#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
RAB9B	51209	genome.wustl.edu	37	X	103080663	103080663	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chrX:103080663C>A	ENST00000243298.2	-	3	336	c.52G>T	c.(52-54)Gtt>Ttt	p.V18F		NM_016370.2	NP_057454.1	Q9NP90	RAB9B_HUMAN	RAB9B, member RAS oncogene family	18					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(1)|lung(11)	14						CTTTTCCCAACTCCACCATCA	0.443																																																	0								ENSG00000123570						137.0	127.0	130.0					X																	103080663		2203	4300	6503	RAB9B	SO:0001583	missense	0			-	HGNC	AB036693	CCDS14515.1	Xq22.1-q22.3	2010-04-19			ENSG00000123570	ENSG00000123570		"""RAB, member RAS oncogene"""	14090	protein-coding gene	gene with protein product		300285				11043518	Standard	NM_016370		Approved	RAB9L	uc004ell.2	Q9NP90	OTTHUMG00000022112	ENST00000243298.2:c.52G>T	X.37:g.103080663C>A	ENSP00000243298:p.Val18Phe	Somatic	0	30	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	39	36.07	B2R8M0|Q52LX2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.V18F	ENST00000243298.2	37	c.52	CCDS14515.1	X	.	.	.	.	.	.	.	.	.	.	C	19.31	3.803382	0.70682	.	.	ENSG00000123570	ENST00000243298	D	0.83250	-1.7	5.95	5.95	0.96441	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.95472	0.8529	H	0.99573	4.635	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97462	1.0035	10	0.87932	D	0	.	16.5572	0.84488	0.0:1.0:0.0:0.0	.	18	Q9NP90	RAB9B_HUMAN	F	18	ENSP00000243298:V18F	ENSP00000243298:V18F	V	-	1	0	RAB9B	102967319	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.518000	0.84900	0.600000	0.82982	GTT	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.443	RAB9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB9B	protein_coding	OTTHUMT00000057746.1	C		-		103080663	-1	no_errors	ENST00000243298	ensembl	human	known	74_37	missense	SNP	1.000	A
GOLGA6L10	647042	genome.wustl.edu	37	15	82637334	82637334	+	Missense_Mutation	SNP	T	T	C	rs77281226	byFrequency	TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr15:82637334T>C	ENST00000439287.4	-	6	851	c.752A>G	c.(751-753)cAt>cGt	p.H251R		NM_001164465.1	NP_001157937.1	A6NI86	GG6LA_HUMAN	golgin A6 family-like 10	251										endometrium(1)|kidney(4)	5						CTCCTGTTCATGTAGCCTCTC	0.577																																																	0								ENSG00000205281																																			GOLGA6L10	SO:0001583	missense	0			-	Uniprot_gn		CCDS45325.1	15q25.2	2014-08-13	2010-02-12		ENSG00000278662				37228	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 10"", ""golgin A6 family-like 18"""	GOLGA6L18			Standard	XM_006720643		Approved		uc021ssn.1	A6NI86	OTTHUMG00000172580	ENST00000439287.4:c.752A>G	15.37:g.82637334T>C	ENSP00000388606:p.His251Arg	Somatic	0	17	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	26	21.21		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.H251R	ENST00000439287.4	37	c.752	CCDS45325.1	15	.	.	.	.	.	.	.	.	.	.	.	0.007	-1.943215	0.00479	.	.	ENSG00000205281	ENST00000439287;ENST00000430944	T	0.21191	2.02	0.256	-0.513	0.11962	.	.	.	.	.	T	0.09598	0.0236	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.38672	-0.9650	5	0.16420	T	0.52	.	2.1009	0.03680	0.2548:0.2601:0.0:0.4851	.	.	.	.	R	251	ENSP00000388606:H251R	ENSP00000390083:H251R	H	-	2	0	GOLGA6L10	80424389	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.158000	0.01281	-2.062000	0.00891	-2.029000	0.00425	CAT	-	NULL		0.577	GOLGA6L10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927601	protein_coding	OTTHUMT00000419403.2	T	NM_001164465	rs77281226		82637334	-1	no_errors	ENST00000439287	ensembl	human	known	74_37	missense	SNP	0.000	C
OTOL1	131149	genome.wustl.edu	37	3	161214858	161214858	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr3:161214858A>G	ENST00000327928.4	+	1	263	c.263A>G	c.(262-264)gAa>gGa	p.E88G		NM_001080440.1	NP_001073909.1	A6NHN0	OTOL1_HUMAN	otolin 1	88						collagen trimer (GO:0005581)|extracellular region (GO:0005576)				central_nervous_system(2)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)	27						TCTCCCTTTGAAAACTTCACT	0.473																																																	0								ENSG00000182447						159.0	154.0	156.0					3																	161214858		1862	4104	5966	OTOL1	SO:0001583	missense	0			-	HGNC		CCDS46948.1	3q26.1	2011-05-19	2011-05-19			ENSG00000182447			34071	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 15"""		"""otolin 1 homolog (zebrafish)"""			17544811, 15905077	Standard	NM_001080440		Approved	C1QTNF15	uc011bpb.2	A6NHN0		ENST00000327928.4:c.263A>G	3.37:g.161214858A>G	ENSP00000330808:p.Glu88Gly	Somatic	0	131	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	72	93	43.64		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.E88G	ENST00000327928.4	37	c.263	CCDS46948.1	3	.	.	.	.	.	.	.	.	.	.	A	10.52	1.372057	0.24857	.	.	ENSG00000182447	ENST00000327928	D	0.90900	-2.75	5.66	4.47	0.54385	.	0.206217	0.50627	D	0.000119	D	0.84275	0.5436	L	0.32530	0.975	0.31608	N	0.651875	B	0.12630	0.006	B	0.12156	0.007	T	0.79130	-0.1930	10	0.29301	T	0.29	.	11.0151	0.47685	0.8437:0.1563:0.0:0.0	.	88	A6NHN0	OTOL1_HUMAN	G	88	ENSP00000330808:E88G	ENSP00000330808:E88G	E	+	2	0	OTOL1	162697552	1.000000	0.71417	0.920000	0.36463	0.099000	0.18886	5.270000	0.65547	0.946000	0.37632	0.528000	0.53228	GAA	-	NULL		0.473	OTOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOL1	protein_coding	OTTHUMT00000353184.1	A	NM_001080440	-		161214858	+1	no_errors	ENST00000327928	ensembl	human	known	74_37	missense	SNP	0.998	G
FLG2	388698	genome.wustl.edu	37	1	152330046	152330046	+	Silent	SNP	A	A	C			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr1:152330046A>C	ENST00000388718.5	-	3	288	c.216T>G	c.(214-216)acT>acG	p.T72T	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	72	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.|S-100-like. {ECO:0000250}.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AAAGAAACTCAGTAAAGTCCA	0.443																																																	0								ENSG00000143520																																			FLG2	SO:0001819	synonymous_variant	0			-	HGNC	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.216T>G	1.37:g.152330046A>C		Somatic	0	34	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	46	39.47	Q9H4U1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.T72	ENST00000388718.5	37	c.216	CCDS30861.1	1																																																																																			-	pfscan_EF_hand_dom		0.443	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	protein_coding	OTTHUMT00000034018.5	A	NM_001014342	-		152330046	-1	no_errors	ENST00000388718	ensembl	human	known	74_37	silent	SNP	0.992	C
TP53	7157	genome.wustl.edu	37	17	7577152	7577154	+	Splice_Site	DEL	ACC	ACC	-	rs200579969		TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	ACC	ACC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr17:7577152_7577154delACC	ENST00000269305.4	-	8	973_975	c.784_786delGGT	c.(784-786)ggtdel	p.G262del	TP53_ENST00000455263.2_Splice_Site_p.G262del|TP53_ENST00000359597.4_Splice_Site_p.G262del|TP53_ENST00000445888.2_Splice_Site_p.G262del|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Splice_Site_p.G262del|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	262	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		G -> C (in a sporadic cancer; somatic mutation).|G -> D (in sporadic cancers; somatic mutation).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> S (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation). {ECO:0000269|Ref.23}.|GN -> PD (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G262V(19)|p.0?(8)|p.G262fs*83(5)|p.G262D(4)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G262del(2)|p.G262_S269delGNLLGRNS(2)|p.G262S(2)|p.N263fs*5(1)|p.G262H(1)|p.G262G(1)|p.E258fs*71(1)|p.S261_L264>R(1)|p.N263fs*84(1)|p.S261_G262insX(1)|p.G262fs*2(1)|p.N263H(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCAGTAGATTACCACTACTCAGG	0.517		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	56	Substitution - Missense(27)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(6)|Unknown(3)|Insertion - Frameshift(1)|Insertion - In frame(1)|Complex - deletion inframe(1)|Substitution - coding silent(1)	lung(9)|large_intestine(8)|ovary(6)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(5)|urinary_tract(5)|upper_aerodigestive_tract(4)|bone(4)|endometrium(2)|breast(2)|stomach(2)|pancreas(2)|eye(1)|liver(1)						ENSG00000141510																																			TP53	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.783-1GGT>-	17.37:g.7577152_7577154delACC		Somatic	0	16	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	4	75.00	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.G262in_frame_del	ENST00000269305.4	37	c.786_784	CCDS11118.1	17																																																																																			-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd		0.517	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	ACC	NM_000546		In_Frame_Del	7577154	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	in_frame_del	DEL	0.004:1.000:1.000	-
ANP32E	81611	genome.wustl.edu	37	1	150199040	150199045	+	In_Frame_Del	DEL	TCCTCT	TCCTCT	-	rs56692627|rs28594165|rs68136184|rs28460085	byFrequency	TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	TCCTCT	TCCTCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr1:150199040_150199045delTCCTCT	ENST00000314136.8	-	5	945_950	c.576_581delAGAGGA	c.(574-582)gaagaggag>gag	p.192_194EEE>E	ANP32E_ENST00000369119.3_In_Frame_Del_p.144_146EEE>E|ANP32E_ENST00000533654.1_In_Frame_Del_p.KR137del|ANP32E_ENST00000369114.5_Intron|ANP32E_ENST00000369115.2_In_Frame_Del_p.60_62EEE>E|ANP32E_ENST00000436748.2_In_Frame_Del_p.151_153EEE>E|ANP32E_ENST00000369116.4_In_Frame_Del_p.60_62EEE>E	NM_001136478.2|NM_001280559.1|NM_030920.3	NP_001129950.1|NP_001267488.1|NP_112182.1	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member E	192	Asp/Glu-rich (highly acidic).				histone exchange (GO:0043486)|negative regulation of catalytic activity (GO:0043086)	cytoplasmic membrane-bounded vesicle (GO:0016023)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	histone binding (GO:0042393)|phosphatase inhibitor activity (GO:0019212)			breast(3)|endometrium(3)|lung(7)|skin(1)|urinary_tract(1)	15	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			atcctcatcctcctcttcctcttcct	0.437														1756	0.350639	0.1596	0.3559	5008	,	,		19419	0.5446		0.2753	False		,,,				2504	0.4826																0								ENSG00000143401		,,	627,3639		79,469,1585					,,	-6.5	0.0		dbSNP_130	261	1908,6340		294,1320,2510	no	coding,coding,coding	ANP32E	NM_030920.3,NM_001136479.1,NM_001136478.2	,,	373,1789,4095	A1A1,A1R,RR		23.1329,14.6976,20.2573	,,	,,		2535,9979				ANP32E	SO:0001651	inframe_deletion	0				HGNC	AK092672	CCDS946.1, CCDS44214.1, CCDS44215.1, CCDS60245.1	1q22	2008-02-05			ENSG00000143401	ENSG00000143401		"""ANP32 acidic nuclear phosphoproteins"""	16673	protein-coding gene	gene with protein product		609611				12438741	Standard	NM_030920		Approved	LANPL, MGC5350, LANP-L	uc001etw.3	Q9BTT0	OTTHUMG00000012547	ENST00000314136.8:c.576_581delAGAGGA	1.37:g.150199046_150199051delTCCTCT	ENSP00000324074:p.Glu192_Glu193del	Somatic	NA	NA	NA		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4E0I6|E9PEA6|Q5TB18|Q5TB20|Q8N1S4|Q8WWW9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt	p.EE193in_frame_del	ENST00000314136.8	37	c.581_576	CCDS946.1	1																																																																																			-	NULL		0.437	ANP32E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANP32E	protein_coding	OTTHUMT00000035056.1	TCCTCT	NM_030920			150199045	-1	no_errors	ENST00000314136	ensembl	human	known	74_37	in_frame_del	DEL	0.001:0.006:0.000:0.058:0.106:0.091	-
SPATA31D1	389763	genome.wustl.edu	37	9	84608855	84608855	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr9:84608855C>T	ENST00000344803.2	+	4	3517	c.3470C>T	c.(3469-3471)aCt>aTt	p.T1157I		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1157					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CAATCACAAACTAGGAACAAC	0.418																																																	0								ENSG00000214929						51.0	50.0	50.0					9																	84608855		1919	4131	6050	SPATA31D1	SO:0001583	missense	0			-	HGNC		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3470C>T	9.37:g.84608855C>T	ENSP00000341988:p.Thr1157Ile	Somatic	0	45	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	54	46.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T1157I	ENST00000344803.2	37	c.3470	CCDS47986.1	9	.	.	.	.	.	.	.	.	.	.	C	13.33	2.205165	0.39003	.	.	ENSG00000214929	ENST00000344803	T	0.04654	3.58	2.86	2.86	0.33363	.	.	.	.	.	T	0.06645	0.0170	N	0.14661	0.345	0.09310	N	1	D	0.64830	0.994	P	0.56960	0.81	T	0.42932	-0.9422	9	0.38643	T	0.18	0.5154	9.4644	0.38804	0.0:1.0:0.0:0.0	.	1157	Q6ZQQ2	F75D1_HUMAN	I	1157	ENSP00000341988:T1157I	ENSP00000341988:T1157I	T	+	2	0	FAM75D1	83798675	0.000000	0.05858	0.003000	0.11579	0.005000	0.04900	-0.599000	0.05700	1.937000	0.56155	0.603000	0.83216	ACT	-	NULL		0.418	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31D1	protein_coding	OTTHUMT00000402325.1	C	NM_001001670	-		84608855	+1	no_errors	ENST00000344803	ensembl	human	known	74_37	missense	SNP	0.003	T
AKAP13	11214	genome.wustl.edu	37	15	86118421	86118421	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr15:86118421A>G	ENST00000394518.2	+	6	817	c.722A>G	c.(721-723)gAc>gGc	p.D241G	AKAP13_ENST00000361243.2_Missense_Mutation_p.D241G	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	241					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						CCGTATGGAGACTGTTCTGTG	0.443																																					Melanoma(94;603 1453 3280 32295 32951)												0								ENSG00000170776						153.0	145.0	147.0					15																	86118421		2202	4299	6501	AKAP13	SO:0001583	missense	0			-	HGNC	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.722A>G	15.37:g.86118421A>G	ENSP00000378026:p.Asp241Gly	Somatic	0	43	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	57	40.00	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.D241G	ENST00000394518.2	37	c.722	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	A	18.72	3.685006	0.68157	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.61274	0.12;0.12	5.2	4.08	0.47627	.	.	.	.	.	T	0.56601	0.1996	N	0.14661	0.345	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.60321	-0.7286	9	0.87932	D	0	.	7.622	0.28191	0.9058:0.0:0.0942:0.0	.	241;241	Q12802;Q12802-2	AKP13_HUMAN;.	G	241;241;240;240	ENSP00000354718:D241G;ENSP00000378026:D241G	ENSP00000354718:D241G	D	+	2	0	AKAP13	83919425	1.000000	0.71417	0.997000	0.53966	0.949000	0.60115	3.283000	0.51701	1.104000	0.41587	0.533000	0.62120	GAC	-	NULL		0.443	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	protein_coding	OTTHUMT00000417318.1	A	NM_007200	-		86118421	+1	no_errors	ENST00000361243	ensembl	human	known	74_37	missense	SNP	0.999	G
TMTC1	83857	genome.wustl.edu	37	12	29669380	29669380	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr12:29669380C>T	ENST00000539277.1	-	15	2267	c.2209G>A	c.(2209-2211)Gaa>Aaa	p.E737K	TMTC1_ENST00000256062.5_Missense_Mutation_p.E629K|TMTC1_ENST00000319685.8_5'UTR|TMTC1_ENST00000551659.1_Missense_Mutation_p.E799K|TMTC1_ENST00000552618.1_Missense_Mutation_p.E761K	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	737						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GTCATCTTTTCAGCTTCTTTT	0.463																																																	0								ENSG00000133687						148.0	136.0	140.0					12																	29669380		2203	4300	6503	TMTC1	SO:0001583	missense	0			-	HGNC		CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.2209G>A	12.37:g.29669380C>T	ENSP00000442046:p.Glu737Lys	Somatic	0	19	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	41	29.31	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TPR_1,pfam_TPR_2,pfam_DUF1736,pfam_PIK-rel_kinase_FAT,pfam_TPR-3,smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E629K	ENST00000539277.1	37	c.1885	CCDS53772.1	12	.	.	.	.	.	.	.	.	.	.	C	18.92	3.726214	0.69074	.	.	ENSG00000133687	ENST00000540901;ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277	T;T;T;T	0.52295	0.67;0.67;0.67;1.15	5.26	4.38	0.52667	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.151837	0.64402	D	0.000020	T	0.44414	0.1292	M	0.62723	1.935	0.80722	D	1	P;P;B	0.43578	0.459;0.811;0.105	B;B;B	0.39119	0.291;0.227;0.062	T	0.43294	-0.9400	9	.	.	.	-24.8941	12.5748	0.56357	0.0:0.9199:0.0:0.0801	.	737;799;82	Q8IUR5;F8VTQ9;Q8IUR5-4	TMTC1_HUMAN;.;.	K	500;629;799;761;737	ENSP00000256062:E629K;ENSP00000448112:E799K;ENSP00000449043:E761K;ENSP00000442046:E737K	.	E	-	1	0	TMTC1	29560647	1.000000	0.71417	0.812000	0.32479	0.985000	0.73830	5.225000	0.65294	1.449000	0.47699	0.655000	0.94253	GAA	-	pfscan_TPR-contain_dom		0.463	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	TMTC1	protein_coding	OTTHUMT00000403509.1	C	NM_031920	-		29669380	-1	no_errors	ENST00000256062	ensembl	human	known	74_37	missense	SNP	1.000	T
MRC1	4360	genome.wustl.edu	37	10	18122792	18122792	+	Splice_Site	SNP	G	G	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr10:18122792G>A	ENST00000239761.3	+	4	905	c.802G>A	c.(802-804)Gga>Aga	p.G268R		NM_002438.2	NP_002429.1	P22897	MRC1_HUMAN	mannose receptor, C type 1	268	C-type lectin 1. {ECO:0000255|PROSITE- ProRule:PRU00040}.				receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	mannose binding (GO:0005537)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|kidney(1)|lung(2)|prostate(1)|urinary_tract(1)	6						ATACCTGACAGGTAGTGACAT	0.398																																					GBM(115;1153 1594 28187 28781 35884)												0								ENSG00000120586						69.0	73.0	72.0					10																	18122792		1535	3471	5006	MRC1	SO:0001630	splice_region_variant	0			-	HGNC	J05550	CCDS7123.1, CCDS7123.2	10p13	2014-04-10			ENSG00000120586	ENSG00000260314		"""CD molecules"", ""C-type lectin domain containing"""	7228	protein-coding gene	gene with protein product		153618	"""mannose receptor, C type 1-like 1"""	MRC1L1		1294118	Standard	NM_002438		Approved	CLEC13D, CD206, bA541I19.1, CLEC13DL	uc031ptj.1	P22897	OTTHUMG00000174646	ENST00000239761.3:c.802+1G>A	10.37:g.18122792G>A		Somatic	0	29	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	1	96.55	A5PKW3|Q5VSJ2|Q5VSK2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,pfam_FN_type2_col-bd,pfam_Ricin_B_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin,prints_AntifreezeII	p.G268R	ENST00000239761.3	37	c.802	CCDS7123.1	10	.	.	.	.	.	.	.	.	.	.	G	18.60	3.658100	0.67586	.	.	ENSG00000120586	ENST00000239761	T	0.18338	2.22	3.57	3.57	0.40892	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.56097	U	0.000036	T	0.30166	0.0756	L	0.39085	1.19	0.80722	D	1	D	0.67145	0.996	D	0.68483	0.958	T	0.07139	-1.0788	10	0.56958	D	0.05	-7.7689	14.9246	0.70866	0.0:0.0:1.0:0.0	.	268	P22897	MRC1_HUMAN	R	268	ENSP00000239761:G268R	ENSP00000239761:G268R	G	+	1	0	MRC1	18162798	1.000000	0.71417	1.000000	0.80357	0.640000	0.38277	9.465000	0.97660	1.804000	0.52760	0.436000	0.28706	GGA	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.398	MRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRC1	protein_coding	OTTHUMT00000047057.1	G	NM_002438	-	Missense_Mutation	18122792	+1	no_errors	ENST00000239761	ensembl	human	known	74_37	missense	SNP	1.000	A
MAG	4099	genome.wustl.edu	37	19	35793405	35793405	+	Missense_Mutation	SNP	C	C	T	rs199924214		TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr19:35793405C>T	ENST00000392213.3	+	7	1184	c.1025C>T	c.(1024-1026)aCg>aTg	p.T342M	MAG_ENST00000537831.2_Missense_Mutation_p.T317M|MAG_ENST00000361922.4_Missense_Mutation_p.T342M	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	342	Ig-like C2-type 3.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GAGGGGGAGACGGTCTCTATC	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		20027	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000105695						106.0	88.0	94.0					19																	35793405		2203	4300	6503	MAG	SO:0001583	missense	0			-	HGNC	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.1025C>T	19.37:g.35793405C>T	ENSP00000376048:p.Thr342Met	Somatic	0	27	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	24	52.00	B7Z2E5|F5GYC0|Q567S4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_CD80_C2-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T342M	ENST00000392213.3	37	c.1025	CCDS12455.1	19	.	.	.	.	.	.	.	.	.	.	C	14.54	2.565172	0.45694	.	.	ENSG00000105695	ENST00000262624;ENST00000361922;ENST00000392213;ENST00000537831	T;T;T	0.12879	2.64;2.64;2.64	5.28	4.23	0.50019	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.416754	0.26601	N	0.023466	T	0.31734	0.0806	M	0.74389	2.26	0.46701	D	0.999168	D;D;D	0.76494	0.998;0.995;0.999	P;P;P	0.60012	0.652;0.81;0.867	T	0.04796	-1.0926	10	0.52906	T	0.07	.	11.9245	0.52812	0.0:0.9139:0.0:0.0861	.	379;342;342	Q59GD9;P20916;Q567S4	.;MAG_HUMAN;.	M	379;342;342;317	ENSP00000355234:T342M;ENSP00000376048:T342M;ENSP00000440695:T317M	ENSP00000262624:T379M	T	+	2	0	MAG	40485245	0.586000	0.26782	0.721000	0.30653	0.148000	0.21650	2.130000	0.42064	1.216000	0.43427	0.455000	0.32223	ACG	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.577	MAG-001	KNOWN	basic|CCDS	protein_coding	MAG	protein_coding	OTTHUMT00000466071.1	C	NM_080600	rs199924214		35793405	+1	no_errors	ENST00000392213	ensembl	human	known	74_37	missense	SNP	0.863	T
FAM47C	442444	genome.wustl.edu	37	X	37028799	37028799	+	Silent	SNP	C	C	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chrX:37028799C>A	ENST00000358047.3	+	1	2368	c.2316C>A	c.(2314-2316)tcC>tcA	p.S772S		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	772										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CTGGAGTGTCCCATCTCCACC	0.632																																																	0								ENSG00000198173						41.0	41.0	41.0					X																	37028799		2202	4300	6502	FAM47C	SO:0001819	synonymous_variant	0			-	HGNC	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2316C>A	X.37:g.37028799C>A		Somatic	0	131	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	172	155	52.28	Q6ZU46	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S772	ENST00000358047.3	37	c.2316	CCDS35227.1	X																																																																																			-	NULL		0.632	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	protein_coding	OTTHUMT00000060508.1	C	NM_001013736	-		37028799	+1	no_errors	ENST00000358047	ensembl	human	known	74_37	silent	SNP	0.059	A
UBA2	10054	genome.wustl.edu	37	19	34949766	34949766	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr19:34949766C>G	ENST00000246548.4	+	13	1408	c.1338C>G	c.(1336-1338)agC>agG	p.S446R	UBA2_ENST00000439527.2_Missense_Mutation_p.S350R|UBA2_ENST00000592791.1_5'UTR	NM_005499.2	NP_005490.1	Q9UBT2	SAE2_HUMAN	ubiquitin-like modifier activating enzyme 2	446					cellular protein metabolic process (GO:0044267)|positive regulation of catalytic activity (GO:0043085)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)|SMT3-dependent protein catabolic process (GO:0019950)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|SUMO activating enzyme complex (GO:0031510)	ATP binding (GO:0005524)|enzyme activator activity (GO:0008047)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|SUMO activating enzyme activity (GO:0019948)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	20	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			TATGTGCCAGCAAGCCAGAGG	0.453																																																	0								ENSG00000126261						124.0	109.0	114.0					19																	34949766		2203	4300	6503	UBA2	SO:0001583	missense	0			-	HGNC	BC003153	CCDS12439.1	19q13.11	2008-02-05	2007-11-30	2007-11-30		ENSG00000126261		"""Ubiquitin-like modifier activating enzymes"""	30661	protein-coding gene	gene with protein product	"""UBA2, ubiquitin-activating enzyme E1 homolog (yeast)"""	613295	"""SUMO1 activating enzyme subunit 2"""	SAE2		10187858, 9920803	Standard	NM_005499		Approved	FLJ13058, HRIHFB2115, ARX	uc002nvk.3	Q9UBT2		ENST00000246548.4:c.1338C>G	19.37:g.34949766C>G	ENSP00000246548:p.Ser446Arg	Somatic	0	43	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	36	32.08	B3KWB9|O95605|Q59H87|Q6IBP6|Q9NTJ1|Q9UED2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ThiF_NAD_FAD-bd,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB	p.S446R	ENST00000246548.4	37	c.1338	CCDS12439.1	19	.	.	.	.	.	.	.	.	.	.	C	15.43	2.830965	0.50845	.	.	ENSG00000126261	ENST00000246548;ENST00000439527	T;T	0.31247	1.5;1.5	5.5	3.34	0.38264	Molybdenum cofactor biosynthesis, MoeB (1);	0.035291	0.85682	D	0.000000	T	0.28995	0.0720	M	0.72118	2.19	0.58432	D	0.999996	B	0.19073	0.033	B	0.14578	0.011	T	0.06752	-1.0809	10	0.17832	T	0.49	-15.9676	9.135	0.36868	0.0:0.7685:0.0:0.2315	.	446	Q9UBT2	SAE2_HUMAN	R	446;350	ENSP00000246548:S446R;ENSP00000437484:S350R	ENSP00000246548:S446R	S	+	3	2	UBA2	39641606	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.824000	0.39072	0.779000	0.33543	-0.145000	0.13849	AGC	-	superfamily_Molybdenum_cofac_synth_MoeB		0.453	UBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA2	protein_coding	OTTHUMT00000459257.3	C	NM_005499	-		34949766	+1	no_errors	ENST00000246548	ensembl	human	known	74_37	missense	SNP	1.000	G
PLG	5340	genome.wustl.edu	37	6	161134199	161134199	+	Intron	SNP	A	A	C			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr6:161134199A>C	ENST00000308192.9	+	5	610				PLG_ENST00000462918.1_3'UTR	NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen						blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	TCTGCCCTTCACCTGTAAAAT	0.388																																																	0								ENSG00000122194						52.0	51.0	51.0					6																	161134199		2203	4300	6503	PLG	SO:0001627	intron_variant	0			-	HGNC	M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.547+42A>C	6.37:g.161134199A>C		Somatic	0	63	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	58	38.95	Q15146|Q5TEH4|Q6PA00	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000308192.9	37	NULL	CCDS5279.1	6																																																																																			-	-		0.388	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLG	protein_coding	OTTHUMT00000042959.2	A	NM_000301	-		161134199	+1	no_errors	ENST00000462918	ensembl	human	known	74_37	rna	SNP	0.000	C
VIPR1	7433	genome.wustl.edu	37	3	42573303	42573303	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr3:42573303A>G	ENST00000325123.4	+	9	973	c.860A>G	c.(859-861)gAc>gGc	p.D287G	VIPR1-AS1_ENST00000452639.3_RNA|VIPR1-AS1_ENST00000601312.1_RNA|VIPR1-AS1_ENST00000596630.1_RNA|VIPR1-AS1_ENST00000608869.1_RNA|VIPR1-AS1_ENST00000598837.1_RNA|VIPR1-AS1_ENST00000600342.1_RNA|VIPR1_ENST00000543411.1_Missense_Mutation_p.D239G|VIPR1-AS1_ENST00000593611.1_RNA|VIPR1_ENST00000438259.2_Missense_Mutation_p.D77G|VIPR1-AS1_ENST00000602176.1_RNA|VIPR1-AS1_ENST00000593621.1_RNA|VIPR1-AS1_ENST00000610022.1_RNA|VIPR1_ENST00000433647.1_Missense_Mutation_p.D246G	NM_001251885.1|NM_004624.3	NP_001238814.1|NP_004615.2	P32241	VIPR1_HUMAN	vasoactive intestinal peptide receptor 1	287					digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|muscle contraction (GO:0006936)|positive regulation of cell proliferation (GO:0008284)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|ovary(2)|skin(1)|urinary_tract(3)	18				KIRC - Kidney renal clear cell carcinoma(284;0.241)		AGGTGCTGGGACACCATCAAC	0.582																																																	0								ENSG00000114812						143.0	124.0	130.0					3																	42573303		2203	4300	6503	VIPR1	SO:0001583	missense	0			-	HGNC	AH005329	CCDS2698.1, CCDS58827.1, CCDS58828.1, CCDS58829.1	3p22	2012-08-10			ENSG00000114812	ENSG00000114812		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12694	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 1"""	192321				7708752	Standard	NM_004624		Approved	VPAC1, RDC1, HVR1, VPAC1R	uc003clf.2	P32241	OTTHUMG00000131792	ENST00000325123.4:c.860A>G	3.37:g.42573303A>G	ENSP00000327246:p.Asp287Gly	Somatic	0	49	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	38	41.79	A5JUT9|B3KPV1|B4DEB5|B4DGI4|F5H1F5|G3V0I1|Q15871|Q6P2M6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_VIP_rcpt_1,prints_GPCR_2_secretin-like,prints_GPCR_2_VIP_rcpt	p.D287G	ENST00000325123.4	37	c.860	CCDS2698.1	3	.	.	.	.	.	.	.	.	.	.	A	19.47	3.833582	0.71258	.	.	ENSG00000114812	ENST00000433647;ENST00000543411;ENST00000438259;ENST00000325123	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	5.07	5.07	0.68467	GPCR, family 2-like (1);	0.111129	0.64402	D	0.000017	T	0.62636	0.2444	M	0.65975	2.015	0.58432	D	0.999994	D;D;D;D	0.76494	0.996;0.995;0.989;0.999	D;D;P;D	0.75484	0.976;0.97;0.834;0.986	T	0.67027	-0.5774	10	0.87932	D	0	.	14.8443	0.70249	1.0:0.0:0.0:0.0	.	260;77;239;287	B4DNY6;B4DEB5;F5H1F5;P32241	.;.;.;VIPR1_HUMAN	G	246;239;77;287	ENSP00000394950:D246G;ENSP00000445701:D239G;ENSP00000415371:D77G;ENSP00000327246:D287G	ENSP00000327246:D287G	D	+	2	0	VIPR1	42548307	1.000000	0.71417	1.000000	0.80357	0.448000	0.32197	7.470000	0.80973	1.909000	0.55274	0.533000	0.62120	GAC	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.582	VIPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIPR1	protein_coding	OTTHUMT00000254728.4	A	NM_004624	-		42573303	+1	no_errors	ENST00000325123	ensembl	human	known	74_37	missense	SNP	1.000	G
AARS2	57505	genome.wustl.edu	37	6	44278041	44278041	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr6:44278041G>A	ENST00000244571.4	-	5	891	c.889C>T	c.(889-891)Cag>Tag	p.Q297*	RP11-444E17.6_ENST00000505802.1_Intron	NM_020745.3	NP_065796			alanyl-tRNA synthetase 2, mitochondrial											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(2)|stomach(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTCACCTGCTGTATGGCGTTG	0.542																																																	0								ENSG00000124608						134.0	105.0	115.0					6																	44278041		2203	4300	6503	AARS2	SO:0001587	stop_gained	0			-	HGNC	AB033096	CCDS34464.1	6p21.1	2012-10-26	2012-10-26	2007-02-23	ENSG00000124608	ENSG00000124608	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	21022	protein-coding gene	gene with protein product	"""alanine tRNA ligase 2, mitochondrial"""	612035	"""alanyl-tRNA synthetase like"", ""alanyl-tRNA synthetase 2, mitochondrial (putative)"""	AARSL		15779907, 21549344	Standard	NM_020745		Approved	KIAA1270, bA444E17.1	uc010jza.1	Q5JTZ9	OTTHUMG00000014766	ENST00000244571.4:c.889C>T	6.37:g.44278041G>A	ENSP00000244571:p.Gln297*	Somatic	0	22	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	49	39.51		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ala-tRNA-synth_IIc_N,pfam_tRNA_SAD,superfamily_Ala-tRNA-ligase_IIc_anticod-bd,superfamily_Thr/Ala-tRNA-synth_IIc_edit,smart_tRNA_SAD,prints_Ala-tRNA-lgiase_IIc,pfscan_Ala-tRNA-synth_IIc_core,tigrfam_Ala-tRNA-lgiase_IIc	p.Q297*	ENST00000244571.4	37	c.889	CCDS34464.1	6	.	.	.	.	.	.	.	.	.	.	G	25.2	4.610390	0.87258	.	.	ENSG00000124608	ENST00000244571	.	.	.	4.72	3.86	0.44501	.	0.334072	0.34777	N	0.003687	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-7.6499	8.7998	0.34901	0.0797:0.1501:0.7702:0.0	.	.	.	.	X	297	.	ENSP00000244571:Q297X	Q	-	1	0	AARS2	44386019	1.000000	0.71417	0.997000	0.53966	0.477000	0.33069	6.361000	0.73070	1.231000	0.43661	-0.140000	0.14226	CAG	-	pfam_Ala-tRNA-synth_IIc_N,superfamily_Ala-tRNA-ligase_IIc_anticod-bd,pfscan_Ala-tRNA-synth_IIc_core,tigrfam_Ala-tRNA-lgiase_IIc		0.542	AARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AARS2	protein_coding	OTTHUMT00000040741.2	G	NM_020745	-		44278041	-1	no_errors	ENST00000244571	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ACSL6	23305	genome.wustl.edu	37	5	131305834	131305834	+	Silent	SNP	G	G	A	rs138919958		TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr5:131305834G>A	ENST00000379240.1	-	15	1572	c.1419C>T	c.(1417-1419)ggC>ggT	p.G473G	ACSL6_ENST00000379272.2_Silent_p.G488G|ACSL6_ENST00000379255.1_Silent_p.G398G|AC034228.4_ENST00000446275.1_RNA|ACSL6_ENST00000357096.1_Silent_p.G398G|ACSL6_ENST00000379249.3_Silent_p.G473G|ACSL6_ENST00000431707.1_Silent_p.G453G|ACSL6_ENST00000543479.1_Silent_p.G473G|ACSL6_ENST00000544770.1_Silent_p.G382G|ACSL6_ENST00000379244.1_Silent_p.G473G|ACSL6_ENST00000296869.4_Silent_p.G498G|ACSL6_ENST00000379246.1_Silent_p.G484G|ACSL6_ENST00000379264.2_Silent_p.G498G			Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	473					acyl-CoA metabolic process (GO:0006637)|cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|fatty acid transport (GO:0015908)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|phospholipid biosynthetic process (GO:0008654)|positive regulation of neuron projection development (GO:0010976)|positive regulation of plasma membrane long-chain fatty acid transport (GO:0010747)|positive regulation of triglyceride biosynthetic process (GO:0010867)|response to gravity (GO:0009629)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	35		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGGTCCAGTCGCCAGGAGTGG	0.502													G|||	1	0.000199681	0.0	0.0	5008	,	,		19488	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000164398	G	,,,,,	1,4405	2.1+/-5.4	0,1,2202	173.0	151.0	158.0		1494,1389,1419,1452,1194,1494	0.3	1.0	5	dbSNP_134	158	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ACSL6	NM_001009185.2,NM_001205247.1,NM_001205248.1,NM_001205250.1,NM_001205251.1,NM_015256.3	,,,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,,,	498/723,463/688,473/698,484/709,398/623,498/723	131305834	1,13005	2203	4300	6503	ACSL6	SO:0001819	synonymous_variant	0			-	HGNC	AB020644	CCDS34228.1, CCDS34229.1, CCDS56381.1, CCDS56382.1, CCDS56383.1	5q31	2008-02-05	2004-02-19	2004-02-20	ENSG00000164398	ENSG00000164398		"""Acyl-CoA synthetase family"""	16496	protein-coding gene	gene with protein product		604443	"""fatty-acid-Coenzyme A ligase, long-chain 6"""	FACL6		10502316, 10548543	Standard	NM_015256		Approved	KIAA0837, ACS2, LACS5, LACS2	uc003kvy.2	Q9UKU0	OTTHUMG00000150692	ENST00000379240.1:c.1419C>T	5.37:g.131305834G>A		Somatic	0	39	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	43	41.33	J3KPG3|O94924|O95829|Q108M9|Q108N0|Q4G191|Q86TN7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig	p.G498	ENST00000379240.1	37	c.1494		5																																																																																			-	pfam_AMP-dep_Synth/Lig		0.502	ACSL6-004	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	ACSL6	protein_coding	OTTHUMT00000132622.1	G	NM_015256	rs138919958		131305834	-1	no_errors	ENST00000296869	ensembl	human	known	74_37	silent	SNP	0.999	A
CUBN	8029	genome.wustl.edu	37	10	16873360	16873360	+	Silent	SNP	C	C	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr10:16873360C>T	ENST00000377833.4	-	65	10484	c.10419G>A	c.(10417-10419)ctG>ctA	p.L3473L		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3473	CUB 26. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGTTTGGCAGCAGAGTTCCAC	0.378																																																	0								ENSG00000107611						136.0	125.0	129.0					10																	16873360		2203	4300	6503	CUBN	SO:0001819	synonymous_variant	0			-	HGNC	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.10419G>A	10.37:g.16873360C>T		Somatic	0	28	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	45	33.82	B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.L3473	ENST00000377833.4	37	c.10419	CCDS7113.1	10																																																																																			-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.378	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	protein_coding	OTTHUMT00000047009.1	C	NM_001081	-		16873360	-1	no_errors	ENST00000377833	ensembl	human	known	74_37	silent	SNP	0.939	T
MIR518F	574472	genome.wustl.edu	37	19	54200859	54200859	+	RNA	SNP	G	G	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr19:54200859G>A	ENST00000384973.1	+	0	0				MIR525_ENST00000384978.1_RNA|MIR523_ENST00000385281.1_RNA|MIR519B_ENST00000385090.1_RNA	NR_030194.1				microRNA 518f																		CCTTTAGAGCGTTACGGTTTG	0.428																																																	0								ENSG00000207711						66.0	64.0	64.0					19																	54200859		1568	3582	5150	MIR525			0			-	HGNC			19q13.42	2011-09-12		2008-12-18	ENSG00000207706	ENSG00000207706		"""ncRNAs / Micro RNAs"""	32104	non-coding RNA	RNA, micro				MIRN518F			Standard	NR_030194		Approved	hsa-mir-518f	uc021uzx.1				19.37:g.54200859G>A		Somatic	0	67	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	58	57	50.43		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000384973.1	37	NULL		19																																																																																			-	-		0.428	MIR518F-201	KNOWN	basic	miRNA	MIR525	miRNA		G	NR_030194	-		54200859	+1	no_errors	ENST00000384978	ensembl	human	known	74_37	rna	SNP	0.020	A
LOC403323	403323	genome.wustl.edu	37	9	66513513	66513513	+	IGR	SNP	C	C	A	rs201075544		TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr9:66513513C>A								RP11-262H14.1 (44203 upstream) : RP11-262H14.7 (3692 downstream)																							CGAACACTGCCTTAAGAACTT	0.498																																																	0								ENSG00000234665																																			RP11-262H14.3	SO:0001628	intergenic_variant	0			-	Clone_based_vega_gene																													9.37:g.66513513C>A		Somatic	0	42	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	102	8.11		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		9																																																																																			-	-	0	0.498					FLJ20444			C		rs201075544		66513513	-1	no_errors	ENST00000586625	ensembl	human	known	74_37	rna	SNP	1.000	A
LRRC75A	388341	genome.wustl.edu	37	17	16344167	16344167	+	IGR	DEL	A	A	-	rs112317984|rs555182592	byFrequency	TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr17:16344167delA	ENST00000409083.3	-	0	2656				C17orf76-AS1_ENST00000477249.2_RNA|C17orf76-AS1_ENST00000580770.1_RNA|C17orf76-AS1_ENST00000492250.1_RNA|C17orf76-AS1_ENST00000475947.2_RNA|C17orf76-AS1_ENST00000581718.1_RNA|C17orf76-AS1_ENST00000384229.1_RNA|C17orf76-AS1_ENST00000584926.1_RNA|C17orf76-AS1_ENST00000472367.1_RNA|C17orf76-AS1_ENST00000579473.1_RNA|C17orf76-AS1_ENST00000481027.1_RNA|C17orf76-AS1_ENST00000480811.1_RNA|C17orf76-AS1_ENST00000491009.1_RNA|C17orf76-AS1_ENST00000584141.1_RNA|C17orf76-AS1_ENST00000460249.1_RNA|C17orf76-AS1_ENST00000584177.1_RNA|C17orf76-AS1_ENST00000470491.2_RNA|C17orf76-AS1_ENST00000481898.1_RNA|C17orf76-AS1_ENST00000581913.1_RNA|C17orf76-AS1_ENST00000582911.1_RNA|C17orf76-AS1_ENST00000478103.2_RNA|C17orf76-AS1_ENST00000578380.2_RNA|C17orf76-AS1_ENST00000483140.1_RNA|C17orf76-AS1_ENST00000583400.2_RNA|C17orf76-AS1_ENST00000475953.1_RNA|C17orf76-AS1_ENST00000487066.1_RNA|RP11-138I1.3_ENST00000585048.1_lincRNA|C17orf76-AS1_ENST00000580180.1_RNA|C17orf76-AS1_ENST00000365172.1_RNA|C17orf76-AS1_ENST00000484836.1_RNA|C17orf76-AS1_ENST00000391079.1_RNA	NM_207387.3	NP_997270.2														lung(1)	1						actccatctcaaaaaaaaaaa	0.413																																																	0								ENSG00000266651																																			RP11-138I1.3	SO:0001628	intergenic_variant	0				Clone_based_vega_gene																													17.37:g.16344167delA		Somatic	0	9	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	10	41.18		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000409083.3	37	NULL	CCDS11178.2	17																																																																																			-	-		0.413	FAM211A-001	NOVEL	basic|exp_conf|CCDS	protein_coding	ENSG00000266651	protein_coding	OTTHUMT00000130461.2	A				16344167	-1	no_errors	ENST00000585048	ensembl	human	known	74_37	rna	DEL	0.000	-
PCDHGB3	56102	genome.wustl.edu	37	5	140807667	140807667	+	Intron	SNP	G	G	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr5:140807667G>A	ENST00000576222.1	+	1	2546				PCDHGA8_ENST00000398604.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA12_ENST00000252085.3_5'Flank|PCDHGA10_ENST00000398610.2_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB8P_ENST00000502926.1_RNA|PCDHGB1_ENST00000523390.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCCTACCACGTGCTGCAGGC	0.657																																																	0								ENSG00000248449																																			PCDHGB8P	SO:0001627	intron_variant	0			-	HGNC	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2415+55291G>A	5.37:g.140807667G>A		Somatic	0	59	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	70	69	50.36	A7E229|Q9Y5C7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000576222.1	37	NULL	CCDS58980.1	5																																																																																			-	-		0.657	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB8P	protein_coding	OTTHUMT00000437094.1	G	NM_018924	-		140807667	+1	no_errors	ENST00000502926	ensembl	human	known	74_37	rna	SNP	0.970	A
NCOR2	9612	genome.wustl.edu	37	12	124832774	124832774	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr12:124832774A>T	ENST00000405201.1	-	29	3931	c.3931T>A	c.(3931-3933)Tat>Aat	p.Y1311N	NCOR2_ENST00000397355.1_Missense_Mutation_p.Y1302N|NCOR2_ENST00000404121.2_Missense_Mutation_p.Y872N|NCOR2_ENST00000404621.1_Missense_Mutation_p.Y1301N|NCOR2_ENST00000356219.3_Missense_Mutation_p.Y1318N|NCOR2_ENST00000429285.2_Missense_Mutation_p.Y1301N			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1319					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		ATCATGTCATAGGTGCGCTTG	0.632											OREG0022238	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000196498						41.0	48.0	46.0					12																	124832774		2034	4160	6194	NCOR2	SO:0001583	missense	0			-	HGNC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.3931T>A	12.37:g.124832774A>T	ENSP00000384018:p.Tyr1311Asn	Somatic	0	48	0.00	1537	0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	107	10.08	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.Y1318N	ENST00000405201.1	37	c.3952	CCDS41858.2	12	.	.	.	.	.	.	.	.	.	.	A	16.54	3.151526	0.57151	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000429285;ENST00000458234	T;T;T;T;T;T;T	0.55930	0.56;0.56;0.56;0.56;0.56;0.56;0.49	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.69611	0.3130	L	0.61218	1.895	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.85130	0.997;0.994;0.997	T	0.73467	-0.3973	10	0.87932	D	0	-17.4956	14.7178	0.69284	1.0:0.0:0.0:0.0	.	1301;1302;1311	C9J0Q5;C9J239;C9JFD3	.;.;.	N	1311;1301;1318;1302;1310;872;1301;1319	ENSP00000384018:Y1311N;ENSP00000384202:Y1301N;ENSP00000348551:Y1318N;ENSP00000380513:Y1302N;ENSP00000385618:Y872N;ENSP00000400281:Y1301N;ENSP00000402808:Y1319N	ENSP00000348551:Y1318N	Y	-	1	0	NCOR2	123398727	1.000000	0.71417	0.998000	0.56505	0.685000	0.39939	6.298000	0.72763	1.879000	0.54435	0.459000	0.35465	TAT	-	NULL		0.632	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	protein_coding	OTTHUMT00000318173.2	A	NM_006312	-		124832774	-1	no_errors	ENST00000356219	ensembl	human	known	74_37	missense	SNP	1.000	T
MLIP	90523	genome.wustl.edu	37	6	53986337	53986337	+	Silent	SNP	C	C	G			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr6:53986337C>G	ENST00000274897.5	+	2	269	c.156C>G	c.(154-156)acC>acG	p.T52T	MLIP_ENST00000514921.1_Silent_p.T52T|MLIP_ENST00000511744.1_3'UTR|MLIP_ENST00000509997.1_Intron|MLIP_ENST00000370877.2_Intron|MLIP_ENST00000370876.2_Intron|MLIP_ENST00000358276.5_Silent_p.T46T|MLIP_ENST00000502396.1_Silent_p.T63T	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein	52						nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						TGGCTGACACCTCTAAATTCC	0.378																																																	0								ENSG00000146147						101.0	100.0	100.0					6																	53986337		2203	4300	6503	MLIP	SO:0001819	synonymous_variant	0			-	HGNC	AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.156C>G	6.37:g.53986337C>G		Somatic	0	33	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	30	41.18	B7Z2N0|D6RE05|Q96H08|Q96NF7	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T52	ENST00000274897.5	37	c.156	CCDS4954.1	6																																																																																			-	NULL		0.378	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLIP	protein_coding	OTTHUMT00000040979.3	C	NM_138569	-		53986337	+1	no_errors	ENST00000274897	ensembl	human	known	74_37	silent	SNP	1.000	G
MYF6	4618	genome.wustl.edu	37	12	81102319	81102319	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr12:81102319T>A	ENST00000228641.3	+	2	758	c.536T>A	c.(535-537)tTc>tAc	p.F179Y		NM_002469.2	NP_002460.1	P23409	MYF6_HUMAN	myogenic factor 6 (herculin)	179					muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|skin(1)	26						GGTGCGGATTTCCTGCGCACC	0.592																																																	0								ENSG00000111046						66.0	71.0	69.0					12																	81102319		2203	4300	6503	MYF6	SO:0001583	missense	0			-	HGNC		CCDS9019.1	12q21	2013-05-21				ENSG00000111046		"""Basic helix-loop-helix proteins"""	7566	protein-coding gene	gene with protein product	"""muscle-specific regulatory factor 4"""	159991				8978788	Standard	NM_002469		Approved	MRF4, bHLHc4	uc001szf.2	P23409		ENST00000228641.3:c.536T>A	12.37:g.81102319T>A	ENSP00000228641:p.Phe179Tyr	Somatic	0	74	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	72	37.93	B2R898|Q53X80|Q6FHI9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Basic,pfam_bHLH_dom,superfamily_bHLH_dom,smart_Basic,smart_bHLH_dom,pfscan_bHLH_dom	p.F179Y	ENST00000228641.3	37	c.536	CCDS9019.1	12	.	.	.	.	.	.	.	.	.	.	T	0.018	-1.480595	0.01027	.	.	ENSG00000111046	ENST00000228641	D	0.95980	-3.87	5.36	4.21	0.49690	.	0.266653	0.37857	N	0.001919	D	0.90099	0.6907	L	0.57536	1.79	0.46458	D	0.999056	P	0.40144	0.704	B	0.31442	0.13	D	0.86946	0.2082	10	0.02654	T	1	-29.5767	9.0697	0.36484	0.0:0.0847:0.0:0.9153	.	179	P23409	MYF6_HUMAN	Y	179	ENSP00000228641:F179Y	ENSP00000228641:F179Y	F	+	2	0	MYF6	79626450	1.000000	0.71417	1.000000	0.80357	0.111000	0.19643	3.388000	0.52509	0.968000	0.38212	-0.256000	0.11100	TTC	-	NULL		0.592	MYF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYF6	protein_coding	OTTHUMT00000407756.1	T	NM_002469	-		81102319	+1	no_errors	ENST00000228641	ensembl	human	known	74_37	missense	SNP	1.000	A
PLIN2	123	genome.wustl.edu	37	9	19116354	19116354	+	Silent	SNP	T	T	C			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr9:19116354T>C	ENST00000276914.2	-	8	1385	c.1206A>G	c.(1204-1206)gtA>gtG	p.V402V	PLIN2_ENST00000411567.1_Silent_p.V321V	NM_001122.3	NP_001113.2	Q99541	PLIN2_HUMAN	perilipin 2	402					cellular lipid metabolic process (GO:0044255)|lipid storage (GO:0019915)|long-chain fatty acid transport (GO:0015909)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	19						AAAAGGGACCTACCAGCCAGT	0.498																																																	0								ENSG00000147872						91.0	84.0	87.0					9																	19116354		2203	4300	6503	PLIN2	SO:0001819	synonymous_variant	0			-	HGNC	X97324	CCDS6490.1	9p22.1	2009-08-12	2009-08-12	2009-08-12	ENSG00000147872	ENSG00000147872		"""Perilipins"""	248	protein-coding gene	gene with protein product	"""adipophilin"""	103195	"""adipose differentiation-related protein"""	ADFP		9003395, 19638644	Standard	NM_001122		Approved	ADRP	uc003zno.3	Q99541	OTTHUMG00000019624	ENST00000276914.2:c.1206A>G	9.37:g.19116354T>C		Somatic	0	74	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	67	75	47.18	Q9BSC3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Perilipin,pirsf_Perilipin	p.V402	ENST00000276914.2	37	c.1206	CCDS6490.1	9																																																																																			-	pirsf_Perilipin		0.498	PLIN2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	PLIN2	protein_coding	OTTHUMT00000051835.1	T	NM_001122	-		19116354	-1	no_errors	ENST00000276914	ensembl	human	known	74_37	silent	SNP	1.000	C
MYH4	4622	genome.wustl.edu	37	17	10355349	10355349	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr17:10355349C>T	ENST00000255381.2	-	27	3757	c.3647G>A	c.(3646-3648)cGg>cAg	p.R1216Q	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1216					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						CTGCTTGACCCGCTGAAGGCT	0.527																																																	0								ENSG00000264424						110.0	87.0	94.0					17																	10355349		2203	4300	6503	MYH4	SO:0001583	missense	0			-	HGNC		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.3647G>A	17.37:g.10355349C>T	ENSP00000255381:p.Arg1216Gln	Somatic	0	50	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	107	33.12		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1216Q	ENST00000255381.2	37	c.3647	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	C	29.7	5.025232	0.93518	.	.	ENSG00000141048	ENST00000255381	T	0.80214	-1.35	5.51	5.51	0.81932	Myosin tail (1);	0.000000	0.35870	U	0.002927	D	0.90338	0.6977	M	0.81497	2.545	0.52501	D	0.99995	D	0.89917	1.0	D	0.85130	0.997	D	0.89053	0.3457	10	0.40728	T	0.16	.	19.7768	0.96398	0.0:1.0:0.0:0.0	.	1216	Q9Y623	MYH4_HUMAN	Q	1216	ENSP00000255381:R1216Q	ENSP00000255381:R1216Q	R	-	2	0	MYH4	10296074	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	7.733000	0.84916	2.745000	0.94114	0.655000	0.94253	CGG	-	pfam_Myosin_tail,superfamily_Prefoldin		0.527	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	protein_coding	OTTHUMT00000252731.1	C	NM_017533	-		10355349	-1	no_errors	ENST00000255381	ensembl	human	known	74_37	missense	SNP	1.000	T
AP001631.10	0	genome.wustl.edu	37	21	44579697	44579697	+	Silent	SNP	G	G	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr21:44579697G>A	ENST00000433840.1	-	3	530	c.345C>T	c.(343-345)aaC>aaT	p.N115N																								GACTGCTGGCGTTACGGGAAT	0.597																																																	0								ENSG00000228120																																			AP001631.10	SO:0001819	synonymous_variant	0			-	Clone_based_vega_gene																												ENST00000433840.1:c.345C>T	21.37:g.44579697G>A		Somatic	0	66	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	52	70	42.62		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.N115	ENST00000433840.1	37	c.345		21																																																																																			-	NULL		0.597	AP001631.10-001	PUTATIVE	basic|appris_principal	protein_coding	ENSG00000228120	protein_coding	OTTHUMT00000195568.1	G		-		44579697	-1	no_errors	ENST00000433840	ensembl	human	putative	74_37	silent	SNP	0.063	A
ADAMTSL3	57188	genome.wustl.edu	37	15	84611788	84611788	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr15:84611788C>T	ENST00000286744.5	+	19	2668	c.2444C>T	c.(2443-2445)gCc>gTc	p.A815V	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.A815V	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	815	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			AAGTCCTGTGCCAGGACAGAC	0.512																																																	0								ENSG00000156218						72.0	63.0	66.0					15																	84611788		2203	4300	6503	ADAMTSL3	SO:0001583	missense	0			-	HGNC	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.2444C>T	15.37:g.84611788C>T	ENSP00000286744:p.Ala815Val	Somatic	0	33	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom,prints_Peptidase_M12B_ADAM-TS	p.A815V	ENST00000286744.5	37	c.2444	CCDS10326.1	15	.	.	.	.	.	.	.	.	.	.	C	22.2	4.255082	0.80135	.	.	ENSG00000156218	ENST00000286744	T	0.60299	0.2	5.08	4.09	0.47781	.	0.480689	0.15875	N	0.240353	T	0.59824	0.2222	N	0.25789	0.76	0.31667	N	0.644868	P;D	0.76494	0.778;0.999	P;P	0.62491	0.596;0.903	T	0.60042	-0.7340	10	0.30854	T	0.27	.	13.3742	0.60728	0.0:0.7098:0.2902:0.0	.	815;815	P82987-2;P82987	.;ATL3_HUMAN	V	815	ENSP00000286744:A815V	ENSP00000286744:A815V	A	+	2	0	ADAMTSL3	82402792	0.999000	0.42202	0.997000	0.53966	0.996000	0.88848	2.133000	0.42093	2.358000	0.79984	0.655000	0.94253	GCC	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.512	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL3	protein_coding	OTTHUMT00000304007.2	C	NM_207517	-		84611788	+1	no_errors	ENST00000286744	ensembl	human	known	74_37	missense	SNP	0.996	T
THOC2	57187	genome.wustl.edu	37	X	122756709	122756709	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chrX:122756709T>G	ENST00000245838.8	-	30	3716	c.3685A>C	c.(3685-3687)Aaa>Caa	p.K1229Q	THOC2_ENST00000491737.1_Missense_Mutation_p.K1114Q|THOC2_ENST00000497887.1_5'Flank|THOC2_ENST00000355725.4_Missense_Mutation_p.K1229Q	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	1229					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						TCCCTTGATTTATCTGAAATA	0.338																																																	0								ENSG00000125676						83.0	66.0	71.0					X																	122756709		1819	4067	5886	THOC2	SO:0001583	missense	0			-	HGNC	AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.3685A>C	X.37:g.122756709T>G	ENSP00000245838:p.Lys1229Gln	Somatic	0	51	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	47	49.46	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_THO_THOC2_C,pfam_THO_THOC2_N	p.K1229Q	ENST00000245838.8	37	c.3685	CCDS43988.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.74|12.74	2.029022|2.029022	0.35797|0.35797	.|.	.|.	ENSG00000125676|ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737|ENST00000438358	T;T;T|.	0.42513|.	0.97;0.97;0.97|.	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|.	0.56615|.	0.1997|.	L|L	0.32530|0.32530	0.975|0.975	0.58432|0.58432	D|D	0.999995|0.999995	D|.	0.53619|.	0.961|.	P|.	0.47206|.	0.541|.	T|.	0.53549|.	-0.8423|.	9|.	.|.	.|.	.|.	-17.4268|-17.4268	14.9574|14.9574	0.71127|0.71127	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1229|.	Q8NI27|.	THOC2_HUMAN|.	Q|S	1229;1229;1114|323	ENSP00000245838:K1229Q;ENSP00000347959:K1229Q;ENSP00000419795:K1114Q|.	.|.	K|X	-|-	1|2	0|2	THOC2|THOC2	122584390|122584390	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.393000|5.393000	0.66279|0.66279	1.915000|1.915000	0.55452|0.55452	0.437000|0.437000	0.28790|0.28790	AAA|TAA	-	NULL		0.338	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC2	protein_coding	OTTHUMT00000058153.3	T		-		122756709	-1	no_errors	ENST00000245838	ensembl	human	known	74_37	missense	SNP	1.000	G
ANAPC2	29882	genome.wustl.edu	37	9	140070253	140070253	+	Silent	SNP	G	G	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr9:140070253G>A	ENST00000323927.2	-	11	1931	c.1927C>T	c.(1927-1929)Ctg>Ttg	p.L643L	ANAPC2_ENST00000487917.1_5'UTR	NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2	643					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		ATGGTCACCAGGCCCAGGGTG	0.662																																																	0								ENSG00000176248						61.0	46.0	51.0					9																	140070253		2195	4296	6491	ANAPC2	SO:0001819	synonymous_variant	0			-	HGNC	AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.1927C>T	9.37:g.140070253G>A		Somatic	0	54	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	63	42.73	Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cullin_N,pfam_APC_su2_C,superfamily_Cullin_homology,smart_Cullin_homology,pfscan_Cullin_homology	p.L643	ENST00000323927.2	37	c.1927	CCDS7033.1	9																																																																																			-	pfam_Cullin_N,superfamily_Cullin_homology,smart_Cullin_homology,pfscan_Cullin_homology		0.662	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC2	protein_coding	OTTHUMT00000055315.1	G	NM_013366	-		140070253	-1	no_errors	ENST00000323927	ensembl	human	known	74_37	silent	SNP	0.998	A
RP11-509A17.3	0	genome.wustl.edu	37	15	20563408	20563417	+	lincRNA	DEL	CCTCTCCCTT	CCTCTCCCTT	-	rs537093760|rs537797892	byFrequency	TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	CCTCTCCCTT	CCTCTCCCTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr15:20563408_20563417delCCTCTCCCTT	ENST00000557528.1	+	0	1812				AC026495.1_ENST00000581090.1_RNA																							CCTCCCAGAGcctctcccttcctctccctt	0.671														795	0.158746	0.1793	0.1427	5008	,	,		62278	0.1319		0.1322	False		,,,				2504	0.1973																0								ENSG00000265002																																			AC026495.1			0				Clone_based_ensembl_gene																													15.37:g.20563418_20563427delCCTCTCCCTT		Somatic	NA	NA	NA		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000557528.1	37	NULL		15																																																																																			-	-		0.671	RP11-509A17.3-001	KNOWN	basic	lincRNA	ENSG00000265002	lincRNA	OTTHUMT00000414658.1	CCTCTCCCTT				20563417	+1	no_errors	ENST00000581090	ensembl	human	novel	74_37	rna	DEL	0.055:0.047:0.032:0.034:0.033:0.036:0.075:0.098:0.111:0.132	-
ILF2	3608	genome.wustl.edu	37	1	153634783	153634783	+	3'UTR	SNP	C	C	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr1:153634783C>T	ENST00000361891.4	-	0	1387				ILF2_ENST00000480213.1_5'UTR	NM_001267809.1|NM_004515.3	NP_001254738.1|NP_004506.2	Q12905	ILF2_HUMAN	interleukin enhancer binding factor 2						immune response (GO:0006955)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|transferase activity (GO:0016740)			cervix(1)|kidney(1)|lung(4)|skin(1)	7	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCCTATCCCACGGAAATGTCT	0.483																																																	0								ENSG00000143621																																			ILF2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U10323	CCDS1050.1, CCDS72919.1	1q21.3	2012-12-04	2012-12-04		ENSG00000143621	ENSG00000143621			6037	protein-coding gene	gene with protein product		603181	"""interleukin enhancer binding factor 2, 45kD"", ""interleukin enhancer binding factor 2, 45kDa"""			7519613	Standard	NM_004515		Approved	NF45	uc001fcr.4	Q12905	OTTHUMG00000037087	ENST00000361891.4:c.*89G>A	1.37:g.153634783C>T		Somatic	0	37	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	55	11.29	A6NDB0|B2R8G7|Q5SR10|Q5SR11|Q7L7R3|Q9BWD4|Q9P1N0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361891.4	37	NULL	CCDS1050.1	1																																																																																			-	-		0.483	ILF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILF2	protein_coding	OTTHUMT00000090040.1	C	NM_004515	-		153634783	-1	no_errors	ENST00000480213	ensembl	human	known	74_37	rna	SNP	0.419	T
PCNXL2	80003	genome.wustl.edu	37	1	233122167	233122167	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr1:233122167T>C	ENST00000258229.9	-	33	6145	c.5911A>G	c.(5911-5913)Acc>Gcc	p.T1971A	PCNXL2_ENST00000344698.2_Missense_Mutation_p.T623A	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1971	Ser-rich.					integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				TGCACTGAGGTGGACGTCTGG	0.662																																																	0								ENSG00000135749						20.0	27.0	24.0					1																	233122167		2049	4184	6233	PCNXL2	SO:0001583	missense	0			-	HGNC	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.5911A>G	1.37:g.233122167T>C	ENSP00000258229:p.Thr1971Ala	Somatic	0	40	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	68	32.35	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pecanex,superfamily_Trypsin-like_Pept_dom	p.T1971A	ENST00000258229.9	37	c.5911	CCDS44335.1	1	.	.	.	.	.	.	.	.	.	.	T	11.77	1.737513	0.30774	.	.	ENSG00000135749	ENST00000344698;ENST00000258229	T;T	0.25250	1.81;2.99	5.85	-2.92	0.05615	.	0.421931	0.26016	N	0.026845	T	0.23886	0.0578	M	0.65975	2.015	0.80722	D	1	B;B	0.28378	0.209;0.204	B;B	0.33521	0.116;0.165	T	0.02625	-1.1132	10	0.41790	T	0.15	.	7.9038	0.29750	0.5221:0.0585:0.0:0.4194	.	1971;623	A6NKB5;A6NKB5-3	PCX2_HUMAN;.	A	623;1971	ENSP00000340759:T623A;ENSP00000258229:T1971A	ENSP00000258229:T1971A	T	-	1	0	PCNXL2	231188790	1.000000	0.71417	0.504000	0.27639	0.151000	0.21798	0.921000	0.28718	-0.833000	0.04245	-0.516000	0.04426	ACC	-	NULL		0.662	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	protein_coding	OTTHUMT00000092480.3	T	NM_014801	-		233122167	-1	no_errors	ENST00000258229	ensembl	human	known	74_37	missense	SNP	0.935	C
FOXD4L3	286380	genome.wustl.edu	37	9	70918571	70918571	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr9:70918571C>G	ENST00000342833.2	+	1	1296	c.704C>G	c.(703-705)cCt>cGt	p.P235R		NM_199135.4	NP_954586.4	Q6VB84	FX4L3_HUMAN	forkhead box D4-like 3	235						nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			ovary(1)	1				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		CGCCCAGGCCCTCTGCTTGGG	0.716																																																	0								ENSG00000187559						1.0	1.0	1.0					9																	70918571		138	366	504	FOXD4L3	SO:0001583	missense	0			-	HGNC	AY344642	CCDS43833.1	9q13	2008-05-13				ENSG00000187559			18523	protein-coding gene	gene with protein product		611086				12421752	Standard	NM_199135		Approved	OTTHUMG00000019959, FOXD6	uc004agm.1	Q6VB84	OTTHUMG00000019959	ENST00000342833.2:c.704C>G	9.37:g.70918571C>G	ENSP00000341961:p.Pro235Arg	Somatic	0	36	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	50	13.79	Q5JTX9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.P235R	ENST00000342833.2	37	c.704	CCDS43833.1	9	.	.	.	.	.	.	.	.	.	.	.	2.380	-0.342205	0.05243	.	.	ENSG00000187559	ENST00000342833	D	0.94576	-3.46	3.57	2.23	0.28157	.	.	.	.	.	D	0.86682	0.5991	N	0.24115	0.695	0.20764	N	0.999853	B	0.29909	0.261	B	0.20577	0.03	T	0.75938	-0.3141	9	0.33940	T	0.23	.	5.5441	0.17053	0.0:0.2527:0.0:0.7473	.	235	Q6VB84	FX4L3_HUMAN	R	235	ENSP00000341961:P235R	ENSP00000341961:P235R	P	+	2	0	FOXD4L3	70108391	0.002000	0.14202	0.012000	0.15200	0.093000	0.18481	0.388000	0.20735	0.354000	0.24105	-0.680000	0.03767	CCT	-	NULL		0.716	FOXD4L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD4L3	protein_coding	OTTHUMT00000052539.2	C	NM_199358	-		70918571	+1	no_errors	ENST00000342833	ensembl	human	known	74_37	missense	SNP	0.536	G
SCML2	10389	genome.wustl.edu	37	X	18257532	18257532	+	3'UTR	SNP	T	T	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chrX:18257532T>A	ENST00000251900.4	-	0	4101				SCML2_ENST00000491988.1_5'UTR	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)						anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					GGGTACAGCATCTTCATACAA	0.284																																					Esophageal Squamous(100;1252 1965 19021 35517)												0								ENSG00000102098																																			SCML2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.*1839A>T	X.37:g.18257532T>A		Somatic	0	42	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	32	60.00	Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000251900.4	37	NULL	CCDS14185.1	X																																																																																			-	-		0.284	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCML2	protein_coding	OTTHUMT00000055941.1	T	NM_006089	-		18257532	-1	no_errors	ENST00000491988	ensembl	human	known	74_37	rna	SNP	0.979	A
SNAPC4	6621	genome.wustl.edu	37	9	139275295	139275295	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr9:139275295T>C	ENST00000298532.2	-	19	2764	c.2396A>G	c.(2395-2397)cAc>cGc	p.H799R		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa											biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		AGTATCGATGTGGAACAGCTG	0.637																																																	0								ENSG00000165684						48.0	45.0	46.0					9																	139275295		2201	4298	6499	SNAPC4	SO:0001583	missense	0			-	HGNC	AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.2396A>G	9.37:g.139275295T>C	ENSP00000298532:p.His799Arg	Somatic	0	76	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	58	63	47.93		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.H799R	ENST00000298532.2	37	c.2396	CCDS6998.1	9	.	.	.	.	.	.	.	.	.	.	T	2.902	-0.227375	0.06022	.	.	ENSG00000165684	ENST00000298532	T	0.28069	1.63	4.15	4.15	0.48705	.	0.206990	0.35708	N	0.003030	T	0.14614	0.0353	N	0.08118	0	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.11131	-1.0600	10	0.42905	T	0.14	-18.3209	7.2061	0.25907	0.1986:0.0:0.0:0.8014	.	799	Q5SXM2	SNPC4_HUMAN	R	799	ENSP00000298532:H799R	ENSP00000298532:H799R	H	-	2	0	SNAPC4	138395116	0.998000	0.40836	0.985000	0.45067	0.334000	0.28698	1.362000	0.34148	1.648000	0.50643	0.533000	0.62120	CAC	-	NULL		0.637	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAPC4	protein_coding	OTTHUMT00000055071.1	T	NM_003086	-		139275295	-1	no_errors	ENST00000298532	ensembl	human	known	74_37	missense	SNP	1.000	C
SLC9A9	285195	genome.wustl.edu	37	3	143297459	143297459	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr3:143297459T>C	ENST00000316549.6	-	7	1070	c.862A>G	c.(862-864)Atg>Gtg	p.M288V		NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9	288					ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)			breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						GCAGACCCCATTGCAAATGAG	0.458																																																	0								ENSG00000181804						112.0	107.0	108.0					3																	143297459		2203	4300	6503	SLC9A9	SO:0001583	missense	0			-	HGNC	AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.862A>G	3.37:g.143297459T>C	ENSP00000320246:p.Met288Val	Somatic	0	22	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	35	42.62	A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cation/H_exchanger,prints_Na/H_exchanger_6,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.M288V	ENST00000316549.6	37	c.862	CCDS33872.1	3	.	.	.	.	.	.	.	.	.	.	T	12.51	1.959149	0.34565	.	.	ENSG00000181804	ENST00000316549;ENST00000450105	T	0.13778	2.56	4.54	4.54	0.55810	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.07593	0.0191	N	0.05124	-0.11	0.44780	D	0.997789	B	0.23128	0.08	B	0.21917	0.037	T	0.32268	-0.9913	10	0.27785	T	0.31	.	14.1779	0.65555	0.0:0.0:0.0:1.0	.	288	Q8IVB4	SL9A9_HUMAN	V	288;171	ENSP00000320246:M288V	ENSP00000320246:M288V	M	-	1	0	SLC9A9	144780149	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.556000	0.53734	1.813000	0.52934	0.533000	0.62120	ATG	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger		0.458	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A9	protein_coding	OTTHUMT00000354994.1	T	NM_173653	-		143297459	-1	no_errors	ENST00000316549	ensembl	human	known	74_37	missense	SNP	0.993	C
LOR	4014	genome.wustl.edu	37	1	153233506	153233506	+	Silent	SNP	C	C	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr1:153233506C>T	ENST00000368742.3	+	2	138	c.81C>T	c.(79-81)ggC>ggT	p.G27G		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	27					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.G27G(1)		lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gcggtggcggcggcagcggcg	0.682																																																	1	Substitution - coding silent(1)	lung(1)						ENSG00000203782						8.0	10.0	9.0					1																	153233506		2045	4027	6072	LOR	SO:0001819	synonymous_variant	0			-	HGNC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.81C>T	1.37:g.153233506C>T		Somatic	0	17	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	11	35.29	Q5T869|Q5XKF8	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G27	ENST00000368742.3	37	c.81	CCDS30870.1	1																																																																																			-	NULL		0.682	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOR	protein_coding	OTTHUMT00000039107.1	C	NM_000427	-		153233506	+1	no_errors	ENST00000368742	ensembl	human	known	74_37	silent	SNP	0.000	T
SLC15A1	6564	genome.wustl.edu	37	13	99340755	99340755	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr13:99340755C>A	ENST00000376503.5	-	19	1598	c.1543G>T	c.(1543-1545)Gcc>Tcc	p.A515S		NM_005073.3	NP_005064.1	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide transporter), member 1	515					digestion (GO:0007586)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	peptide:proton symporter activity (GO:0015333)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Captopril(DB01197)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftizoxime(DB01332)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Enalapril(DB00584)|Fluvastatin(DB01095)|Fosinopril(DB00492)|Glyburide(DB01016)|L-DOPA(DB01235)|Lisinopril(DB00722)|Methyldopa(DB00968)|Midodrine(DB00211)|Moexipril(DB00691)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	TATGTGCTGGCATTGTAGCTG	0.358																																																	0								ENSG00000088386						127.0	127.0	127.0					13																	99340755		2203	4300	6503	SLC15A1	SO:0001583	missense	0			-	HGNC	U13173	CCDS9489.1	13q32.3	2013-05-22			ENSG00000088386	ENSG00000088386		"""Solute carriers"""	10920	protein-coding gene	gene with protein product	"""peptide transporter HPEPT1"", ""bA551M18.1.1 (solute carrier family 15 (oligopeptide transporter) member 1)"", ""solute carrier family 15 oligopeptide transporter member 1"""	600544				7896779	Standard	NM_005073		Approved	PEPT1, HPECT1, HPEPT1	uc001vno.3	P46059	OTTHUMG00000017255	ENST00000376503.5:c.1543G>T	13.37:g.99340755C>A	ENSP00000365686:p.Ala515Ser	Somatic	0	82	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	62	43.12	Q5VW82	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_POT_fam,superfamily_MFS_dom_general_subst_transpt,tigrfam_Oligopep_transport	p.A515S	ENST00000376503.5	37	c.1543	CCDS9489.1	13	.	.	.	.	.	.	.	.	.	.	C	6.480	0.456741	0.12283	.	.	ENSG00000088386	ENST00000376503	T	0.02103	4.45	5.91	5.91	0.95273	Major facilitator superfamily domain, general substrate transporter (1);	0.264293	0.45126	D	0.000395	T	0.04907	0.0132	L	0.58101	1.795	0.80722	D	1	B	0.23540	0.087	B	0.28991	0.097	T	0.40664	-0.9551	10	0.41790	T	0.15	-33.2304	17.2153	0.86941	0.0:1.0:0.0:0.0	.	515	P46059	S15A1_HUMAN	S	515	ENSP00000365686:A515S	ENSP00000365686:A515S	A	-	1	0	SLC15A1	98138756	0.560000	0.26570	0.979000	0.43373	0.007000	0.05969	1.840000	0.39230	2.793000	0.96121	0.655000	0.94253	GCC	-	superfamily_MFS_dom_general_subst_transpt,tigrfam_Oligopep_transport		0.358	SLC15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC15A1	protein_coding	OTTHUMT00000045560.3	C	NM_005073	-		99340755	-1	no_errors	ENST00000376503	ensembl	human	known	74_37	missense	SNP	0.995	A
ZDHHC11B	653082	genome.wustl.edu	37	5	733873	733873	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr5:733873C>A	ENST00000382776.4	-	8	1016	c.1017G>T	c.(1015-1017)aaG>aaT	p.K339N	ZDHHC11_ENST00000424784.2_Intron|ZDHHC11B_ENST00000508859.2_Missense_Mutation_p.K350N|ZDHHC11B_ENST00000522356.1_5'Flank			P0C7U3	ZH11B_HUMAN	zinc finger, DHHC-type containing 11B	339						integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			lung(3)|stomach(1)	4						TTACCTGTGCCTTCGAATCCC	0.542																																																	0								ENSG00000206077																																			ZDHHC11B	SO:0001583	missense	0			-	HGNC			5p15.33	2007-01-29				ENSG00000206077		"""Zinc fingers, DHHC-type"""	32962	protein-coding gene	gene with protein product							Standard	XM_003118532		Approved			P0C7U3		ENST00000382776.4:c.1017G>T	5.37:g.733873C>A	ENSP00000445280:p.Lys339Asn	Somatic	0	25	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	17	34.62	A6NHR3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.K339N	ENST00000382776.4	37	c.1017		5	.	.	.	.	.	.	.	.	.	.	c	2.320	-0.355763	0.05138	.	.	ENSG00000206077	ENST00000508859;ENST00000382776	T;T	0.28454	1.61;1.62	0.587	-0.4	0.12411	.	.	.	.	.	T	0.15998	0.0385	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.32851	-0.9891	5	0.17832	T	0.49	.	.	.	.	.	.	.	.	N	350;339	ENSP00000442373:K350N;ENSP00000445280:K339N	ENSP00000445280:K339N	K	-	3	2	ZDHHC11B	786873	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.140000	0.10342	-0.224000	0.09928	-0.738000	0.03535	AAG	-	NULL		0.542	ZDHHC11B-201	KNOWN	basic|appris_candidate	protein_coding	ZDHHC11B	protein_coding		C	XM_926053	-		733873	-1	no_errors	ENST00000382776	ensembl	human	known	74_37	missense	SNP	0.000	A
BTK	695	genome.wustl.edu	37	X	100615557	100615557	+	Splice_Site	SNP	C	C	G			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chrX:100615557C>G	ENST00000308731.7	-	8	938	c.775G>C	c.(775-777)Ggg>Cgg	p.G259R	BTK_ENST00000372880.1_Splice_Site_p.G259R	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	259	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						TGGACTCACCCATTTTTATCT	0.498									Agammaglobulinemia, X-linked																																								0								ENSG00000010671						132.0	111.0	118.0					X																	100615557		2203	4300	6503	BTK	SO:0001630	splice_region_variant	0	Familial Cancer Database	Bruton Type Agammaglobulinemia	-	HGNC	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.776+1G>C	X.37:g.100615557C>G		Somatic	0	26	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	24	52.00	B2RAW1|Q32ML5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,prints_SH2,prints_Znf_Btk_motif	p.G259R	ENST00000308731.7	37	c.775	CCDS14482.1	X	.	.	.	.	.	.	.	.	.	.	C	28.4	4.918709	0.92249	.	.	ENSG00000010671	ENST00000372880;ENST00000308731	T;T	0.42900	0.96;0.96	5.98	5.98	0.97165	Src homology-3 domain (3);	0.000000	0.85682	D	0.000000	T	0.71400	0.3335	M	0.87971	2.92	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.91635	0.998;0.999;0.985	T	0.76099	-0.3083	10	0.87932	D	0	.	18.9869	0.92775	0.0:1.0:0.0:0.0	.	259;259;259	Q5JY90;B2RAW1;Q06187	.;.;BTK_HUMAN	R	259	ENSP00000361971:G259R;ENSP00000308176:G259R	ENSP00000308176:G259R	G	-	1	0	BTK	100502213	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.200000	0.77838	2.532000	0.85374	0.594000	0.82650	GGG	-	pfam_SH3_domain,pfam_SH3_2,smart_SH3_domain,pfscan_SH3_domain		0.498	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	BTK	protein_coding	OTTHUMT00000057532.2	C	NM_000061	-	Missense_Mutation	100615557	-1	no_errors	ENST00000308731	ensembl	human	known	74_37	missense	SNP	1.000	G
GOLGA8EP	390535	genome.wustl.edu	37	15	23437006	23437006	+	RNA	SNP	A	A	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr15:23437006A>T	ENST00000526079.1	+	0	212					NR_027407.1|NR_033350.1				golgin A8 family, member E, pseudogene																		ACAGGAAAACAAATGGCAGCA	0.507																																																	0								ENSG00000175676																																			GOLGA8EP			0			-	HGNC			15q11.2	2014-03-21	2012-10-05	2012-10-05	ENSG00000175676	ENSG00000175676			32377	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8E"", ""golgin A8 family, member E"""	GOLGA8E		12477932	Standard	NR_033350		Approved		uc001yvu.3		OTTHUMG00000167132		15.37:g.23437006A>T		Somatic	0	26	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	12	78.57		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000526079.1	37	NULL		15																																																																																			-	-		0.507	GOLGA8EP-002	KNOWN	basic	processed_transcript	GOLGA8EP	pseudogene	OTTHUMT00000393312.1	A	NR_033350.1	-		23437006	+1	no_errors	ENST00000526079	ensembl	human	known	74_37	rna	SNP	0.574	T
UGT1A5	54579	genome.wustl.edu	37	2	234622417	234622417	+	Silent	SNP	C	C	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr2:234622417C>T	ENST00000373414.3	+	1	780	c.780C>T	c.(778-780)gaC>gaT	p.D260D	UGT1A6_ENST00000406651.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000608381.1_Silent_p.D260D|UGT1A9_ENST00000354728.4_Intron			P35504	UD15_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A5	260						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		TCCGAGGGGACTTTGTGATGG	0.522																																																	0								ENSG00000240224						145.0	154.0	151.0					2																	234622417		2203	4299	6502	UGT1A5	SO:0001819	synonymous_variant	0			-	HGNC	M84129	CCDS33404.1	2q37	2010-03-05	2005-07-20		ENSG00000240224	ENSG00000240224		"""UDP glucuronosyltransferases"""	12537	other	complex locus constituent		606430	"""UDP glycosyltransferase 1 family, polypeptide A5"""			9295054, 1339448	Standard	NM_019078		Approved	UGT1E		P35504	OTTHUMG00000059120	ENST00000373414.3:c.780C>T	2.37:g.234622417C>T		Somatic	0	75	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	63	103	37.95	B8K294	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.D260	ENST00000373414.3	37	c.780	CCDS33404.1	2																																																																																			-	pfam_UDP_glucos_trans		0.522	UGT1A5-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	UGT1A5	protein_coding	OTTHUMT00000130985.1	C	NM_019078	-		234622417	+1	no_errors	ENST00000373414	ensembl	human	known	74_37	silent	SNP	1.000	T
VTI1A	143187	genome.wustl.edu	37	10	114286971	114286971	+	Intron	SNP	A	A	C			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr10:114286971A>C	ENST00000393077.2	+	4	458				VTI1A_ENST00000432306.1_Intron	NM_145206.2	NP_660207.2	Q96AJ9	VTI1A_HUMAN	vesicle transport through interaction with t-SNAREs 1A						intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	SNAP receptor activity (GO:0005484)		VTI1A/TCF7L2(8)	breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		Colorectal(252;0.0314)|Breast(234;0.183)		Epithelial(162;0.0126)|all cancers(201;0.0487)		AGGGTGAAGGAGGTCACTGGC	0.517			T	TCF7L2	colorectal																																			Dom	yes		10	10q25.2	143187	vesicle transport through interaction with t-SNAREs homolog 1A		E	0								ENSG00000151532						47.0	49.0	49.0					10																	114286971		2203	4300	6503	VTI1A	SO:0001627	intron_variant	0			-	HGNC	BC017052	CCDS7575.2	10q25.2	2012-12-10	2012-12-10		ENSG00000151532	ENSG00000151532			17792	protein-coding gene	gene with protein product		614316	"""vesicle transport through interaction with t-SNAREs homolog 1A (yeast)"""			9446565	Standard	NM_145206		Approved	MVti1, Vti1a, Vti1-rp2	uc001kzz.3	Q96AJ9	OTTHUMG00000019063	ENST00000393077.2:c.342+48A>C	10.37:g.114286971A>C		Somatic	0	16	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	14	30.00	A2A307|B4E137|Q5W0D7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000393077.2	37	NULL	CCDS7575.2	10																																																																																			-	-		0.517	VTI1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VTI1A	protein_coding	OTTHUMT00000050397.2	A		-		114286971	+1	no_errors	ENST00000480057	ensembl	human	known	74_37	rna	SNP	1.000	C
CES3	23491	genome.wustl.edu	37	16	66998569	66998569	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr16:66998569C>A	ENST00000303334.4	+	6	829	c.758C>A	c.(757-759)aCa>aAa	p.T253K	CES3_ENST00000394037.1_Missense_Mutation_p.T253K|RP11-361L15.4_ENST00000566869.1_RNA|CES3_ENST00000543856.1_5'Flank	NM_024922.5	NP_079198.2	Q6UWW8	EST3_HUMAN	carboxylesterase 3	253						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	carboxylic ester hydrolase activity (GO:0052689)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	24		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		AGAGCCATCACACAGAGTGGG	0.587																																																	0								ENSG00000172828						169.0	138.0	149.0					16																	66998569		2200	4300	6500	CES3	SO:0001583	missense	0			-	HGNC	AK025389	CCDS10826.1, CCDS54022.1, CCDS54023.1	16q22.1	2014-05-13	2008-07-25		ENSG00000172828	ENSG00000172828		"""Carboxylesterases"""	1865	protein-coding gene	gene with protein product	"""esterase 31"", ""brain carboxylesterase BR3"""	605279	"""carboxylesterase 3 (brain)"""			10518925, 14581373, 15100172, 20931200	Standard	NM_001185176		Approved	FLJ21736, ES31	uc002eqt.3	Q6UWW8	OTTHUMG00000137525	ENST00000303334.4:c.758C>A	16.37:g.66998569C>A	ENSP00000304782:p.Thr253Lys	Somatic	0	54	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	63	41.67	B2Z3W9|F5H242|Q7Z6J1|Q9H6X7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.T253K	ENST00000303334.4	37	c.758	CCDS10826.1	16	.	.	.	.	.	.	.	.	.	.	C	14.43	2.533322	0.45073	.	.	ENSG00000172828	ENST00000303334;ENST00000394037	T;T	0.67345	-0.26;-0.26	4.14	2.17	0.27698	Carboxylesterase, type B (1);	0.623213	0.13351	N	0.394414	T	0.56891	0.2016	L	0.43923	1.385	0.09310	N	0.999997	B	0.25272	0.122	B	0.21917	0.037	T	0.52419	-0.8578	10	0.72032	D	0.01	.	9.6549	0.39919	0.0:0.8474:0.0:0.1526	.	253	Q6UWW8	EST3_HUMAN	K	253	ENSP00000304782:T253K;ENSP00000377602:T253K	ENSP00000304782:T253K	T	+	2	0	CES3	65556070	0.008000	0.16893	0.002000	0.10522	0.547000	0.35210	2.372000	0.44257	0.482000	0.27582	0.655000	0.94253	ACA	-	pfam_CarbesteraseB		0.587	CES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CES3	protein_coding	OTTHUMT00000268848.1	C	NM_024922	-		66998569	+1	no_errors	ENST00000303334	ensembl	human	known	74_37	missense	SNP	0.002	A
PPP5C	5536	genome.wustl.edu	37	19	46891839	46891839	+	Silent	SNP	G	G	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr19:46891839G>A	ENST00000012443.4	+	11	1309	c.1206G>A	c.(1204-1206)gtG>gtA	p.V402V	PPP5C_ENST00000391919.1_Silent_p.V274V|AC007193.8_ENST00000598616.1_RNA	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	402	Catalytic.				cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)			endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		AGCGGGGCGTGAGCTGTCAGT	0.612																																																	0								ENSG00000011485						88.0	67.0	75.0					19																	46891839		2203	4300	6503	PPP5C	SO:0001819	synonymous_variant	0			-	HGNC		CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.1206G>A	19.37:g.46891839G>A		Somatic	0	34	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	60	42.86	Q16722|Q53XV2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PEstase_dom,pfam_PPP_dom,pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,smart_Ser/Thr-sp_prot-phosphatase,pirsf_Ser/Thr_PPase_5,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ser/Thr-sp_prot-phosphatase	p.V402	ENST00000012443.4	37	c.1206	CCDS12684.1	19																																																																																			-	pfam_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,pirsf_Ser/Thr_PPase_5		0.612	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP5C	protein_coding	OTTHUMT00000258969.2	G	NM_006247	-		46891839	+1	no_errors	ENST00000012443	ensembl	human	known	74_37	silent	SNP	1.000	A
TUBA4A	7277	genome.wustl.edu	37	2	220116779	220116779	+	Silent	SNP	T	T	C			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr2:220116779T>C	ENST00000248437.4	-	2	350	c.177A>G	c.(175-177)ggA>ggG	p.G59G	TUBA4B_ENST00000490341.1_RNA|TUBA4A_ENST00000498660.1_Intron|TUBA4A_ENST00000392088.2_Silent_p.G44G	NM_006000.2	NP_005991.1	P68366	TBA4A_HUMAN	tubulin, alpha 4a	59					'de novo' posttranslational protein folding (GO:0051084)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Cabazitaxel(DB06772)|Podofilox(DB01179)|Vincristine(DB00541)	GTACGTGTTTTCCAGCACCAG	0.532																																																	0								ENSG00000127824						94.0	79.0	84.0					2																	220116779		2203	4300	6503	TUBA4A	SO:0001819	synonymous_variant	0			-	HGNC	AK054731	CCDS2438.1, CCDS63131.1	2q36.1	2012-10-02	2007-02-12	2007-02-12	ENSG00000127824	ENSG00000127824		"""Tubulins"""	12407	protein-coding gene	gene with protein product		191110	"""tubulin, alpha 1 (testis specific)"", ""tubulin, alpha 1"""	TUBA1		3785200	Standard	NM_006000		Approved	FLJ30169, H2-ALPHA	uc002vkt.1	P68366	OTTHUMG00000133126	ENST00000248437.4:c.177A>G	2.37:g.220116779T>C		Somatic	0	47	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	42	46.84	A8MUB1|B3KNQ6|P05215	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Beta_tubulin,prints_Delta_tubulin	p.G59	ENST00000248437.4	37	c.177	CCDS2438.1	2																																																																																			-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Tubulin		0.532	TUBA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA4A	protein_coding	OTTHUMT00000256816.3	T	NM_006000	-		220116779	-1	no_errors	ENST00000248437	ensembl	human	known	74_37	silent	SNP	0.987	C
TGIF1	7050	genome.wustl.edu	37	18	3457483	3457483	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr18:3457483T>C	ENST00000330513.5	+	3	1054	c.751T>C	c.(751-753)Tct>Cct	p.S251P	TGIF1_ENST00000407501.2_Missense_Mutation_p.S122P|TGIF1_ENST00000345133.5_Missense_Mutation_p.S102P|TGIF1_ENST00000401449.1_Missense_Mutation_p.S102P|TGIF1_ENST00000577543.1_3'UTR|TGIF1_ENST00000343820.5_Missense_Mutation_p.S122P|TGIF1_ENST00000548489.2_Missense_Mutation_p.S136P|TGIF1_ENST00000400167.2_Missense_Mutation_p.S102P|TGIF1_ENST00000472042.1_Missense_Mutation_p.S102P|TGIF1_ENST00000551541.1_Missense_Mutation_p.S102P|TGIF1_ENST00000405385.3_Missense_Mutation_p.S102P	NM_170695.2	NP_733796.2	Q15583	TGIF1_HUMAN	TGFB-induced factor homeobox 1	251					determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nodal signaling pathway (GO:0038092)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)				TGAAACGAGCTCTGTGGAGTC	0.552																																																	0								ENSG00000177426						54.0	54.0	54.0					18																	3457483		2203	4300	6503	TGIF1	SO:0001583	missense	0			-	HGNC	X89750	CCDS11832.1, CCDS11833.1, CCDS11834.1, CCDS11835.1	18p11.31	2011-06-20	2007-01-30	2007-01-30	ENSG00000177426	ENSG00000177426		"""Homeoboxes / TALE class"""	11776	protein-coding gene	gene with protein product		602630	"""TGFB-induced factor (TALE family homeobox)"""	HPE4, TGIF		8537382, 10835638	Standard	NM_173211		Approved		uc002klz.3	Q15583	OTTHUMG00000131511	ENST00000330513.5:c.751T>C	18.37:g.3457483T>C	ENSP00000327959:p.Ser251Pro	Somatic	0	44	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	26	64.38	A6NE42|A6NLU7|F8VZB6|Q6ICR0|Q8N5X9|Q9NRS0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_KN_domain,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.S251P	ENST00000330513.5	37	c.751	CCDS11834.1	18	.	.	.	.	.	.	.	.	.	.	T	2.608	-0.291383	0.05568	.	.	ENSG00000177426	ENST00000552383;ENST00000401449;ENST00000550958;ENST00000548489;ENST00000549780;ENST00000405385;ENST00000343820;ENST00000407501;ENST00000551541;ENST00000345133;ENST00000330513;ENST00000549546;ENST00000549468;ENST00000400167;ENST00000551333;ENST00000472042	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.73681	0.48;0.5;-0.76;0.49;0.48;0.5;0.5;0.5;0.5;0.5;0.44;0.5;-0.77;0.5;-0.77;0.5	5.58	1.73	0.24493	.	0.550760	0.20856	N	0.084436	T	0.57344	0.2047	L	0.41492	1.28	0.45883	D	0.998736	B;B;B	0.19331	0.01;0.011;0.035	B;B;B	0.19148	0.024;0.02;0.015	T	0.49224	-0.8962	10	0.40728	T	0.16	-12.081	0.8962	0.01264	0.1768:0.1731:0.364:0.286	.	251;122;136	Q15583;Q15583-2;F8VZB6	TGIF1_HUMAN;.;.	P	102;102;102;136;102;102;122;122;102;102;251;102;102;102;102;102	ENSP00000449287:S102P;ENSP00000385206:S102P;ENSP00000449531:S102P;ENSP00000447747:S136P;ENSP00000448121:S102P;ENSP00000384970:S102P;ENSP00000339631:S122P;ENSP00000384133:S122P;ENSP00000450025:S102P;ENSP00000343969:S102P;ENSP00000327959:S251P;ENSP00000449580:S102P;ENSP00000449722:S102P;ENSP00000383031:S102P;ENSP00000446838:S102P;ENSP00000449501:S102P	ENSP00000327959:S251P	S	+	1	0	TGIF1	3447483	0.999000	0.42202	0.972000	0.41901	0.478000	0.33099	2.010000	0.40913	0.340000	0.23745	0.460000	0.39030	TCT	-	pfam_Homeobox_KN_domain		0.552	TGIF1-003	KNOWN	basic|CCDS	protein_coding	TGIF1	protein_coding	OTTHUMT00000254368.4	T	NM_170695	-		3457483	+1	no_errors	ENST00000330513	ensembl	human	known	74_37	missense	SNP	0.997	C
ZBTB43	23099	genome.wustl.edu	37	9	129598673	129598673	+	3'UTR	SNP	G	G	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr9:129598673G>A	ENST00000373464.4	+	0	4149				ZBTB43_ENST00000449886.1_3'UTR|ZBTB43_ENST00000497064.1_3'UTR|ZBTB43_ENST00000373457.1_3'UTR	NM_014007.3	NP_054726.1	O43298	ZBT43_HUMAN	zinc finger and BTB domain containing 43						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						TGTTCTTTTAGTGTTTTGTGG	0.393																																																	0								ENSG00000169155																																			ZBTB43	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF049907	CCDS6867.1	9q33.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000169155	ENSG00000169155		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	17908	protein-coding gene	gene with protein product			"""zinc finger protein 297B"""	ZNF297B			Standard	NM_014007		Approved	KIAA0414, ZNF-X, FLJ22470, ZBTB22B	uc010mxf.3	O43298	OTTHUMG00000020693	ENST00000373464.4:c.*2481G>A	9.37:g.129598673G>A		Somatic	0	21	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	37	13.95	Q5JU96	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373464.4	37	NULL	CCDS6867.1	9																																																																																			-	-		0.393	ZBTB43-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZBTB43	protein_coding	OTTHUMT00000054124.1	G	NM_001135776	-		129598673	+1	no_errors	ENST00000497064	ensembl	human	known	74_37	rna	SNP	0.001	A
ALG11	440138	genome.wustl.edu	37	13	52602658	52602658	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr13:52602658G>T	ENST00000521508.1	+	4	1416	c.1411G>T	c.(1411-1413)Gta>Tta	p.V471L	ALG11_ENST00000523764.1_3'UTR|UTP14C_ENST00000521776.2_5'UTR|ALG11_ENST00000519151.1_3'UTR	NM_001004127.2	NP_001004127.2	Q2TAA5	ALG11_HUMAN	ALG11, alpha-1,2-mannosyltransferase	471					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GDP-Man:Man3GlcNAc2-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0004377)			endometrium(1)|large_intestine(6)|lung(4)|ovary(2)	13		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.44e-08)		TCGTGCATCTGTAAGCAGATT	0.358																																																	0								ENSG00000253710						63.0	64.0	64.0					13																	52602658		2203	4300	6503	ALG11	SO:0001583	missense	0			-	HGNC	AK025456	CCDS31977.1	13q14.3	2013-02-22	2013-02-22		ENSG00000253710	ENSG00000253710	2.4.1.131	"""Glycosyltransferase group 1 domain containing"""	32456	protein-coding gene	gene with protein product	"""GDP-Man:Man(3)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"""	613666	"""asparagine-linked glycosylation 11 homolog (S. cerevisiae, alpha-1,2-mannosyltransferase)"", ""asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast)"""			20080937	Standard	NM_001004127		Approved	KIAA0266		Q2TAA5	OTTHUMG00000016959	ENST00000521508.1:c.1411G>T	13.37:g.52602658G>T	ENSP00000430236:p.Val471Leu	Somatic	0	29	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	A5PLP3|B4DKW9|Q5TAN9|Q6DKI6|Q96FI7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_1	p.V471L	ENST00000521508.1	37	c.1411	CCDS31977.1	13	.	.	.	.	.	.	.	.	.	.	G	14.81	2.645323	0.47258	.	.	ENSG00000253710	ENST00000521508	T	0.81415	-1.49	5.74	2.1	0.27182	.	0.147583	0.44902	N	0.000413	T	0.73544	0.3600	L	0.57130	1.785	0.80722	D	1	B	0.14805	0.011	B	0.12156	0.007	T	0.64470	-0.6400	10	0.48119	T	0.1	.	7.5446	0.27759	0.1893:0.1222:0.6884:0.0	.	471	Q2TAA5	ALG11_HUMAN	L	471	ENSP00000430236:V471L	ENSP00000430236:V471L	V	+	1	0	ALG11	51500659	1.000000	0.71417	0.780000	0.31762	0.991000	0.79684	3.887000	0.56197	0.085000	0.17107	0.655000	0.94253	GTA	-	NULL		0.358	ALG11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG11	protein_coding	OTTHUMT00000045050.1	G	NM_001004127	-		52602658	+1	no_errors	ENST00000521508	ensembl	human	known	74_37	missense	SNP	0.979	T
PCDH12	51294	genome.wustl.edu	37	5	141324955	141324956	+	In_Frame_Ins	INS	-	-	CTGCTGCTG	rs5871792|rs200883539|rs59930617	byFrequency	TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr5:141324955_141324956insCTGCTGCTG	ENST00000231484.3	-	4	4755_4756	c.3545_3546insCAGCAGCAG	c.(3544-3546)agg>agCAGCAGCAGg	p.1181_1182insSSS		NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	1181	Poly-Ser.			S -> SSSS (in Ref. 4; BAB14837). {ECO:0000305}.	calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCACAGGCACctgctgctgct	0.559														2618	0.522764	0.3064	0.5807	5008	,	,		19761	0.8323		0.4095	False		,,,				2504	0.5716																0								ENSG00000113555																																			PCDH12	SO:0001652	inframe_insertion	0				HGNC	AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.3537_3545dupCAGCAGCAG	5.37:g.141324956_141324964dupCTGCTGCTG	ENSP00000231484:p.Ser1179_Ser1181dup	Somatic	NA	NA	NA		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.1182in_frame_insSSS	ENST00000231484.3	37	c.3546_3545	CCDS4269.1	5																																																																																			-	NULL		0.559	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH12	protein_coding	OTTHUMT00000251858.1	-	NM_016580			141324956	-1	no_errors	ENST00000231484	ensembl	human	known	74_37	in_frame_ins	INS	0.176:0.994	CTGCTGCTG
ZNF564	163050	genome.wustl.edu	37	19	12638575	12638575	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr19:12638575G>A	ENST00000339282.7	-	4	543	c.347C>T	c.(346-348)tCa>tTa	p.S116L	CTD-2192J16.20_ENST00000593682.1_3'UTR|CTD-2192J16.21_ENST00000601420.1_RNA|ZNF709_ENST00000428311.1_Intron	NM_144976.3	NP_659413.1	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	116					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						ACTAAGGGATGAATGATGCAT	0.393																																																	0								ENSG00000249709						126.0	127.0	126.0					19																	12638575		2146	4271	6417	ZNF564	SO:0001583	missense	0			-	HGNC	BC028367	CCDS42505.1	19p13.2	2013-09-19			ENSG00000249709	ENSG00000249709		"""Zinc fingers, C2H2-type"", ""-"""	31106	protein-coding gene	gene with protein product							Standard	NM_144976		Approved	MGC26914		Q8TBZ8	OTTHUMG00000156418	ENST00000339282.7:c.347C>T	19.37:g.12638575G>A	ENSP00000340004:p.Ser116Leu	Somatic	0	29	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	31	45.61	B9EGT4|Q6P1K6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S116L	ENST00000339282.7	37	c.347	CCDS42505.1	19	.	.	.	.	.	.	.	.	.	.	G	26.2	4.711507	0.89112	.	.	ENSG00000249709	ENST00000339282	T	0.36157	1.27	1.56	1.56	0.23342	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.41789	0.1174	M	0.82132	2.575	0.80722	D	1	B	0.21147	0.052	B	0.29524	0.103	T	0.51228	-0.8732	9	0.56958	D	0.05	.	10.7898	0.46426	0.0:0.0:1.0:0.0	.	116	Q8TBZ8	ZN564_HUMAN	L	116	ENSP00000340004:S116L	ENSP00000340004:S116L	S	-	2	0	ZNF564	12499575	0.002000	0.14202	0.653000	0.29593	0.890000	0.51754	1.016000	0.29976	1.186000	0.42985	0.643000	0.83706	TCA	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.393	ZNF564-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF564	protein_coding	OTTHUMT00000344120.2	G	NM_144976	-		12638575	-1	no_errors	ENST00000339282	ensembl	human	known	74_37	missense	SNP	0.993	A
LOC100506302	100506302	genome.wustl.edu	37	7	155404081	155404081	+	Silent	SNP	G	G	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr7:155404081G>A	ENST00000401694.1	-	3	355	c.132C>T	c.(130-132)atC>atT	p.I44I																								GGAGGCAGCCGATGGGAGACC	0.557																																																	0								ENSG00000216895																																			AC009403.2	SO:0001819	synonymous_variant	0			-	Clone_based_vega_gene																												ENST00000401694.1:c.132C>T	7.37:g.155404081G>A		Somatic	0	15	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	31	49.18		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I44	ENST00000401694.1	37	c.132		7																																																																																			-	NULL		0.557	AC009403.2-001	PUTATIVE	basic|appris_principal	protein_coding	LOC100506302	protein_coding	OTTHUMT00000322338.1	G		-		155404081	-1	no_errors	ENST00000401694	ensembl	human	putative	74_37	silent	SNP	0.005	A
CRB1	23418	genome.wustl.edu	37	1	197398724	197398724	+	Missense_Mutation	SNP	C	C	T	rs77334581		TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr1:197398724C>T	ENST00000367400.3	+	8	2957	c.2822C>T	c.(2821-2823)cCg>cTg	p.P941L	CRB1_ENST00000535699.1_Missense_Mutation_p.P917L|CRB1_ENST00000367397.1_Missense_Mutation_p.P322L|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000544212.1_Missense_Mutation_p.P422L|CRB1_ENST00000367399.2_Missense_Mutation_p.P829L	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	941	EGF-like 14. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						CAGTGCCAGCCGGTGCTTCAA	0.507													C|||	1	0.000199681	0.0	0.0	5008	,	,		17368	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000134376						91.0	79.0	83.0					1																	197398724		2203	4300	6503	CRB1	SO:0001583	missense	0			GMAF=0.0005	HGNC		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2822C>T	1.37:g.197398724C>T	ENSP00000356370:p.Pro941Leu	Somatic	0	41	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	56	32.53	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.P941L	ENST00000367400.3	37	c.2822	CCDS1390.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	2.860	-0.236376	0.05944	.	.	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	D;D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05;-2.05	5.55	-4.81	0.03180	Concanavalin A-like lectin/glucanase, subgroup (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.50360	0.1611	N	0.00358	-1.6	0.20403	N	0.99991	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.48514	-0.9029	9	0.41790	T	0.15	.	3.7125	0.08425	0.1084:0.3876:0.1201:0.3839	.	917;829;590;941	F5H0L2;P82279-3;P82279-4;P82279	.;.;.;CRUM1_HUMAN	L	917;941;829;422;322;590	ENSP00000438786:P917L;ENSP00000356370:P941L;ENSP00000356369:P829L;ENSP00000444556:P422L;ENSP00000356367:P322L	ENSP00000356367:P322L	P	+	2	0	CRB1	195665347	0.001000	0.12720	0.001000	0.08648	0.036000	0.12997	-0.006000	0.12833	-1.193000	0.02688	-1.202000	0.01658	CCG	-	NULL		0.507	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	protein_coding	OTTHUMT00000086565.2	C	NM_201253	rs77334581		197398724	+1	no_errors	ENST00000367400	ensembl	human	known	74_37	missense	SNP	0.009	T
LSAMP	4045	genome.wustl.edu	37	3	115535479	115535479	+	Intron	SNP	C	C	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr3:115535479C>T	ENST00000490035.2	-	7	1419				LSAMP_ENST00000539563.1_Missense_Mutation_p.V321M	NM_002338.3	NP_002329.2	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein						cell adhesion (GO:0007155)|locomotory exploration behavior (GO:0035641)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(1)|large_intestine(4)|lung(14)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		TTGAAGTGCACGGTGGTACCA	0.279																																																	0								ENSG00000185565																																			LSAMP	SO:0001627	intron_variant	0			-	HGNC	U41901	CCDS2982.1	3q13.2-q21	2013-01-11			ENSG00000185565	ENSG00000185565		"""Immunoglobulin superfamily / I-set domain containing"""	6705	protein-coding gene	gene with protein product	"""IgLON family member 3"""	603241				9615236	Standard	NM_002338		Approved	LAMP, IGLON3	uc003ebs.3	Q13449	OTTHUMG00000159308	ENST00000490035.2:c.920-6218G>A	3.37:g.115535479C>T		Somatic	0	43	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	32	44.83	Q8IV49	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.V308M	ENST00000490035.2	37	c.922	CCDS2982.1	3	.	.	.	.	.	.	.	.	.	.	C	16.80	3.223624	0.58668	.	.	ENSG00000185565	ENST00000333617;ENST00000539563	T;T	0.59224	0.33;0.28	5.46	4.59	0.56863	.	.	.	.	.	T	0.62295	0.2416	.	.	.	0.24986	N	0.991567	.	.	.	.	.	.	T	0.57154	-0.7860	6	0.59425	D	0.04	.	12.3513	0.55151	0.0:0.9173:0.0:0.0827	.	.	.	.	M	308;321	ENSP00000328455:V308M;ENSP00000443429:V321M	ENSP00000328455:V308M	V	-	1	0	LSAMP	117018169	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.466000	0.45084	1.435000	0.47434	0.650000	0.86243	GTG	-	NULL		0.279	LSAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSAMP	protein_coding	OTTHUMT00000354495.4	C	NM_002338	-		115535479	-1	no_errors	ENST00000333617	ensembl	human	novel	74_37	missense	SNP	1.000	T
SLC30A9	10463	genome.wustl.edu	37	4	42080286	42080286	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr4:42080286G>C	ENST00000264451.7	+	17	1786	c.1606G>C	c.(1606-1608)Gaa>Caa	p.E536Q		NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	536					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E536*(1)		central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TAAACATGGAGAAAATATTAT	0.284																																																	1	Substitution - Nonsense(1)	large_intestine(1)						ENSG00000014824						53.0	59.0	57.0					4																	42080286		2201	4298	6499	SLC30A9	SO:0001583	missense	0			-	HGNC	AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.1606G>C	4.37:g.42080286G>C	ENSP00000264451:p.Glu536Gln	Somatic	0	53	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	56	8.20	Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cation_efflux,superfamily_DNA-bd_dom_put,tigrfam_Cation_efflux	p.E536Q	ENST00000264451.7	37	c.1606	CCDS3465.1	4	.	.	.	.	.	.	.	.	.	.	G	29.2	4.982940	0.93044	.	.	ENSG00000014824	ENST00000264451;ENST00000536881	T	0.32023	1.47	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.66829	0.2829	M	0.91090	3.175	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.74000	-0.3805	10	0.87932	D	0	-23.428	19.8737	0.96861	0.0:0.0:1.0:0.0	.	536	Q6PML9	ZNT9_HUMAN	Q	536;364	ENSP00000264451:E536Q	ENSP00000264451:E536Q	E	+	1	0	SLC30A9	41775043	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.185000	0.94900	2.693000	0.91896	0.650000	0.86243	GAA	-	NULL		0.284	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A9	protein_coding	OTTHUMT00000216842.3	G		-		42080286	+1	no_errors	ENST00000264451	ensembl	human	known	74_37	missense	SNP	1.000	C
ADARB2	105	genome.wustl.edu	37	10	1230815	1230815	+	Missense_Mutation	SNP	G	G	A	rs369823256		TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr10:1230815G>A	ENST00000381312.1	-	9	2354	c.2029C>T	c.(2029-2031)Cgg>Tgg	p.R677W	ADARB2_ENST00000381305.1_Missense_Mutation_p.R79W|ADARB2_ENST00000381310.3_Missense_Mutation_p.R186W	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	677	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		CCATACAGCCGCGCCCACCGT	0.662																																																	0								ENSG00000185736	G	TRP/ARG	0,4406		0,0,2203	37.0	34.0	35.0		2029	1.9	0.0	10		35	1,8599	1.2+/-3.3	0,1,4299	no	missense	ADARB2	NM_018702.3	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	677/740	1230815	1,13005	2203	4300	6503	ADARB2	SO:0001583	missense	0			-	HGNC	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.2029C>T	10.37:g.1230815G>A	ENSP00000370713:p.Arg677Trp	Somatic	0	52	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	60	35.11	B2RPJ5|Q5VUT6|Q5VW42	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A_deamin,pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_A_deamin	p.R677W	ENST00000381312.1	37	c.2029	CCDS7058.1	10	.	.	.	.	.	.	.	.	.	.	G	11.34	1.609188	0.28623	0.0	1.16E-4	ENSG00000185736	ENST00000381312;ENST00000381310;ENST00000381305	D;D;D	0.94092	-3.35;-3.35;-3.35	5.14	1.94	0.25998	Adenosine deaminase/editase (3);	0.348186	0.33075	N	0.005309	D	0.96140	0.8742	M	0.80616	2.505	0.28238	N	0.925795	D;D;D	0.89917	0.998;0.994;1.0	P;P;D	0.72625	0.765;0.843;0.978	D	0.92386	0.5917	10	0.87932	D	0	-19.0263	13.966	0.64209	0.0:0.0:0.2212:0.7788	.	677;79;186	Q9NS39;Q5VW43;Q5VW42	RED2_HUMAN;.;.	W	677;186;79	ENSP00000370713:R677W;ENSP00000370711:R186W;ENSP00000370706:R79W	ENSP00000370706:R79W	R	-	1	2	ADARB2	1220815	0.027000	0.19231	0.005000	0.12908	0.005000	0.04900	1.570000	0.36439	0.132000	0.18615	-0.268000	0.10319	CGG	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin		0.662	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADARB2	protein_coding	OTTHUMT00000046426.1	G	NM_018702	-		1230815	-1	no_errors	ENST00000381312	ensembl	human	known	74_37	missense	SNP	0.282	A
TRIM25	7706	genome.wustl.edu	37	17	54968579	54968579	+	3'UTR	SNP	G	G	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr17:54968579G>T	ENST00000316881.4	-	0	2424				TRIM25_ENST00000573108.1_5'UTR|MIR3614_ENST00000581261.1_RNA|RP11-670E13.5_ENST00000574826.1_RNA	NM_005082.4	NP_005073.2	Q14258	TRI25_HUMAN	tripartite motif containing 25						defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral entry into host cell (GO:0046596)|regulation of viral release from host cell (GO:1902186)|response to estrogen (GO:0043627)|response to vitamin D (GO:0033280)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Breast(9;6.15e-08)					GCGGGTAATGGAGTTTATGTA	0.413																																																	0								ENSG00000121060																																			TRIM25	SO:0001624	3_prime_UTR_variant	0			-	HGNC	D21205	CCDS11591.1	17q23.1	2013-01-09	2011-01-25	2004-03-30				"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12932	protein-coding gene	gene with protein product		600453	"""zinc finger protein 147 (estrogen-responsive finger protein)"", ""tripartite motif-containing 25"""	ZNF147		7789997	Standard	NM_005082		Approved	EFP, RNF147	uc002iut.3	Q14258		ENST00000316881.4:c.*482C>A	17.37:g.54968579G>T		Somatic	0	24	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	10	28.57		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000316881.4	37	NULL	CCDS11591.1	17																																																																																			-	-		0.413	TRIM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM25	protein_coding	OTTHUMT00000440609.1	G	NM_005082	-		54968579	-1	no_errors	ENST00000573108	ensembl	human	putative	74_37	rna	SNP	0.001	T
NGF	4803	genome.wustl.edu	37	1	115828887	115828887	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr1:115828887G>T	ENST00000369512.2	-	3	698	c.530C>A	c.(529-531)aCc>aAc	p.T177N	RP4-663N10.1_ENST00000425449.1_RNA	NM_002506.2	NP_002497.2	P01138	NGF_HUMAN	nerve growth factor (beta polypeptide)	177					activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|adult locomotory behavior (GO:0008344)|apoptotic signaling pathway (GO:0097190)|circadian rhythm (GO:0007623)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|nerve growth factor processing (GO:0032455)|neuron apoptotic process (GO:0051402)|neuron projection morphogenesis (GO:0048812)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axon extension (GO:0045773)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotrophin TRK receptor signaling pathway (GO:0051388)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|Ras protein signal transduction (GO:0007265)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of neurotransmitter secretion (GO:0046928)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to peptide hormone (GO:0043434)|response to radiation (GO:0009314)|sensory perception of pain (GO:0019233)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)	nerve growth factor receptor binding (GO:0005163)|receptor signaling protein activity (GO:0005057)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)	CCGGCACTTGGTCTCAAAAAA	0.512																																																	0								ENSG00000134259						122.0	112.0	116.0					1																	115828887		2203	4300	6503	NGF	SO:0001583	missense	0			-	HGNC		CCDS882.1	1p13.1	2014-09-17	2008-02-07	2008-02-07	ENSG00000134259	ENSG00000134259		"""Endogenous ligands"""	7808	protein-coding gene	gene with protein product		162030		NGFB			Standard	XM_006710663		Approved		uc001efu.1	P01138	OTTHUMG00000011880	ENST00000369512.2:c.530C>A	1.37:g.115828887G>T	ENSP00000358525:p.Thr177Asn	Somatic	0	39	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	34	42.37	A1A4E5|Q6FHA0|Q96P60|Q9P2Q8|Q9UKL8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Nerve_growth_factor-like,pfam_Nerve_growth_factor-rel,smart_Nerve_growth_factor-rel,prints_Nerve_growth_factor-rel,prints_Nerve_growth_factor_bsu_mml,prints_Nerve_growth_factor_bsu,pfscan_Nerve_growth_factor-rel	p.T177N	ENST00000369512.2	37	c.530	CCDS882.1	1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.345831	0.82022	.	.	ENSG00000134259	ENST00000369512	T	0.73363	-0.74	4.9	4.9	0.64082	Nerve growth factor-related (5);	0.000000	0.85682	D	0.000000	D	0.86822	0.6025	M	0.88775	2.98	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89336	0.3650	10	0.87932	D	0	-28.2626	17.1926	0.86883	0.0:0.0:1.0:0.0	.	177	P01138	NGF_HUMAN	N	177	ENSP00000358525:T177N	ENSP00000358525:T177N	T	-	2	0	NGF	115630410	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.753000	0.98904	2.426000	0.82243	0.455000	0.32223	ACC	-	pirsf_Nerve_growth_factor-like,pfam_Nerve_growth_factor-rel,smart_Nerve_growth_factor-rel,prints_Nerve_growth_factor-rel,pfscan_Nerve_growth_factor-rel		0.512	NGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NGF	protein_coding	OTTHUMT00000032832.1	G	NM_002506	-		115828887	-1	no_errors	ENST00000369512	ensembl	human	known	74_37	missense	SNP	1.000	T
LGALS17A	400696	genome.wustl.edu	37	19	40172709	40172709	+	RNA	SNP	G	G	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr19:40172709G>A	ENST00000412609.1	+	0	210																											TTCCATTTCCGAGTGTACTTT	0.522																																					Colon(98;189 2488 3678)												0								ENSG00000226025						193.0	160.0	170.0					19																	40172709		692	1591	2283	LGALS17A			0			-	Clone_based_vega_gene																													19.37:g.40172709G>A		Somatic	0	44	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	66	67	49.62		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000412609.1	37	NULL		19																																																																																			-	-		0.522	LGALS17A-001	KNOWN	basic	processed_transcript	LGALS17A	pseudogene	OTTHUMT00000280514.1	G		-		40172709	+1	no_errors	ENST00000412609	ensembl	human	known	74_37	rna	SNP	0.050	A
CATIP-AS2	103689911	genome.wustl.edu	37	2	219215890	219215890	+	RNA	DEL	T	T	-			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr2:219215890delT	ENST00000411433.1	-	0	112																											tacccatcgcttttttttttc	0.358																																																	0								ENSG00000237281			38,149,1665		4,0,30,4,141,747	15.0	13.0	14.0				0.2	2		15	90,337,3477		1,1,87,14,308,1541	no	intergenic				5,1,117,18,449,2288	A1A1,A1A2,A1R,A2A2,A2R,RR		10.9375,10.0972,10.6671			219215890	128,486,5142	692	1590	2282	AC021016.8			0				Clone_based_vega_gene																													2.37:g.219215890delT		Somatic	0	42	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000411433.1	37	NULL		2																																																																																			-	-		0.358	AC021016.8-001	KNOWN	basic	antisense	ENSG00000237281	antisense	OTTHUMT00000338557.1	T				219215890	-1	no_errors	ENST00000411433	ensembl	human	known	74_37	rna	DEL	0.199	-
NCOR2	9612	genome.wustl.edu	37	12	124824721	124824722	+	In_Frame_Ins	INS	-	-	GCCGCTGCT	rs61519723|rs112797765|rs143952466	byFrequency	TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr12:124824721_124824722insGCCGCTGCT	ENST00000405201.1	-	37	5517_5518	c.5517_5518insAGCAGCGGC	c.(5515-5520)ggcggg>ggcAGCAGCGGCggg	p.1838_1839insGSS	NCOR2_ENST00000397355.1_In_Frame_Ins_p.1829_1830insGSS|NCOR2_ENST00000404121.2_In_Frame_Ins_p.1399_1400insGSS|NCOR2_ENST00000404621.1_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000356219.3_In_Frame_Ins_p.1845_1846insGSS|NCOR2_ENST00000429285.2_In_Frame_Ins_p.1828_1829insGSS			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1849					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		cccccacccccgccgctgctgc	0.713														4762	0.950879	0.8979	0.9496	5008	,	,		14227	0.9633		0.9672	False		,,,				2504	0.9939																0								ENSG00000196498																																			NCOR2	SO:0001652	inframe_insertion	0				HGNC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5509_5517dupAGCAGCGGC	12.37:g.124824722_124824730dupGCCGCTGCT	ENSP00000384018:p.Gly1836_Ser1838dup	Somatic	NA	NA	NA		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.1846in_frame_insSSG	ENST00000405201.1	37	c.5539_5538	CCDS41858.2	12																																																																																			-	NULL		0.713	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	protein_coding	OTTHUMT00000318173.2	-	NM_006312			124824722	-1	no_errors	ENST00000356219	ensembl	human	known	74_37	in_frame_ins	INS	1.000:0.999	GCCGCTGCT
FGFBP1	9982	genome.wustl.edu	37	4	15938241	15938241	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr4:15938241G>T	ENST00000382333.1	-	3	309	c.15C>A	c.(13-15)agC>agA	p.S5R	FGFBP1_ENST00000259988.2_Missense_Mutation_p.S5R	NM_005130.4	NP_005121.1	Q14512	FGFP1_HUMAN	fibroblast growth factor binding protein 1	5					cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|prostate(2)|skin(1)	10						GCAGGGTGAGGCTACAGATCT	0.537																																																	0								ENSG00000137440						46.0	47.0	46.0					4																	15938241		2077	4073	6150	FGFBP1	SO:0001583	missense	0			-	HGNC	M60047	CCDS3418.1	4p15.32	2008-02-05			ENSG00000137440	ENSG00000137440			19695	protein-coding gene	gene with protein product		607737				11148217, 1885605	Standard	NM_005130		Approved	HBP17, FGFBP	uc003gom.3	Q14512	OTTHUMG00000097745	ENST00000382333.1:c.15C>A	4.37:g.15938241G>T	ENSP00000371770:p.Ser5Arg	Somatic	0	35	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	6	84.21	A8K5J2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FGF1-bd	p.S5R	ENST00000382333.1	37	c.15	CCDS3418.1	4	.	.	.	.	.	.	.	.	.	.	G	12.67	2.007958	0.35415	.	.	ENSG00000137440	ENST00000382333;ENST00000259988	T;T	0.18657	2.2;2.2	5.77	3.08	0.35506	.	0.781971	0.12707	N	0.445840	T	0.19208	0.0461	L	0.40543	1.245	0.22185	N	0.999303	P	0.40476	0.718	B	0.40009	0.316	T	0.08126	-1.0737	10	0.52906	T	0.07	-0.2955	9.6188	0.39708	0.2914:0.0:0.7086:0.0	.	5	Q14512	FGFP1_HUMAN	R	5	ENSP00000371770:S5R;ENSP00000259988:S5R	ENSP00000259988:S5R	S	-	3	2	FGFBP1	15547339	0.969000	0.33509	0.640000	0.29408	0.771000	0.43674	0.575000	0.23729	0.773000	0.33404	0.643000	0.83706	AGC	-	NULL		0.537	FGFBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGFBP1	protein_coding	OTTHUMT00000214974.1	G	NM_005130	-		15938241	-1	no_errors	ENST00000259988	ensembl	human	known	74_37	missense	SNP	0.494	T
CLLU1OS	574016	genome.wustl.edu	37	12	92816388	92816388	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr12:92816388C>G	ENST00000378487.2	-	2	78	c.77G>C	c.(76-78)aGt>aCt	p.S26T	CLLU1_ENST00000472839.2_Intron|CLLU1OS_ENST00000538965.1_Missense_Mutation_p.S26T|CLLU1_ENST00000378485.1_5'Flank|RP11-693J15.4_ENST00000508671.1_RNA	NM_001025232.1	NP_001020403.1	Q5K130	CLU1O_HUMAN	chronic lymphocytic leukemia up-regulated 1 opposite strand	26										large_intestine(1)|lung(7)	8						ctgggagatactaggctgcac	0.398																																																	0								ENSG00000205057						58.0	58.0	58.0					12																	92816388		2203	4298	6501	CLLU1OS	SO:0001583	missense	0			-	HGNC	AJ845168	CCDS31871.1	12q22	2006-03-30	2006-03-30		ENSG00000205057	ENSG00000205057			24070	protein-coding gene	gene with protein product			"""chronic lymphocytic leukemia up-regulated 1 overlapping strand"""				Standard	NM_001025232		Approved		uc001tcb.1	Q5K130	OTTHUMG00000161990	ENST00000378487.2:c.77G>C	12.37:g.92816388C>G	ENSP00000367748:p.Ser26Thr	Somatic	0	42	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	32	46.67		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S26T	ENST00000378487.2	37	c.77	CCDS31871.1	12	.	.	.	.	.	.	.	.	.	.	T	0.855	-0.737342	0.03111	.	.	ENSG00000205057	ENST00000378487;ENST00000538965	.	.	.	2.18	-4.35	0.03656	.	.	.	.	.	T	0.14184	0.0343	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14896	-1.0456	8	0.87932	D	0	.	0.9009	0.01273	0.2976:0.3436:0.1506:0.2082	.	26	Q5K130	CLU1O_HUMAN	T	26	.	ENSP00000367748:S26T	S	-	2	0	CLLU1OS	91340519	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.269000	0.00532	-2.323000	0.00639	-0.380000	0.06706	AGT	-	NULL		0.398	CLLU1OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLLU1OS	protein_coding	OTTHUMT00000366646.1	C		-		92816388	-1	no_errors	ENST00000378487	ensembl	human	known	74_37	missense	SNP	0.000	G
ANO9	338440	genome.wustl.edu	37	11	428528	428528	+	Missense_Mutation	SNP	C	C	T	rs559572219		TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr11:428528C>T	ENST00000332826.6	-	13	1216	c.1132G>A	c.(1132-1134)Gtg>Atg	p.V378M		NM_001012302.2	NP_001012302	A1A5B4	ANO9_HUMAN	anoctamin 9	378					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|negative regulation of intracellular calcium activated chloride channel activity (GO:1902939)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|lung(5)|ovary(1)|prostate(4)|skin(4)	21						GTCACCACCACGGCCGTGGTC	0.687													c|||	1	0.000199681	0.0	0.0	5008	,	,		15322	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000185101						29.0	34.0	32.0					11																	428528		2195	4290	6485	ANO9	SO:0001583	missense	0			-	HGNC	U33271	CCDS31326.1	11p15.5	2014-04-09	2008-08-28	2008-08-28	ENSG00000185101	ENSG00000185101		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	20679	protein-coding gene	gene with protein product			"""tumor protein p53 inducible protein 5"", ""transmembrane protein 16J"""	TP53I5, TMEM16J		9305847, 24692353	Standard	NM_001012302		Approved	PIG5	uc001lpi.2	A1A5B4	OTTHUMG00000165446	ENST00000332826.6:c.1132G>A	11.37:g.428528C>T	ENSP00000332788:p.Val378Met	Somatic	0	37	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	41	10.87	B3KUC4|B4E134|Q8TEN4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Anoctamin	p.V378M	ENST00000332826.6	37	c.1132	CCDS31326.1	11	.	.	.	.	.	.	.	.	.	.	C	10.53	1.377262	0.24944	.	.	ENSG00000185101	ENST00000332826	T	0.64260	-0.09	3.73	2.8	0.32819	.	3.950950	0.01833	N	0.034807	T	0.64182	0.2575	M	0.79693	2.465	0.28286	N	0.923783	P;P	0.49862	0.912;0.929	B;B	0.37198	0.157;0.243	T	0.57271	-0.7840	10	0.62326	D	0.03	.	8.0762	0.30718	0.0:0.8111:0.0:0.1889	.	79;378	A1A5B4-2;A1A5B4	.;ANO9_HUMAN	M	378	ENSP00000332788:V378M	ENSP00000332788:V378M	V	-	1	0	ANO9	418528	0.942000	0.31987	0.768000	0.31515	0.049000	0.14656	3.229000	0.51278	0.924000	0.37069	0.451000	0.29950	GTG	-	pfam_Anoctamin		0.687	ANO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO9	protein_coding	OTTHUMT00000384116.1	C	NM_001012302	-		428528	-1	no_errors	ENST00000332826	ensembl	human	known	74_37	missense	SNP	0.952	T
ZNF786	136051	genome.wustl.edu	37	7	148771578	148771578	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr7:148771578C>G	ENST00000491431.1	-	3	262	c.198G>C	c.(196-198)gaG>gaC	p.E66D	ZNF786_ENST00000316286.9_5'UTR|ZNF786_ENST00000451334.3_Missense_Mutation_p.E29D	NM_152411.3	NP_689624.2	Q8N393	ZN786_HUMAN	zinc finger protein 786	66	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(2)	26	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			TCCTGAAGGGCTCTCCCCCGT	0.433																																																	0								ENSG00000197362						113.0	105.0	107.0					7																	148771578		1883	4093	5976	ZNF786	SO:0001583	missense	0			-	HGNC	AK095701, AL834510	CCDS47738.1	7q36.1	2013-01-08			ENSG00000197362	ENSG00000197362		"""Zinc fingers, C2H2-type"", ""-"""	21806	protein-coding gene	gene with protein product							Standard	NM_152411		Approved	DKFZp762I137	uc003wfh.2	Q8N393	OTTHUMG00000158975	ENST00000491431.1:c.198G>C	7.37:g.148771578C>G	ENSP00000417470:p.Glu66Asp	Somatic	0	58	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	28	60.56	A1A568|B4DMI1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E66D	ENST00000491431.1	37	c.198	CCDS47738.1	7	.	.	.	.	.	.	.	.	.	.	C	15.88	2.964527	0.53507	.	.	ENSG00000197362	ENST00000491431;ENST00000451334	T;T	0.11930	3.02;2.73	4.62	1.7	0.24286	Krueppel-associated box (2);	0.000000	0.38663	N	0.001602	T	0.08403	0.0209	L	0.33753	1.03	0.09310	N	0.999998	B	0.22080	0.064	B	0.17979	0.02	T	0.22695	-1.0209	10	0.51188	T	0.08	-20.0721	3.0055	0.06027	0.2338:0.5314:0.0:0.2348	.	66	Q8N393	ZN786_HUMAN	D	66;29	ENSP00000417470:E66D;ENSP00000404984:E29D	ENSP00000404984:E29D	E	-	3	2	ZNF786	148402511	0.130000	0.22417	0.155000	0.22561	0.300000	0.27592	-0.475000	0.06599	0.622000	0.30249	0.655000	0.94253	GAG	-	smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.433	ZNF786-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF786	protein_coding	OTTHUMT00000352751.1	C	NM_152411	-		148771578	-1	no_errors	ENST00000491431	ensembl	human	known	74_37	missense	SNP	0.189	G
RB1	5925	genome.wustl.edu	37	13	49030390	49030391	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr13:49030390_49030391insA	ENST00000267163.4	+	19	2003_2004	c.1865_1866insA	c.(1864-1869)gtaaatfs	p.N623fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	623	Pocket; binds T and E1A.|Spacer.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(10)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ACTACGCGTGTAAATTCTACTG	0.371		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	25	Whole gene deletion(15)|Unknown(10)	bone(10)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|lung(1)|liver(1)						ENSG00000139687																																			RB1	SO:0001589	frameshift_variant	0	Familial Cancer Database			HGNC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1868dupA	13.37:g.49030393_49030393dupA	ENSP00000267163:p.Asn623fs	Somatic	0	41	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	7	80.00	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.N623fs	ENST00000267163.4	37	c.1865_1866	CCDS31973.1	13																																																																																			-	NULL		0.371	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	-				49030391	+1	no_errors	ENST00000267163	ensembl	human	known	74_37	frame_shift_ins	INS	0.967:0.967	A
RB1	5925	genome.wustl.edu	37	13	49039232	49039232	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr13:49039232G>T	ENST00000267163.4	+	22	2448	c.2310G>T	c.(2308-2310)caG>caT	p.Q770H		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	770	Domain B.|Interaction with LIMD1.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(12)|p.Q770fs*24(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ATATTTTGCAGTATGCTTCCA	0.318		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	28	Whole gene deletion(15)|Unknown(12)|Insertion - Frameshift(1)	bone(11)|breast(5)|haematopoietic_and_lymphoid_tissue(4)|eye(2)|adrenal_gland(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|lung(1)|liver(1)						ENSG00000139687						75.0	77.0	77.0					13																	49039232		2203	4300	6503	RB1	SO:0001583	missense	0	Familial Cancer Database		-	HGNC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2310G>T	13.37:g.49039232G>T	ENSP00000267163:p.Gln770His	Somatic	0	76	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A8K5E3|P78499|Q5VW46|Q8IZL4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.Q770H	ENST00000267163.4	37	c.2310	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	G	18.20	3.570322	0.65765	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	D	0.84298	-1.83	5.48	3.71	0.42584	Rb C-terminal (1);Cyclin-like (2);	0.000000	0.85682	D	0.000000	D	0.88702	0.6508	L	0.55990	1.75	0.58432	D	0.999999	D	0.89917	1.0	D	0.68943	0.961	D	0.88807	0.3289	10	0.87932	D	0	.	11.0805	0.48057	0.1746:0.0:0.8254:0.0	.	770	P06400	RB_HUMAN	H	749;770	ENSP00000267163:Q770H	ENSP00000267163:Q770H	Q	+	3	2	RB1	47937233	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.469000	0.45110	2.593000	0.87608	0.591000	0.81541	CAG	-	pfam_RB_C,superfamily_Cyclin-like		0.318	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	G		-		49039232	+1	no_errors	ENST00000267163	ensembl	human	known	74_37	missense	SNP	1.000	T
KIAA0430	9665	genome.wustl.edu	37	16	15696479	15696480	+	Intron	DEL	GA	GA	-	rs373385405|rs373082870|rs79821793|rs76777980|rs71293163	byFrequency	TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr16:15696479_15696480delGA	ENST00000396368.3	-	23	4620				KIAA0430_ENST00000547936.1_Intron|KIAA0430_ENST00000551742.1_Intron|KIAA0430_ENST00000602337.1_Intron|KIAA0430_ENST00000540441.2_Intron|KIAA0430_ENST00000344181.3_Frame_Shift_Del_p.P1117fs|KIAA0430_ENST00000548025.1_Intron	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430						double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						ggaggaggaggaaggaaagaag	0.406																																																	0								ENSG00000166783																																			KIAA0430	SO:0001627	intron_variant	0				HGNC	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.4414-419TC>-	16.37:g.15696479_15696480delGA		Somatic	0	9	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	19	32.14	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.P1114fs	ENST00000396368.3	37	c.3340_3339	CCDS10562.2	16																																																																																			-	NULL		0.406	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	protein_coding	OTTHUMT00000252131.2	GA	NM_014647			15696480	-1	no_errors	ENST00000344181	ensembl	human	known	74_37	frame_shift_del	DEL	0.000:0.000	-
CRNN	49860	genome.wustl.edu	37	1	152382389	152382389	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr1:152382389A>T	ENST00000271835.3	-	3	1231	c.1169T>A	c.(1168-1170)gTg>gAg	p.V390E	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	390					response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGGGTTGCTCACTTGCATCCA	0.597																																																	0								ENSG00000143536						128.0	108.0	115.0					1																	152382389		2203	4300	6503	CRNN	SO:0001583	missense	0			-	HGNC	AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.1169T>A	1.37:g.152382389A>T	ENSP00000271835:p.Val390Glu	Somatic	0	48	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	122	11.59	B2RE60|Q8N613	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub,smart_EF_hand_dom,pfscan_EF_hand_dom	p.V390E	ENST00000271835.3	37	c.1169	CCDS1010.1	1	.	.	.	.	.	.	.	.	.	.	A	5.180	0.218805	0.09810	.	.	ENSG00000143536	ENST00000271835	T	0.03745	3.82	4.72	-0.447	0.12234	.	0.150909	0.30809	N	0.008826	T	0.00754	0.0025	L	0.31476	0.935	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.46938	-0.9155	10	0.54805	T	0.06	.	0.9549	0.01383	0.4127:0.1674:0.0959:0.324	.	390	Q9UBG3	CRNN_HUMAN	E	390	ENSP00000271835:V390E	ENSP00000271835:V390E	V	-	2	0	CRNN	150649013	0.000000	0.05858	0.014000	0.15608	0.034000	0.12701	-1.007000	0.03667	0.280000	0.22209	-0.386000	0.06593	GTG	-	NULL		0.597	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRNN	protein_coding	OTTHUMT00000034503.1	A	NM_016190	-		152382389	-1	no_errors	ENST00000271835	ensembl	human	known	74_37	missense	SNP	0.002	T
IGSF22	283284	genome.wustl.edu	37	11	18733913	18733913	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr11:18733913T>C	ENST00000513874.1	-	15	2253	c.2114A>G	c.(2113-2115)cAg>cGg	p.Q705R	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	708	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.									NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						CACCCGGCCCTGTGGAGGCTT	0.562																																																	0								ENSG00000179057						44.0	43.0	43.0					11																	18733913		692	1591	2283	IGSF22	SO:0001583	missense	0			-	HGNC	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.2114A>G	11.37:g.18733913T>C	ENSP00000421191:p.Gln705Arg	Somatic	0	36	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	50	13.79	A6NNA0|D6RGV7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.Q705R	ENST00000513874.1	37	c.2114	CCDS41625.2	11	.	.	.	.	.	.	.	.	.	.	t	13.76	2.334369	0.41297	.	.	ENSG00000179057	ENST00000513874	T	0.38722	1.12	4.11	4.11	0.48088	.	.	.	.	.	T	0.56731	0.2005	L	0.59436	1.845	0.09310	N	0.999998	D	0.65815	0.995	D	0.66351	0.943	T	0.44190	-0.9344	9	0.39692	T	0.17	.	11.4856	0.50352	0.0:0.0:0.0:1.0	.	705	D6RGV7	.	R	705	ENSP00000421191:Q705R	ENSP00000421191:Q705R	Q	-	2	0	IGSF22	18690489	0.631000	0.27164	0.590000	0.28732	0.771000	0.43674	0.514000	0.22786	1.740000	0.51718	0.449000	0.29647	CAG	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.562	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	protein_coding	OTTHUMT00000360850.2	T	NM_173588	-		18733913	-1	no_errors	ENST00000513874	ensembl	human	known	74_37	missense	SNP	0.981	C
CACNA1A	773	genome.wustl.edu	37	19	13397420	13397420	+	Silent	SNP	G	G	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr19:13397420G>A	ENST00000360228.5	-	20	3449	c.3450C>T	c.(3448-3450)agC>agT	p.S1150S	CACNA1A_ENST00000573710.2_Silent_p.S1151S	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1151					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TCTGGGTGCCGCTGGGGTTGG	0.652																																																	0								ENSG00000141837						44.0	46.0	45.0					19																	13397420		1965	4134	6099	CACNA1A	SO:0001819	synonymous_variant	0			-	HGNC	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.3450C>T	19.37:g.13397420G>A		Somatic	0	23	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	25	44.44	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.S1150	ENST00000360228.5	37	c.3450	CCDS45998.1	19																																																																																			-	NULL		0.652	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	protein_coding	OTTHUMT00000104062.2	G	NM_000068	-		13397420	-1	no_errors	ENST00000360228	ensembl	human	known	74_37	silent	SNP	1.000	A
HIRA	7290	genome.wustl.edu	37	22	19384361	19384361	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr22:19384361C>G	ENST00000263208.5	-	7	859	c.603G>C	c.(601-603)tgG>tgC	p.W201C	HIRA_ENST00000340170.4_Missense_Mutation_p.W201C|HIRA_ENST00000464189.1_5'Flank|HIRA_ENST00000541063.1_Missense_Mutation_p.W157C|HIRA_ENST00000546308.1_Missense_Mutation_p.W157C	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	201					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					CCAGCGTCCTCCACACCTTTA	0.557																																																	0								ENSG00000100084						90.0	82.0	85.0					22																	19384361		2203	4300	6503	HIRA	SO:0001583	missense	0			-	HGNC	X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.603G>C	22.37:g.19384361C>G	ENSP00000263208:p.Trp201Cys	Somatic	0	34	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	54	8.33	Q05BU9|Q8IXN2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hira,pfam_WD40_repeat,pfam_HIRA_B_motif,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W201C	ENST00000263208.5	37	c.603	CCDS13759.1	22	.	.	.	.	.	.	.	.	.	.	C	24.2	4.501789	0.85176	.	.	ENSG00000100084	ENST00000340170;ENST00000263208;ENST00000541063;ENST00000546308	D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73	5.13	5.13	0.70059	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.93174	0.7826	M	0.91561	3.22	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;1.0	D	0.94360	0.7587	10	0.87932	D	0	-12.1332	18.7753	0.91908	0.0:1.0:0.0:0.0	.	157;201;201	F5H4M2;P54198-2;P54198	.;.;HIRA_HUMAN	C	201;201;157;157	ENSP00000345350:W201C;ENSP00000263208:W201C;ENSP00000446073:W157C;ENSP00000441870:W157C	ENSP00000263208:W201C	W	-	3	0	HIRA	17764361	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.119000	0.77145	2.655000	0.90218	0.655000	0.94253	TGG	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.557	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIRA	protein_coding	OTTHUMT00000316488.2	C	NM_003325	-		19384361	-1	no_errors	ENST00000263208	ensembl	human	known	74_37	missense	SNP	1.000	G
DNAH7	56171	genome.wustl.edu	37	2	196689122	196689122	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr2:196689122G>T	ENST00000312428.6	-	49	9248	c.9148C>A	c.(9148-9150)Ctt>Att	p.L3050I		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3050	AAA 5. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TTTAGTAGAAGAGGTTCCAAA	0.363																																																	0								ENSG00000118997						137.0	129.0	132.0					2																	196689122		1832	4083	5915	DNAH7	SO:0001583	missense	0			-	HGNC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.9148C>A	2.37:g.196689122G>T	ENSP00000311273:p.Leu3050Ile	Somatic	0	50	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_hand_dom	p.L3050I	ENST00000312428.6	37	c.9148	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	G	1.651	-0.514037	0.04200	.	.	ENSG00000118997	ENST00000312428	T	0.26373	1.74	4.97	3.18	0.36537	.	0.000000	0.85682	D	0.000000	T	0.17450	0.0419	N	0.20483	0.58	0.80722	D	1	B	0.27286	0.174	B	0.38225	0.268	T	0.03394	-1.1041	10	0.06236	T	0.91	.	11.2046	0.48762	0.1505:0.0:0.8495:0.0	.	3050	Q8WXX0	DYH7_HUMAN	I	3050	ENSP00000311273:L3050I	ENSP00000311273:L3050I	L	-	1	0	DNAH7	196397367	0.995000	0.38212	0.995000	0.50966	0.032000	0.12392	2.157000	0.42320	0.808000	0.34231	-0.142000	0.14014	CTT	-	NULL		0.363	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	protein_coding	OTTHUMT00000335202.3	G	NM_018897	-		196689122	-1	no_errors	ENST00000312428	ensembl	human	known	74_37	missense	SNP	1.000	T
CDH26	60437	genome.wustl.edu	37	20	58587784	58587784	+	Intron	DEL	A	A	-			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr20:58587784delA	ENST00000244047.5	+	15	2483				CDH26_ENST00000497614.1_3'UTR|CDH26_ENST00000244049.3_Stop_Codon_Del|CDH26_ENST00000350849.6_Stop_Codon_Del|CDH26_ENST00000348616.4_Stop_Codon_Del			Q8IXH8	CAD26_HUMAN	cadherin 26						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.*833fs?(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			GTTCCTTCCTAAAAAAAAAAG	0.393																																																	1	Deletion - Frameshift(1)	ovary(1)						ENSG00000124215		,	355,66,3841		7,1,340,0,65,1718	39.0	41.0	40.0		,	-1.5	0.0	20		43	31,134,8089		0,0,31,0,134,3962	no	codingComplex,codingComplex	CDH26	NM_177980.2,NM_021810.4	,	7,1,371,0,199,5680	A1A1,A1A2,A1R,A2A2,A2R,RR		1.999,9.878,4.682	,	,	58587784	386,200,11930	2203	4300	6503	CDH26	SO:0001627	intron_variant	0				HGNC	AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.2172+5942A>-	20.37:g.58587784delA		Somatic	0	24	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.*833fs	ENST00000244047.5	37	c.2498		20																																																																																			-	NULL		0.393	CDH26-201	KNOWN	basic	protein_coding	CDH26	protein_coding		A	NM_177980			58587784	+1	no_errors	ENST00000348616	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
PNPLA7	375775	genome.wustl.edu	37	9	140379046	140379046	+	Silent	SNP	G	G	A			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr9:140379046G>A	ENST00000277531.4	-	20	2451	c.2265C>T	c.(2263-2265)agC>agT	p.S755S	PNPLA7_ENST00000406427.1_Silent_p.S780S|PNPLA7_ENST00000371457.1_Silent_p.S361S	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	755					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		TACCGATGGCGCTGAGGGCAT	0.682																																																	0								ENSG00000130653																																			PNPLA7	SO:0001819	synonymous_variant	0			-	HGNC	AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.2265C>T	9.37:g.140379046G>A		Somatic	1	122	0.81		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	91	109	45.27	B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_cNMP-bd_dom,pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.S780	ENST00000277531.4	37	c.2340	CCDS7045.1	9																																																																																			-	NULL		0.682	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	PNPLA7	protein_coding	OTTHUMT00000254787.1	G	NM_152286	-		140379046	-1	no_errors	ENST00000406427	ensembl	human	known	74_37	silent	SNP	0.079	A
SLC39A6	25800	genome.wustl.edu	37	18	33694172	33694172	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr18:33694172A>C	ENST00000590986.1	-	7	2020	c.1731T>G	c.(1729-1731)agT>agG	p.S577R	SLC39A6_ENST00000269187.5_Missense_Mutation_p.S577R|SLC39A6_ENST00000440549.2_Missense_Mutation_p.S302R			Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter), member 6	577	His-rich.				cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|lamellipodium membrane (GO:0031258)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	41						gctggctgtgactgtgaggat	0.537																																																	0								ENSG00000141424						161.0	163.0	162.0					18																	33694172		2179	4287	6466	SLC39A6	SO:0001583	missense	0			-	HGNC	U41060	CCDS42428.1, CCDS45854.1	18q12.2	2013-05-22				ENSG00000141424		"""Solute carriers"""	18607	protein-coding gene	gene with protein product		608731	"""solute carrier family 39 (metal ion transporter), member 6"""			12659941, 12839489	Standard	NM_012319		Approved	LIV-1	uc010dmy.3	Q13433		ENST00000590986.1:c.1731T>G	18.37:g.33694172A>C	ENSP00000465915:p.Ser577Arg	Somatic	0	31	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	60	24.05	B4DR49|B4E224|Q8IXR3|Q96HP5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ZIP	p.S577R	ENST00000590986.1	37	c.1731	CCDS42428.1	18	.	.	.	.	.	.	.	.	.	.	A	18.57	3.653229	0.67472	.	.	ENSG00000141424	ENST00000269187;ENST00000543723;ENST00000440549	T;T	0.50813	0.73;0.73	6.04	-0.177	0.13307	.	0.075413	0.85682	D	0.000000	T	0.47229	0.1434	N	0.17631	0.505	0.47374	D	0.999401	D;D	0.76494	0.999;0.982	D;P	0.73380	0.98;0.802	T	0.40572	-0.9556	10	0.56958	D	0.05	-18.9648	9.7552	0.40500	0.5031:0.0:0.4969:0.0	.	577;302	Q13433;Q13433-2	S39A6_HUMAN;.	R	577;302;302	ENSP00000269187:S577R;ENSP00000401139:S302R	ENSP00000269187:S577R	S	-	3	2	SLC39A6	31948170	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	1.158000	0.31737	-0.032000	0.13758	0.460000	0.39030	AGT	-	pfam_ZIP		0.537	SLC39A6-004	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	SLC39A6	protein_coding	OTTHUMT00000444136.1	A		-		33694172	-1	no_errors	ENST00000269187	ensembl	human	known	74_37	missense	SNP	0.997	C
RPA4	29935	genome.wustl.edu	37	X	96140083	96140083	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chrX:96140083G>C	ENST00000373040.3	+	1	1177	c.774G>C	c.(772-774)aaG>aaC	p.K258N	DIAPH2_ENST00000373054.4_Intron|DIAPH2_ENST00000324765.8_Intron|DIAPH2_ENST00000355827.4_Intron|DIAPH2_ENST00000373049.4_Intron|DIAPH2_ENST00000373061.3_Intron	NM_013347.4	NP_037479.1	Q13156	RFA4_HUMAN	replication protein A4, 30kDa	258					DNA damage checkpoint (GO:0000077)|DNA recombination (GO:0006310)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	13						AGCATTTTAAGTCTGCTGATT	0.468								Other identified genes with known or suspected DNA repair function																																									0								ENSG00000204086						81.0	71.0	74.0					X																	96140083		2203	4300	6503	RPA4	SO:0001583	missense	0			-	HGNC	U24186	CCDS35345.1	Xq21	2010-04-09	2010-04-09		ENSG00000204086	ENSG00000204086			30305	protein-coding gene	gene with protein product		300767	"""replication protein A4, 34kDa"""			7760808	Standard	NM_013347		Approved	HSU24186	uc004efv.4	Q13156	OTTHUMG00000021987	ENST00000373040.3:c.774G>C	X.37:g.96140083G>C	ENSP00000362131:p.Lys258Asn	Somatic	0	17	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	17	56.41	Q3SY03	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RPA_C,pfam_NA-bd_OB_tRNA,superfamily_NA-bd_OB-fold,pirsf_RPA32	p.K258N	ENST00000373040.3	37	c.774	CCDS35345.1	X	.	.	.	.	.	.	.	.	.	.	G	12.79	2.043267	0.36085	.	.	ENSG00000204086	ENST00000373040	T	0.46063	0.88	3.52	2.37	0.29283	Winged helix-turn-helix transcription repressor DNA-binding (1);	.	.	.	.	T	0.51278	0.1665	M	0.93420	3.415	0.09310	N	1	D	0.54047	0.964	B	0.43445	0.42	T	0.54846	-0.8232	9	0.87932	D	0	-27.831	4.4009	0.11386	0.8401:0.0:0.1599:0.0	.	258	Q13156	RFA4_HUMAN	N	258	ENSP00000362131:K258N	ENSP00000362131:K258N	K	+	3	2	RPA4	96026739	0.987000	0.35691	0.022000	0.16811	0.051000	0.14879	0.828000	0.27435	0.568000	0.29311	-0.340000	0.08031	AAG	-	pirsf_RPA32		0.468	RPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPA4	protein_coding	OTTHUMT00000057464.1	G	NM_013347	-		96140083	+1	no_errors	ENST00000373040	ensembl	human	known	74_37	missense	SNP	0.026	C
ALDH18A1	5832	genome.wustl.edu	37	10	97402888	97402888	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr10:97402888C>T	ENST00000371224.2	-	3	301	c.164G>A	c.(163-165)cGt>cAt	p.R55H	ALDH18A1_ENST00000483788.1_5'UTR|ALDH18A1_ENST00000371221.3_Missense_Mutation_p.R55H	NM_002860.3	NP_002851.2	P54886	P5CS_HUMAN	aldehyde dehydrogenase 18 family, member A1	55	Glutamate 5-kinase.				cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|glutamate metabolic process (GO:0006536)|L-proline biosynthetic process (GO:0055129)|ornithine biosynthetic process (GO:0006592)|proline biosynthetic process (GO:0006561)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glutamate 5-kinase activity (GO:0004349)|glutamate-5-semialdehyde dehydrogenase activity (GO:0004350)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(9)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)		GCCATGTGTACGACTGAGGGG	0.517																																																	0								ENSG00000059573						162.0	131.0	142.0					10																	97402888		2203	4300	6503	ALDH18A1	SO:0001583	missense	0			-	HGNC	X94453	CCDS7443.1, CCDS31257.1	10q24.3-q24.6	2004-08-12	2004-08-12	2004-08-12	ENSG00000059573	ENSG00000059573		"""Aldehyde dehydrogenases"""	9722	protein-coding gene	gene with protein product		138250	"""pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase)"""	GSAS, PYCS		8921385	Standard	XM_006717933		Approved	P5CS	uc001kkz.3	P54886	OTTHUMG00000018815	ENST00000371224.2:c.164G>A	10.37:g.97402888C>T	ENSP00000360268:p.Arg55His	Somatic	0	15	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	18	51.35	B2R5Q4|B7Z350|B7Z5X8|B7ZLP1|D3DR44|O95952|Q3KQU2|Q5T566|Q5T567|Q9UM72	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Asp/Glu/Uridylate_kinase,pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,superfamily_Asp/Glu/Uridylate_kinase,pirsf_P5_carboxy_syn,prints_Glu/AcGlu_kinase,tigrfam_P5_carboxy_syn,tigrfam_G-glutamylP_reductase	p.R55H	ENST00000371224.2	37	c.164	CCDS7443.1	10	.	.	.	.	.	.	.	.	.	.	C	19.14	3.769982	0.69992	.	.	ENSG00000059573	ENST00000371224;ENST00000371221	T;T	0.78816	-1.21;-1.21	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.66396	0.2785	N	0.19112	0.55	0.80722	D	1	B;B	0.26041	0.048;0.14	B;B	0.16722	0.004;0.016	T	0.64508	-0.6391	10	0.52906	T	0.07	-11.9993	17.1215	0.86702	0.0:1.0:0.0:0.0	.	55;55	P54886;P54886-2	P5CS_HUMAN;.	H	55	ENSP00000360268:R55H;ENSP00000360265:R55H	ENSP00000360265:R55H	R	-	2	0	ALDH18A1	97392878	1.000000	0.71417	0.962000	0.40283	0.739000	0.42172	5.612000	0.67681	2.706000	0.92434	0.655000	0.94253	CGT	-	pirsf_P5_carboxy_syn		0.517	ALDH18A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALDH18A1	protein_coding	OTTHUMT00000049552.1	C	NM_002860	-		97402888	-1	no_errors	ENST00000371224	ensembl	human	known	74_37	missense	SNP	0.999	T
APOBR	55911	genome.wustl.edu	37	16	28507424	28507424	+	Intron	SNP	C	C	T	rs148114931|rs441214	byFrequency	TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr16:28507424C>T	ENST00000431282.1	+	3	1058				CLN3_ENST00000567160.1_5'Flank|APOBR_ENST00000328423.5_Intron|APOBR_ENST00000564831.1_Silent_p.A354A|CLN3_ENST00000569430.1_5'Flank			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor						cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						GGGAGGAGGCCGGGACAGCCT	0.711																																																	0								ENSG00000184730						8.0	11.0	10.0					16																	28507424		1858	4004	5862	APOBR	SO:0001627	intron_variant	0			-	HGNC	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.1049-14C>T	16.37:g.28507424C>T		Somatic	0	17	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	27	22.86	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A354	ENST00000431282.1	37	c.1062		16																																																																																			-	NULL		0.711	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	APOBR	protein_coding		C	NM_182804	rs441214		28507424	+1	no_errors	ENST00000564831	ensembl	human	known	74_37	silent	SNP	0.000	T
NAA16	79612	genome.wustl.edu	37	13	41936768	41936768	+	Intron	SNP	G	G	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr13:41936768G>T	ENST00000379406.3	+	13	1863				NAA16_ENST00000497143.1_3'UTR|NAA16_ENST00000379367.3_Intron	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit						N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						TTATTTTATTGCTTGCTTTTA	0.398																																																	0								ENSG00000172766																																			NAA16	SO:0001627	intron_variant	0			-	HGNC	AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.1539+473G>T	13.37:g.41936768G>T		Somatic	0	60	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000379406.3	37	NULL	CCDS9379.1	13																																																																																			-	-		0.398	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA16	protein_coding	OTTHUMT00000044672.2	G	NM_018527	-		41936768	+1	no_errors	ENST00000497143	ensembl	human	known	74_37	rna	SNP	0.961	T
TUBB8P12	260334	genome.wustl.edu	37	18	47562	47582	+	In_Frame_Del	DEL	ATTGCTGTAAACTGCTCTGAG	ATTGCTGTAAACTGCTCTGAG	-			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	ATTGCTGTAAACTGCTCTGAG	ATTGCTGTAAACTGCTCTGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr18:47562_47582delATTGCTGTAAACTGCTCTGAG	ENST00000573909.1	-	3	1573_1593	c.1041_1061delCTCAGAGCAGTTTACAGCAAT	c.(1039-1062)gtctcagagcagtttacagcaatg>gtg	p.SEQFTAM348del	RP11-683L23.1_ENST00000594555.1_5'Flank|RP11-683L23.1_ENST00000308911.6_In_Frame_Del_p.SEQFTAM382del																							GCGCCTGAACATTGCTGTAAACTGCTCTGAGACACATGTGA	0.534																																																	0								ENSG00000173213																																			RP11-683L23.1	SO:0001651	inframe_deletion	0				Clone_based_vega_gene																												ENST00000573909.1:c.1041_1061delCTCAGAGCAGTTTACAGCAAT	18.37:g.47562_47582delATTGCTGTAAACTGCTCTGAG	ENSP00000459638:p.Ser348_Met354del	Somatic	NA	NA	NA		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.SEQFTAM382in_frame_del	ENST00000573909.1	37	c.1163_1143		18																																																																																			-	superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin		0.534	RP11-683L23.1-002	PUTATIVE	not_best_in_genome_evidence|basic	protein_coding	ENSG00000173213	protein_coding	OTTHUMT00000439819.1	ATTGCTGTAAACTGCTCTGAG				47582	-1	no_errors	ENST00000308911	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
MYO7A	4647	genome.wustl.edu	37	11	76895771	76895792	+	Intron	DEL	GGAGGCGGGGACACCAGGGCCT	GGAGGCGGGGACACCAGGGCCT	-	rs111906251|rs143953991|rs78509218|rs111033223|rs369969967|rs12291062	byFrequency	TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	GGAGGCGGGGACACCAGGGCCT	GGAGGCGGGGACACCAGGGCCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr11:76895771_76895792delGGAGGCGGGGACACCAGGGCCT	ENST00000409709.3	+	27	3775				MYO7A_ENST00000409893.1_Stop_Codon_Del|MYO7A_ENST00000409619.2_Intron|MYO7A_ENST00000458637.2_Intron	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA						actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						GTCAGTGCCGGGAGGCGGGGACACCAGGGCCTGAAAGTCTTT	0.599														2033	0.40595	0.466	0.4712	5008	,	,		20094	0.3194		0.4901	False		,,,				2504	0.2812																0								ENSG00000137474		,,	1379,2453		340,699,877					,,	-8.4	0.0		dbSNP_126	18	3099,4701		776,1547,1577	no	intron,frameshift,intron	MYO7A	NM_001127180.1,NM_001127179.2,NM_000260.3	,,	1116,2246,2454	A1A1,A1R,RR		39.7308,35.9864,38.4972	,,	,,		4478,7154				MYO7A	SO:0001627	intron_variant	0				HGNC	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.3503+11GGAGGCGGGGACACCAGGGCCT>-	11.37:g.76895771_76895792delGGAGGCGGGGACACCAGGGCCT		Somatic	NA	NA	NA		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom	p.G1172fs	ENST00000409709.3	37	c.3514_3535	CCDS53683.1	11																																																																																			-	smart_MyTH4_dom,pfscan_MyTH4_dom		0.599	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	protein_coding	OTTHUMT00000328133.1	GGAGGCGGGGACACCAGGGCCT	NM_000260			76895792	+1	no_errors	ENST00000409893	ensembl	human	putative	74_37	frame_shift_del	DEL	0.000:0.000:0.001:0.001:0.004:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.011:0.011:0.009:0.051:0.048:0.007	-
CACNG3	10368	genome.wustl.edu	37	16	24373086	24373086	+	Missense_Mutation	SNP	C	C	T	rs555623613		TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr16:24373086C>T	ENST00000005284.3	+	4	2052	c.850C>T	c.(850-852)Cgg>Tgg	p.R284W		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	284					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		CAACTCCGACCGGGACCACGC	0.552													c|||	1	0.000199681	0.0	0.0	5008	,	,		18452	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000006116						97.0	103.0	101.0					16																	24373086		2197	4300	6497	CACNG3	SO:0001583	missense	0			-	HGNC	AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.850C>T	16.37:g.24373086C>T	ENSP00000005284:p.Arg284Trp	Somatic	0	15	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	18	56.10		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_gsu	p.R284W	ENST00000005284.3	37	c.850	CCDS10620.1	16	.	.	.	.	.	.	.	.	.	.	c	18.07	3.542135	0.65198	.	.	ENSG00000006116	ENST00000005284	T	0.58210	0.35	4.93	3.95	0.45737	.	0.348823	0.26062	N	0.026565	T	0.67924	0.2945	M	0.66939	2.045	0.51233	D	0.999918	D	0.89917	1.0	D	0.70487	0.969	T	0.70263	-0.4920	10	0.72032	D	0.01	-9.5464	11.9856	0.53145	0.315:0.685:0.0:0.0	.	284	O60359	CCG3_HUMAN	W	284	ENSP00000005284:R284W	ENSP00000005284:R284W	R	+	1	2	CACNG3	24280587	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	2.536000	0.45693	1.015000	0.39444	0.645000	0.84053	CGG	-	NULL		0.552	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG3	protein_coding	OTTHUMT00000254548.1	C	NM_006539	-		24373086	+1	no_errors	ENST00000005284	ensembl	human	known	74_37	missense	SNP	1.000	T
ADRB2	154	genome.wustl.edu	37	5	148206526	148206526	+	Silent	SNP	C	C	T			TCGA-DX-A3UE-01A-11D-A307-09	TCGA-DX-A3UE-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99becc09-c06c-445f-946c-0d4950325629	2ae737e8-11a5-4237-9e76-1dc179ac3d11	g.chr5:148206526C>T	ENST00000305988.4	+	1	371	c.132C>T	c.(130-132)gtC>gtT	p.V44V		NM_000024.5	NP_000015	P07550	ADRB2_HUMAN	adrenoceptor beta 2, surface	44					activation of adenylate cyclase activity (GO:0007190)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|bone resorption (GO:0045453)|brown fat cell differentiation (GO:0050873)|cell surface receptor signaling pathway (GO:0007166)|desensitization of G-protein coupled receptor protein signaling pathway by arrestin (GO:0002032)|diet induced thermogenesis (GO:0002024)|endosome to lysosome transport (GO:0008333)|heat generation (GO:0031649)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of smooth muscle contraction (GO:0045986)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor-mediated endocytosis (GO:0006898)|regulation of sodium ion transport (GO:0002028)|regulation of vasodilation (GO:0042312)|response to cold (GO:0009409)|vasodilation by norepinephrine-epinephrine involved in regulation of systemic arterial blood pressure (GO:0002025)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	beta2-adrenergic receptor activity (GO:0004941)|norepinephrine binding (GO:0051380)|potassium channel regulator activity (GO:0015459)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(3)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Acebutolol(DB01193)|Alprenolol(DB00866)|Amitriptyline(DB00321)|Amphetamine(DB00182)|Arbutamine(DB01102)|Arformoterol(DB01274)|Asenapine(DB06216)|Atenolol(DB00335)|Bambuterol(DB01408)|Betaxolol(DB00195)|Bethanidine(DB00217)|Bevantolol(DB01295)|Bisoprolol(DB00612)|Bopindolol(DB08807)|Bupranolol(DB08808)|Cabergoline(DB00248)|Carteolol(DB00521)|Carvedilol(DB01136)|Clenbuterol(DB01407)|Desipramine(DB01151)|Dipivefrin(DB00449)|Dobutamine(DB00841)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Fenoterol(DB01288)|Formoterol(DB00983)|Indacaterol(DB05039)|Isoetarine(DB00221)|Isoprenaline(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Mephentermine(DB01365)|Metipranolol(DB01214)|Metoprolol(DB00264)|Mirtazapine(DB00370)|Nadolol(DB01203)|Nebivolol(DB04861)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Orciprenaline(DB00816)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Phenoxybenzamine(DB00925)|Phenylpropanolamine(DB00397)|Pindolol(DB00960)|Pirbuterol(DB01291)|Procaterol(DB01366)|Propranolol(DB00571)|Pseudoephedrine(DB00852)|Ritodrine(DB00867)|Salbutamol(DB01001)|Salmeterol(DB00938)|Sotalol(DB00489)|Terbutaline(DB00871)|Timolol(DB00373)|Trimipramine(DB00726)	CTCTCATCGTCCTGGCCATCG	0.582																																																	0								ENSG00000169252						192.0	174.0	180.0					5																	148206526		2203	4300	6503	ADRB2	SO:0001819	synonymous_variant	0			-	HGNC	AF022953	CCDS4292.1	5q31-q32	2012-08-08	2012-05-09		ENSG00000169252	ENSG00000169252		"""GPCR / Class A : Adrenoceptors : beta"""	286	protein-coding gene	gene with protein product		109690	"""adrenergic, beta-2-, receptor, surface"""	ADRB2R			Standard	NM_000024		Approved	ADRBR, BAR, B2AR	uc003lpr.2	P07550	OTTHUMG00000129933	ENST00000305988.4:c.132C>T	5.37:g.148206526C>T		Somatic	0	29	0.00		0.6985951174838387	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	34	47.69	B0LPE4|B2R7X2|O14823|O14824|O14825|O14826|Q4JG18|Q53GA6|Q6GMT4|Q6P4D8|Q8NEQ9|Q96EC3|Q9UCZ0|Q9UCZ1|Q9UCZ2|Q9UCZ3|Q9UH95|Q9UHA1|Q9UMZ5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_ADRB2_rcpt,prints_GPCR_Rhodpsn,prints_ADR_fam	p.V44	ENST00000305988.4	37	c.132	CCDS4292.1	5																																																																																			-	prints_GPCR_Rhodpsn		0.582	ADRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRB2	protein_coding	OTTHUMT00000252189.1	C	NM_000024	-		148206526	+1	no_errors	ENST00000305988	ensembl	human	known	74_37	silent	SNP	0.998	T
