#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PDXDC1	23042	genome.wustl.edu	37	16	15198400	15198401	+	Intron	INS	-	-	G	rs372111052|rs543842154|rs62039523	byFrequency	TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr16:15198400_15198401insG	ENST00000535621.2	+	17	1587				RP11-72I8.1_ENST00000569858.1_RNA|NPIPP1_ENST00000534799.2_RNA|RP11-1186N24.5_ENST00000605794.1_RNA			Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1						carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AGCAGACACTCGGAGGTGTCTT	0.545																																																	0								ENSG00000188599																																			NPIPP1	SO:0001627	intron_variant	0				HGNC	AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000535621.2:c.1400-34335->G	16.37:g.15198402_15198402dupG		Somatic	0	28	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	45	16.67	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000535621.2	37	NULL		16																																																																																			-	-		0.545	PDXDC1-016	PUTATIVE	basic	protein_coding	NPIPP1	protein_coding	OTTHUMT00000422421.1	-	NM_015027			15198401	-1	no_errors	ENST00000534799	ensembl	human	known	74_37	rna	INS	0.017:0.018	G
RPL23AP82	284942	genome.wustl.edu	37	22	51237643	51237643	+	RNA	SNP	C	C	G			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr22:51237643C>G	ENST00000480246.1	+	0	893					NR_026982.1																						TAAttagaatcaaatctataa	0.269																																																	0								ENSG00000184319																																			AC002055.4			0			-	Clone_based_vega_gene																													22.37:g.51237643C>G		Somatic	0	19	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	11	42.11		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000480246.1	37	NULL		22																																																																																			-	-		0.269	AC002055.4-006	KNOWN	basic	processed_transcript	RPL23AP82	pseudogene	OTTHUMT00000316621.1	C		-		51237643	+1	no_errors	ENST00000462238	ensembl	human	known	74_37	rna	SNP	0.999	G
PTCD1	26024	genome.wustl.edu	37	7	99022880	99022880	+	Silent	SNP	G	G	A	rs80070442	byFrequency	TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr7:99022880G>A	ENST00000292478.4	-	6	1525	c.1275C>T	c.(1273-1275)gcC>gcT	p.A425A	ATP5J2-PTCD1_ENST00000413834.1_Silent_p.A474A|PTCD1_ENST00000555673.1_Silent_p.A474A	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	425					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			CTGCGGTGAGGGCTGCTGTGT	0.647																																																	0								ENSG00000248919						101.0	100.0	101.0					7																	99022880		2203	4300	6503	ATP5J2-PTCD1	SO:0001819	synonymous_variant	0			-	HGNC	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.1275C>T	7.37:g.99022880G>A		Somatic	0	22	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	17	45.16	Q3ZB78|Q66K60|Q9UDV2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Pentatricopeptide_repeat,pfam_F1F0-ATPsyn_F_prd,tigrfam_Pentatricopeptide_repeat	p.A474	ENST00000292478.4	37	c.1422	CCDS34691.1	7																																																																																			-	NULL		0.647	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5J2-PTCD1	protein_coding	OTTHUMT00000336391.1	G	NM_015545	-		99022880	-1	no_errors	ENST00000413834	ensembl	human	known	74_37	silent	SNP	0.000	A
MCRS1	10445	genome.wustl.edu	37	12	49960203	49960203	+	Intron	DEL	C	C	-			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr12:49960203delC	ENST00000550165.1	-	4	277				MCRS1_ENST00000343810.4_Intron|MCRS1_ENST00000357123.4_Frame_Shift_Del_p.G7fs|MCRS1_ENST00000546244.1_Intron			Q96EZ8	MCRS1_HUMAN	microspherule protein 1						cellular protein modification process (GO:0006464)|chromatin organization (GO:0006325)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|Ino80 complex (GO:0031011)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)	23						CTGGGCAGTTCCCCCGGTGCC	0.597																																																	0								ENSG00000187778						31.0	28.0	29.0					12																	49960203		2201	4297	6498	MCRS1	SO:0001627	intron_variant	0				HGNC	BC011794	CCDS8787.1, CCDS31795.1, CCDS61118.1	12q13.12	2011-07-06				ENSG00000187778		"""INO80 complex subunits"""	6960	protein-coding gene	gene with protein product	"""INO80 complex subunit Q"""	609504				9765390, 9654073	Standard	NM_006337		Approved	ICP22BP, MSP58, P78, MCRS2, INO80Q	uc001rui.1	Q96EZ8		ENST00000550165.1:c.11-205G>-	12.37:g.49960203delC		Somatic	0	36	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	33	8.33	O14742|O75497|Q6VN53|Q7Z372	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.G7fs	ENST00000550165.1	37	c.20	CCDS8787.1	12																																																																																			-	NULL		0.597	MCRS1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MCRS1	protein_coding	OTTHUMT00000405102.1	C	NM_006337			49960203	-1	no_errors	ENST00000357123	ensembl	human	known	74_37	frame_shift_del	DEL	0.965	-
LAMC3	10319	genome.wustl.edu	37	9	133901823	133901823	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr9:133901823G>T	ENST00000361069.4	+	2	658	c.525G>T	c.(523-525)gaG>gaT	p.E175D	LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	175	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GCCGGCCCGAGGGCCAGTACC	0.672																																																	0								ENSG00000050555						33.0	38.0	36.0					9																	133901823		2203	4298	6501	LAMC3	SO:0001583	missense	0			-	HGNC	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.525G>T	9.37:g.133901823G>T	ENSP00000354360:p.Glu175Asp	Somatic	0	43	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_B_type_IV,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.E175D	ENST00000361069.4	37	c.525	CCDS6938.1	9	.	.	.	.	.	.	.	.	.	.	G	8.447	0.852171	0.17034	.	.	ENSG00000050555	ENST00000361069;ENST00000355048;ENST00000320021	T	0.74947	-0.89	5.93	4.06	0.47325	Laminin, N-terminal (3);	0.377733	0.30151	N	0.010290	T	0.50326	0.1609	N	0.13098	0.295	0.30535	N	0.767011	B	0.12013	0.005	B	0.20184	0.028	T	0.42599	-0.9442	10	0.06891	T	0.86	.	6.1204	0.20150	0.071:0.1342:0.6558:0.1391	.	175	Q9Y6N6	LAMC3_HUMAN	D	175	ENSP00000354360:E175D	ENSP00000325873:E175D	E	+	3	2	LAMC3	132891644	0.252000	0.23972	1.000000	0.80357	0.009000	0.06853	0.291000	0.18994	0.813000	0.34350	-0.150000	0.13652	GAG	-	pfam_Laminin_N,smart_Laminin_N,pfscan_Laminin_N		0.672	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC3	protein_coding	OTTHUMT00000054717.3	G	NM_006059	-		133901823	+1	no_errors	ENST00000361069	ensembl	human	known	74_37	missense	SNP	0.946	T
TGM6	343641	genome.wustl.edu	37	20	2380365	2380365	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr20:2380365C>A	ENST00000202625.2	+	6	892	c.831C>A	c.(829-831)ttC>ttA	p.F277L	TGM6_ENST00000381423.1_Missense_Mutation_p.F277L|TGM6_ENST00000477505.1_3'UTR	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	277					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	GCTGGGTCTTCGCCGGAGTCC	0.587																																																	0								ENSG00000166948						29.0	34.0	32.0					20																	2380365		2203	4300	6503	TGM6	SO:0001583	missense	0			-	HGNC	AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.831C>A	20.37:g.2380365C>A	ENSP00000202625:p.Phe277Leu	Somatic	0	29	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.F277L	ENST00000202625.2	37	c.831	CCDS13025.1	20	.	.	.	.	.	.	.	.	.	.	C	19.00	3.741952	0.69418	.	.	ENSG00000166948	ENST00000202625;ENST00000381423	D;D	0.98264	-4.83;-4.83	5.0	2.9	0.33743	Transglutaminase, conserved site (1);Transglutaminase-like (2);	0.050698	0.85682	D	0.000000	D	0.98488	0.9496	M	0.83692	2.655	0.38855	D	0.956357	D;D	0.89917	0.997;1.0	D;D	0.91635	0.944;0.999	D	0.98735	1.0714	10	0.87932	D	0	-22.3758	5.7509	0.18146	0.0:0.6952:0.0:0.3048	.	277;277	O95932-2;O95932	.;TGM3L_HUMAN	L	277	ENSP00000202625:F277L;ENSP00000370831:F277L	ENSP00000202625:F277L	F	+	3	2	TGM6	2328365	0.999000	0.42202	1.000000	0.80357	0.973000	0.67179	0.586000	0.23894	1.312000	0.45043	0.561000	0.74099	TTC	-	pfam_Transglutaminase-like,smart_Transglutaminase-like		0.587	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM6	protein_coding	OTTHUMT00000077581.2	C	NM_198994	-		2380365	+1	no_errors	ENST00000202625	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC25A36	55186	genome.wustl.edu	37	3	140695202	140695207	+	In_Frame_Del	DEL	TCGTGG	TCGTGG	-	rs142389196		TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	TCGTGG	TCGTGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr3:140695202_140695207delTCGTGG	ENST00000324194.6	+	7	1011_1016	c.843_848delTCGTGG	c.(841-849)tatcgtggt>tat	p.RG282del	SLC25A36_ENST00000446041.2_In_Frame_Del_p.RG281del|SLC25A36_ENST00000453248.2_In_Frame_Del_p.RG256del			Q96CQ1	S2536_HUMAN	solute carrier family 25 (pyrimidine nucleotide carrier ), member 36	282					response to estradiol (GO:0032355)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						GGTCTCTTTATCGTGGTCTGACAACT	0.408																																																	0								ENSG00000114120																																			SLC25A36	SO:0001651	inframe_deletion	0				HGNC	AK001480	CCDS3114.1, CCDS46927.1	3q23	2013-05-22	2012-03-29		ENSG00000114120	ENSG00000114120		"""Solute carriers"""	25554	protein-coding gene	gene with protein product			"""solute carrier family 25, member 36"""				Standard	NM_001104647		Approved	FLJ10618, PNC2	uc003etr.2	Q96CQ1	OTTHUMG00000160260	ENST00000324194.6:c.843_848delTCGTGG	3.37:g.140695202_140695207delTCGTGG	ENSP00000320688:p.Arg282_Gly283del	Somatic	NA	NA	NA		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8MYF7|Q05CY1|Q9H0G8|Q9NVN5	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier,prints_Mit_uncoupling	p.RG282in_frame_del	ENST00000324194.6	37	c.843_848	CCDS46927.1	3																																																																																			-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier		0.408	SLC25A36-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A36	protein_coding	OTTHUMT00000359929.1	TCGTGG	NM_018155			140695207	+1	no_errors	ENST00000324194	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:0.993:1.000:1.000	-
LSP1	4046	genome.wustl.edu	37	11	1905554	1905557	+	Splice_Site	DEL	GTCT	GTCT	-			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	GTCT	GTCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr11:1905554_1905557delGTCT	ENST00000311604.3	+	6	810		c.e6+1		LSP1_ENST00000405957.2_Splice_Site|LSP1_ENST00000381775.1_Splice_Site|LSP1_ENST00000485341.1_Splice_Site|LSP1_ENST00000406638.2_Splice_Site	NM_002339.2	NP_002330.1	P33241	LSP1_HUMAN	lymphocyte-specific protein 1						cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|signal transducer activity (GO:0004871)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)		TAGAGAAGAGgtctgtctgtctgt	0.569																																																	0								ENSG00000130592		,,,	3,4255		0,3,2126					,,,	3.1	0.7			63	16,8228		0,16,4106	no	splice-5,splice-5,splice-5,splice-5	LSP1	NM_002339.2,NM_001013255.1,NM_001013254.1,NM_001013253.1	,,,	0,19,6232	A1A1,A1R,RR		0.1941,0.0705,0.152	,,,	,,,		19,12483				LSP1	SO:0001630	splice_region_variant	0				HGNC	M33552	CCDS31334.1, CCDS31335.1, CCDS58110.1	11p15.5	2008-02-05			ENSG00000130592	ENSG00000130592			6707	protein-coding gene	gene with protein product		153432				2174784	Standard	NM_001242932		Approved	WP34	uc001luj.3	P33241	OTTHUMG00000012252	ENST00000311604.3:c.635+1GTCT>-	11.37:g.1905562_1905565delGTCT		Somatic	0	53	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	48	11.11	B3KPP1|B3KRR6|E9PBV6|E9PFP3|Q16096|Q53H48|Q6FHM3|Q9BUY8	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	e6+1	ENST00000311604.3	37	c.635+1_635+1	CCDS31334.1	11																																																																																			-	-		0.569	LSP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	LSP1	protein_coding	OTTHUMT00000034045.3	GTCT	NM_002339		Intron	1905557	+1	no_errors	ENST00000311604	ensembl	human	known	74_37	splice_site_del	DEL	1.000:0.959:0.063:0.057	-
SYCP3	50511	genome.wustl.edu	37	12	102122901	102122901	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr12:102122901delT	ENST00000392927.3	-	8	774	c.643delA	c.(643-645)attfs	p.I215fs	SYCP3_ENST00000392924.1_Frame_Shift_Del_p.I215fs|SYCP3_ENST00000266743.2_Frame_Shift_Del_p.I215fs	NM_001177948.1|NM_001177949.1|NM_153694.4	NP_001171419.1|NP_001171420.1|NP_710161.1	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	215	Gln-rich.				male meiosis I (GO:0007141)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						TCCATCATAATTTTTTTTTGC	0.259																																																	0			GRCh37	CD035010	SYCP3	D		ENSG00000139351		,,	9,54,4181		1,0,7,9,36,2069	53.0	55.0	54.0		,,	4.2	1.0	12		55	10,59,8149		0,0,10,17,25,4057	no	codingComplex,codingComplex,codingComplex	SYCP3	NM_153694.4,NM_001177949.1,NM_001177948.1	,,	1,0,17,26,61,6126	A1A1,A1A2,A1R,A2A2,A2R,RR		0.8396,1.4844,1.0592	,,	,,	102122901	19,113,12330	2198	4284	6482	SYCP3	SO:0001589	frameshift_variant	0				HGNC	AF492003, AI075991	CCDS9087.1	12q23.2	2007-02-05			ENSG00000139351	ENSG00000139351			18130	protein-coding gene	gene with protein product		604759				12213195, 10854409	Standard	NM_153694		Approved		uc001tis.3	Q8IZU3	OTTHUMG00000150132	ENST00000392927.3:c.643delA	12.37:g.102122901delT	ENSP00000376658:p.Ile215fs	Somatic	0	35	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	48	9.43		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Cor1/Xlr/Xmr	p.I215fs	ENST00000392927.3	37	c.643	CCDS9087.1	12																																																																																			-	NULL		0.259	SYCP3-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	SYCP3	protein_coding	OTTHUMT00000316478.2	T	NM_153694			102122901	-1	no_errors	ENST00000266743	ensembl	human	known	74_37	frame_shift_del	DEL	0.988	-
SLC19A1	6573	genome.wustl.edu	37	21	46951687	46951687	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr21:46951687A>T	ENST00000311124.4	-	3	717	c.565T>A	c.(565-567)Tcg>Acg	p.S189T	SLC19A1_ENST00000485649.2_Missense_Mutation_p.S149T|SLC19A1_ENST00000380010.4_Missense_Mutation_p.S189T|SLC19A1_ENST00000567670.1_Missense_Mutation_p.S189T	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1	189					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	Methotrexate(DB00563)|Pralatrexate(DB06813)	AAGGCCAGCGAGATGTAGTTG	0.662																																																	0								ENSG00000173638						75.0	56.0	62.0					21																	46951687		2201	4295	6496	SLC19A1	SO:0001583	missense	0			-	HGNC	U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638		"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424				9570943	Standard	NM_194255		Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000311124.4:c.565T>A	21.37:g.46951687A>T	ENSP00000308895:p.Ser189Thr	Somatic	0	45	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	30	36.73	B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier	p.S189T	ENST00000311124.4	37	c.565	CCDS13725.1	21	.	.	.	.	.	.	.	.	.	.	A	15.94	2.979726	0.53827	.	.	ENSG00000173638	ENST00000311124;ENST00000380010;ENST00000485649	D;D;D	0.89196	-2.48;-2.48;-2.48	4.78	2.21	0.28008	Major facilitator superfamily domain, general substrate transporter (1);	0.120243	0.64402	N	0.000019	D	0.90280	0.6960	L	0.49571	1.57	0.54753	D	0.999986	D;D;D;D	0.89917	1.0;0.999;0.999;0.999	D;D;D;D	0.77004	0.989;0.984;0.984;0.984	D	0.85486	0.1182	10	0.22109	T	0.4	-25.0419	8.9947	0.36045	0.7047:0.0:0.0:0.2953	.	149;211;189;189	B7Z8C3;D3DSM6;E9PFY4;P41440	.;.;.;S19A1_HUMAN	T	189;189;149	ENSP00000308895:S189T;ENSP00000369347:S189T;ENSP00000441772:S149T	ENSP00000308895:S189T	S	-	1	0	SLC19A1	45776115	1.000000	0.71417	0.759000	0.31340	0.961000	0.63080	6.623000	0.74238	0.230000	0.21059	0.254000	0.18369	TCG	-	pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier		0.662	SLC19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC19A1	protein_coding	OTTHUMT00000206796.1	A		-		46951687	-1	no_errors	ENST00000311124	ensembl	human	known	74_37	missense	SNP	1.000	T
FBXL3	26224	genome.wustl.edu	37	13	77581683	77581683	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr13:77581683delA	ENST00000355619.5	-	5	1208	c.884delT	c.(883-885)ttafs	p.L295fs	FBXL3_ENST00000477982.1_Intron	NM_012158.2	NP_036290.1	Q9UKT7	FBXL3_HUMAN	F-box and leucine-rich repeat protein 3	295					entrainment of circadian clock by photoperiod (GO:0043153)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.L295fs*3(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|urinary_tract(1)	16		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.218)		GBM - Glioblastoma multiforme(99;0.0521)		TTCTTCATATAAAAAAAAATA	0.418																																																	1	Insertion - Frameshift(1)	lung(1)						ENSG00000005812						72.0	73.0	72.0					13																	77581683		2203	4300	6503	FBXL3	SO:0001589	frameshift_variant	0				HGNC	AF129532	CCDS9457.1	13q22	2011-06-09	2004-07-20	2004-07-21	ENSG00000005812	ENSG00000005812		"""F-boxes / Leucine-rich repeats"""	13599	protein-coding gene	gene with protein product		605653	"""F-box and leucine-rich repeat protein 3A"""	FBXL3A		10531035, 10828603	Standard	NM_012158		Approved	FBL3, FBL3A	uc001vkd.3	Q9UKT7	OTTHUMG00000017099	ENST00000355619.5:c.884delT	13.37:g.77581683delA	ENSP00000347834:p.Leu295fs	Somatic	0	33	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	B2RB04|Q9P122	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom	p.L295fs	ENST00000355619.5	37	c.884	CCDS9457.1	13																																																																																			-	NULL		0.418	FBXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL3	protein_coding	OTTHUMT00000045312.3	A				77581683	-1	no_errors	ENST00000355619	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
PTPRVP	148713	genome.wustl.edu	37	1	202156135	202156136	+	RNA	INS	-	-	CCTCGCT	rs369231344|rs139095833|rs78957599|rs368169635	byFrequency	TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr1:202156135_202156136insCCTCGCT	ENST00000482597.1	+	0	3411_3412					NR_002930.2				protein tyrosine phosphatase, receptor type, V, pseudogene																		CTGCAGGCCCCcctcgctcctc	0.639														3092	0.617412	0.3094	0.6816	5008	,	,		20478	0.6835		0.7137	False		,,,				2504	0.8211																0								ENSG00000243323																																			PTPRVP			0				HGNC	AJ629456		1q32.1	2013-09-26	2010-03-16	2010-03-16	ENSG00000243323	ENSG00000243323		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	13421	pseudogene	pseudogene				PTPRV		15358244	Standard	NR_002930		Approved	OST-PTP, ESP	uc009xaa.2		OTTHUMG00000040524		1.37:g.202156136_202156142dupCCTCGCT		Somatic	NA	NA	NA		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000482597.1	37	NULL		1																																																																																			-	-		0.639	PTPRVP-003	KNOWN	basic	processed_transcript	PTPRVP	pseudogene	OTTHUMT00000334021.1	-	XM_086287			202156136	+1	no_errors	ENST00000482597	ensembl	human	known	74_37	rna	INS	0.022:0.016	CCTCGCT
TNFRSF9	3604	genome.wustl.edu	37	1	7995073	7995073	+	Splice_Site	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr1:7995073C>T	ENST00000377507.3	-	6	710	c.544G>A	c.(544-546)Gga>Aga	p.G182R		NM_001561.5	NP_001552.2	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily, member 9	182					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)		GCCCAGTTACCTGGCTCTCTC	0.537																																																	0								ENSG00000049249						76.0	67.0	70.0					1																	7995073		2203	4300	6503	TNFRSF9	SO:0001630	splice_region_variant	0			-	HGNC	L12964	CCDS92.1	1p36	2008-02-05			ENSG00000049249	ENSG00000049249		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11924	protein-coding gene	gene with protein product		602250		ILA		8262389, 8639902	Standard	NM_001561		Approved	CD137, 4-1BB	uc001aot.3	Q07011	OTTHUMG00000001223	ENST00000377507.3:c.544+1G>A	1.37:g.7995073C>T		Somatic	0	52	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	44	27.87		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_9	p.G182R	ENST00000377507.3	37	c.544	CCDS92.1	1	.	.	.	.	.	.	.	.	.	.	C	12.92	2.081545	0.36758	.	.	ENSG00000049249	ENST00000377507	T	0.06687	3.27	4.59	2.63	0.31362	.	0.477271	0.21933	N	0.066988	T	0.06508	0.0167	L	0.38531	1.155	0.09310	N	1	B	0.18461	0.028	B	0.17433	0.018	T	0.37009	-0.9724	9	.	.	.	-7.2801	7.6105	0.28126	0.189:0.6287:0.1823:0.0	.	182	Q07011	TNR9_HUMAN	R	182	ENSP00000366729:G182R	.	G	-	1	0	TNFRSF9	7917660	0.001000	0.12720	0.001000	0.08648	0.399000	0.30720	0.600000	0.24104	0.619000	0.30197	0.455000	0.32223	GGA	-	NULL		0.537	TNFRSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF9	protein_coding	OTTHUMT00000003622.1	C		-	Missense_Mutation	7995073	-1	no_errors	ENST00000377507	ensembl	human	known	74_37	missense	SNP	0.003	T
C4orf33	132321	genome.wustl.edu	37	4	130030691	130030691	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr4:130030691C>T	ENST00000281146.5	+	5	1079	c.358C>T	c.(358-360)Ctc>Ttc	p.L120F	C4orf33_ENST00000425929.1_Missense_Mutation_p.L120F|C4orf33_ENST00000502887.1_Missense_Mutation_p.L120F	NM_173487.2	NP_775758.2	Q8N1A6	CD033_HUMAN	chromosome 4 open reading frame 33	120										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	10						CAAAGCTTATCTCCCTTGGAG	0.358																																																	0								ENSG00000151470						73.0	75.0	74.0					4																	130030691		2203	4300	6503	C4orf33	SO:0001583	missense	0			-	HGNC	AK091022	CCDS3741.1	4q28.2	2008-02-05			ENSG00000151470	ENSG00000151470			27025	protein-coding gene	gene with protein product						12477932	Standard	NM_001099783		Approved	FLJ33703	uc010iod.3	Q8N1A6	OTTHUMG00000133347	ENST00000281146.5:c.358C>T	4.37:g.130030691C>T	ENSP00000281146:p.Leu120Phe	Somatic	0	45	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	27	54.24	D3DNY2|Q6PJF3|Q8NBC5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L120F	ENST00000281146.5	37	c.358	CCDS3741.1	4	.	.	.	.	.	.	.	.	.	.	C	19.73	3.881257	0.72294	.	.	ENSG00000151470	ENST00000281146;ENST00000502887;ENST00000425929	T;T;T	0.35789	1.29;1.29;1.29	5.61	3.86	0.44501	.	0.201130	0.44902	D	0.000403	T	0.51822	0.1697	M	0.73962	2.25	0.48696	D	0.999695	P;P	0.50369	0.934;0.934	P;P	0.53313	0.609;0.723	T	0.56667	-0.7941	10	0.66056	D	0.02	-42.7824	14.0962	0.65023	0.2735:0.7265:0.0:0.0	.	120;120	D6RIT3;Q8N1A6	.;CD033_HUMAN	F	120	ENSP00000281146:L120F;ENSP00000427406:L120F;ENSP00000401090:L120F	ENSP00000281146:L120F	L	+	1	0	C4orf33	130250141	0.372000	0.25064	0.799000	0.32177	0.936000	0.57629	0.344000	0.19962	0.689000	0.31550	0.655000	0.94253	CTC	-	NULL		0.358	C4orf33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf33	protein_coding	OTTHUMT00000257177.2	C	NM_173487	-		130030691	+1	no_errors	ENST00000281146	ensembl	human	known	74_37	missense	SNP	0.981	T
MAP3K14-AS1	100133991	genome.wustl.edu	37	17	43347872	43347872	+	RNA	SNP	G	G	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr17:43347872G>T	ENST00000585780.1	+	0	4950				MAP3K14-AS1_ENST00000590100.1_RNA|MAP3K14_ENST00000344686.2_RNA|MAP3K14-AS1_ENST00000588698.1_RNA|MAP3K14-AS1_ENST00000586450.1_RNA|MAP3K14-AS1_ENST00000585351.1_RNA|MAP3K14-AS1_ENST00000592422.1_RNA|MAP3K14-AS1_ENST00000588504.1_RNA					MAP3K14 antisense RNA 1																		GATGGCCTGGGCTGTGAGAGG	0.637																																																	0								ENSG00000006062						34.0	39.0	38.0					17																	43347872		1971	4153	6124	MAP3K14			0			-	HGNC	AK311429, BC031942		17q21.31	2014-06-16			ENSG00000267278	ENSG00000267278		"""Long non-coding RNAs"""	44359	non-coding RNA	RNA, long non-coding							Standard	NR_024435		Approved		uc002iit.4		OTTHUMG00000180362		17.37:g.43347872G>T		Somatic	0	52	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000585780.1	37	NULL		17	.	.	.	.	.	.	.	.	.	.	G	12.79	2.044594	0.36085	.	.	ENSG00000006062	ENST00000344686	.	.	.	5.46	4.48	0.54585	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.448580	0.25572	N	0.029741	T	0.40119	0.1104	N	0.16307	0.4	0.35082	D	0.763520	P;P	0.52316	0.845;0.952	P;P	0.52424	0.48;0.698	T	0.51934	-0.8642	8	0.33940	T	0.23	.	9.3324	0.38030	0.0771:0.1441:0.7788:0.0	.	627;157	Q99558;Q6ZMZ1	M3K14_HUMAN;.	D	626	.	ENSP00000342059:A626D	A	-	2	0	MAP3K14	40703655	1.000000	0.71417	0.999000	0.59377	0.148000	0.21650	3.632000	0.54287	1.271000	0.44313	0.561000	0.74099	GCC	-	-		0.637	MAP3K14-AS1-008	KNOWN	basic	antisense	MAP3K14	antisense	OTTHUMT00000450941.1	G	NR_024434	-		43347872	-1	no_errors	ENST00000344686	ensembl	human	known	74_37	rna	SNP	0.986	T
PLK3	1263	genome.wustl.edu	37	1	45270790	45270791	+	Intron	INS	-	-	AAAG	rs34617431|rs199871265|rs200571145|rs370027677	byFrequency	TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr1:45270790_45270791insAAAG	ENST00000372201.4	+	14	1874				PLK3_ENST00000465443.1_Intron	NM_004073.2	NP_004064.2	Q9H4B4	PLK3_HUMAN	polo-like kinase 3						apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic microtubule organization (GO:0031122)|endomitotic cell cycle (GO:0007113)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi disassembly (GO:0090166)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G1/S transition checkpoint (GO:0044819)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of cell division (GO:0051302)|regulation of cytokinesis (GO:0032465)|response to osmotic stress (GO:0006970)|response to radiation (GO:0009314)|response to reactive oxygen species (GO:0000302)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi stack (GO:0005795)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					aaaaaaaaaataaagaaaagaa	0.515														659	0.131589	0.0643	0.1412	5008	,	,		17241	0.1647		0.175	False		,,,				2504	0.137																0								ENSG00000173846																																			PLK3	SO:0001627	intron_variant	0				HGNC	AJ293866	CCDS515.1	1p34.1	2013-01-18	2010-06-24	2004-01-28	ENSG00000173846	ENSG00000173846			2154	protein-coding gene	gene with protein product		602913	"""cytokine-inducible kinase"", ""polo-like kinase 3 (Drosophila)"""	CNK		8702627	Standard	NM_004073		Approved	FNK, PRK	uc001cmn.3	Q9H4B4	OTTHUMG00000008491	ENST00000372201.4:c.1636-147->AAAG	1.37:g.45270791_45270794dupAAAG		Somatic	0	13	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	Q15767|Q5JR99|Q96CV1	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372201.4	37	NULL	CCDS515.1	1																																																																																			-	-		0.515	PLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK3	protein_coding	OTTHUMT00000023429.1	-	NM_004073			45270791	+1	no_errors	ENST00000461769	ensembl	human	known	74_37	rna	INS	0.005:0.008	AAAG
GLUL	2752	genome.wustl.edu	37	1	182353691	182353691	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr1:182353691C>T	ENST00000331872.6	-	7	1511	c.971G>A	c.(970-972)cGc>cAc	p.R324H	GLUL_ENST00000339526.4_Missense_Mutation_p.R324H|GLUL_ENST00000491322.1_5'UTR|GLUL_ENST00000417584.2_Missense_Mutation_p.R324H|GLUL_ENST00000311223.5_Missense_Mutation_p.R324H	NM_001033044.2	NP_001028216.1	P15104	GLNA_HUMAN	glutamate-ammonia ligase	324			R -> C (in CSGD; reduced glutamine synthetase activity). {ECO:0000269|PubMed:16267323}.		cell proliferation (GO:0008283)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to starvation (GO:0009267)|glutamate catabolic process (GO:0006538)|glutamine biosynthetic process (GO:0006542)|neurotransmitter uptake (GO:0001504)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of insulin secretion (GO:0032024)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein homooligomerization (GO:0051260)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glial cell projection (GO:0097386)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|glutamate-ammonia ligase activity (GO:0004356)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			endometrium(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	16					Ceftriaxone(DB01212)|Diazoxide(DB01119)|L-Glutamine(DB00130)|L-Methionine(DB00134)|Pegvisomant(DB00082)	CCGGGGAATGCGTATGCTGGC	0.552																																																	0								ENSG00000135821						101.0	91.0	95.0					1																	182353691		2203	4300	6503	GLUL	SO:0001583	missense	0			-	HGNC	AL161952	CCDS1344.1	1q31	2010-05-04	2010-05-04		ENSG00000135821	ENSG00000135821	6.3.1.2		4341	protein-coding gene	gene with protein product	"""glutamine synthetase"""	138290	"""glutamate-ammonia ligase (glutamine synthase)"""	GLNS		1681907, 2888076	Standard	NM_002065		Approved		uc001gpa.2	P15104	OTTHUMG00000037407	ENST00000331872.6:c.971G>A	1.37:g.182353691C>T	ENSP00000356537:p.Arg324His	Somatic	0	32	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	27	34.15	Q499Y9|Q5T9Z1|Q7Z3W4|Q8IZ17	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Gln_synth_cat_dom,pfam_Gln_synt_beta,superfamily_Gln_synt_beta	p.R324H	ENST00000331872.6	37	c.971	CCDS1344.1	1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.560314	0.86335	.	.	ENSG00000135821	ENST00000331872;ENST00000311223;ENST00000417584;ENST00000339526	D;D;D;D	0.95171	-3.63;-3.63;-3.63;-3.63	5.34	5.34	0.76211	Glutamine synthetase, catalytic domain (1);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96664	0.8911	H	0.98351	4.21	0.80722	D	1	P	0.37466	0.596	B	0.34180	0.177	D	0.97664	1.0162	10	0.87932	D	0	-19.7213	17.5747	0.87946	0.0:1.0:0.0:0.0	.	324	P15104	GLNA_HUMAN	H	324	ENSP00000356537:R324H;ENSP00000307900:R324H;ENSP00000398320:R324H;ENSP00000344958:R324H	ENSP00000307900:R324H	R	-	2	0	GLUL	180620314	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.309000	0.78937	2.488000	0.83962	0.563000	0.77884	CGC	-	pfam_Gln_synth_cat_dom		0.552	GLUL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUL	protein_coding	OTTHUMT00000091043.1	C	NM_002065	-		182353691	-1	no_errors	ENST00000311223	ensembl	human	known	74_37	missense	SNP	1.000	T
AL132819.1	0	genome.wustl.edu	37	14	99828698	99828699	+	RNA	DEL	CA	CA	-	rs61984102		TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr14:99828698_99828699delCA	ENST00000401354.1	+	0	71_72																											ctctctctctcACACACACACA	0.5																																																	0								ENSG00000216173																																			AL132819.1			0				Clone_based_ensembl_gene																													14.37:g.99828708_99828709delCA		Somatic	0	34	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401354.1	37	NULL		14																																																																																			-	-		0.500	AL132819.1-201	NOVEL	basic	miRNA	ENSG00000216173	miRNA		CA				99828699	+1	no_errors	ENST00000401354	ensembl	human	novel	74_37	rna	DEL	0.002:0.000	-
MGAT5	4249	genome.wustl.edu	37	2	135206251	135206251	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr2:135206251G>A	ENST00000409645.1	+	17	2311	c.2059G>A	c.(2059-2061)Gcc>Acc	p.A687T	MGAT5_ENST00000281923.2_Missense_Mutation_p.A687T			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	687					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		CTCAGAGCTGGCCAAGGACAT	0.557																																																	0								ENSG00000152127						212.0	206.0	208.0					2																	135206251		2203	4300	6503	MGAT5	SO:0001583	missense	0			-	HGNC	D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.2059G>A	2.37:g.135206251G>A	ENSP00000386377:p.Ala687Thr	Somatic	0	40	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	D3DP70	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A687T	ENST00000409645.1	37	c.2059	CCDS2171.1	2	.	.	.	.	.	.	.	.	.	.	G	11.00	1.510601	0.27036	.	.	ENSG00000152127	ENST00000409645;ENST00000281923	.	.	.	5.09	4.18	0.49190	.	0.251585	0.46442	D	0.000292	T	0.47078	0.1426	L	0.40543	1.245	0.42845	D	0.994068	B	0.28291	0.206	B	0.25291	0.059	T	0.37526	-0.9702	9	0.20519	T	0.43	-4.8993	14.7381	0.69430	0.0:0.0:0.8495:0.1504	.	687	Q09328	MGT5A_HUMAN	T	687	.	ENSP00000281923:A687T	A	+	1	0	MGAT5	134922721	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.551000	0.53698	1.215000	0.43411	0.655000	0.94253	GCC	-	NULL		0.557	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT5	protein_coding	OTTHUMT00000254584.3	G	NM_002410	-		135206251	+1	no_errors	ENST00000281923	ensembl	human	known	74_37	missense	SNP	1.000	A
PLEKHA8P1	51054	genome.wustl.edu	37	12	45567092	45567092	+	RNA	SNP	C	C	T	rs145353585	byFrequency	TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr12:45567092C>T	ENST00000256692.5	-	0	1593					NR_037144.1		O95397	PKHA9_HUMAN	pleckstrin homology domain containing, family A member 8 pseudogene 1							cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						ACGGTTAACGCGGCCACAAAA	0.502																																																	0								ENSG00000134297	C		1,4405	2.1+/-5.4	0,1,2202	103.0	97.0	99.0			-0.7	0.0	12	dbSNP_134	99	1,8599	1.2+/-3.3	0,1,4299	no	intergenic				0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154			45567092	2,13004	2203	4300	6503	PLEKHA8P1			0			-	HGNC	AF103731		12q12	2010-11-24	2010-11-24	2010-11-24	ENSG00000134297	ENSG00000134297			30222	pseudogene	pseudogene	"""putative glycolipid transfer protein"""		"""pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 9"""	PLEKHA9		12477932	Standard	NR_037144		Approved	FLJ14156	uc001rom.2	O95397			12.37:g.45567092C>T		Somatic	0	78	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	83	13.54		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000256692.5	37	NULL		12																																																																																			-	-		0.502	PLEKHA8P1-002	KNOWN	basic	processed_transcript	PLEKHA8P1	pseudogene	OTTHUMT00000404814.1	C	NR_037144	rs145353585		45567092	-1	no_errors	ENST00000256692	ensembl	human	known	74_37	rna	SNP	0.989	T
RP11-289H16.1	0	genome.wustl.edu	37	1	144090788	144090788	+	lincRNA	SNP	C	C	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr1:144090788C>A	ENST00000441760.1	-	0	600				SRGAP2B_ENST00000467933.1_RNA																							ATAGAACCAGCATTGTTAACT	0.403																																																	0								ENSG00000224363																																			RP11-289H16.1			0			-	Clone_based_vega_gene																													1.37:g.144090788C>A		Somatic	0	55	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	74	8.64		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000441760.1	37	NULL		1																																																																																			-	-		0.403	RP11-289H16.1-001	KNOWN	not_best_in_genome_evidence|basic	lincRNA	ENSG00000224363	lincRNA	OTTHUMT00000099257.1	C		-		144090788	-1	no_errors	ENST00000441760	ensembl	human	known	74_37	rna	SNP	0.850	A
HOXA9	3205	genome.wustl.edu	37	7	27204839	27204839	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr7:27204839C>A	ENST00000343483.6	-	1	310	c.238G>T	c.(238-240)Gct>Tct	p.A80S	RP1-170O19.20_ENST00000470747.4_Intron|RP1-170O19.20_ENST00000465941.1_Intron|HOXA9_ENST00000497089.1_Intron|HOXA9_ENST00000396345.1_Missense_Mutation_p.A80S	NM_152739.3	NP_689952.1	P31269	HXA9_HUMAN	homeobox A9	80				Missing (in Ref. 1; AAB40867). {ECO:0000305}.	endothelial cell activation (GO:0042118)|multicellular organismal development (GO:0007275)|negative regulation of myeloid cell differentiation (GO:0045638)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|endometrium(1)|lung(5)|prostate(1)	8						TACACCGCAGCGGGTACAGCG	0.711			T	"""NUP98, MSI2"""	AML*																																			Dom	yes		7	7p15-p14.2	3205	homeo box A9		L	0								ENSG00000078399						9.0	11.0	11.0					7																	27204839		2162	4237	6399	HOXA9	SO:0001583	missense	0			-	HGNC		CCDS5409.1	7p15.2	2011-06-20	2005-12-22		ENSG00000078399	ENSG00000078399		"""Homeoboxes / ANTP class : HOXL subclass"""	5109	protein-coding gene	gene with protein product		142956	"""homeo box A9"""	HOX1G, HOX1		1973146, 1358459	Standard	NM_152739		Approved		uc003syt.3	P31269	OTTHUMG00000023220	ENST00000343483.6:c.238G>T	7.37:g.27204839C>A	ENSP00000343619:p.Ala80Ser	Somatic	0	27	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	O43369|O43429|Q99820	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hox9_activation_N,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pirsf_Homeobox_Hox9,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.A80S	ENST00000343483.6	37	c.238	CCDS5409.1	7	.	.	.	.	.	.	.	.	.	.	C	0.450	-0.894079	0.02491	.	.	ENSG00000078399	ENST00000343483;ENST00000396345	D	0.93019	-3.15	5.37	3.57	0.40892	Hox9, N-terminal activation domain (1);	0.166457	0.28865	N	0.013895	D	0.83418	0.5250	N	0.16602	0.42	0.40567	D	0.981269	B	0.09022	0.002	B	0.15052	0.012	T	0.72830	-0.4174	10	0.02654	T	1	.	9.2544	0.37575	0.0:0.7788:0.0:0.2212	.	80	P31269	HXA9_HUMAN	S	80	ENSP00000343619:A80S	ENSP00000343619:A80S	A	-	1	0	HOXA9	27171364	0.779000	0.28652	0.922000	0.36590	0.517000	0.34286	1.075000	0.30716	0.653000	0.30826	-0.291000	0.09656	GCT	-	pfam_Hox9_activation_N,pirsf_Homeobox_Hox9		0.711	HOXA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA9	protein_coding	OTTHUMT00000358706.2	C		-		27204839	-1	no_errors	ENST00000343483	ensembl	human	known	74_37	missense	SNP	1.000	A
RBM5	10181	genome.wustl.edu	37	3	50155888	50155889	+	Stop_Codon_Del	DEL	GA	GA	-	rs112672304		TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr3:50155888_50155889delGA	ENST00000347869.3	+	0	2622_2623				RP11-493K19.3_ENST00000437204.1_RNA|RP11-493K19.3_ENST00000425674.1_RNA	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5						apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.*816fs?(1)		breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GAGATGgagtgagagagagaga	0.535																																																	1	Deletion - Frameshift(1)	breast(1)						ENSG00000003756																																			RBM5	SO:0001567	stop_retained_variant	0				HGNC	U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	Exception_encountered	3.37:g.50155898_50155899delGA		Somatic	0	23	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	22	26.67	B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_G_patch_dom,pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,smart_G_patch_dom,pfscan_Znf_RanBP2,pfscan_Znf_C2H2,pfscan_G_patch_dom,pfscan_RRM_dom	p.*816fs	ENST00000347869.3	37	c.2447_2448	CCDS2810.1	3																																																																																			-	NULL		0.535	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM5	protein_coding	OTTHUMT00000345797.3	GA	NM_005778			50155889	+1	no_errors	ENST00000347869	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:0.999	-
TBC1D10A	83874	genome.wustl.edu	37	22	30695466	30695466	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr22:30695466C>A	ENST00000215790.7	-	3	548	c.384G>T	c.(382-384)aaG>aaT	p.K128N	RP1-130H16.18_ENST00000447976.1_Missense_Mutation_p.K2N|TBC1D10A_ENST00000490449.1_5'Flank|TBC1D10A_ENST00000403477.3_Missense_Mutation_p.K135N|TBC1D10A_ENST00000403362.1_Missense_Mutation_p.K40N	NM_031937.2	NP_114143.1	Q9BXI6	TB10A_HUMAN	TBC1 domain family, member 10A	128	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				activation of cysteine-type endopeptidase activity (GO:0097202)|positive regulation of proteolysis (GO:0045862)|retrograde transport, endosome to Golgi (GO:0042147)	extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rab GTPase activator activity (GO:0005097)			cervix(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23						GTAACTTCACCTTGCCTCCTG	0.567																																																	0								ENSG00000099992						225.0	156.0	180.0					22																	30695466		2203	4300	6503	TBC1D10A	SO:0001583	missense	0			-	HGNC	AF331038	CCDS13874.1, CCDS56227.1	22q12.2	2013-07-09	2005-03-10	2005-03-10	ENSG00000099992	ENSG00000099992			23609	protein-coding gene	gene with protein product	"""EBP50-PDZ interactor of 64 kD"""	610020	"""TBC1 domain family, member 10"""	TBC1D10		11285285, 20404108	Standard	NM_001204240		Approved	EPI64, AC004997.C22.2	uc010gvu.3	Q9BXI6	OTTHUMG00000150924	ENST00000215790.7:c.384G>T	22.37:g.30695466C>A	ENSP00000215790:p.Lys128Asn	Somatic	0	45	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B3KXT8|O76053|Q20WK7|Q543A2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.K128N	ENST00000215790.7	37	c.384	CCDS13874.1	22	.	.	.	.	.	.	.	.	.	.	C	13.07	2.126211	0.37533	.	.	ENSG00000248751;ENSG00000099992;ENSG00000099992;ENSG00000099992;ENSG00000099992	ENST00000434291;ENST00000215790;ENST00000403477;ENST00000403362;ENST00000393906	T;T;T;T;T	0.17370	3.05;2.28;2.28;2.28;2.28	5.06	2.96	0.34315	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.11623	0.0283	N	0.20483	0.58	0.54753	D	0.999983	B;B;B	0.28470	0.213;0.115;0.213	B;B;B	0.33960	0.173;0.173;0.173	T	0.17592	-1.0364	9	.	.	.	.	10.8299	0.46654	0.0:0.7716:0.0:0.2284	.	128;135;128	Q20WK7;B3KXT8;Q9BXI6	.;.;TB10A_HUMAN	N	2;128;135;40;40	ENSP00000401535:K2N;ENSP00000215790:K128N;ENSP00000384996:K135N;ENSP00000385050:K40N;ENSP00000377484:K40N	.	K	-	3	2	TBC1D10A;RP1-130H16.18	29025466	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	1.164000	0.31810	0.270000	0.21984	-1.134000	0.01955	AAG	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom		0.567	TBC1D10A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TBC1D10A	protein_coding	OTTHUMT00000320550.1	C	NM_031937	-		30695466	-1	no_errors	ENST00000215790	ensembl	human	known	74_37	missense	SNP	1.000	A
CXorf30	645090	genome.wustl.edu	37	X	36337408	36337408	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chrX:36337408C>T	ENST00000378657.4	+	11	1415	c.767C>T	c.(766-768)cCg>cTg	p.P256L		NM_001098843.4	NP_001092313.2	A6PW82	CX030_HUMAN	chromosome X open reading frame 30	256										breast(1)|lung(2)|stomach(1)	4						TTTAGTTCTCCGAGTGAAATA	0.353																																																	0								ENSG00000205081						192.0	145.0	159.0					X																	36337408		692	1591	2283	CXorf30	SO:0001583	missense	0			-	HGNC		CCDS55396.1	Xp21.1	2014-08-07			ENSG00000205081	ENSG00000205081			27298	protein-coding gene	gene with protein product							Standard	NM_001098843		Approved		uc011mkc.3	A6PW82	OTTHUMG00000021353	ENST00000378657.4:c.767C>T	X.37:g.36337408C>T	ENSP00000367926:p.Pro256Leu	Somatic	0	31	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	18	55.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P256L	ENST00000378657.4	37	c.767	CCDS55396.1	X	.	.	.	.	.	.	.	.	.	.	C	2.598	-0.293616	0.05568	.	.	ENSG00000205081	ENST00000378653;ENST00000378657	T;T	0.21734	1.99;2.0	4.32	-1.17	0.09648	.	3.775070	0.00822	N	0.001597	T	0.08313	0.0207	N	0.01352	-0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.26608	-1.0098	10	0.25751	T	0.34	4.4714	8.3663	0.32389	0.0:0.309:0.0:0.691	.	256	A6PW82	CX030_HUMAN	L	541;256	ENSP00000367922:P541L;ENSP00000367926:P256L	ENSP00000367922:P541L	P	+	2	0	CXorf30	36247329	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.270000	0.18607	-0.394000	0.07727	-1.163000	0.01768	CCG	-	NULL		0.353	CXorf30-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf30	protein_coding		C	NP_001092313	-		36337408	+1	no_errors	ENST00000378657	ensembl	human	known	74_37	missense	SNP	0.000	T
TCEB3B	51224	genome.wustl.edu	37	18	44560730	44560730	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr18:44560730G>T	ENST00000332567.4	-	1	1258	c.906C>A	c.(904-906)gaC>gaA	p.D302E	KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000356157.7_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	302					regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TCTGGTGACTGTCTGGAGCCT	0.632																																																	0								ENSG00000206181						108.0	113.0	111.0					18																	44560730		2203	4300	6503	TCEB3B	SO:0001583	missense	0			-	HGNC	BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.906C>A	18.37:g.44560730G>T	ENSP00000331302:p.Asp302Glu	Somatic	0	40	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q9P2V9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub	p.D302E	ENST00000332567.4	37	c.906	CCDS11932.1	18	.	.	.	.	.	.	.	.	.	.	G	11.27	1.588466	0.28357	.	.	ENSG00000206181	ENST00000332567	T	0.06768	3.26	2.09	1.21	0.21127	.	1.176810	0.06948	U	0.814085	T	0.05868	0.0153	L	0.29908	0.895	0.09310	N	1	P	0.41232	0.743	B	0.38056	0.264	T	0.36962	-0.9726	10	0.18276	T	0.48	.	4.6028	0.12361	0.1919:0.0:0.8081:0.0	.	302	Q8IYF1	ELOA2_HUMAN	E	302	ENSP00000331302:D302E	ENSP00000331302:D302E	D	-	3	2	TCEB3B	42814728	0.003000	0.15002	0.000000	0.03702	0.002000	0.02628	0.659000	0.24994	0.462000	0.27095	0.462000	0.41574	GAC	-	NULL		0.632	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEB3B	protein_coding	OTTHUMT00000255900.1	G	NM_016427	-		44560730	-1	no_errors	ENST00000332567	ensembl	human	known	74_37	missense	SNP	0.000	T
UNC5D	137970	genome.wustl.edu	37	8	35624545	35624545	+	Silent	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr8:35624545C>T	ENST00000404895.2	+	15	2767	c.2439C>T	c.(2437-2439)ggC>ggT	p.G813G	UNC5D_ENST00000420357.1_Silent_p.G746G|UNC5D_ENST00000416672.1_Silent_p.G818G|UNC5D_ENST00000449677.1_Silent_p.G389G|UNC5D_ENST00000453357.2_Silent_p.G808G|UNC5D_ENST00000287272.2_Silent_p.G744G	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	813					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		AGCTCAAAGGCCATGAACAGA	0.512																																																	0								ENSG00000156687						141.0	117.0	125.0					8																	35624545		2203	4300	6503	UNC5D	SO:0001819	synonymous_variant	0			-	HGNC	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2439C>T	8.37:g.35624545C>T		Somatic	0	31	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q8WYP7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death_domain,pfam_Immunoglobulin,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.G813	ENST00000404895.2	37	c.2439	CCDS6093.2	8																																																																																			-	NULL		0.512	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	protein_coding	OTTHUMT00000347586.2	C		-		35624545	+1	no_errors	ENST00000404895	ensembl	human	known	74_37	silent	SNP	1.000	T
OPCML	4978	genome.wustl.edu	37	11	132307146	132307146	+	Missense_Mutation	SNP	C	C	T	rs372641813		TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr11:132307146C>T	ENST00000331898.7	-	4	1212	c.634G>A	c.(634-636)Gat>Aat	p.D212N	OPCML_ENST00000524381.1_Missense_Mutation_p.D205N|OPCML_ENST00000374778.4_Missense_Mutation_p.D171N|OPCML_ENST00000529038.1_5'UTR|OPCML_ENST00000541867.1_Missense_Mutation_p.D212N	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	212	Ig-like C2-type 2.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)			endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		TTCCGCACATCGGGCGCAGCG	0.537																																																	0								ENSG00000183715	C	ASN/ASP,ASN/ASP	0,4402		0,0,2201	128.0	114.0	119.0		613,634	5.9	0.8	11		119	1,8593		0,1,4296	no	missense,missense	OPCML	NM_001012393.1,NM_002545.3	23,23	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	205/339,212/346	132307146	1,12995	2201	4297	6498	OPCML	SO:0001583	missense	0			-	HGNC	BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.634G>A	11.37:g.132307146C>T	ENSP00000330862:p.Asp212Asn	Somatic	0	47	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	28	47.17	B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.D212N	ENST00000331898.7	37	c.634	CCDS8492.1	11	.	.	.	.	.	.	.	.	.	.	C	24.7	4.558459	0.86231	0.0	1.16E-4	ENSG00000183715	ENST00000331898;ENST00000524381;ENST00000374778;ENST00000416724;ENST00000541867	T;T;T;T	0.58940	0.32;0.3;1.14;1.14	5.95	5.95	0.96441	Immunoglobulin-like (1);	0.000000	0.85682	D	0.000000	T	0.79816	0.4511	M	0.83118	2.625	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.996;0.996;0.998;0.996	T	0.80754	-0.1241	10	0.66056	D	0.02	-20.0948	19.9958	0.97383	0.0:1.0:0.0:0.0	.	212;205;211;212	B7ZLQ1;Q7Z3W6;B7ZLQ0;Q14982	.;.;.;OPCM_HUMAN	N	212;205;171;179;212	ENSP00000330862:D212N;ENSP00000434750:D205N;ENSP00000363910:D171N;ENSP00000445496:D212N	ENSP00000330862:D212N	D	-	1	0	OPCML	131812356	1.000000	0.71417	0.803000	0.32268	0.233000	0.25261	7.487000	0.81328	2.825000	0.97269	0.655000	0.94253	GAT	-	smart_Ig_sub,pfscan_Ig-like_dom		0.537	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPCML	protein_coding	OTTHUMT00000374689.3	C	NM_001012393	-		132307146	-1	no_errors	ENST00000541867	ensembl	human	known	74_37	missense	SNP	1.000	T
LONRF2	164832	genome.wustl.edu	37	2	100910718	100910718	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr2:100910718C>T	ENST00000393437.3	-	9	2369	c.1730G>A	c.(1729-1731)gGc>gAc	p.G577D	LONRF2_ENST00000409647.1_Missense_Mutation_p.G334D	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	577	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						TAAACACATGCCAAACCGCTT	0.493																																																	0								ENSG00000170500						111.0	95.0	101.0					2																	100910718		2203	4300	6503	LONRF2	SO:0001583	missense	0			-	HGNC	AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.1730G>A	2.37:g.100910718C>T	ENSP00000377086:p.Gly577Asp	Somatic	0	49	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B9A006|Q6ZSR4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_Znf_RING,smart_TPR_repeat,smart_Pept_S16_N,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.G577D	ENST00000393437.3	37	c.1730	CCDS2046.2	2	.	.	.	.	.	.	.	.	.	.	C	15.48	2.845807	0.51164	.	.	ENSG00000170500	ENST00000393437;ENST00000409647	T;T	0.55760	0.5;0.5	4.08	3.16	0.36331	Peptidase S16, lon N-terminal (1);PUA-like domain (1);	0.053608	0.85682	D	0.000000	T	0.79429	0.4444	H	0.95402	3.665	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85055	0.0931	10	0.87932	D	0	-4.8041	13.6772	0.62460	0.0:0.8436:0.1564:0.0	.	577	Q1L5Z9	LONF2_HUMAN	D	577;334	ENSP00000377086:G577D;ENSP00000386823:G334D	ENSP00000377086:G577D	G	-	2	0	LONRF2	100277150	1.000000	0.71417	0.397000	0.26308	0.028000	0.11728	5.186000	0.65082	0.771000	0.33359	0.655000	0.94253	GGC	-	pfam_Pept_S16_N,superfamily_PUA-like_domain,smart_Pept_S16_N		0.493	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF2	protein_coding	OTTHUMT00000253161.2	C	NM_198461	-		100910718	-1	no_errors	ENST00000393437	ensembl	human	known	74_37	missense	SNP	1.000	T
PCDHA2	56146	genome.wustl.edu	37	5	140176057	140176057	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr5:140176057C>T	ENST00000526136.1	+	1	1508	c.1508C>T	c.(1507-1509)gCg>gTg	p.A503V	PCDHA2_ENST00000378132.1_Missense_Mutation_p.A503V|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000520672.2_Missense_Mutation_p.A503V	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	503	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A503V(2)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCGAGCGCGCGTTGTCGAGC	0.677																																																	2	Substitution - Missense(2)	kidney(2)						ENSG00000204969						57.0	59.0	58.0					5																	140176057		2203	4299	6502	PCDHA2	SO:0001583	missense	0			-	HGNC	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1508C>T	5.37:g.140176057C>T	ENSP00000431748:p.Ala503Val	Somatic	0	163	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	105	27.52	O75287|Q9BTV3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A503V	ENST00000526136.1	37	c.1508	CCDS54914.1	5	.	.	.	.	.	.	.	.	.	.	c	16.98	3.272519	0.59649	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.54071	0.66;0.59;0.63	3.88	1.98	0.26296	Cadherin (4);Cadherin-like (1);	0.970408	0.08372	U	0.955891	T	0.51856	0.1699	N	0.20610	0.595	0.09310	N	1	P;P;P	0.52692	0.955;0.869;0.955	P;P;P	0.56398	0.461;0.797;0.461	T	0.46303	-0.9201	10	0.66056	D	0.02	.	9.4268	0.38586	0.0:0.8211:0.0:0.1789	.	503;503;503	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	V	503	ENSP00000430584:A503V;ENSP00000367372:A503V;ENSP00000431748:A503V	ENSP00000367372:A503V	A	+	2	0	PCDHA2	140156241	0.000000	0.05858	0.963000	0.40424	0.959000	0.62525	0.232000	0.17891	0.219000	0.20840	0.644000	0.83932	GCG	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.677	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA2	protein_coding	OTTHUMT00000372877.3	C	NM_018905	-		140176057	+1	no_errors	ENST00000526136	ensembl	human	known	74_37	missense	SNP	0.132	T
TRIM16	10626	genome.wustl.edu	37	17	15554817	15554817	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr17:15554817G>A	ENST00000578237.1	-	6	962	c.107C>T	c.(106-108)tCa>tTa	p.S36L	RP11-385D13.1_ENST00000455584.2_Missense_Mutation_p.S36L|TRIM16_ENST00000581224.1_Intron|TRIM16_ENST00000336708.7_Missense_Mutation_p.S36L|RP11-640I15.1_ENST00000584540.1_RNA|TRIM16_ENST00000416464.2_Intron			O95361	TRI16_HUMAN	tripartite motif containing 16	36					histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription, DNA-templated (GO:0045893)|response to growth hormone (GO:0060416)|response to organophosphorus (GO:0046683)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|PML body (GO:0016605)	DNA binding (GO:0003677)|interleukin-1 binding (GO:0019966)|NACHT domain binding (GO:0032089)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	19				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		TGGGCTGGCTGACCCAGAATC	0.642																																																	0								ENSG00000221926						74.0	79.0	77.0					17																	15554817		2203	4300	6503	TRIM16	SO:0001583	missense	0			-	HGNC	AF096870	CCDS11171.1	17p11.2	2011-04-20	2011-01-25		ENSG00000221926	ENSG00000221926		"""Tripartite motif containing / Tripartite motif containing"""	17241	protein-coding gene	gene with protein product	"""estrogen-responsive B box protein"""	609505	"""tripartite motif-containing 16"""			11331580	Standard	NM_006470		Approved	EBBP	uc002gor.1	O95361	OTTHUMG00000059067	ENST00000578237.1:c.107C>T	17.37:g.15554817G>A	ENSP00000463188:p.Ser36Leu	Somatic	0	29	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	63	12.50	Q6IAL8|Q7Z6I2|Q96BE8|Q96J43	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,prints_Butyrophylin	p.S36L	ENST00000578237.1	37	c.107	CCDS11171.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	7.419|7.419	0.636415|0.636415	0.14386|0.14386	.|.	.|.	ENSG00000251537|ENSG00000221926	ENST00000455584|ENST00000336708	.|T	.|0.64618	.|-0.11	0.137|0.137	0.137|0.137	0.14787|0.14787	.|.	.|7.084450	.|0.01642	.|U	.|0.024100	.|T	.|0.66005	.|0.2746	L|L	0.56769|0.56769	1.78|1.78	0.09310|0.09310	N|N	1|1	.|B;P	.|0.48350	.|0.437;0.909	.|B;P	.|0.48704	.|0.098;0.587	.|T	.|0.53092	.|-0.8487	.|9	.|0.62326	.|D	.|0.03	.|.	.|.	.|.	.|.	.|.	.|36;50	.|O95361;Q59EB2	.|TRI16_HUMAN;.	X|L	51|36	.|ENSP00000338989:S36L	.|ENSP00000338989:S36L	Q|S	-|-	1|2	0|0	RP11-385D13.1|TRIM16	15495542|15495542	0.008000|0.008000	0.16893|0.16893	0.052000|0.052000	0.19188|0.19188	0.072000|0.072000	0.16883|0.16883	0.310000|0.310000	0.19356|0.19356	0.291000|0.291000	0.22468|0.22468	0.297000|0.297000	0.19635|0.19635	CAG|TCA	-	NULL		0.642	TRIM16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM16	protein_coding	OTTHUMT00000130700.2	G	NM_006470	-		15554817	-1	no_errors	ENST00000336708	ensembl	human	known	74_37	missense	SNP	0.049	A
MYH7	4625	genome.wustl.edu	37	14	23884643	23884645	+	In_Frame_Del	DEL	CCT	CCT	-	rs149509691		TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	CCT	CCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr14:23884643_23884645delCCT	ENST00000355349.3	-	36	5390_5392	c.5228_5230delAGG	c.(5227-5232)gaggca>gca	p.E1743del	CTD-2201G16.1_ENST00000557368.1_RNA|MIR208B_ENST00000401172.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1743					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TCCTGCACTGCCTCCTCCACTTC	0.586																																																	0								ENSG00000092054																																			MYH7	SO:0001651	inframe_deletion	0				HGNC	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.5228_5230delAGG	14.37:g.23884646_23884648delCCT	ENSP00000347507:p.Glu1743del	Somatic	0	55	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	45	23.73	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1743in_frame_del	ENST00000355349.3	37	c.5230_5228	CCDS9601.1	14																																																																																			-	pfam_Myosin_tail		0.586	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	protein_coding	OTTHUMT00000071798.3	CCT	NM_000257			23884645	-1	no_errors	ENST00000355349	ensembl	human	known	74_37	in_frame_del	DEL	1.000:0.995:1.000	-
LOC101929008	101929008	genome.wustl.edu	37	16	90168703	90168703	+	lincRNA	SNP	A	A	G	rs59633829		TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr16:90168703A>G	ENST00000562203.1	-	0	832																											cggcagcagcagcagcagcag	0.542																																																	0								ENSG00000260528																																			FAM157C			0			-	HGNC																													16.37:g.90168703A>G		Somatic	0	111	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	96	11.93		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000562203.1	37	NULL		16																																																																																			-	-		0.542	RP11-356C4.3-001	KNOWN	basic	lincRNA	FAM157C	lincRNA	OTTHUMT00000420874.1	A		-		90168703	+1	no_errors	ENST00000563357	ensembl	human	known	74_37	rna	SNP	0.021	G
RBM8A	9939	genome.wustl.edu	37	1	145508402	145508415	+	Intron	DEL	CTCACTCTATTCCT	CTCACTCTATTCCT	-	rs587653214		TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	CTCACTCTATTCCT	CTCACTCTATTCCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr1:145508402_145508415delCTCACTCTATTCCT	ENST00000330165.8	+	4	274				RP11-315I20.1_ENST00000597144.1_RNA|RP11-315I20.1_ENST00000421764.1_RNA|RP11-315I20.1_ENST00000599626.1_RNA|RP11-315I20.1_ENST00000448561.1_RNA|RP11-315I20.1_ENST00000601726.1_RNA|RBM8A_ENST00000369307.3_Intron|GNRHR2_ENST00000312753.5_RNA|RP11-315I20.1_ENST00000437797.1_RNA|RP11-315I20.1_ENST00000595494.1_RNA|RP11-315I20.1_ENST00000599147.1_RNA|RP11-315I20.1_ENST00000600340.1_RNA|RP11-315I20.1_ENST00000596355.1_RNA|RP11-315I20.1_ENST00000447686.2_RNA|RP11-315I20.1_ENST00000598103.1_RNA|RP11-315I20.1_ENST00000599469.1_RNA|RP11-315I20.1_ENST00000595518.1_RNA|RP11-315I20.1_ENST00000598354.1_RNA|RP11-315I20.1_ENST00000412239.1_RNA	NM_005105.3	NP_005096.1	Q9Y5S9	RBM8A_HUMAN	RNA binding motif protein 8A						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TGAGTCCGCACTCACTCTATTCCTGTGAGCCTGC	0.453																																																	0								ENSG00000234222																																			RP11-315I20.1	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF127761	CCDS72872.1	1q21.1	2013-02-12			ENSG00000131795			"""RNA binding motif (RRM) containing"""	9905	protein-coding gene	gene with protein product		605313		RBM8		11004516, 11013075	Standard	NM_005105		Approved	ZNRP, BOV-1A, BOV-1B, BOV-1C, RBM8B, Y14	uc001ent.2	Q9Y5S9	OTTHUMG00000013736	ENST00000330165.8:c.206-60CTCACTCTATTCCT>-	1.37:g.145508402_145508415delCTCACTCTATTCCT		Somatic	NA	NA	NA		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KQI9|Q6FHD1|Q6IQ40|Q9GZX8|Q9NZI4	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000330165.8	37	c.NULL	CCDS916.1	1																																																																																			-	-		0.453	RBM8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000234222	protein_coding	OTTHUMT00000038503.2	CTCACTCTATTCCT	NM_005105			145508415	-1	no_errors	ENST00000596355	ensembl	human	known	74_37	splice_site_del	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-
NARS2	79731	genome.wustl.edu	37	11	78154811	78154811	+	Intron	DEL	A	A	-			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr11:78154811delA	ENST00000281038.5	-	12	1540				RP11-452H21.1_ENST00000534168.1_RNA|NARS2_ENST00000528850.1_Intron	NM_001243251.1|NM_024678.5	NP_001230180.1|NP_078954.4	Q96I59	SYNM_HUMAN	asparaginyl-tRNA synthetase 2, mitochondrial (putative)						asparaginyl-tRNA aminoacylation (GO:0006421)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	asparagine-tRNA ligase activity (GO:0004816)|ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)	27	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)	CAACCTAAGGAAAAAAAAAAA	0.393																																																	0								ENSG00000254420						35.0	37.0	36.0					11																	78154811		2200	4292	6492	RP11-452H21.1	SO:0001627	intron_variant	0				Clone_based_vega_gene	BC007800	CCDS8261.1, CCDS58164.1	11q14.1	2011-07-01	2007-02-23		ENSG00000137513	ENSG00000137513	6.1.1.22	"""Aminoacyl tRNA synthetases / Class II"""	26274	protein-coding gene	gene with protein product	"""asparagine tRNA ligase 2, mitochondrial (putative)"""	612803				15779907	Standard	NM_024678		Approved	FLJ23441, SLM5	uc001ozi.3	Q96I59	OTTHUMG00000166702	ENST00000281038.5:c.1165-7T>-	11.37:g.78154811delA		Somatic	0	20	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	G3V178	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000281038.5	37	NULL	CCDS8261.1	11																																																																																			-	-		0.393	NARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000254420	protein_coding	OTTHUMT00000391138.2	A	NM_024678			78154811	+1	no_errors	ENST00000534168	ensembl	human	known	74_37	rna	DEL	0.000	-
CFTR	1080	genome.wustl.edu	37	7	117292952	117292952	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr7:117292952G>T	ENST00000003084.6	+	24	4062	c.3930G>T	c.(3928-3930)tgG>tgT	p.W1310C	CFTR_ENST00000454343.1_Missense_Mutation_p.W1249C	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	1310	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	ATGAACAGTGGAGTGATCAAG	0.323									Cystic Fibrosis																																								0								ENSG00000001626						107.0	111.0	109.0					7																	117292952		2203	4300	6503	CFTR	SO:0001583	missense	0	Familial Cancer Database	CF	-	HGNC	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.3930G>T	7.37:g.117292952G>T	ENSP00000003084:p.Trp1310Cys	Somatic	0	29	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_CysFib_conduc_TM,tigrfam_cAMP_cl_channel	p.W1310C	ENST00000003084.6	37	c.3930	CCDS5773.1	7	.	.	.	.	.	.	.	.	.	.	G	12.60	1.986331	0.35036	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.93811	-3.29;-3.29;-3.29	5.13	4.24	0.50183	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.335476	0.36628	N	0.002483	D	0.86343	0.5910	N	0.05487	-0.04	0.80722	D	1	B	0.10296	0.003	B	0.20577	0.03	T	0.82246	-0.0552	10	0.72032	D	0.01	-1.8944	15.0396	0.71777	0.0:0.0:0.8567:0.1433	.	1310	P13569	CFTR_HUMAN	C	1310;1249;1280	ENSP00000003084:W1310C;ENSP00000403677:W1249C;ENSP00000389119:W1280C	ENSP00000003084:W1310C	W	+	3	0	CFTR	117080188	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.846000	0.62860	1.284000	0.44531	0.655000	0.94253	TGG	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_cAMP_cl_channel		0.323	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFTR	protein_coding	OTTHUMT00000059397.3	G	NM_000492	-		117292952	+1	no_errors	ENST00000003084	ensembl	human	known	74_37	missense	SNP	1.000	T
ANKRD20A5P	440482	genome.wustl.edu	37	18	14184361	14184362	+	RNA	INS	-	-	T	rs143131015		TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr18:14184361_14184362insT	ENST00000581935.1	+	0	1050_1051							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						ATGCAGGGTTATCTTTCCTTTT	0.322																																																	0								ENSG00000186481																																			ANKRD20A5P			0				HGNC	BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14184362_14184362dupT		Somatic	0	18	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	20	25.93	Q4G1B6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000581935.1	37	NULL		18																																																																																			-	-		0.322	ANKRD20A5P-002	KNOWN	basic	processed_transcript	ANKRD20A5P	pseudogene	OTTHUMT00000442833.1	-				14184362	+1	no_errors	ENST00000581935	ensembl	human	known	74_37	rna	INS	0.001:0.000	T
CELP	1057	genome.wustl.edu	37	9	135962585	135962586	+	RNA	INS	-	-	GCCCCATCCCCGCTACGGGTGACTCTGAGGCC	rs641386|rs372789499|rs143200085	byFrequency	TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr9:135962585_135962586insGCCCCATCCCCGCTACGGGTGACTCTGAGGCC	ENST00000411440.2	+	0	1092_1093					NR_001275.2				carboxyl ester lipase pseudogene																		ACACTGAGGCTGCCCCTGTGTC	0.629																																																	0								ENSG00000170827																																			CELP			0				HGNC	L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135962585_135962586insGCCCCATCCCCGCTACGGGTGACTCTGAGGCC		Somatic	NA	NA	NA		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000411440.2	37	NULL		9																																																																																			-	-		0.629	CELP-002	KNOWN	basic	processed_transcript	CELP	pseudogene	OTTHUMT00000339837.1	-	NM_001808			135962586	+1	no_errors	ENST00000411440	ensembl	human	known	74_37	rna	INS	0.130:0.000	GCCCCATCCCCGCTACGGGTGACTCTGAGGCC
PYCR1	5831	genome.wustl.edu	37	17	79894067	79894067	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr17:79894067C>T	ENST00000329875.8	-	2	134	c.70G>A	c.(70-72)Gtc>Atc	p.V24I	PYCR1_ENST00000402252.2_Missense_Mutation_p.V51I|PYCR1_ENST00000337943.5_Missense_Mutation_p.V24I|PYCR1_ENST00000403172.4_Missense_Mutation_p.V24I|PYCR1_ENST00000577756.1_Missense_Mutation_p.V24I	NM_001282280.1|NM_001282281.1|NM_006907.2	NP_001269209.1|NP_001269210.1|NP_008838.2	P32322	P5CR1_HUMAN	pyrroline-5-carboxylate reductase 1	24					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to oxidative stress (GO:0034599)|L-proline biosynthetic process (GO:0055129)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|proline biosynthetic process (GO:0006561)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|pyrroline-5-carboxylate reductase activity (GO:0004735)			endometrium(2)|kidney(1)|lung(1)|prostate(1)	5	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0165)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		L-Proline(DB00172)	GCAGCCAAGACGCCTGAGGGG	0.507																																																	0								ENSG00000183010						94.0	90.0	91.0					17																	79894067		2203	4300	6503	PYCR1	SO:0001583	missense	0			-	HGNC		CCDS11794.1, CCDS11795.1, CCDS62365.1, CCDS62366.1	17q25.3	2013-09-23			ENSG00000183010	ENSG00000183010	1.5.1.2		9721	protein-coding gene	gene with protein product		179035				1730675	Standard	XM_005256381		Approved	P5C	uc002kcr.1	P32322	OTTHUMG00000178436	ENST00000329875.8:c.70G>A	17.37:g.79894067C>T	ENSP00000328858:p.Val24Ile	Somatic	0	49	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	60	17.81	A6NFM2|B4DMU0|Q6FHI4|Q96DI6|Q9HBQ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_G3P_DH_NAD-dep_N,superfamily_6-PGluconate_DH_C-like,pirsf_Pyrroline-COOH_reductase,tigrfam_Pyrroline-COOH_reductase	p.V24I	ENST00000329875.8	37	c.70	CCDS11795.1	17	.	.	.	.	.	.	.	.	.	.	C	10.59	1.392175	0.25118	.	.	ENSG00000183010	ENST00000337943;ENST00000329875;ENST00000403172;ENST00000402252;ENST00000405481	T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06	4.25	-6.83	0.01693	NAD(P)-binding domain (1);	0.389040	0.25932	N	0.027364	T	0.40522	0.1120	L	0.31371	0.925	0.23950	N	0.996372	B;B;B;B;B;B	0.06786	0.001;0.001;0.001;0.001;0.0;0.0	B;B;B;B;B;B	0.18561	0.002;0.001;0.022;0.001;0.0;0.001	T	0.36504	-0.9745	10	0.10111	T	0.7	-4.8113	14.7019	0.69162	0.0:0.6743:0.0:0.3257	.	51;24;24;24;24;24	B4DMU0;E7D7X9;Q9HBQ4;P32322;E7D7Y0;A6NFM2	.;.;.;P5CR1_HUMAN;.;.	I	24;24;24;51;24	ENSP00000336579:V24I;ENSP00000328858:V24I;ENSP00000385483:V24I;ENSP00000384949:V51I;ENSP00000386002:V24I	ENSP00000328858:V24I	V	-	1	0	PYCR1	77487358	0.000000	0.05858	0.004000	0.12327	0.147000	0.21601	-0.463000	0.06696	-1.240000	0.02529	-1.267000	0.01435	GTC	-	pfam_G3P_DH_NAD-dep_N,pirsf_Pyrroline-COOH_reductase,tigrfam_Pyrroline-COOH_reductase		0.507	PYCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYCR1	protein_coding	OTTHUMT00000441953.1	C		-		79894067	-1	no_errors	ENST00000329875	ensembl	human	known	74_37	missense	SNP	0.039	T
SLC12A2	6558	genome.wustl.edu	37	5	127419938	127419955	+	In_Frame_Del	DEL	GCGGCGGCGGCGGCGGCA	GCGGCGGCGGCGGCGGCA	-	rs181849063|rs560532409	byFrequency	TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	GCGGCGGCGGCGGCGGCA	GCGGCGGCGGCGGCGGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr5:127419938_127419955delGCGGCGGCGGCGGCGGCA	ENST00000262461.2	+	1	481_498	c.292_309delGCGGCGGCGGCGGCGGCA	c.(292-309)gcggcggcggcggcggcadel	p.AAAAAA98del	SLC12A2_ENST00000343225.4_In_Frame_Del_p.AAAAAA98del|CTC-228N24.3_ENST00000501702.2_lincRNA	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	98	Ala-rich.				ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	TGCTgcggcggcggcggcggcggcggcagcggcggcgg	0.771																																																	0								ENSG00000064651			17,429		8,1,214						1.7	0.7			1	60,1308		28,4,652	no	coding	SLC12A2	NM_001046.2		36,5,866	A1A1,A1R,RR		4.386,3.8117,4.2448				77,1737				SLC12A2	SO:0001651	inframe_deletion	0				HGNC		CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.292_309delGCGGCGGCGGCGGCGGCA	5.37:g.127419938_127419955delGCGGCGGCGGCGGCGGCA	ENSP00000262461:p.Ala98_Ala103del	Somatic	NA	NA	NA		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q8N713|Q8WWH7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_AA-permease/SLC12A_dom,pfam_AA_permease_N,prints_Na/K/Cl_cotranspt1,prints_Na/K/Cl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.AAAAAA101in_frame_del	ENST00000262461.2	37	c.292_309	CCDS4144.1	5																																																																																			-	NULL		0.771	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A2	protein_coding	OTTHUMT00000250972.1	GCGGCGGCGGCGGCGGCA	NM_001046			127419955	+1	no_errors	ENST00000262461	ensembl	human	known	74_37	in_frame_del	DEL	0.986:0.660:0.322:0.982:0.990:0.982:0.984:0.993:0.986:0.997:0.991:0.966:0.942:0.693:0.010:0.018:0.020:0.019	-
IFIT5	24138	genome.wustl.edu	37	10	91177283	91177283	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr10:91177283G>T	ENST00000371795.4	+	2	540	c.327G>T	c.(325-327)caG>caT	p.Q109H	LIPA_ENST00000371837.1_5'Flank|IFIT5_ENST00000416601.1_Missense_Mutation_p.Q109H	NM_012420.2	NP_036552.1	Q13325	IFIT5_HUMAN	interferon-induced protein with tetratricopeptide repeats 5	109					defense response to virus (GO:0051607)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|ruffle membrane (GO:0032587)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)|tRNA binding (GO:0000049)			endometrium(1)|large_intestine(4)|lung(4)	9						ACATGGACCAGCTTGAAGAAG	0.433																																																	0								ENSG00000152778						90.0	84.0	86.0					10																	91177283		2203	4300	6503	IFIT5	SO:0001583	missense	0			-	HGNC	U34605	CCDS7403.1	10q23.31	2013-01-10			ENSG00000152778	ENSG00000152778		"""Tetratricopeptide (TTC) repeat domain containing"""	13328	protein-coding gene	gene with protein product	"""retinoic acid- and interferon-inducible protein (58kD)"""					9398535	Standard	NM_012420		Approved	RI58	uc010qnh.2	Q13325	OTTHUMG00000018713	ENST00000371795.4:c.327G>T	10.37:g.91177283G>T	ENSP00000360860:p.Gln109His	Somatic	0	49	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B2R5X9|B4DDV1|Q5T7I9|Q6IAX3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TPR_2,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Q109H	ENST00000371795.4	37	c.327	CCDS7403.1	10	.	.	.	.	.	.	.	.	.	.	G	8.551	0.875539	0.17395	.	.	ENSG00000152778	ENST00000371795;ENST00000416601	D;D	0.94497	-3.44;-3.44	6.03	-4.61	0.03380	Tetratricopeptide-like helical (1);	0.553031	0.20872	N	0.084158	D	0.87285	0.6139	L	0.49350	1.555	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.74813	-0.3537	10	0.56958	D	0.05	-0.1317	0.4832	0.00551	0.3576:0.2136:0.1227:0.3061	.	109;109	Q13325;B4DDV1	IFIT5_HUMAN;.	H	109	ENSP00000360860:Q109H;ENSP00000414042:Q109H	ENSP00000360860:Q109H	Q	+	3	2	IFIT5	91167263	0.000000	0.05858	0.000000	0.03702	0.631000	0.37964	-0.303000	0.08210	-0.409000	0.07553	-0.140000	0.14226	CAG	-	NULL		0.433	IFIT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIT5	protein_coding	OTTHUMT00000049303.1	G	NM_012420	-		91177283	+1	no_errors	ENST00000371795	ensembl	human	known	74_37	missense	SNP	0.000	T
FAM118A	55007	genome.wustl.edu	37	22	45719209	45719209	+	Silent	SNP	G	G	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr22:45719209G>A	ENST00000216214.3	+	4	1035	c.201G>A	c.(199-201)gaG>gaA	p.E67E	FAM118A_ENST00000405673.1_Silent_p.E67E|FAM118A_ENST00000441876.2_Silent_p.E67E	NM_001104595.1	NP_001098065.1	Q9NWS6	F118A_HUMAN	family with sequence similarity 118, member A	67						integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	11		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		AGCAGCTGGAGGTGCTGCACC	0.632																																																	0								ENSG00000100376						58.0	57.0	57.0					22																	45719209		2203	4300	6503	FAM118A	SO:0001819	synonymous_variant	0			-	HGNC	BC013696	CCDS14065.1	22q13.3	2006-04-26	2006-04-26	2006-04-26	ENSG00000100376	ENSG00000100376			1313	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 8"""	C22orf8		12477932	Standard	NM_001104595		Approved	FLJ20635, bK268H5.C22.4	uc003bga.4	Q9NWS6	OTTHUMG00000151338	ENST00000216214.3:c.201G>A	22.37:g.45719209G>A		Somatic	0	19	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	15	25.00	B3KWG4|B4DY02|Q5TII5|Q96CY3	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_RNaseH-like_dom	p.E67	ENST00000216214.3	37	c.201	CCDS14065.1	22																																																																																			-	NULL		0.632	FAM118A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM118A	protein_coding	OTTHUMT00000322260.1	G	NM_017911	-		45719209	+1	no_errors	ENST00000216214	ensembl	human	known	74_37	silent	SNP	1.000	A
ADAMTSL4	54507	genome.wustl.edu	37	1	150524368	150524368	+	Intron	DEL	A	A	-	rs199813152		TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr1:150524368delA	ENST00000271643.4	+	3	152				MIR4257_ENST00000581735.1_RNA|ADAMTSL4_ENST00000369041.5_Intron|ADAMTSL4_ENST00000369038.2_5'Flank|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000483335.1_3'UTR|ADAMTSL4_ENST00000369039.5_Intron	NM_019032.4	NP_061905.2	Q6UY14	ATL4_HUMAN	ADAMTS-like 4						apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			tctccatctcaaaaaaaaaaa	0.527																																																	0								ENSG00000143382																																			ADAMTSL4	SO:0001627	intron_variant	0				HGNC	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000271643.4:c.-84-313A>-	1.37:g.150524368delA		Somatic	0	14	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000271643.4	37	NULL	CCDS955.1	1																																																																																			-	-		0.527	ADAMTSL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL4	protein_coding		A	NM_019032			150524368	+1	no_errors	ENST00000483335	ensembl	human	known	74_37	rna	DEL	0.000	-
PVRL2	5819	genome.wustl.edu	37	19	45381598	45381600	+	Intron	DEL	GAG	GAG	-	rs375813744		TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr19:45381598_45381600delGAG	ENST00000252483.5	+	5	1042				PVRL2_ENST00000252485.4_In_Frame_Del_p.R391del	NM_001042724.1	NP_001036189.1	Q92692	PVRL2_HUMAN	poliovirus receptor-related 2 (herpesvirus entry mediator B)						acrosome assembly (GO:0001675)|adherens junction organization (GO:0034332)|adhesion of symbiont to host (GO:0044406)|cell junction assembly (GO:0034329)|cell part morphogenesis (GO:0032990)|cell-cell junction organization (GO:0045216)|cilium organization (GO:0044782)|coreceptor-mediated virion attachment to host cell (GO:0046814)|cytoskeleton organization (GO:0007010)|establishment of mitochondrion localization (GO:0051654)|fertilization (GO:0009566)|fusion of virus membrane with host plasma membrane (GO:0019064)|homophilic cell adhesion (GO:0007156)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|sperm mitochondrion organization (GO:0030382)|spermatid development (GO:0007286)|spermatid nucleus differentiation (GO:0007289)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|large_intestine(6)|lung(5)	13	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		TGCTgagggtgaggaggaggagg	0.665																																																	0								ENSG00000130202		,	4,172,3746		0,0,4,17,138,1802					,	-2.1	1.0			26	34,410,7168		2,1,29,23,363,3388	no	codingComplex,intron	PVRL2	NM_002856.2,NM_001042724.1	,	2,1,33,40,501,5190	A1A1,A1A2,A1R,A2A2,A2R,RR		5.8329,4.4875,5.3754	,	,		38,582,10914				PVRL2	SO:0001627	intron_variant	0				HGNC	X80038	CCDS12645.1, CCDS42576.1	19q13.32	2013-01-29			ENSG00000130202	ENSG00000130202		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9707	protein-coding gene	gene with protein product		600798		HVEB		7622062, 10196354	Standard	NM_001042724		Approved	PVRR2, PRR2, CD112	uc002ozw.1	Q92692	OTTHUMG00000180839	ENST00000252483.5:c.1042+3863GAG>-	19.37:g.45381607_45381609delGAG		Somatic	0	25	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	A8K5L5|O75455|Q6IBI6|Q96J29	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_CD80_C2-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.R391in_frame_del	ENST00000252483.5	37	c.1161_1163	CCDS42576.1	19																																																																																			-	NULL		0.665	PVRL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PVRL2	protein_coding	OTTHUMT00000453231.1	GAG	NM_002856			45381600	+1	no_errors	ENST00000252485	ensembl	human	known	74_37	in_frame_del	DEL	0.999:1.000:1.000	-
PSMC6	5706	genome.wustl.edu	37	14	53187633	53187633	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr14:53187633G>T	ENST00000606149.1	+	11	848	c.832G>T	c.(832-834)Gct>Tct	p.A278S	PSMC6_ENST00000445930.2_Missense_Mutation_p.A292S	NM_002806.3	NP_002797.3	P62333	PRS10_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 6	278					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein binding, bridging (GO:0030674)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	19	Breast(41;0.176)					AATGATCATGGCTACAAACAG	0.338																																																	0								ENSG00000100519						69.0	71.0	70.0					14																	53187633		2203	4300	6503	PSMC6	SO:0001583	missense	0			-	HGNC		CCDS9710.2	14q22.1	2010-04-21			ENSG00000100519	ENSG00000100519		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9553	protein-coding gene	gene with protein product		602708				8674546, 9473509	Standard	NM_002806		Approved	p42	uc010tqx.2	P62333	OTTHUMG00000152333	ENST00000606149.1:c.832G>T	14.37:g.53187633G>T	ENSP00000475721:p.Ala278Ser	Somatic	0	46	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B2R975|P49719|Q6IBU3|Q92524	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA_core,pfam_ATPase_AAA-2,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.A292S	ENST00000606149.1	37	c.874		14	.	.	.	.	.	.	.	.	.	.	G	32	5.175168	0.94807	.	.	ENSG00000100519	ENST00000445930	D	0.95724	-3.79	4.93	4.93	0.64822	ATPase, AAA-type, conserved site (1);ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.048245	0.85682	D	0.000000	D	0.97570	0.9204	M	0.78344	2.41	0.80722	D	1	D	0.61080	0.989	D	0.71656	0.974	D	0.98362	1.0549	10	0.87932	D	0	.	18.4944	0.90860	0.0:0.0:1.0:0.0	.	278	P62333	PRS10_HUMAN	S	292	ENSP00000401802:A292S	ENSP00000401802:A292S	A	+	1	0	PSMC6	52257383	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.596000	0.82721	2.420000	0.82092	0.585000	0.79938	GCT	-	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_26S_Psome_P45		0.338	PSMC6-018	KNOWN	basic|appris_candidate	protein_coding	PSMC6	protein_coding	OTTHUMT00000470741.1	G	NM_002806	-		53187633	+1	no_errors	ENST00000445930	ensembl	human	known	74_37	missense	SNP	1.000	T
ABI3BP	25890	genome.wustl.edu	37	3	100542341	100542341	+	Intron	SNP	C	C	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr3:100542341C>A	ENST00000284322.5	-	19	1707				ABI3BP_ENST00000383691.4_Nonsense_Mutation_p.E206*|ABI3BP_ENST00000471714.1_Nonsense_Mutation_p.E929*|ABI3BP_ENST00000495063.1_Nonsense_Mutation_p.E842*	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein						extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						GTGACAGGTTCTAGGACTGTA	0.368																																																	0								ENSG00000154175																																			ABI3BP	SO:0001627	intron_variant	0			-	HGNC	AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.1598-15262G>T	3.37:g.100542341C>A		Somatic	0	36	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.E206*	ENST00000284322.5	37	c.616	CCDS46880.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.52|19.52	3.843625|3.843625	0.71488|0.71488	.|.	.|.	ENSG00000154175|ENSG00000154175	ENST00000471714;ENST00000383692;ENST00000383691;ENST00000495063|ENST00000495591;ENST00000471901	.|.	.|.	.|.	4.05|4.05	3.1|3.1	0.35709|0.35709	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.10636|.	T|.	0.68|.	.|.	6.4532|6.4532	0.21916|0.21916	0.0:0.852:0.0:0.148|0.0:0.852:0.0:0.148	.|.	.|.	.|.	.|.	X|Y	929;176;206;842|307;51	.|.	ENSP00000373189:E206X|.	E|X	-|-	1|3	0|2	ABI3BP|ABI3BP	102025031|102025031	0.998000|0.998000	0.40836|0.40836	0.916000|0.916000	0.36221|0.36221	0.912000|0.912000	0.54170|0.54170	1.631000|1.631000	0.37092|0.37092	1.196000|1.196000	0.43129|0.43129	0.655000|0.655000	0.94253|0.94253	GAA|TAG	-	NULL		0.368	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABI3BP	protein_coding	OTTHUMT00000353260.1	C		-		100542341	-1	no_errors	ENST00000383691	ensembl	human	known	74_37	nonsense	SNP	0.925	A
RNF183	138065	genome.wustl.edu	37	9	116059948	116059948	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr9:116059948C>T	ENST00000478815.1	-	1	2097	c.517G>A	c.(517-519)Gtc>Atc	p.V173I	RNF183_ENST00000297894.5_Missense_Mutation_p.V173I|RNF183_ENST00000416588.2_Missense_Mutation_p.V173I|RNF183_ENST00000441031.3_Missense_Mutation_p.V173I|RNF183_ENST00000478493.1_5'Flank			Q96D59	RN183_HUMAN	ring finger protein 183	173						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			lung(1)|prostate(1)|skin(1)	3						AACAGAGTGACACTGAGGATG	0.522																																																	0								ENSG00000165188						91.0	97.0	95.0					9																	116059948		2104	4213	6317	RNF183	SO:0001583	missense	0			-	HGNC		CCDS43866.1	9q32	2007-04-24			ENSG00000165188	ENSG00000165188		"""RING-type (C3HC4) zinc fingers"""	28721	protein-coding gene	gene with protein product						12477932	Standard	NM_145051		Approved	MGC4734	uc004bgz.3	Q96D59	OTTHUMG00000020520	ENST00000478815.1:c.517G>A	9.37:g.116059948C>T	ENSP00000419454:p.Val173Ile	Somatic	0	33	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	30	38.78		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_RING,pfscan_Znf_RING	p.V173I	ENST00000478815.1	37	c.517	CCDS43866.1	9	.	.	.	.	.	.	.	.	.	.	C	11.79	1.744958	0.30865	.	.	ENSG00000165188	ENST00000441031;ENST00000416588;ENST00000478815;ENST00000297894	T;T;T;T	0.19806	2.12;2.12;2.12;2.12	5.09	3.26	0.37387	.	0.544492	0.17776	N	0.162409	T	0.12817	0.0311	L	0.29908	0.895	0.20307	N	0.999916	B	0.09022	0.002	B	0.06405	0.002	T	0.34129	-0.9841	10	0.08179	T	0.78	-16.8988	9.4541	0.38745	0.0:0.8277:0.0:0.1722	.	173	Q96D59	RN183_HUMAN	I	173	ENSP00000417176:V173I;ENSP00000420740:V173I;ENSP00000419454:V173I;ENSP00000417943:V173I	ENSP00000417943:V173I	V	-	1	0	RNF183	115099769	0.109000	0.22037	0.017000	0.16124	0.531000	0.34715	1.595000	0.36708	0.737000	0.32582	-0.258000	0.10820	GTC	-	NULL		0.522	RNF183-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF183	protein_coding	OTTHUMT00000356360.1	C	NM_145051	-		116059948	-1	no_errors	ENST00000297894	ensembl	human	known	74_37	missense	SNP	0.261	T
UVRAG	7405	genome.wustl.edu	37	11	75694430	75694431	+	Splice_Site	INS	-	-	A	rs369320979		TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr11:75694430_75694431insA	ENST00000356136.3	+	8	940_941		c.e8-1		UVRAG_ENST00000539288.1_5'Flank|UVRAG_ENST00000531818.1_Splice_Site|UVRAG_ENST00000533454.1_Splice_Site|UVRAG_ENST00000528420.1_Splice_Site|UVRAG_ENST00000532130.1_Splice_Site	NM_003369.3	NP_003360.2	Q9P2Y5	UVRAG_HUMAN	UV radiation resistance associated						DNA repair (GO:0006281)|positive regulation of autophagy (GO:0010508)|SNARE complex assembly (GO:0035493)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|phagocytic vesicle (GO:0045335)|protein complex (GO:0043234)				central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(15)|skin(5)|urinary_tract(2)	32						TATTTATTTAGAAAAAAAAAAG	0.302																																																	0								ENSG00000198382																																			UVRAG	SO:0001630	splice_region_variant	0				HGNC	X99050, AB012958	CCDS8241.1	11q13	2012-11-15	2012-11-15		ENSG00000198382	ENSG00000198382			12640	protein-coding gene	gene with protein product	"""beclin 1 binding protein"""	602493	"""UV radiation resistance associated gene"""			9169138, 16799551, 18843052	Standard	NM_003369		Approved	VPS38	uc001oxc.3	Q9P2Y5	OTTHUMG00000165319	ENST00000356136.3:c.700-1->A	11.37:g.75694440_75694440dupA		Somatic	0	51	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	45	15.09	B3KTC1|O00392	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom	p.S237fs	ENST00000356136.3	37	c.701_700	CCDS8241.1	11																																																																																			-	NULL		0.302	UVRAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UVRAG	protein_coding	OTTHUMT00000383430.1	-	NM_003369		Intron	75694431	+1	no_errors	ENST00000356136	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
SIRT3	23410	genome.wustl.edu	37	11	233415	233415	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr11:233415G>A	ENST00000382743.4	-	2	503	c.401C>T	c.(400-402)gCc>gTc	p.A134V	SIRT3_ENST00000532956.1_Missense_Mutation_p.A134V|SIRT3_ENST00000524564.1_Intron|SIRT3_ENST00000529382.1_5'UTR|SIRT3_ENST00000525319.1_Missense_Mutation_p.A53V|SIRT3_ENST00000528702.1_5'UTR	NM_001017524.2|NM_012239.5	NP_001017524.1|NP_036371.1	Q9NTG7	SIR3_HUMAN	sirtuin 3	134	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				aerobic respiration (GO:0009060)|peptidyl-lysine deacetylation (GO:0034983)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)	membrane (GO:0016020)|mitochondrion (GO:0005739)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|zinc ion binding (GO:0008270)			endometrium(1)|lung(5)|urinary_tract(1)	7		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.66e-27)|Epithelial(43;2.02e-26)|OV - Ovarian serous cystadenocarcinoma(40;2.9e-21)|BRCA - Breast invasive adenocarcinoma(625;3.88e-05)|Lung(200;0.111)|LUSC - Lung squamous cell carcinoma(625;0.129)		GCAGGCTCTGGCCCGAATCAG	0.572																																																	0								ENSG00000142082						85.0	74.0	78.0					11																	233415		2203	4300	6503	SIRT3	SO:0001583	missense	0			-	HGNC	AF083108	CCDS7691.1, CCDS53590.1	11p15.5	2010-06-25	2010-06-25		ENSG00000142082	ENSG00000142082			14931	protein-coding gene	gene with protein product		604481	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 3"", ""sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae)"""			10381378, 18215119	Standard	NM_012239		Approved	SIR2L3	uc001lok.4	Q9NTG7	OTTHUMG00000119074	ENST00000382743.4:c.401C>T	11.37:g.233415G>A	ENSP00000372191:p.Ala134Val	Somatic	0	18	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	18	33.33	B7Z5U6|Q9Y6E8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sirtuin,pirsf_NAD-dep_deAcase_SIR2_class_I,pfscan_Ssirtuin_cat_dom	p.A134V	ENST00000382743.4	37	c.401	CCDS7691.1	11	.	.	.	.	.	.	.	.	.	.	G	12.92	2.081520	0.36758	.	.	ENSG00000142082	ENST00000382743;ENST00000525319;ENST00000532956	T;T;T	0.23552	2.2;1.9;2.2	4.38	2.47	0.30058	.	1.100240	0.07141	N	0.847264	T	0.24586	0.0596	M	0.62723	1.935	0.09310	N	0.999997	P;B;B;B	0.34864	0.473;0.42;0.184;0.039	B;B;B;B	0.28011	0.085;0.014;0.008;0.003	T	0.24404	-1.0161	10	0.51188	T	0.08	-1.7959	5.9599	0.19293	0.0937:0.0:0.4339:0.4723	.	134;134;53;134	E9PM75;B7Z7G4;E9PK80;Q9NTG7	.;.;.;SIRT3_HUMAN	V	134;53;134	ENSP00000372191:A134V;ENSP00000435464:A53V;ENSP00000433077:A134V	ENSP00000372191:A134V	A	-	2	0	SIRT3	223415	0.053000	0.20554	0.003000	0.11579	0.983000	0.72400	2.437000	0.44828	0.464000	0.27142	0.555000	0.69702	GCC	-	pirsf_NAD-dep_deAcase_SIR2_class_I,pfscan_Ssirtuin_cat_dom		0.572	SIRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT3	protein_coding	OTTHUMT00000239288.3	G		-		233415	-1	no_errors	ENST00000382743	ensembl	human	known	74_37	missense	SNP	0.000	A
DUOXA2	405753	genome.wustl.edu	37	15	45409411	45409411	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr15:45409411C>T	ENST00000323030.5	+	5	962	c.677C>T	c.(676-678)tCc>tTc	p.S226F	DUOX2_ENST00000389039.6_5'Flank	NM_207581.3	NP_997464.2	Q1HG44	DOXA2_HUMAN	dual oxidase maturation factor 2	226					hydrogen peroxide metabolic process (GO:0042743)|protein transport (GO:0015031)|regulation of inflammatory response (GO:0050727)|regulation of thyroid hormone generation (GO:2000609)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)							all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;2.88e-18)|GBM - Glioblastoma multiforme(94;3.95e-07)|COAD - Colon adenocarcinoma(120;0.0652)|Colorectal(133;0.0659)		GCCTTGGCCTCCATCTCTAGC	0.692																																																	0								ENSG00000140274						19.0	21.0	20.0					15																	45409411		2053	4193	6246	DUOXA2	SO:0001583	missense	0			-	HGNC	BX537581	CCDS10118.2	15q21.1	2008-10-30		2006-07-25	ENSG00000140274	ENSG00000140274			32698	protein-coding gene	gene with protein product		612772				16651268	Standard	NM_207581		Approved		uc001zuo.3	Q1HG44	OTTHUMG00000131354	ENST00000323030.5:c.677C>T	15.37:g.45409411C>T	ENSP00000319705:p.Ser226Phe	Somatic	0	25	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	17	29.17	B2RPI9|H0YNQ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dual_oxidase_maturation_fac	p.S226F	ENST00000323030.5	37	c.677	CCDS10118.2	15	.	.	.	.	.	.	.	.	.	.	c	11.53	1.666706	0.29604	.	.	ENSG00000140274	ENST00000323030;ENST00000350243	T	0.56103	0.48	4.9	4.9	0.64082	.	0.364671	0.29537	N	0.011864	T	0.60805	0.2297	L	0.52011	1.625	0.41562	D	0.988635	D	0.53462	0.96	P	0.54965	0.765	T	0.61163	-0.7118	10	0.41790	T	0.15	-15.5902	15.57	0.76326	0.0:1.0:0.0:0.0	.	226	Q1HG44	DOXA2_HUMAN	F	226;181	ENSP00000319705:S226F	ENSP00000319705:S226F	S	+	2	0	DUOXA2	43196703	0.377000	0.25106	1.000000	0.80357	0.225000	0.24961	3.046000	0.49846	2.276000	0.75962	0.506000	0.49869	TCC	-	pfam_Dual_oxidase_maturation_fac		0.692	DUOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUOXA2	protein_coding	OTTHUMT00000254142.1	C	NM_207581	-		45409411	+1	no_errors	ENST00000323030	ensembl	human	known	74_37	missense	SNP	0.995	T
Z97352.1	0	genome.wustl.edu	37	6	130068891	130068891	+	RNA	SNP	G	G	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr6:130068891G>A	ENST00000390707.1	+	0	10																											CAttaggttggtgcaaaagta	0.373																																																	0								ENSG00000211996																																			Z97352.1			0			-	Clone_based_ensembl_gene																													6.37:g.130068891G>A		Somatic	0	38	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	16	27.27		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000390707.1	37	NULL		6																																																																																			-	-		0.373	Z97352.1-201	NOVEL	basic	miRNA	ENSG00000211996	miRNA		G		-		130068891	+1	no_errors	ENST00000390707	ensembl	human	novel	74_37	rna	SNP	0.085	A
RP11-80F22.10	0	genome.wustl.edu	37	16	34682224	34682224	+	RNA	SNP	C	C	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr16:34682224C>A	ENST00000568619.1	-	0	255																											AAATCAAAGGCTTTTTCACAT	0.383																																																	0								ENSG00000214581																																			RP11-80F22.10			0			-	Clone_based_vega_gene																													16.37:g.34682224C>A		Somatic	0	77	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	69	25.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000568619.1	37	NULL		16	.	.	.	.	.	.	.	.	.	.	c	1.309	-0.602687	0.03744	.	.	ENSG00000214581	ENST00000398617	.	.	.	0.253	0.253	0.15551	.	.	.	.	.	T	0.37865	0.1019	.	.	.	.	.	.	.	.	.	.	.	.	T	0.45352	-0.9267	3	.	.	.	.	6.4222	0.21750	0.0:0.9998:0.0:2.0E-4	.	.	.	.	N	11	.	.	K	-	3	2	AC018558.1	34539725	0.000000	0.05858	0.010000	0.14722	0.010000	0.07245	-1.052000	0.03503	0.383000	0.24910	0.388000	0.25769	AAG	-	-		0.383	RP11-80F22.10-002	KNOWN	basic	processed_transcript	ENSG00000214581	pseudogene	OTTHUMT00000431371.1	C		-		34682224	-1	no_errors	ENST00000568619	ensembl	human	known	74_37	rna	SNP	0.136	A
BSN	8927	genome.wustl.edu	37	3	49698842	49698842	+	Silent	SNP	C	C	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr3:49698842C>A	ENST00000296452.4	+	6	9678	c.9564C>A	c.(9562-9564)ggC>ggA	p.G3188G		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	3188					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		TGAGCAGCGGCTATGAGCAGG	0.622																																																	0								ENSG00000164061						67.0	62.0	64.0					3																	49698842		2203	4300	6503	BSN	SO:0001819	synonymous_variant	0			-	HGNC	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.9564C>A	3.37:g.49698842C>A		Somatic	0	40	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	O43161|Q7LGH3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_piccolo,superfamily_Znf_FYVE_PHD	p.G3188	ENST00000296452.4	37	c.9564	CCDS2800.1	3																																																																																			-	NULL		0.622	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	BSN	protein_coding	OTTHUMT00000258164.1	C	NM_003458	-		49698842	+1	no_errors	ENST00000296452	ensembl	human	known	74_37	silent	SNP	1.000	A
CAPN8	388743	genome.wustl.edu	37	1	223716526	223716526	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr1:223716526G>T	ENST00000366872.5	-	19	1965	c.1966C>A	c.(1966-1968)Cta>Ata	p.L656I				A6NHC0	CAN8_HUMAN	calpain 8	678					digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)	4						AGGCTGAATAGTTCTAAAACA	0.488																																																	0								ENSG00000203697						111.0	103.0	105.0					1																	223716526		692	1591	2283	CAPN8	SO:0001583	missense	0			-	HGNC		CCDS73038.1	1q41	2013-01-10	2007-02-21		ENSG00000203697	ENSG00000203697		"""EF-hand domain containing"""	1485	protein-coding gene	gene with protein product			"""calpain 8 (nCL-2)"""			7690035, 8889549	Standard	NM_001143962		Approved	nCL-2	uc009xee.2	A6NHC0	OTTHUMG00000037378	ENST00000366872.5:c.1966C>A	1.37:g.223716526G>T	ENSP00000355837:p.Leu656Ile	Somatic	0	57	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	40	37.50	B2RXL2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.L656I	ENST00000366872.5	37	c.1966		1	.	.	.	.	.	.	.	.	.	.	G	0.333	-0.954780	0.02285	.	.	ENSG00000203697	ENST00000430824;ENST00000366872	D;D	0.94497	-3.44;-3.44	4.8	1.57	0.23409	EF-hand-like domain (1);	0.233246	0.37261	N	0.002162	T	0.82047	0.4952	N	0.05441	-0.05	0.23751	N	0.996943	B	0.09022	0.002	B	0.06405	0.002	T	0.67389	-0.5683	10	0.09590	T	0.72	.	4.1826	0.10383	0.2189:0.0:0.4242:0.3568	.	678	A6NHC0	CAN8_HUMAN	I	131;656	ENSP00000390294:L131I;ENSP00000355837:L656I	ENSP00000355837:L656I	L	-	1	2	CAPN8	221783149	0.151000	0.22747	0.744000	0.31058	0.016000	0.09150	-0.458000	0.06737	0.120000	0.18254	-0.143000	0.13931	CTA	-	NULL		0.488	CAPN8-201	KNOWN	basic|appris_principal	protein_coding	CAPN8	protein_coding		G	NM_001143962	-		223716526	-1	no_errors	ENST00000366872	ensembl	human	known	74_37	missense	SNP	0.998	T
ZNF391	346157	genome.wustl.edu	37	6	27368642	27368642	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr6:27368642T>C	ENST00000244576.4	+	3	1038	c.493T>C	c.(493-495)Tat>Cat	p.Y165H		NM_001076781.1	NP_001070249.1	Q9UJN7	ZN391_HUMAN	zinc finger protein 391	165					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(6)|lung(7)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	21						AGAGAAACCTTATGAATGCAA	0.393																																																	0								ENSG00000124613						84.0	91.0	89.0					6																	27368642		2198	4298	6496	ZNF391	SO:0001583	missense	0			-	HGNC	BC132797	CCDS43429.1	6p21	2013-01-08			ENSG00000124613	ENSG00000124613		"""Zinc fingers, C2H2-type"""	18779	protein-coding gene	gene with protein product							Standard	NM_001076781		Approved	dJ153G14.3	uc003njf.1	Q9UJN7	OTTHUMG00000014477	ENST00000244576.4:c.493T>C	6.37:g.27368642T>C	ENSP00000244576:p.Tyr165His	Somatic	0	25	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	20	31.03	B4DH77	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Y165H	ENST00000244576.4	37	c.493	CCDS43429.1	6	.	.	.	.	.	.	.	.	.	.	T	20.8	4.045665	0.75846	.	.	ENSG00000124613	ENST00000244576	T	0.21734	1.99	4.01	4.01	0.46588	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19765	0.0475	L	0.28400	0.85	0.25604	N	0.986567	D	0.89917	1.0	D	0.97110	1.0	T	0.06734	-1.0810	9	0.66056	D	0.02	.	10.8976	0.47031	0.0:0.0:0.0:1.0	.	165	Q9UJN7	ZN391_HUMAN	H	165	ENSP00000244576:Y165H	ENSP00000244576:Y165H	Y	+	1	0	ZNF391	27476621	0.305000	0.24481	0.990000	0.47175	0.986000	0.74619	3.892000	0.56235	1.440000	0.47531	0.460000	0.39030	TAT	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.393	ZNF391-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF391	protein_coding	OTTHUMT00000040145.2	T	NM_001076781	-		27368642	+1	no_errors	ENST00000244576	ensembl	human	known	74_37	missense	SNP	0.906	C
TLR2	7097	genome.wustl.edu	37	4	154626356	154626356	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr4:154626356T>C	ENST00000260010.6	+	1	3705	c.2297T>C	c.(2296-2298)aTg>aCg	p.M766T		NM_003264.3	NP_003255.2	O60603	TLR2_HUMAN	toll-like receptor 2	766	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				apoptotic process (GO:0006915)|cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to peptidoglycan (GO:0071224)|cellular response to triacyl bacterial lipopeptide (GO:0071727)|central nervous system myelin formation (GO:0032289)|chloramphenicol transport (GO:0042892)|defense response to Gram-positive bacterium (GO:0050830)|detection of diacyl bacterial lipopeptide (GO:0042496)|detection of triacyl bacterial lipopeptide (GO:0042495)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|induction by symbiont of defense-related host nitric oxide production (GO:0052063)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukotriene metabolic process (GO:0006691)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-17 production (GO:0032700)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of Wnt signaling pathway (GO:0030177)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to molecule of fungal origin (GO:0002238)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell body (GO:0044297)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopolysaccharide receptor activity (GO:0001875)|lipoteichoic acid binding (GO:0070891)|peptidoglycan binding (GO:0042834)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)|triacyl lipopeptide binding (GO:0042497)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	29	all_hematologic(180;0.093)	Renal(120;0.117)			OspA lipoprotein(DB00045)	GAGTGGCCCATGGACGAGGCT	0.478																																																	0								ENSG00000137462						68.0	72.0	71.0					4																	154626356		2201	4300	6501	TLR2	SO:0001583	missense	0			-	HGNC	U88878	CCDS3784.1	4q32	2008-02-05				ENSG00000137462		"""CD molecules"""	11848	protein-coding gene	gene with protein product		603028				9435236	Standard	XM_005263193		Approved	TIL4, CD282	uc003inq.3	O60603		ENST00000260010.6:c.2297T>C	4.37:g.154626356T>C	ENSP00000260010:p.Met766Thr	Somatic	0	43	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	18	50.00	B3Y612|D1CS45|D1CS48|D1CS49|O15454|Q8NI00	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.M766T	ENST00000260010.6	37	c.2297	CCDS3784.1	4	.	.	.	.	.	.	.	.	.	.	T	3.005	-0.205078	0.06180	.	.	ENSG00000137462	ENST00000260010	T	0.20598	2.06	5.63	-6.7	0.01766	Toll/interleukin-1 receptor homology (TIR) domain (4);	2.979670	0.01204	N	0.007661	T	0.04003	0.0112	N	0.00446	-1.495	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28038	-1.0056	10	0.12766	T	0.61	.	1.6857	0.02841	0.1572:0.2618:0.3076:0.2733	.	766	O60603	TLR2_HUMAN	T	766	ENSP00000260010:M766T	ENSP00000260010:M766T	M	+	2	0	TLR2	154845806	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.133000	0.01308	-1.122000	0.02945	-1.064000	0.02280	ATG	-	pirsf_Toll-like_receptor,pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom		0.478	TLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR2	protein_coding	OTTHUMT00000365205.1	T		-		154626356	+1	no_errors	ENST00000260010	ensembl	human	known	74_37	missense	SNP	0.000	C
SERHL2	253190	genome.wustl.edu	37	22	42951979	42951979	+	Intron	SNP	C	C	G	rs146115538|rs543882404	byFrequency	TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr22:42951979C>G	ENST00000327678.5	+	5	430				RRP7B_ENST00000357802.2_RNA|SERHL2_ENST00000407614.4_Intron|SERHL2_ENST00000340239.4_Intron|SERHL2_ENST00000335879.5_Intron	NM_014509.3	NP_055324.2	Q9NQF3	SERHL_HUMAN	serine hydrolase-like 2								hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|lung(3)|skin(1)|stomach(1)	8						CCATATGGTGCCCCCCCCCCC	0.592																																																	0								ENSG00000182841						4.0	8.0	7.0					22																	42951979		602	1535	2137	RRP7B	SO:0001627	intron_variant	0			-	HGNC		CCDS14037.1, CCDS63498.1	22q13	2005-08-09			ENSG00000183569	ENSG00000183569			29446	protein-coding gene	gene with protein product							Standard	NM_014509		Approved		uc003bcr.3	Q9H4I8	OTTHUMG00000150892	ENST00000327678.5:c.329-91C>G	22.37:g.42951979C>G		Somatic	0	24	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	19	17.14	Q5JZ95|Q9UH21	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000327678.5	37	NULL	CCDS14037.1	22																																																																																			-	-		0.592	SERHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP7B	protein_coding	OTTHUMT00000320454.1	C	NM_014509	-		42951979	-1	no_errors	ENST00000357802	ensembl	human	known	74_37	rna	SNP	0.001	G
MAP2K7	5609	genome.wustl.edu	37	19	7976147	7976147	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr19:7976147G>A	ENST00000397979.3	+	8	922	c.868G>A	c.(868-870)Gac>Aac	p.D290N	MAP2K7_ENST00000545011.1_Missense_Mutation_p.D332N|MAP2K7_ENST00000397981.3_Missense_Mutation_p.D290N|CTD-3193O13.13_ENST00000595655.1_RNA|MAP2K7_ENST00000397983.3_Missense_Mutation_p.D306N	NM_145185.2	NP_660186.1	O14733	MP2K7_HUMAN	mitogen-activated protein kinase kinase 7	290	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of neuron apoptotic process (GO:0043525)|response to heat (GO:0009408)|response to osmotic stress (GO:0006970)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|central_nervous_system(3)|endometrium(1)|large_intestine(8)|lung(4)|ovary(1)	19						CGAGCGCATTGACCCCCCAGA	0.701																																																	0								ENSG00000076984						33.0	38.0	36.0					19																	7976147		1872	4089	5961	MAP2K7	SO:0001583	missense	0			-	HGNC	AF006689	CCDS42491.1, CCDS74277.1, CCDS74278.1	19p13.3-p13.2	2011-06-09			ENSG00000076984	ENSG00000076984	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6847	protein-coding gene	gene with protein product		603014		PRKMK7		9312068	Standard	XM_005272489		Approved	MKK7, Jnkk2	uc002mit.3	O14733	OTTHUMG00000137368	ENST00000397979.3:c.868G>A	19.37:g.7976147G>A	ENSP00000381066:p.Asp290Asn	Somatic	0	22	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	33	21.43	B2R9S5|D6W659|O14648|O14816|O60452|O60453|Q1PG43|Q8IY10	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D332N	ENST00000397979.3	37	c.994	CCDS42491.1	19	.	.	.	.	.	.	.	.	.	.	G	17.70	3.453583	0.63290	.	.	ENSG00000076984	ENST00000397981;ENST00000397983;ENST00000545011;ENST00000425613;ENST00000397979	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	5.67	4.57	0.56435	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.38188	0.1031	N	0.04787	-0.16	0.58432	D	0.999997	B;P	0.36144	0.198;0.539	B;B	0.29942	0.049;0.109	T	0.43228	-0.9404	10	0.42905	T	0.14	-11.1265	14.1594	0.65436	0.0:0.1511:0.8489:0.0	.	290;290	O14733-4;O14733	.;MP2K7_HUMAN	N	290;306;332;306;290	ENSP00000381068:D290N;ENSP00000381070:D306N;ENSP00000443946:D332N;ENSP00000381066:D290N	ENSP00000381066:D290N	D	+	1	0	MAP2K7	7882147	1.000000	0.71417	0.869000	0.34112	0.868000	0.49771	7.566000	0.82347	2.836000	0.97738	0.655000	0.94253	GAC	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.701	MAP2K7-002	KNOWN	basic|CCDS	protein_coding	MAP2K7	protein_coding	OTTHUMT00000267980.1	G		-		7976147	+1	no_errors	ENST00000545011	ensembl	human	known	74_37	missense	SNP	0.999	A
PSG1	5669	genome.wustl.edu	37	19	43383883	43383883	+	5'Flank	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr19:43383883C>T	ENST00000436291.2	-	0	0				PSG1_ENST00000244296.2_5'Flank|PSG1_ENST00000595356.1_5'Flank|PSG1_ENST00000601073.1_5'UTR|PSG1_ENST00000403380.3_5'Flank|PSG1_ENST00000595124.1_5'Flank|PSG1_ENST00000312439.6_5'Flank	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1						female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				TGGGCAGGGTCAGGCCCAGGA	0.552																																																	0								ENSG00000231924																																			PSG1	SO:0001631	upstream_gene_variant	0			-	HGNC		CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123		19.37:g.43383883C>T	Exception_encountered	Somatic	0	35	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	47	9.62	O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000436291.2	37	NULL	CCDS54275.1	19																																																																																			-	-		0.552	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PSG1	protein_coding	OTTHUMT00000321426.1	C		-		43383883	-1	no_errors	ENST00000601073	ensembl	human	known	74_37	rna	SNP	0.003	T
VPS13D	55187	genome.wustl.edu	37	1	12335915	12335915	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr1:12335915C>A	ENST00000358136.3	+	19	2400	c.2270C>A	c.(2269-2271)gCa>gAa	p.A757E	VPS13D_ENST00000356315.4_Missense_Mutation_p.A757E	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GATGGGTCAGCATCTGAAGAG	0.443											OREG0013110	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000048707						83.0	85.0	84.0					1																	12335915		2203	4300	6503	VPS13D	SO:0001583	missense	0			-	HGNC	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.2270C>A	1.37:g.12335915C>A	ENSP00000350854:p.Ala757Glu	Somatic	0	42	0.00	679	0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VPSAP_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.A757E	ENST00000358136.3	37	c.2270	CCDS30588.1	1	.	.	.	.	.	.	.	.	.	.	C	0.063	-1.219030	0.01542	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	T;T	0.50277	0.75;0.75	5.8	5.8	0.92144	.	0.405610	0.27126	N	0.020815	T	0.27384	0.0672	N	0.01874	-0.695	0.80722	D	1	B;B	0.22683	0.073;0.02	B;B	0.24394	0.053;0.024	T	0.14896	-1.0456	10	0.27785	T	0.31	.	20.0534	0.97636	0.0:1.0:0.0:0.0	.	757;757	Q5THJ4-2;Q5THJ4	.;VP13D_HUMAN	E	757	ENSP00000348666:A757E;ENSP00000350854:A757E	ENSP00000348666:A757E	A	+	2	0	VPS13D	12258502	0.591000	0.26824	0.257000	0.24404	0.032000	0.12392	3.158000	0.50723	2.746000	0.94184	0.650000	0.86243	GCA	-	NULL		0.443	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	protein_coding	OTTHUMT00000036897.2	C	NM_015378	-		12335915	+1	no_errors	ENST00000358136	ensembl	human	known	74_37	missense	SNP	0.136	A
SIX4	51804	genome.wustl.edu	37	14	61180142	61180142	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr14:61180142C>A	ENST00000216513.4	-	3	2388	c.2329G>T	c.(2329-2331)Gat>Tat	p.D777Y		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	777					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		TCTTGCATATCTTCATCCAGC	0.423																																																	0								ENSG00000100625						100.0	91.0	94.0					14																	61180142		2203	4300	6503	SIX4	SO:0001583	missense	0			-	HGNC	AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.2329G>T	14.37:g.61180142C>A	ENSP00000216513:p.Asp777Tyr	Somatic	0	34	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	Q4QQH5|Q4V764	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.D777Y	ENST00000216513.4	37	c.2329	CCDS9749.2	14	.	.	.	.	.	.	.	.	.	.	C	20.2	3.945757	0.73672	.	.	ENSG00000100625	ENST00000216513;ENST00000554079	D;T	0.94138	-3.36;0.41	5.63	5.63	0.86233	.	0.123434	0.52532	D	0.000068	D	0.93736	0.7998	N	0.19112	0.55	0.80722	D	1	D	0.71674	0.998	D	0.64042	0.921	D	0.94626	0.7817	10	0.87932	D	0	.	20.0396	0.97574	0.0:1.0:0.0:0.0	.	777	Q9UIU6	SIX4_HUMAN	Y	777;450	ENSP00000216513:D777Y;ENSP00000451537:D450Y	ENSP00000216513:D777Y	D	-	1	0	SIX4	60249895	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.221000	0.78016	2.814000	0.96858	0.563000	0.77884	GAT	-	NULL		0.423	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX4	protein_coding	OTTHUMT00000072397.2	C		-		61180142	-1	no_errors	ENST00000216513	ensembl	human	known	74_37	missense	SNP	1.000	A
ARID2	196528	genome.wustl.edu	37	12	46123649	46123649	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr12:46123649delG	ENST00000334344.6	+	1	202	c.30delG	c.(28-30)ccgfs	p.P10fs	LINC00938_ENST00000609803.1_lincRNA|ARID2_ENST00000422737.1_5'Flank	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	10					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		AGGCGCCTCCGGACGAGCGGA	0.602			"""N, S, F"""		hepatocellular carcinoma																																			Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	0								ENSG00000189079						16.0	21.0	19.0					12																	46123649		2188	4296	6484	ARID2	SO:0001589	frameshift_variant	0				HGNC		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.30delG	12.37:g.46123649delG	ENSP00000335044:p.Pro10fs	Somatic	0	26	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	7	22.22	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_ARID/BRIGHT_DNA-bd,pfam_DNA-bd_RFX,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.D11fs	ENST00000334344.6	37	c.30	CCDS31783.1	12																																																																																			-	NULL		0.602	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID2	protein_coding	OTTHUMT00000318380.2	G	XM_350875			46123649	+1	no_errors	ENST00000334344	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
ANKRD30BP2	149992	genome.wustl.edu	37	21	14418386	14418386	+	RNA	SNP	A	A	T	rs201367790		TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr21:14418386A>T	ENST00000507941.1	+	0	998				RNU6-614P_ENST00000384369.1_RNA					ankyrin repeat domain 30B pseudogene 2																		CCAGTGAGACATGAGTCTTTT	0.368																																																	0								ENSG00000224309																																			ANKRD30BP2			0			-	HGNC	AF427490		21q11.2	2010-06-14	2010-06-14	2010-06-14	ENSG00000224309	ENSG00000224309			16620	pseudogene	pseudogene	"""cancer/testis antigen 85"""		"""chromosome 21 open reading frame 99"""	C21orf99		12036297, 17114284	Standard	NR_026916		Approved	CT85, CTSP-1	uc002yja.4		OTTHUMG00000074164		21.37:g.14418386A>T		Somatic	0	23	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	31	16.22		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000507941.1	37	NULL		21																																																																																			-	-		0.368	ANKRD30BP2-004	KNOWN	basic	processed_transcript	ANKRD30BP2	pseudogene	OTTHUMT00000372094.1	A	NR_026916	rs201367790		14418386	+1	no_errors	ENST00000507941	ensembl	human	known	74_37	rna	SNP	0.003	T
HCN2	610	genome.wustl.edu	37	19	613914	613914	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr19:613914C>A	ENST00000251287.2	+	7	1941	c.1888C>A	c.(1888-1890)Ctc>Atc	p.L630I	AC005559.2_ENST00000591847.1_RNA	NM_001194.3	NP_001185.3	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 2	630					cell-cell signaling (GO:0007267)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	cAMP binding (GO:0030552)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			endometrium(5)|lung(4)	9		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTACTGCCGCCTCTATTCGCT	0.687																																					Melanoma(145;1175 2427 8056 36306)												0								ENSG00000099822						39.0	37.0	38.0					19																	613914		2199	4297	6496	HCN2	SO:0001583	missense	0			-	HGNC	AF064877	CCDS12035.1	19p13	2011-07-05				ENSG00000099822		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4846	protein-coding gene	gene with protein product		602781		BCNG2		9405696, 9630217, 16382102	Standard	NM_001194		Approved	BCNG-2, HAC-1	uc002lpe.3	Q9UL51		ENST00000251287.2:c.1888C>A	19.37:g.613914C>A	ENSP00000251287:p.Leu630Ile	Somatic	0	48	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	O60742|O60743|O75267|Q9UBS2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.L630I	ENST00000251287.2	37	c.1888	CCDS12035.1	19	.	.	.	.	.	.	.	.	.	.	.	18.58	3.653895	0.67472	.	.	ENSG00000099822	ENST00000251287	D	0.97529	-4.42	3.83	3.83	0.44106	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	.	.	.	.	D	0.98071	0.9364	M	0.73753	2.245	0.80722	D	1	P	0.41910	0.764	P	0.62435	0.902	D	0.99305	1.0902	9	0.72032	D	0.01	.	15.1504	0.72692	0.0:1.0:0.0:0.0	.	630	Q9UL51	HCN2_HUMAN	I	630	ENSP00000251287:L630I	ENSP00000251287:L630I	L	+	1	0	HCN2	564914	1.000000	0.71417	1.000000	0.80357	0.105000	0.19272	5.494000	0.66905	1.876000	0.54355	0.425000	0.28330	CTC	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG		0.687	HCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN2	protein_coding	OTTHUMT00000452100.1	C	NM_001194	-		613914	+1	no_errors	ENST00000251287	ensembl	human	known	74_37	missense	SNP	1.000	A
EP400	57634	genome.wustl.edu	37	12	132547141	132547141	+	Silent	SNP	G	G	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr12:132547141G>A	ENST00000333577.4	+	48	8446	c.8337G>A	c.(8335-8337)caG>caA	p.Q2779Q	EP400_ENST00000389561.2_Silent_p.Q2743Q|EP400_ENST00000332482.4_Silent_p.Q2706Q|EP400_ENST00000389562.2_Silent_p.Q2742Q|EP400_ENST00000330386.6_Silent_p.Q2662Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2779	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2742Q(2)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacagcagcagcagc	0.597																																																	2	Substitution - coding silent(2)	kidney(2)						ENSG00000183495						52.0	42.0	46.0					12																	132547141		2203	4300	6503	EP400	SO:0001819	synonymous_variant	0			-	HGNC	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8337G>A	12.37:g.132547141G>A		Somatic	0	22	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q2779	ENST00000333577.4	37	c.8337		12																																																																																			-	NULL		0.597	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	protein_coding		G	NM_015409	-		132547141	+1	no_errors	ENST00000333577	ensembl	human	known	74_37	silent	SNP	0.737	A
TEX37	200523	genome.wustl.edu	37	2	88828633	88828633	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr2:88828633C>T	ENST00000303254.3	+	4	326	c.184C>T	c.(184-186)Ccc>Tcc	p.P62S		NM_152670.2	NP_689883.1	Q96LM6	TEX37_HUMAN	testis expressed 37	62						nucleus (GO:0005634)											TAACCCCAACCCCAAGCTAAC	0.532																																																	0								ENSG00000172073						94.0	89.0	91.0					2																	88828633		2203	4300	6503	TEX37	SO:0001583	missense	0			-	HGNC	AK058098	CCDS2003.1	2p11.2	2014-01-28	2012-09-14	2012-09-14	ENSG00000172073	ENSG00000172073			26341	protein-coding gene	gene with protein product	"""Testis-Specific Conserved gene 21kDa"""		"""chromosome 2 open reading frame 51"""	C2orf51		17091336	Standard	NM_152670		Approved	FLJ25369, TSC21	uc002stb.2	Q96LM6	OTTHUMG00000130332	ENST00000303254.3:c.184C>T	2.37:g.88828633C>T	ENSP00000307142:p.Pro62Ser	Somatic	0	38	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	29	34.78		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P62S	ENST00000303254.3	37	c.184	CCDS2003.1	2	.	.	.	.	.	.	.	.	.	.	C	15.46	2.839903	0.51057	.	.	ENSG00000172073	ENST00000303254	T	0.59224	0.28	4.61	3.73	0.42828	.	0.000000	0.47852	D	0.000205	T	0.61590	0.2359	L	0.36672	1.1	0.35693	D	0.815038	D	0.69078	0.997	D	0.69307	0.963	T	0.68969	-0.5269	10	0.87932	D	0	-23.0829	7.9692	0.30117	0.0:0.8915:0.0:0.1085	.	62	Q96LM6	TSC21_HUMAN	S	62	ENSP00000307142:P62S	ENSP00000307142:P62S	P	+	1	0	C2orf51	88609748	0.927000	0.31430	1.000000	0.80357	0.380000	0.30137	1.788000	0.38714	2.561000	0.86390	0.462000	0.41574	CCC	-	NULL		0.532	TEX37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX37	protein_coding	OTTHUMT00000252682.1	C	NM_152670	-		88828633	+1	no_errors	ENST00000303254	ensembl	human	known	74_37	missense	SNP	0.987	T
MFGE8	4240	genome.wustl.edu	37	15	89442651	89442651	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr15:89442651A>G	ENST00000566497.1	-	8	1200	c.1139T>C	c.(1138-1140)cTg>cCg	p.L380P	MFGE8_ENST00000539437.1_Missense_Mutation_p.L372P|MFGE8_ENST00000268150.8_Missense_Mutation_p.L380P|MFGE8_ENST00000542878.1_Missense_Mutation_p.L336P|MFGE8_ENST00000268151.7_Missense_Mutation_p.L328P			Q08431	MFGM_HUMAN	milk fat globule-EGF factor 8 protein	380	F5/8 type C 2. {ECO:0000255|PROSITE- ProRule:PRU00081}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of apoptotic cell clearance (GO:2000427)|single fertilization (GO:0007338)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|vesicle (GO:0031982)	phosphatidylethanolamine binding (GO:0008429)|phosphatidylserine binding (GO:0001786)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	22	Lung NSC(78;0.0392)|all_lung(78;0.077)					CTCCAGGCGCAGGGCGATGCG	0.602																																																	0								ENSG00000140545						117.0	105.0	109.0					15																	89442651		2200	4299	6499	MFGE8	SO:0001583	missense	0			-	HGNC	U58516	CCDS10347.1, CCDS45345.1	15q25	2009-03-25			ENSG00000140545	ENSG00000140545			7036	protein-coding gene	gene with protein product	"""sperm surface protein hP47"""	602281	"""sperm associated antigen 10"""	SPAG10		9027496, 19204935	Standard	NM_005928		Approved	SED1, EDIL1, BA46, OAcGD3S, HsT19888, MFG-E8, hP47	uc002bng.4	Q08431	OTTHUMG00000148682	ENST00000566497.1:c.1139T>C	15.37:g.89442651A>G	ENSP00000456281:p.Leu380Pro	Somatic	0	66	0.00		0.5018226239868958	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B2R6M7|Q53FU9|Q7Z3D2|Q9BTL9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Coagulation_fac_5/8-C_type_dom,pfam_EG-like_dom,superfamily_Galactose-bd-like,smart_EG-like_dom,smart_Coagulation_fac_5/8-C_type_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.L380P	ENST00000566497.1	37	c.1139	CCDS10347.1	15	.	.	.	.	.	.	.	.	.	.	A	23.9	4.465757	0.84425	.	.	ENSG00000140545	ENST00000268150;ENST00000268151;ENST00000539437;ENST00000542878	D;D;D;D	0.85411	-1.98;-1.98;-1.98;-1.98	4.88	4.88	0.63580	Coagulation factor 5/8 C-terminal type domain (4);Galactose-binding domain-like (1);	0.074974	0.53938	D	0.000041	D	0.95284	0.8470	H	0.98466	4.24	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.96739	0.9545	10	0.87932	D	0	-12.8829	13.3576	0.60638	1.0:0.0:0.0:0.0	.	372;336;372;328;380	B3KTQ2;F5GZN3;F5H7N9;Q08431-3;Q08431	.;.;.;.;MFGM_HUMAN	P	380;328;372;336	ENSP00000268150:L380P;ENSP00000268151:L328P;ENSP00000442386:L372P;ENSP00000444332:L336P	ENSP00000268150:L380P	L	-	2	0	MFGE8	87243655	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.146000	0.94640	1.843000	0.53566	0.454000	0.30748	CTG	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom		0.602	MFGE8-015	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	MFGE8	protein_coding	OTTHUMT00000432804.1	A	NM_005928	-		89442651	-1	no_errors	ENST00000268150	ensembl	human	known	74_37	missense	SNP	1.000	G
