#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CDH7	1005	genome.wustl.edu	37	18	63547710	63547710	+	Silent	SNP	C	C	T	rs115462274		TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr18:63547710C>T	ENST00000397968.2	+	12	2364	c.1938C>T	c.(1936-1938)atC>atT	p.I646I	CDH7_ENST00000323011.3_Silent_p.I646I	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	646					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				AAAGAGACATCAGAGAAAATA	0.458																																																	0								ENSG00000081138						65.0	67.0	67.0					18																	63547710		2203	4300	6503	CDH7	SO:0001819	synonymous_variant	0			-	HGNC	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1938C>T	18.37:g.63547710C>T		Somatic	0	86	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	99	10.00	Q9H157	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I646	ENST00000397968.2	37	c.1938	CCDS11993.1	18																																																																																			-	pfam_Cadherin_cytoplasmic-dom		0.458	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	protein_coding	OTTHUMT00000256217.2	C	NM_033646	-		63547710	+1	no_errors	ENST00000323011	ensembl	human	known	74_37	silent	SNP	0.998	T
RP11-782C8.2	0	genome.wustl.edu	37	1	143210392	143210396	+	lincRNA	DEL	ATAAC	ATAAC	-	rs372710968|rs574899120		TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	ATAAC	ATAAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr1:143210392_143210396delATAAC	ENST00000412204.2	-	0	674_678				RP11-782C8.1_ENST00000438000.1_lincRNA																							ACTCAATAAAATAACATATCATGAT	0.302																																																	0								ENSG00000232274																																			RP11-782C8.2			0				Clone_based_vega_gene																													1.37:g.143210392_143210396delATAAC		Somatic	NA	NA	NA		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			-	-		0.302	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	lincRNA	OTTHUMT00000037567.2	ATAAC				143210396	-1	no_errors	ENST00000412204	ensembl	human	known	74_37	rna	DEL	0.841:0.809:0.673:0.586:0.231	-
PRODH2	58510	genome.wustl.edu	37	19	36293961	36293961	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr19:36293961G>T	ENST00000301175.3	-	9	1266	c.1249C>A	c.(1249-1251)Ctg>Atg	p.L417M		NM_021232.1	NP_067055.1	Q9UF12	PROD2_HUMAN	proline dehydrogenase (oxidase) 2	417					proline catabolic process to glutamate (GO:0010133)	mitochondrial inner membrane (GO:0005743)	proline dehydrogenase activity (GO:0004657)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GTCAGCATCAGTTCCAGGCAG	0.617																																																	0								ENSG00000250799						37.0	26.0	30.0					19																	36293961		2196	4291	6487	PRODH2	SO:0001583	missense	0			-	HGNC	U80018	CCDS12478.1	19q13.1	2014-07-11				ENSG00000250799			17325	protein-coding gene	gene with protein product							Standard	NM_021232		Approved	HSPOX1	uc002obx.1	Q9UF12		ENST00000301175.3:c.1249C>A	19.37:g.36293961G>T	ENSP00000301175:p.Leu417Met	Somatic	0	64	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	7	81.08		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Proline_DH	p.L417M	ENST00000301175.3	37	c.1249	CCDS12478.1	19	.	.	.	.	.	.	.	.	.	.	G	12.10	1.836786	0.32421	.	.	ENSG00000250799	ENST00000301175	T	0.32753	1.44	5.55	3.45	0.39498	Proline dehydrogenase (1);	.	.	.	.	T	0.23766	0.0575	L	0.39326	1.205	0.80722	D	1	B	0.30146	0.27	B	0.31812	0.136	T	0.03840	-1.0999	9	0.29301	T	0.29	.	8.4807	0.33040	0.1589:0.0:0.8411:0.0	.	417	Q9UF12	PROD2_HUMAN	M	417	ENSP00000301175:L417M	ENSP00000301175:L417M	L	-	1	2	PRODH2	40985801	0.736000	0.28164	1.000000	0.80357	0.949000	0.60115	0.567000	0.23608	0.915000	0.36847	0.655000	0.94253	CTG	-	pfam_Proline_DH		0.617	PRODH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRODH2	protein_coding	OTTHUMT00000452552.2	G	NM_021232	-		36293961	-1	no_errors	ENST00000301175	ensembl	human	known	74_37	missense	SNP	1.000	T
TIE1	7075	genome.wustl.edu	37	1	43783334	43783334	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr1:43783334G>A	ENST00000372476.3	+	16	2799	c.2720G>A	c.(2719-2721)tGt>tAt	p.C907Y	TIE1_ENST00000473014.1_3'UTR|TIE1_ENST00000433781.2_Missense_Mutation_p.C552Y	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	907	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CTGGGGGCCTGTAAGAACCGA	0.557																																																	0								ENSG00000066056						101.0	114.0	110.0					1																	43783334		2203	4300	6503	TIE1	SO:0001583	missense	0			-	HGNC	BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.2720G>A	1.37:g.43783334G>A	ENSP00000361554:p.Cys907Tyr	Somatic	0	73	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	56	13.85	B5A949|B5A950	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_EG-like_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.C907Y	ENST00000372476.3	37	c.2720	CCDS482.1	1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.422515	0.83559	.	.	ENSG00000066056	ENST00000372476;ENST00000372475;ENST00000536913;ENST00000433781	D;D	0.84442	-1.85;-1.85	5.66	5.66	0.87406	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43747	D	0.000521	D	0.92492	0.7616	M	0.75884	2.315	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.77004	0.989;0.985;0.989	D	0.92778	0.6238	10	0.87932	D	0	.	19.7383	0.96217	0.0:0.0:1.0:0.0	.	862;552;907	B4DTW8;B4DKW0;P35590	.;.;TIE1_HUMAN	Y	907;310;190;552	ENSP00000361554:C907Y;ENSP00000411728:C552Y	ENSP00000361553:C310Y	C	+	2	0	TIE1	43555921	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.790000	0.99075	2.675000	0.91044	0.655000	0.94253	TGT	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.557	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIE1	protein_coding	OTTHUMT00000019011.1	G	NM_005424	-		43783334	+1	no_errors	ENST00000372476	ensembl	human	known	74_37	missense	SNP	1.000	A
CCDC134	79879	genome.wustl.edu	37	22	42205936	42205936	+	Silent	SNP	C	C	T			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr22:42205936C>T	ENST00000255784.5	+	3	261	c.157C>T	c.(157-159)Ctg>Ttg	p.L53L	CCDC134_ENST00000402061.3_Silent_p.L53L	NM_024821.2	NP_079097.1	Q9H6E4	CC134_HUMAN	coiled-coil domain containing 134	53						extracellular region (GO:0005576)|membrane (GO:0016020)				large_intestine(1)|lung(2)|ovary(2)|skin(1)	6						ACTGAAGAACCTGGCACAGCT	0.547																																																	0								ENSG00000100147						79.0	68.0	72.0					22																	42205936		2203	4300	6503	CCDC134	SO:0001819	synonymous_variant	0			-	HGNC	AL021453	CCDS33654.1	22q13.2	2010-12-24			ENSG00000100147	ENSG00000100147			26185	protein-coding gene	gene with protein product						18087676	Standard	NM_024821		Approved	FLJ22349	uc003bbh.1	Q9H6E4	OTTHUMG00000151262	ENST00000255784.5:c.157C>T	22.37:g.42205936C>T		Somatic	0	129	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	72	38.46		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L53	ENST00000255784.5	37	c.157	CCDS33654.1	22																																																																																			-	NULL		0.547	CCDC134-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	CCDC134	protein_coding	OTTHUMT00000321964.1	C	NM_024821	-		42205936	+1	no_errors	ENST00000255784	ensembl	human	known	74_37	silent	SNP	1.000	T
SUMO3	6612	genome.wustl.edu	37	21	46228430	46228430	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr21:46228430delA	ENST00000397893.3	-	4	275	c.276delT	c.(274-276)tttfs	p.F92fs	SUMO3_ENST00000332859.6_Intron|SUMO3_ENST00000397898.3_Intron|SUMO3_ENST00000411651.2_Intron|SUMO3_ENST00000479153.1_Intron					small ubiquitin-like modifier 3											prostate(1)	1				Colorectal(79;0.058)		actccgtctcaaaaaaaaaag	0.498																																																	0								ENSG00000184900																																			SUMO3	SO:0001589	frameshift_variant	0				HGNC		CCDS33587.1, CCDS68220.1	21q22.3	2013-06-05	2013-06-05	2004-05-19	ENSG00000184900	ENSG00000184900			11124	protein-coding gene	gene with protein product		602231	"""SMT3 (suppressor of mif two 3, yeast) homolog 1"", ""SMT3 suppressor of mif two 3 homolog 3 (yeast)"", ""SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae)"""	SMT3H1		9119407	Standard	NM_006936		Approved	SMT3A	uc002zfz.1	P55854	OTTHUMG00000090256	ENST00000397893.3:c.276delT	21.37:g.46228430delA	ENSP00000380990:p.Phe92fs	Somatic	0	28	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Rad60/SUMO_like,pfam_Ubiquitin_dom,smart_Ubiquitin_dom	p.F92fs	ENST00000397893.3	37	c.276		21																																																																																			-	NULL		0.498	SUMO3-005	PUTATIVE	basic|exp_conf	protein_coding	SUMO3	protein_coding	OTTHUMT00000206564.1	A				46228430	-1	no_errors	ENST00000397893	ensembl	human	putative	74_37	frame_shift_del	DEL	0.008	-
MALAT1	378938	genome.wustl.edu	37	11	65272832	65272832	+	lincRNA	SNP	G	G	C			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr11:65272832G>C	ENST00000534336.1	+	0	7600					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TGAAGCATCCGAAGGAATGCT	0.423																																																	0								ENSG00000251562						45.0	44.0	45.0					11																	65272832		874	1988	2862	MALAT1			0			-	HGNC	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65272832G>C		Somatic	0	125	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	51	47.96		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			-	-		0.423	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	lincRNA	OTTHUMT00000389143.1	G	NR_002819	-		65272832	+1	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	SNP	0.000	C
PTPRM	5797	genome.wustl.edu	37	18	8380421	8380421	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr18:8380421C>T	ENST00000332175.8	+	27	4912	c.3875C>T	c.(3874-3876)gCc>gTc	p.A1292V	PTPRM_ENST00000580170.1_Missense_Mutation_p.A1305V|PTPRM_ENST00000400053.4_Missense_Mutation_p.A1230V|PTPRM_ENST00000444013.1_Missense_Mutation_p.A1079V|PTPRM_ENST00000400060.4_Missense_Mutation_p.A1306V	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1292	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GTGGATCCTGCCCAGGTGAGA	0.488																																																	0								ENSG00000173482						102.0	92.0	95.0					18																	8380421		2203	4300	6503	PTPRM	SO:0001583	missense	0			-	HGNC	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.3875C>T	18.37:g.8380421C>T	ENSP00000331418:p.Ala1292Val	Somatic	0	100	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	67	40.18	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.A1306V	ENST00000332175.8	37	c.3917	CCDS11840.1	18	.	.	.	.	.	.	.	.	.	.	C	26.5	4.741391	0.89573	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.13778	2.56;2.56;2.56;2.56	5.49	5.49	0.81192	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.058646	0.64402	D	0.000002	T	0.30355	0.0762	L	0.41356	1.27	0.80722	D	1	B;D;D	0.69078	0.443;0.992;0.997	B;P;D	0.71414	0.425;0.87;0.973	T	0.00542	-1.1680	10	0.41790	T	0.15	.	19.3775	0.94517	0.0:1.0:0.0:0.0	.	1079;1305;1292	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	V	1292;1306;1230;1079	ENSP00000331418:A1292V;ENSP00000382933:A1306V;ENSP00000382927:A1230V;ENSP00000387608:A1079V	ENSP00000331418:A1292V	A	+	2	0	PTPRM	8370421	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	5.920000	0.70017	2.588000	0.87417	0.467000	0.42956	GCC	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt		0.488	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRM	protein_coding	OTTHUMT00000254456.1	C		-		8380421	+1	no_errors	ENST00000400060	ensembl	human	known	74_37	missense	SNP	1.000	T
TSPY1	7258	genome.wustl.edu	37	Y	9304680	9304680	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chrY:9304680G>A	ENST00000451548.1	+	1	117	c.71G>A	c.(70-72)cGg>cAg	p.R24Q	AC006156.1_ENST00000450145.1_Intron|AC006156.1_ENST00000423213.1_Intron|TSPY1_ENST00000423647.2_Intron|TSPY3_ENST00000440483.1_Intron	NM_001197242.1|NM_003308.3	NP_001184171.1|NP_003299.2	Q01534	TSPY1_HUMAN	testis specific protein, Y-linked 1	24					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|gonadal mesoderm development (GO:0007506)|nucleosome assembly (GO:0006334)|sex differentiation (GO:0007548)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				lung(4)	4						GGCGTGGGTCGGGCAGCACAG	0.706																																																	0								ENSG00000258992						1.0	1.0	1.0					Y																	9304680		9	17	26	TSPY1	SO:0001583	missense	0			-	HGNC		CCDS48205.1, CCDS76071.1	Yp11.2	2009-08-06	2004-04-05	2004-04-07					12381	protein-coding gene	gene with protein product	"""cancer/testis antigen 78"""	480100	"""testis specific protein, Y-linked"""	TSPY			Standard	NM_003308		Approved	CT78	uc004frw.4	Q01534		ENST00000451548.1:c.71G>A	Y.37:g.9304680G>A	ENSP00000403304:p.Arg24Gln	Somatic	0	299	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	276	10.39	A6NJD2|O00216|P09002|Q0VAD3|Q9UNN7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NAP_family	p.R24Q	ENST00000451548.1	37	c.71	CCDS48205.1	Y																																																																																			-	NULL		0.706	TSPY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TSPY1	protein_coding	OTTHUMT00000413463.1	G	NM_003308	-		9304680	+1	no_errors	ENST00000451548	ensembl	human	known	74_37	missense	SNP	0.998	A
TLK2	11011	genome.wustl.edu	37	17	60631103	60631142	+	Splice_Site	DEL	ATGATTTATTAAGAGTAAGTATTAAAATGTAAGAGATTTT	ATGATTTATTAAGAGTAAGTATTAAAATGTAAGAGATTTT	-			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	ATGATTTATTAAGAGTAAGTATTAAAATGTAAGAGATTTT	ATGATTTATTAAGAGTAAGTATTAAAATGTAAGAGATTTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr17:60631103_60631142delATGATTTATTAAGAGTAAGTATTAAAATGTAAGAGATTTT	ENST00000326270.9	+	9	975_988	c.707_720delATGATTTATTAAGAGTAAGTATTAAAATGTAAGAGATTTT	c.(706-720)gatgatttattaaga>g	p.DDLLR236fs	TLK2_ENST00000582809.1_Splice_Site_p.DDLLR87fs|RP11-464D20.6_ENST00000583426.1_RNA|TLK2_ENST00000542523.1_Splice_Site_p.DDLLR204fs|TLK2_ENST00000346027.5_Splice_Site_p.DDLLR236fs|TLK2_ENST00000343388.7_Splice_Site_p.DDLLR204fs	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	236					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						GGAAGAATAGATGATTTATTAAGAGTAAGTATTAAAATGTAAGAGATTTTATAGCAAGCA	0.283																																																	0								ENSG00000146872																																			TLK2	SO:0001630	splice_region_variant	0				HGNC	AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.720+1ATGATTTATTAAGAGTAAGTATTAAAATGTAAGAGATTTT>-	17.37:g.60631103_60631142delATGATTTATTAAGAGTAAGTATTAAAATGTAAGAGATTTT		Somatic	NA	NA	NA		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	D3DU07|Q9UKI7|Q9Y4F7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D236fs	ENST00000326270.9	37	c.707_720		17																																																																																			-	NULL		0.283	TLK2-004	KNOWN	basic	protein_coding	TLK2	protein_coding	OTTHUMT00000445140.1	ATGATTTATTAAGAGTAAGTATTAAAATGTAAGAGATTTT	NM_006852		Frame_Shift_Del	60631142	+1	no_errors	ENST00000326270	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.994:0.999:1.000:1.000:1.000:1.000:1.000	-
ZAN	7455	genome.wustl.edu	37	7	100385562	100385596	+	RNA	DEL	GCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT	GCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT	-	rs549519838|rs369526619|rs112538235|rs373952854|rs113714278|rs72364644|rs59541653	byFrequency	TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	GCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT	GCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr7:100385562_100385596delGCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT	ENST00000348028.3	+	0	7195_7229				ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000421100.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ACATTTGACGGCTTCAGCTACCGCTTGCAAGGCCGCATGACCTATGTTCTGATCA	0.583														1187	0.237021	0.1029	0.2752	5008	,	,		26483	0.0327		0.5388	False		,,,				2504	0.2914																0								ENSG00000146839		,	590,3208		88,414,1397					,	-3.1	0.0		dbSNP_130	52	3589,4247		975,1639,1304	no	frameshift,frameshift	ZAN	NM_173059.1,NM_003386.1	,	1063,2053,2701	A1A1,A1R,RR		45.8014,15.5345,35.9206	,	,		4179,7455				ZAN			0				HGNC	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100385562_100385596delGCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT		Somatic	NA	NA	NA		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.F2344fs	ENST00000348028.3	37	c.7028_7062		7																																																																																			-	pfam_VWF_type-D,smart_VWF_type-D		0.583	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	polymorphic_pseudogene	OTTHUMT00000347214.1	GCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT	NM_003386			100385596	+1	no_errors	ENST00000546292	ensembl	human	known	74_37	frame_shift_del	DEL	0.013:0.005:0.000:0.001:0.000:0.000:0.005:0.239:0.512:0.532:0.543:0.259:0.193:0.551:0.747:0.746:0.691:0.313:0.001:0.036:0.867:0.876:0.710:0.622:0.357:0.357:0.884:0.969:0.998:1.000:1.000:1.000:1.000:0.989:0.652	-
DCAF8L2	347442	genome.wustl.edu	37	X	27765399	27765399	+	Silent	SNP	A	A	G	rs371896121		TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chrX:27765399A>G	ENST00000451261.2	+	5	786	c.387A>G	c.(385-387)gaA>gaG	p.E129E		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	129	Glu-rich.									central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						aggaggaggaagaggaggagg	0.572																																																	0								ENSG00000189186						24.0	21.0	22.0					X																	27765399		692	1589	2281	DCAF8L2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.387A>G	X.37:g.27765399A>G		Somatic	0	20	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	17	25.00	B2RXH9|J3KT06	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E129	ENST00000451261.2	37	c.387	CCDS59162.1	X																																																																																			-	NULL		0.572	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L2	protein_coding	OTTHUMT00000056143.4	A	XM_293354	-		27765399	+1	no_errors	ENST00000451261	ensembl	human	known	74_37	silent	SNP	0.009	G
SPEG	10290	genome.wustl.edu	37	2	220327072	220327072	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr2:220327072T>G	ENST00000312358.7	+	8	2801	c.2669T>G	c.(2668-2670)aTc>aGc	p.I890S	SPEG_ENST00000396686.1_Missense_Mutation_p.I41S|SPEG_ENST00000396698.1_Missense_Mutation_p.I786S|SPEG_ENST00000396689.2_Missense_Mutation_p.I41S|SPEG_ENST00000485813.1_3'UTR|SPEG_ENST00000396688.1_Missense_Mutation_p.I41S|SPEG_ENST00000396695.2_Missense_Mutation_p.I98S	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	890	Ig-like 3.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		ATCATGAGCATCCGCGTGCAG	0.592																																																	0								ENSG00000072195						25.0	29.0	28.0					2																	220327072		2017	4176	6193	SPEG	SO:0001583	missense	0			-	HGNC	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.2669T>G	2.37:g.220327072T>G	ENSP00000311684:p.Ile890Ser	Somatic	0	70	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	25	50.00	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.I98S	ENST00000312358.7	37	c.293	CCDS42824.1	2	.	.	.	.	.	.	.	.	.	.	T	22.7	4.324592	0.81580	.	.	ENSG00000072195	ENST00000312358;ENST00000265327;ENST00000396698;ENST00000396695;ENST00000396688;ENST00000396686;ENST00000396689	T;T;T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83;-0.83;-0.83	5.7	5.7	0.88788	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.40908	D	0.000990	T	0.74275	0.3695	N	0.12746	0.255	0.39907	D	0.973971	D;P;D	0.71674	0.959;0.949;0.998	P;P;D	0.68483	0.626;0.57;0.958	T	0.79708	-0.1690	10	0.59425	D	0.04	.	14.2182	0.65807	0.0:0.0:0.0:1.0	.	890;98;786	Q15772;Q15772-3;B9ZVR7	SPEG_HUMAN;.;.	S	890;890;786;98;41;41;41	ENSP00000311684:I890S;ENSP00000379926:I786S;ENSP00000379923:I98S;ENSP00000379919:I41S;ENSP00000379917:I41S;ENSP00000379920:I41S	ENSP00000265327:I890S	I	+	2	0	SPEG	220035316	0.995000	0.38212	1.000000	0.80357	0.971000	0.66376	2.624000	0.46444	2.172000	0.68678	0.533000	0.62120	ATC	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.592	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	protein_coding	OTTHUMT00000130252.2	T	NM_005876	-		220327072	+1	no_errors	ENST00000396695	ensembl	human	known	74_37	missense	SNP	1.000	G
AK5	26289	genome.wustl.edu	37	1	77984281	77984281	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr1:77984281G>A	ENST00000354567.2	+	11	1443	c.1180G>A	c.(1180-1182)Gaa>Aaa	p.E394K	AK5_ENST00000344720.5_Missense_Mutation_p.E368K	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5	394	Adenylate kinase 2.				ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						CACACAGTGTGAAAAGCTGGT	0.453																																																	0								ENSG00000154027						65.0	59.0	61.0					1																	77984281		2203	4300	6503	AK5	SO:0001583	missense	0			-	HGNC	AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.1180G>A	1.37:g.77984281G>A	ENSP00000346577:p.Glu394Lys	Somatic	0	83	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	68	37.04	Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Adenylate_kin,pfam_Dpy-30_motif,superfamily_P-loop_NTPase,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,prints_Adenylate_kin,tigrfam_Adenylate_kin1	p.E394K	ENST00000354567.2	37	c.1180	CCDS675.1	1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.102668	0.56183	.	.	ENSG00000154027	ENST00000354567;ENST00000344720	T;T	0.71222	-0.55;-0.55	5.12	2.23	0.28157	.	0.419710	0.23091	N	0.052030	T	0.37945	0.1022	L	0.29908	0.895	0.80722	D	1	B	0.10296	0.003	B	0.17979	0.02	T	0.15464	-1.0436	10	0.32370	T	0.25	-3.0776	9.5141	0.39095	0.2357:0.0:0.7643:0.0	.	394	Q9Y6K8	KAD5_HUMAN	K	394;368	ENSP00000346577:E394K;ENSP00000341430:E368K	ENSP00000341430:E368K	E	+	1	0	AK5	77756869	1.000000	0.71417	0.799000	0.32177	0.906000	0.53458	4.362000	0.59467	0.282000	0.22254	-0.136000	0.14681	GAA	-	pfam_Adenylate_kin,superfamily_P-loop_NTPase,tigrfam_Adenylate_kin1		0.453	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AK5	protein_coding	OTTHUMT00000026993.4	G	NM_174858	-		77984281	+1	no_errors	ENST00000354567	ensembl	human	known	74_37	missense	SNP	1.000	A
AK5	26289	genome.wustl.edu	37	1	77984373	77984373	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr1:77984373G>C	ENST00000354567.2	+	11	1535	c.1272G>C	c.(1270-1272)ttG>ttC	p.L424F	AK5_ENST00000344720.5_Missense_Mutation_p.L398F	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5	424	Adenylate kinase 2.|NMPbind 2. {ECO:0000250}.				ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						GAAGCAAATTGATCAGAGACA	0.483																																																	0								ENSG00000154027						111.0	100.0	103.0					1																	77984373		2203	4300	6503	AK5	SO:0001583	missense	0			-	HGNC	AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.1272G>C	1.37:g.77984373G>C	ENSP00000346577:p.Leu424Phe	Somatic	0	91	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	63	33.68	Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Adenylate_kin,pfam_Dpy-30_motif,superfamily_P-loop_NTPase,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,prints_Adenylate_kin,tigrfam_Adenylate_kin1	p.L424F	ENST00000354567.2	37	c.1272	CCDS675.1	1	.	.	.	.	.	.	.	.	.	.	G	8.013	0.758002	0.15846	.	.	ENSG00000154027	ENST00000354567;ENST00000344720	T;T	0.77358	-1.09;-1.09	5.21	4.27	0.50696	.	0.556961	0.16274	N	0.221658	T	0.61652	0.2364	L	0.53249	1.67	0.80722	D	1	B	0.17852	0.024	B	0.15052	0.012	T	0.61710	-0.7007	10	0.41790	T	0.15	.	13.6011	0.62020	0.0:0.4274:0.5726:0.0	.	424	Q9Y6K8	KAD5_HUMAN	F	424;398	ENSP00000346577:L424F;ENSP00000341430:L398F	ENSP00000341430:L398F	L	+	3	2	AK5	77756961	0.983000	0.35010	0.974000	0.42286	0.820000	0.46376	0.876000	0.28092	1.276000	0.44395	0.655000	0.94253	TTG	-	pfam_Adenylate_kin,superfamily_P-loop_NTPase,tigrfam_Adenylate_kin1		0.483	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AK5	protein_coding	OTTHUMT00000026993.4	G	NM_174858	-		77984373	+1	no_errors	ENST00000354567	ensembl	human	known	74_37	missense	SNP	0.998	C
PCDHB11	56125	genome.wustl.edu	37	5	140579996	140579996	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr5:140579996G>T	ENST00000354757.3	+	1	649	c.649G>T	c.(649-651)Ggt>Tgt	p.G217C	PCDHB11_ENST00000536699.1_Intron	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	217	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGCTCTGGATGGTGGGTCCCC	0.507																																																	0								ENSG00000197479						81.0	83.0	82.0					5																	140579996		2203	4300	6503	PCDHB11	SO:0001583	missense	0			-	HGNC	AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.649G>T	5.37:g.140579996G>T	ENSP00000346802:p.Gly217Cys	Somatic	0	162	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	88	38.46	B4DSF7|Q2M223	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.G217C	ENST00000354757.3	37	c.649	CCDS4253.1	5	.	.	.	.	.	.	.	.	.	.	G	16.58	3.163998	0.57476	.	.	ENSG00000197479	ENST00000354757	T	0.53206	0.63	2.7	1.78	0.24846	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.72716	0.3495	H	0.95004	3.61	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74219	-0.3736	9	0.87932	D	0	.	8.4334	0.32773	0.1279:0.0:0.8721:0.0	.	217	Q9Y5F2	PCDBB_HUMAN	C	217	ENSP00000346802:G217C	ENSP00000346802:G217C	G	+	1	0	PCDHB11	140560180	1.000000	0.71417	0.265000	0.24526	0.224000	0.24922	3.925000	0.56484	0.420000	0.25954	0.467000	0.42956	GGT	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.507	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB11	protein_coding	OTTHUMT00000251813.1	G	NM_018931	-		140579996	+1	no_errors	ENST00000354757	ensembl	human	known	74_37	missense	SNP	1.000	T
ENPP3	5169	genome.wustl.edu	37	6	131992466	131992466	+	Splice_Site	SNP	C	C	T			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr6:131992466C>T	ENST00000414305.1	+	8	969	c.641C>T	c.(640-642)aCg>aTg	p.T214M	ENPP3_ENST00000543135.1_Splice_Site_p.T180M|ENPP3_ENST00000427148.2_Splice_Site_p.T180M|ENPP3_ENST00000470930.1_3'UTR|ENPP3_ENST00000358229.5_Splice_Site_p.T214M|ENPP3_ENST00000357639.3_Splice_Site_p.T214M			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	214	Phosphodiesterase.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		ACCATTGTCACGGTAAGTGCT	0.433																																																	0								ENSG00000154269						199.0	170.0	180.0					6																	131992466		2203	4300	6503	ENPP3	SO:0001630	splice_region_variant	0			-	HGNC	AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.642+1C>T	6.37:g.131992466C>T		Somatic	0	43	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q5JTL3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom	p.T214M	ENST00000414305.1	37	c.641	CCDS5148.1	6	.	.	.	.	.	.	.	.	.	.	C	22.3	4.266327	0.80358	.	.	ENSG00000154269	ENST00000414305;ENST00000357639;ENST00000543135;ENST00000427148;ENST00000358229	D;D;D;D;D	0.92299	-3.01;-3.01;-3.01;-3.01;-3.01	5.52	5.52	0.82312	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.64402	D	0.000001	D	0.97810	0.9281	H	0.98218	4.175	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.98710	1.0704	10	0.72032	D	0.01	-13.6389	18.5765	0.91157	0.0:1.0:0.0:0.0	.	214	O14638	ENPP3_HUMAN	M	214;214;180;180;214	ENSP00000406261:T214M;ENSP00000350265:T214M;ENSP00000440810:T180M;ENSP00000399269:T180M;ENSP00000350964:T214M	ENSP00000350265:T214M	T	+	2	0	ENPP3	132034159	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	6.343000	0.72986	2.756000	0.94617	0.655000	0.94253	ACG	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core		0.433	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP3	protein_coding	OTTHUMT00000043627.2	C		-	Missense_Mutation	131992466	+1	no_errors	ENST00000357639	ensembl	human	known	74_37	missense	SNP	1.000	T
EVPLL	645027	genome.wustl.edu	37	17	18292454	18292454	+	3'UTR	SNP	C	C	G	rs199697056		TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr17:18292454C>G	ENST00000399134.4	+	0	1588				EVPLL_ENST00000583003.1_3'UTR|RP1-37N7.1_ENST00000579352.1_RNA	NM_001145127.1	NP_001138599.1	A8MZ36	EVPLL_HUMAN	envoplakin-like											NS(1)|endometrium(1)|large_intestine(1)|lung(2)	5						GCAGCTCCCACGCTGCCCCTA	0.587																																																	0								ENSG00000214860																																			EVPLL	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS45626.1	17p11.2	2009-08-25			ENSG00000214860	ENSG00000214860			35236	protein-coding gene	gene with protein product							Standard	NM_001145127		Approved		uc002gte.3	A8MZ36	OTTHUMG00000059095	ENST00000399134.4:c.*324C>G	17.37:g.18292454C>G		Somatic	0	13	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	13	31.58	B4DPD4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000399134.4	37	NULL	CCDS45626.1	17																																																																																			-	-		0.587	EVPLL-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	EVPLL	protein_coding	OTTHUMT00000130836.2	C	NM_001145127	rs199697056		18292454	+1	no_errors	ENST00000583003	ensembl	human	putative	74_37	rna	SNP	0.006	G
KRTAP4-16P	85354	genome.wustl.edu	37	17	39257945	39257950	+	In_Frame_Del	DEL	CGGGTG	CGGGTG	-	rs543735212|rs140048812	byFrequency	TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	CGGGTG	CGGGTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr17:39257945_39257950delCGGGTG	ENST00000440582.1	-	1	511_516	c.512_517delCACCCG	c.(511-519)ccacccgtt>ctt	p.171_173PPV>L						keratin associated protein 4-16, pseudogene											haematopoietic_and_lymphoid_tissue(1)|lung(1)	2						gggaggggaacgggtggggaagggaa	0.655																																																	0								ENSG00000241241																																			KRTAP4-16P	SO:0001651	inframe_deletion	0				HGNC	AC025904		17q21.2	2013-06-25	2010-01-06	2010-01-06	ENSG00000241241	ENSG00000241241		"""Keratin associated proteins"""	18921	pseudogene	pseudogene			"""keratin associated protein 4 pseudogene 1"""	KRTAP4P1			Standard	NG_005311		Approved	KAP4A			OTTHUMG00000133590	ENST00000440582.1:c.512_517delCACCCG	17.37:g.39257945_39257950delCGGGTG	ENSP00000411198:p.Pro171_Val173delinsLeu	Somatic	NA	NA	NA		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.PPV171in_frame_delL	ENST00000440582.1	37	c.517_512		17																																																																																			-	NULL		0.655	KRTAP4-16P-001	PUTATIVE	basic|appris_principal	protein_coding	KRTAP4-16P	protein_coding	OTTHUMT00000257694.1	CGGGTG	NG_005311			39257950	-1	no_errors	ENST00000440582	ensembl	human	putative	74_37	in_frame_del	DEL	0.000:0.000:0.001:0.001:0.002:0.010	-
AFM	173	genome.wustl.edu	37	4	74361050	74361050	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr4:74361050C>G	ENST00000226355.3	+	9	1185	c.1092C>G	c.(1090-1092)gaC>gaG	p.D364E		NM_001133.2	NP_001124.1	P43652	AFAM_HUMAN	afamin	364	Albumin 2. {ECO:0000255|PROSITE- ProRule:PRU00769}.				vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GACATCCAGACCTGTCTATAC	0.358																																																	0								ENSG00000079557						84.0	94.0	91.0					4																	74361050		2203	4300	6503	AFM	SO:0001583	missense	0			-	HGNC	L32140	CCDS3557.1	4q13.3	2008-06-11			ENSG00000079557	ENSG00000079557			316	protein-coding gene	gene with protein product		104145				7517938	Standard	NM_001133		Approved	ALB2, ALBA	uc003hhb.3	P43652	OTTHUMG00000130004	ENST00000226355.3:c.1092C>G	4.37:g.74361050C>G	ENSP00000226355:p.Asp364Glu	Somatic	0	114	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	71	70	50.35	A8K3E1|Q32MR3|Q4W5C5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Serum_albumin/AFP,pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,prints_ALB/AFP/VDB,prints_Alpha-fetoprotein	p.D364E	ENST00000226355.3	37	c.1092	CCDS3557.1	4	.	.	.	.	.	.	.	.	.	.	C	0.080	-1.186162	0.01620	.	.	ENSG00000079557	ENST00000226355	T	0.71817	-0.6	4.02	-5.93	0.02254	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.563068	0.18452	N	0.140812	T	0.28863	0.0716	N	0.03194	-0.395	0.24303	N	0.995111	B	0.09022	0.002	B	0.10450	0.005	T	0.45877	-0.9231	10	0.02654	T	1	.	0.9463	0.01366	0.2873:0.1597:0.3392:0.2138	.	364	P43652	AFAM_HUMAN	E	364	ENSP00000226355:D364E	ENSP00000226355:D364E	D	+	3	2	AFM	74579914	0.136000	0.22515	0.731000	0.30826	0.570000	0.35934	-0.397000	0.07269	-1.018000	0.03363	0.655000	0.94253	GAC	-	pirsf_Serum_albumin/AFP,pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N		0.358	AFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFM	protein_coding	OTTHUMT00000252275.2	C		-		74361050	+1	no_errors	ENST00000226355	ensembl	human	known	74_37	missense	SNP	0.728	G
GABBR2	9568	genome.wustl.edu	37	9	101258770	101258770	+	Silent	SNP	C	C	T			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr9:101258770C>T	ENST00000259455.2	-	4	1116	c.657G>A	c.(655-657)ctG>ctA	p.L219L	GABBR2_ENST00000477471.1_5'UTR	NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	219					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)		NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	CCTCGCCATACAGAACTCCAG	0.557																																																	0								ENSG00000136928						145.0	125.0	132.0					9																	101258770		2203	4300	6503	GABBR2	SO:0001819	synonymous_variant	0			-	HGNC	AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.657G>A	9.37:g.101258770C>T		Somatic	0	36	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3_GABA_rcpt_B2,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,prints_GPCR_3,pfscan_GPCR_3_C	p.L219	ENST00000259455.2	37	c.657	CCDS6736.1	9																																																																																			-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I		0.557	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR2	protein_coding	OTTHUMT00000053373.1	C		-		101258770	-1	no_errors	ENST00000259455	ensembl	human	known	74_37	silent	SNP	1.000	T
CAMKK1	84254	genome.wustl.edu	37	17	3788691	3788691	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr17:3788691G>T	ENST00000348335.2	-	2	439	c.291C>A	c.(289-291)agC>agA	p.S97R	CAMKK1_ENST00000381771.2_Missense_Mutation_p.S97R|CAMKK1_ENST00000381769.2_Missense_Mutation_p.S124R|CAMKK1_ENST00000158166.5_Missense_Mutation_p.S97R	NM_032294.2	NP_115670.1	Q8N5S9	KKCC1_HUMAN	calcium/calmodulin-dependent protein kinase kinase 1, alpha	97					synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	11				LUAD - Lung adenocarcinoma(2;2.11e-05)|Lung(3;0.0176)		GGGAGATGTGGCTGGCAGGCC	0.662																																																	0								ENSG00000004660						14.0	18.0	16.0					17																	3788691		2185	4266	6451	CAMKK1	SO:0001583	missense	0			-	HGNC	AL136576	CCDS11038.1, CCDS11039.1	17p13.3	2004-02-18			ENSG00000004660	ENSG00000004660			1469	protein-coding gene	gene with protein product		611411				11230166	Standard	NM_172207		Approved	DKFZp761M0423, CAMKKA, MGC34095	uc002fwt.3	Q8N5S9	OTTHUMG00000090725	ENST00000348335.2:c.291C>A	17.37:g.3788691G>T	ENSP00000323118:p.Ser97Arg	Somatic	0	185	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	97	19	83.62	Q9BQH3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S97R	ENST00000348335.2	37	c.291	CCDS11038.1	17	.	.	.	.	.	.	.	.	.	.	G	11.29	1.595091	0.28445	.	.	ENSG00000004660	ENST00000381769;ENST00000348335;ENST00000381771;ENST00000158166	T;T;T;T	0.74002	-0.45;-0.43;-0.8;-0.8	5.42	3.42	0.39159	.	0.333481	0.30930	N	0.008586	T	0.53481	0.1799	L	0.29908	0.895	0.43226	D	0.995117	B;B	0.33345	0.409;0.025	B;B	0.28553	0.091;0.025	T	0.39292	-0.9621	10	0.18276	T	0.48	-22.5228	4.7476	0.13045	0.1841:0.0:0.6446:0.1712	.	97;97	F8W9H1;Q8N5S9	.;KKCC1_HUMAN	R	124;97;97;97	ENSP00000371188:S124R;ENSP00000323118:S97R;ENSP00000371190:S97R;ENSP00000158166:S97R	ENSP00000158166:S97R	S	-	3	2	CAMKK1	3735440	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.457000	0.21875	0.657000	0.30906	0.491000	0.48974	AGC	-	NULL		0.662	CAMKK1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMKK1	protein_coding	OTTHUMT00000207456.1	G	NM_032294, NM_172206, NM_172207	-		3788691	-1	no_errors	ENST00000381771	ensembl	human	known	74_37	missense	SNP	1.000	T
OPLAH	26873	genome.wustl.edu	37	8	145110770	145110770	+	Silent	SNP	G	G	A			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr8:145110770G>A	ENST00000426825.1	-	16	2250	c.2169C>T	c.(2167-2169)gcC>gcT	p.A723A	OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	723					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CGGGGACTTCGGCCCCCACGG	0.647																																																	0								ENSG00000178814						29.0	32.0	31.0					8																	145110770		1972	4140	6112	OPLAH	SO:0001819	synonymous_variant	0			-	HGNC	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.2169C>T	8.37:g.145110770G>A		Somatic	0	115	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	68	44.26	A5PKY8|Q75W65|Q9Y4Q0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Hydantoinase_B,pfam_Hydantoinase_A,pfam_Hydant_A_N	p.A723	ENST00000426825.1	37	c.2169		8																																																																																			-	NULL		0.647	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	OPLAH	protein_coding		G	NM_017570	-		145110770	-1	no_errors	ENST00000426825	ensembl	human	known	74_37	silent	SNP	0.004	A
CHAMP1	283489	genome.wustl.edu	37	13	115090959	115090959	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr13:115090959C>G	ENST00000361283.1	+	3	1951	c.1642C>G	c.(1642-1644)Cgt>Ggt	p.R548G		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	548	Mediates localization to the spindle and the kinetochore and is required for the attachment of spindle microtubules to the kinetochore.|Pro-rich.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										AGCACGCAAACGTGCCCTTTT	0.527																																																	0								ENSG00000198824						205.0	233.0	223.0					13																	115090959		2203	4300	6503	CHAMP1	SO:0001583	missense	0			-	HGNC	AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.1642C>G	13.37:g.115090959C>G	ENSP00000354730:p.Arg548Gly	Somatic	0	63	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	50	21.88	B3KU06|Q6P181|Q8NC88|Q9BST0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R548G	ENST00000361283.1	37	c.1642	CCDS9545.1	13	.	.	.	.	.	.	.	.	.	.	C	16.12	3.034503	0.54896	.	.	ENSG00000198824	ENST00000361283	T	0.01406	4.93	5.59	4.74	0.60224	.	0.115558	0.40222	N	0.001146	T	0.03477	0.0100	L	0.54323	1.7	0.34360	D	0.69083	P	0.51933	0.949	P	0.50896	0.653	T	0.49184	-0.8966	9	.	.	.	-13.3081	13.1983	0.59752	0.0:0.9248:0.0:0.0752	.	548	Q96JM3	ZN828_HUMAN	G	548	ENSP00000354730:R548G	.	R	+	1	0	ZNF828	114109061	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	3.099000	0.50267	2.631000	0.89168	0.650000	0.86243	CGT	-	NULL		0.527	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAMP1	protein_coding	OTTHUMT00000045977.2	C	NM_032436	-		115090959	+1	no_errors	ENST00000361283	ensembl	human	known	74_37	missense	SNP	0.995	G
GCLC	2729	genome.wustl.edu	37	6	53409419	53409419	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr6:53409419G>C	ENST00000229416.6	-	1	508	c.25C>G	c.(25-27)Ccg>Gcg	p.P9A	GCLC_ENST00000514004.1_Missense_Mutation_p.P9A	NM_001197115.1|NM_001498.3	NP_001184044.1|NP_001489.1	P48506	GSH1_HUMAN	glutamate-cysteine ligase, catalytic subunit	9					apoptotic mitochondrial changes (GO:0008637)|cell redox homeostasis (GO:0045454)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to arsenic-containing substance (GO:0046685)|response to heat (GO:0009408)|response to hormone (GO:0009725)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|coenzyme binding (GO:0050662)|glutamate binding (GO:0016595)|glutamate-cysteine ligase activity (GO:0004357)|magnesium ion binding (GO:0000287)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22	Lung NSC(77;0.0137)				L-Cysteine(DB00151)|Vitamin E(DB00163)	CAGCTCAGCGGCGAGCCCTGG	0.706																																																	0								ENSG00000001084						51.0	42.0	45.0					6																	53409419		2203	4299	6502	GCLC	SO:0001583	missense	0			-	HGNC	M90656	CCDS4952.1, CCDS75471.1	6p12	2008-02-05				ENSG00000001084	6.3.2.2		4311	protein-coding gene	gene with protein product		606857		GLCLC, GLCL		1350904	Standard	NM_001498		Approved	GCS	uc003pbw.2	P48506		ENST00000229416.6:c.25C>G	6.37:g.53409419G>C	ENSP00000229416:p.Pro9Ala	Somatic	0	114	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	66	38.89	Q14399	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GCS	p.P9A	ENST00000229416.6	37	c.25	CCDS4952.1	6	.	.	.	.	.	.	.	.	.	.	G	27.3	4.819802	0.90873	.	.	ENSG00000001084	ENST00000229416;ENST00000514004	T;T	0.75154	-0.91;-0.91	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.84356	0.5454	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.85197	0.1013	10	0.48119	T	0.1	.	17.6062	0.88039	0.0:0.0:1.0:0.0	.	9	P48506	GSH1_HUMAN	A	9	ENSP00000229416:P9A;ENSP00000421908:P9A	ENSP00000229416:P9A	P	-	1	0	GCLC	53517378	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.959000	0.93110	2.300000	0.77407	0.467000	0.42956	CCG	-	NULL		0.706	GCLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCLC	protein_coding	OTTHUMT00000359710.2	G		-		53409419	-1	no_errors	ENST00000229416	ensembl	human	known	74_37	missense	SNP	1.000	C
ATP6V1A	523	genome.wustl.edu	37	3	113505230	113505230	+	Splice_Site	SNP	C	C	T			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr3:113505230C>T	ENST00000273398.3	+	6	824	c.716C>T	c.(715-717)cCg>cTg	p.P239L	ATP6V1A_ENST00000538620.1_Splice_Site_p.P206L	NM_001690.3	NP_001681.2	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A	239					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	ATP binding (GO:0005524)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Alendronate(DB00630)|Etidronic acid(DB01077)|Tiludronate(DB01133)	GCCCTTTTTCCGTAAGTTTGA	0.418																																																	0								ENSG00000114573						214.0	198.0	203.0					3																	113505230		2203	4300	6503	ATP6V1A	SO:0001630	splice_region_variant	0			-	HGNC	L09235	CCDS2976.1	3q13.31	2010-04-21	2002-08-29	2003-04-25	ENSG00000114573	ENSG00000114573	3.6.3.14	"""ATPases / V-type"""	851	protein-coding gene	gene with protein product		607027	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), alpha polypeptide, 70kD, isoform 1"""	VPP2, ATP6A1, ATP6V1A1		8463241	Standard	NM_001690		Approved	Vma1, VA68	uc003eao.3	P38606	OTTHUMG00000159295	ENST00000273398.3:c.716+1C>T	3.37:g.113505230C>T		Somatic	0	240	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	124	176	41.06	B2RBR8|B7Z1R5|D3DN75|Q53YD9|Q96DY6|Q9UHY3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,pfam_ATPase_F1/V1/A1-cplx_a/bsu_C,pfam_ATPase_F1_a/bsu_N,superfamily_P-loop_NTPase,superfamily_ATPase_F1/V1/A1-cplx_a/bsu_C,superfamily_ATPase_F1_a/bsu_N,tigrfam_ATPase_V1-cplx_asu	p.P239L	ENST00000273398.3	37	c.716	CCDS2976.1	3	.	.	.	.	.	.	.	.	.	.	C	32	5.185225	0.94885	.	.	ENSG00000114573	ENST00000273398;ENST00000538620	D;D	0.87491	-2.26;-2.26	5.33	5.33	0.75918	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);	0.047084	0.85682	N	0.000000	D	0.96237	0.8773	H	0.97340	3.985	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97680	1.0172	10	0.87932	D	0	-2.618	18.9993	0.92826	0.0:1.0:0.0:0.0	.	239	P38606	VATA_HUMAN	L	239;206	ENSP00000273398:P239L;ENSP00000439874:P206L	ENSP00000273398:P239L	P	+	2	0	ATP6V1A	114987920	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.280000	0.78610	2.499000	0.84300	0.591000	0.81541	CCG	-	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,superfamily_P-loop_NTPase,tigrfam_ATPase_V1-cplx_asu		0.418	ATP6V1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1A	protein_coding	OTTHUMT00000354457.1	C	NM_001690	-	Missense_Mutation	113505230	+1	no_errors	ENST00000273398	ensembl	human	known	74_37	missense	SNP	1.000	T
KIAA1549	57670	genome.wustl.edu	37	7	138602177	138602177	+	Missense_Mutation	SNP	G	G	A	rs375118283		TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr7:138602177G>A	ENST00000422774.1	-	2	2243	c.2195C>T	c.(2194-2196)gCg>gTg	p.A732V	KIAA1549_ENST00000242365.4_Missense_Mutation_p.A682V|KIAA1549_ENST00000440172.1_Missense_Mutation_p.A732V			Q9HCM3	K1549_HUMAN	KIAA1549	732	Ser-rich.					integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						AACCGTAGACGCTTCAACAAA	0.458			O	BRAF	pilocytic astrocytoma								G|||	1	0.000199681	0.0008	0.0	5008	,	,		22456	0.0		0.0	False		,,,				2504	0.0				NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	0								ENSG00000122778	G	VAL/ALA,VAL/ALA	3,3909		0,3,1953	66.0	63.0	64.0		2195,2195	2.4	0.0	7		64	0,8312		0,0,4156	no	missense,missense	KIAA1549	NM_001164665.1,NM_020910.2	64,64	0,3,6109	AA,AG,GG		0.0,0.0767,0.0245	benign,benign	732/1951,732/1935	138602177	3,12221	1956	4156	6112	KIAA1549	SO:0001583	missense	0			-	HGNC		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.2195C>T	7.37:g.138602177G>A	ENSP00000416040:p.Ala732Val	Somatic	0	75	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	57	39.36	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A732V	ENST00000422774.1	37	c.2195	CCDS56513.1	7	.	.	.	.	.	.	.	.	.	.	G	10.93	1.490435	0.26686	7.67E-4	0.0	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.26067	1.76;1.76;1.76	4.25	2.4	0.29515	.	0.492284	0.18841	N	0.129663	T	0.12390	0.0301	N	0.24115	0.695	0.09310	N	1	P;P	0.39624	0.553;0.681	B;B	0.29440	0.047;0.102	T	0.14309	-1.0477	10	0.32370	T	0.25	.	7.9343	0.29920	0.1938:0.0:0.8062:0.0	.	732;732	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	V	732;682;732	ENSP00000406661:A732V;ENSP00000242365:A682V;ENSP00000416040:A732V	ENSP00000242365:A682V	A	-	2	0	KIAA1549	138252717	0.554000	0.26522	0.002000	0.10522	0.009000	0.06853	1.103000	0.31062	0.426000	0.26116	0.591000	0.81541	GCG	-	NULL		0.458	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1549	protein_coding	OTTHUMT00000348092.1	G		-		138602177	-1	no_errors	ENST00000422774	ensembl	human	known	74_37	missense	SNP	0.116	A
POM121L1P	25812	genome.wustl.edu	37	22	22985468	22985468	+	RNA	SNP	T	T	C			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr22:22985468T>C	ENST00000402027.1	-	0	1476					NR_024591.1		Q3SYA9	P12L1_HUMAN	POM121 transmembrane nucleoporin-like 1, pseudogene																		GCCTTGTTCTTCTCATGCCCG	0.627																																																	0								ENSG00000183169																																			POM121L1P			0			-	HGNC			22q11.22	2013-10-11	2012-03-13	2009-01-15	ENSG00000183169	ENSG00000183169			16439	pseudogene	pseudogene	"""POM121-like 2"""		"""POM121 membrane glycoprotein-like 1 (rat)"", ""POM121 membrane glycoprotein-like 1, pseudogene"""	POM121L1		9074928	Standard	NR_024591		Approved		uc011ait.1	Q3SYA9	OTTHUMG00000151169		22.37:g.22985468T>C		Somatic	0	370	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	148	238	38.24		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000402027.1	37	NULL		22																																																																																			-	-		0.627	POM121L1P-002	KNOWN	basic|exp_conf	processed_transcript	POM121L1P	pseudogene	OTTHUMT00000468457.1	T	NR_024591	-		22985468	-1	no_errors	ENST00000402027	ensembl	human	known	74_37	rna	SNP	0.717	C
MTPAP	55149	genome.wustl.edu	37	10	30653860	30653860	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr10:30653860C>T	ENST00000358107.4	-	2	321	c.322G>A	c.(322-324)Ggt>Agt	p.G108S	AL161651.1_ENST00000408070.1_RNA|RN7SL241P_ENST00000482973.2_RNA|MTPAP_ENST00000488290.1_5'UTR			Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase	0					cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						cccaccccacccccaccccca	0.642																																																	0								ENSG00000107951																																			MTPAP	SO:0001583	missense	0			-	HGNC	AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000358107.4:c.322G>A	10.37:g.30653860C>T	ENSP00000350820:p.Gly108Ser	Somatic	0	176	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	165	24.66	D3DRX0|Q659E3|Q6P7E5|Q9HA74	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PAP_assoc	p.G108S	ENST00000358107.4	37	c.322		10	.	.	.	.	.	.	.	.	.	.	.	4.817	0.151974	0.09185	.	.	ENSG00000107951	ENST00000358107	T	0.17691	2.26	0.436	-0.871	0.10642	.	.	.	.	.	T	0.10380	0.0254	.	.	.	0.09310	N	1	B	0.31548	0.328	B	0.20384	0.029	T	0.12941	-1.0528	8	0.87932	D	0	.	3.6364	0.08150	0.0:0.5021:0.2552:0.2427	.	108	Q9NVV4-2	.	S	108	ENSP00000350820:G108S	ENSP00000350820:G108S	G	-	1	0	MTPAP	30693866	0.000000	0.05858	0.004000	0.12327	0.007000	0.05969	-1.365000	0.02587	-1.825000	0.01207	-1.087000	0.02190	GGT	-	NULL		0.642	MTPAP-201	KNOWN	basic	protein_coding	MTPAP	protein_coding		C	NM_018109	-		30653860	-1	no_errors	ENST00000358107	ensembl	human	known	74_37	missense	SNP	0.001	T
PPAT	5471	genome.wustl.edu	37	4	57301629	57301629	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr4:57301629C>A	ENST00000264220.2	-	1	152	c.15G>T	c.(13-15)gaG>gaT	p.E5D	PAICS_ENST00000264221.2_5'Flank|PAICS_ENST00000512576.1_5'Flank|PAICS_ENST00000399688.3_5'Flank|PAICS_ENST00000514888.1_5'Flank	NM_002703.4	NP_002694.3	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	5					'de novo' IMP biosynthetic process (GO:0006189)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|G1/S transition of mitotic cell cycle (GO:0000082)|glutamine catabolic process (GO:0006543)|kidney development (GO:0001822)|lactation (GO:0007595)|maternal process involved in female pregnancy (GO:0060135)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|protein homotetramerization (GO:0051289)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|amidophosphoribosyltransferase activity (GO:0004044)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	20	Glioma(25;0.08)|all_neural(26;0.101)				Fluorouracil(DB00544)|L-Glutamine(DB00130)|Mercaptopurine(DB01033)	GGATCCCCAACTCCTCCAGCT	0.637																																																	0								ENSG00000128059						99.0	90.0	93.0					4																	57301629		2203	4300	6503	PPAT	SO:0001583	missense	0			-	HGNC		CCDS3505.1	4q12	2012-10-02			ENSG00000128059	ENSG00000128059	2.4.2.14		9238	protein-coding gene	gene with protein product		172450					Standard	NM_002703		Approved	GPAT, PRAT	uc003hbr.3	Q06203	OTTHUMG00000128842	ENST00000264220.2:c.15G>T	4.37:g.57301629C>A	ENSP00000264220:p.Glu5Asp	Somatic	0	93	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	51	40.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GATase_dom,pfam_PRibTrfase_dom,pirsf_Amd_phspho_trans,tigrfam_Amd_phspho_trans	p.E5D	ENST00000264220.2	37	c.15	CCDS3505.1	4	.	.	.	.	.	.	.	.	.	.	C	14.52	2.558455	0.45590	.	.	ENSG00000128059	ENST00000264220	T	0.64085	-0.08	5.14	2.3	0.28687	.	0.050821	0.85682	D	0.000000	T	0.34106	0.0886	N	0.04203	-0.255	0.48975	D	0.999732	B	0.16802	0.019	B	0.10450	0.005	T	0.06463	-1.0825	10	0.14656	T	0.56	-20.4406	10.1894	0.43017	0.0:0.7694:0.0:0.2306	.	5	Q06203	PUR1_HUMAN	D	5	ENSP00000264220:E5D	ENSP00000264220:E5D	E	-	3	2	PPAT	56996386	0.990000	0.36364	0.958000	0.39756	0.407000	0.30961	1.633000	0.37113	0.682000	0.31407	-0.367000	0.07326	GAG	-	pirsf_Amd_phspho_trans		0.637	PPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAT	protein_coding	OTTHUMT00000250781.2	C	NM_002703	-		57301629	-1	no_errors	ENST00000264220	ensembl	human	known	74_37	missense	SNP	0.997	A
ENTPD1	953	genome.wustl.edu	37	10	97515949	97515949	+	5'UTR	DEL	G	G	-	rs200451742	byFrequency	TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr10:97515949delG	ENST00000371205.4	+	0	236				ENTPD1_ENST00000371203.5_5'UTR|ENTPD1_ENST00000371207.3_Intron|ENTPD1_ENST00000539125.1_5'UTR|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1_ENST00000453258.2_Intron|ENTPD1_ENST00000543964.1_Intron			P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1						ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|skin(1)	16		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		AGCAGAGGCTGGGGGGGGGAA	0.493																																																	0								ENSG00000226688						25.0	29.0	27.0					10																	97515949		2203	4300	6503	ENTPD1-AS1	SO:0001623	5_prime_UTR_variant	0				HGNC	S73813	CCDS7444.1, CCDS53556.1, CCDS53557.1, CCDS53558.1, CCDS41554.1	10q24.1	2014-03-03			ENSG00000138185	ENSG00000138185		"""CD molecules"""	3363	protein-coding gene	gene with protein product		601752		CD39		9226376, 24482476	Standard	NM_001098175		Approved	NTPDase-1, ATPDase, SPG64	uc010qoj.2	P49961	OTTHUMG00000018818	ENST00000371205.4:c.-48G>-	10.37:g.97515949delG		Somatic	0	74	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	68	9.33	A9Z1X8|B4DWB9|B4E1X1|B7Z599|G3XAF6|Q5T561|Q5T562|Q86VV3|Q9UQQ9|Q9Y3Q9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371205.4	37	NULL	CCDS7444.1	10																																																																																			-	-		0.493	ENTPD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD1-AS1	protein_coding	OTTHUMT00000049566.1	G	NM_001776			97515949	-1	no_errors	ENST00000416301	ensembl	human	known	74_37	rna	DEL	0.906	-
PTCHD2	57540	genome.wustl.edu	37	1	11596444	11596444	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr1:11596444G>A	ENST00000294484.6	+	21	4018	c.3880G>A	c.(3880-3882)Gtc>Atc	p.V1294I	PTCHD2_ENST00000304391.6_Missense_Mutation_p.R180H|PTCHD2_ENST00000389575.3_Missense_Mutation_p.V1294I	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1294					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CGTGGCCATCGTCTCCAGTGC	0.657																																																	0								ENSG00000204624						89.0	94.0	92.0					1																	11596444		2200	4279	6479	PTCHD2	SO:0001583	missense	0			-	HGNC	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.3880G>A	1.37:g.11596444G>A	ENSP00000294484:p.Val1294Ile	Somatic	0	175	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	89	11	89.00	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Patched,pfam_MMPL_dom,pfscan_SSD	p.V1294I	ENST00000294484.6	37	c.3880	CCDS41247.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.5|21.5	4.154759|4.154759	0.78114|0.78114	.|.	.|.	ENSG00000204624|ENSG00000204624	ENST00000304391|ENST00000294484;ENST00000389575	.|D;D	.|0.91407	.|-2.84;-2.84	4.89|4.89	4.89|4.89	0.63831|0.63831	.|Membrane transport protein, MMPL type (1);	.|0.000000	.|0.64402	.|D	.|0.000005	D|D	0.87281|0.87281	0.6138|0.6138	N|N	0.13235|0.13235	0.315|0.315	0.54753|0.54753	D|D	0.999986|0.999986	.|D	.|0.54207	.|0.965	.|P	.|0.51974	.|0.686	D|D	0.86116|0.86116	0.1565|0.1565	6|10	0.87932|0.23891	D|T	0|0.37	-49.9588|-49.9588	17.0791|17.0791	0.86593|0.86593	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1294	.|Q9P2K9	.|PTHD2_HUMAN	H|I	180|1294	.|ENSP00000294484:V1294I;ENSP00000374226:V1294I	ENSP00000303400:R180H|ENSP00000294484:V1294I	R|V	+|+	2|1	0|0	PTCHD2|PTCHD2	11519031|11519031	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	6.263000|6.263000	0.72521|0.72521	2.256000|2.256000	0.74724|0.74724	0.655000|0.655000	0.94253|0.94253	CGT|GTC	-	pfam_Patched,pfam_MMPL_dom		0.657	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	protein_coding	OTTHUMT00000005770.2	G	XM_052561	-		11596444	+1	no_errors	ENST00000294484	ensembl	human	known	74_37	missense	SNP	1.000	A
CACNA1S	779	genome.wustl.edu	37	1	201038658	201038658	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr1:201038658A>C	ENST00000362061.3	-	18	2658	c.2432T>G	c.(2431-2433)cTc>cGc	p.L811R	CACNA1S_ENST00000367338.3_Missense_Mutation_p.L811R	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	811					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGCGCTGCTgagcaggatgaa	0.617																																																	0								ENSG00000081248						61.0	49.0	53.0					1																	201038658		2201	4299	6500	CACNA1S	SO:0001583	missense	0			-	HGNC	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.2432T>G	1.37:g.201038658A>C	ENSP00000355192:p.Leu811Arg	Somatic	0	85	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	89	11.00	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_VDCC_L_a1ssu	p.L811R	ENST00000362061.3	37	c.2432	CCDS1407.1	1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.202515	0.79127	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.97888	-4.59;-4.59	3.91	3.91	0.45181	.	0.000000	0.85682	D	0.000000	D	0.98811	0.9599	H	0.94345	3.525	0.58432	D	0.999992	D	0.58620	0.983	P	0.61592	0.891	D	0.99486	1.0949	10	0.87932	D	0	.	13.0387	0.58887	1.0:0.0:0.0:0.0	.	811	Q13698	CAC1S_HUMAN	R	811	ENSP00000355192:L811R;ENSP00000356307:L811R	ENSP00000355192:L811R	L	-	2	0	CACNA1S	199305281	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	9.104000	0.94239	1.549000	0.49425	0.448000	0.29417	CTC	-	NULL		0.617	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1S	protein_coding	OTTHUMT00000087049.1	A	NM_000069	-		201038658	-1	no_errors	ENST00000362061	ensembl	human	known	74_37	missense	SNP	1.000	C
TPTE	7179	genome.wustl.edu	37	21	10951356	10951356	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr21:10951356T>G	ENST00000361285.4	-	10	685	c.356A>C	c.(355-357)aAa>aCa	p.K119T	TPTE_ENST00000342420.5_Missense_Mutation_p.K81T|TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Missense_Mutation_p.K101T	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	119					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AATATAAAGTTTGCTGTCAGT	0.323																																																	0								ENSG00000166157						110.0	118.0	116.0					21																	10951356		2203	4297	6500	TPTE	SO:0001583	missense	0			-	HGNC	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.356A>C	21.37:g.10951356T>G	ENSP00000355208:p.Lys119Thr	Somatic	1	717	0.14		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	108	957	10.12	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Ion_trans_dom,superfamily_C2_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.K119T	ENST00000361285.4	37	c.356	CCDS13560.2	21	.	.	.	.	.	.	.	.	.	.	.	1.268	-0.613816	0.03690	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420;ENST00000328758	D;D;D	0.97404	-4.37;-4.37;-4.37	1.8	-3.6	0.04570	.	0.528264	0.20609	N	0.089019	D	0.89736	0.6801	N	0.16903	0.455	0.09310	N	1	B;B;B	0.19445	0.035;0.035;0.036	B;B;B	0.23574	0.047;0.047;0.021	T	0.80195	-0.1483	10	0.29301	T	0.29	0.008	4.7888	0.13238	0.0:0.1732:0.2583:0.5685	.	81;101;119	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	T	101;119;81;101	ENSP00000298232:K101T;ENSP00000355208:K119T;ENSP00000344441:K81T	ENSP00000298232:K101T	K	-	2	0	TPTE	9973227	0.000000	0.05858	0.000000	0.03702	0.096000	0.18686	-0.215000	0.09279	-1.486000	0.01851	0.163000	0.16589	AAA	-	NULL		0.323	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPTE	protein_coding	OTTHUMT00000157413.1	T		-		10951356	-1	no_errors	ENST00000361285	ensembl	human	known	74_37	missense	SNP	0.000	G
OBSCN	84033	genome.wustl.edu	37	1	228521396	228521396	+	Silent	SNP	C	C	T			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr1:228521396C>T	ENST00000422127.1	+	59	16013	c.15969C>T	c.(15967-15969)gtC>gtT	p.V5323V	OBSCN_ENST00000366707.4_Silent_p.V2957V|OBSCN_ENST00000284548.11_Silent_p.V5323V|OBSCN_ENST00000366709.4_Silent_p.V2442V|OBSCN_ENST00000570156.2_Silent_p.V6280V	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5323	Ig-like 50.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TCATCTCCGTCACCCGGGAGG	0.582																																																	0								ENSG00000154358						47.0	54.0	51.0					1																	228521396		2084	4232	6316	OBSCN	SO:0001819	synonymous_variant	0			-	HGNC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.15969C>T	1.37:g.228521396C>T		Somatic	0	136	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	74	41.73	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.V5323	ENST00000422127.1	37	c.15969	CCDS58065.1	1																																																																																			-	pfam_Ig_I-set,smart_Ig_sub2,smart_Ig_sub,pfscan_Ig-like_dom		0.582	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	protein_coding		C	NM_052843	-		228521396	+1	no_errors	ENST00000422127	ensembl	human	known	74_37	silent	SNP	0.827	T
COL12A1	1303	genome.wustl.edu	37	6	75848600	75848600	+	Missense_Mutation	SNP	C	C	T	rs550455854	byFrequency	TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr6:75848600C>T	ENST00000322507.8	-	28	5344	c.5035G>A	c.(5035-5037)Gct>Act	p.A1679T	COL12A1_ENST00000483888.2_Missense_Mutation_p.A1679T|COL12A1_ENST00000345356.6_Missense_Mutation_p.A515T|COL12A1_ENST00000416123.2_Missense_Mutation_p.A1679T	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1679	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						ACATCTGAAGCTCCATGATCC	0.438													C|||	2	0.000399361	0.0008	0.0	5008	,	,		17186	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000111799						123.0	121.0	121.0					6																	75848600		1857	4098	5955	COL12A1	SO:0001583	missense	0			-	HGNC	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.5035G>A	6.37:g.75848600C>T	ENSP00000325146:p.Ala1679Thr	Somatic	0	46	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	51	13.56	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.A1679T	ENST00000322507.8	37	c.5035	CCDS43482.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.9|21.9	4.211289|4.211289	0.79240|0.79240	.|.	.|.	ENSG00000111799|ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888|ENST00000419671	T;T;T;T|.	0.53423|.	0.62;0.62;0.62;0.62|.	5.95|5.95	5.95|5.95	0.96441|0.96441	Fibronectin, type III (4);Immunoglobulin-like fold (1);|.	0.120747|.	0.64402|.	D|.	0.000020|.	T|T	0.66616|0.66616	0.2807|0.2807	L|L	0.55481|0.55481	1.735|1.735	0.80722|0.80722	D|D	1|1	D;D|.	0.71674|.	0.984;0.998|.	P;D|.	0.70016|.	0.862;0.967|.	T|T	0.60870|0.60870	-0.7177|-0.7177	10|5	0.66056|.	D|.	0.02|.	.|.	20.4024|20.4024	0.99000|0.99000	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	515;1679|.	Q99715-2;Q99715|.	.;COCA1_HUMAN|.	T|N	1679;1679;515;1679;1679|420	ENSP00000325146:A1679T;ENSP00000305147:A515T;ENSP00000412864:A1679T;ENSP00000421216:A1679T|.	ENSP00000325146:A1679T|.	A|S	-|-	1|2	0|0	COL12A1|COL12A1	75905320|75905320	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.129000|0.129000	0.20672|0.20672	7.294000|7.294000	0.78760|0.78760	2.827000|2.827000	0.97445|0.97445	0.650000|0.650000	0.86243|0.86243	GCT|AGC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.438	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	protein_coding	OTTHUMT00000041249.3	C	NM_004370	-		75848600	-1	no_errors	ENST00000322507	ensembl	human	known	74_37	missense	SNP	1.000	T
ZBTB42	100128927	genome.wustl.edu	37	14	105268140	105268140	+	Missense_Mutation	SNP	C	C	G	rs537042606		TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr14:105268140C>G	ENST00000342537.7	+	1	891	c.606C>G	c.(604-606)caC>caG	p.H202Q	ZBTB42_ENST00000555360.1_Missense_Mutation_p.H202Q	NM_001137601.1	NP_001131073.1	B2RXF5	ZBT42_HUMAN	zinc finger and BTB domain containing 42	202	Pro-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										AGCGGGTCCACCCACCGTGCG	0.657																																																	0								ENSG00000179627						24.0	31.0	29.0					14																	105268140		692	1587	2279	ZBTB42	SO:0001583	missense	0			-	HGNC	AX721091	CCDS45174.1	14q32.33	2013-01-09				ENSG00000179627		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	32550	protein-coding gene	gene with protein product		613915					Standard	NM_001137601		Approved	ZNF925	uc001ypp.3	B2RXF5		ENST00000342537.7:c.606C>G	14.37:g.105268140C>G	ENSP00000409107:p.His202Gln	Somatic	0	74	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	31	53.03	B7ZW21	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.H202Q	ENST00000342537.7	37	c.606	CCDS45174.1	14	.	.	.	.	.	.	.	.	.	.	C	5.830	0.337433	0.11013	.	.	ENSG00000179627	ENST00000555360;ENST00000342537	T;T	0.12569	2.67;2.67	3.53	0.348	0.16026	.	.	.	.	.	T	0.07593	0.0191	N	0.19112	0.55	0.29420	N	0.860593	B	0.09022	0.002	B	0.08055	0.003	T	0.42949	-0.9421	9	0.13108	T	0.6	.	8.9311	0.35670	0.0:0.4928:0.4222:0.085	.	202	B2RXF5	ZBT42_HUMAN	Q	202	ENSP00000450673:H202Q;ENSP00000409107:H202Q	ENSP00000409107:H202Q	H	+	3	2	ZBTB42	104339185	0.981000	0.34729	0.021000	0.16686	0.647000	0.38526	0.381000	0.20619	-0.131000	0.11578	0.462000	0.41574	CAC	-	NULL		0.657	ZBTB42-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZBTB42	protein_coding	OTTHUMT00000410372.1	C		-		105268140	+1	no_errors	ENST00000342537	ensembl	human	known	74_37	missense	SNP	0.999	G
ANKRD20A1	84210	genome.wustl.edu	37	9	67968798	67968798	+	Missense_Mutation	SNP	T	T	C	rs201758821		TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr9:67968798T>C	ENST00000377477.2	+	15	2469	c.2357T>C	c.(2356-2358)aTg>aCg	p.M786T	RP11-195B21.3_ENST00000417488.1_5'UTR	NM_032250.3	NP_115626.2	Q5TYW2	A20A1_HUMAN	ankyrin repeat domain 20 family, member A1	786						plasma membrane (GO:0005886)				kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	11						AAGAAGCTAATGAATGAATGT	0.328																																																	0								ENSG00000196774						1.0	1.0	1.0					9																	67968798		4	15	19	ANKRD20A1	SO:0001583	missense	0			-	HGNC	AL136793	CCDS6620.1	9p12	2014-04-16	2005-08-23	2005-08-23	ENSG00000196774	ENSG00000260691		"""Ankyrin repeat domain containing"""	23665	protein-coding gene	gene with protein product			"""ankyrin repeat domain 20A"""	ANKRD20A			Standard	NM_032250		Approved	DKFZp434A171		Q5TYW2	OTTHUMG00000188594	ENST00000377477.2:c.2357T>C	9.37:g.67968798T>C	ENSP00000366697:p.Met786Thr	Somatic	0	9	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	4	60.00	Q9H0H6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.M786T	ENST00000377477.2	37	c.2357	CCDS6620.1	9	.	.	.	.	.	.	.	.	.	.	.	0.042	-1.279168	0.01410	.	.	ENSG00000196774	ENST00000377477	T	0.13778	2.56	1.88	0.641	0.17759	.	.	.	.	.	T	0.10680	0.0261	L	0.40543	1.245	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.30268	-0.9984	9	0.72032	D	0.01	.	4.9653	0.14087	0.0:0.1793:0.0:0.8207	.	786	Q5TYW2	A20A1_HUMAN	T	786	ENSP00000366697:M786T	ENSP00000366697:M786T	M	+	2	0	ANKRD20A1	67558618	0.201000	0.23410	0.001000	0.08648	0.004000	0.04260	0.935000	0.28924	0.037000	0.15575	0.092000	0.15492	ATG	-	NULL		0.328	ANKRD20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD20A1	protein_coding	OTTHUMT00000083800.1	T		rs201758821		67968798	+1	no_errors	ENST00000377477	ensembl	human	known	74_37	missense	SNP	0.157	C
MAGEB2	4113	genome.wustl.edu	37	X	30236779	30236779	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chrX:30236779C>T	ENST00000378988.4	+	2	183	c.82C>T	c.(82-84)Cct>Tct	p.P28S		NM_002364.4	NP_002355.2	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	28										breast(1)|large_intestine(3)|lung(17)|ovary(1)|skin(1)	23						TCTCAATGTTCCTCAGGTCAC	0.582																																																	0								ENSG00000099399						38.0	36.0	37.0					X																	30236779		2202	4300	6502	MAGEB2	SO:0001583	missense	0			-	HGNC	AF015766	CCDS14219.1	Xp21.3	2009-03-17			ENSG00000099399	ENSG00000099399			6809	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 6"", ""melanoma-associated antigen B2"", ""cancer/testis antigen family 3, member 2"""	300098				9441743	Standard	NM_002364		Approved	DAM6, MAGE-XP-2, MGC26438, CT3.2	uc004dbz.3	O15479	OTTHUMG00000021319	ENST00000378988.4:c.82C>T	X.37:g.30236779C>T	ENSP00000368273:p.Pro28Ser	Somatic	0	72	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	82	8	90.11	O75860	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.P28S	ENST00000378988.4	37	c.82	CCDS14219.1	X	.	.	.	.	.	.	.	.	.	.	C	9.261	1.043323	0.19748	.	.	ENSG00000099399	ENST00000378988	T	0.03951	3.75	3.43	1.6	0.23607	Melanoma associated antigen, MAGE, N-terminal (1);	0.610551	0.15506	N	0.258780	T	0.03390	0.0098	N	0.24115	0.695	0.09310	N	1	B	0.28350	0.208	B	0.30251	0.113	T	0.41448	-0.9508	10	0.52906	T	0.07	.	3.7237	0.08466	0.1583:0.2743:0.5674:0.0	.	28	O15479	MAGB2_HUMAN	S	28	ENSP00000368273:P28S	ENSP00000368273:P28S	P	+	1	0	MAGEB2	30146700	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	0.395000	0.20850	0.297000	0.22615	-0.384000	0.06662	CCT	-	pfam_Melanoma_ass_antigen_N		0.582	MAGEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB2	protein_coding	OTTHUMT00000056157.1	C	NM_002364	-		30236779	+1	no_errors	ENST00000378988	ensembl	human	known	74_37	missense	SNP	0.003	T
SEC22B	9554	genome.wustl.edu	37	1	145116561	145116561	+	RNA	SNP	T	T	C			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr1:145116561T>C	ENST00000453618.1	+	0	1647							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											TGCCTTGAAATTATAGCACTC	0.303																																																	0								ENSG00000223380																																			SEC22B			0			-	HGNC	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145116561T>C		Somatic	0	399	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	339	10.79	A8K1G0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000453618.1	37	NULL		1																																																																																			-	-		0.303	SEC22B-001	KNOWN	basic	processed_transcript	SEC22B	processed_transcript	OTTHUMT00000038523.5	T	NM_004892	-		145116561	+1	no_errors	ENST00000453618	ensembl	human	known	74_37	rna	SNP	1.000	C
ASTN2	23245	genome.wustl.edu	37	9	119976716	119976716	+	Silent	SNP	G	G	A			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr9:119976716G>A	ENST00000313400.4	-	3	1036	c.936C>T	c.(934-936)gaC>gaT	p.D312D	ASTN2_ENST00000361209.2_Silent_p.D312D|ASTN2_ENST00000361477.3_De_novo_Start_OutOfFrame|ASTN2_ENST00000373996.3_Silent_p.D312D			O75129	ASTN2_HUMAN	astrotactin 2	312					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						TGCCAAACTCGTCCTCGCGGG	0.582																																																	0								ENSG00000148219						87.0	87.0	87.0					9																	119976716		2203	4300	6503	ASTN2	SO:0001819	synonymous_variant	0			-	HGNC	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.936C>T	9.37:g.119976716G>A		Somatic	0	111	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	74	42.19	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,superfamily_Fibronectin_type3,smart_MACPF	p.D312	ENST00000313400.4	37	c.936		9																																																																																			-	NULL		0.582	ASTN2-201	KNOWN	basic	protein_coding	ASTN2	protein_coding		G	NM_014010	-		119976716	-1	no_errors	ENST00000313400	ensembl	human	known	74_37	silent	SNP	0.576	A
SLC45A4	57210	genome.wustl.edu	37	8	142222376	142222376	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr8:142222376C>A	ENST00000024061.3	-	7	2375	c.2068G>T	c.(2068-2070)Ggt>Tgt	p.G690C	SLC45A4_ENST00000519067.1_Missense_Mutation_p.G690C|SLC45A4_ENST00000517878.1_Missense_Mutation_p.G741C|SLC45A4_ENST00000433583.2_Missense_Mutation_p.G683C	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			CTGTTCCCACCGGCCCTGCCT	0.642																																																	0								ENSG00000022567						36.0	33.0	34.0					8																	142222376		2201	4300	6501	SLC45A4	SO:0001583	missense	0			-	HGNC	AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.2068G>T	8.37:g.142222376C>A	ENSP00000024061:p.Gly690Cys	Somatic	0	76	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	58	27.50	Q6ZRI2|Q9ULU3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_MFS_dom_general_subst_transpt	p.G741C	ENST00000024061.3	37	c.2221	CCDS34948.1	8	.	.	.	.	.	.	.	.	.	.	C	14.18	2.458458	0.43634	.	.	ENSG00000022567	ENST00000519067;ENST00000517878;ENST00000433583;ENST00000024061	T;T;T;T	0.17370	2.34;2.3;2.31;2.28	4.2	-5.55	0.02536	.	0.861717	0.09958	N	0.733808	T	0.34308	0.0893	M	0.67953	2.075	0.09310	N	1	D;D;D	0.76494	0.997;0.999;0.999	P;D;D	0.65773	0.68;0.938;0.911	T	0.38824	-0.9643	10	0.87932	D	0	-0.7871	14.4865	0.67622	0.0:0.3587:0.0:0.6413	.	741;690;690	E7EV90;Q5BKX6-3;Q5BKX6-2	.;.;.	C	690;741;683;690	ENSP00000429059:G690C;ENSP00000428137:G741C;ENSP00000400799:G683C;ENSP00000024061:G690C	ENSP00000024061:G690C	G	-	1	0	SLC45A4	142291558	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.025000	0.13577	-1.181000	0.02730	-0.783000	0.03347	GGT	-	NULL		0.642	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A4	protein_coding	OTTHUMT00000378571.3	C	XM_050325	-		142222376	-1	no_errors	ENST00000517878	ensembl	human	known	74_37	missense	SNP	0.000	A
A2M	2	genome.wustl.edu	37	12	9229983	9229983	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr12:9229983A>C	ENST00000318602.7	-	27	3617	c.3310T>G	c.(3310-3312)Tat>Gat	p.Y1104D	A2M_ENST00000542567.1_5'Flank	NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	1104					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	ATGGTGATATAGGCGGAGAGG	0.453																																																	0								ENSG00000175899						99.0	102.0	101.0					12																	9229983		2192	4300	6492	A2M	SO:0001583	missense	0			-	HGNC	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.3310T>G	12.37:g.9229983A>C	ENSP00000323929:p.Tyr1104Asp	Somatic	0	63	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	5	88.89	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,superfamily_Beta-lactam/transpept-like,superfamily_Cupredoxin	p.Y1104D	ENST00000318602.7	37	c.3310	CCDS44827.1	12	.	.	.	.	.	.	.	.	.	.	A	17.94	3.510490	0.64522	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	T	0.42900	0.96	5.86	5.86	0.93980	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.000000	0.85682	D	0.000000	T	0.78792	0.4339	H	0.98577	4.27	0.50313	D	0.999868	D	0.89917	1.0	D	0.97110	1.0	D	0.87298	0.2303	10	0.87932	D	0	.	15.9227	0.79589	1.0:0.0:0.0:0.0	.	1104	P01023	A2MG_HUMAN	D	1104;1119	ENSP00000323929:Y1104D	ENSP00000323929:Y1104D	Y	-	1	0	A2M	9121250	1.000000	0.71417	0.988000	0.46212	0.235000	0.25334	8.240000	0.89813	2.244000	0.73946	0.477000	0.44152	TAT	-	pfam_A2M_comp,superfamily_Terpenoid_cyclase/PrenylTrfase		0.453	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2M	protein_coding	OTTHUMT00000317233.2	A	NM_000014	-		9229983	-1	no_errors	ENST00000318602	ensembl	human	known	74_37	missense	SNP	1.000	C
STRIP1	85369	genome.wustl.edu	37	1	110580694	110580697	+	Intron	DEL	ATAT	ATAT	-	rs200695359|rs372322579|rs576249701|rs58967128		TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	ATAT	ATAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr1:110580694_110580697delATAT	ENST00000369795.3	+	2	272				STRIP1_ENST00000369794.2_Intron|STRIP1_ENST00000369796.1_Intron	NM_033088.3	NP_149079.2	Q5VSL9	STRP1_HUMAN	striatin interacting protein 1						cortical actin cytoskeleton organization (GO:0030866)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)											GTTCTATCAAatatatatatatat	0.24																																																	0								ENSG00000143093																																			STRIP1	SO:0001627	intron_variant	0				HGNC	AK027649	CCDS30798.1, CCDS59197.1	1p13.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000143093	ENSG00000143093			25916	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog A (yeast)"""		"""family with sequence similarity 40, member A"""	FAM40A		11214970, 12588993, 22782902, 22298706, 18782753	Standard	NM_033088		Approved	FLJ14743, KIAA1761, FAR11A	uc001dza.2	Q5VSL9	OTTHUMG00000170607	ENST00000369795.3:c.250+112ATAT>-	1.37:g.110580702_110580705delATAT		Somatic	0	46	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	43	10.42	Q0V925|Q5VSL8|Q658K2|Q6ZV31|Q8N598|Q96SN2|Q9C0A2	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369795.3	37	NULL	CCDS30798.1	1																																																																																			-	-		0.240	STRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRIP1	protein_coding	OTTHUMT00000032213.1	ATAT	NM_033088			110580697	+1	no_errors	ENST00000489059	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000:0.000	-
STX12	23673	genome.wustl.edu	37	1	28128387	28128387	+	Intron	SNP	G	G	A			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr1:28128387G>A	ENST00000373943.4	+	4	551				STX12_ENST00000468761.1_3'UTR	NM_177424.2	NP_803173.1	Q86Y82	STX12_HUMAN	syntaxin 12						cholesterol efflux (GO:0033344)|intracellular protein transport (GO:0006886)|protein stabilization (GO:0050821)|synaptic vesicle exocytosis (GO:0016079)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|phagocytic vesicle (GO:0045335)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			breast(1)|central_nervous_system(1)|large_intestine(3)|lung(3)	8		Colorectal(325;3.46e-05)|all_lung(284;9.43e-05)|Lung NSC(340;0.000185)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;3.96e-24)|Colorectal(126;3.46e-08)|COAD - Colon adenocarcinoma(152;1.83e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00258)|KIRC - Kidney renal clear cell carcinoma(1967;0.00302)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0649)		CAAGTTTGTGGGTTTTTTTCT	0.373																																					Ovarian(5;5 342 2097 9488 34083)												0								ENSG00000117758																																			STX12	SO:0001627	intron_variant	0			-	HGNC	BC046999	CCDS310.1	1p35.3	2008-05-14			ENSG00000117758	ENSG00000117758			11430	protein-coding gene	gene with protein product		606892				9507000	Standard	NM_177424		Approved	STX13, STX14	uc001bou.4	Q86Y82	OTTHUMG00000003730	ENST00000373943.4:c.426+61G>A	1.37:g.28128387G>A		Somatic	0	103	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	56	67	45.53	B1AJQ7|O95564	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373943.4	37	NULL	CCDS310.1	1																																																																																			-	-		0.373	STX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX12	protein_coding	OTTHUMT00000010519.1	G	NM_177424	-		28128387	+1	no_errors	ENST00000468761	ensembl	human	known	74_37	rna	SNP	0.000	A
XAF1	54739	genome.wustl.edu	37	17	6663165	6663165	+	Intron	SNP	G	G	A			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr17:6663165G>A	ENST00000361842.3	+	3	464				XAF1_ENST00000441631.1_Intron|XAF1_ENST00000438512.1_Intron|XAF1_ENST00000346752.4_Intron	NM_017523.3	NP_059993.2	Q6GPH4	XAF1_HUMAN	XIAP associated factor 1						apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|negative regulation of protein complex assembly (GO:0031333)|response to interferon-beta (GO:0035456)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	6						ATTAGGCTTGGAGAGCAGTGG	0.507																																																	0								ENSG00000132530																																			XAF1	SO:0001627	intron_variant	0			-	HGNC	X99699	CCDS11080.1, CCDS11081.1	17p13.2	2010-03-19			ENSG00000132530	ENSG00000132530			30932	protein-coding gene	gene with protein product		606717				12029096, 11175744	Standard	NM_199139		Approved	BIRC4BP, XIAPAF1, HSXIAPAF1	uc002gdn.3	Q6GPH4		ENST00000361842.3:c.225+128G>A	17.37:g.6663165G>A		Somatic	0	15	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	0	100.00	A2T931|A2T932|A8K2L1|A8K9Y3|D3DTM6|Q6MZE8|Q8N557|Q99982	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_TRAF-like	p.W58*	ENST00000361842.3	37	c.174	CCDS11080.1	17																																																																																			-	superfamily_TRAF-like		0.507	XAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XAF1	protein_coding	OTTHUMT00000439643.5	G	NM_017523	-		6663165	+1	no_errors	ENST00000575147	ensembl	human	known	74_37	nonsense	SNP	0.000	A
PCF11	51585	genome.wustl.edu	37	11	82877729	82877729	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr11:82877729G>T	ENST00000298281.4	+	5	2242	c.1790G>T	c.(1789-1791)tGg>tTg	p.W597L		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	597					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						GCCAAAAGATGGAAATCTGGT	0.348																																																	0								ENSG00000165494						74.0	76.0	76.0					11																	82877729		1751	3825	5576	PCF11	SO:0001583	missense	0			-	HGNC	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1790G>T	11.37:g.82877729G>T	ENSP00000298281:p.Trp597Leu	Somatic	0	130	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	47	53.00	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_CID_dom	p.W597L	ENST00000298281.4	37	c.1790	CCDS44689.1	11	.	.	.	.	.	.	.	.	.	.	G	21.5	4.165027	0.78339	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.73681	0.03;-0.77;-0.5	6.07	6.07	0.98685	.	0.000000	0.56097	D	0.000033	T	0.81341	0.4802	L	0.34521	1.04	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	T	0.77688	-0.2494	9	.	.	.	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	597;597	E9PQ01;O94913	.;PCF11_HUMAN	L	597	ENSP00000298281:W597L;ENSP00000434540:W597L;ENSP00000431567:W597L	.	W	+	2	0	PCF11	82555377	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.912000	0.92726	2.885000	0.99019	0.655000	0.94253	TGG	-	NULL		0.348	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCF11	protein_coding	OTTHUMT00000392548.2	G	NM_015885	-		82877729	+1	no_errors	ENST00000298281	ensembl	human	known	74_37	missense	SNP	1.000	T
GNAT1	2779	genome.wustl.edu	37	3	50229150	50229164	+	Start_Codon_Del	DEL	GCTGGGACCATGGGG	GCTGGGACCATGGGG	-	rs151191490		TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	GCTGGGACCATGGGG	GCTGGGACCATGGGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr3:50229150_50229164delGCTGGGACCATGGGG	ENST00000433068.1	+	0	48_62				GNAT1_ENST00000232461.3_Start_Codon_Del	NM_000172.3	NP_000163.2	P11488	GNAT1_HUMAN	guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell proliferation (GO:0008283)|cellular response to electrical stimulus (GO:0071257)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|phototransduction, visible light (GO:0007603)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to light intensity (GO:0009642)|response to light stimulus (GO:0009416)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	acyl binding (GO:0000035)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		TTCGCCTGCTGCTGGGACCATGGGGGCTGGGGCCA	0.619																																																	0								ENSG00000114349																																			GNAT1	SO:0001582	initiator_codon_variant	0				HGNC		CCDS2812.1	3p21	2014-01-28			ENSG00000114349	ENSG00000114349			4393	protein-coding gene	gene with protein product		139330					Standard	NM_000172		Approved	CSNBAD3	uc003cyl.2	P11488	OTTHUMG00000156808		3.37:g.50229150_50229164delGCTGGGACCATGGGG		Somatic	NA	NA	NA		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q4VBN2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_I	p.11in_frame_del	ENST00000433068.1	37	c.10_6	CCDS2812.1	3																																																																																			-	pfam_Gprotein_alpha_su,smart_Gprotein_alpha_su		0.619	GNAT1-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	GNAT1	protein_coding	OTTHUMT00000345957.1	GCTGGGACCATGGGG	NM_000172			50229164	+1	no_errors	ENST00000232461	ensembl	human	known	74_37	in_frame_del	DEL	0.028:0.025:0.005:0.099:0.108:0.097:0.110:0.223:0.447:0.998:1.000:1.000:1.000:1.000:1.000	-
C12orf57	113246	genome.wustl.edu	37	12	7053098	7053099	+	5'Flank	INS	-	-	T	rs386759963|rs74057228		TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr12:7053098_7053099insT	ENST00000229281.5	+	0	0				C12orf57_ENST00000544681.1_5'UTR|C12orf57_ENST00000542222.1_Intron|PTPN6_ENST00000447931.2_5'Flank|PTPN6_ENST00000399448.1_5'Flank|C12orf57_ENST00000537087.1_5'UTR|C12orf57_ENST00000540506.2_5'Flank|RNU7-1_ENST00000458811.1_RNA|U47924.31_ENST00000607421.1_RNA	NM_138425.2	NP_612434.1	Q99622	C10_HUMAN	chromosome 12 open reading frame 57							cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)	2						ATTATGGGTAGTTTTGGTGGTC	0.485																																																	0								ENSG00000272173																																			U47924.31	SO:0001631	upstream_gene_variant	0				Clone_based_vega_gene	U47924	CCDS8571.1	12p13.31	2012-05-30			ENSG00000111678	ENSG00000111678			29521	protein-coding gene	gene with protein product		615140				9445485	Standard	NM_138425		Approved	GRCC10, C10	uc009zfj.2	Q99622	OTTHUMG00000169017		12.37:g.7053102_7053102dupT	Exception_encountered	Somatic	0	51	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	11	62.07	B2R4Q6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000229281.5	37	NULL	CCDS8571.1	12																																																																																			-	-		0.485	C12orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNU7-1	protein_coding	OTTHUMT00000401959.1	-	NM_138425			7053099	-1	no_errors	ENST00000607421	ensembl	human	known	74_37	rna	INS	0.000:0.000	T
PTPRM	5797	genome.wustl.edu	37	18	8380423	8380423	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr18:8380423C>T	ENST00000332175.8	+	27	4914	c.3877C>T	c.(3877-3879)Cag>Tag	p.Q1293*	PTPRM_ENST00000580170.1_Nonsense_Mutation_p.Q1306*|PTPRM_ENST00000400053.4_Nonsense_Mutation_p.Q1231*|PTPRM_ENST00000444013.1_Nonsense_Mutation_p.Q1080*|PTPRM_ENST00000400060.4_Nonsense_Mutation_p.Q1307*	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1293	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.Q1293*(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GGATCCTGCCCAGGTGAGACC	0.493																																																	1	Substitution - Nonsense(1)	kidney(1)						ENSG00000173482						101.0	90.0	94.0					18																	8380423		2203	4300	6503	PTPRM	SO:0001587	stop_gained	0			-	HGNC	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.3877C>T	18.37:g.8380423C>T	ENSP00000331418:p.Gln1293*	Somatic	0	99	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	69	38.39	A7MBN1|D3DUH8|J3QL11	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.Q1307*	ENST00000332175.8	37	c.3919	CCDS11840.1	18	.	.	.	.	.	.	.	.	.	.	C	50	17.020914	0.99877	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	19.3775	0.94517	0.0:1.0:0.0:0.0	.	.	.	.	X	1293;1307;1231;1080	.	ENSP00000331418:Q1293X	Q	+	1	0	PTPRM	8370423	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	5.920000	0.70017	2.588000	0.87417	0.467000	0.42956	CAG	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt		0.493	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRM	protein_coding	OTTHUMT00000254456.1	C		-		8380423	+1	no_errors	ENST00000400060	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ATP6V1A	523	genome.wustl.edu	37	3	113505151	113505151	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr3:113505151C>G	ENST00000273398.3	+	6	745	c.637C>G	c.(637-639)Caa>Gaa	p.Q213E	ATP6V1A_ENST00000538620.1_Missense_Mutation_p.Q180E	NM_001690.3	NP_001681.2	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A	213					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	ATP binding (GO:0005524)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Alendronate(DB00630)|Etidronic acid(DB01077)|Tiludronate(DB01133)	GCCTGTACGTCAAGTTCGACC	0.448																																																	0								ENSG00000114573						218.0	192.0	200.0					3																	113505151		2203	4300	6503	ATP6V1A	SO:0001583	missense	0			-	HGNC	L09235	CCDS2976.1	3q13.31	2010-04-21	2002-08-29	2003-04-25	ENSG00000114573	ENSG00000114573	3.6.3.14	"""ATPases / V-type"""	851	protein-coding gene	gene with protein product		607027	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), alpha polypeptide, 70kD, isoform 1"""	VPP2, ATP6A1, ATP6V1A1		8463241	Standard	NM_001690		Approved	Vma1, VA68	uc003eao.3	P38606	OTTHUMG00000159295	ENST00000273398.3:c.637C>G	3.37:g.113505151C>G	ENSP00000273398:p.Gln213Glu	Somatic	1	172	0.58		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	82	137	37.44	B2RBR8|B7Z1R5|D3DN75|Q53YD9|Q96DY6|Q9UHY3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,pfam_ATPase_F1/V1/A1-cplx_a/bsu_C,pfam_ATPase_F1_a/bsu_N,superfamily_P-loop_NTPase,superfamily_ATPase_F1/V1/A1-cplx_a/bsu_C,superfamily_ATPase_F1_a/bsu_N,tigrfam_ATPase_V1-cplx_asu	p.Q213E	ENST00000273398.3	37	c.637	CCDS2976.1	3	.	.	.	.	.	.	.	.	.	.	C	9.246	1.039624	0.19669	.	.	ENSG00000114573	ENST00000273398;ENST00000538620;ENST00000496747;ENST00000475322	T;T	0.81330	-1.48;-1.48	5.33	5.33	0.75918	.	0.111853	0.64402	D	0.000003	T	0.76506	0.3997	M	0.74467	2.265	0.53005	D	0.99996	B	0.11235	0.004	B	0.17098	0.017	T	0.67818	-0.5572	10	0.09084	T	0.74	-11.6205	10.5281	0.44960	0.1488:0.7075:0.1437:0.0	.	213	P38606	VATA_HUMAN	E	213;180;180;213	ENSP00000273398:Q213E;ENSP00000439874:Q180E	ENSP00000273398:Q213E	Q	+	1	0	ATP6V1A	114987841	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.312000	0.59154	2.499000	0.84300	0.591000	0.81541	CAA	-	superfamily_P-loop_NTPase,tigrfam_ATPase_V1-cplx_asu		0.448	ATP6V1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1A	protein_coding	OTTHUMT00000354457.1	C	NM_001690	-		113505151	+1	no_errors	ENST00000273398	ensembl	human	known	74_37	missense	SNP	0.999	G
AP5B1	91056	genome.wustl.edu	37	11	65546103	65546103	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr11:65546103G>A	ENST00000532090.2	-	2	2071	c.1861C>T	c.(1861-1863)Cac>Tac	p.H621Y		NM_138368.4	NP_612377.4	Q2VPB7	AP5B1_HUMAN	adaptor-related protein complex 5, beta 1 subunit	621					endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-type membrane coat adaptor complex (GO:0030119)|lysosomal membrane (GO:0005765)				lung(1)	1						GCTGCCAGGTGTGCCAGCAGG	0.682																																																	0								ENSG00000254470						9.0	13.0	12.0					11																	65546103		2041	4172	6213	AP5B1	SO:0001583	missense	0			-	HGNC	JQ313135	CCDS58146.1	11q13.1	2012-02-29			ENSG00000254470	ENSG00000254470			25104	protein-coding gene	gene with protein product		614367				22022230	Standard	NM_138368		Approved	PP1030, AP-5, DKFZp761E198	uc031qbm.1	Q2VPB7	OTTHUMG00000166593	ENST00000532090.2:c.1861C>T	11.37:g.65546103G>A	ENSP00000454303:p.His621Tyr	Somatic	0	156	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	94	106	47.00	A1L0S6|H6WUK2|Q0D2Q2|Q8N3J7|Q8WYH6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.H621Y	ENST00000532090.2	37	c.1861	CCDS58146.1	11																																																																																			-	NULL		0.682	AP5B1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	AP5B1	protein_coding	OTTHUMT00000390636.2	G	NM_138368	-		65546103	-1	no_errors	ENST00000532090	ensembl	human	novel	74_37	missense	SNP	1.000	A
CCAR2	57805	genome.wustl.edu	37	8	22472281	22472281	+	Intron	SNP	A	A	T	rs113423385		TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr8:22472281A>T	ENST00000308511.4	+	11	1290				CCAR2_ENST00000389279.3_Intron|RP11-582J16.5_ENST00000521025.1_RNA|CCAR2_ENST00000520861.1_Intron			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2						cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										GATGGGTGGCAGCCTTGCCCT	0.522																																																	0								ENSG00000253200																																			RP11-582J16.5	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.1042-70A>T	8.37:g.22472281A>T		Somatic	0	16	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	14	30.00	A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000308511.4	37	NULL	CCDS34863.1	8																																																																																			-	-		0.522	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000253200	protein_coding	OTTHUMT00000375865.1	A	NM_021174	rs113423385		22472281	-1	no_errors	ENST00000521025	ensembl	human	known	74_37	rna	SNP	0.000	T
PLXNB1	5364	genome.wustl.edu	37	3	48465046	48465046	+	Silent	SNP	G	G	C			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr3:48465046G>C	ENST00000358536.4	-	3	1244	c.975C>G	c.(973-975)ccC>ccG	p.P325P	PLXNB1_ENST00000456774.1_Silent_p.P325P|PLXNB1_ENST00000296440.6_Silent_p.P325P|PLXNB1_ENST00000358459.4_Silent_p.P325P|PLXNB1_ENST00000448774.2_Intron	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	325	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CCTCATCCAGGGGGAAGGCAC	0.657																																																	0								ENSG00000164050						38.0	41.0	40.0					3																	48465046		2203	4300	6503	PLXNB1	SO:0001819	synonymous_variant	0			-	HGNC	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.975C>G	3.37:g.48465046G>C		Somatic	0	120	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	52	64	44.83	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.P325	ENST00000358536.4	37	c.975	CCDS2765.1	3																																																																																			-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.657	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLXNB1	protein_coding	OTTHUMT00000344454.1	G	NM_002673	-		48465046	-1	no_errors	ENST00000296440	ensembl	human	known	74_37	silent	SNP	0.802	C
TP53	7157	genome.wustl.edu	37	17	7576852	7576852	+	Splice_Site	SNP	C	C	A	rs11575997		TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr17:7576852C>A	ENST00000269305.4	-	9	1183		c.e9+1		TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(24)|p.0?(8)|p.I332fs*49(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGACTTAGTACCTGAAGGGTG	0.458		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	33	Unknown(24)|Whole gene deletion(8)|Insertion - Frameshift(1)	ovary(8)|lung(4)|breast(4)|bone(4)|stomach(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|NS(2)|pancreas(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|skin(1)	GRCh37	CD002536	TP53	D	rs11575997	ENSG00000141510						115.0	108.0	111.0					17																	7576852		2203	4300	6503	TP53	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.993+1G>T	17.37:g.7576852C>A		Somatic	0	131	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	91	7	92.86	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e8+1	ENST00000269305.4	37	c.993+1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	13.65	2.301218	0.40694	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000419024	.	.	.	4.41	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6932	0.56988	0.0:1.0:0.0:0.0	rs11575997	.	.	.	.	-1	.	.	.	-	.	.	TP53	7517577	1.000000	0.71417	1.000000	0.80357	0.648000	0.38561	2.315000	0.43752	2.462000	0.83206	0.561000	0.74099	.	-	-		0.458	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	rs11575997	Intron	7576852	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site	SNP	1.000	A
STIM2	57620	genome.wustl.edu	37	4	27010131	27010131	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr4:27010131C>T	ENST00000467011.1	+	9	1656	c.1231C>T	c.(1231-1233)Cac>Tac	p.H411Y	STIM2_ENST00000412829.2_Missense_Mutation_p.H498Y|STIM2_ENST00000237364.5_Missense_Mutation_p.H498Y|STIM2_ENST00000465503.1_Missense_Mutation_p.H419Y|STIM2_ENST00000382009.3_Missense_Mutation_p.H506Y|STIM2_ENST00000467087.1_Missense_Mutation_p.H411Y	NM_001169117.1	NP_001162588	Q9P246	STIM2_HUMAN	stromal interaction molecule 2	411					activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|positive regulation of calcium ion transport (GO:0051928)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|store-operated calcium channel activity (GO:0015279)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	25		Breast(46;0.0503)				TGAGGTAGACCACAAAATTCT	0.338																																																	0								ENSG00000109689						68.0	66.0	67.0					4																	27010131		2203	4300	6503	STIM2	SO:0001583	missense	0			-	HGNC	AB040915	CCDS3440.1, CCDS3440.2, CCDS54751.1, CCDS54752.1	4p15.2	2013-01-10			ENSG00000109689	ENSG00000109689		"""Sterile alpha motif (SAM) domain containing"""	19205	protein-coding gene	gene with protein product		610841				11463338	Standard	NM_020860		Approved		uc003gsh.4	Q9P246	OTTHUMG00000097805	ENST00000467011.1:c.1231C>T	4.37:g.27010131C>T	ENSP00000419383:p.His411Tyr	Somatic	0	95	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	51	64	44.35	A6H8L7|B7ZVY0|Q96BF1|Q9BQH2|Q9H8R1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,pfscan_SAM	p.H506Y	ENST00000467011.1	37	c.1516	CCDS54752.1	4	.	.	.	.	.	.	.	.	.	.	C	21.7	4.185244	0.78677	.	.	ENSG00000109689	ENST00000467087;ENST00000382009;ENST00000237364;ENST00000467011;ENST00000412829;ENST00000465503;ENST00000473519;ENST00000477474	T;T;T;T;T;T;T;T	0.80123	-1.21;-1.21;-1.21;-1.21;-1.21;-1.2;-1.2;-1.34	5.42	5.42	0.78866	.	0.100596	0.64402	D	0.000002	D	0.88526	0.6460	L	0.58810	1.83	0.80722	D	1	D;D;D;D	0.69078	0.997;0.993;0.993;0.996	D;D;D;D	0.75484	0.986;0.968;0.968;0.986	D	0.88885	0.3342	10	0.72032	D	0.01	.	19.5823	0.95473	0.0:1.0:0.0:0.0	.	411;498;506;498	Q9P246;A6H8L7;E9PGD0;F5GXJ4	STIM2_HUMAN;.;.;.	Y	411;506;498;411;498;419;119;13	ENSP00000419073:H411Y;ENSP00000371439:H506Y;ENSP00000237364:H498Y;ENSP00000419383:H411Y;ENSP00000404812:H498Y;ENSP00000417569:H419Y;ENSP00000420113:H119Y;ENSP00000419536:H13Y	ENSP00000237364:H498Y	H	+	1	0	STIM2	26619229	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.722000	0.68485	2.695000	0.91970	0.655000	0.94253	CAC	-	NULL		0.338	STIM2-003	NOVEL	basic|exp_conf|CCDS	protein_coding	STIM2	protein_coding	OTTHUMT00000356861.1	C	NM_020860	-		27010131	+1	no_errors	ENST00000382009	ensembl	human	known	74_37	missense	SNP	1.000	T
LRRC56	115399	genome.wustl.edu	37	11	554105	554105	+	Silent	SNP	G	G	A			TCGA-DX-A48V-01A-11D-A307-09	TCGA-DX-A48V-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da538815-9376-42e8-a240-698c84a0b9ff	0592a9f9-dc45-4eb6-88d6-5fb679f03b4c	g.chr11:554105G>A	ENST00000270115.7	+	14	1958	c.1458G>A	c.(1456-1458)ggG>ggA	p.G486G		NM_198075.3	NP_932341.1	Q8IYG6	LRC56_HUMAN	leucine rich repeat containing 56	486										kidney(1)|lung(4)|skin(1)	6		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCAGCTGGGGGCCTGGCCTGG	0.697																																																	0								ENSG00000161328						34.0	40.0	38.0					11																	554105		2199	4296	6495	LRRC56	SO:0001819	synonymous_variant	0			-	HGNC		CCDS7700.1	11p15.5	2005-10-18			ENSG00000161328	ENSG00000161328			25430	protein-coding gene	gene with protein product						12477932	Standard	NM_198075		Approved	FLJ00101, DKFZp761L1518	uc010qvz.2	Q8IYG6	OTTHUMG00000132003	ENST00000270115.7:c.1458G>A	11.37:g.554105G>A		Somatic	0	65	0.00		0.596464803265561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	58	14.71	Q8N3Q4	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G486	ENST00000270115.7	37	c.1458	CCDS7700.1	11																																																																																			-	NULL		0.697	LRRC56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC56	protein_coding	OTTHUMT00000254969.1	G	NM_198075	-		554105	+1	no_errors	ENST00000270115	ensembl	human	known	74_37	silent	SNP	0.537	A
