1198 1520 13195 17913 37529)												0								ENSG00000186635						268.0	216.0	234.0					11																	72410086		2200	4293	6493	ARAP1	SO:0001819	synonymous_variant	0			-	HGNC	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.2505G>T	11.37:g.72410086C>A		Somatic	0	29	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_Ras-assoc,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.A835	ENST00000393609.3	37	c.2505	CCDS41687.1	11	.	.	.	.	.	.	.	.	.	.	C	0.910	-0.719296	0.03182	.	.	ENSG00000186635	ENST00000340247	.	.	.	5.55	-6.76	0.01732	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	1.5456	0.02564	0.1786:0.1371:0.2529:0.4314	.	.	.	.	X	624	.	ENSP00000345207:G624X	G	-	1	0	ARAP1	72087734	0.000000	0.05858	0.072000	0.20136	0.044000	0.14063	-2.517000	0.00954	-0.919000	0.03803	-0.448000	0.05591	GGA	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.592	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARAP1	protein_coding	OTTHUMT00000347428.1	C	NM_001040118	-		72410086	-1	no_errors	ENST00000393609	ensembl	human	known	74_37	silent	SNP	0.682	A
STAT2	6773	genome.wustl.edu	37	12	56749495	56749495	+	Silent	SNP	T	T	C	rs112826194	byFrequency	TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr12:56749495T>C	ENST00000314128.4	-	4	401	c.378A>G	c.(376-378)caA>caG	p.Q126Q	STAT2_ENST00000557235.1_Silent_p.Q122Q|STAT2_ENST00000418572.2_Silent_p.Q122Q			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	126					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						TCCTCACCAATTGGGCCCTCT	0.473																																																	0								ENSG00000170581	T	,	8,4398	14.3+/-33.2	0,8,2195	126.0	131.0	129.0		378,366	-0.1	0.0	12	dbSNP_132	129	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	STAT2	NM_005419.3,NM_198332.1	,	0,9,6494	CC,CT,TT		0.0116,0.1816,0.0692	,	126/852,122/848	56749495	9,12997	2203	4300	6503	STAT2	SO:0001819	synonymous_variant	0			-	HGNC	BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.378A>G	12.37:g.56749495T>C		Somatic	0	34	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	1	94.12	B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_STAT2_C,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.Q126	ENST00000314128.4	37	c.378	CCDS8917.1	12																																																																																			-	superfamily_STAT_TF_prot_interaction		0.473	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT2	protein_coding	OTTHUMT00000410277.1	T	NM_005419	rs112826194		56749495	-1	no_errors	ENST00000314128	ensembl	human	known	74_37	silent	SNP	0.144	C
KLHL10	317719	genome.wustl.edu	37	17	40003538	40003538	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr17:40003538G>T	ENST00000293303.4	+	4	1481	c.1328G>T	c.(1327-1329)gGa>gTa	p.G443V	RP11-156E6.1_ENST00000560400.1_RNA	NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	443					cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				GGGTTTAATGGAAACGAGTGC	0.433																																																	0								ENSG00000161594						141.0	130.0	134.0					17																	40003538		1938	4147	6085	KLHL10	SO:0001583	missense	0			-	HGNC	AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.1328G>T	17.37:g.40003538G>T	ENSP00000293303:p.Gly443Val	Somatic	0	34	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q6NW28|Q96MC0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.G443V	ENST00000293303.4	37	c.1328	CCDS42340.1	17	.	.	.	.	.	.	.	.	.	.	G	25.3	4.624789	0.87560	.	.	ENSG00000161594	ENST00000293303	T	0.71341	-0.56	5.17	5.17	0.71159	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.86197	0.5875	M	0.87758	2.905	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87623	0.2511	9	.	.	.	.	17.4056	0.87472	0.0:0.0:1.0:0.0	.	443	Q6JEL2	KLH10_HUMAN	V	443	ENSP00000293303:G443V	.	G	+	2	0	KLHL10	37257064	1.000000	0.71417	0.938000	0.37757	0.985000	0.73830	5.044000	0.64214	2.689000	0.91719	0.491000	0.48974	GGA	-	pfam_Kelch_1,pfam_Kelch_2,smart_Kelch_1,pirsf_Kelch-like_gigaxonin		0.433	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL10	protein_coding	OTTHUMT00000326535.1	G	NM_152467	-		40003538	+1	no_errors	ENST00000293303	ensembl	human	known	74_37	missense	SNP	1.000	T
TRMT13	54482	genome.wustl.edu	37	1	100598848	100598848	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr1:100598848G>T	ENST00000370141.2	+	1	130	c.124G>T	c.(124-126)Ggt>Tgt	p.G42C	TRMT13_ENST00000370139.1_Missense_Mutation_p.G11C|SASS6_ENST00000287482.5_5'Flank|SASS6_ENST00000535161.1_5'Flank|SASS6_ENST00000462159.1_5'Flank|TRMT13_ENST00000370143.1_Missense_Mutation_p.G42C	NM_019083.2	NP_061956.2	Q9NUP7	TRM13_HUMAN	tRNA methyltransferase 13 homolog (S. cerevisiae)	42					tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										AAGATTTTGTGGTGAACACGC	0.567																																																	0								ENSG00000122435						72.0	69.0	70.0					1																	100598848		2203	4300	6503	TRMT13	SO:0001583	missense	0			-	HGNC	BC075811	CCDS765.1	1p21.2	2012-06-07	2012-06-07	2012-06-07	ENSG00000122435	ENSG00000122435			25502	protein-coding gene	gene with protein product			"""coiled-coil domain containing 76"""	CCDC76		11799066	Standard	NM_019083		Approved	FLJ10287, FLJ11219	uc001dsv.3	Q9NUP7	OTTHUMG00000010841	ENST00000370141.2:c.124G>T	1.37:g.100598848G>T	ENSP00000359160:p.Gly42Cys	Somatic	0	24	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q5VVL0|Q9NW65	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Methyltransferase_TRM13,pfam_Znf_CCCH-type_TRM13,pfam_TRM13/UPF0224_CHHC_Znf_dom	p.G42C	ENST00000370141.2	37	c.124	CCDS765.1	1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.571612	0.86542	.	.	ENSG00000122435	ENST00000370143;ENST00000370141;ENST00000370139	T;T;T	0.58506	0.7;0.59;0.33	4.99	4.99	0.66335	Zinc finger, CCCH-type, TRM13 (1);	0.000000	0.85682	D	0.000000	T	0.76011	0.3928	M	0.86502	2.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.77981	-0.2383	10	0.48119	T	0.1	-13.6717	18.0698	0.89403	0.0:0.0:1.0:0.0	.	42;42	B4DQS9;Q9NUP7	.;TRM13_HUMAN	C	42;42;11	ENSP00000359162:G42C;ENSP00000359160:G42C;ENSP00000359158:G11C	ENSP00000359158:G11C	G	+	1	0	CCDC76	100371436	1.000000	0.71417	0.981000	0.43875	0.733000	0.41908	5.967000	0.70403	2.588000	0.87417	0.650000	0.86243	GGT	-	pfam_Znf_CCCH-type_TRM13		0.567	TRMT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT13	protein_coding	OTTHUMT00000029919.1	G	NM_019083	-		100598848	+1	no_errors	ENST00000370141	ensembl	human	known	74_37	missense	SNP	1.000	T
FAM95B1	100133036	genome.wustl.edu	37	9	42472249	42472249	+	Intron	SNP	C	C	G	rs371849497		TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr9:42472249C>G	ENST00000421686.2	+	11	1457				FAM95B1_ENST00000592873.1_RNA																							tacccctggtcccttgctctg	0.547																																																	0								ENSG00000223839																																			FAM95B1	SO:0001627	intron_variant	0			-	HGNC																												ENST00000421686.2:c.224-1687C>G	9.37:g.42472249C>G		Somatic	0	26	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	31	13.89		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000421686.2	37	NULL		9																																																																																			-	-		0.547	RP11-146D12.2-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	FAM95B1	protein_coding	OTTHUMT00000129789.5	C		-		42472249	+1	no_errors	ENST00000592873	ensembl	human	known	74_37	rna	SNP	0.019	G
NRCAM	4897	genome.wustl.edu	37	7	107788355	107788355	+	3'UTR	SNP	A	A	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr7:107788355A>T	ENST00000379028.3	-	0	6385				NRCAM_ENST00000351718.4_3'UTR|NRCAM_ENST00000522550.2_5'UTR|NRCAM_ENST00000413765.2_3'UTR			Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule						angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						TTCTCCCAAAATATTGGCAAA	0.348																																																	0								ENSG00000091129																																			NRCAM	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000379028.3:c.*2000T>A	7.37:g.107788355A>T		Somatic	0	58	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	31	43.64	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000379028.3	37	NULL	CCDS47686.1	7																																																																																			-	-		0.348	NRCAM-202	KNOWN	basic|appris_principal|CCDS	protein_coding	NRCAM	protein_coding		A	NM_001037132	-		107788355	-1	no_errors	ENST00000522550	ensembl	human	known	74_37	rna	SNP	0.000	T
SREBF2	6721	genome.wustl.edu	37	22	42276780	42276780	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr22:42276780C>A	ENST00000361204.4	+	10	1988	c.1822C>A	c.(1822-1824)Ctg>Atg	p.L608M		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	608					cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						GGGCCGGGCACTGCCCACCTC	0.587																																																	0								ENSG00000198911						48.0	53.0	51.0					22																	42276780		2203	4300	6503	SREBF2	SO:0001583	missense	0			-	HGNC	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.1822C>A	22.37:g.42276780C>A	ENSP00000354476:p.Leu608Met	Somatic	0	61	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	49	27.94	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.L608M	ENST00000361204.4	37	c.1822	CCDS14023.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.14|19.14	3.769467|3.769467	0.69992|0.69992	.|.	.|.	ENSG00000198911|ENSG00000198911	ENST00000361204;ENST00000457567|ENST00000444813	T|.	0.29655|.	1.56|.	4.95|4.95	4.95|4.95	0.65309|0.65309	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.65322|0.65322	0.2680|0.2680	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	D|.	0.53312|.	0.959|.	P|.	0.47744|.	0.556|.	T|T	0.68697|0.68697	-0.5340|-0.5340	10|6	0.51188|0.87932	T|D	0.08|0	-12.7337|-12.7337	11.654|11.654	0.51306|0.51306	0.0:0.918:0.0:0.082|0.0:0.918:0.0:0.082	.|.	608|.	Q12772|.	SRBP2_HUMAN|.	M|N	608|641	ENSP00000354476:L608M|.	ENSP00000354476:L608M|ENSP00000395728:T641N	L|T	+|+	1|2	2|0	SREBF2|SREBF2	40606726|40606726	1.000000|1.000000	0.71417|0.71417	0.966000|0.966000	0.40874|0.40874	0.862000|0.862000	0.49288|0.49288	4.935000|4.935000	0.63498|0.63498	2.292000|2.292000	0.77174|0.77174	0.478000|0.478000	0.44815|0.44815	CTG|ACT	-	NULL		0.587	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF2	protein_coding	OTTHUMT00000321956.1	C	NM_004599	-		42276780	+1	no_errors	ENST00000361204	ensembl	human	known	74_37	missense	SNP	0.999	A
CDK5RAP3	80279	genome.wustl.edu	37	17	46053334	46053334	+	Silent	SNP	A	A	G	rs202125432	byFrequency	TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr17:46053334A>G	ENST00000338399.4	+	8	859	c.753A>G	c.(751-753)gaA>gaG	p.E251E	RP11-6N17.9_ENST00000582262.1_RNA|CDK5RAP3_ENST00000536708.2_Silent_p.E276E	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3	251					brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)	p.E251E(1)		NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						CTGTGGTGGAACGACCCCACC	0.602																																																	1	Substitution - coding silent(1)	prostate(1)						ENSG00000108465																																			CDK5RAP3	SO:0001819	synonymous_variant	0			-	HGNC	AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.753A>G	17.37:g.46053334A>G		Somatic	0	29	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF773	p.E251	ENST00000338399.4	37	c.753	CCDS42356.1	17																																																																																			-	pfam_DUF773		0.602	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK5RAP3	protein_coding	OTTHUMT00000442913.1	A	NM_176096	rs202125432		46053334	+1	no_errors	ENST00000338399	ensembl	human	known	74_37	silent	SNP	1.000	G
ANKRD30BL	554226	genome.wustl.edu	37	2	133014623	133014623	+	Intron	SNP	C	C	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr2:133014623C>A	ENST00000470729.1	-	1	441				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						CCGCAGCGACCCGCCTAGGAT	0.692																																																	0								ENSG00000221288						26.0	45.0	39.0					2																	133014623		1553	3578	5131	MIR663B	SO:0001627	intron_variant	0			-	HGNC			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.984+478G>T	2.37:g.133014623C>A		Somatic	0	23	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	42	16.00	B8ZZL7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			-	-		0.692	ANKRD30BL-002	KNOWN	basic	processed_transcript	MIR663B	protein_coding	OTTHUMT00000331354.1	C	NR_027019	-		133014623	-1	no_errors	ENST00000408361	ensembl	human	known	74_37	rna	SNP	0.005	A
IDI2-AS1	55853	genome.wustl.edu	37	10	1081791	1081792	+	RNA	INS	-	-	CCTGGCCCA	rs146706331	byFrequency	TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr10:1081791_1081792insCCTGGCCCA	ENST00000428780.2	+	0	154_155				IDI2-AS1_ENST00000420381.1_RNA|IDI2-AS1_ENST00000434470.1_RNA|IDI2-AS1_ENST00000437374.1_RNA|IDI2-AS1_ENST00000536039.1_RNA	NR_024628.1		Q9NZ38	IDAS1_HUMAN	IDI2 antisense RNA 1																		CTGTGCCACTGcctggcccacc	0.545														817	0.163139	0.3041	0.1383	5008	,	,		17054	0.1121		0.1322	False		,,,				2504	0.0746																0								ENSG00000232656																																			IDI2-AS1			0				HGNC	AF220183		10p15.3	2014-01-15	2012-08-15	2010-11-25	ENSG00000232656	ENSG00000232656		"""Long non-coding RNAs"""	30885	non-coding RNA	RNA, long non-coding		615391	"""chromosome 10 open reading frame 110"", ""IDI2 antisense RNA (non-protein coding)"", ""IDI2 antisense RNA 1 (non-protein coding)"""	C10orf110, IDI2-AS		24036268	Standard	NR_024628		Approved	HT009, Em:AC022536.4	uc001ifw.3	Q9NZ38	OTTHUMG00000017535		10.37:g.1081792_1081800dupCCTGGCCCA		Somatic	NA	NA	NA		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000428780.2	37	NULL		10																																																																																			-	-		0.545	IDI2-AS1-002	KNOWN	basic	antisense	IDI2-AS1	antisense	OTTHUMT00000046403.1	-	NR_024628			1081792	+1	no_errors	ENST00000420381	ensembl	human	known	74_37	rna	INS	0.016:0.021	CCTGGCCCA
MEFV	4210	genome.wustl.edu	37	16	3299599	3299599	+	Silent	SNP	C	C	T	rs11466022	byFrequency	TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr16:3299599C>T	ENST00000219596.1	-	3	1131	c.1092G>A	c.(1090-1092)ccG>ccA	p.P364P	MEFV_ENST00000339854.4_Silent_p.P184P|MEFV_ENST00000536379.1_Silent_p.P153P|MEFV_ENST00000541159.1_Silent_p.P153P	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	364					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						TTAGGCTTCCCGGGCTCTTCC	0.647																																																	0								ENSG00000103313						37.0	35.0	36.0					16																	3299599		2197	4300	6497	MEFV	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1092G>A	16.37:g.3299599C>T		Somatic	0	38	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	27	53.45	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DAPIN,pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_DEATH-like_dom,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_DAPIN,pfscan_Znf_B-box,prints_Butyrophylin	p.P364	ENST00000219596.1	37	c.1092	CCDS10498.1	16																																																																																			-	NULL		0.647	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEFV	protein_coding	OTTHUMT00000251464.1	C	NM_000243	rs11466022		3299599	-1	no_errors	ENST00000219596	ensembl	human	known	74_37	silent	SNP	0.000	T
GRM4	2914	genome.wustl.edu	37	6	34100761	34100761	+	Silent	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr6:34100761G>T	ENST00000538487.2	-	2	956	c.513C>A	c.(511-513)ctC>ctA	p.L171L	GRM4_ENST00000374181.4_Silent_p.L171L|GRM4_ENST00000374177.3_Intron	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	171					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						TGACCTTGAAGAGGCGAAGGA	0.632																																																	0								ENSG00000124493						66.0	58.0	61.0					6																	34100761		2203	4300	6503	GRM4	SO:0001819	synonymous_variant	0			-	HGNC	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.513C>A	6.37:g.34100761G>T		Somatic	0	29	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	17	19.05	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_4,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_GABA_rcpt_B	p.L171	ENST00000538487.2	37	c.513	CCDS4787.1	6																																																																																			-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3,prints_GPCR_3_GABA_rcpt_B		0.632	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM4	protein_coding	OTTHUMT00000040213.2	G		-		34100761	-1	no_errors	ENST00000374181	ensembl	human	known	74_37	silent	SNP	1.000	T
MSC-AS1	100132891	genome.wustl.edu	37	8	72744891	72744891	+	Intron	SNP	A	A	G			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr8:72744891A>G	ENST00000521467.1	+	1	49				AC104012.1_ENST00000390739.2_RNA																lung(1)	1						taatggcaaaaacctcagtaa	0.378																																																	0								ENSG00000264576																																			AC104012.1	SO:0001627	intron_variant	0			-	Clone_based_ensembl_gene																												ENST00000521467.1:c.-91+4441A>G	8.37:g.72744891A>G		Somatic	0	31	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	21	51.16		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000521467.1	37	NULL		8																																																																																			-	-		0.378	RP11-383H13.1-006	PUTATIVE	basic|appris_candidate	protein_coding	ENSG00000264576	protein_coding	OTTHUMT00000379051.1	A		-		72744891	-1	no_errors	ENST00000390739	ensembl	human	novel	74_37	rna	SNP	0.003	G
CHRDL2	25884	genome.wustl.edu	37	11	74414359	74414359	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr11:74414359T>C	ENST00000376332.3	-	8	1433	c.937A>G	c.(937-939)Att>Gtt	p.I313V	CHRDL2_ENST00000263671.5_Missense_Mutation_p.I313V|CHRDL2_ENST00000534159.1_5'UTR	NM_001278473.1	NP_001265402.1	Q6WN34	CRDL2_HUMAN	chordin-like 2	313	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cartilage development (GO:0051216)|cell differentiation (GO:0030154)|ossification (GO:0001503)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)|skin(2)	15	Hepatocellular(1;0.098)					CCTGGGCAAATCTTGCAGCAC	0.637																																																	0								ENSG00000054938						49.0	43.0	45.0					11																	74414359		2200	4293	6493	CHRDL2	SO:0001583	missense	0			-	HGNC	AL110168	CCDS8234.1, CCDS60893.1	11q13.4	2013-09-20			ENSG00000054938	ENSG00000054938			24168	protein-coding gene	gene with protein product		613127				12853144, 12975309	Standard	NM_015424		Approved	BNF1	uc001ovh.3	Q6WN34	OTTHUMG00000165623	ENST00000376332.3:c.937A>G	11.37:g.74414359T>C	ENSP00000365510:p.Ile313Val	Somatic	0	43	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	32	46.67	A5PKU9|Q6WN30|Q6WN31|Q6WN32|Q7Z5J3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_C,smart_VWF_C,pfscan_VWF_C	p.I313V	ENST00000376332.3	37	c.937		11	.	.	.	.	.	.	.	.	.	.	T	2.379	-0.342549	0.05243	.	.	ENSG00000054938	ENST00000263671;ENST00000376332;ENST00000376323;ENST00000393519	T;T	0.62498	0.02;0.02	5.75	4.62	0.57501	von Willebrand factor, type C (4);	0.164300	0.53938	N	0.000054	T	0.40145	0.1105	N	0.17312	0.475	0.40337	D	0.978998	B;B	0.26845	0.153;0.161	B;B	0.27262	0.078;0.075	T	0.23547	-1.0185	10	0.06099	T	0.92	-3.5298	9.8464	0.41030	0.0:0.0809:0.0:0.9191	.	313;313	Q6WN34;Q6WN34-2	CRDL2_HUMAN;.	V	313;313;199;197	ENSP00000263671:I313V;ENSP00000365510:I313V	ENSP00000263671:I313V	I	-	1	0	CHRDL2	74092007	1.000000	0.71417	0.993000	0.49108	0.149000	0.21700	1.171000	0.31896	1.003000	0.39130	0.459000	0.35465	ATT	-	pfam_VWF_C,smart_VWF_C,pfscan_VWF_C		0.637	CHRDL2-002	KNOWN	basic	protein_coding	CHRDL2	protein_coding	OTTHUMT00000385391.1	T		-		74414359	-1	no_errors	ENST00000263671	ensembl	human	known	74_37	missense	SNP	1.000	C
EIF1	10209	genome.wustl.edu	37	17	39845149	39845162	+	5'UTR	DEL	GAGCCGCCGCCGAG	GAGCCGCCGCCGAG	-			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	GAGCCGCCGCCGAG	GAGCCGCCGCCGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr17:39845149_39845162delGAGCCGCCGCCGAG	ENST00000469257.1	+	0	5_18				EIF1_ENST00000310837.4_3'UTR|EIF1_ENST00000591776.1_5'UTR|JUP_ENST00000540235.1_Intron			P41567	EIF1_HUMAN	eukaryotic translation initiation factor 1						dosage compensation by inactivation of X chromosome (GO:0009048)|regulation of translational initiation (GO:0006446)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(2)|skin(1)	5		Breast(137;0.000307)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			CCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAG	0.706																																					Pancreas(176;1692 2837 16734 17588)												0								ENSG00000173812																																			EIF1	SO:0001623	5_prime_UTR_variant	0				HGNC	AF083441	CCDS11403.1	17q21.2	2006-02-02			ENSG00000173812	ENSG00000173812			3249	protein-coding gene	gene with protein product						7904817, 10347211	Standard	NM_005801		Approved	EIF-1, ISO1, A121, SUI1, EIF1A	uc002hxj.3	P41567	OTTHUMG00000133492	ENST00000469257.1:c.-129GAGCCGCCGCCGAG>-	17.37:g.39845149_39845162delGAGCCGCCGCCGAG		Somatic	NA	NA	NA		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q9UNQ9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000469257.1	37	NULL	CCDS11403.1	17																																																																																			-	-		0.706	EIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF1	protein_coding	OTTHUMT00000257390.1	GAGCCGCCGCCGAG	NM_005801			39845162	+1	no_errors	ENST00000310837	ensembl	human	known	74_37	rna	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
GSAP	54103	genome.wustl.edu	37	7	76941178	76941178	+	Missense_Mutation	SNP	T	T	A	rs201644766		TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr7:76941178T>A	ENST00000257626.7	-	30	2531	c.2453A>T	c.(2452-2454)gAt>gTt	p.D818V	GSAP_ENST00000441833.2_Missense_Mutation_p.D139V|GSAP_ENST00000440473.1_5'Flank	NM_017439.3	NP_059135.2	A4D1B5	GSAP_HUMAN	gamma-secretase activating protein	818					positive regulation of beta-amyloid formation (GO:1902004)|regulation of proteolysis (GO:0030162)	trans-Golgi network (GO:0005802)	beta-amyloid binding (GO:0001540)										GGACTCTATATCTGTCAGAAT	0.408																																																	0								ENSG00000186088						77.0	76.0	76.0					7																	76941178		1856	4097	5953	GSAP	SO:0001583	missense	0			-	HGNC		CCDS34672.2	7q11.23	2013-04-05	2013-04-05	2013-04-05	ENSG00000186088	ENSG00000186088			28042	protein-coding gene	gene with protein product		613552	"""pigeon homolog (Drosophila)"""	PION		20811458	Standard	NM_017439		Approved	LOC54103	uc003ugf.3	A4D1B5	OTTHUMG00000150504	ENST00000257626.7:c.2453A>T	7.37:g.76941178T>A	ENSP00000257626:p.Asp818Val	Somatic	0	10	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53	A4D1B6|Q3MJC0|Q8ND73|Q9UMH3|Q9Y4L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D818V	ENST00000257626.7	37	c.2453	CCDS34672.2	7	.	.	.	.	.	.	.	.	.	.	T	12.14	1.848722	0.32699	.	.	ENSG00000186088	ENST00000257626;ENST00000441833	T	0.21543	2.0	5.11	1.2	0.21068	.	0.449553	0.27105	N	0.020907	T	0.15176	0.0366	L	0.47716	1.5	0.19300	N	0.999978	P	0.37276	0.589	B	0.35813	0.211	T	0.13469	-1.0508	10	0.62326	D	0.03	.	4.3857	0.11316	0.0:0.1776:0.1691:0.6533	.	818	A4D1B5	GSAP_HUMAN	V	818;139	ENSP00000257626:D818V	ENSP00000257626:D818V	D	-	2	0	PION	76779114	0.643000	0.27269	0.017000	0.16124	0.992000	0.81027	0.951000	0.29135	0.117000	0.18138	0.454000	0.30748	GAT	-	NULL		0.408	GSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSAP	protein_coding	OTTHUMT00000318672.2	T	NM_017439	-		76941178	-1	no_errors	ENST00000257626	ensembl	human	known	74_37	missense	SNP	0.048	A
ANKRD30BL	554226	genome.wustl.edu	37	2	133015485	133015485	+	5'UTR	SNP	C	C	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr2:133015485C>A	ENST00000470729.1	-	0	57				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						AACCCACACACAACCTGTCGG	0.697																																																	0								ENSG00000163046						58.0	58.0	58.0					2																	133015485		692	1591	2283	ANKRD30BL	SO:0001623	5_prime_UTR_variant	0			-	HGNC			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-1368G>T	2.37:g.133015485C>A		Somatic	0	52	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	83	10.75	B8ZZL7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			-	-		0.697	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	protein_coding	OTTHUMT00000331354.1	C	NR_027019	-		133015485	-1	no_errors	ENST00000470729	ensembl	human	known	74_37	rna	SNP	0.001	A
KDM4C	23081	genome.wustl.edu	37	9	6849598	6849598	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr9:6849598C>A	ENST00000381309.3	+	5	1092	c.527C>A	c.(526-528)cCa>cAa	p.P176Q	KDM4C_ENST00000536108.1_5'UTR|KDM4C_ENST00000543771.1_Missense_Mutation_p.P176Q|KDM4C_ENST00000489243.1_3'UTR|KDM4C_ENST00000381306.3_Missense_Mutation_p.P176Q|KDM4C_ENST00000535193.1_Missense_Mutation_p.P198Q|KDM4C_ENST00000442236.2_5'UTR	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	176	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						GTAAATACCCCATATCTCTAT	0.448																																																	0								ENSG00000107077						224.0	199.0	208.0					9																	6849598		2203	4300	6503	KDM4C	SO:0001583	missense	0			-	HGNC	AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.527C>A	9.37:g.6849598C>A	ENSP00000370710:p.Pro176Gln	Somatic	0	32	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,superfamily_Chorismate_mutase_type_II,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.P176Q	ENST00000381309.3	37	c.527	CCDS6471.1	9	.	.	.	.	.	.	.	.	.	.	C	27.5	4.837299	0.91117	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000381309;ENST00000381306	T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64	5.43	5.43	0.79202	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.000000	0.85682	D	0.000000	D	0.88466	0.6444	M	0.92367	3.3	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.998;0.999;1.0;1.0	D	0.90966	0.4816	10	0.87932	D	0	-27.8636	19.2483	0.93912	0.0:1.0:0.0:0.0	.	176;176;198;176;176	F5H347;B4E1Y4;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;KDM4C_HUMAN;.	Q	198;176;176;176	ENSP00000442382:P198Q;ENSP00000445427:P176Q;ENSP00000370710:P176Q;ENSP00000370707:P176Q	ENSP00000370707:P176Q	P	+	2	0	KDM4C	6839598	1.000000	0.71417	0.991000	0.47740	0.909000	0.53808	7.750000	0.85110	2.540000	0.85666	0.491000	0.48974	CCA	-	smart_JmjC_dom,pfscan_JmjC_dom		0.448	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4C	protein_coding	OTTHUMT00000051692.1	C	NM_015061	-		6849598	+1	no_errors	ENST00000381309	ensembl	human	known	74_37	missense	SNP	1.000	A
EVPLL	645027	genome.wustl.edu	37	17	18291344	18291345	+	Intron	INS	-	-	TATATATATATACACATATATG			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr17:18291344_18291345insTATATATATATACACATATATG	ENST00000399134.4	+	10	1234				RP1-37N7.1_ENST00000579352.1_RNA|EVPLL_ENST00000583003.1_Intron	NM_001145127.1	NP_001138599.1	A8MZ36	EVPLL_HUMAN	envoplakin-like											NS(1)|endometrium(1)|large_intestine(1)|lung(2)	5						CTCTCTCCatatatatatatat	0.396																																																	0								ENSG00000264177																																			RP1-37N7.1	SO:0001627	intron_variant	0				Clone_based_vega_gene		CCDS45626.1	17p11.2	2009-08-25			ENSG00000214860	ENSG00000214860			35236	protein-coding gene	gene with protein product							Standard	NM_001145127		Approved		uc002gte.3	A8MZ36	OTTHUMG00000059095	ENST00000399134.4:c.877-188->TATATATATATACACATATATG	17.37:g.18291344_18291345insTATATATATATACACATATATG		Somatic	NA	NA	NA		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DPD4	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000399134.4	37	NULL	CCDS45626.1	17																																																																																			-	-		0.396	EVPLL-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LOC101928729	protein_coding	OTTHUMT00000130836.2	-	NM_001145127			18291345	-1	no_errors	ENST00000579352	ensembl	human	known	74_37	rna	INS	0.001:0.001	TATATATATATACACATATATG
RGMB	285704	genome.wustl.edu	37	5	98115393	98115393	+	Silent	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr5:98115393C>T	ENST00000513185.1	+	2	682	c.246C>T	c.(244-246)tgC>tgT	p.C82C	RGMB_ENST00000504776.1_3'UTR|RGMB_ENST00000308234.7_Silent_p.C123C			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	82					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		CTGAGTTTTGCAAGGCCTTGC	0.542																																																	0								ENSG00000174136						127.0	128.0	127.0					5																	98115393		2002	4162	6164	RGMB	SO:0001819	synonymous_variant	0			-	HGNC	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.246C>T	5.37:g.98115393C>T		Somatic	0	27	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	D6R9A0|Q8NC92	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RGM_C,pfam_RGM_N	p.C123	ENST00000513185.1	37	c.369		5																																																																																			-	pfam_RGM_N		0.542	RGMB-003	KNOWN	basic	protein_coding	RGMB	protein_coding	OTTHUMT00000370308.1	C	NM_173670	-		98115393	+1	no_errors	ENST00000308234	ensembl	human	known	74_37	silent	SNP	1.000	T
SDC1	6382	genome.wustl.edu	37	2	20423047	20423048	+	Intron	INS	-	-	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr2:20423047_20423048insA	ENST00000254351.4	-	1	311				SDC1_ENST00000482879.1_5'UTR|SDC1_ENST00000403076.1_Intron|SDC1_ENST00000381150.1_Intron	NM_002997.4	NP_002988	P18827	SDC1_HUMAN	syndecan 1						canonical Wnt signaling pathway (GO:0060070)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|myoblast development (GO:0048627)|odontogenesis (GO:0042476)|phototransduction, visible light (GO:0007603)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to toxic substance (GO:0009636)|retinoid metabolic process (GO:0001523)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|striated muscle cell development (GO:0055002)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|skin(2)	21	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)			OV - Ovarian serous cystadenocarcinoma(76;0.221)		ACTCTGTAAAGAAAAAAAAAAC	0.52																																																	0								ENSG00000115884																																			SDC1	SO:0001627	intron_variant	0				HGNC	AJ551176	CCDS1697.1	2p24.1	2008-02-05			ENSG00000115884	ENSG00000115884		"""CD molecules"", ""Proteoglycans / Cell Surface : Syndecans"""	10658	protein-coding gene	gene with protein product	"""syndecan proteoglycan 1"""	186355		SDC			Standard	XM_005262621		Approved	CD138, syndecan, SYND1	uc002rdo.1	P18827	OTTHUMG00000090751	ENST00000254351.4:c.66+1514->T	2.37:g.20423057_20423057dupA		Somatic	0	51	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	22	18.52	D6W523|Q53QV0|Q546D3|Q96HB7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000254351.4	37	NULL	CCDS1697.1	2																																																																																			-	-		0.520	SDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDC1	protein_coding	OTTHUMT00000207495.1	-	NM_001006946			20423048	-1	no_errors	ENST00000482879	ensembl	human	known	74_37	rna	INS	0.001:0.002	A
KRT85	3891	genome.wustl.edu	37	12	52756664	52756664	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr12:52756664C>T	ENST00000257901.3	-	6	1126	c.1051G>A	c.(1051-1053)Gcc>Acc	p.A351T	KRT85_ENST00000544265.1_Missense_Mutation_p.A139T	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	351	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TCAATCTCGGCCGTCAGCCTC	0.592																																																	0								ENSG00000135443						146.0	119.0	128.0					12																	52756664		2203	4300	6503	KRT85	SO:0001583	missense	0			-	HGNC	X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.1051G>A	12.37:g.52756664C>T	ENSP00000257901:p.Ala351Thr	Somatic	0	37	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q9NSB1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.A351T	ENST00000257901.3	37	c.1051	CCDS8824.1	12	.	.	.	.	.	.	.	.	.	.	C	18.71	3.682318	0.68042	.	.	ENSG00000135443	ENST00000257901;ENST00000544265	T;T	0.79454	-0.93;-1.27	4.49	4.49	0.54785	Filament (1);	0.000000	0.56097	D	0.000021	T	0.78039	0.4221	M	0.73598	2.24	0.09310	N	1	B	0.27166	0.17	B	0.33121	0.158	T	0.72551	-0.4259	10	0.59425	D	0.04	.	11.89	0.52624	0.0:0.9128:0.0:0.0872	.	351	P78386	KRT85_HUMAN	T	351;139	ENSP00000257901:A351T;ENSP00000440240:A139T	ENSP00000257901:A351T	A	-	1	0	KRT85	51042931	0.000000	0.05858	0.607000	0.28956	0.987000	0.75469	-0.138000	0.10374	2.339000	0.79563	0.561000	0.74099	GCC	-	pfam_IF,superfamily_Prefoldin		0.592	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT85	protein_coding	OTTHUMT00000405184.1	C	NM_002283	-		52756664	-1	no_errors	ENST00000257901	ensembl	human	known	74_37	missense	SNP	0.029	T
EPB41L4A	64097	genome.wustl.edu	37	5	111576464	111576464	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr5:111576464G>T	ENST00000261486.5	-	10	1115	c.839C>A	c.(838-840)gCt>gAt	p.A280D	RP11-526F3.1_ENST00000504004.1_RNA	NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A	280	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		GTGCTTGCAAGCAGTTTTACT	0.348																																																	0								ENSG00000129595						72.0	68.0	70.0					5																	111576464		1815	4093	5908	EPB41L4A	SO:0001583	missense	0			-	HGNC	AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.839C>A	5.37:g.111576464G>T	ENSP00000261486:p.Ala280Asp	Somatic	0	20	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	33	23.26	A4FUI6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.A280D	ENST00000261486.5	37	c.839	CCDS43350.1	5	.	.	.	.	.	.	.	.	.	.	G	17.59	3.426703	0.62733	.	.	ENSG00000129595	ENST00000261486	D	0.87729	-2.29	5.76	4.88	0.63580	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.267779	0.36591	N	0.002512	D	0.86830	0.6027	M	0.79805	2.47	0.35088	D	0.76402	P	0.43542	0.81	B	0.37650	0.255	D	0.92475	0.5988	10	0.87932	D	0	.	14.0608	0.64800	0.0751:0.0:0.9249:0.0	.	280	Q9HCS5	E41LA_HUMAN	D	280	ENSP00000261486:A280D	ENSP00000261486:A280D	A	-	2	0	EPB41L4A	111604363	0.950000	0.32346	1.000000	0.80357	0.986000	0.74619	3.569000	0.53827	2.720000	0.93068	0.655000	0.94253	GCT	-	pfam_FERM_PH-like_C,pfscan_FERM_domain		0.348	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41L4A	protein_coding	OTTHUMT00000370969.1	G		-		111576464	-1	no_errors	ENST00000261486	ensembl	human	known	74_37	missense	SNP	0.996	T
RPGRIP1L	23322	genome.wustl.edu	37	16	53679891	53679891	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr16:53679891C>A	ENST00000379925.3	-	17	2379	c.2329G>T	c.(2329-2331)Gct>Tct	p.A777S	RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.A777S|RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.A777S|RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.A777S	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	777	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				CTGAGTTGAGCAGTTTTGGGT	0.403																																																	0								ENSG00000103494						82.0	76.0	78.0					16																	53679891		2198	4300	6498	RPGRIP1L	SO:0001583	missense	0			-	HGNC		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.2329G>T	16.37:g.53679891C>A	ENSP00000369257:p.Ala777Ser	Somatic	0	26	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	A0PJ88|Q9Y2K8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3250,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.A777S	ENST00000379925.3	37	c.2329	CCDS32447.1	16	.	.	.	.	.	.	.	.	.	.	C	9.512	1.106098	0.20632	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	T;T	0.76316	-0.81;-1.01	5.53	3.59	0.41128	C2 calcium/lipid-binding domain, CaLB (1);	0.348821	0.30185	N	0.010202	T	0.56499	0.1989	N	0.08118	0	0.80722	D	1	B;B;B;B	0.19200	0.023;0.034;0.013;0.011	B;B;B;B	0.20767	0.013;0.031;0.013;0.017	T	0.44574	-0.9319	10	0.26408	T	0.33	-8.5876	9.2584	0.37597	0.0:0.7757:0.0:0.2243	.	777;777;777;777	B4E3M8;B7ZKJ9;Q68CZ1;Q68CZ1-2	.;.;FTM_HUMAN;.	S	777	ENSP00000369257:A777S;ENSP00000262135:A777S	ENSP00000262135:A777S	A	-	1	0	RPGRIP1L	52237392	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	0.753000	0.26376	0.704000	0.31869	-0.263000	0.10527	GCT	-	superfamily_C2_dom		0.403	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	RPGRIP1L	protein_coding	OTTHUMT00000422187.1	C	NM_015272	-		53679891	-1	no_errors	ENST00000379925	ensembl	human	known	74_37	missense	SNP	1.000	A
MT-ND1	4535	genome.wustl.edu	37	M	1056	1056	+	5'Flank	SNP	A	A	G			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chrM:1056A>G	ENST00000361390.2	+	0	0				MT-RNR1_ENST00000389680.2_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TL1_ENST00000386347.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TGAACACACAATAGCTAAGAC	0.423																																																	0								ENSG00000211459																																			MT-RNR1	SO:0001631	upstream_gene_variant	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.1056A>G	Exception_encountered	Somatic	0	19	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	3	62.50	C0JKH6|Q37523	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361390.2	37	NULL		MT																																																																																			-	-		0.423	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR1	protein_coding		A	YP_003024026	-		1056	+1	no_errors	ENST00000389680	ensembl	human	known	74_37	rna	SNP	NULL	G
MLLT3	4300	genome.wustl.edu	37	9	20620794	20620794	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr9:20620794G>T	ENST00000380338.4	-	2	338	c.52C>A	c.(52-54)Cag>Aag	p.Q18K	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Missense_Mutation_p.Q15K	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	18	YEATS. {ECO:0000255|PROSITE- ProRule:PRU00376}.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		TTCCTCACCTGGGCGCGGTGC	0.597			T	MLL	ALL																																			Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	0								ENSG00000171843						87.0	86.0	87.0					9																	20620794		2203	4300	6503	MLLT3	SO:0001583	missense	0			-	HGNC	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.52C>A	9.37:g.20620794G>T	ENSP00000369695:p.Gln18Lys	Somatic	0	35	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_YEATS,pfscan_YEATS	p.Q18K	ENST00000380338.4	37	c.52	CCDS6494.1	9	.	.	.	.	.	.	.	.	.	.	G	18.32	3.598547	0.66332	.	.	ENSG00000171843	ENST00000380338;ENST00000429426;ENST00000540751	.	.	.	5.07	5.07	0.68467	.	0.000000	0.64402	D	0.000001	T	0.45034	0.1322	N	0.12746	0.255	0.80722	D	1	P;B	0.52061	0.95;0.118	P;B	0.49752	0.621;0.092	T	0.39981	-0.9587	9	0.26408	T	0.33	-7.6878	18.0624	0.89381	0.0:0.0:1.0:0.0	.	15;18	B7Z755;P42568	.;AF9_HUMAN	K	18;15;57	.	ENSP00000369695:Q18K	Q	-	1	0	MLLT3	20610794	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.856000	0.99531	2.336000	0.79503	0.561000	0.74099	CAG	-	pfscan_YEATS		0.597	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT3	protein_coding	OTTHUMT00000051872.1	G	NM_004529	-		20620794	-1	no_errors	ENST00000380338	ensembl	human	known	74_37	missense	SNP	1.000	T
KIAA1462	57608	genome.wustl.edu	37	10	30316501	30316503	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	CTG	CTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr10:30316501_30316503delCTG	ENST00000375377.1	-	3	2675_2677	c.2574_2576delCAG	c.(2572-2577)agcagt>agt	p.858_859SS>S		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	858	Ser-rich.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						ACTCTCCTCActgctgctgctgc	0.571																																																	0								ENSG00000165757			16,121,147,3686		2,1,1,10,9,1,101,3,139,1718						-7.0	0.0			46	4,50,242,7744		0,0,1,3,0,0,50,8,225,3733	no	codingComplex	KIAA1462	NM_020848.2		2,1,2,13,9,1,151,11,364,5451	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		3.6816,7.1537,4.8293				20,171,389,11430				KIAA1462	SO:0001651	inframe_deletion	0				HGNC	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.2574_2576delCAG	10.37:g.30316510_30316512delCTG	ENSP00000364526:p.Ser859del	Somatic	0	42	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	43	12.24	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.S859in_frame_del	ENST00000375377.1	37	c.2576_2574	CCDS41500.1	10																																																																																			-	NULL		0.571	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1462	protein_coding	OTTHUMT00000047409.1	CTG	NM_020848			30316503	-1	no_errors	ENST00000375377	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.000:0.001	-
ONECUT1	3175	genome.wustl.edu	37	15	53081693	53081693	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr15:53081693T>G	ENST00000305901.5	-	1	516	c.389A>C	c.(388-390)cAt>cCt	p.H130P	ONECUT1_ENST00000561401.2_Intron	NM_004498.2	NP_004489.1	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	130	Poly-His.				B cell differentiation (GO:0030183)|cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|endoderm development (GO:0007492)|epithelial cell development (GO:0002064)|glucose metabolic process (GO:0006006)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription, DNA-templated (GO:0006355)|spleen development (GO:0048536)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	17				all cancers(107;0.0708)		gtggtggtgatggtggtggtg	0.637																																																	0								ENSG00000169856						52.0	47.0	49.0					15																	53081693		2194	4293	6487	ONECUT1	SO:0001583	missense	0			-	HGNC	U77975	CCDS10150.1	15q21.3	2012-03-09	2007-07-16		ENSG00000169856	ENSG00000169856		"""Homeoboxes / CUT class"""	8138	protein-coding gene	gene with protein product		604164	"""one cut domain, family member 1"""	HNF6, HNF6A		8887657, 8790352	Standard	NM_004498		Approved	HNF-6	uc002aci.2	Q9UBC0	OTTHUMG00000131899	ENST00000305901.5:c.389A>C	15.37:g.53081693T>G	ENSP00000302630:p.His130Pro	Somatic	0	44	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	43	15.69	B2RTV4|Q99744|Q9UMR6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.H130P	ENST00000305901.5	37	c.389	CCDS10150.1	15	.	.	.	.	.	.	.	.	.	.	T	12.66	2.003964	0.35320	.	.	ENSG00000169856	ENST00000305901	T	0.51574	0.7	4.2	4.2	0.49525	.	0.126884	0.50627	D	0.000119	T	0.51126	0.1656	L	0.31294	0.92	0.80722	D	1	P	0.51240	0.943	D	0.64321	0.924	T	0.40459	-0.9562	10	0.22109	T	0.4	-9.6666	12.2841	0.54783	0.0:0.0:0.0:1.0	.	130	Q9UBC0	HNF6_HUMAN	P	130	ENSP00000302630:H130P	ENSP00000302630:H130P	H	-	2	0	ONECUT1	50868985	1.000000	0.71417	0.996000	0.52242	0.981000	0.71138	7.431000	0.80335	1.760000	0.52011	0.352000	0.21897	CAT	-	NULL		0.637	ONECUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ONECUT1	protein_coding	OTTHUMT00000254849.2	T		-		53081693	-1	no_errors	ENST00000305901	ensembl	human	known	74_37	missense	SNP	1.000	G
PTCHD1	139411	genome.wustl.edu	37	X	23397790	23397790	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chrX:23397790A>G	ENST00000379361.4	+	2	1294	c.434A>G	c.(433-435)gAt>gGt	p.D145G		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	145					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						CTGAATAATGATAAGACTTGC	0.448																																																	0								ENSG00000165186						85.0	76.0	79.0					X																	23397790		2203	4300	6503	PTCHD1	SO:0001583	missense	0			-	HGNC	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.434A>G	X.37:g.23397790A>G	ENSP00000368666:p.Asp145Gly	Somatic	0	44	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	90	22.41	B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Patched,pfscan_SSD	p.D145G	ENST00000379361.4	37	c.434	CCDS35215.2	X	.	.	.	.	.	.	.	.	.	.	A	11.32	1.604104	0.28534	.	.	ENSG00000165186	ENST00000379361	D	0.86366	-2.11	5.06	5.06	0.68205	.	0.175286	0.51477	D	0.000088	T	0.73528	0.3598	N	0.17082	0.46	0.39163	D	0.96244	B;B	0.29862	0.259;0.05	B;B	0.23716	0.041;0.048	T	0.71849	-0.4468	10	0.02654	T	1	.	14.135	0.65281	1.0:0.0:0.0:0.0	.	40;145	Q96NR3-3;Q96NR3	.;PTHD1_HUMAN	G	145	ENSP00000368666:D145G	ENSP00000368666:D145G	D	+	2	0	PTCHD1	23307711	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.579000	0.74036	1.983000	0.57843	0.486000	0.48141	GAT	-	pfam_Patched		0.448	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD1	protein_coding	OTTHUMT00000056047.2	A	NM_173495	-		23397790	+1	no_errors	ENST00000379361	ensembl	human	known	74_37	missense	SNP	1.000	G
VPS16	64601	genome.wustl.edu	37	20	2841110	2841110	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr20:2841110C>T	ENST00000380445.3	+	5	457	c.385C>T	c.(385-387)Cgg>Tgg	p.R129W	VPS16_ENST00000380469.3_Missense_Mutation_p.R129W|VPS16_ENST00000380443.3_5'Flank	NM_022575.2	NP_072097.2	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 homolog (S. cerevisiae)	129					intracellular protein transport (GO:0006886)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|axon (GO:0030424)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	37						GCTCCAGAACCGGGTTCTGGA	0.597																																																	0								ENSG00000215305						76.0	74.0	75.0					20																	2841110		2203	4300	6503	VPS16	SO:0001583	missense	0			-	HGNC	AF308801	CCDS13036.1, CCDS13037.1	20p13	2009-07-07	2009-07-07	2009-07-07	ENSG00000215305	ENSG00000215305			14584	protein-coding gene	gene with protein product		608550					Standard	NM_022575		Approved		uc002whe.3	Q9H269	OTTHUMG00000031714	ENST00000380445.3:c.385C>T	20.37:g.2841110C>T	ENSP00000369810:p.Arg129Trp	Somatic	0	41	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q5JUB1|Q8WU31|Q96EE7|Q96N92|Q9H1Q4|Q9H1Q5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Vps16_N,pfam_Vps16_C,pirsf_VPS16	p.R129W	ENST00000380445.3	37	c.385	CCDS13036.1	20	.	.	.	.	.	.	.	.	.	.	C	22.0	4.229040	0.79688	.	.	ENSG00000215305	ENST00000380445;ENST00000380469;ENST00000453689;ENST00000417508	T;T	0.44881	0.91;0.91	5.95	5.95	0.96441	Vps16, N-terminal (1);	0.166737	0.53938	D	0.000042	T	0.56587	0.1995	L	0.46157	1.445	0.80722	D	1	D;D	0.76494	0.999;0.998	P;P	0.60609	0.877;0.865	T	0.55547	-0.8124	10	0.72032	D	0.01	-25.9441	17.8727	0.88815	0.0:1.0:0.0:0.0	.	129;129	Q9H269-2;Q9H269	.;VPS16_HUMAN	W	129;129;11;11	ENSP00000369810:R129W;ENSP00000369836:R129W	ENSP00000369810:R129W	R	+	1	2	VPS16	2789110	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	3.503000	0.53340	2.826000	0.97356	0.563000	0.77884	CGG	-	pfam_Vps16_N,pirsf_VPS16		0.597	VPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS16	protein_coding	OTTHUMT00000077658.2	C	NM_022575	-		2841110	+1	no_errors	ENST00000380445	ensembl	human	known	74_37	missense	SNP	1.000	T
C22orf34	348645	genome.wustl.edu	37	22	50017970	50017970	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr22:50017970G>T	ENST00000444628.1	-	4	1562	c.491C>A	c.(490-492)cCc>cAc	p.P164H	C22orf34_ENST00000405854.1_Intron|C22orf34_ENST00000400023.1_Intron			Q6ZV56	CV034_HUMAN	chromosome 22 open reading frame 34	138										pancreas(1)	1						TGATGCTCGGGGTGCTGACCT	0.647																																																	0								ENSG00000188511																																			C22orf34	SO:0001583	missense	0			-	HGNC	BC048207		22q13.33	2013-01-15			ENSG00000188511	ENSG00000188511			28010	other	unknown						12477932	Standard	NR_026997		Approved		uc003bit.3	Q6ZV56	OTTHUMG00000030424	ENST00000444628.1:c.491C>A	22.37:g.50017970G>T	ENSP00000395549:p.Pro164His	Somatic	0	56	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	40	38.81	Q147Y0|Q5R3D1|Q6ZTN8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P164H	ENST00000444628.1	37	c.491		22	.	.	.	.	.	.	.	.	.	.	G	9.693	1.152473	0.21371	.	.	ENSG00000188511	ENST00000444628	.	.	.	0.463	-0.927	0.10451	.	.	.	.	.	T	0.23289	0.0563	.	.	.	0.21675	N	0.999594	.	.	.	.	.	.	T	0.27640	-1.0068	4	.	.	.	.	4.3979	0.11372	0.3276:0.0:0.6724:0.0	.	.	.	.	H	164	.	.	P	-	2	0	C22orf34	48403974	0.998000	0.40836	0.002000	0.10522	0.367000	0.29736	1.345000	0.33953	-0.359000	0.08150	0.121000	0.15741	CCC	-	NULL		0.647	C22orf34-201	KNOWN	basic|appris_candidate_longest	protein_coding	C22orf34	protein_coding		G	NR_026997	-		50017970	-1	no_errors	ENST00000444628	ensembl	human	known	74_37	missense	SNP	0.994	T
WRAP53	55135	genome.wustl.edu	37	17	7592932	7592932	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr17:7592932G>C	ENST00000316024.5	+	3	2903	c.555G>C	c.(553-555)ttG>ttC	p.L185F	WRAP53_ENST00000396463.2_Missense_Mutation_p.L185F|WRAP53_ENST00000534050.1_Missense_Mutation_p.L152F|TP53_ENST00000269305.4_5'Flank|TP53_ENST00000420246.2_5'Flank|TP53_ENST00000445888.2_5'Flank|WRAP53_ENST00000457584.2_Missense_Mutation_p.L185F|WRAP53_ENST00000431639.2_Missense_Mutation_p.L185F|TP53_ENST00000455263.2_5'Flank			Q9BUR4	WAP53_HUMAN	WD repeat containing, antisense to TP53	185					positive regulation of telomerase activity (GO:0051973)|telomere formation via telomerase (GO:0032203)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(2)	18						CCTGCATCTTGACCAATAGTG	0.517																																																	0								ENSG00000141499						104.0	93.0	97.0					17																	7592932		2203	4300	6503	WRAP53	SO:0001583	missense	0			-	HGNC	AK001247, DQ431240	CCDS11119.1	17p13.1	2014-09-17	2009-02-16	2009-02-16	ENSG00000141499	ENSG00000141499		"""WD repeat domain containing"""	25522	protein-coding gene	gene with protein product	"""telomerase cajal body protein 1"", ""WD-encoding RNA antisense to p53"""	612661	"""WD repeat domain 79"""	WDR79		19179534, 19250907, 19571673, 19342896, 20494116, 21441950	Standard	NM_018081		Approved	FLJ10385, TCAB1	uc010vuh.2	Q9BUR4	OTTHUMG00000134323	ENST00000316024.5:c.555G>C	17.37:g.7592932G>C	ENSP00000324203:p.Leu185Phe	Somatic	0	33	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	2	95.35	B3KPR9|D3DTQ4|Q08ET9|Q9NW09	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L185F	ENST00000316024.5	37	c.555	CCDS11119.1	17	.	.	.	.	.	.	.	.	.	.	G	20.6	4.021801	0.75275	.	.	ENSG00000141499	ENST00000431639;ENST00000316024;ENST00000457584;ENST00000396463;ENST00000534050	T;T;T;T;T	0.67171	0.1;0.1;0.1;0.1;-0.25	5.0	3.97	0.46021	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.64402	D	0.000010	D	0.82861	0.5129	M	0.88241	2.94	0.40299	D	0.978581	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	D	0.86048	0.1524	10	0.62326	D	0.03	-7.9239	12.5379	0.56152	0.0:0.1693:0.8307:0.0	.	152;185	E9PMG4;Q9BUR4	.;WAP53_HUMAN	F	185;185;185;185;152	ENSP00000397219:L185F;ENSP00000324203:L185F;ENSP00000411061:L185F;ENSP00000379727:L185F;ENSP00000434999:L152F	ENSP00000324203:L185F	L	+	3	2	WRAP53	7533657	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.423000	0.44705	2.330000	0.79161	0.655000	0.94253	TTG	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat		0.517	WRAP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRAP53	protein_coding	OTTHUMT00000259385.2	G	NM_018081	-		7592932	+1	no_errors	ENST00000316024	ensembl	human	known	74_37	missense	SNP	1.000	C
HPS1	3257	genome.wustl.edu	37	10	100186987	100186987	+	Frame_Shift_Del	DEL	G	G	-	rs281865082		TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr10:100186987delG	ENST00000325103.6	-	11	1205	c.972delC	c.(970-972)cccfs	p.P324fs	HPS1_ENST00000467246.1_5'UTR|HPS1_ENST00000361490.4_Frame_Shift_Del_p.P324fs	NM_000195.3	NP_000186.2	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1	324					blood coagulation (GO:0007596)|eye pigmentation (GO:0048069)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of natural killer cell activation (GO:0032816)|retina development in camera-type eye (GO:0060041)|secretion of lysosomal enzymes (GO:0033299)|visual perception (GO:0007601)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	protein dimerization activity (GO:0046983)	p.M325fs*128(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)		GGGCATCCATGGGGGGGGTGC	0.572									Hermansky-Pudlak syndrome																																								1	Insertion - Frameshift(1)	large_intestine(1)	GRCh37	CD982691	HPS1	D		ENSG00000107521						28.0	26.0	27.0					10																	100186987		2079	3959	6038	HPS1	SO:0001589	frameshift_variant	0	Familial Cancer Database	HPS, HPS1-8		HGNC	U79136	CCDS7475.1, CCDS7476.1	10q23.1-q23.3	2014-06-18		2002-05-01	ENSG00000107521	ENSG00000107521			5163	protein-coding gene	gene with protein product		604982	"""Hermansky-Pudlak syndrome"""	HPS		8541858, 7573033	Standard	NM_182639		Approved		uc021pwv.1	Q92902	OTTHUMG00000018876	ENST00000325103.6:c.972delC	10.37:g.100186987delG	ENSP00000326649:p.Pro324fs	Somatic	0	46	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	A8MRT2|O15402|O15502|Q5TAA3|Q8WXE5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.M325fs	ENST00000325103.6	37	c.972	CCDS7475.1	10																																																																																			-	NULL		0.572	HPS1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS1	protein_coding	OTTHUMT00000049776.1	G	NM_000195, NM_182637, NM_182638, NM_182639			100186987	-1	no_errors	ENST00000325103	ensembl	human	known	74_37	frame_shift_del	DEL	0.170	-
HAS3	3038	genome.wustl.edu	37	16	69149089	69149089	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr16:69149089C>A	ENST00000306560.1	+	4	1738	c.1582C>A	c.(1582-1584)Ctc>Atc	p.L528I	HAS3_ENST00000569188.1_Missense_Mutation_p.L528I|HAS3_ENST00000219322.3_Intron	NM_005329.2	NP_005320.2	O00219	HYAS3_HUMAN	hyaluronan synthase 3	528					carbohydrate metabolic process (GO:0005975)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of transcription, DNA-templated (GO:0045893)|small molecule metabolic process (GO:0044281)	hyaluranon cable (GO:0036117)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(2)	16		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		GGTGGCCCTCCTCATGCTATA	0.572																																																	0								ENSG00000103044						88.0	89.0	88.0					16																	69149089		2198	4300	6498	HAS3	SO:0001583	missense	0			-	HGNC	BC021853	CCDS10870.1, CCDS10871.1	16q22.1	2013-02-22			ENSG00000103044	ENSG00000103044	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4820	protein-coding gene	gene with protein product		602428				9169154, 9083017	Standard	NM_005329		Approved		uc010cfh.3	O00219	OTTHUMG00000137562	ENST00000306560.1:c.1582C>A	16.37:g.69149089C>A	ENSP00000304440:p.Leu528Ile	Somatic	0	35	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	A8K5T5|Q8WTZ0|Q9NYP0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Chitin_synth_fng,pfam_Glyco_trans_2	p.L528I	ENST00000306560.1	37	c.1582	CCDS10871.1	16	.	.	.	.	.	.	.	.	.	.	C	12.88	2.069776	0.36566	.	.	ENSG00000103044	ENST00000306560	T	0.60299	0.2	5.76	4.81	0.61882	.	0.059424	0.64402	D	0.000001	T	0.54029	0.1833	L	0.53729	1.69	0.45515	D	0.998472	B	0.22146	0.065	B	0.21546	0.035	T	0.52328	-0.8590	10	0.40728	T	0.16	-18.862	14.9353	0.70951	0.0:0.9304:0.0:0.0696	.	528	O00219	HAS3_HUMAN	I	528	ENSP00000304440:L528I	ENSP00000304440:L528I	L	+	1	0	HAS3	67706590	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.068000	0.41471	1.575000	0.49775	0.655000	0.94253	CTC	-	NULL		0.572	HAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAS3	protein_coding	OTTHUMT00000268898.2	C	NM_138612	-		69149089	+1	no_errors	ENST00000306560	ensembl	human	known	74_37	missense	SNP	1.000	A
SARDH	1757	genome.wustl.edu	37	9	136594926	136594926	+	Silent	SNP	G	G	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr9:136594926G>A	ENST00000371872.4	-	6	1133	c.876C>T	c.(874-876)caC>caT	p.H292H	SARDH_ENST00000371867.1_Silent_p.H203H|SARDH_ENST00000298628.5_Silent_p.H292H|SARDH_ENST00000422262.2_Silent_p.H124H|SARDH_ENST00000439388.1_Silent_p.H292H	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	292					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CATAGGCATGGTGCATGGCCA	0.632																																																	0								ENSG00000123453						102.0	84.0	90.0					9																	136594926		2203	4300	6503	SARDH	SO:0001819	synonymous_variant	0			-	HGNC		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.876C>T	9.37:g.136594926G>A		Somatic	0	12	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	11	31.25	B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C	p.H292	ENST00000371872.4	37	c.876	CCDS6978.1	9																																																																																			-	pfam_FAD-dep_OxRdtase		0.632	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SARDH	protein_coding	OTTHUMT00000054931.1	G		-		136594926	-1	no_errors	ENST00000371872	ensembl	human	known	74_37	silent	SNP	0.999	A
KRT16P6	353194	genome.wustl.edu	37	17	16722165	16722165	+	RNA	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr17:16722165G>T	ENST00000602730.1	+	0	6486				AC022596.6_ENST00000417510.1_RNA																							AGGAGAGGCTGTGAAGACAGA	0.592																																																	0								ENSG00000226145																																			AC022596.6			0			-	Clone_based_vega_gene																													17.37:g.16722165G>T		Somatic	0	128	0.00		0.7068600073138991	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	151	180	45.48		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000602730.1	37	NULL		17																																																																																			-	-		0.592	RP11-219A15.4-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000226145	processed_transcript	OTTHUMT00000468034.1	G		-		16722165	-1	no_errors	ENST00000417510	ensembl	human	known	74_37	rna	SNP	0.211	T
