#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
FZD5	7855	genome.wustl.edu	37	2	208632893	208632893	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr2:208632893T>A	ENST00000295417.3	-	2	1124	c.571A>T	c.(571-573)Aag>Tag	p.K191*		NM_003468.3	NP_003459.2	Q13467	FZD5_HUMAN	frizzled class receptor 5	191					angiogenesis (GO:0001525)|anterior/posterior axis specification, embryo (GO:0008595)|apoptotic process (GO:0006915)|apoptotic process involved in morphogenesis (GO:0060561)|axonogenesis (GO:0007409)|brain development (GO:0007420)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|canonical Wnt signaling pathway (GO:0060070)|cell maturation (GO:0048469)|cellular response to molecule of bacterial origin (GO:0071219)|chorionic trophoblast cell differentiation (GO:0060718)|embryonic axis specification (GO:0000578)|embryonic camera-type eye development (GO:0031076)|gonad development (GO:0008406)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|neuron differentiation (GO:0030182)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic camera-type eye development (GO:0031077)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of chorionic trophoblast cell proliferation (GO:1901382)|regulation of tight junction assembly (GO:2000810)|Spemann organizer formation (GO:0060061)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell differentiation in thymus (GO:0033077)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	cell projection (GO:0042995)|cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			NS(1)|kidney(1)|lung(1)|ovary(2)|prostate(1)|skin(1)	7				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.13)|Lung(261;0.134)		TCGCGACACTTGCACACGAAC	0.706																																																	0								ENSG00000163251						21.0	23.0	22.0					2																	208632893		2200	4298	6498	FZD5	SO:0001587	stop_gained	0			-	HGNC	U43318	CCDS33366.1	2q33.3	2014-01-29	2014-01-29		ENSG00000163251	ENSG00000163251		"""GPCR / Class F : Frizzled receptors"""	4043	protein-coding gene	gene with protein product		601723	"""frizzled (Drosophila) homolog 5"", ""chromosome 2 open reading frame 31"", ""frizzled homolog 5 (Drosophila)"", ""frizzled 5, seven transmembrane spanning receptor"", ""frizzled family receptor 5"""	C2orf31		8626800, 11408929	Standard	NM_003468		Approved	HFZ5, DKFZP434E2135	uc002vcj.3	Q13467	OTTHUMG00000154790	ENST00000295417.3:c.571A>T	2.37:g.208632893T>A	ENSP00000354607:p.Lys191*	Somatic	0	53	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	21	40.00	A8K2X1|B2RCZ1|Q53R22	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.K191*	ENST00000295417.3	37	c.571	CCDS33366.1	2	.	.	.	.	.	.	.	.	.	.	T	40	8.311456	0.98754	.	.	ENSG00000163251	ENST00000295417	.	.	.	4.68	3.49	0.39957	.	0.633028	0.14883	N	0.292824	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.6576	0.34073	0.0:0.1556:0.0:0.8444	.	.	.	.	X	191	.	ENSP00000354607:K191X	K	-	1	0	FZD5	208341138	0.985000	0.35326	1.000000	0.80357	0.807000	0.45602	0.737000	0.26144	1.973000	0.57446	0.459000	0.35465	AAG	-	NULL		0.706	FZD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD5	protein_coding	OTTHUMT00000337060.1	T	NM_003468	-		208632893	-1	no_errors	ENST00000295417	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ANKRD20A5P	440482	genome.wustl.edu	37	18	14187363	14187366	+	RNA	DEL	TCTT	TCTT	-	rs201795140		TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	TCTT	TCTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr18:14187363_14187366delTCTT	ENST00000581935.1	+	0	2089							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						CCCCTAAAACTCTTAATTCCTCAA	0.387																																																	0								ENSG00000186481																																			ANKRD20A5P			0				HGNC	BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14187363_14187366delTCTT		Somatic	0	40	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	21	22.22	Q4G1B6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000581935.1	37	NULL		18																																																																																			-	-		0.387	ANKRD20A5P-002	KNOWN	basic	processed_transcript	ANKRD20A5P	pseudogene	OTTHUMT00000442833.1	TCTT				14187366	+1	no_errors	ENST00000581181	ensembl	human	known	74_37	rna	DEL	0.022:0.029:0.030:0.026	-
MED14	9282	genome.wustl.edu	37	X	40588606	40588606	+	Intron	DEL	A	A	-	rs200699843|rs369436436		TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chrX:40588606delA	ENST00000324817.1	-	2	334					NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14						androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GTCTAAGAAGAAAAAAAAAAA	0.318																																																	0								ENSG00000180182						62.0	57.0	59.0					X																	40588606		2202	4299	6501	MED14	SO:0001627	intron_variant	0				HGNC	AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.216-9T>-	X.37:g.40588606delA		Somatic	0	24	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q4KMR7|Q9UNB3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000324817.1	37	NULL	CCDS14254.1	X																																																																																			-	-		0.318	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MED14	protein_coding	OTTHUMT00000060692.1	A	NM_004229			40588606	-1	no_errors	ENST00000463072	ensembl	human	known	74_37	rna	DEL	0.000	-
TP53	7157	genome.wustl.edu	37	17	7577114	7577114	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr17:7577114C>T	ENST00000269305.4	-	8	1013	c.824G>A	c.(823-825)tGt>tAt	p.C275Y	TP53_ENST00000359597.4_Missense_Mutation_p.C275Y|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.C275Y|TP53_ENST00000455263.2_Missense_Mutation_p.C275Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.C275Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	275	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7887414}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C275Y(53)|p.C275F(37)|p.0?(8)|p.C275fs*70(3)|p.?(2)|p.C275S(2)|p.C275fs*20(1)|p.L265_K305del41(1)|p.R273_C275delRVC(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.A276fs*29(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGACAGGCACAAACACGCAC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	115	Substitution - Missense(92)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(2)	lung(14)|large_intestine(13)|breast(13)|upper_aerodigestive_tract(12)|central_nervous_system(10)|haematopoietic_and_lymphoid_tissue(10)|ovary(7)|urinary_tract(6)|stomach(5)|oesophagus(5)|bone(5)|liver(5)|skin(3)|pancreas(2)|NS(2)|prostate(2)|biliary_tract(1)	GRCh37	CM076568|CM951234	TP53	M		ENSG00000141510						71.0	61.0	64.0					17																	7577114		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.824G>A	17.37:g.7577114C>T	ENSP00000269305:p.Cys275Tyr	Somatic	0	51	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	3	82.61	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C275Y	ENST00000269305.4	37	c.824	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	25.1	4.605675	0.87157	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99874	-7.39;-7.39;-7.39;-7.39;-7.39;-7.39	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99883	0.9944	M	0.92738	3.34	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;0.997;0.997	D	0.96317	0.9233	10	0.87932	D	0	-17.2181	15.662	0.77193	0.0:1.0:0.0:0.0	.	275;275;275;275	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	Y	275;275;275;275;275;264;143	ENSP00000352610:C275Y;ENSP00000269305:C275Y;ENSP00000398846:C275Y;ENSP00000391127:C275Y;ENSP00000391478:C275Y;ENSP00000425104:C143Y	ENSP00000269305:C275Y	C	-	2	0	TP53	7517839	1.000000	0.71417	0.999000	0.59377	0.904000	0.53231	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	TGT	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	-		7577114	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	T
BARHL2	343472	genome.wustl.edu	37	1	91180171	91180171	+	Silent	SNP	G	G	A	rs371535178		TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr1:91180171G>A	ENST00000370445.4	-	2	809	c.768C>T	c.(766-768)taC>taT	p.Y256Y		NM_020063.1	NP_064447.1	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	256					cell fate determination (GO:0001709)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|positive regulation of translation (GO:0045727)|regulation of axon extension (GO:0030516)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			cervix(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		GCACGCTCAGGTACTTCTGCC	0.562																																					GBM(199;3561 4100 22440)												0								ENSG00000143032	G		0,4406		0,0,2203	168.0	152.0	157.0		768	3.6	1.0	1		157	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	BARHL2	NM_020063.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		256/388	91180171	1,13005	2203	4300	6503	BARHL2	SO:0001819	synonymous_variant	0			-	HGNC	AJ251753	CCDS730.1	1p22.2	2011-07-08	2007-07-09		ENSG00000143032	ENSG00000143032		"""Homeoboxes / ANTP class : NKL subclass"""	954	protein-coding gene	gene with protein product		605212	"""BarH (Drosophila)-like 2"""				Standard	NM_020063		Approved		uc001dns.3	Q9NY43	OTTHUMG00000010020	ENST00000370445.4:c.768C>T	1.37:g.91180171G>A		Somatic	0	75	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	42	23.64	A0AVP2|Q7Z4N7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.Y256	ENST00000370445.4	37	c.768	CCDS730.1	1																																																																																			-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa		0.562	BARHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BARHL2	protein_coding	OTTHUMT00000027728.2	G		-		91180171	-1	no_errors	ENST00000370445	ensembl	human	known	74_37	silent	SNP	1.000	A
STEAP1	26872	genome.wustl.edu	37	7	89791383	89791383	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr7:89791383C>G	ENST00000297205.2	+	4	953	c.753C>G	c.(751-753)caC>caG	p.H251Q	STEAP2-AS1_ENST00000478318.2_RNA	NM_012449.2	NP_036581.1	Q9UHE8	STEA1_HUMAN	six transmembrane epithelial antigen of the prostate 1	251	Ferric oxidoreductase.				ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|transmembrane transport (GO:0055085)	cell-cell junction (GO:0005911)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	channel activity (GO:0015267)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|transporter activity (GO:0005215)			kidney(2)|large_intestine(3)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	14	all_hematologic(106;0.112)					GAGAATTTCACTATATTCAGG	0.333																																																	0								ENSG00000164647						45.0	42.0	43.0					7																	89791383		2203	4295	6498	STEAP1	SO:0001583	missense	0			-	HGNC	AF186249	CCDS5614.1	7q21	2011-08-31	2005-02-21	2005-02-24	ENSG00000164647	ENSG00000164647		"""Serine peptidases / Serine peptidases"""	11378	protein-coding gene	gene with protein product		604415	"""six transmembrane epithelial antigen of the prostate"""	STEAP			Standard	NM_012449		Approved	PRSS24	uc003ujx.3	Q9UHE8	OTTHUMG00000023006	ENST00000297205.2:c.753C>G	7.37:g.89791383C>G	ENSP00000297205:p.His251Gln	Somatic	0	109	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	65	28.57	A4D1E0|O95034	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fe3_Rdtase_TM_dom	p.H251Q	ENST00000297205.2	37	c.753	CCDS5614.1	7	.	.	.	.	.	.	.	.	.	.	C	11.29	1.596192	0.28445	.	.	ENSG00000164647	ENST00000297205	D	0.90732	-2.72	5.73	-0.94	0.10405	Flavoprotein transmembrane component (1);	0.338343	0.29059	N	0.013262	T	0.81264	0.4786	L	0.40543	1.245	0.37471	D	0.915603	B;B	0.13145	0.007;0.003	B;B	0.12837	0.008;0.008	T	0.65948	-0.6044	10	0.29301	T	0.29	-10.2187	3.8591	0.08988	0.0984:0.3147:0.3857:0.2012	.	251;251	B4E221;Q9UHE8	.;STEA1_HUMAN	Q	251	ENSP00000297205:H251Q	ENSP00000297205:H251Q	H	+	3	2	STEAP1	89629319	0.136000	0.22515	0.997000	0.53966	0.887000	0.51463	-0.152000	0.10159	0.062000	0.16340	-0.929000	0.02709	CAC	-	pfam_Fe3_Rdtase_TM_dom		0.333	STEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP1	protein_coding	OTTHUMT00000059327.3	C	NM_012449	-		89791383	+1	no_errors	ENST00000297205	ensembl	human	known	74_37	missense	SNP	0.969	G
RBM6	10180	genome.wustl.edu	37	3	50004794	50004794	+	Intron	DEL	A	A	-			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr3:50004794delA	ENST00000266022.4	+	3	303				RBM6_ENST00000441115.1_Intron|RBM6_ENST00000539992.1_Intron|RBM6_ENST00000442092.1_Intron|RBM6_ENST00000422955.1_Intron|RBM6_ENST00000443081.1_5'UTR	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6						RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		GAACTCTGCCAAAAAAAAAAT	0.363																																																	0								ENSG00000004534																																			RBM6	SO:0001627	intron_variant	0				HGNC	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.45-109A>-	3.37:g.50004794delA		Somatic	0	26	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	O60549|O75524|Q86SS3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000266022.4	37	NULL	CCDS2809.1	3																																																																																			-	-		0.363	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM6	protein_coding	OTTHUMT00000345528.4	A	NM_005777			50004794	+1	no_errors	ENST00000488807	ensembl	human	putative	74_37	rna	DEL	1.000	-
KIAA0430	9665	genome.wustl.edu	37	16	15696480	15696481	+	Intron	INS	-	-	AGGAAAGAAGGAGGGAGGCAGAG	rs373385405|rs373082870|rs79821793|rs71293163	byFrequency	TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr16:15696480_15696481insAGGAAAGAAGGAGGGAGGCAGAG	ENST00000396368.3	-	23	4620				KIAA0430_ENST00000548025.1_Intron|KIAA0430_ENST00000547936.1_Intron|KIAA0430_ENST00000344181.3_Frame_Shift_Ins_p.-1113fs|KIAA0430_ENST00000602337.1_Intron|KIAA0430_ENST00000540441.2_Intron|KIAA0430_ENST00000551742.1_Intron	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430						double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						gaggaggaggaaggaaagaagg	0.406														4802	0.958866	0.9955	0.9294	5008	,	,		23942	0.998		0.8777	False		,,,				2504	0.9734																0								ENSG00000166783																																			KIAA0430	SO:0001627	intron_variant	0				HGNC	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.4414-420->CTCTGCCTCCCTCCTTCTTTCCT	16.37:g.15696480_15696481insAGGAAAGAAGGAGGGAGGCAGAG		Somatic	NA	NA	NA		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.P1114fs	ENST00000396368.3	37	c.3339_3338	CCDS10562.2	16																																																																																			-	NULL		0.406	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	protein_coding	OTTHUMT00000252131.2	-	NM_014647			15696481	-1	no_errors	ENST00000344181	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.000	AGGAAAGAAGGAGGGAGGCAGAG
KANK3	256949	genome.wustl.edu	37	19	8398950	8398961	+	In_Frame_Del	DEL	TCGCTGTCGCCA	TCGCTGTCGCCA	-	rs111751275|rs199822445|rs201862465|rs6146458|rs200669927	byFrequency	TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	TCGCTGTCGCCA	TCGCTGTCGCCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr19:8398950_8398961delTCGCTGTCGCCA	ENST00000593649.1	-	5	1532_1543	c.1467_1478delTGGCGACAGCGA	c.(1465-1479)gatggcgacagcgag>gag	p.DGDS489del	KANK3_ENST00000330915.3_In_Frame_Del_p.DGDS489del			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	489								p.D489_S492delDGDS(2)		breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						GCCACCGTTCTCGCTGTCGCCATCGCTGTCGC	0.717														1760	0.351438	0.4085	0.428	5008	,	,		15278	0.2927		0.2962	False		,,,				2504	0.3374																2	Deletion - In frame(2)	large_intestine(1)|breast(1)						ENSG00000186994			958,2544		287,384,1080						-7.5	0.0		dbSNP_114	6	1402,5766		338,726,2520	no	coding	KANK3	NM_198471.2		625,1110,3600	A1A1,A1R,RR		19.5592,27.3558,22.1181				2360,8310				KANK3	SO:0001651	inframe_deletion	0				HGNC	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1467_1478delTGGCGACAGCGA	19.37:g.8398950_8398961delTCGCTGTCGCCA	ENSP00000470728:p.Asp489_Ser492del	Somatic	NA	NA	NA		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6NZI1|Q6ZQR3|Q8IUV2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.DGDS489in_frame_del	ENST00000593649.1	37	c.1478_1467		19																																																																																			-	NULL		0.717	KANK3-002	KNOWN	basic	protein_coding	KANK3	protein_coding	OTTHUMT00000461379.1	TCGCTGTCGCCA	NM_198471			8398961	-1	no_errors	ENST00000593649	ensembl	human	known	74_37	in_frame_del	DEL	0.002:0.046:0.028:0.025:0.017:0.004:0.003:0.002:0.000:0.001:0.003:0.001	-
RBM6	10180	genome.wustl.edu	37	3	50005514	50005514	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr3:50005514A>C	ENST00000266022.4	+	3	915	c.656A>C	c.(655-657)gAt>gCt	p.D219A	RBM6_ENST00000441115.1_Intron|RBM6_ENST00000539992.1_Intron|RBM6_ENST00000442092.1_Intron|RBM6_ENST00000422955.1_Intron|RBM6_ENST00000443081.1_Missense_Mutation_p.D87A	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	219					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		AGGAATAGAGATGTATCTGAT	0.448																																																	0								ENSG00000004534						68.0	69.0	69.0					3																	50005514		2203	4300	6503	RBM6	SO:0001583	missense	0			-	HGNC	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.656A>C	3.37:g.50005514A>C	ENSP00000266022:p.Asp219Ala	Somatic	0	39	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	20	25.93	O60549|O75524|Q86SS3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_G_patch_dom,smart_RRM_dom,smart_G_patch_dom,pfscan_G_patch_dom,pfscan_RRM_dom	p.D219A	ENST00000266022.4	37	c.656	CCDS2809.1	3	.	.	.	.	.	.	.	.	.	.	A	11.64	1.699880	0.30142	.	.	ENSG00000004534	ENST00000266022;ENST00000443081	T;T	0.34667	1.38;1.35	6.04	6.04	0.98038	.	0.214672	0.37437	N	0.002085	T	0.31327	0.0793	L	0.36672	1.1	0.80722	D	1	B	0.16603	0.018	B	0.18263	0.021	T	0.06770	-1.0808	9	.	.	.	-11.1019	16.5763	0.84648	1.0:0.0:0.0:0.0	.	219	P78332	RBM6_HUMAN	A	219;87	ENSP00000266022:D219A;ENSP00000396466:D87A	.	D	+	2	0	RBM6	49980518	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.804000	0.69135	2.317000	0.78254	0.459000	0.35465	GAT	-	NULL		0.448	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM6	protein_coding	OTTHUMT00000345528.4	A	NM_005777	-		50005514	+1	no_errors	ENST00000266022	ensembl	human	known	74_37	missense	SNP	0.978	C
RBM25	58517	genome.wustl.edu	37	14	73572607	73572608	+	Frame_Shift_Del	DEL	AG	AG	-	rs150988201		TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr14:73572607_73572608delAG	ENST00000261973.7	+	11	1480_1481	c.1195_1196delAG	c.(1195-1197)agafs	p.R399fs	RBM25_ENST00000527432.1_Frame_Shift_Del_p.R399fs	NM_021239.2	NP_067062.1	P49756	RBM25_HUMAN	RNA binding motif protein 25	399	Arg-rich.|Glu-rich.|Necessary for nuclear speckle localization.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of apoptotic process (GO:0042981)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(6)|ovary(2)|pancreas(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		agagcgggaaagagagagagag	0.446																																																	0								ENSG00000119707																																			RBM25	SO:0001589	frameshift_variant	0				HGNC	BX647116	CCDS32113.1	14q24.3	2013-02-12	2004-04-23	2004-04-29	ENSG00000119707	ENSG00000119707		"""RNA binding motif (RRM) containing"""	23244	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 94"""	612427	"""RNA-binding region (RNP1, RRM) containing 7"""	RNPC7		9847074, 7596406	Standard	NM_021239		Approved	S164, fSAP94, NET52, Snu71	uc001xno.3	P49756	OTTHUMG00000167540	ENST00000261973.7:c.1195_1196delAG	14.37:g.73572617_73572618delAG	ENSP00000261973:p.Arg399fs	Somatic	0	35	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	A0PJL9|B2RNA8|B3KT03|Q2TA72|Q5XJ17|Q6P665|Q9H6A1|Q9UEQ5|Q9UIE9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PWI_dom,pfam_RRM_dom,superfamily_PWI_dom,smart_RRM_dom,smart_PWI_dom,pfscan_RRM_dom	p.E402fs	ENST00000261973.7	37	c.1195_1196	CCDS32113.1	14																																																																																			-	NULL		0.446	RBM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM25	protein_coding	OTTHUMT00000394966.1	AG	XM_027330			73572608	+1	no_errors	ENST00000261973	ensembl	human	known	74_37	frame_shift_del	DEL	0.998:1.000	-
FAM91A3P	729182	genome.wustl.edu	37	1	149261581	149261581	+	lincRNA	SNP	G	G	C	rs77998576	byFrequency	TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr1:149261581G>C	ENST00000325963.8	+	0	1128																											TGAAGAGCTTGAGCATAACAC	0.408																																																	0								ENSG00000223779																																			RP11-403I13.4			0			-	Clone_based_vega_gene																													1.37:g.149261581G>C		Somatic	0	29	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	23	23.33		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000325963.8	37	NULL		1																																																																																			-	-		0.408	RP11-403I13.4-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC100293748	lincRNA	OTTHUMT00000099551.1	G		rs77998576		149261581	+1	no_errors	ENST00000325963	ensembl	human	known	74_37	rna	SNP	1.000	C
BCAN	63827	genome.wustl.edu	37	1	156616443	156616449	+	Intron	DEL	CCCTGGC	CCCTGGC	-	rs113490499|rs368082583|rs200291408|rs200678440	byFrequency	TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	CCCTGGC	CCCTGGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr1:156616443_156616449delCCCTGGC	ENST00000329117.5	+	3	427				RP11-284F21.10_ENST00000605886.1_RNA|RP11-284F21.7_ENST00000448869.1_RNA|BCAN_ENST00000361588.5_Intron	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican						carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGCTGCAGGAccctggcccctggcccc	0.686														1575	0.314497	0.1377	0.4352	5008	,	,		12797	0.3532		0.3549	False		,,,				2504	0.3865																0								ENSG00000229953																																			RP11-284F21.7	SO:0001627	intron_variant	0				Clone_based_vega_gene	BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.92-144CCCTGGC>-	1.37:g.156616450_156616456delCCCTGGC		Somatic	NA	NA	NA		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000329117.5	37	NULL	CCDS1149.1	1																																																																																			-	-		0.686	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000229953	protein_coding	OTTHUMT00000081844.2	CCCTGGC	NM_021948			156616449	-1	no_errors	ENST00000448869	ensembl	human	known	74_37	rna	DEL	0.040:0.040:0.040:0.039:0.037:0.036:0.008	-
SCN2A	6326	genome.wustl.edu	37	2	166187935	166187935	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr2:166187935A>G	ENST00000375437.2	+	14	2535	c.2245A>G	c.(2245-2247)Aaa>Gaa	p.K749E	SCN2A_ENST00000283256.6_Missense_Mutation_p.K749E|SCN2A_ENST00000357398.3_Missense_Mutation_p.K749E|SCN2A_ENST00000375427.2_Missense_Mutation_p.K749E	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	749					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GTTAAAGGTGAAACACCTTGT	0.418																																																	0								ENSG00000136531						194.0	168.0	177.0					2																	166187935		2203	4300	6503	SCN2A	SO:0001583	missense	0			-	HGNC	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.2245A>G	2.37:g.166187935A>G	ENSP00000364586:p.Lys749Glu	Somatic	0	71	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	50	41.86	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.K749E	ENST00000375437.2	37	c.2245	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	A	27.6	4.847885	0.91277	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.96830	-4.14;-4.14;-4.14;-4.14	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.98229	0.9414	M	0.87180	2.865	0.58432	D	0.999996	D;D	0.76494	0.999;0.997	D;D	0.79784	0.974;0.993	D	0.99342	1.0912	10	0.87932	D	0	.	15.6948	0.77488	1.0:0.0:0.0:0.0	.	749;749	Q99250-2;Q99250	.;SCN2A_HUMAN	E	749	ENSP00000364586:K749E;ENSP00000349973:K749E;ENSP00000283256:K749E;ENSP00000364576:K749E	ENSP00000283256:K749E	K	+	1	0	SCN2A	165896181	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.339000	0.96797	2.114000	0.64651	0.477000	0.44152	AAA	-	NULL		0.418	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	protein_coding	OTTHUMT00000102659.2	A	NM_021007	-		166187935	+1	no_errors	ENST00000283256	ensembl	human	known	74_37	missense	SNP	1.000	G
ACOT13	55856	genome.wustl.edu	37	6	24687908	24687908	+	Intron	DEL	A	A	-			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr6:24687908delA	ENST00000230048.4	+	2	274				ACOT13_ENST00000537591.1_5'UTR|ACOT13_ENST00000476436.1_3'UTR	NM_018473.3	NP_060943.1	Q9NPJ3	ACO13_HUMAN	acyl-CoA thioesterase 13						metabolic process (GO:0008152)|protein homotetramerization (GO:0051289)	cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA hydrolase activity (GO:0047617)			large_intestine(1)	1						AAGAAGACAGAAATGGTTAGA	0.363																																																	0								ENSG00000112304						187.0	171.0	176.0					6																	24687908		692	1591	2283	ACOT13	SO:0001627	intron_variant	0				HGNC	AF220186	CCDS4558.1, CCDS54972.1	6p22.1	2009-11-20	2009-05-05	2009-05-05	ENSG00000112304	ENSG00000112304		"""Acyl CoA thioesterases"""	20999	protein-coding gene	gene with protein product		615652	"""thioesterase superfamily member 2"""	THEM2		16934754, 19405909	Standard	NM_018473		Approved	HT012	uc003nek.3	Q9NPJ3	OTTHUMG00000014359	ENST00000230048.4:c.82-10203A>-	6.37:g.24687908delA		Somatic	0	24	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	18	40.00	F5H2L4|O95549	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000230048.4	37	NULL	CCDS4558.1	6																																																																																			-	-		0.363	ACOT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACOT13	protein_coding	OTTHUMT00000040010.2	A	NM_018473			24687908	+1	no_errors	ENST00000476436	ensembl	human	known	74_37	rna	DEL	0.636	-
PEPD	5184	genome.wustl.edu	37	19	33877912	33877913	+	3'UTR	INS	-	-	AAAGT	rs140842|rs10659604|rs398120965	byFrequency	TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr19:33877912_33877913insAAAGT	ENST00000244137.7	-	0	1852_1853				PEPD_ENST00000591968.1_5'UTR|PEPD_ENST00000397032.4_3'UTR	NM_000285.3	NP_000276.2	P12955	PEPD_HUMAN	peptidase D						cellular amino acid metabolic process (GO:0006520)|collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)	aminopeptidase activity (GO:0004177)|dipeptidase activity (GO:0016805)|manganese ion binding (GO:0030145)|metallocarboxypeptidase activity (GO:0004181)			endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	17	Esophageal squamous(110;0.137)					ATTTTTGACAGAAAGTATCAGA	0.342														1290	0.257588	0.4213	0.2133	5008	,	,		20834	0.1915		0.2515	False		,,,				2504	0.1421																0								ENSG00000124299																																			PEPD	SO:0001624	3_prime_UTR_variant	0				HGNC	BC015027	CCDS42544.1, CCDS54244.1, CCDS54245.1	19q13.11	2008-02-05				ENSG00000124299	3.4.13.9		8840	protein-coding gene	gene with protein product	"""prolidase"""	613230				2925654, 1972707	Standard	NM_000285		Approved		uc002nur.4	P12955		ENST00000244137.7:c.*338->ACTTT	19.37:g.33877913_33877917dupAAAGT		Somatic	NA	NA	NA		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K3Z1|A8K416|A8K696|A8MX47|B4DDB7|B4DGJ1|E9PCE8|Q8TBN9|Q9BT75	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000244137.7	37	NULL	CCDS42544.1	19																																																																																			-	-		0.342	PEPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEPD	protein_coding	OTTHUMT00000451432.3	-	NM_000285			33877913	-1	no_errors	ENST00000589598	ensembl	human	known	74_37	rna	INS	0.016:0.087	AAAGT
MED12	9968	genome.wustl.edu	37	X	70361098	70361100	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chrX:70361098_70361100delCAG	ENST00000374080.3	+	43	6318_6320	c.6286_6288delCAG	c.(6286-6288)cagdel	p.Q2115del	AL590764.1_ENST00000579622.1_RNA|MED12_ENST00000333646.6_In_Frame_Del_p.Q2118del|MED12_ENST00000374102.1_In_Frame_Del_p.Q2114del			Q93074	MED12_HUMAN	mediator complex subunit 12	2115	Gln-rich.				androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.Q2096delQ(2)		breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					gcaacagcaacagcagcagcagc	0.557			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																	Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	2	Deletion - In frame(2)	large_intestine(2)						ENSG00000184634			109,2865		8,79,14,1239,308						-0.5	0.8			13	174,4778		12,93,57,1759,1167	no	coding	MED12	NM_005120.2		20,172,71,2998,1475	A1A1,A1R,A1,RR,R		3.5137,3.6651,3.5705				283,7643				MED12	SO:0001651	inframe_deletion	0				HGNC	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.6286_6288delCAG	X.37:g.70361107_70361109delCAG	ENSP00000363193:p.Gln2115del	Somatic	0	44	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	29	9.38	O15410|O75557|Q9UHV6|Q9UND7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.Q2102in_frame_del	ENST00000374080.3	37	c.6295_6297	CCDS43970.1	X																																																																																			-	NULL		0.557	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	protein_coding	OTTHUMT00000057105.1	CAG	NM_005120			70361100	+1	no_errors	ENST00000333646	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:0.999	-
ARFGEF1	10565	genome.wustl.edu	37	8	68172143	68172144	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr8:68172143_68172144insTT	ENST00000262215.3	-	15	2530_2531	c.2141_2142insAA	c.(2140-2142)aagfs	p.K714fs	ARFGEF1_ENST00000520381.1_Frame_Shift_Ins_p.K168fs	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	714	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			GTATTCCTCTCTTTGGTTTCTT	0.342																																																	0								ENSG00000066777																																			ARFGEF1	SO:0001589	frameshift_variant	0				HGNC	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.2140_2141dupAA	8.37:g.68172144_68172145dupTT	ENSP00000262215:p.Lys714fs	Somatic	0	84	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	36	38.98	Q9NV46|Q9UFV2|Q9UNL0	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Sec7_dom,pfam_DUF1981_Sec7_assoc,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.G716fs	ENST00000262215.3	37	c.2142_2141	CCDS6199.1	8																																																																																			-	pfam_Sec7_dom,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom		0.342	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF1	protein_coding	OTTHUMT00000379441.4	-	NM_006421			68172144	-1	no_errors	ENST00000262215	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	TT
GRIA1	2890	genome.wustl.edu	37	5	152873487	152873487	+	Splice_Site	SNP	G	G	A			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr5:152873487G>A	ENST00000285900.5	+	2	425		c.e2-1		GRIA1_ENST00000518862.1_Splice_Site|GRIA1_ENST00000521843.2_Splice_Site|GRIA1_ENST00000448073.4_Splice_Site|GRIA1_ENST00000518142.1_Splice_Site|GRIA1_ENST00000340592.5_Splice_Site|GRIA1_ENST00000518783.1_Splice_Site	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1						ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	TTTTCTCATAGGGGGATTATT	0.463																																																	0								ENSG00000155511						109.0	107.0	107.0					5																	152873487		2203	4300	6503	GRIA1	SO:0001630	splice_region_variant	0			-	HGNC		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.83-1G>A	5.37:g.152873487G>A		Somatic	0	49	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e2-1	ENST00000285900.5	37	c.113-1	CCDS4322.1	5	.	.	.	.	.	.	.	.	.	.	G	15.41	2.825867	0.50739	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000340592;ENST00000518783;ENST00000448073	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3214	0.90239	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRIA1	152853680	1.000000	0.71417	0.996000	0.52242	0.699000	0.40488	7.604000	0.82830	2.548000	0.85928	0.655000	0.94253	.	-	-		0.463	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	protein_coding	OTTHUMT00000252456.3	G		-	Intron	152873487	+1	no_errors	ENST00000448073	ensembl	human	known	74_37	splice_site	SNP	1.000	A
SLC35F4	341880	genome.wustl.edu	37	14	58031030	58031030	+	Silent	SNP	G	G	T			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr14:58031030G>T	ENST00000339762.6	-	8	1388	c.1389C>A	c.(1387-1389)atC>atA	p.I463I	SLC35F4_ENST00000554729.1_Silent_p.I304I|SLC35F4_ENST00000556826.1_Silent_p.I427I			A4IF30	S35F4_HUMAN	solute carrier family 35, member F4	463					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|large_intestine(3)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ACCCAATGCAGATGATGATGG	0.468																																																	0								ENSG00000151812						71.0	71.0	71.0					14																	58031030		2024	4176	6200	SLC35F4	SO:0001819	synonymous_variant	0			-	HGNC			14q22.3	2013-05-22		2003-11-28	ENSG00000151812	ENSG00000151812		"""Solute carriers"""	19845	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 36"""	C14orf36			Standard	NM_001206920		Approved	FLJ37712	uc021rtp.1	A4IF30	OTTHUMG00000171317	ENST00000339762.6:c.1389C>A	14.37:g.58031030G>T		Somatic	0	37	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	A6NDQ3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DMT,pfam_SLC35_F1/F2/F6	p.I463	ENST00000339762.6	37	c.1389		14																																																																																			-	NULL		0.468	SLC35F4-201	KNOWN	basic	protein_coding	SLC35F4	protein_coding		G	XM_292260	-		58031030	-1	no_errors	ENST00000339762	ensembl	human	known	74_37	silent	SNP	1.000	T
KCNK10	54207	genome.wustl.edu	37	14	88652154	88652154	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr14:88652154C>T	ENST00000340700.5	-	7	1793	c.1342G>A	c.(1342-1344)Ggg>Agg	p.G448R	KCNK10_ENST00000319231.5_Missense_Mutation_p.G453R|KCNK10_ENST00000312350.5_Missense_Mutation_p.G453R	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	448					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.G448R(1)|p.G453R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						GAGGTGGACCCGAACTTGTTG	0.542																																																	2	Substitution - Missense(2)	breast(2)						ENSG00000100433						133.0	126.0	128.0					14																	88652154		2203	4300	6503	KCNK10	SO:0001583	missense	0			-	HGNC	AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.1342G>A	14.37:g.88652154C>T	ENSP00000343104:p.Gly448Arg	Somatic	0	141	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	39	43.48	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TASK	p.G453R	ENST00000340700.5	37	c.1357	CCDS9880.1	14	.	.	.	.	.	.	.	.	.	.	C	23.9	4.469234	0.84533	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231	D;D;D	0.96459	-3.99;-4.01;-4.02	5.71	5.71	0.89125	.	0.333272	0.31566	N	0.007436	D	0.97368	0.9139	L	0.46157	1.445	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.98045	1.0384	10	0.87932	D	0	.	18.8558	0.92251	0.0:1.0:0.0:0.0	.	448;453;453	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	R	448;453;453	ENSP00000343104:G448R;ENSP00000310568:G453R;ENSP00000312811:G453R	ENSP00000310568:G453R	G	-	1	0	KCNK10	87721907	1.000000	0.71417	0.991000	0.47740	0.965000	0.64279	7.487000	0.81328	2.709000	0.92574	0.655000	0.94253	GGG	-	NULL		0.542	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK10	protein_coding	OTTHUMT00000410167.1	C	NM_021161	-		88652154	-1	no_errors	ENST00000312350	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC7A2	6542	genome.wustl.edu	37	8	17422530	17422530	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr8:17422530G>T	ENST00000494857.1	+	13	2070	c.1852G>T	c.(1852-1854)Gaa>Taa	p.E618*	SLC7A2_ENST00000004531.10_Nonsense_Mutation_p.E658*|SLC7A2_ENST00000398090.3_Nonsense_Mutation_p.E657*|SLC7A2_ENST00000522656.1_Nonsense_Mutation_p.E618*|SLC7A2_ENST00000470360.1_Nonsense_Mutation_p.E657*	NM_001008539.3	NP_001008539.3	P52569	CTR2_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 2	618					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|macrophage activation (GO:0042116)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide production involved in inflammatory response (GO:0002537)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	basic amino acid transmembrane transporter activity (GO:0015174)|high-affinity arginine transmembrane transporter activity (GO:0005289)|L-lysine transmembrane transporter activity (GO:0015189)|L-ornithine transmembrane transporter activity (GO:0000064)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	25				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	AAACAATGAAGAAGATGCTTA	0.398																																																	0								ENSG00000003989						94.0	82.0	86.0					8																	17422530		2203	4300	6503	SLC7A2	SO:0001587	stop_gained	0			-	HGNC	D29990	CCDS6002.2, CCDS34852.1, CCDS55203.1	8p22	2013-05-22			ENSG00000003989	ENSG00000003989		"""Solute carriers"""	11060	protein-coding gene	gene with protein product		601872		ATRC2		8954799	Standard	NM_001164771		Approved	CAT-2, HCAT2	uc011kye.2	P52569	OTTHUMG00000130819	ENST00000494857.1:c.1852G>T	8.37:g.17422530G>T	ENSP00000419140:p.Glu618*	Somatic	0	39	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	B7ZL54|O15291|O15292|Q14CQ6|Q6NSZ7|Q86TC6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AA-permease/SLC12A_dom,tigrfam_Cat_AA_permease	p.E658*	ENST00000494857.1	37	c.1972	CCDS34852.1	8	.	.	.	.	.	.	.	.	.	.	G	21.6	4.166304	0.78339	.	.	ENSG00000003989	ENST00000494857;ENST00000522656;ENST00000470360;ENST00000004531;ENST00000398090	.	.	.	5.51	4.63	0.57726	.	0.959528	0.08722	N	0.903307	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	14.3073	0.66393	0.071:0.0:0.929:0.0	.	.	.	.	X	618;618;657;658;657	.	ENSP00000004531:E658X	E	+	1	0	SLC7A2	17466804	1.000000	0.71417	0.051000	0.19133	0.005000	0.04900	4.992000	0.63889	1.469000	0.48083	0.650000	0.86243	GAA	-	NULL		0.398	SLC7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A2	protein_coding	OTTHUMT00000253367.3	G	NM_003046	-		17422530	+1	no_errors	ENST00000004531	ensembl	human	known	74_37	nonsense	SNP	0.286	T
KIF27	55582	genome.wustl.edu	37	9	86530369	86530369	+	Silent	SNP	A	A	C			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr9:86530369A>C	ENST00000297814.2	-	2	281	c.138T>G	c.(136-138)acT>acG	p.T46T	KIF27_ENST00000334204.2_Silent_p.T46T|KIF27_ENST00000413982.1_Silent_p.T46T	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	46	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						CAAAATCAAAAGTGAAGACTC	0.378																																																	0								ENSG00000165115						53.0	56.0	55.0					9																	86530369		2202	4297	6499	KIF27	SO:0001819	synonymous_variant	0			-	HGNC	AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.138T>G	9.37:g.86530369A>C		Somatic	0	142	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	111	15.79	B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.T46	ENST00000297814.2	37	c.138	CCDS6665.1	9																																																																																			-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom		0.378	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF27	protein_coding	OTTHUMT00000052861.1	A	NM_017576	-		86530369	-1	no_errors	ENST00000297814	ensembl	human	known	74_37	silent	SNP	0.998	C
AP1G2	8906	genome.wustl.edu	37	14	24028936	24028936	+	3'UTR	SNP	T	T	A			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr14:24028936T>A	ENST00000308724.5	-	0	3135				RP11-66N24.3_ENST00000555968.1_RNA|AP1G2_ENST00000397120.3_3'UTR|RP11-66N24.4_ENST00000556354.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA|RP11-66N24.4_ENST00000555446.1_RNA|THTPA_ENST00000288014.6_3'UTR	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit						intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		ACAGGAGAATTTCAGGCTGTG	0.562											OREG0022604	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000157306						52.0	40.0	44.0					14																	24028936		2203	4300	6503	RP11-66N24.4	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene	AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.*22A>T	14.37:g.24028936T>A		Somatic	0	27	0.00	768	0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	D3DS51|O75504	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000308724.5	37	NULL	CCDS9602.1	14																																																																																			-	-		0.562	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	THTPA	protein_coding	OTTHUMT00000071812.4	T	NM_003917	-		24028936	+1	no_errors	ENST00000553985	ensembl	human	known	74_37	rna	SNP	0.011	A
GSTA5	221357	genome.wustl.edu	37	6	52705543	52705543	+	Silent	SNP	C	C	G			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr6:52705543C>G	ENST00000370989.2	-	1	98	c.69G>C	c.(67-69)ctG>ctC	p.L23L	GSTA5_ENST00000284562.2_Silent_p.L23L|GSTA5_ENST00000475052.1_5'UTR			Q7RTV2	GSTA5_HUMAN	glutathione S-transferase alpha 5	23	GST N-terminal.				glutathione metabolic process (GO:0006749)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)			endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Lung NSC(77;0.0912)				Glutathione(DB00143)	CAGCTGCAGCCAGGAGCCACC	0.473																																																	0								ENSG00000182793						115.0	109.0	111.0					6																	52705543		2203	4300	6503	GSTA5	SO:0001819	synonymous_variant	0			-	HGNC	BK000212	CCDS4946.1	6p12.2	2012-06-21	2008-11-26		ENSG00000182793	ENSG00000182793	2.5.1.18	"""Glutathione S-transferases / Soluble"""	19662	protein-coding gene	gene with protein product		607605	"""glutathione S-transferase A5"""			12042665	Standard	NM_153699		Approved		uc003pba.1	Q7RTV2	OTTHUMG00000014857	ENST00000370989.2:c.69G>C	6.37:g.52705543C>G		Somatic	0	67	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	31	36.73	Q5SZC2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_GST_alpha	p.L23	ENST00000370989.2	37	c.69	CCDS4946.1	6																																																																																			-	pfam_Glutathione_S-Trfase_N,superfamily_Thioredoxin-like_fold,prints_GST_alpha		0.473	GSTA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTA5	protein_coding	OTTHUMT00000040917.1	C	NM_153699	-		52705543	-1	no_errors	ENST00000284562	ensembl	human	known	74_37	silent	SNP	1.000	G
CLCN1	1180	genome.wustl.edu	37	7	143042676	143042676	+	Silent	SNP	C	C	T			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr7:143042676C>T	ENST00000343257.2	+	17	2080	c.1993C>T	c.(1993-1995)Ctg>Ttg	p.L665L		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	665	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					GCAGCGCCACCTGTGTCCTGA	0.687											OREG0018402	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000188037						14.0	11.0	12.0					7																	143042676		2127	4159	6286	CLCN1	SO:0001819	synonymous_variant	0			-	HGNC	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.1993C>T	7.37:g.143042676C>T		Somatic	0	174	0.00	1676	0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	62	87	41.61	A4D2H5|Q2M202	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cl-channel_volt-gated,pfam_CBS_dom,superfamily_Cl-channel_core,prints_Cl-channel_volt-gated,prints_Cl_channel-1	p.L665	ENST00000343257.2	37	c.1993	CCDS5881.1	7																																																																																			-	NULL		0.687	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN1	protein_coding	OTTHUMT00000327420.1	C	NM_000083	-		143042676	+1	no_errors	ENST00000343257	ensembl	human	known	74_37	silent	SNP	0.998	T
FRMPD4	9758	genome.wustl.edu	37	X	12736131	12736131	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chrX:12736131T>G	ENST00000380682.1	+	16	3692	c.3186T>G	c.(3184-3186)agT>agG	p.S1062R		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	1062					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						AGGAGGCCAGTGGTAAATTTG	0.512																																																	0								ENSG00000169933						108.0	90.0	96.0					X																	12736131		2203	4300	6503	FRMPD4	SO:0001583	missense	0			-	HGNC	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.3186T>G	X.37:g.12736131T>G	ENSP00000370057:p.Ser1062Arg	Somatic	0	11	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	9	59.09	A8K0X9|O15032	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ,pfscan_WW_dom	p.S1062R	ENST00000380682.1	37	c.3186	CCDS35201.1	X	.	.	.	.	.	.	.	.	.	.	T	8.333	0.826946	0.16749	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.05649	3.41	5.49	3.01	0.34805	.	0.366185	0.31821	N	0.007003	T	0.02767	0.0083	N	0.08118	0	0.21675	N	0.999596	B;B	0.19583	0.037;0.015	B;B	0.15052	0.012;0.012	T	0.41734	-0.9492	10	0.46703	T	0.11	-3.6168	1.7736	0.03017	0.4694:0.1333:0.0805:0.3168	.	1054;1062	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	R	1062;1053;1051	ENSP00000370057:S1062R	ENSP00000304583:S1051R	S	+	3	2	FRMPD4	12646052	1.000000	0.71417	0.867000	0.34043	0.871000	0.50021	2.119000	0.41958	0.219000	0.20840	0.486000	0.48141	AGT	-	NULL		0.512	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD4	protein_coding	OTTHUMT00000055771.1	T	XM_045712	-		12736131	+1	no_errors	ENST00000380682	ensembl	human	known	74_37	missense	SNP	0.624	G
TRPM1	4308	genome.wustl.edu	37	15	31339353	31339353	+	Silent	SNP	G	G	A			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr15:31339353G>A	ENST00000256552.6	-	15	1872	c.1725C>T	c.(1723-1725)aaC>aaT	p.N575N	TRPM1_ENST00000397795.2_Silent_p.N553N|TRPM1_ENST00000542188.1_Silent_p.N592N	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		GGGTCCGAAAGTTTTTCCGAG	0.522																																																	0								ENSG00000134160						113.0	114.0	113.0					15																	31339353		1965	4142	6107	TRPM1	SO:0001819	synonymous_variant	0			-	HGNC	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.1725C>T	15.37:g.31339353G>A		Somatic	0	87	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	43	39.73		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom	p.N592	ENST00000256552.6	37	c.1776	CCDS58346.1	15																																																																																			-	NULL		0.522	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	TRPM1	protein_coding	OTTHUMT00000417166.2	G	NM_002420	-		31339353	-1	no_errors	ENST00000542188	ensembl	human	known	74_37	silent	SNP	0.749	A
BAHCC1	57597	genome.wustl.edu	37	17	79426613	79426613	+	Missense_Mutation	SNP	C	C	T	rs374689780		TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr17:79426613C>T	ENST00000307745.7	+	27	5888	c.5888C>T	c.(5887-5889)cCg>cTg	p.P1963L	RP11-1055B8.8_ENST00000572590.1_RNA																							TGTCTGTACCCGGGCAACGTG	0.657																																																	0								ENSG00000171282	C	LEU/PRO	0,4028		0,0,2014	45.0	52.0	50.0		5717	4.9	0.8	17		50	1,8331		0,1,4165	no	missense	BAHCC1	NM_001080519.2	98	0,1,6179	TT,TC,CC		0.012,0.0,0.0081	probably-damaging	1906/2552	79426613	1,12359	2014	4166	6180	RP11-1055B8.7	SO:0001583	missense	0			-	Clone_based_vega_gene																												ENST00000307745.7:c.5888C>T	17.37:g.79426613C>T	ENSP00000303486:p.Pro1963Leu	Somatic	0	69	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	23	53.85		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.P1963L	ENST00000307745.7	37	c.5888		17	.	.	.	.	.	.	.	.	.	.	C	23.6	4.433674	0.83776	0.0	1.2E-4	ENSG00000171282	ENST00000307745	T	0.51574	0.7	4.9	4.9	0.64082	.	0.000000	0.64402	D	0.000012	T	0.67841	0.2936	M	0.71206	2.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.965;0.996	T	0.72157	-0.4375	10	0.87932	D	0	.	15.5589	0.76223	0.0:1.0:0.0:0.0	.	1963;1963	Q9P281;F8WBW8	BAHC1_HUMAN;.	L	1963	ENSP00000303486:P1963L	ENSP00000303486:P1963L	P	+	2	0	AC110285.1	77041208	1.000000	0.71417	0.806000	0.32338	0.768000	0.43524	5.275000	0.65575	2.273000	0.75805	0.561000	0.74099	CCG	-	NULL		0.657	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	BAHCC1	protein_coding		C		-		79426613	+1	no_errors	ENST00000307745	ensembl	human	known	74_37	missense	SNP	0.998	T
HIPK1	204851	genome.wustl.edu	37	1	114515911	114515911	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr1:114515911G>A	ENST00000369558.1	+	16	3642	c.3410G>A	c.(3409-3411)gGt>gAt	p.G1137D	HIPK1_ENST00000340480.4_Missense_Mutation_p.G763D|HIPK1_ENST00000426820.2_Missense_Mutation_p.G1137D|HIPK1_ENST00000369561.4_Missense_Mutation_p.G1103D|HIPK1_ENST00000369554.2_Missense_Mutation_p.G1092D|HIPK1_ENST00000369553.1_Missense_Mutation_p.G743D|HIPK1_ENST00000369555.2_Missense_Mutation_p.G1092D|HIPK1_ENST00000406344.1_Missense_Mutation_p.G743D			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	1137					anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCCCCACAGGGTTCCTCAAGG	0.582																																																	0								ENSG00000163349						185.0	152.0	163.0					1																	114515911		2203	4300	6503	HIPK1	SO:0001583	missense	0			-	HGNC	AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.3410G>A	1.37:g.114515911G>A	ENSP00000358571:p.Gly1137Asp	Somatic	0	34	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	29	43.14	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G1137D	ENST00000369558.1	37	c.3410	CCDS867.1	1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.315087	0.81358	.	.	ENSG00000163349	ENST00000426820;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000340480;ENST00000369553;ENST00000406344	T;T;T;T;T;T;T;T;T	0.58797	0.31;0.38;0.34;0.34;0.38;0.33;3.39;2.48;2.48	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000001	T	0.67524	0.2902	L	0.50333	1.59	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.994;0.995;0.998	T	0.63088	-0.6715	10	0.40728	T	0.16	.	20.099	0.97865	0.0:0.0:1.0:0.0	.	429;743;1137	E9PCF6;Q86Z02-4;Q86Z02	.;.;HIPK1_HUMAN	D	1208;1137;1092;1092;1137;1103;763;743;743	ENSP00000407442:G1208D;ENSP00000409673:G1137D;ENSP00000358567:G1092D;ENSP00000358568:G1092D;ENSP00000358571:G1137D;ENSP00000358574:G1103D;ENSP00000340956:G763D;ENSP00000358566:G743D;ENSP00000384960:G743D	ENSP00000340956:G763D	G	+	2	0	HIPK1	114317434	1.000000	0.71417	0.999000	0.59377	0.927000	0.56198	7.601000	0.82783	2.752000	0.94435	0.655000	0.94253	GGT	-	NULL		0.582	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HIPK1	protein_coding	OTTHUMT00000033127.1	G	NM_198268	-		114515911	+1	no_errors	ENST00000369558	ensembl	human	known	74_37	missense	SNP	1.000	A
FCGBP	8857	genome.wustl.edu	37	19	40363977	40363977	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr19:40363977T>G	ENST00000221347.6	-	31	14672	c.14665A>C	c.(14665-14667)Aag>Cag	p.K4889Q		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4889	VWFD 12. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TCCCCAGGCTTTGGGTGGCAG	0.587																																																	0								ENSG00000090920						91.0	79.0	83.0					19																	40363977		2203	4300	6503	FCGBP	SO:0001583	missense	0			-	HGNC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.14665A>C	19.37:g.40363977T>G	ENSP00000221347:p.Lys4889Gln	Somatic	0	58	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	29	46.30	O95784	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.K4889Q	ENST00000221347.6	37	c.14665	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	T	0.422	-0.907770	0.02434	.	.	ENSG00000090920	ENST00000221347	T	0.58652	0.32	5.04	-2.98	0.05513	von Willebrand factor, type D domain (3);	1.225820	0.05890	N	0.628026	T	0.38852	0.1056	N	0.13168	0.305	0.09310	N	1	B	0.24963	0.115	B	0.33960	0.173	T	0.34354	-0.9832	10	0.12430	T	0.62	.	8.5975	0.33725	0.0:0.2954:0.4158:0.2888	.	4889	Q9Y6R7	FCGBP_HUMAN	Q	4889	ENSP00000221347:K4889Q	ENSP00000221347:K4889Q	K	-	1	0	FCGBP	45055817	0.004000	0.15560	0.001000	0.08648	0.040000	0.13550	-0.088000	0.11198	-0.727000	0.04888	0.260000	0.18958	AAG	-	pfam_VWF_type-D,smart_VWF_type-D		0.587	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	protein_coding	OTTHUMT00000462507.1	T	NM_003890	-		40363977	-1	no_errors	ENST00000221347	ensembl	human	known	74_37	missense	SNP	0.000	G
RIOK1	83732	genome.wustl.edu	37	6	7405562	7405562	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr6:7405562G>T	ENST00000379834.2	+	12	1684	c.1177G>T	c.(1177-1179)Gag>Tag	p.E393*		NM_031480.2|NM_153005.1	NP_113668.2|NP_694550.1	Q9BRS2	RIOK1_HUMAN	RIO kinase 1	393	Protein kinase.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19	Ovarian(93;0.0418)					CATTACACATGAGAACATGGA	0.433																																																	0								ENSG00000124784						86.0	72.0	76.0					6																	7405562		2203	4300	6503	RIOK1	SO:0001587	stop_gained	0			-	HGNC	BC006104	CCDS4500.1	6p24.3	2012-12-10	2012-12-10		ENSG00000124784	ENSG00000124784			18656	protein-coding gene	gene with protein product			"""RIO kinase 1 (yeast)"""				Standard	NM_031480		Approved	AD034, FLJ30006, bA288G3.1, RRP10	uc003mxn.3	Q9BRS2	OTTHUMG00000014207	ENST00000379834.2:c.1177G>T	6.37:g.7405562G>T	ENSP00000369162:p.Glu393*	Somatic	0	36	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	B2RB28|Q8NDC8|Q96NV9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RIO-like_kinase,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_RIO_kinase,pirsf_Ser/Thr_kinase_Rio1	p.E393*	ENST00000379834.2	37	c.1177	CCDS4500.1	6	.	.	.	.	.	.	.	.	.	.	G	42	9.294451	0.99128	.	.	ENSG00000124784	ENST00000379834	.	.	.	5.57	5.57	0.84162	.	0.374342	0.31472	N	0.007582	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-19.0914	18.5311	0.90992	0.0:0.0:1.0:0.0	.	.	.	.	X	393	.	ENSP00000369162:E393X	E	+	1	0	RIOK1	7350561	1.000000	0.71417	0.950000	0.38849	0.961000	0.63080	3.203000	0.51075	2.615000	0.88500	0.557000	0.71058	GAG	-	pirsf_Ser/Thr_kinase_Rio1		0.433	RIOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIOK1	protein_coding	OTTHUMT00000039780.2	G	NM_031480	-		7405562	+1	no_errors	ENST00000379834	ensembl	human	known	74_37	nonsense	SNP	0.991	T
FAM86B2	653333	genome.wustl.edu	37	8	12283473	12283473	+	Silent	SNP	C	C	T			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr8:12283473C>T	ENST00000262365.4	-	8	917	c.918G>A	c.(916-918)gcG>gcA	p.A306A	FAM86B2_ENST00000351291.4_Silent_p.A272A|FAM86B2_ENST00000393715.3_Missense_Mutation_p.G126R|FAM86B2_ENST00000309608.5_3'UTR|AC087203.1_ENST00000580058.1_RNA	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2	306										endometrium(1)|kidney(2)	3						GATGAGCTTCCGCTTCCCATC	0.527																																																	0								ENSG00000145002						2.0	2.0	2.0					8																	12283473		521	1081	1602	FAM86B2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.918G>A	8.37:g.12283473C>T		Somatic	0	43	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	33	13.16		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G126R	ENST00000262365.4	37	c.376	CCDS59092.1	8	.	.	.	.	.	.	.	.	.	.	-	0.010	-1.795600	0.00617	.	.	ENSG00000145002	ENST00000393715	T	0.34072	1.38	2.22	-4.44	0.03557	.	.	.	.	.	T	0.12263	0.0298	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.29181	-1.0020	5	0.07175	T	0.84	.	4.0137	0.09634	0.0:0.4192:0.2034:0.3774	.	.	.	.	R	126	ENSP00000377318:G126R	ENSP00000377318:G126R	G	-	1	0	FAM86B2	12327844	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-4.923000	0.00169	-1.939000	0.01044	-1.565000	0.00878	GGA	-	NULL		0.527	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86B2	protein_coding		C	XM_928336	-		12283473	-1	no_errors	ENST00000393715	ensembl	human	known	74_37	missense	SNP	0.000	T
BAIAP2L2	80115	genome.wustl.edu	37	22	38483155	38483156	+	In_Frame_Ins	INS	-	-	TCATGGGTG	rs132924|rs142739979	byFrequency	TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr22:38483155_38483156insTCATGGGTG	ENST00000381669.3	-	11	1378_1379	c.1234_1235insCACCCATGA	c.(1234-1236)aac>aCACCCATGAac	p.411_412insTPM	CTA-228A9.3_ENST00000609162.1_lincRNA	NM_025045.4	NP_079321.3	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	411				M -> MTPM (in Ref. 3; AAH15619). {ECO:0000305}.	filopodium assembly (GO:0046847)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|signal transduction (GO:0007165)	cell-cell contact zone (GO:0044291)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	phospholipid binding (GO:0005543)			large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	8	Melanoma(58;0.045)					GTTCCCggggttcatgggtgtc	0.653														1505	0.300519	0.2814	0.3602	5008	,	,		13633	0.1796		0.3529	False		,,,				2504	0.3548																0								ENSG00000128298			1032,2628		159,714,957						-3.7	0.0		dbSNP_130	29	2800,5058		480,1840,1609	no	coding	BAIAP2L2	NM_025045.4		639,2554,2566	A1A1,A1R,RR		35.6325,28.1967,33.2697				3832,7686				BAIAP2L2	SO:0001652	inframe_insertion	0				HGNC	BC015619	CCDS43018.1	22q13.1	2005-02-09			ENSG00000128298	ENSG00000128298			26203	protein-coding gene	gene with protein product							Standard	NM_025045		Approved	FLJ22582	uc003auw.3	Q6UXY1	OTTHUMG00000151197	ENST00000381669.3:c.1226_1234dupCACCCATGA	22.37:g.38483156_38483164dupTCATGGGTG	ENSP00000371085:p.Thr409_Met411dup	Somatic	NA	NA	NA		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B0QYE2|Q96BG7	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_IRSp53/MIM_homology_IMD,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.412in_frame_insTPM	ENST00000381669.3	37	c.1235_1234	CCDS43018.1	22																																																																																			-	NULL		0.653	BAIAP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAIAP2L2	protein_coding	OTTHUMT00000321727.1	-	NM_025045			38483156	-1	no_errors	ENST00000381669	ensembl	human	known	74_37	in_frame_ins	INS	0.001:0.006	TCATGGGTG
PCNXL3	399909	genome.wustl.edu	37	11	65402801	65402801	+	Missense_Mutation	SNP	G	G	A	rs375106937		TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr11:65402801G>A	ENST00000355703.3	+	31	5605	c.5066G>A	c.(5065-5067)aGc>aAc	p.S1689N	MIR4690_ENST00000578459.1_RNA|SIPA1_ENST00000534313.1_5'Flank	NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1689						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						GCATGGCGCAGCGCCATCCTC	0.612																																																	0								ENSG00000197136	G	ASN/SER	0,4124		0,0,2062	23.0	24.0	24.0		5066	4.0	1.0	11		24	1,8353		0,1,4176	no	missense	PCNXL3	NM_032223.2	46	0,1,6238	AA,AG,GG		0.012,0.0,0.0080	probably-damaging	1689/2035	65402801	1,12477	2062	4177	6239	PCNXL3	SO:0001583	missense	0			-	HGNC	BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.5066G>A	11.37:g.65402801G>A	ENSP00000347931:p.Ser1689Asn	Somatic	0	10	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	14	39.13	Q6MZN8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pecanex	p.S1689N	ENST00000355703.3	37	c.5066	CCDS44650.1	11	.	.	.	.	.	.	.	.	.	.	G	14.30	2.494225	0.44352	0.0	1.2E-4	ENSG00000197136	ENST00000355703	T	0.42131	0.98	4.03	4.03	0.46877	.	0.000000	0.85682	D	0.000000	T	0.35595	0.0937	N	0.12637	0.245	0.37096	D	0.899669	B;D	0.58268	0.038;0.982	B;P	0.54629	0.062;0.757	T	0.25328	-1.0135	10	0.19590	T	0.45	.	13.7058	0.62639	0.0:0.0:1.0:0.0	.	576;1689	Q9H6A9-3;Q9H6A9	.;PCX3_HUMAN	N	1689	ENSP00000347931:S1689N	ENSP00000347931:S1689N	S	+	2	0	PCNXL3	65159377	1.000000	0.71417	0.998000	0.56505	0.973000	0.67179	5.827000	0.69300	2.097000	0.63578	0.462000	0.41574	AGC	-	pfam_Pecanex		0.612	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL3	protein_coding	OTTHUMT00000390321.1	G	NM_032223	-		65402801	+1	no_errors	ENST00000355703	ensembl	human	known	74_37	missense	SNP	1.000	A
FAM46A	55603	genome.wustl.edu	37	6	82459945	82459945	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr6:82459945C>G	ENST00000320172.6	-	3	1110	c.796G>C	c.(796-798)Ggc>Cgc	p.G266R	FAM46A_ENST00000369756.3_Missense_Mutation_p.G347R|FAM46A_ENST00000369754.3_Missense_Mutation_p.G285R	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	266					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		TGGAAATCGCCATAGACGCTC	0.453																																																	0								ENSG00000112773						70.0	75.0	73.0					6																	82459945		2203	4300	6503	FAM46A	SO:0001583	missense	0			-	HGNC	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.796G>C	6.37:g.82459945C>G	ENSP00000318298:p.Gly266Arg	Somatic	0	55	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	23	47.73	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1693	p.G285R	ENST00000320172.6	37	c.853	CCDS34489.1	6	.	.	.	.	.	.	.	.	.	.	C	19.77	3.889828	0.72524	.	.	ENSG00000112773	ENST00000369754;ENST00000320172;ENST00000369756	T;T;T	0.51574	0.7;0.7;0.7	5.95	5.95	0.96441	Domain of unknown function DUF1693 (1);	0.000000	0.85682	D	0.000000	T	0.74238	0.3690	M	0.91090	3.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.78919	-0.2014	10	0.87932	D	0	-18.8827	20.3932	0.98965	0.0:1.0:0.0:0.0	.	266;285	Q96IP4;Q96IP4-2	FA46A_HUMAN;.	R	285;266;347	ENSP00000358769:G285R;ENSP00000318298:G266R;ENSP00000358771:G347R	ENSP00000318298:G266R	G	-	1	0	FAM46A	82516664	1.000000	0.71417	0.984000	0.44739	0.730000	0.41778	7.818000	0.86416	2.824000	0.97209	0.655000	0.94253	GGC	-	pfam_DUF1693		0.453	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM46A	protein_coding	OTTHUMT00000041331.1	C		-		82459945	-1	no_errors	ENST00000369754	ensembl	human	known	74_37	missense	SNP	1.000	G
PIK3C2B	5287	genome.wustl.edu	37	1	204419217	204419218	+	Intron	INS	-	-	AGGCTG	rs61762615|rs371889705	byFrequency	TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr1:204419217_204419218insAGGCTG	ENST00000367187.3	-	14	2623				PIK3C2B_ENST00000424712.2_Intron	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta						phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			CCCAGGAAGTCAGGCTGAGGCT	0.579														84	0.0167732	0.0015	0.0202	5008	,	,		19362	0.0		0.0368	False		,,,				2504	0.0317																0								ENSG00000133056																																			PIK3C2B	SO:0001627	intron_variant	0				HGNC	Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.2067-72->CAGCCT	1.37:g.204419218_204419223dupAGGCTG		Somatic	NA	NA	NA		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O95666|Q5SW99	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000367187.3	37	NULL	CCDS1446.1	1																																																																																			-	-		0.579	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2B	protein_coding	OTTHUMT00000087965.1	-	NM_002646			204419218	-1	no_errors	ENST00000479079	ensembl	human	known	74_37	rna	INS	0.000:0.000	AGGCTG
CEP85	64793	genome.wustl.edu	37	1	26603636	26603636	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr1:26603636C>A	ENST00000252992.4	+	14	2272	c.2141C>A	c.(2140-2142)cCa>cAa	p.P714Q	CEP85_ENST00000451429.2_Missense_Mutation_p.P663Q|CEP85_ENST00000469609.1_3'UTR|SH3BGRL3_ENST00000270792.5_5'Flank|SH3BGRL3_ENST00000319041.6_5'Flank	NM_001281517.1|NM_022778.2	NP_001268446.1|NP_073615.2	Q6P2H3	CEP85_HUMAN	centrosomal protein 85kDa	714						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|spindle pole (GO:0000922)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(11)|skin(2)	25						GCACAGCACCCAGAGACTCAG	0.468																																																	0								ENSG00000130695						190.0	185.0	187.0					1																	26603636		2203	4300	6503	CEP85	SO:0001583	missense	0			-	HGNC	AK024038	CCDS277.1, CCDS60038.1	1p36.11	2014-02-20	2011-05-06	2011-05-06	ENSG00000130695	ENSG00000130695			25309	protein-coding gene	gene with protein product			"""coiled-coil domain containing 21"""	CCDC21		12477932	Standard	NM_022778		Approved	DKFZP434L0117	uc001bls.1	Q6P2H3	OTTHUMG00000003380	ENST00000252992.4:c.2141C>A	1.37:g.26603636C>A	ENSP00000252992:p.Pro714Gln	Somatic	0	37	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	B4DRL1|D3DPK4|F8W7K4|Q5VY68|Q5VY70|Q9H6Q1|Q9H828|Q9UF52	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P714Q	ENST00000252992.4	37	c.2141	CCDS277.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.30|14.30	2.492996|2.492996	0.44352|0.44352	.|.	.|.	ENSG00000130695|ENSG00000130695	ENST00000451429;ENST00000252992|ENST00000453146	T;T|.	0.11063|.	2.81;2.81|.	5.92|5.92	4.02|4.02	0.46733|0.46733	.|.	0.442609|.	0.26092|.	N|.	0.026393|.	T|T	0.41789|0.41789	0.1174|0.1174	L|L	0.47716|0.47716	1.5|1.5	0.09310|0.09310	N|N	1|1	P;D;P|.	0.54397|.	0.928;0.966;0.928|.	P;P;P|.	0.53593|.	0.543;0.648;0.73|.	T|T	0.25984|0.25984	-1.0116|-1.0116	10|5	0.27082|.	T|.	0.32|.	-3.3649|-3.3649	9.1051|9.1051	0.36692|0.36692	0.1471:0.7797:0.0:0.0731|0.1471:0.7797:0.0:0.0731	.|.	663;714;713|.	F8W7K4;Q6P2H3;Q6P2H3-2|.	.;CEP85_HUMAN;.|.	Q|K	663;714|387	ENSP00000417002:P663Q;ENSP00000252992:P714Q|.	ENSP00000252992:P714Q|.	P|Q	+|+	2|1	0|0	CEP85|CEP85	26476223|26476223	0.003000|0.003000	0.15002|0.15002	1.000000|1.000000	0.80357|0.80357	0.303000|0.303000	0.27691|0.27691	1.387000|1.387000	0.34430|0.34430	1.474000|1.474000	0.48178|0.48178	0.561000|0.561000	0.74099|0.74099	CCA|CAG	-	NULL		0.468	CEP85-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	CEP85	protein_coding	OTTHUMT00000009492.2	C	NM_022778	-		26603636	+1	no_errors	ENST00000252992	ensembl	human	known	74_37	missense	SNP	0.113	A
RXFP3	51289	genome.wustl.edu	37	5	33937261	33937261	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr5:33937261C>T	ENST00000330120.3	+	1	771	c.416C>T	c.(415-417)gCg>gTg	p.A139V		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	139					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)			endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						CCCTTCTGGGCGGTGGAGAAC	0.552																																																	0								ENSG00000182631						136.0	123.0	127.0					5																	33937261		2203	4300	6503	RXFP3	SO:0001583	missense	0			-	HGNC	D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.416C>T	5.37:g.33937261C>T	ENSP00000328708:p.Ala139Val	Somatic	0	46	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	21	46.15	Q14DA5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Formyl_pep_rcpt	p.A139V	ENST00000330120.3	37	c.416	CCDS3900.1	5	.	.	.	.	.	.	.	.	.	.	C	33	5.269589	0.95429	.	.	ENSG00000182631	ENST00000330120	T	0.18338	2.22	5.72	5.72	0.89469	GPCR, rhodopsin-like superfamily (1);	0.052019	0.85682	N	0.000000	T	0.38026	0.1025	L	0.45422	1.42	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.04811	-1.0925	10	0.87932	D	0	-26.0635	19.8764	0.96873	0.0:1.0:0.0:0.0	.	139	Q9NSD7	RL3R1_HUMAN	V	139	ENSP00000328708:A139V	ENSP00000328708:A139V	A	+	2	0	RXFP3	33973018	1.000000	0.71417	0.960000	0.40013	0.982000	0.71751	4.902000	0.63266	2.700000	0.92200	0.650000	0.86243	GCG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Formyl_pep_rcpt		0.552	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RXFP3	protein_coding	OTTHUMT00000207369.1	C	NM_016568	-		33937261	+1	no_errors	ENST00000330120	ensembl	human	known	74_37	missense	SNP	1.000	T
SCFD1	23256	genome.wustl.edu	37	14	31091601	31091601	+	Silent	SNP	G	G	A			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr14:31091601G>A	ENST00000458591.2	+	1	284	c.57G>A	c.(55-57)caG>caA	p.Q19Q	SCFD1_ENST00000541123.1_5'UTR|SCFD1_ENST00000396629.2_5'UTR|SCFD1_ENST00000544052.2_5'UTR|SCFD1_ENST00000421551.3_5'UTR	NM_016106.3	NP_057190.2	Q8WVM8	SCFD1_HUMAN	sec1 family domain containing 1	19					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|response to hypoxia (GO:0001666)|response to toxic substance (GO:0009636)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle docking involved in exocytosis (GO:0006904)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi transport complex (GO:0017119)|Golgi-associated vesicle (GO:0005798)|plasma membrane (GO:0005886)	syntaxin binding (GO:0019905)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)	13	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		GGGAAAGGCAGACAGGTACTG	0.632																																																	0								ENSG00000092108						87.0	62.0	71.0					14																	31091601		2116	4109	6225	SCFD1	SO:0001819	synonymous_variant	0			-	HGNC	AF110646	CCDS9639.1, CCDS45092.1, CCDS58308.1	14q12	2006-04-04	2004-01-15	2004-01-16	ENSG00000092108	ENSG00000092108			20726	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 163"""	C14orf163			Standard	NM_016106		Approved	RA410, KIAA0917, STXBP1L2, SLY1	uc001wqm.2	Q8WVM8	OTTHUMG00000029420	ENST00000458591.2:c.57G>A	14.37:g.31091601G>A		Somatic	0	92	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	44	44.30	A8K2Z5|B7Z4U7|B7Z594|O60754|O94990|Q7Z529|Q9BZI3|Q9UNL3|Q9Y6A8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sec1-like,superfamily_Sec1-like	p.Q19	ENST00000458591.2	37	c.57	CCDS9639.1	14																																																																																			-	superfamily_Sec1-like		0.632	SCFD1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SCFD1	protein_coding	OTTHUMT00000276612.3	G	NM_182835	-		31091601	+1	no_errors	ENST00000458591	ensembl	human	known	74_37	silent	SNP	1.000	A
KDELC1	79070	genome.wustl.edu	37	13	103436678	103436678	+	3'UTR	SNP	T	T	A			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr13:103436678T>A	ENST00000376004.4	-	0	2012				KDELC1_ENST00000460338.1_5'UTR	NM_024089.2	NP_076994.2	Q6UW63	KDEL1_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 1							endoplasmic reticulum lumen (GO:0005788)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(1)	19	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					AAAATGTACTTTAAAGTACAG	0.294																																																	0								ENSG00000134901																																			KDELC1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC001297	CCDS9504.1	13q33	2010-11-18			ENSG00000134901	ENSG00000134901			19350	protein-coding gene	gene with protein product		611613					Standard	NM_024089		Approved	MGC5302, EP58	uc001vpq.4	Q6UW63	OTTHUMG00000017307	ENST00000376004.4:c.*167A>T	13.37:g.103436678T>A		Somatic	0	26	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	14	41.67	Q53HL3|Q9BVD2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376004.4	37	NULL	CCDS9504.1	13																																																																																			-	-		0.294	KDELC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELC1	protein_coding	OTTHUMT00000045699.1	T		-		103436678	-1	no_errors	ENST00000460338	ensembl	human	known	74_37	rna	SNP	0.121	A
TRIOBP	11078	genome.wustl.edu	37	22	38155238	38155238	+	Silent	SNP	G	G	A			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr22:38155238G>A	ENST00000406386.3	+	17	6546	c.6291G>A	c.(6289-6291)gaG>gaA	p.E2097E	TRIOBP_ENST00000403663.2_Silent_p.E384E|TRIOBP_ENST00000407319.2_Silent_p.E384E	NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	2097					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GATCCCAGGAGGATGGCCACA	0.617																																																	0								ENSG00000100106						29.0	33.0	31.0					22																	38155238		2201	4299	6500	TRIOBP	SO:0001819	synonymous_variant	0			-	HGNC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.6291G>A	22.37:g.38155238G>A		Somatic	0	38	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	12	63.64	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E2097	ENST00000406386.3	37	c.6291	CCDS43015.1	22																																																																																			-	NULL		0.617	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	protein_coding	OTTHUMT00000319439.2	G		-		38155238	+1	no_errors	ENST00000406386	ensembl	human	known	74_37	silent	SNP	0.999	A
LGALS12	85329	genome.wustl.edu	37	11	63276351	63276351	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr11:63276351G>C	ENST00000394618.3	+	3	617	c.326G>C	c.(325-327)tGc>tCc	p.C109S	LGALS12_ENST00000340246.5_Missense_Mutation_p.C110S|LGALS12_ENST00000255684.5_Missense_Mutation_p.C109S|LGALS12_ENST00000415491.2_Missense_Mutation_p.C48S|LGALS12_ENST00000425950.2_Missense_Mutation_p.C48S	NM_001142535.1|NM_033101.3	NP_001136007.1|NP_149092.2	Q96DT0	LEG12_HUMAN	lectin, galactoside-binding, soluble, 12	109	Galectin 1. {ECO:0000255|PROSITE- ProRule:PRU00639}.				intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	16						CATGTCATCTGCAACACCCTG	0.602																																																	0								ENSG00000133317						81.0	80.0	80.0					11																	63276351		2201	4298	6499	LGALS12	SO:0001583	missense	0			-	HGNC	AF222695	CCDS8045.1, CCDS44633.1, CCDS44634.1, CCDS44635.1, CCDS53648.1	11q13	2011-08-04	2008-07-25		ENSG00000133317	ENSG00000133317		"""Lectins, galactoside-binding"""	15788	protein-coding gene	gene with protein product	"""galectin 12"""	606096				11283015, 11435439	Standard	NM_033101		Approved	GRIP1	uc001nxc.2	Q96DT0	OTTHUMG00000167807	ENST00000394618.3:c.326G>C	11.37:g.63276351G>C	ENSP00000378116:p.Cys109Ser	Somatic	0	49	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	23	41.03	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl_sf,smart_Galectin_CRD	p.C110S	ENST00000394618.3	37	c.329	CCDS8045.1	11	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140907	0.77775	.	.	ENSG00000133317	ENST00000255684;ENST00000394618;ENST00000340246;ENST00000415491;ENST00000425950	T;T;T;T;T	0.18016	2.24;2.24;2.73;3.44;3.44	5.63	5.63	0.86233	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.64402	D	0.000003	T	0.51109	0.1655	M	0.92507	3.315	0.58432	D	0.999993	D;D;D;D	0.89917	1.0;0.996;1.0;1.0	D;D;D;D	0.87578	0.998;0.959;0.987;0.998	T	0.54111	-0.8342	10	0.22706	T	0.39	-30.4819	17.5502	0.87873	0.0:0.0:1.0:0.0	.	69;110;109;109	Q9NZ03;G5E970;Q96DT0-3;Q96DT0	.;.;.;LEG12_HUMAN	S	109;109;110;48;48	ENSP00000255684:C109S;ENSP00000378116:C109S;ENSP00000339374:C110S;ENSP00000394659:C48S;ENSP00000399093:C48S	ENSP00000255684:C109S	C	+	2	0	LGALS12	63032927	1.000000	0.71417	1.000000	0.80357	0.578000	0.36192	7.910000	0.87451	2.824000	0.97209	0.655000	0.94253	TGC	-	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl_sf,smart_Galectin_CRD		0.602	LGALS12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LGALS12	protein_coding	OTTHUMT00000396378.1	G	NM_033101	-		63276351	+1	no_errors	ENST00000340246	ensembl	human	known	74_37	missense	SNP	1.000	C
TSR1	55720	genome.wustl.edu	37	17	2227521	2227521	+	Missense_Mutation	SNP	G	G	T	rs376000588		TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr17:2227521G>T	ENST00000301364.5	-	15	3463	c.2384C>A	c.(2383-2385)tCt>tAt	p.S795Y	SRR_ENST00000344595.5_3'UTR	NM_018128.4	NP_060598.3	Q2NL82	TSR1_HUMAN	TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)	795					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	20						CACTGTTGAAGAAATCTCACT	0.463																																																	0								ENSG00000167721						159.0	150.0	153.0					17																	2227521		2203	4300	6503	TSR1	SO:0001583	missense	0			-	HGNC	AK026565	CCDS32525.1	17p13.3	2006-04-20	2006-04-20			ENSG00000167721			25542	protein-coding gene	gene with protein product		611214	"""TSR1, 20S rRNA accumulation, homolog (yeast)"""			10718198	Standard	NM_018128		Approved	FLJ10534	uc002fuj.3	Q2NL82		ENST00000301364.5:c.2384C>A	17.37:g.2227521G>T	ENSP00000301364:p.Ser795Tyr	Somatic	0	70	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34	Q8WUY5|Q9NVT0|Q9P2E6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BMS1_TSR1_C,pfam_AARP2CN,superfamily_Transl_B-barrel,smart_AARP2CN	p.S795Y	ENST00000301364.5	37	c.2384	CCDS32525.1	17	.	.	.	.	.	.	.	.	.	.	G	7.415	0.635456	0.14322	.	.	ENSG00000167721	ENST00000301364	T	0.12361	2.69	4.92	3.94	0.45596	.	0.301561	0.37178	N	0.002217	T	0.06962	0.0177	N	0.08118	0	0.09310	N	1	B	0.29805	0.257	B	0.26969	0.075	T	0.26815	-1.0092	10	0.59425	D	0.04	-7.5304	10.0094	0.41977	0.0936:0.0:0.9064:0.0	.	795	Q2NL82	TSR1_HUMAN	Y	795	ENSP00000301364:S795Y	ENSP00000301364:S795Y	S	-	2	0	TSR1	2174271	0.483000	0.25956	0.086000	0.20670	0.019000	0.09904	3.662000	0.54510	2.277000	0.76020	0.655000	0.94253	TCT	-	NULL		0.463	TSR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TSR1	protein_coding	OTTHUMT00000438180.2	G	NM_018128	-		2227521	-1	no_errors	ENST00000301364	ensembl	human	known	74_37	missense	SNP	0.070	T
HIPK1	204851	genome.wustl.edu	37	1	114512653	114512653	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr1:114512653G>C	ENST00000369558.1	+	14	3079	c.2847G>C	c.(2845-2847)ttG>ttC	p.L949F	HIPK1_ENST00000340480.4_Missense_Mutation_p.L575F|HIPK1_ENST00000426820.2_Missense_Mutation_p.L949F|HIPK1_ENST00000369561.4_Missense_Mutation_p.L915F|HIPK1_ENST00000369554.2_Missense_Mutation_p.L904F|HIPK1_ENST00000369559.4_Missense_Mutation_p.L949F|HIPK1_ENST00000369553.1_Missense_Mutation_p.L555F|HIPK1_ENST00000369555.2_Missense_Mutation_p.L904F|HIPK1_ENST00000406344.1_Missense_Mutation_p.L555F			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	949	Interaction with TP53.|Required for localization to nuclear speckles. {ECO:0000250}.				anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACTCTTCTTTGAGCAGCCCTT	0.488																																																	0								ENSG00000163349						188.0	194.0	192.0					1																	114512653		2203	4300	6503	HIPK1	SO:0001583	missense	0			-	HGNC	AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.2847G>C	1.37:g.114512653G>C	ENSP00000358571:p.Leu949Phe	Somatic	0	79	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	56	37.08	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L949F	ENST00000369558.1	37	c.2847	CCDS867.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.00|14.00	2.406165|2.406165	0.42715|0.42715	.|.	.|.	ENSG00000163349|ENSG00000163349	ENST00000361587|ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000340480;ENST00000369553;ENST00000406344	.|T;T;T;T;T;T;T;T;T;T	.|0.24908	.|1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83	6.04|6.04	6.04|6.04	0.98038|0.98038	.|.	.|0.230505	.|0.30329	.|N	.|0.009871	T|T	0.13628|0.13628	0.0330|0.0330	N|N	0.22421|0.22421	0.69|0.69	0.48452|0.48452	D|D	0.999658|0.999658	.|P;P;B;P	.|0.47034	.|0.889;0.812;0.435;0.703	.|P;B;B;B	.|0.46585	.|0.521;0.424;0.221;0.395	T|T	0.02789|0.02789	-1.1110|-1.1110	5|10	.|0.09590	.|T	.|0.72	.|.	20.5792|20.5792	0.99380|0.99380	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|241;555;949;949	.|E9PCF6;Q86Z02-4;Q86Z02;Q86Z02-2	.|.;.;HIPK1_HUMAN;.	Q|F	230|1020;949;949;904;904;949;915;575;555;555	.|ENSP00000407442:L1020F;ENSP00000358572:L949F;ENSP00000409673:L949F;ENSP00000358567:L904F;ENSP00000358568:L904F;ENSP00000358571:L949F;ENSP00000358574:L915F;ENSP00000340956:L575F;ENSP00000358566:L555F;ENSP00000384960:L555F	.|ENSP00000340956:L575F	E|L	+|+	1|3	0|2	HIPK1|HIPK1	114314176|114314176	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	3.766000|3.766000	0.55280|0.55280	2.873000|2.873000	0.98535|0.98535	0.561000|0.561000	0.74099|0.74099	GAG|TTG	-	NULL		0.488	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HIPK1	protein_coding	OTTHUMT00000033127.1	G	NM_198268	-		114512653	+1	no_errors	ENST00000369558	ensembl	human	known	74_37	missense	SNP	1.000	C
LINC00987	100499405	genome.wustl.edu	37	12	9392739	9392740	+	lincRNA	INS	-	-	TCTTCCTCCTCC	rs71045240|rs71265059		TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr12:9392739_9392740insTCTTCCTCCTCC	ENST00000427111.3	+	0	141_142					NR_036466.1				long intergenic non-protein coding RNA 987																		caccatcaccttcttcctcccc	0.545														354	0.0706869	0.0272	0.1455	5008	,	,		14189	0.0813		0.0706	False		,,,				2504	0.0654																0								ENSG00000237248																																			LINC00987			0				HGNC	AK126248		12p13.31	2013-07-04			ENSG00000237248	ENSG00000237248		"""Long non-coding RNAs"""	48911	non-coding RNA	RNA, long non-coding							Standard	NR_036466		Approved				OTTHUMG00000168332		12.37:g.9392739_9392740insTCTTCCTCCTCC		Somatic	NA	NA	NA		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000427111.3	37	NULL		12																																																																																			-	-		0.545	LINC00987-001	KNOWN	basic	lincRNA	LINC00987	lincRNA	OTTHUMT00000399347.1	-				9392740	+1	no_errors	ENST00000427111	ensembl	human	known	74_37	rna	INS	0.164:0.294	TCTTCCTCCTCC
ENOSF1	55556	genome.wustl.edu	37	18	690702	690703	+	Intron	INS	-	-	AGCTGTTTCCCCTGGAGAGTCC	rs145372402|rs3217715	byFrequency	TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr18:690702_690703insAGCTGTTTCCCCTGGAGAGTCC	ENST00000251101.7	-	8	624				ENOSF1_ENST00000340116.7_Intron|ENOSF1_ENST00000580982.1_Intron|ENOSF1_ENST00000383578.3_Intron|ENOSF1_ENST00000319815.6_5'Flank|ENOSF1_ENST00000583973.1_5'Flank	NM_017512.5	NP_059982.2	Q7L5Y1	ENOF1_HUMAN	enolase superfamily member 1						cellular amino acid catabolic process (GO:0009063)|cellular carbohydrate catabolic process (GO:0044275)	mitochondrion (GO:0005739)	isomerase activity (GO:0016853)|L-fuconate dehydratase activity (GO:0050023)|magnesium ion binding (GO:0000287)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	10						GCCTGTAGCTAAGCTGTTTCCC	0.52														1644	0.328275	0.2995	0.2305	5008	,	,		24177	0.5704		0.1988	False		,,,				2504	0.32																0								ENSG00000132199																																			ENOSF1	SO:0001627	intron_variant	0				HGNC	X67098	CCDS11822.1, CCDS11823.1, CCDS45821.1	18p11.32	2005-01-26			ENSG00000132199	ENSG00000132199			30365	protein-coding gene	gene with protein product		607427				14508106	Standard	NM_001126123		Approved	HSRTSBETA, rTS, TYMSAS	uc002kku.4	Q7L5Y1	OTTHUMG00000131470	ENST00000251101.7:c.536-71->GGACTCTCCAGGGGAAACAGCT	18.37:g.690702_690703insAGCTGTTTCCCCTGGAGAGTCC		Somatic	NA	NA	NA		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NMP3|A8K9R5|B3KSL6|B3KXE4|D3DUH0|Q15407|Q15594|Q15595|Q6ZS08|Q9HAS5|Q9HAS6	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Mandelate_racemase_N	p.L156fs	ENST00000251101.7	37	c.467_466	CCDS11822.1	18																																																																																			-	NULL		0.520	ENOSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENOSF1	protein_coding	OTTHUMT00000254312.2	-	NM_017512			690703	-1	no_errors	ENST00000581475	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.000	AGCTGTTTCCCCTGGAGAGTCC
UNC13A	23025	genome.wustl.edu	37	19	17740964	17740964	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr19:17740964C>T	ENST00000519716.2	-	30	3658	c.3659G>A	c.(3658-3660)cGc>cAc	p.R1220H	UNC13A_ENST00000552293.1_Missense_Mutation_p.R1220H|UNC13A_ENST00000550896.1_Missense_Mutation_p.R1218H|UNC13A_ENST00000252773.7_Missense_Mutation_p.R1220H|UNC13A_ENST00000551649.1_Missense_Mutation_p.R1220H|UNC13A_ENST00000428389.2_Missense_Mutation_p.R1308H	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	1220	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						CTTGGCAAAGCGCCTCATGTA	0.537																																																	0								ENSG00000130477						41.0	41.0	41.0					19																	17740964		1794	3825	5619	UNC13A	SO:0001583	missense	0			-	HGNC	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.3659G>A	19.37:g.17740964C>T	ENSP00000429562:p.Arg1220His	Somatic	0	39	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	32	27.27	E5RHY9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Munc13_subgr_dom-2,pfam_C2_dom,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.R1308H	ENST00000519716.2	37	c.3923	CCDS46013.2	19	.	.	.	.	.	.	.	.	.	.	c	16.65	3.180894	0.57800	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44;-1.44;-1.44	3.01	3.01	0.34805	Munc13 homology 1 (1);	0.000000	0.64402	U	0.000004	D	0.89090	0.6616	M	0.85299	2.745	0.48236	D	0.999616	D	0.89917	1.0	D	0.79784	0.993	D	0.90314	0.4339	10	0.87932	D	0	.	11.54	0.50661	0.0:1.0:0.0:0.0	.	1220	Q9UPW8	UN13A_HUMAN	H	1220;1308;1220;1220;1220;1218	ENSP00000429562:R1220H;ENSP00000400409:R1308H;ENSP00000252773:R1220H;ENSP00000447236:R1220H;ENSP00000447572:R1220H;ENSP00000446831:R1218H	ENSP00000252773:R1220H	R	-	2	0	UNC13A	17601964	1.000000	0.71417	1.000000	0.80357	0.381000	0.30169	7.497000	0.81536	1.541000	0.49316	0.282000	0.19409	CGC	-	NULL		0.537	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	protein_coding	OTTHUMT00000376169.2	C	XM_038604	-		17740964	-1	no_errors	ENST00000428389	ensembl	human	known	74_37	missense	SNP	1.000	T
FAM230C	26080	genome.wustl.edu	37	22	21663186	21663187	+	lincRNA	INS	-	-	TAGCGA			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr22:21663186_21663187insTAGCGA	ENST00000436681.1	-	0	983_984																											GGCATCCTCCTTGGCGATGCCC	0.743																																																	0								ENSG00000206142																																			KB-1183D5.13			0				Clone_based_vega_gene																													22.37:g.21663186_21663187insTAGCGA		Somatic	NA	NA	NA		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000436681.1	37	NULL		22																																																																																			-	-		0.743	KB-1183D5.13-003	KNOWN	basic	lincRNA	FAM230C	lincRNA	OTTHUMT00000320109.1	-				21663187	-1	no_errors	ENST00000436681	ensembl	human	known	74_37	rna	INS	0.002:0.008	TAGCGA
ATM	472	genome.wustl.edu	37	11	108159797	108159797	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr11:108159797delA	ENST00000452508.2	+	29	4392	c.4203delA	c.(4201-4203)ttafs	p.L1401fs	ATM_ENST00000278616.4_Frame_Shift_Del_p.L1401fs			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1401					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	AAACCAAGTTAAAAAGCATTT	0.318			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0								ENSG00000149311						58.0	57.0	57.0					11																	108159797		2201	4294	6495	ATM	SO:0001589	frameshift_variant	0	Familial Cancer Database	AT, Louis-Bar syndrome		HGNC	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.4203delA	11.37:g.108159797delA	ENSP00000388058:p.Leu1401fs	Somatic	0	71	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	51	19.05	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.S1403fs	ENST00000452508.2	37	c.4203	CCDS31669.1	11																																																																																			-	superfamily_ARM-type_fold		0.318	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	protein_coding	OTTHUMT00000389938.1	A	NM_000051			108159797	+1	no_errors	ENST00000278616	ensembl	human	known	74_37	frame_shift_del	DEL	0.201	-
ST5	6764	genome.wustl.edu	37	11	8715262	8715263	+	3'UTR	INS	-	-	CAGG	rs55680964|rs397775044|rs3833781	byFrequency	TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr11:8715262_8715263insCAGG	ENST00000534127.1	-	0	4179_4180				ST5_ENST00000526757.1_3'UTR|ST5_ENST00000530991.1_3'UTR|RPL27A_ENST00000531102.1_Intron|RP11-152H18.3_ENST00000529883.1_RNA|ST5_ENST00000357665.1_3'UTR|ST5_ENST00000313726.6_3'UTR	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5						positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		AGCGGGGACCTCAGGCAGGCAG	0.535														1715	0.342452	0.3147	0.3429	5008	,	,		18392	0.3006		0.4066	False		,,,				2504	0.3569																0								ENSG00000254665																																			RP11-152H18.3	SO:0001624	3_prime_UTR_variant	0				Clone_based_vega_gene	U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.*381->CCTG	11.37:g.8715267_8715270dupCAGG		Somatic	0	8	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	8	42.86	B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000534127.1	37	NULL	CCDS7791.1	11																																																																																			-	-		0.535	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000254665	protein_coding	OTTHUMT00000386518.1	-	NM_005418			8715263	+1	no_errors	ENST00000529883	ensembl	human	known	74_37	rna	INS	0.007:0.136	CAGG
ARID3B	10620	genome.wustl.edu	37	15	74888025	74888027	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr15:74888025_74888027delCAG	ENST00000346246.5	+	9	1824_1826	c.1593_1595delCAG	c.(1591-1596)gccagc>gcc	p.S537del		NM_006465.2	NP_006456.1	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B (BRIGHT-like)	538	Ser-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(2)	14						gcagcagcgccagcagcagcagc	0.64																																																	0								ENSG00000179361																																			ARID3B	SO:0001651	inframe_deletion	0				HGNC		CCDS10264.1	15q24	2013-02-07	2006-11-08		ENSG00000179361	ENSG00000179361		"""-"""	14350	protein-coding gene	gene with protein product		612457	"""AT rich interactive domain 3B (BRIGHT- like)"""				Standard	NM_006465		Approved	BDP, DRIL2	uc002ayd.3	Q8IVW6	OTTHUMG00000141321	ENST00000346246.5:c.1593_1595delCAG	15.37:g.74888034_74888036delCAG	ENSP00000343126:p.Ser537del	Somatic	0	44	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	O95443|Q59HC9|Q6P9C9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.S535in_frame_del	ENST00000346246.5	37	c.1593_1595	CCDS10264.1	15																																																																																			-	NULL		0.640	ARID3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID3B	protein_coding	OTTHUMT00000280688.2	CAG	NM_006465			74888027	+1	no_errors	ENST00000346246	ensembl	human	known	74_37	in_frame_del	DEL	0.996:0.998:1.000	-
FAM86B2	653333	genome.wustl.edu	37	8	12293822	12293822	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr8:12293822G>T	ENST00000262365.4	-	1	30	c.31C>A	c.(31-33)Ctc>Atc	p.L11I	FAM86B2_ENST00000351291.4_Missense_Mutation_p.L11I|FAM86B2_ENST00000393715.3_5'UTR|FAM86B2_ENST00000309608.5_Missense_Mutation_p.L11I	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2	11										endometrium(1)|kidney(2)	3						TGCAGCAAGAGTTCGGTCCCC	0.731																																																	0								ENSG00000145002						1.0	2.0	2.0					8																	12293822		104	543	647	FAM86B2	SO:0001583	missense	0			-	HGNC		CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.31C>A	8.37:g.12293822G>T	ENSP00000262365:p.Leu11Ile	Somatic	0	50	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	36	18.18		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nicotinamide_N-MeTfrase-like	p.L11I	ENST00000262365.4	37	c.31	CCDS59092.1	8	.	.	.	.	.	.	.	.	.	.	g	13.72	2.320011	0.41096	.	.	ENSG00000145002	ENST00000262365;ENST00000351291;ENST00000309608;ENST00000527331;ENST00000532480	T;T;T;T;T	0.18016	2.24;2.24;2.24;2.24;2.24	0.893	0.893	0.19236	.	7779.730000	0.00789	U	0.001326	T	0.16085	0.0387	L	0.43152	1.355	0.09310	N	1	B	0.20780	0.048	B	0.15484	0.013	T	0.22068	-1.0227	10	0.37606	T	0.19	.	5.1414	0.14961	0.0:0.0:1.0:0.0	.	11	P0C5J1	F86B2_HUMAN	I	11	ENSP00000262365:L11I;ENSP00000283479:L11I;ENSP00000311330:L11I;ENSP00000432491:L11I;ENSP00000436338:L11I	ENSP00000262365:L11I	L	-	1	0	FAM86B2	12338193	0.000000	0.05858	0.015000	0.15790	0.038000	0.13279	-1.695000	0.01913	0.768000	0.33290	0.162000	0.16502	CTC	-	NULL		0.731	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86B2	protein_coding		G	XM_928336	-		12293822	-1	no_errors	ENST00000262365	ensembl	human	known	74_37	missense	SNP	0.397	T
ATM	472	genome.wustl.edu	37	11	108159802	108159802	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr11:108159802G>T	ENST00000452508.2	+	29	4397	c.4208G>T	c.(4207-4209)aGc>aTc	p.S1403I	ATM_ENST00000278616.4_Missense_Mutation_p.S1403I			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1403					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	AAGTTAAAAAGCATTTTAGAA	0.318			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0								ENSG00000149311						55.0	54.0	55.0					11																	108159802		2201	4294	6495	ATM	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	-	HGNC	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.4208G>T	11.37:g.108159802G>T	ENSP00000388058:p.Ser1403Ile	Somatic	0	68	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	51	19.05	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.S1403I	ENST00000452508.2	37	c.4208	CCDS31669.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.50|15.50	2.851278|2.851278	0.51270|0.51270	.|.	.|.	ENSG00000149311|ENSG00000149311	ENST00000531525|ENST00000278616;ENST00000452508;ENST00000389511	.|T;T	.|0.74209	.|-0.82;-0.82	5.36|5.36	4.45|4.45	0.53987|0.53987	.|Armadillo-type fold (1);	.|0.181972	.|0.64402	.|D	.|0.000013	T|T	0.78323|0.78323	0.4265|0.4265	L|L	0.45581|0.45581	1.43|1.43	0.42471|0.42471	D|D	0.992825|0.992825	.|D;P	.|0.59767	.|0.986;0.842	.|P;B	.|0.60012	.|0.867;0.388	T|T	0.78826|0.78826	-0.2051|-0.2051	5|10	.|0.52906	.|T	.|0.07	.|.	11.1026|11.1026	0.48184|0.48184	0.1487:0.0:0.8513:0.0|0.1487:0.0:0.8513:0.0	.|.	.|55;1403	.|E7EV38;Q13315	.|.;ATM_HUMAN	S|I	73|1403;1403;55	.|ENSP00000278616:S1403I;ENSP00000388058:S1403I	.|ENSP00000278616:S1403I	A|S	+|+	1|2	0|0	ATM|ATM	107665012|107665012	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.511000|0.511000	0.34104|0.34104	2.110000|2.110000	0.41873|0.41873	1.255000|1.255000	0.44051|0.44051	0.650000|0.650000	0.86243|0.86243	GCA|AGC	-	superfamily_ARM-type_fold		0.318	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	protein_coding	OTTHUMT00000389938.1	G	NM_000051	-		108159802	+1	no_errors	ENST00000278616	ensembl	human	known	74_37	missense	SNP	1.000	T
PRDM15	63977	genome.wustl.edu	37	21	43230531	43230531	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6B7-01A-11D-A307-09	TCGA-DX-A6B7-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fe12005c-6c77-45ca-a85d-e85367fa7567	6aff930d-fe20-4689-9af5-f730e5d138e0	g.chr21:43230531G>T	ENST00000269844.3	-	28	3839	c.3729C>A	c.(3727-3729)caC>caA	p.H1243Q	PRDM15_ENST00000398548.1_Missense_Mutation_p.H914Q|PRDM15_ENST00000538201.1_Missense_Mutation_p.H897Q|PRDM15_ENST00000470586.1_5'UTR|PRDM15_ENST00000447207.2_Missense_Mutation_p.H877Q|PRDM15_ENST00000422911.1_Missense_Mutation_p.H934Q	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	1243					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						TGCGCCGCATGTGTCGGCTCA	0.692																																																	0								ENSG00000141956						56.0	45.0	48.0					21																	43230531		2202	4300	6502	PRDM15	SO:0001583	missense	0			-	HGNC	AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.3729C>A	21.37:g.43230531G>T	ENSP00000269844:p.His1243Gln	Somatic	0	29	0.00		0.7035740472496306	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.H1243Q	ENST00000269844.3	37	c.3729	CCDS13676.1	21	.	.	.	.	.	.	.	.	.	.	g	14.77	2.633702	0.47049	.	.	ENSG00000141956	ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844	T;T;T;T;T	0.19806	3.03;3.03;3.03;3.03;2.12	4.11	2.21	0.28008	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	.	.	.	.	T	0.27419	0.0673	N	0.24115	0.695	0.41634	D	0.989034	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.87578	0.997;0.996;0.998	T	0.05225	-1.0898	9	0.87932	D	0	-25.0433	7.1848	0.25793	0.3745:0.0:0.6255:0.0	.	1243;934;914	P57071;E9PDJ6;E9PF37	PRD15_HUMAN;.;.	Q	934;914;897;877;1243	ENSP00000408592:H934Q;ENSP00000381556:H914Q;ENSP00000444044:H897Q;ENSP00000390245:H877Q;ENSP00000269844:H1243Q	ENSP00000269844:H1243Q	H	-	3	2	PRDM15	42103600	1.000000	0.71417	1.000000	0.80357	0.467000	0.32768	1.874000	0.39568	0.679000	0.31345	0.306000	0.20318	CAC	-	smart_Znf_C2H2-like		0.692	PRDM15-201	KNOWN	basic|CCDS	protein_coding	PRDM15	protein_coding		G	NM_022115	-		43230531	-1	no_errors	ENST00000269844	ensembl	human	known	74_37	missense	SNP	1.000	T
