#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CALHM1	255022	genome.wustl.edu	37	10	105215261	105215261	+	Silent	SNP	G	G	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr10:105215261G>A	ENST00000329905.5	-	2	935	c.799C>T	c.(799-801)Ctg>Ttg	p.L267L	RP11-225H22.4_ENST00000411906.1_RNA|CALHM2_ENST00000393235.1_5'Flank	NM_001001412.3	NP_001001412.3	Q8IU99	CAHM1_HUMAN	calcium homeostasis modulator 1	267					ATP transport (GO:0015867)|cation transport (GO:0006812)|protein homooligomerization (GO:0051260)|regulation of ion transmembrane transport (GO:0034765)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|identical protein binding (GO:0042802)|voltage-gated ion channel activity (GO:0005244)			large_intestine(2)|liver(1)|lung(5)|ovary(1)	9						GCCGTGGCCAGTGTCCCGTGG	0.632																																																	0								ENSG00000185933						70.0	49.0	56.0					10																	105215261		2203	4300	6503	CALHM1	SO:0001819	synonymous_variant	0			-	HGNC	BC036208	CCDS7550.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000185933	ENSG00000185933			23494	protein-coding gene	gene with protein product		612234	"""family with sequence similarity 26, member C"""	FAM26C		18585350	Standard	NM_001001412		Approved		uc001kxe.2	Q8IU99	OTTHUMG00000018991	ENST00000329905.5:c.799C>T	10.37:g.105215261G>A		Somatic	1	162	0.61		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	1	97.14	Q5W091	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L267	ENST00000329905.5	37	c.799	CCDS7550.1	10																																																																																			-	NULL		0.632	CALHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALHM1	protein_coding	OTTHUMT00000050165.1	G	NM_001001412	-		105215261	-1	no_errors	ENST00000329905	ensembl	human	known	74_37	silent	SNP	0.115	A
FBXO5	26271	genome.wustl.edu	37	6	153294183	153294183	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr6:153294183T>C	ENST00000229758.3	-	3	965	c.907A>G	c.(907-909)Acc>Gcc	p.T303A	FBXO5_ENST00000477822.1_5'UTR|FBXO5_ENST00000367241.3_Missense_Mutation_p.T257A	NM_012177.3	NP_036309.1	Q9UKT4	FBX5_HUMAN	F-box protein 5	303					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibition of mitotic anaphase-promoting complex activity (GO:0060565)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|negative regulation of meiosis (GO:0045835)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|oocyte maturation (GO:0001556)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly involved in female meiosis I (GO:0007057)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	15		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		ACACTTACGGTAACTCTTTGT	0.363																																					NSCLC(121;372 1757 17721 17977 29669)												0								ENSG00000112029						156.0	131.0	140.0					6																	153294183		2203	4300	6503	FBXO5	SO:0001583	missense	0			-	HGNC	AF129535	CCDS5242.1, CCDS47501.1	6q25-q26	2008-02-05	2004-06-15		ENSG00000112029	ENSG00000112029		"""F-boxes /  ""other"""""	13584	protein-coding gene	gene with protein product		606013	"""F-box only protein 5"""			10531035, 10531037	Standard	NM_012177		Approved	FBX5, Fbxo31, EMI1	uc003qpg.3	Q9UKT4	OTTHUMG00000015854	ENST00000229758.3:c.907A>G	6.37:g.153294183T>C	ENSP00000229758:p.Thr303Ala	Somatic	0	124	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	13	51.85	B3KNX5|Q5TF47|Q8WV29|Q9UGC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_F-box_dom,superfamily_F-box_dom	p.T303A	ENST00000229758.3	37	c.907	CCDS5242.1	6	.	.	.	.	.	.	.	.	.	.	T	4.808	0.150269	0.09185	.	.	ENSG00000112029	ENST00000229758;ENST00000367241	T;T	0.22539	1.95;1.95	5.83	0.0323	0.14175	.	1.005070	0.07993	N	0.987471	T	0.03608	0.0103	L	0.36672	1.1	0.09310	N	1	B	0.22480	0.07	B	0.19148	0.024	T	0.43814	-0.9368	10	0.06757	T	0.87	-1.7533	6.5742	0.22555	0.6341:0.0953:0.0:0.2705	.	303	Q9UKT4	FBX5_HUMAN	A	303;257	ENSP00000229758:T303A;ENSP00000356210:T257A	ENSP00000229758:T303A	T	-	1	0	FBXO5	153335876	0.480000	0.25933	0.840000	0.33206	0.181000	0.23173	0.252000	0.18278	-0.221000	0.09973	0.460000	0.39030	ACC	-	NULL		0.363	FBXO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO5	protein_coding	OTTHUMT00000042757.1	T		-		153294183	-1	no_errors	ENST00000229758	ensembl	human	known	74_37	missense	SNP	0.008	C
GRIN2D	2906	genome.wustl.edu	37	19	48945211	48945211	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr19:48945211A>G	ENST00000263269.3	+	11	2526	c.2438A>G	c.(2437-2439)gAt>gGt	p.D813G		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	813					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TTCCTGGGGGATGGTGCGGCT	0.662																																																	0								ENSG00000105464						28.0	28.0	28.0					19																	48945211		2203	4300	6503	GRIN2D	SO:0001583	missense	0			-	HGNC	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2438A>G	19.37:g.48945211A>G	ENSP00000263269:p.Asp813Gly	Somatic	0	74	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	25	25.71		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.D813G	ENST00000263269.3	37	c.2438	CCDS12719.1	19	.	.	.	.	.	.	.	.	.	.	A	29.4	4.998941	0.93227	.	.	ENSG00000105464	ENST00000263269	T	0.35789	1.29	4.5	4.5	0.54988	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.57140	0.2033	M	0.68317	2.08	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	T	0.61744	-0.7000	10	0.87932	D	0	.	13.2727	0.60170	1.0:0.0:0.0:0.0	.	813	O15399	NMDE4_HUMAN	G	813	ENSP00000263269:D813G	ENSP00000263269:D813G	D	+	2	0	GRIN2D	53637023	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	9.101000	0.94219	2.034000	0.60081	0.374000	0.22700	GAT	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt		0.662	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2D	protein_coding	OTTHUMT00000466121.1	A		-		48945211	+1	no_errors	ENST00000263269	ensembl	human	known	74_37	missense	SNP	1.000	G
GSDMD	79792	genome.wustl.edu	37	8	144642051	144642051	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr8:144642051G>T	ENST00000526406.1	+	6	1205	c.322G>T	c.(322-324)Gcc>Tcc	p.A108S	GSDMD_ENST00000262580.4_Missense_Mutation_p.A108S|GSDMD_ENST00000533063.1_Missense_Mutation_p.A156S	NM_001166237.1	NP_001159709.1	P57764	GSDMD_HUMAN	gasdermin D	108					cellular response to extracellular stimulus (GO:0031668)					breast(1)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	12						CGCAGGCGGGGCCGCGGTGTC	0.617																																																	0								ENSG00000104518						45.0	47.0	46.0					8																	144642051		2201	4298	6499	GSDMD	SO:0001583	missense	0			-	HGNC	AK096216	CCDS34956.1	8q24.3	2008-07-31	2008-07-31	2008-07-31		ENSG00000104518			25697	protein-coding gene	gene with protein product			"""gasdermin domain containing 1"""	GSDMDC1		15289881, 17350798	Standard	NM_024736		Approved	FLJ12150, DF5L	uc003yyg.3	P57764		ENST00000526406.1:c.322G>T	8.37:g.144642051G>T	ENSP00000433209:p.Ala108Ser	Somatic	0	87	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	24	42.86	D3DWJ9|Q96Q98	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Gasdermin	p.A108S	ENST00000526406.1	37	c.322	CCDS34956.1	8	.	.	.	.	.	.	.	.	.	.	G	15.67	2.900991	0.52227	.	.	ENSG00000104518	ENST00000526406;ENST00000533348;ENST00000533063;ENST00000262580;ENST00000525721;ENST00000534018;ENST00000533888	T;T;T;T;T;T;T	0.27402	1.67;1.67;1.67;1.67;1.67;1.67;1.67	4.7	2.81	0.32909	.	0.235038	0.29145	N	0.013011	T	0.43897	0.1268	M	0.68317	2.08	0.09310	N	1	D;P;P	0.71674	0.998;0.848;0.817	D;P;P	0.78314	0.991;0.527;0.471	T	0.19679	-1.0298	10	0.26408	T	0.33	-20.3059	5.032	0.14415	0.1061:0.0:0.6854:0.2085	.	138;108;156	Q6ZRV8;P57764;G3V1A6	.;GSDMD_HUMAN;.	S	108;108;156;108;108;124;108	ENSP00000433209:A108S;ENSP00000434386:A108S;ENSP00000433958:A156S;ENSP00000262580:A108S;ENSP00000434452:A108S;ENSP00000436684:A124S;ENSP00000437065:A108S	ENSP00000262580:A108S	A	+	1	0	GSDMD	144713194	0.752000	0.28338	0.790000	0.31976	0.062000	0.15995	2.697000	0.47060	2.455000	0.83008	0.543000	0.68304	GCC	-	pfam_Gasdermin		0.617	GSDMD-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GSDMD	protein_coding	OTTHUMT00000382046.3	G	NM_024736	-		144642051	+1	no_errors	ENST00000262580	ensembl	human	known	74_37	missense	SNP	0.074	T
SNHG15	285958	genome.wustl.edu	37	7	45025228	45025228	+	lincRNA	DEL	T	T	-			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr7:45025228delT	ENST00000384215.1	-	0	0					NR_002952.1				small nucleolar RNA host gene 15 (non-protein coding)																		CTGAGCTTGGTTCCAGGAGCC	0.498																																																	0								ENSG00000232956																																			SNHG15			0				HGNC	BC092459, AK096179		7p13	2014-06-23	2011-11-24	2011-11-24		ENSG00000232956		"""Long non-coding RNAs"""	27797	non-coding RNA	RNA, long non-coding	"""MYO1G upstream transcript"""		"""chromosome 7 open reading frame 40"""	C7orf40		14702039, 24036268	Standard	NR_003697		Approved	FLJ38860, MYO1GUT, Linc-Myo1g	uc003tmk.4				7.37:g.45025228delT		Somatic	0	54	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	13	13.33		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000384215.1	37	NULL		7																																																																																			-	-		0.498	SNHG15-201	KNOWN	basic	snoRNA	SNHG15	lincRNA		T	NR_003697			45025228	-1	no_errors	ENST00000577700	ensembl	human	known	74_37	rna	DEL	0.000	-
SCN1A	6323	genome.wustl.edu	37	2	166908339	166908339	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr2:166908339G>A	ENST00000303395.4	-	6	853	c.854C>T	c.(853-855)gCt>gTt	p.A285V	SCN1A_ENST00000409050.1_Missense_Mutation_p.A285V|AC010127.3_ENST00000599041.1_RNA|SCN1A_ENST00000423058.2_Missense_Mutation_p.A285V|AC010127.3_ENST00000595268.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.A285V|AC010127.3_ENST00000595647.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	285					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTCCAAGGAAGCATTGGTGGG	0.383																																																	0								ENSG00000144285						86.0	87.0	87.0					2																	166908339		2203	4298	6501	SCN1A	SO:0001583	missense	0			-	HGNC	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.854C>T	2.37:g.166908339G>A	ENSP00000303540:p.Ala285Val	Somatic	0	109	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	21	43.24	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.A285V	ENST00000303395.4	37	c.854	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	G	10.66	1.413210	0.25465	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.96011	-3.88;-3.88;-3.84;-3.81	5.41	4.53	0.55603	Ion transport (1);	0.780281	0.11919	N	0.516868	D	0.89357	0.6692	N	0.12637	0.245	0.09310	N	1	B;B;B	0.14805	0.004;0.001;0.011	B;B;B	0.22386	0.038;0.039;0.02	T	0.80353	-0.1418	10	0.33940	T	0.23	.	8.7615	0.34678	0.2419:0.0:0.7581:0.0	.	285;285;285	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	V	285	ENSP00000407030:A285V;ENSP00000303540:A285V;ENSP00000364554:A285V;ENSP00000386312:A285V	ENSP00000303540:A285V	A	-	2	0	SCN1A	166616585	0.955000	0.32602	0.670000	0.29842	0.970000	0.65996	1.936000	0.40183	1.409000	0.46915	0.655000	0.94253	GCT	-	pfam_Ion_trans_dom,prints_Na_channel_a1su		0.383	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	protein_coding	OTTHUMT00000102661.1	G	NM_006920	-		166908339	-1	no_errors	ENST00000303395	ensembl	human	known	74_37	missense	SNP	0.015	A
NCAPG	64151	genome.wustl.edu	37	4	17838918	17838918	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr4:17838918G>T	ENST00000251496.2	+	15	2422	c.2246G>T	c.(2245-2247)cGa>cTa	p.R749L		NM_022346.4	NP_071741.2	Q9BPX3	CND3_HUMAN	non-SMC condensin I complex, subunit G	749					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	27				STAD - Stomach adenocarcinoma(129;0.18)		GTTCAACTTCGACATTGCCTA	0.428																																																	0								ENSG00000109805						180.0	157.0	165.0					4																	17838918		2203	4300	6503	NCAPG	SO:0001583	missense	0			-	HGNC	AF331796	CCDS3424.1	4p15.32	2014-01-15			ENSG00000109805	ENSG00000109805			24304	protein-coding gene	gene with protein product	"""chromosome condensation protein G"""	606280				10910072, 11136719	Standard	NM_022346		Approved	FLJ12450, hCAP-G, CAP-G, YCG1	uc003gpp.4	Q9BPX3	OTTHUMG00000128539	ENST00000251496.2:c.2246G>T	4.37:g.17838918G>T	ENSP00000251496:p.Arg749Leu	Somatic	0	130	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.R749L	ENST00000251496.2	37	c.2246	CCDS3424.1	4	.	.	.	.	.	.	.	.	.	.	G	32	5.167745	0.94768	.	.	ENSG00000109805	ENST00000251496	T	0.54279	0.58	5.97	5.97	0.96955	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.71995	0.3406	M	0.70842	2.15	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	T	0.64546	-0.6382	10	0.22706	T	0.39	-9.9136	20.4209	0.99038	0.0:0.0:1.0:0.0	.	749	Q9BPX3	CND3_HUMAN	L	749	ENSP00000251496:R749L	ENSP00000251496:R749L	R	+	2	0	NCAPG	17448016	1.000000	0.71417	0.981000	0.43875	0.977000	0.68977	9.417000	0.97391	2.823000	0.97156	0.591000	0.81541	CGA	-	superfamily_ARM-type_fold		0.428	NCAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPG	protein_coding	OTTHUMT00000250375.1	G	NM_022346	-		17838918	+1	no_errors	ENST00000251496	ensembl	human	known	74_37	missense	SNP	1.000	T
SND1	27044	genome.wustl.edu	37	7	127347658	127347658	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr7:127347658C>A	ENST00000354725.3	+	9	1189	c.995C>A	c.(994-996)cCc>cAc	p.P332H		NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	332					gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)			central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						TATGTGGCTCCCACAGCTAAT	0.458																																																	0								ENSG00000197157						137.0	121.0	126.0					7																	127347658		2203	4300	6503	SND1	SO:0001583	missense	0			-	HGNC		CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.995C>A	7.37:g.127347658C>A	ENSP00000346762:p.Pro332His	Somatic	0	67	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	16	38.46	Q13122|Q96AG0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Staphylococal_nuclease_OB-fold,pfam_Tudor,superfamily_Staphylococal_nuclease_OB-fold,smart_Staphylococal_nuclease_OB-fold,smart_Tudor,pirsf_Silence_cplx_Nase-comp_TudorSN,pfscan_Tudor,pfscan_Staphylococal_nuclease_OB-fold	p.P332H	ENST00000354725.3	37	c.995	CCDS34747.1	7	.	.	.	.	.	.	.	.	.	.	C	20.1	3.940951	0.73557	.	.	ENSG00000197157	ENST00000354725;ENST00000438400	T	0.36157	1.27	5.29	5.29	0.74685	Staphylococcal nuclease (SNase-like) (1);Staphylococcal nuclease (SNase-like), OB-fold (1);	0.147927	0.64402	D	0.000007	T	0.51160	0.1658	M	0.64170	1.965	0.80722	D	1	P	0.50443	0.935	P	0.53649	0.731	T	0.53892	-0.8374	10	0.87932	D	0	-17.8438	16.7834	0.85568	0.0:1.0:0.0:0.0	.	332	Q7KZF4	SND1_HUMAN	H	332;322	ENSP00000346762:P332H	ENSP00000346762:P332H	P	+	2	0	SND1	127134894	1.000000	0.71417	1.000000	0.80357	0.442000	0.32017	7.244000	0.78228	2.621000	0.88768	0.557000	0.71058	CCC	-	superfamily_Staphylococal_nuclease_OB-fold,pirsf_Silence_cplx_Nase-comp_TudorSN		0.458	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SND1	protein_coding	OTTHUMT00000349148.1	C	NM_014390	-		127347658	+1	no_errors	ENST00000354725	ensembl	human	known	74_37	missense	SNP	1.000	A
LINC00052	145978	genome.wustl.edu	37	15	88121557	88121558	+	lincRNA	DEL	CA	CA	-	rs147007133|rs368572077		TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr15:88121557_88121558delCA	ENST00000560153.1	+	0	426_427				RP11-648K4.2_ENST00000560439.1_lincRNA	NR_026869.1		Q96N35	TMM83_HUMAN	long intergenic non-protein coding RNA 52							integral component of membrane (GO:0016021)											gtttctctctcACACACACACA	0.406																																																	0								ENSG00000259527																																			LINC00052			0				HGNC	AK056023		15q25.3	2012-10-12	2011-08-10	2011-08-10		ENSG00000259527		"""Long non-coding RNAs"""	26455	non-coding RNA	RNA, long non-coding			"""transmembrane protein 83"", ""non-protein coding RNA 52"""	TMEM83, NCRNA00052			Standard	NR_026869		Approved	FLJ31461	uc002bmc.1	Q96N35			15.37:g.88121567_88121568delCA		Somatic	1	170	0.58		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000560153.1	37	NULL		15																																																																																			-	-		0.406	LINC00052-002	KNOWN	basic	lincRNA	LINC00052	lincRNA	OTTHUMT00000416151.1	CA	XR_017978			88121558	+1	no_errors	ENST00000560153	ensembl	human	known	74_37	rna	DEL	0.000:0.000	-
LOC151174	151174	genome.wustl.edu	37	2	239140352	239140353	+	5'Flank	INS	-	-	GGCCTCCGGGCCGCGGC			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr2:239140352_239140353insGGCCTCCGGGCCGCGGC	ENST00000409070.1	-	0	0				AC096574.4_ENST00000456601.1_RNA|AC016757.3_ENST00000409376.1_5'Flank|AC016757.3_ENST00000470346.1_5'Flank|AC016757.3_ENST00000334973.4_5'Flank|AC016757.3_ENST00000409942.1_5'Flank																							CCAAGGGGCGTGGCCTCCGGGC	0.559																																																	0								ENSG00000225057																																			AC096574.4	SO:0001631	upstream_gene_variant	0				Clone_based_vega_gene																													2.37:g.239140352_239140353insGGCCTCCGGGCCGCGGC	Exception_encountered	Somatic	NA	NA	NA		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000409070.1	37	NULL		2																																																																																			-	-		0.559	AC016757.3-006	PUTATIVE	basic|appris_candidate_longest	protein_coding	LOC101927958	protein_coding	OTTHUMT00000328480.1	-				239140353	+1	no_errors	ENST00000456601	ensembl	human	known	74_37	rna	INS	0.000:0.000	GGCCTCCGGGCCGCGGC
CTNND2	1501	genome.wustl.edu	37	5	11117589	11117589	+	Silent	SNP	C	C	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr5:11117589C>T	ENST00000304623.8	-	13	2439	c.2250G>A	c.(2248-2250)gcG>gcA	p.A750A	CTNND2_ENST00000359640.2_Silent_p.A750A|CTNND2_ENST00000511377.1_Silent_p.A659A|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000503622.1_Silent_p.A413A|CTNND2_ENST00000458100.2_Silent_p.A317A	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	750					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TGCTCCCCAGCGCAGACTGGA	0.507																																																	0								ENSG00000169862						199.0	172.0	181.0					5																	11117589		2203	4300	6503	CTNND2	SO:0001819	synonymous_variant	0			-	HGNC	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2250G>A	5.37:g.11117589C>T		Somatic	0	137	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	17	55.26	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.A750	ENST00000304623.8	37	c.2250	CCDS3881.1	5																																																																																			-	superfamily_ARM-type_fold,smart_Armadillo		0.507	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNND2	protein_coding	OTTHUMT00000206999.1	C	NM_001332	-		11117589	-1	no_errors	ENST00000304623	ensembl	human	known	74_37	silent	SNP	0.188	T
EFCAB6	64800	genome.wustl.edu	37	22	43930759	43930759	+	Intron	DEL	A	A	-			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr22:43930759delA	ENST00000262726.7	-	30	4302				EFCAB6-AS1_ENST00000431327.3_RNA|EFCAB6_ENST00000461800.1_Intron|EFCAB6_ENST00000396231.2_Intron	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				AGAGCTACAGAAAAAAATGGC	0.413																																																	0								ENSG00000223843						77.0	78.0	78.0					22																	43930759		2203	4300	6503	EFCAB6-AS1	SO:0001627	intron_variant	0				HGNC	Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.4049-7T>-	22.37:g.43930759delA		Somatic	0	43	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	2	81.82	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000262726.7	37	NULL	CCDS14049.1	22																																																																																			-	-		0.413	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB6-AS1	protein_coding	OTTHUMT00000353176.1	A	NM_022785			43930759	+1	no_errors	ENST00000431327	ensembl	human	known	74_37	rna	DEL	0.015	-
MYRF	745	genome.wustl.edu	37	11	61541466	61541466	+	Silent	SNP	G	G	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr11:61541466G>A	ENST00000278836.5	+	8	1239	c.1143G>A	c.(1141-1143)gcG>gcA	p.A381A	TMEM258_ENST00000535042.1_5'UTR|MYRF_ENST00000327797.1_Silent_p.A8A|MYRF_ENST00000265460.5_Silent_p.A372A	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	381					central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GCGTGGATGCGGACAAGGGCT	0.637																																																	0								ENSG00000124920						67.0	58.0	61.0					11																	61541466		2202	4299	6501	MYRF	SO:0001819	synonymous_variant	0			-	HGNC		CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.1143G>A	11.37:g.61541466G>A		Somatic	0	49	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	O43582|Q9P1Q6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_NDT80_DNA-bd_dom,superfamily_p53-like_TF_DNA-bd	p.A381	ENST00000278836.5	37	c.1143	CCDS44622.1	11																																																																																			-	superfamily_p53-like_TF_DNA-bd		0.637	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYRF	protein_coding	OTTHUMT00000398519.2	G	NM_013279	-		61541466	+1	no_errors	ENST00000278836	ensembl	human	known	74_37	silent	SNP	0.259	A
PACS2	23241	genome.wustl.edu	37	14	105843157	105843157	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr14:105843157A>G	ENST00000325438.8	+	9	1358	c.854A>G	c.(853-855)gAc>gGc	p.D285G	PACS2_ENST00000430725.2_Missense_Mutation_p.D210G|PACS2_ENST00000447393.1_Missense_Mutation_p.D285G|PACS2_ENST00000458164.2_Missense_Mutation_p.D285G|PACS2_ENST00000547217.1_Missense_Mutation_p.D255G			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	285					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)				endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		GCAGAGGAGGACCTGGACCTC	0.662																																																	0								ENSG00000179364						79.0	67.0	71.0					14																	105843157		2202	4300	6502	PACS2	SO:0001583	missense	0			-	HGNC	AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.854A>G	14.37:g.105843157A>G	ENSP00000321834:p.Asp285Gly	Somatic	0	144	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	41	33.87	A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Phosphofurin_acidic_CS-1	p.D285G	ENST00000325438.8	37	c.854	CCDS32168.1	14	.	.	.	.	.	.	.	.	.	.	A	20.6	4.015372	0.75161	.	.	ENSG00000179364	ENST00000430725;ENST00000325438;ENST00000458164;ENST00000447393;ENST00000547217	T;T;T;T;T	0.17691	2.26;2.26;2.26;2.26;2.26	4.8	4.8	0.61643	.	0.050604	0.85682	D	0.000000	T	0.41282	0.1152	M	0.74647	2.275	0.80722	D	1	D;D;D;P	0.89917	0.998;0.998;1.0;0.867	D;D;D;B	0.83275	0.963;0.984;0.996;0.382	T	0.32107	-0.9919	10	0.54805	T	0.06	-42.9638	13.1551	0.59511	1.0:0.0:0.0:0.0	.	285;285;285;286	E9PB38;Q86VP3-2;Q86VP3;Q86VP3-3	.;.;PACS2_HUMAN;.	G	210;285;285;285;255	ENSP00000393524:D210G;ENSP00000321834:D285G;ENSP00000399732:D285G;ENSP00000393559:D285G;ENSP00000449525:D255G	ENSP00000321834:D285G	D	+	2	0	PACS2	104914202	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	7.339000	0.79282	1.785000	0.52413	0.383000	0.25322	GAC	-	NULL		0.662	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PACS2	protein_coding	OTTHUMT00000409209.1	A	XM_377355	-		105843157	+1	no_errors	ENST00000458164	ensembl	human	known	74_37	missense	SNP	1.000	G
SUFU	51684	genome.wustl.edu	37	10	104352400	104352401	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr10:104352400_104352401delAA	ENST00000369902.3	+	4	682_683	c.516_517delAA	c.(514-519)tcaagafs	p.R173fs	SUFU_ENST00000471000.1_3'UTR|SUFU_ENST00000369899.2_Frame_Shift_Del_p.R173fs|RNU6-43P_ENST00000384302.1_RNA|SUFU_ENST00000423559.2_Frame_Shift_Del_p.R173fs	NM_016169.3	NP_057253.2	Q9UMX1	SUFU_HUMAN	suppressor of fused homolog (Drosophila)	173					cytoplasmic sequestering of transcription factor (GO:0042994)|heart looping (GO:0001947)|multicellular organismal development (GO:0007275)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skin development (GO:0043588)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|primary cilium (GO:0072372)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(7)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	24		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		ACAGTGAGTCAAGAATTCAGCA	0.55			"""D, F, S"""		medulloblastoma	medulloblastoma			Medulloblastoma, associated with Germline SUFU Mutation																														yes	Rec	yes	Medulloblastoma predisposition	10	10q24.32	51684	suppressor of fused homolog (Drosophila)		O	0								ENSG00000107882																																			SUFU	SO:0001589	frameshift_variant	0	Familial Cancer Database			HGNC	AF175770	CCDS7537.1, CCDS53571.1	10q24.32	2014-09-17			ENSG00000107882	ENSG00000107882			16466	protein-coding gene	gene with protein product		607035				15367681	Standard	NM_016169		Approved	SUFUH, SUFUXL, PRO1280	uc001kvy.2	Q9UMX1	OTTHUMG00000018966	ENST00000369902.3:c.516_517delAA	10.37:g.104352400_104352401delAA	ENSP00000358918:p.Arg173fs	Somatic	0	53	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	Q7LCP7|Q9NT90|Q9NZ07|Q9UHK2|Q9UHM8|Q9UMY0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SUFU_C,pfam_SUFU-like_domain,pirsf_Suppressor_of_fused_euk	p.R173fs	ENST00000369902.3	37	c.516_517	CCDS7537.1	10																																																																																			-	pfam_SUFU-like_domain,pirsf_Suppressor_of_fused_euk		0.550	SUFU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUFU	protein_coding	OTTHUMT00000050089.1	AA	NM_016169			104352401	+1	no_errors	ENST00000369902	ensembl	human	known	74_37	frame_shift_del	DEL	0.987:1.000	-
DNAJC8	22826	genome.wustl.edu	37	1	28535044	28535045	+	Intron	INS	-	-	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr1:28535044_28535045insA	ENST00000263697.4	-	6	426				DNAJC8_ENST00000489277.1_Intron	NM_014280.2	NP_055095.2	O75937	DNJC8_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 8						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)				kidney(1)|large_intestine(3)|lung(2)	6		Colorectal(325;3.46e-05)|Lung NSC(340;4.08e-05)|all_lung(284;4.29e-05)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.0105)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		OV - Ovarian serous cystadenocarcinoma(117;2.81e-22)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00275)|BRCA - Breast invasive adenocarcinoma(304;0.0059)|STAD - Stomach adenocarcinoma(196;0.00671)|READ - Rectum adenocarcinoma(331;0.0649)		AAGTTTTCATTAAAAAAAAAAA	0.361																																																	0								ENSG00000126698																																			DNAJC8	SO:0001627	intron_variant	0				HGNC	AF083190	CCDS41292.1	1p35	2011-09-02			ENSG00000126698	ENSG00000126698		"""Heat shock proteins / DNAJ (HSP40)"""	15470	protein-coding gene	gene with protein product						11147971	Standard	NM_014280		Approved	SPF31	uc001bpn.3	O75937	OTTHUMG00000003538	ENST00000263697.4:c.400-120->T	1.37:g.28535055_28535055dupA		Somatic	0	21	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27	B4DUU4|D3DPM0|Q6IBA4|Q8N4Z5|Q9P051|Q9P067	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000263697.4	37	NULL	CCDS41292.1	1																																																																																			-	-		0.361	DNAJC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC8	protein_coding	OTTHUMT00000009860.1	-	NM_014280			28535045	-1	no_errors	ENST00000470967	ensembl	human	known	74_37	rna	INS	0.000:0.000	A
SERPINB8	5271	genome.wustl.edu	37	18	61654403	61654403	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr18:61654403G>T	ENST00000397985.2	+	7	1272	c.1016G>T	c.(1015-1017)cGg>cTg	p.R339L	SERPINB8_ENST00000542677.1_Missense_Mutation_p.R157L|SERPINB8_ENST00000493661.1_Intron|SERPINB8_ENST00000353706.2_Missense_Mutation_p.R339L	NM_001276490.1	NP_001263419.1	P50452	SPB8_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 8	339		Reactive bond. {ECO:0000250}.			negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|kidney(1)|large_intestine(4)|lung(9)|skin(1)	17		Esophageal squamous(42;0.129)				AGGAATTCCCGGTGCAGCAGA	0.527																																																	0								ENSG00000166401						77.0	75.0	76.0					18																	61654403		2203	4300	6503	SERPINB8	SO:0001583	missense	0			-	HGNC	L40377	CCDS11991.1, CCDS42442.1, CCDS62460.1	18q22.1	2014-02-18	2005-08-18		ENSG00000166401	ENSG00000166401		"""Serine (or cysteine) peptidase inhibitors"""	8952	protein-coding gene	gene with protein product	"""cytoplasmic antiproteinase 2"""	601697	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 8"""	PI8		8530382, 9268635, 24172014	Standard	NM_198833		Approved	CAP2	uc002lju.3	P50452	OTTHUMG00000060596	ENST00000397985.2:c.1016G>T	18.37:g.61654403G>T	ENSP00000381072:p.Arg339Leu	Somatic	0	90	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	B4DTW2|Q7Z2V6|Q8N178	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.R339L	ENST00000397985.2	37	c.1016	CCDS11991.1	18	.	.	.	.	.	.	.	.	.	.	G	10.08	1.251703	0.22880	.	.	ENSG00000166401	ENST00000397985;ENST00000353706;ENST00000542677	D;D;T	0.82526	-1.62;-1.62;2.8	5.65	3.74	0.42951	Serpin domain (3);	0.205916	0.52532	D	0.000077	T	0.75576	0.3868	L	0.53780	1.695	0.09310	N	0.999996	B	0.17465	0.022	B	0.21708	0.036	T	0.56715	-0.7933	10	0.07644	T	0.81	.	10.988	0.47532	0.0749:0.0:0.7566:0.1685	.	339	P50452	SPB8_HUMAN	L	339;339;157	ENSP00000381072:R339L;ENSP00000331368:R339L;ENSP00000438328:R157L	ENSP00000331368:R339L	R	+	2	0	SERPINB8	59805383	0.779000	0.28652	0.033000	0.17914	0.382000	0.30200	2.750000	0.47500	1.633000	0.50488	0.655000	0.94253	CGG	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.527	SERPINB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB8	protein_coding	OTTHUMT00000134014.1	G	NM_001031848	-		61654403	+1	no_errors	ENST00000353706	ensembl	human	known	74_37	missense	SNP	0.017	T
MAP3K11	4296	genome.wustl.edu	37	11	65374848	65374848	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr11:65374848A>T	ENST00000530153.1	-	5	1132	c.611T>A	c.(610-612)cTg>cAg	p.L204Q	MAP3K11_ENST00000532507.1_5'Flank|MAP3K11_ENST00000534432.1_5'Flank|MAP3K11_ENST00000309100.3_Missense_Mutation_p.L461Q					mitogen-activated protein kinase kinase kinase 11											breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(14)|skin(1)	24						CACCTGCTGCAGCAGCAGCGT	0.731																																																	0								ENSG00000173327						3.0	3.0	3.0					11																	65374848		1592	3182	4774	MAP3K11	SO:0001583	missense	0			-	HGNC		CCDS8107.1	11q13.1-q13.3	2011-06-09			ENSG00000173327	ENSG00000173327	2.7.10.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6850	protein-coding gene	gene with protein product		600050		MLK3, PTK1		9267807, 8183572	Standard	NM_002419		Approved	SPRK, MEKK11	uc001oew.3	Q16584	OTTHUMG00000166529	ENST00000530153.1:c.611T>A	11.37:g.65374848A>T	ENSP00000433886:p.Leu204Gln	Somatic	0	13	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	5	66.67		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.L461Q	ENST00000530153.1	37	c.1382		11	.	.	.	.	.	.	.	.	.	.	A	14.95	2.687671	0.48097	.	.	ENSG00000173327	ENST00000309100;ENST00000530153	T;T	0.76316	-0.87;-1.01	4.46	4.46	0.54185	.	0.187154	0.37483	N	0.002072	T	0.77432	0.4129	N	0.20685	0.6	0.44762	D	0.99776	D	0.60575	0.988	D	0.64042	0.921	T	0.80555	-0.1330	10	0.87932	D	0	.	11.9774	0.53100	1.0:0.0:0.0:0.0	.	461	Q16584	M3K11_HUMAN	Q	461;204	ENSP00000309597:L461Q;ENSP00000433886:L204Q	ENSP00000309597:L461Q	L	-	2	0	MAP3K11	65131424	1.000000	0.71417	0.991000	0.47740	0.004000	0.04260	4.340000	0.59328	2.001000	0.58596	0.402000	0.26972	CTG	-	pirsf_MAPKKK9/10/11		0.731	MAP3K11-004	PUTATIVE	basic|exp_conf	protein_coding	MAP3K11	protein_coding	OTTHUMT00000390233.2	A		-		65374848	-1	no_errors	ENST00000309100	ensembl	human	known	74_37	missense	SNP	1.000	T
EMID1	129080	genome.wustl.edu	37	22	29611585	29611585	+	Silent	SNP	C	C	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr22:29611585C>T	ENST00000404820.3	+	3	412	c.285C>T	c.(283-285)tgC>tgT	p.C95C	EMID1_ENST00000404755.3_Silent_p.C95C|EMID1_ENST00000334018.6_Silent_p.C95C|EMID1_ENST00000484039.1_3'UTR			Q96A84	EMID1_HUMAN	EMI domain containing 1	95	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.					collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(2)|skin(3)	12						AGTGGAGGTGCTGCCCTGGGC	0.627																																																	0								ENSG00000186998						100.0	92.0	95.0					22																	29611585		2203	4300	6503	EMID1	SO:0001819	synonymous_variant	0			-	HGNC	AJ416090	CCDS33630.1	22q12.2	2009-08-04			ENSG00000186998	ENSG00000186998		"""EMI domain containing"""	18036	protein-coding gene	gene with protein product	"""emilin and multimerin-domain containing protein 1"", ""putative emu1"""	608926				12221002	Standard	NM_001267895		Approved	EMU1, hEmu1, EMI5	uc003aem.4	Q96A84	OTTHUMG00000151013	ENST00000404820.3:c.285C>T	22.37:g.29611585C>T		Somatic	0	97	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	B0QYK6|Q6ICG1|Q86SS7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_EMI_domain,pfscan_EMI_domain	p.C95	ENST00000404820.3	37	c.285		22																																																																																			-	pfam_EMI_domain,pfscan_EMI_domain		0.627	EMID1-002	NOVEL	basic|appris_principal	protein_coding	EMID1	protein_coding	OTTHUMT00000321075.1	C	NM_133455	-		29611585	+1	no_errors	ENST00000334018	ensembl	human	known	74_37	silent	SNP	1.000	T
TESK2	10420	genome.wustl.edu	37	1	45811025	45811025	+	Silent	SNP	A	A	C			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr1:45811025A>C	ENST00000372086.3	-	11	1603	c.1203T>G	c.(1201-1203)ccT>ccG	p.P401P	TESK2_ENST00000486676.1_5'UTR|TESK2_ENST00000372084.1_Silent_p.P372P|TESK2_ENST00000538496.1_Silent_p.P318P|TESK2_ENST00000341771.6_Silent_p.P372P	NM_007170.2	NP_009101.2	Q96S53	TESK2_HUMAN	testis-specific kinase 2	401					actin cytoskeleton organization (GO:0030036)|focal adhesion assembly (GO:0048041)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	32	Acute lymphoblastic leukemia(166;0.155)					GAGCACTAAAAGGGTTGACTT	0.547																																																	0								ENSG00000070759						47.0	48.0	48.0					1																	45811025		1918	4124	6042	TESK2	SO:0001819	synonymous_variant	0			-	HGNC	AJ132545	CCDS41323.1	1p32	2010-04-27			ENSG00000070759	ENSG00000070759	2.7.12.1		11732	protein-coding gene	gene with protein product		604746				10512679	Standard	NM_007170		Approved		uc001cns.1	Q96S53	OTTHUMG00000007680	ENST00000372086.3:c.1203T>G	1.37:g.45811025A>C		Somatic	0	89	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	14	48.15	Q5T422|Q5T423|Q8N520|Q9Y3Q6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.P401	ENST00000372086.3	37	c.1203	CCDS41323.1	1																																																																																			-	NULL		0.547	TESK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TESK2	protein_coding	OTTHUMT00000020523.1	A	NM_007170	-		45811025	-1	no_errors	ENST00000372086	ensembl	human	known	74_37	silent	SNP	0.999	C
RP11-435B5.5	0	genome.wustl.edu	37	1	143398949	143398949	+	lincRNA	SNP	A	A	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr1:143398949A>T	ENST00000428624.1	+	0	4990				RP11-435B5.4_ENST00000423249.1_lincRNA																							AAATTCTATGATGATTTAAAA	0.289																																																	0								ENSG00000238261																																			RP11-435B5.5			0			-	Clone_based_vega_gene																													1.37:g.143398949A>T		Somatic	0	70	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			-	-		0.289	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	lincRNA	OTTHUMT00000037971.1	A		-		143398949	+1	no_errors	ENST00000458155	ensembl	human	known	74_37	rna	SNP	0.181	T
PRIM2	5558	genome.wustl.edu	37	6	57512787	57512788	+	3'UTR	INS	-	-	CACCAAGGC	rs373452397|rs376103961|rs386701662|rs79832250		TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr6:57512787_57512788insCACCAAGGC	ENST00000389488.2	+	0	1702_1703				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttgcactctgttgtgtaattgt	0.431																																																	0								ENSG00000146143																																			PRIM2	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1700->CACCAAGGC	6.37:g.57512787_57512788insCACCAAGGC		Somatic	NA	NA	NA		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			-	-		0.431	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	protein_coding	OTTHUMT00000043468.3	-	NM_000947			57512788	+1	no_errors	ENST00000389488	ensembl	human	known	74_37	rna	INS	0.057:0.034	CACCAAGGC
DOCK8	81704	genome.wustl.edu	37	9	379812	379812	+	Missense_Mutation	SNP	G	G	A	rs138519226	byFrequency	TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr9:379812G>A	ENST00000453981.1	+	21	2594	c.2482G>A	c.(2482-2484)Gcc>Acc	p.A828T	DOCK8_ENST00000469391.1_Missense_Mutation_p.A760T|DOCK8_ENST00000432829.2_Missense_Mutation_p.A760T|DOCK8_ENST00000382331.1_Missense_Mutation_p.A130T|DOCK8_ENST00000382329.1_Missense_Mutation_p.A295T			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	828					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		GGTGGCCATCGCCAACAGTCT	0.572																																																	0								ENSG00000107099	G	THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	133.0	109.0	117.0		2278,2278,2482	5.4	1.0	9	dbSNP_134	117	5,8595	5.0+/-18.6	0,5,4295	yes	missense,missense,missense	DOCK8	NM_001190458.1,NM_001193536.1,NM_203447.3	58,58,58	0,5,6498	AA,AG,GG		0.0581,0.0,0.0384	benign,benign,benign	760/2000,760/2032,828/2100	379812	5,13001	2203	4300	6503	DOCK8	SO:0001583	missense	0			-	HGNC	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.2482G>A	9.37:g.379812G>A	ENSP00000408464:p.Ala828Thr	Somatic	0	150	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	25	50.00	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_DOCK_C/D_N,superfamily_ARM-type_fold	p.A828T	ENST00000453981.1	37	c.2482	CCDS6440.2	9	.	.	.	.	.	.	.	.	.	.	G	20.2	3.943101	0.73672	0.0	5.81E-4	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382331;ENST00000382329	T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42	5.45	5.45	0.79879	.	0.190963	0.45361	D	0.000371	T	0.27933	0.0688	L	0.38531	1.155	0.42544	D	0.993081	P;B;B;B	0.49696	0.927;0.002;0.006;0.002	B;B;B;B	0.39217	0.294;0.004;0.007;0.004	T	0.06679	-1.0813	10	0.51188	T	0.08	.	19.2789	0.94044	0.0:0.0:1.0:0.0	.	130;760;295;828	A2A370;E9PH09;A2A369;Q8NF50	.;.;.;DOCK8_HUMAN	T	828;828;760;760;130;295	ENSP00000408464:A828T;ENSP00000394888:A760T;ENSP00000419438:A760T;ENSP00000371768:A130T;ENSP00000371766:A295T	ENSP00000287364:A828T	A	+	1	0	DOCK8	369812	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.589000	0.74080	2.561000	0.86390	0.555000	0.69702	GCC	-	NULL		0.572	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	protein_coding	OTTHUMT00000171792.5	G	XM_036307	rs138519226		379812	+1	no_errors	ENST00000453981	ensembl	human	known	74_37	missense	SNP	1.000	A
SPATA31A6	389730	genome.wustl.edu	37	9	43626916	43626916	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr9:43626916G>C	ENST00000332857.6	-	4	1799	c.1771C>G	c.(1771-1773)Ctc>Gtc	p.L591V	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	591					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TGTCTCCGGAGTTCAGGACTG	0.493																																																	0								ENSG00000185775						1.0	1.0	1.0					9																	43626916		38	123	161	SPATA31A6	SO:0001583	missense	0			-	HGNC		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.1771C>G	9.37:g.43626916G>C	ENSP00000329825:p.Leu591Val	Somatic	0	177	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	59	73	44.70		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L591V	ENST00000332857.6	37	c.1771	CCDS47973.1	9	.	.	.	.	.	.	.	.	.	.	G	0.268	-0.995000	0.02145	.	.	ENSG00000185775	ENST00000332857	T	0.09911	2.93	2.44	1.53	0.23141	.	0.805627	0.10828	N	0.629668	T	0.16171	0.0389	L	0.41710	1.295	0.09310	N	1	D	0.55605	0.972	P	0.61592	0.891	T	0.23368	-1.0190	10	0.14656	T	0.56	-8.1591	6.7059	0.23250	0.0:0.0:0.7185:0.2815	.	591	Q5VVP1	F75A6_HUMAN	V	591	ENSP00000329825:L591V	ENSP00000329825:L591V	L	-	1	0	FAM75A6	43566912	0.011000	0.17503	0.002000	0.10522	0.002000	0.02628	0.323000	0.19593	0.620000	0.30215	-1.306000	0.01317	CTC	-	NULL		0.493	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31A6	protein_coding	OTTHUMT00000036987.1	G	NM_001145196	-		43626916	-1	no_errors	ENST00000332857	ensembl	human	known	74_37	missense	SNP	0.002	C
POU4F2	5458	genome.wustl.edu	37	4	147561228	147561228	+	Silent	SNP	G	G	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr4:147561228G>A	ENST00000281321.3	+	2	746	c.498G>A	c.(496-498)gcG>gcA	p.A166A	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	166					axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					ACCCTTCCGCGTTGGCGGGCA	0.657																																																	0								ENSG00000151615						87.0	88.0	87.0					4																	147561228		2203	4300	6503	POU4F2	SO:0001819	synonymous_variant	0			-	HGNC	U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.498G>A	4.37:g.147561228G>A		Somatic	0	122	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	25	47.92	B1PJR6|B2RC84|Q13883|Q14987	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.A166	ENST00000281321.3	37	c.498	CCDS34074.1	4																																																																																			-	NULL		0.657	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F2	protein_coding	OTTHUMT00000367020.1	G	NM_004575	-		147561228	+1	no_errors	ENST00000281321	ensembl	human	known	74_37	silent	SNP	0.217	A
LOC100129434	100129434	genome.wustl.edu	37	2	56404786	56404786	+	RNA	SNP	T	T	G	rs116652533	byFrequency	TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr2:56404786T>G	ENST00000596663.1	-	0	369				AC007743.1_ENST00000447423.2_RNA|RP11-481J13.1_ENST00000606639.1_lincRNA|AC007743.1_ENST00000432793.1_RNA|RP11-482H16.1_ENST00000607540.1_RNA																							CTTAACAATCTGAGAGGCAGG	0.507																																																	0								ENSG00000233251																																			AC007743.1			0			-	Clone_based_vega_gene																													2.37:g.56404786T>G		Somatic	0	118	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	19	20.83		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000596663.1	37	NULL		2																																																																																			-	-		0.507	AC007743.1-005	KNOWN	basic	antisense	LOC100129434	antisense	OTTHUMT00000470756.1	T		-		56404786	-1	no_errors	ENST00000432793	ensembl	human	known	74_37	rna	SNP	0.001	G
RANGAP1	5905	genome.wustl.edu	37	22	41642642	41642642	+	Frame_Shift_Del	DEL	G	G	-	rs201423590		TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr22:41642642delG	ENST00000455915.2	-	15	3198	c.1729delC	c.(1729-1731)cgcfs	p.R577fs	RANGAP1_ENST00000405486.1_Frame_Shift_Del_p.R577fs|RANGAP1_ENST00000356244.3_Frame_Shift_Del_p.R577fs|RANGAP1_ENST00000407260.4_Frame_Shift_Del_p.R522fs			P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	577					mitotic cell cycle (GO:0000278)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of Ran GTPase activity (GO:0032853)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear pore (GO:0005643)|perinuclear region of cytoplasm (GO:0048471)	Ran GTPase activator activity (GO:0005098)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AGACTGTGGCGGGCGAAGGAG	0.622																																																	0								ENSG00000100401																																			RANGAP1	SO:0001589	frameshift_variant	0				HGNC	X82260	CCDS14012.1	22q13	2013-01-17			ENSG00000100401	ENSG00000100401			9854	protein-coding gene	gene with protein product		602362	"""segregation distorter homolog (Drosophila)"""	SD		7878053	Standard	NM_002883		Approved	Fug1, KIAA1835	uc003azu.3	P46060	OTTHUMG00000150940	ENST00000455915.2:c.1729delC	22.37:g.41642642delG	ENSP00000401470:p.Arg577fs	Somatic	0	133	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	21	8.70	Q96JJ2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ran_GTPase_activating_1_C,superfamily_Ran_GTPase_activating_1_C,smart_Leu-rich_rpt_RNase_inh_sub-typ	p.R577fs	ENST00000455915.2	37	c.1729	CCDS14012.1	22																																																																																			-	pfam_Ran_GTPase_activating_1_C,superfamily_Ran_GTPase_activating_1_C		0.622	RANGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RANGAP1	protein_coding	OTTHUMT00000320606.1	G	NM_002883			41642642	-1	no_errors	ENST00000356244	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
THAP11	57215	genome.wustl.edu	37	16	67876994	67876994	+	Silent	SNP	T	T	C			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr16:67876994T>C	ENST00000303596.1	+	1	782	c.537T>C	c.(535-537)acT>acC	p.T179T	CENPT_ENST00000562787.1_Intron	NM_020457.2	NP_065190.2	Q96EK4	THA11_HUMAN	THAP domain containing 11	179					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	8		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		CGCCCATCACTCCCACTGGAG	0.642																																																	0								ENSG00000168286						96.0	111.0	106.0					16																	67876994		2198	4300	6498	THAP11	SO:0001819	synonymous_variant	0			-	HGNC	AB015338	CCDS10847.1	16q22.1	2013-01-25			ENSG00000168286	ENSG00000168286		"""THAP (C2CH-type zinc finger) domain containing"""	23194	protein-coding gene	gene with protein product		609119				12575992, 8325628	Standard	NM_020457		Approved	HRIHFB2206, CTG-B45d, CTG-B43a	uc002euo.3	Q96EK4	OTTHUMG00000137546	ENST00000303596.1:c.537T>C	16.37:g.67876994T>C		Somatic	0	86	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	1	93.33	A4UCT5|A8K002|O94795	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.T179	ENST00000303596.1	37	c.537	CCDS10847.1	16																																																																																			-	NULL		0.642	THAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP11	protein_coding	OTTHUMT00000268879.1	T	NM_020457	-		67876994	+1	no_errors	ENST00000303596	ensembl	human	known	74_37	silent	SNP	0.999	C
KIAA1191	57179	genome.wustl.edu	37	5	175782612	175782612	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr5:175782612G>A	ENST00000298569.4	-	4	702	c.169C>T	c.(169-171)Cca>Tca	p.P57S	KIAA1191_ENST00000393728.2_Intron|RP11-843P14.2_ENST00000508187.1_RNA|KIAA1191_ENST00000393725.2_Missense_Mutation_p.P38S|KIAA1191_ENST00000510164.1_Missense_Mutation_p.P57S|RP11-843P14.1_ENST00000512934.1_RNA|KIAA1191_ENST00000533553.1_Intron	NM_020444.3	NP_065177.2	Q96A73	P33MX_HUMAN	KIAA1191	57						cytoplasm (GO:0005737)	oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6	all_cancers(89;0.00575)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.101)		GGAATCACTGGCTTCCAAGGG	0.582																																																	0								ENSG00000122203						126.0	103.0	111.0					5																	175782612		2203	4300	6503	KIAA1191	SO:0001583	missense	0			-	HGNC	BC010448	CCDS4399.1, CCDS43402.1, CCDS75373.1	5q35.2	2008-02-05			ENSG00000122203	ENSG00000122203			29209	protein-coding gene	gene with protein product						10574461, 10565538	Standard	XM_005265941		Approved	FLJ21022	uc003mdy.3	Q96A73	OTTHUMG00000130656	ENST00000298569.4:c.169C>T	5.37:g.175782612G>A	ENSP00000298569:p.Pro57Ser	Somatic	0	98	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	B2RD69|B8K1S6|Q6IA24|Q8NDU3|Q9BRE5|Q9H7D5|Q9ULM9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P57S	ENST00000298569.4	37	c.169	CCDS4399.1	5	.	.	.	.	.	.	.	.	.	.	G	33	5.275213	0.95459	.	.	ENSG00000122203	ENST00000298569;ENST00000393725;ENST00000510164;ENST00000506983;ENST00000503082;ENST00000504688	.	.	.	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.77157	0.4089	M	0.74881	2.28	0.80722	D	1	D	0.67145	0.996	P	0.59357	0.856	T	0.80113	-0.1518	9	0.66056	D	0.02	-11.5816	18.8135	0.92068	0.0:0.0:1.0:0.0	.	57	Q96A73	K1191_HUMAN	S	57;38;57;38;38;38	.	ENSP00000298569:P57S	P	-	1	0	KIAA1191	175715218	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.177000	0.94849	2.516000	0.84829	0.591000	0.81541	CCA	-	NULL		0.582	KIAA1191-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1191	protein_coding	OTTHUMT00000253146.2	G	NM_020444	-		175782612	-1	no_errors	ENST00000298569	ensembl	human	known	74_37	missense	SNP	1.000	A
FLAD1	80308	genome.wustl.edu	37	1	154956441	154956442	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr1:154956441_154956442insT	ENST00000292180.3	+	1	593_594	c.271_272insT	c.(271-273)aggfs	p.R91fs	FLAD1_ENST00000368432.1_5'UTR|FLAD1_ENST00000487371.1_3'UTR|FLAD1_ENST00000368431.3_5'UTR|FLAD1_ENST00000315144.10_5'UTR|FLAD1_ENST00000368433.1_Frame_Shift_Ins_p.R91fs	NM_025207.4	NP_079483.3	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase 1	91					FAD biosynthetic process (GO:0006747)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|FMN adenylyltransferase activity (GO:0003919)			endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|ovary(3)|skin(3)	22	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GGCCTTGCAGAGGGGCAGAGAA	0.614																																																	0								ENSG00000160688																																			FLAD1	SO:0001589	frameshift_variant	0				HGNC		CCDS1078.1, CCDS1079.1, CCDS53371.1, CCDS53372.1	1q22	2013-03-05	2013-03-05		ENSG00000160688	ENSG00000160688	2.7.7.2		24671	protein-coding gene	gene with protein product		610595	"""Fad1, flavin adenine dinucleotide synthetase, homolog (yeast)"", ""FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)"", ""flavin adenine dinucleotide synthetase"""				Standard	NM_001184891		Approved	PP591, FAD1	uc001fgf.2	Q8NFF5	OTTHUMG00000037416	Exception_encountered	1.37:g.154956441_154956442insT	ENSP00000292180:p.Arg91fs	Somatic	0	86	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	22	43.59	Q8N5J1|Q8N686|Q8WU93|Q8WUJ4|Q96CR8|Q99764|Q9HBN6	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Mopterin-bd_dom,pfam_PAPS_reduct,superfamily_Mopterin-bd_dom,smart_Mopterin-bd_dom,pirsf_FAD_synth_Mopterin-bd	p.R91fs	ENST00000292180.3	37	c.271_272	CCDS1078.1	1																																																																																			-	pirsf_FAD_synth_Mopterin-bd		0.614	FLAD1-001	NOVEL	basic|CCDS	protein_coding	FLAD1	protein_coding	OTTHUMT00000091089.1	-	NM_025207			154956442	+1	no_errors	ENST00000292180	ensembl	human	novel	74_37	frame_shift_ins	INS	0.034:0.042	T
MAML3	55534	genome.wustl.edu	37	4	140811086	140811096	+	Frame_Shift_Del	DEL	GCTGCTGCTGC	GCTGCTGCTGC	-	rs561881989|rs544518608|rs574825040|rs79090010|rs58287721|rs553194721	byFrequency	TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	GCTGCTGCTGC	GCTGCTGCTGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr4:140811086_140811096delGCTGCTGCTGC	ENST00000509479.2	-	2	2350_2360	c.1494_1504delGCAGCAGCAGC	c.(1492-1506)cagcagcagcagcagfs	p.QQQQQ498fs	MAML3_ENST00000327122.5_Frame_Shift_Del_p.QQQQQ342fs|MAML3_ENST00000398940.1_Intron	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					tgctgctgctgctgctgctgctgctgctgct	0.531														46	0.0091853	0.0015	0.0014	5008	,	,		18223	0.0129		0.0229	False		,,,				2504	0.0072																0								ENSG00000196782																																			MAML3	SO:0001589	frameshift_variant	0				HGNC	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1494_1504delGCAGCAGCAGC	4.37:g.140811086_140811096delGCTGCTGCTGC	ENSP00000421180:p.Gln498fs	Somatic	NA	NA	NA		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Neuroggenic_mastermind-like_N	p.Q499fs	ENST00000509479.2	37	c.1504_1494	CCDS54805.1	4																																																																																			-	NULL		0.531	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML3	protein_coding	OTTHUMT00000364934.2	GCTGCTGCTGC				140811096	-1	no_errors	ENST00000509479	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:0.999:1.000:0.997:1.000:1.000:0.999:1.000:1.000:0.999	-
GPR111	222611	genome.wustl.edu	37	6	47649471	47649471	+	Silent	SNP	A	A	G			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr6:47649471A>G	ENST00000296862.1	+	6	1176	c.1176A>G	c.(1174-1176)acA>acG	p.T392T	GPR111_ENST00000507065.1_Silent_p.T324T|GPR111_ENST00000398742.2_Silent_p.T324T			Q8IZF7	GP111_HUMAN	G protein-coupled receptor 111	392	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(15)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						AGAGGAGGACACAGTGTGTTG	0.458																																																	0								ENSG00000164393						93.0	93.0	93.0					6																	47649471		1940	4145	6085	GPR111	SO:0001819	synonymous_variant	0			-	HGNC	AB065684		6p12.3	2014-08-08			ENSG00000164393	ENSG00000164393		"""-"", ""GPCR / Class B : Orphans"""	18991	protein-coding gene	gene with protein product						12435584	Standard	NM_153839		Approved	hGPCR35, PGR20	uc003oyy.3	Q8IZF7	OTTHUMG00000046168	ENST00000296862.1:c.1176A>G	6.37:g.47649471A>G		Somatic	0	60	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	9	40.00	Q2PNZ1|Q86SL6|Q8NGU5|Q8TDT5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.T392	ENST00000296862.1	37	c.1176		6																																																																																			-	pfam_GPS_dom,pfscan_GPS_dom		0.458	GPR111-001	KNOWN	basic	protein_coding	GPR111	protein_coding	OTTHUMT00000106423.2	A	NM_153839	-		47649471	+1	no_errors	ENST00000296862	ensembl	human	known	74_37	silent	SNP	0.004	G
S100A7L2	645922	genome.wustl.edu	37	1	153410753	153410753	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr1:153410753C>T	ENST00000368725.2	-	2	85	c.86G>A	c.(85-87)cGc>cAc	p.R29H		NM_001045479.1	NP_001038944.2	Q5SY68	S1A7B_HUMAN	S100 calcium binding protein A7-like 2	18	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			NS(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	8	all_lung(78;2.4e-33)|Lung NSC(65;8.13e-32)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			ACTGTATTGGCGAAACATCGC	0.448																																																	0								ENSG00000197364						189.0	154.0	166.0					1																	153410753		2203	4300	6503	S100A7L2	SO:0001583	missense	0			-	HGNC			1q21.3	2013-01-10			ENSG00000197364	ENSG00000197364		"""EF-hand domain containing"""	21655	protein-coding gene	gene with protein product							Standard	NM_001045479		Approved	s100a7b	uc010pdx.2	Q5SY68	OTTHUMG00000013129	ENST00000368725.2:c.86G>A	1.37:g.153410753C>T	ENSP00000357714:p.Arg29His	Somatic	0	37	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	6	50.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfscan_EF_hand_dom	p.R29H	ENST00000368725.2	37	c.86		1	.	.	.	.	.	.	.	.	.	.	.	0.007	-1.966075	0.00461	.	.	ENSG00000197364	ENST00000368725;ENST00000368724;ENST00000453814	T;T;T	0.06218	3.33;3.33;3.33	2.01	-2.2	0.06994	EF-hand-like domain (1);	.	.	.	.	T	0.00271	0.0008	N	0.00069	-2.28	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44436	-0.9328	9	0.02654	T	1	.	5.9252	0.19108	0.0:0.473:0.0:0.527	.	18	Q5SY68	S1A7B_HUMAN	H	18;18;29	ENSP00000357714:R18H;ENSP00000357713:R18H;ENSP00000405610:R29H	ENSP00000357713:R18H	R	-	2	0	S100A7L2	151677377	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.049000	0.14099	-0.591000	0.05859	-0.513000	0.04457	CGC	-	NULL		0.448	S100A7L2-001	KNOWN	basic|appris_principal	protein_coding	S100A7L2	protein_coding	OTTHUMT00000036797.2	C	NM_001045479	-		153410753	-1	no_errors	ENST00000368725	ensembl	human	known	74_37	missense	SNP	0.000	T
USP9Y	8287	genome.wustl.edu	37	Y	14902412	14902412	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chrY:14902412G>A	ENST00000338981.3	+	25	4579	c.3634G>A	c.(3634-3636)Gag>Aag	p.E1212K	USP9Y_ENST00000426564.2_3'UTR	NM_004654.3	NP_004645.2	O00507	USP9Y_HUMAN	ubiquitin specific peptidase 9, Y-linked	1212					BMP signaling pathway (GO:0030509)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)	co-SMAD binding (GO:0070410)|cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(8)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						TCCCTCATCCGAGTGCGTACT	0.388																																																	0								ENSG00000114374						81.0	76.0	77.0					Y																	14902412		608	1947	2555	USP9Y	SO:0001583	missense	0			-	HGNC	Y13618	CCDS14781.1	Yq11.2	2010-04-09	2009-03-17		ENSG00000114374	ENSG00000114374		"""Ubiquitin-specific peptidases"""	12633	protein-coding gene	gene with protein product	"""fat facets-like homolog (Drosophila)"""	400005	"""ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila)"""			8922996, 9384609, 19246359	Standard	NM_004654		Approved	DFFRY	uc004fst.1	O00507	OTTHUMG00000036469	ENST00000338981.3:c.3634G>A	Y.37:g.14902412G>A	ENSP00000342812:p.Glu1212Lys	Somatic	0	98	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	O14601	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,superfamily_ARM-type_fold,superfamily_Glycoside_hydrolase_SF,pfscan_Peptidase_C19/C67	p.E1212K	ENST00000338981.3	37	c.3634	CCDS14781.1	Y																																																																																			-	superfamily_ARM-type_fold		0.388	USP9Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP9Y	protein_coding	OTTHUMT00000088703.2	G	NM_004654	-		14902412	+1	no_errors	ENST00000338981	ensembl	human	known	74_37	missense	SNP	1.000	A
SYT16	83851	genome.wustl.edu	37	14	62550996	62550996	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr14:62550996C>T	ENST00000430451.2	+	5	1714	c.1517C>T	c.(1516-1518)gCg>gTg	p.A506V		NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	506					exocytosis (GO:0006887)					central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		CATGGAGGGGCGCCAGAGCTG	0.552																																																	0								ENSG00000139973						94.0	94.0	94.0					14																	62550996		1996	4159	6155	SYT16	SO:0001583	missense	0			-	HGNC	BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.1517C>T	14.37:g.62550996C>T	ENSP00000394700:p.Ala506Val	Somatic	0	69	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	3	75.00	B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.A506V	ENST00000430451.2	37	c.1517	CCDS45121.1	14	.	.	.	.	.	.	.	.	.	.	C	5.516	0.280188	0.10458	.	.	ENSG00000139973	ENST00000430451	T	0.03358	3.96	5.44	2.02	0.26589	C2 calcium/lipid-binding domain, CaLB (1);	0.446785	0.24172	N	0.040890	T	0.00875	0.0029	N	0.00392	-1.555	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44034	-0.9354	10	0.02654	T	1	-8.4549	5.8926	0.18921	0.0:0.3768:0.0:0.6232	.	506	Q17RD7	SYT16_HUMAN	V	506	ENSP00000394700:A506V	ENSP00000394700:A506V	A	+	2	0	SYT16	61620749	0.995000	0.38212	1.000000	0.80357	0.994000	0.84299	0.782000	0.26788	0.646000	0.30693	0.643000	0.83706	GCG	-	superfamily_C2_dom		0.552	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	SYT16	protein_coding	OTTHUMT00000411700.1	C	NM_031914	-		62550996	+1	no_errors	ENST00000430451	ensembl	human	novel	74_37	missense	SNP	0.999	T
DYNC1H1	1778	genome.wustl.edu	37	14	102493601	102493601	+	Silent	SNP	C	C	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr14:102493601C>T	ENST00000360184.4	+	45	9026	c.8862C>T	c.(8860-8862)aaC>aaT	p.N2954N		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2954	AAA 4. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CCTGGATGAACGGTTTGAGTG	0.488																																																	0								ENSG00000197102						274.0	232.0	246.0					14																	102493601		2203	4300	6503	DYNC1H1	SO:0001819	synonymous_variant	0			-	HGNC	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.8862C>T	14.37:g.102493601C>T		Somatic	0	175	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	5	86.49	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.N2954	ENST00000360184.4	37	c.8862	CCDS9966.1	14																																																																																			-	pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.488	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	protein_coding	OTTHUMT00000414574.1	C	NM_001376	-		102493601	+1	no_errors	ENST00000360184	ensembl	human	known	74_37	silent	SNP	0.786	T
PRTN3	5657	genome.wustl.edu	37	19	841040	841040	+	Missense_Mutation	SNP	C	C	T	rs551079189		TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr19:841040C>T	ENST00000234347.5	+	1	78	c.32C>T	c.(31-33)gCg>gTg	p.A11V	PRTN3_ENST00000544537.2_5'Flank	NM_002777.3	NP_002768.3	P24158	PRTN3_HUMAN	proteinase 3	11					collagen catabolic process (GO:0030574)|mature dendritic cell differentiation (GO:0097029)|negative regulation of phagocytosis (GO:0050765)|positive regulation of cell proliferation (GO:0008284)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			lung(1)|ovary(2)|urinary_tract(1)	4		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGCCCTGGCGTCCGTGCTG	0.657													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16432	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000196415						30.0	28.0	29.0					19																	841040		2202	4300	6502	PRTN3	SO:0001583	missense	0			-	HGNC		CCDS32860.1	19p13.3	2008-07-31	2008-07-31			ENSG00000196415			9495	protein-coding gene	gene with protein product	"""myeloblastin"", ""serine proteinase, neutrophil"", ""Wegener granulomatosis autoantigen"""	177020				2258701	Standard	NM_002777		Approved	PR-3, ACPA, C-ANCA, AGP7, MBT, P29	uc002lqa.1	P24158		ENST00000234347.5:c.32C>T	19.37:g.841040C>T	ENSP00000234347:p.Ala11Val	Somatic	0	156	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	41	33.87	P15637|P18078|Q4VB08|Q4VB09|Q6LBM7|Q6LBN2|Q9UD25|Q9UQD8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.A11V	ENST00000234347.5	37	c.32	CCDS32860.1	19	.	.	.	.	.	.	.	.	.	.	C	10.58	1.389380	0.25118	.	.	ENSG00000196415	ENST00000234347	D	0.89123	-2.47	1.75	1.75	0.24633	.	.	.	.	.	T	0.69672	0.3137	N	0.19112	0.55	0.09310	N	1	D	0.54772	0.968	B	0.31869	0.137	T	0.66948	-0.5794	9	0.02654	T	1	.	6.9682	0.24635	0.0:1.0:0.0:0.0	.	11	P24158	PRTN3_HUMAN	V	11	ENSP00000234347:A11V	ENSP00000234347:A11V	A	+	2	0	PRTN3	792040	0.000000	0.05858	0.002000	0.10522	0.046000	0.14306	0.217000	0.17603	1.293000	0.44690	0.313000	0.20887	GCG	-	NULL		0.657	PRTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRTN3	protein_coding	OTTHUMT00000457888.2	C	NM_002777	-		841040	+1	no_errors	ENST00000234347	ensembl	human	known	74_37	missense	SNP	0.002	T
OR52L1	338751	genome.wustl.edu	37	11	6007790	6007790	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr11:6007790G>T	ENST00000332249.4	-	1	425	c.371C>A	c.(370-372)gCa>gAa	p.A124E		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	124						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGAGGAGAATGCATGGATGAA	0.547																																					Melanoma(121;653 1666 10547 22796 51255)												0								ENSG00000183313						53.0	54.0	54.0					11																	6007790		2120	4252	6372	OR52L1	SO:0001583	missense	0			-	HGNC	AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.371C>A	11.37:g.6007790G>T	ENSP00000330338:p.Ala124Glu	Somatic	0	118	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	5	82.76	B2RPA6|Q6IFK9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A124E	ENST00000332249.4	37	c.371	CCDS44529.1	11	.	.	.	.	.	.	.	.	.	.	G	14.70	2.613225	0.46631	.	.	ENSG00000183313	ENST00000332249	T	0.00402	7.56	3.5	2.55	0.30701	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40554	N	0.001073	T	0.00724	0.0024	M	0.66560	2.04	0.25151	N	0.990428	D	0.76494	0.999	D	0.80764	0.994	T	0.50625	-0.8806	10	0.39692	T	0.17	.	5.549	0.17079	0.116:0.0:0.6849:0.1991	.	124	Q8NGH7	O52L1_HUMAN	E	124	ENSP00000330338:A124E	ENSP00000330338:A124E	A	-	2	0	OR52L1	5964366	0.000000	0.05858	1.000000	0.80357	0.940000	0.58332	-0.067000	0.11579	1.662000	0.50781	0.313000	0.20887	GCA	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.547	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52L1	protein_coding	OTTHUMT00000383754.1	G	NM_001005173	-		6007790	-1	no_errors	ENST00000332249	ensembl	human	known	74_37	missense	SNP	0.676	T
PRSS1	5644	genome.wustl.edu	37	7	142459862	142459862	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr7:142459862C>A	ENST00000311737.7	+	3	444	c.438C>A	c.(436-438)aaC>aaA	p.N146K	PRSS1_ENST00000486171.1_Missense_Mutation_p.N160K	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	146	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	GCTGGGGCAACACTGCGAGCT	0.572																																																	0								ENSG00000204983						70.0	71.0	71.0					7																	142459862		2203	4300	6503	PRSS1	SO:0001583	missense	0			-	HGNC	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.438C>A	7.37:g.142459862C>A	ENSP00000308720:p.Asn146Lys	Somatic	0	89	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	36	21.74	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.N146K	ENST00000311737.7	37	c.438	CCDS5872.1	7	.	.	.	.	.	.	.	.	.	.	C	13.43	2.234863	0.39498	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243;ENST00000492062	D;D;D	0.88354	-2.37;-2.37;-2.37	3.28	3.28	0.37604	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.85461	0.5702	N	0.02658	-0.545	0.46149	D	0.998893	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.89571	0.3813	10	0.87932	D	0	.	14.0086	0.64481	0.0:1.0:0.0:0.0	.	160;146	E7EQ64;P07477	.;TRY1_HUMAN	K	160;146;136;96	ENSP00000417854:N160K;ENSP00000308720:N146K;ENSP00000419912:N96K	ENSP00000308720:N146K	N	+	3	2	PRSS1	142139436	1.000000	0.71417	1.000000	0.80357	0.028000	0.11728	4.686000	0.61700	1.789000	0.52484	0.398000	0.26397	AAC	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.572	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS1	protein_coding	OTTHUMT00000352538.2	C		-		142459862	+1	no_errors	ENST00000311737	ensembl	human	known	74_37	missense	SNP	1.000	A
ENO2	2026	genome.wustl.edu	37	12	7028828	7028828	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr12:7028828delA	ENST00000535366.1	+	7	1392	c.766delA	c.(766-768)aaafs	p.K256fs	ENO2_ENST00000229277.1_Frame_Shift_Del_p.K256fs|ENO2_ENST00000545045.2_Frame_Shift_Del_p.K137fs|ENO2_ENST00000538763.1_Frame_Shift_Del_p.K213fs|ENO2_ENST00000541477.1_Frame_Shift_Del_p.K256fs|ENO2_ENST00000544774.1_Frame_Shift_Del_p.K213fs			P09104	ENOG_HUMAN	enolase 2 (gamma, neuronal)	256					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|perikaryon (GO:0043204)|phosphopyruvate hydratase complex (GO:0000015)|photoreceptor inner segment (GO:0001917)|plasma membrane (GO:0005886)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			endometrium(3)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						TCGTGATGGCAAATATGACTT	0.517																																																	0								ENSG00000111674						166.0	132.0	143.0					12																	7028828		2203	4300	6503	ENO2	SO:0001589	frameshift_variant	0				HGNC	M22349	CCDS8570.1	12p13	2012-10-02				ENSG00000111674	4.2.1.11		3353	protein-coding gene	gene with protein product		131360					Standard	NM_001975		Approved		uc001qru.1	P09104		ENST00000535366.1:c.766delA	12.37:g.7028828delA	ENSP00000437402:p.Lys256fs	Somatic	0	78	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	B7Z2X9|Q96J33	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Enolase_C,pfam_Enolase_N,pfam_MeAsp_NH4-lyase_C,pirsf_Enolase,prints_Enolase,tigrfam_Enolase	p.K256fs	ENST00000535366.1	37	c.766	CCDS8570.1	12																																																																																			-	pfam_Enolase_C,pirsf_Enolase,tigrfam_Enolase		0.517	ENO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENO2	protein_coding	OTTHUMT00000401786.1	A				7028828	+1	no_errors	ENST00000229277	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
EDEM2	55741	genome.wustl.edu	37	20	33730242	33730242	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr20:33730242C>T	ENST00000374492.3	-	4	403	c.298G>A	c.(298-300)Gtg>Atg	p.V100M	EDEM2_ENST00000540582.1_Missense_Mutation_p.V59M|EDEM2_ENST00000374491.3_Missense_Mutation_p.V63M|EDEM2_ENST00000541621.1_De_novo_Start_InFrame|EDEM2_ENST00000542871.1_De_novo_Start_OutOfFrame	NM_018217.2	NP_060687.2	Q9BV94	EDEM2_HUMAN	ER degradation enhancer, mannosidase alpha-like 2	100					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	22			BRCA - Breast invasive adenocarcinoma(18;0.00936)			TCCTGGAGCACTTCAACCACT	0.428																																					Esophageal Squamous(51;906 1021 24535 36410 39145)												0								ENSG00000088298						83.0	75.0	78.0					20																	33730242		2203	4300	6503	EDEM2	SO:0001583	missense	0			-	HGNC	AK001645	CCDS13247.1, CCDS46592.1	20q11.22	2006-03-31	2006-03-31	2006-03-31	ENSG00000088298	ENSG00000088298			15877	protein-coding gene	gene with protein product		610302	"""chromosome 20 open reading frame 31"""	C20orf49, C20orf31		15537790, 15579471	Standard	NM_018217		Approved	FLJ10783, bA4204.1	uc002xbo.2	Q9BV94	OTTHUMG00000032322	ENST00000374492.3:c.298G>A	20.37:g.33730242C>T	ENSP00000363616:p.Val100Met	Somatic	0	81	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	19	53.66	B4DTG9|Q6GU33|Q6IA89|Q6UWZ4|Q9H4U0|Q9H886|Q9NTL9|Q9NVE6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.V100M	ENST00000374492.3	37	c.298	CCDS13247.1	20	.	.	.	.	.	.	.	.	.	.	C	14.80	2.642576	0.47153	.	.	ENSG00000088298	ENST00000374491;ENST00000374492;ENST00000540582	T;T;T	0.44083	0.93;0.93;0.93	5.87	5.87	0.94306	.	0.194687	0.44902	D	0.000410	T	0.39655	0.1086	L	0.33137	0.985	0.53688	D	0.999972	B;B;B	0.27117	0.062;0.168;0.098	B;B;B	0.30943	0.012;0.074;0.122	T	0.13255	-1.0516	10	0.45353	T	0.12	-19.5919	19.8286	0.96626	0.0:1.0:0.0:0.0	.	59;63;100	F5GZ44;Q9BV94-2;Q9BV94	.;.;EDEM2_HUMAN	M	63;100;59	ENSP00000363615:V63M;ENSP00000363616:V100M;ENSP00000441548:V59M	ENSP00000363615:V63M	V	-	1	0	EDEM2	33193903	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.515000	0.53429	2.785000	0.95823	0.655000	0.94253	GTG	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47		0.428	EDEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDEM2	protein_coding	OTTHUMT00000078842.2	C	NM_018217	-		33730242	-1	no_errors	ENST00000374492	ensembl	human	known	74_37	missense	SNP	0.998	T
CERS6	253782	genome.wustl.edu	37	2	169571588	169571588	+	Silent	SNP	A	A	C			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr2:169571588A>C	ENST00000305747.6	+	7	1274	c.687A>C	c.(685-687)cgA>cgC	p.R229R	CERS6_ENST00000392687.4_Silent_p.R229R	NM_203463.2	NP_982288.1	Q6ZMG9	CERS6_HUMAN	ceramide synthase 6	229	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										ATATGGCCCGAGTAGGAACGC	0.373																																																	0								ENSG00000172292						209.0	196.0	200.0					2																	169571588		2203	4300	6503	CERS6	SO:0001819	synonymous_variant	0			-	HGNC	BX393696	CCDS2228.1, CCDS58734.1	2q31	2011-07-11	2011-07-08	2011-07-08	ENSG00000172292	ENSG00000172292		"""Homeoboxes / CERS class"""	23826	protein-coding gene	gene with protein product		615336	"""LAG1 longevity assurance homolog 6 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 6"""	LASS6			Standard	NM_203463		Approved		uc002uec.2	Q6ZMG9	OTTHUMG00000132183	ENST00000305747.6:c.687A>C	2.37:g.169571588A>C		Somatic	0	168	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	53	17.19	Q32M63|Q8N617	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TLC-dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_TLC-dom,pirsf_Longevity_assurance_LAG1_LAC1,pfscan_TLC-dom,pfscan_Homeobox_dom	p.R229	ENST00000305747.6	37	c.687	CCDS2228.1	2																																																																																			-	pfam_TLC-dom,smart_TLC-dom,pirsf_Longevity_assurance_LAG1_LAC1,pfscan_TLC-dom		0.373	CERS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CERS6	protein_coding	OTTHUMT00000255235.2	A	NM_203463	-		169571588	+1	no_errors	ENST00000392687	ensembl	human	known	74_37	silent	SNP	1.000	C
CFAP44	55779	genome.wustl.edu	37	3	113045447	113045447	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr3:113045447delT	ENST00000393845.2	-	28	4427	c.4361delA	c.(4360-4362)aagfs	p.K1454fs	WDR52_ENST00000308346.6_Frame_Shift_Del_p.K57fs	NM_001164496.1	NP_001157968.1														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						GATTTCATTCTTTTTCTCTTC	0.338																																																	0								ENSG00000206530						152.0	116.0	127.0					3																	113045447		692	1591	2283	WDR52	SO:0001589	frameshift_variant	0				HGNC																												ENST00000393845.2:c.4361delA	3.37:g.113045447delT	ENSP00000377428:p.Lys1454fs	Somatic	0	60	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K1454fs	ENST00000393845.2	37	c.4361	CCDS54624.1	3																																																																																			-	NULL		0.338	WDR52-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR52	protein_coding		T				113045447	-1	no_errors	ENST00000393845	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
OTUD6B	51633	genome.wustl.edu	37	8	92096322	92096322	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr8:92096322delA	ENST00000285420.4	+	6	966	c.867delA	c.(865-867)tcafs	p.S289fs	OTUD6B_ENST00000404789.3_Frame_Shift_Del_p.S158fs	NM_016023.3	NP_057107.3	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B	259				VNIVTENCS -> GKHSY (in Ref. 1; AAD34073). {ECO:0000305}.			cysteine-type peptidase activity (GO:0008234)	p.K261fs*3(1)|p.K291fs*3(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11			BRCA - Breast invasive adenocarcinoma(11;0.0187)			AAGAATATTCAAAAAAACCAC	0.284																																																	2	Deletion - Frameshift(2)	large_intestine(2)						ENSG00000155100			1,4251		0,1,2125	47.0	42.0	44.0			2.9	0.0	8		45	6,8230		0,6,4112	no	frameshift	OTUD6B	NM_016023.3		0,7,6237	A1A1,A1R,RR		0.0729,0.0235,0.0561			92096322	7,12481	2198	4292	6490	OTUD6B	SO:0001589	frameshift_variant	0				HGNC		CCDS6253.2, CCDS69513.1	8q21.3	2013-01-21			ENSG00000155100	ENSG00000155100		"""OTU domain containing"""	24281	protein-coding gene	gene with protein product		612021					Standard	NM_016023		Approved	CGI-77, DUBA5	uc003yeu.4	Q8N6M0	OTTHUMG00000150758	ENST00000285420.4:c.867delA	8.37:g.92096322delA	ENSP00000285420:p.Ser289fs	Somatic	0	97	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	32	8.57	A8K6I1|B4DEY0|Q9NTA4|Q9Y387	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_OTU,pfam_Peptidase_C65_otubain,pfscan_OTU	p.K291fs	ENST00000285420.4	37	c.867	CCDS6253.2	8																																																																																			-	pfam_OTU,pfscan_OTU		0.284	OTUD6B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	OTUD6B	protein_coding	OTTHUMT00000319968.1	A	NM_016023			92096322	+1	no_errors	ENST00000285420	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
CCDC30	728621	genome.wustl.edu	37	1	42948563	42948563	+	Intron	DEL	A	A	-	rs202122677	byFrequency	TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr1:42948563delA	ENST00000428554.2	+	4	746				CCDC30_ENST00000475614.2_3'UTR			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30							extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						GGAACATGAGAAAAAAAAAAA	0.363													|||unknown(HR)	839	0.167532	0.1573	0.1556	5008	,	,		20659	0.1746		0.1998	False		,,,				2504	0.1493																0								ENSG00000186409																																			CCDC30	SO:0001627	intron_variant	0				HGNC	AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000428554.2:c.-398+76A>-	1.37:g.42948563delA		Somatic	0	24	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	Q14F06|Q5VVM5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000428554.2	37	NULL	CCDS30690.1	1																																																																																			-	-		0.363	CCDC30-203	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC30	protein_coding		A	NM_025030			42948563	+1	no_errors	ENST00000475614	ensembl	human	known	74_37	rna	DEL	0.003	-
ATRX	546	genome.wustl.edu	37	X	76937411	76937411	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chrX:76937411C>A	ENST00000373344.5	-	9	3551	c.3337G>T	c.(3337-3339)Gag>Tag	p.E1113*	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Nonsense_Mutation_p.E1075*	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1113					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						GAATATTTCTCAGTATCAGAT	0.338			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224						94.0	100.0	98.0					X																	76937411		2203	4293	6496	ATRX	SO:0001587	stop_gained	0			-	HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.3337G>T	X.37:g.76937411C>A	ENSP00000362441:p.Glu1113*	Somatic	0	16	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	0	100.00	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E1113*	ENST00000373344.5	37	c.3337	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	C	44	10.988366	0.99499	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	.	.	.	5.51	4.64	0.57946	.	0.253331	0.31071	N	0.008305	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-16.1903	10.7509	0.46209	0.0:0.9101:0.0:0.0899	.	.	.	.	X	1113;1075;1040	.	ENSP00000362441:E1113X	E	-	1	0	ATRX	76824067	1.000000	0.71417	0.846000	0.33378	0.977000	0.68977	5.292000	0.65673	1.084000	0.41184	0.513000	0.50165	GAG	-	NULL		0.338	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	C	NM_000489	-		76937411	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	nonsense	SNP	0.992	A
ANO8	57719	genome.wustl.edu	37	19	17443927	17443927	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr19:17443927G>A	ENST00000159087.4	-	4	630	c.472C>T	c.(472-474)Cgc>Tgc	p.R158C	GTPBP3_ENST00000361619.5_5'Flank	NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	158					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						GTGAAGAAGCGTAGCTCGCTC	0.627																																																	0								ENSG00000074855						40.0	45.0	43.0					19																	17443927		2203	4300	6503	ANO8	SO:0001583	missense	0			-	HGNC	AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.472C>T	19.37:g.17443927G>A	ENSP00000159087:p.Arg158Cys	Somatic	0	65	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	7	74.07	A6NIJ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Anoctamin	p.R158C	ENST00000159087.4	37	c.472	CCDS32949.1	19	.	.	.	.	.	.	.	.	.	.	G	14.64	2.595919	0.46318	.	.	ENSG00000074855	ENST00000159087	T	0.61158	0.13	5.14	4.1	0.47936	.	0.355854	0.31335	N	0.007839	T	0.27205	0.0667	N	0.01705	-0.755	0.37129	D	0.901153	B	0.22983	0.078	B	0.23852	0.049	T	0.20405	-1.0276	10	0.45353	T	0.12	.	5.8157	0.18492	0.0971:0.0:0.7098:0.1931	.	158	Q9HCE9	ANO8_HUMAN	C	158	ENSP00000159087:R158C	ENSP00000159087:R158C	R	-	1	0	ANO8	17304927	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.745000	0.55119	2.396000	0.81511	0.555000	0.69702	CGC	-	NULL		0.627	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO8	protein_coding	OTTHUMT00000462943.1	G	XM_050644	-		17443927	-1	no_errors	ENST00000159087	ensembl	human	known	74_37	missense	SNP	0.988	A
VPS16	64601	genome.wustl.edu	37	20	2842314	2842314	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr20:2842314G>A	ENST00000380445.3	+	9	935	c.863G>A	c.(862-864)cGg>cAg	p.R288Q	PTPRA_ENST00000380393.3_5'Flank|VPS16_ENST00000380443.3_5'Flank|VPS16_ENST00000380469.3_Missense_Mutation_p.R288Q|VPS16_ENST00000481812.2_3'UTR	NM_022575.2	NP_072097.2	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 homolog (S. cerevisiae)	288					intracellular protein transport (GO:0006886)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|axon (GO:0030424)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	37						TGGGAAAGGCGGCTGATGGTG	0.632																																																	0								ENSG00000215305						75.0	67.0	70.0					20																	2842314		2202	4300	6502	VPS16	SO:0001583	missense	0			-	HGNC	AF308801	CCDS13036.1, CCDS13037.1	20p13	2009-07-07	2009-07-07	2009-07-07	ENSG00000215305	ENSG00000215305			14584	protein-coding gene	gene with protein product		608550					Standard	NM_022575		Approved		uc002whe.3	Q9H269	OTTHUMG00000031714	ENST00000380445.3:c.863G>A	20.37:g.2842314G>A	ENSP00000369810:p.Arg288Gln	Somatic	0	135	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	11	74.42	Q5JUB1|Q8WU31|Q96EE7|Q96N92|Q9H1Q4|Q9H1Q5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Vps16_N,pfam_Vps16_C,pirsf_VPS16	p.R288Q	ENST00000380445.3	37	c.863	CCDS13036.1	20	.	.	.	.	.	.	.	.	.	.	G	14.36	2.513223	0.44660	.	.	ENSG00000215305	ENST00000380445;ENST00000380469;ENST00000453689;ENST00000417508	T;T	0.42900	0.98;0.96	5.62	4.66	0.58398	Vps16, N-terminal (1);	0.264721	0.37577	N	0.002033	T	0.32010	0.0815	L	0.29908	0.895	0.80722	D	1	D;B	0.63046	0.992;0.032	P;B	0.45753	0.492;0.008	T	0.04413	-1.0953	10	0.12766	T	0.61	-14.3365	11.8597	0.52459	0.0:0.0:0.8252:0.1748	.	288;288	Q9H269-2;Q9H269	.;VPS16_HUMAN	Q	288;288;170;170	ENSP00000369810:R288Q;ENSP00000369836:R288Q	ENSP00000369810:R288Q	R	+	2	0	VPS16	2790314	1.000000	0.71417	0.999000	0.59377	0.893000	0.52053	3.083000	0.50136	1.365000	0.46057	0.650000	0.86243	CGG	-	pfam_Vps16_N,pirsf_VPS16		0.632	VPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS16	protein_coding	OTTHUMT00000077658.2	G	NM_022575	-		2842314	+1	no_errors	ENST00000380445	ensembl	human	known	74_37	missense	SNP	1.000	A
GSDMD	79792	genome.wustl.edu	37	8	144642052	144642052	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr8:144642052C>A	ENST00000526406.1	+	6	1206	c.323C>A	c.(322-324)gCc>gAc	p.A108D	GSDMD_ENST00000262580.4_Missense_Mutation_p.A108D|GSDMD_ENST00000533063.1_Missense_Mutation_p.A156D	NM_001166237.1	NP_001159709.1	P57764	GSDMD_HUMAN	gasdermin D	108					cellular response to extracellular stimulus (GO:0031668)					breast(1)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	12						GCAGGCGGGGCCGCGGTGTCT	0.612																																																	0								ENSG00000104518						45.0	47.0	46.0					8																	144642052		2201	4298	6499	GSDMD	SO:0001583	missense	0			-	HGNC	AK096216	CCDS34956.1	8q24.3	2008-07-31	2008-07-31	2008-07-31		ENSG00000104518			25697	protein-coding gene	gene with protein product			"""gasdermin domain containing 1"""	GSDMDC1		15289881, 17350798	Standard	NM_024736		Approved	FLJ12150, DF5L	uc003yyg.3	P57764		ENST00000526406.1:c.323C>A	8.37:g.144642052C>A	ENSP00000433209:p.Ala108Asp	Somatic	0	87	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	24	40.00	D3DWJ9|Q96Q98	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Gasdermin	p.A108D	ENST00000526406.1	37	c.323	CCDS34956.1	8	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909706	0.72983	.	.	ENSG00000104518	ENST00000526406;ENST00000533348;ENST00000533063;ENST00000262580;ENST00000525721;ENST00000534018;ENST00000533888	T;T;T;T;T;T;T	0.28255	1.62;1.62;1.62;1.62;1.62;1.62;1.62	4.7	3.8	0.43715	.	0.235038	0.29145	N	0.013011	T	0.51736	0.1692	M	0.78801	2.425	0.09310	N	1	D;D;D	0.89917	1.0;0.997;0.996	D;D;D	0.83275	0.996;0.952;0.919	T	0.35076	-0.9803	10	0.49607	T	0.09	-20.3059	9.0673	0.36471	0.0:0.8964:0.0:0.1036	.	138;108;156	Q6ZRV8;P57764;G3V1A6	.;GSDMD_HUMAN;.	D	108;108;156;108;108;124;108	ENSP00000433209:A108D;ENSP00000434386:A108D;ENSP00000433958:A156D;ENSP00000262580:A108D;ENSP00000434452:A108D;ENSP00000436684:A124D;ENSP00000437065:A108D	ENSP00000262580:A108D	A	+	2	0	GSDMD	144713195	0.741000	0.28217	0.752000	0.31206	0.057000	0.15508	3.289000	0.51747	2.455000	0.83008	0.543000	0.68304	GCC	-	pfam_Gasdermin		0.612	GSDMD-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GSDMD	protein_coding	OTTHUMT00000382046.3	C	NM_024736	-		144642052	+1	no_errors	ENST00000262580	ensembl	human	known	74_37	missense	SNP	0.067	A
HIF1A	3091	genome.wustl.edu	37	14	62187220	62187220	+	Silent	SNP	G	G	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr14:62187220G>A	ENST00000337138.4	+	2	421	c.156G>A	c.(154-156)tcG>tcA	p.S52S	HIF1A-AS2_ENST00000554254.1_lincRNA|HIF1A_ENST00000394997.1_Silent_p.S53S|HIF1A_ENST00000557206.1_3'UTR|HIF1A_ENST00000557538.1_5'UTR|HIF1A_ENST00000539097.1_Silent_p.S76S|HIF1A_ENST00000323441.6_Silent_p.S52S	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	52	Interaction with TSGA10. {ECO:0000250}.|bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	ATGTGAGTTCGCATCTTGATA	0.428																																																	0								ENSG00000100644						113.0	104.0	107.0					14																	62187220		2203	4300	6503	HIF1A	SO:0001819	synonymous_variant	0			-	HGNC	U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.156G>A	14.37:g.62187220G>A		Somatic	0	102	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PAS_fold_3,pfam_HIF-1_TAD_C,pfam_HIF_alpha_subunit,pfam_PAS_fold,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,prints_HIF-1_alpha,pfscan_PAS,pfscan_bHLH_dom,tigrfam_PAS	p.S76	ENST00000337138.4	37	c.228	CCDS9753.1	14																																																																																			-	superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom		0.428	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HIF1A	protein_coding	OTTHUMT00000276977.2	G	NM_001530	-		62187220	+1	no_errors	ENST00000539097	ensembl	human	known	74_37	silent	SNP	0.024	A
KRT74	121391	genome.wustl.edu	37	12	52965747	52965747	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr12:52965747T>G	ENST00000305620.2	-	3	775	c.728A>C	c.(727-729)gAg>gCg	p.E243A	KRT74_ENST00000549343.1_Missense_Mutation_p.E243A	NM_175053.3	NP_778223.2	Q7RTS7	K2C74_HUMAN	keratin 74	243	Coil 1B.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	keratin filament binding (GO:1990254)|structural molecule activity (GO:0005198)			kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	28				BRCA - Breast invasive adenocarcinoma(357;0.191)		CACCACAAACTCATTCTCTGC	0.527																																																	0								ENSG00000170484						168.0	167.0	167.0					12																	52965747		2203	4300	6503	KRT74	SO:0001583	missense	0			-	HGNC	BK000977	CCDS8832.1	12q13.13	2013-06-25			ENSG00000170484	ENSG00000170484		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28929	protein-coding gene	gene with protein product		608248				12648212, 16831889	Standard	NM_175053		Approved	K6IRS4, KRT5C, KRT6IRS4	uc001sap.1	Q7RTS7	OTTHUMG00000169658	ENST00000305620.2:c.728A>C	12.37:g.52965747T>G	ENSP00000307240:p.Glu243Ala	Somatic	0	129	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	B5MD61|Q86Y45	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,prints_Keratin_II	p.E243A	ENST00000305620.2	37	c.728	CCDS8832.1	12	.	.	.	.	.	.	.	.	.	.	T	21.5	4.162629	0.78226	.	.	ENSG00000170484	ENST00000549343;ENST00000305620	D;D	0.93953	-3.32;-3.32	3.92	3.92	0.45320	Filament (1);	0.220610	0.23121	N	0.051691	D	0.95822	0.8640	M	0.85945	2.785	0.46478	D	0.999067	P	0.52463	0.953	P	0.56042	0.79	D	0.96461	0.9341	10	0.87932	D	0	.	13.8397	0.63430	0.0:0.0:0.0:1.0	.	243	Q7RTS7	K2C74_HUMAN	A	243	ENSP00000447447:E243A;ENSP00000307240:E243A	ENSP00000307240:E243A	E	-	2	0	KRT74	51252014	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	7.484000	0.81180	2.014000	0.59158	0.533000	0.62120	GAG	-	pfam_IF,prints_Keratin_II		0.527	KRT74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT74	protein_coding	OTTHUMT00000405324.1	T	NM_175053	-		52965747	-1	no_errors	ENST00000305620	ensembl	human	known	74_37	missense	SNP	1.000	G
HERC2	8924	genome.wustl.edu	37	15	28421691	28421691	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr15:28421691C>G	ENST00000261609.7	-	63	9677	c.9569G>C	c.(9568-9570)aGt>aCt	p.S3190T		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ACAGCCTTCACTTCCGCCCCG	0.493																																																	0								ENSG00000128731						81.0	88.0	86.0					15																	28421691		2203	4300	6503	HERC2	SO:0001583	missense	0			-	HGNC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.9569G>C	15.37:g.28421691C>G	ENSP00000261609:p.Ser3190Thr	Somatic	0	319	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	59	8	88.06		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.S3190T	ENST00000261609.7	37	c.9569	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	C	27.5	4.837512	0.91117	.	.	ENSG00000128731	ENST00000261609	D	0.84370	-1.84	5.65	5.65	0.86999	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.85894	0.5803	N	0.10945	0.07	0.80722	D	1	D	0.67145	0.996	D	0.76071	0.987	D	0.87274	0.2288	10	0.42905	T	0.14	.	19.7107	0.96095	0.0:1.0:0.0:0.0	.	3190	O95714	HERC2_HUMAN	T	3190	ENSP00000261609:S3190T	ENSP00000261609:S3190T	S	-	2	0	HERC2	26095286	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.487000	0.81328	2.659000	0.90383	0.585000	0.79938	AGT	-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens		0.493	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	protein_coding	OTTHUMT00000251358.2	C	NM_004667	-		28421691	-1	no_errors	ENST00000261609	ensembl	human	known	74_37	missense	SNP	1.000	G
YY1	7528	genome.wustl.edu	37	14	100728670	100728670	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr14:100728670G>C	ENST00000262238.4	+	2	969	c.709G>C	c.(709-711)Gtg>Ctg	p.V237L	RP11-638I2.2_ENST00000555212.1_RNA	NM_003403.3	NP_003394.1	P25490	TYY1_HUMAN	YY1 transcription factor	237					anterior/posterior pattern specification (GO:0009952)|camera-type eye morphogenesis (GO:0048593)|cell differentiation (GO:0030154)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromosome organization (GO:0051276)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to prostaglandin F (GO:0034696)|response to UV-C (GO:0010225)|RNA localization (GO:0006403)|spermatogenesis (GO:0007283)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|four-way junction DNA binding (GO:0000400)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(1)|prostate(4)|skin(1)	11		Melanoma(154;0.152)				CCATGAGACAGTGGTTGAAGA	0.358																																																	0								ENSG00000100811						76.0	76.0	76.0					14																	100728670		2203	4300	6503	YY1	SO:0001583	missense	0			-	HGNC	BC020324	CCDS9957.1	14q	2013-01-08			ENSG00000100811	ENSG00000100811		"""INO80 complex subunits"", ""Zinc fingers, C2H2-type"""	12856	protein-coding gene	gene with protein product	"""INO80 complex subunit S"", ""Yin and Yang 1 protein"""	600013				1655281, 7912122	Standard	NM_003403		Approved	NF-E1, DELTA, UCRBP, YIN-YANG-1, INO80S	uc001ygy.2	P25490	OTTHUMG00000150479	ENST00000262238.4:c.709G>C	14.37:g.100728670G>C	ENSP00000262238:p.Val237Leu	Somatic	0	101	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	15	28.57	Q14935	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pirsf_TF_Yin_yang,pfscan_Znf_C2H2	p.V237L	ENST00000262238.4	37	c.709	CCDS9957.1	14	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	15.97|15.97|15.97	2.990556|2.990556|2.990556	0.54041|0.54041|0.54041	.|.|.	.|.|.	ENSG00000100811|ENSG00000100811|ENSG00000100811	ENST00000554804|ENST00000553625|ENST00000262238	.|.|T	.|.|0.10668	.|.|2.85	5.7|5.7|5.7	5.7|5.7|5.7	0.88788|0.88788|0.88788	.|.|.	.|.|0.073661	.|.|0.53938	.|.|U	.|.|0.000049	T|T|T	0.08935|0.08935|0.08935	0.0221|0.0221|0.0221	N|N|N	0.16478|0.16478|0.16478	0.41|0.41|0.41	0.44570|0.44570|0.44570	D|D|D	0.997537|0.997537|0.997537	.|.|B	.|.|0.14805	.|.|0.011	.|.|B	.|.|0.11329	.|.|0.006	T|T|T	0.35351|0.35351|0.35351	-0.9792|-0.9792|-0.9792	5|5|10	.|.|0.16896	.|.|T	.|.|0.51	.|.|.	20.2628|20.2628|20.2628	0.98456|0.98456|0.98456	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|.|237	.|.|P25490	.|.|TYY1_HUMAN	H|T|L	65|67|237	.|.|ENSP00000262238:V237L	.|.|ENSP00000262238:V237L	Q|S|V	+|+|+	3|2|1	2|0|0	YY1|YY1|YY1	99798423|99798423|99798423	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.972000|0.972000|0.972000	0.41901|0.41901|0.41901	0.862000|0.862000|0.862000	0.49288|0.49288|0.49288	6.449000|6.449000|6.449000	0.73473|0.73473|0.73473	2.868000|2.868000|2.868000	0.98415|0.98415|0.98415	0.555000|0.555000|0.555000	0.69702|0.69702|0.69702	CAG|AGT|GTG	-	pirsf_TF_Yin_yang		0.358	YY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YY1	protein_coding	OTTHUMT00000318277.1	G	NM_003403	-		100728670	+1	no_errors	ENST00000262238	ensembl	human	known	74_37	missense	SNP	1.000	C
FBN2	2201	genome.wustl.edu	37	5	127645047	127645047	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr5:127645047delA	ENST00000508053.1	-	47	6219	c.5245delT	c.(5245-5247)tgtfs	p.C1749fs	FBN2_ENST00000262464.4_Frame_Shift_Del_p.C1749fs			P35556	FBN2_HUMAN	fibrillin 2	1749	TB 7.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TCATTCTCACAAGTGGTTCCA	0.393																																																	0								ENSG00000138829						135.0	122.0	126.0					5																	127645047		2203	4300	6503	FBN2	SO:0001589	frameshift_variant	0				HGNC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5245delT	5.37:g.127645047delA	ENSP00000424571:p.Cys1749fs	Somatic	0	73	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	B4DU01|Q59ES6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.C1749fs	ENST00000508053.1	37	c.5245	CCDS34222.1	5																																																																																			-	pirsf_FBN,pfam_TB_dom,superfamily_TB_dom		0.393	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	protein_coding	OTTHUMT00000371618.2	A	NM_001999			127645047	-1	no_errors	ENST00000262464	ensembl	human	known	74_37	frame_shift_del	DEL	0.993	-
STRADA	92335	genome.wustl.edu	37	17	61787902	61787903	+	In_Frame_Ins	INS	-	-	GCAGGATGTAAGCAATCGCCA			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr17:61787902_61787903insGCAGGATGTAAGCAATCGCCA	ENST00000336174.6	-	8	641_642	c.529_530insTGGCGATTGCTTACATCCTGC	c.(529-531)cag>cTGGCGATTGCTTACATCCTGCag	p.176_177insLAIAYIL	RP11-51F16.8_ENST00000580553.1_Intron|STRADA_ENST00000447001.3_In_Frame_Ins_p.132_133insLAIAYIL|STRADA_ENST00000375840.4_In_Frame_Ins_p.118_119insLAIAYIL|STRADA_ENST00000245865.5_In_Frame_Ins_p.118_119insLAIAYIL|STRADA_ENST00000580039.1_5'UTR|STRADA_ENST00000579340.1_In_Frame_Ins_p.118_119insLAIAYIL|STRADA_ENST00000582137.1_In_Frame_Ins_p.147_148insLAIAYIL|STRADA_ENST00000392950.4_In_Frame_Ins_p.139_140insLAIAYIL	NM_001003787.2	NP_001003787.1	Q7RTN6	STRAA_HUMAN	STE20-related kinase adaptor alpha	176	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|protein export from nucleus (GO:0006611)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(2)	13						CAGCACCCCCTGCAGGATGTAA	0.515																																																	0								ENSG00000266173																																			STRADA	SO:0001652	inframe_insertion	0				HGNC	AF308302	CCDS11642.1, CCDS32703.1, CCDS42367.1, CCDS54156.1, CCDS58585.1	17q23.3	2014-09-04			ENSG00000266173	ENSG00000266173			30172	protein-coding gene	gene with protein product	"""STE20-like pseudokinase"""	608626				12805220, 17921699	Standard	NM_153335		Approved	NY-BR-96, LYK5, Stlk, STRAD	uc002jbm.3	Q7RTN6	OTTHUMG00000178908	ENST00000336174.6:c.509_529dupTGGCGATTGCTTACATCCTGC	17.37:g.61787902_61787903insGCAGGATGTAAGCAATCGCCA	ENSP00000336655:p.Leu170_Leu176dup	Somatic	NA	NA	NA		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DDE3|B4DW17|J3KTC9|Q5JPI2|Q7Z4K9|Q8NC31|Q8NCF1|Q9H272	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.177in_frame_insLAIAYIL	ENST00000336174.6	37	c.530_529	CCDS32703.1	17																																																																																			-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.515	STRADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRADA	protein_coding	OTTHUMT00000443894.1	-				61787903	-1	no_errors	ENST00000336174	ensembl	human	known	74_37	in_frame_ins	INS	1.000:1.000	GCAGGATGTAAGCAATCGCCA
MCAM	4162	genome.wustl.edu	37	11	119183296	119183296	+	Missense_Mutation	SNP	C	C	T	rs560440649		TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr11:119183296C>T	ENST00000264036.4	-	7	816	c.802G>A	c.(802-804)Gtg>Atg	p.V268M	MCAM_ENST00000530144.2_5'Flank|MCAM_ENST00000392814.1_Missense_Mutation_p.V217M	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	268	Ig-like C2-type 1.				anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		CTGATTTCCACGCGGTCCCCT	0.582													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18613	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000076706						121.0	113.0	116.0					11																	119183296		2199	4295	6494	MCAM	SO:0001583	missense	0			-	HGNC	X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.802G>A	11.37:g.119183296C>T	ENSP00000264036:p.Val268Met	Somatic	0	63	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	13	50.00	O95812|Q59E86|Q6PHR3|Q6ZTR2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Immunoglobulin,pfam_CD80_C2-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.V268M	ENST00000264036.4	37	c.802	CCDS31690.1	11	.	.	.	.	.	.	.	.	.	.	C	23.0	4.365413	0.82463	.	.	ENSG00000076706	ENST00000264036;ENST00000392814	T;T	0.05199	3.48;3.48	4.7	4.7	0.59300	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.32526	0.0832	M	0.91196	3.185	0.54753	D	0.999983	D	0.89917	1.0	D	0.91635	0.999	T	0.31024	-0.9958	9	0.87932	D	0	-26.5683	15.2962	0.73910	0.0:1.0:0.0:0.0	.	268	P43121	MUC18_HUMAN	M	268;217	ENSP00000264036:V268M;ENSP00000376561:V217M	ENSP00000264036:V268M	V	-	1	0	MCAM	118688506	1.000000	0.71417	0.952000	0.39060	0.955000	0.61496	5.572000	0.67411	2.599000	0.87857	0.561000	0.74099	GTG	-	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.582	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCAM	protein_coding	OTTHUMT00000388332.2	C		-		119183296	-1	no_errors	ENST00000264036	ensembl	human	known	74_37	missense	SNP	0.996	T
FAM131B	9715	genome.wustl.edu	37	7	143053674	143053674	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr7:143053674A>G	ENST00000409408.1	-	6	2676	c.968T>C	c.(967-969)tTt>tCt	p.F323S	FAM131B_ENST00000443739.2_Missense_Mutation_p.F351S|FAM131B_ENST00000409222.3_Missense_Mutation_p.F323S|FAM131B_ENST00000409578.1_Missense_Mutation_p.F339S|FAM131B_ENST00000409346.1_Missense_Mutation_p.F323S			Q86XD5	F131B_HUMAN	family with sequence similarity 131, member B	323										breast(1)|endometrium(4)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24	Melanoma(164;0.205)					CTCCTCATCAAAGGACTGCAC	0.597																																																	0								ENSG00000159784						157.0	124.0	135.0					7																	143053674		2203	4300	6503	FAM131B	SO:0001583	missense	0			-	HGNC	BC045611	CCDS5882.1, CCDS47734.1	7q34	2007-03-20			ENSG00000159784	ENSG00000159784			22202	protein-coding gene	gene with protein product							Standard	NM_014690		Approved	KIAA0773	uc010lpa.3	Q86XD5	OTTHUMG00000152697	ENST00000409408.1:c.968T>C	7.37:g.143053674A>G	ENSP00000387017:p.Phe323Ser	Somatic	0	60	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	14	46.15	A4D2H6|A6NDW3|A8K605|B8ZZN2|D3DXE3|J3KQX2|Q7L0D6|Q86T97	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.F351S	ENST00000409408.1	37	c.1052	CCDS5882.1	7	.	.	.	.	.	.	.	.	.	.	A	19.78	3.891966	0.72524	.	.	ENSG00000159784	ENST00000443739;ENST00000409578;ENST00000409346;ENST00000452076;ENST00000409408;ENST00000409222	T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91	5.81	5.81	0.92471	.	0.284530	0.36740	N	0.002436	T	0.43897	0.1268	L	0.44542	1.39	0.50039	D	0.999841	D;D	0.69078	0.997;0.997	D;D	0.78314	0.991;0.986	T	0.34875	-0.9811	10	0.87932	D	0	-13.1325	14.741	0.69455	1.0:0.0:0.0:0.0	.	339;323	Q86XD5-2;Q86XD5	.;F131B_HUMAN	S	351;339;323;327;323;323	ENSP00000410603:F351S;ENSP00000386568:F339S;ENSP00000386984:F323S;ENSP00000387017:F323S;ENSP00000387147:F323S	ENSP00000387147:F323S	F	-	2	0	FAM131B	142763796	1.000000	0.71417	0.991000	0.47740	0.568000	0.35870	6.959000	0.76031	2.217000	0.71921	0.533000	0.62120	TTT	-	NULL		0.597	FAM131B-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	FAM131B	protein_coding	OTTHUMT00000328057.1	A	NM_014690	-		143053674	-1	no_errors	ENST00000443739	ensembl	human	known	74_37	missense	SNP	1.000	G
EPHA4	2043	genome.wustl.edu	37	2	222283801	222283801	+	3'UTR	DEL	T	T	-			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr2:222283801delT	ENST00000281821.2	-	0	5293				EPHA4_ENST00000469354.1_5'UTR	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4						adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		TGATTTGATGTTATAGCTTAT	0.333																																																	0								ENSG00000116106																																			EPHA4	SO:0001624	3_prime_UTR_variant	0				HGNC	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.*2291A>-	2.37:g.222283801delT		Somatic	0	78	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	A8K2P1|B2R601|B7Z6Q8|Q2M380	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000281821.2	37	NULL	CCDS2447.1	2																																																																																			-	-		0.333	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA4	protein_coding	OTTHUMT00000256836.3	T				222283801	-1	no_errors	ENST00000469354	ensembl	human	putative	74_37	rna	DEL	1.000	-
PCDHB4	56131	genome.wustl.edu	37	5	140502487	140502487	+	Frame_Shift_Del	DEL	A	A	-	rs372292910		TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr5:140502487delA	ENST00000194152.1	+	1	907	c.907delA	c.(907-909)aaafs	p.K305fs	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	305	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.K305fs*12(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AATACTGTTGAAAAAAAAATT	0.368																																																	1	Deletion - Frameshift(1)	lung(1)						ENSG00000081818						88.0	105.0	99.0					5																	140502487		2202	4299	6501	PCDHB4	SO:0001589	frameshift_variant	0				HGNC	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.907delA	5.37:g.140502487delA	ENSP00000194152:p.Lys305fs	Somatic	0	41	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67	Q4V761	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K305fs	ENST00000194152.1	37	c.907	CCDS4246.1	5																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.368	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB4	protein_coding	OTTHUMT00000251812.2	A	NM_018938			140502487	+1	no_errors	ENST00000194152	ensembl	human	known	74_37	frame_shift_del	DEL	0.078	-
NCKAP1	10787	genome.wustl.edu	37	2	183806893	183806894	+	Splice_Site	INS	-	-	A	rs140820523	byFrequency	TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr2:183806893_183806894insA	ENST00000361354.4	-	24	2974		c.e24-2		NCKAP1_ENST00000360982.2_Splice_Site|NCKAP1_ENST00000478449.1_Splice_Site	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1						apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			CACAAGTTTCTAAAAAAAAAAG	0.391																																																	0								ENSG00000061676																																			NCKAP1	SO:0001630	splice_region_variant	0				HGNC	AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.2602-2->T	2.37:g.183806903_183806903dupA		Somatic	0	96	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	O60329|Q53QN5|Q53S94|Q53Y35	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e25-2	ENST00000361354.4	37	c.2620-3_2620-2	CCDS2287.1	2																																																																																			-	-		0.391	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP1	protein_coding	OTTHUMT00000255867.2	-	NM_205842		Intron	183806894	-1	no_errors	ENST00000360982	ensembl	human	known	74_37	splice_site_ins	INS	0.999:0.019	A
KIAA1804	84451	genome.wustl.edu	37	1	233482270	233482270	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr1:233482270G>A	ENST00000366624.3	+	2	1149	c.888G>A	c.(886-888)tgG>tgA	p.W296*	MLK4_ENST00000366623.3_Nonsense_Mutation_p.W296*	NM_032435.2	NP_115811.2																					CGAGGGAATGGCACAGGACCA	0.438																																																	0								ENSG00000143674						100.0	95.0	97.0					1																	233482270		2203	4300	6503	MLK4	SO:0001587	stop_gained	0			-	Uniprot_gn																												ENST00000366624.3:c.888G>A	1.37:g.233482270G>A	ENSP00000355583:p.Trp296*	Somatic	0	66	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	1	94.74		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.W296*	ENST00000366624.3	37	c.888	CCDS1598.1	1	.	.	.	.	.	.	.	.	.	.	G	40	8.173150	0.98688	.	.	ENSG00000143674	ENST00000366623;ENST00000366624	.	.	.	4.49	4.49	0.54785	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	17.3738	0.87386	0.0:0.0:1.0:0.0	.	.	.	.	X	296	.	ENSP00000355582:W296X	W	+	3	0	RP5-862P8.2	231548893	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.648000	0.98483	2.319000	0.78375	0.563000	0.77884	TGG	-	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.438	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1804	protein_coding	OTTHUMT00000092495.1	G		-		233482270	+1	no_errors	ENST00000366624	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ZACN	353174	genome.wustl.edu	37	17	74077182	74077182	+	Intron	SNP	G	G	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr17:74077182G>A	ENST00000334586.5	+	6	627				EXOC7_ENST00000589210.1_3'UTR|EXOC7_ENST00000607838.1_3'UTR|EXOC7_ENST00000591724.1_5'UTR|EXOC7_ENST00000332065.5_3'UTR	NM_180990.3	NP_851321.2	Q401N2	ZACN_HUMAN	zinc activated ligand-gated ion channel						ion transmembrane transport (GO:0034220)|response to zinc ion (GO:0010043)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)|ligand-gated ion channel activity (GO:0015276)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	11						GAGACAATTTGGGATGTTGCA	0.438																																																	0								ENSG00000182473						249.0	220.0	229.0					17																	74077182		692	1591	2283	EXOC7	SO:0001627	intron_variant	0			-	HGNC	AK122638	CCDS11740.2	17q25.3	2012-01-18	2008-04-17	2008-04-17	ENSG00000186919	ENSG00000186919		"""Ligand-gated ion channels / Zinc activated channels"""	29504	protein-coding gene	gene with protein product		610935	"""ligand-gated ion channel, zinc activated 1"""	LGICZ1		12381728, 16083862	Standard	NM_180990		Approved	LGICZ, L2, ZAC, ZAC1	uc002jqn.2	Q401N2	OTTHUMG00000157186	ENST00000334586.5:c.545-177G>A	17.37:g.74077182G>A		Somatic	0	50	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	3	82.35	Q2TB29|Q6ZWK3|Q86YW4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000334586.5	37	NULL	CCDS11740.2	17																																																																																			-	-		0.438	ZACN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC7	protein_coding	OTTHUMT00000347827.2	G	NM_180990	-		74077182	-1	no_errors	ENST00000591724	ensembl	human	known	74_37	rna	SNP	0.000	A
MIR9-2	407047	genome.wustl.edu	37	5	87972088	87972088	+	RNA	SNP	G	G	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr5:87972088G>T	ENST00000510274.1	+	0	46																											ACAGGTTAGAGGAGGCAGCTC	0.607																																																	0								ENSG00000245526																																			LINC00461			0			-	HGNC																													5.37:g.87972088G>T		Somatic	0	71	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000510274.1	37	NULL		5																																																																																			-	-		0.607	CTC-467M3.1-001	KNOWN	basic	antisense	LINC00461	antisense	OTTHUMT00000369794.1	G		-		87972088	-1	no_errors	ENST00000504246	ensembl	human	known	74_37	rna	SNP	1.000	T
ANKRD34C	390616	genome.wustl.edu	37	15	79587136	79587136	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr15:79587136A>G	ENST00000558647.2	+	1	1510	c.1510A>G	c.(1510-1512)Aga>Gga	p.R504G	ANKRD34C_ENST00000421388.2_Missense_Mutation_p.R504G			P0C6C1	AN34C_HUMAN	ankyrin repeat domain 34C	504										endometrium(3)|kidney(1)|skin(1)	5						TTCACCAAAGAGAGTTGACTT	0.393																																																	0								ENSG00000235711						57.0	45.0	48.0					15																	79587136		685	1584	2269	ANKRD34C	SO:0001583	missense	0			-	HGNC		CCDS53965.1	15q25.1	2013-01-10			ENSG00000235711	ENSG00000235711		"""Ankyrin repeat domain containing"""	33888	protein-coding gene	gene with protein product							Standard	NM_001146341		Approved		uc002bet.3	P0C6C1		ENST00000558647.2:c.1510A>G	15.37:g.79587136A>G	ENSP00000454921:p.Arg504Gly	Somatic	0	71	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	5	78.26	H3BNM1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R504G	ENST00000558647.2	37	c.1510	CCDS53965.1	15	.	.	.	.	.	.	.	.	.	.	A	13.33	2.204983	0.38905	.	.	ENSG00000235711	ENST00000421388	T	0.19669	2.13	4.72	4.72	0.59763	.	.	.	.	.	T	0.26376	0.0644	L	0.56769	1.78	0.31567	N	0.656789	P	0.49090	0.919	P	0.47015	0.534	T	0.30179	-0.9987	9	0.52906	T	0.07	.	8.487	0.33078	0.8034:0.1966:0.0:0.0	.	504	P0C6C1	AN34C_HUMAN	G	504	ENSP00000401089:R504G	ENSP00000401089:R504G	R	+	1	2	ANKRD34C	77374191	1.000000	0.71417	0.985000	0.45067	0.218000	0.24690	1.285000	0.33261	1.966000	0.57179	0.533000	0.62120	AGA	-	NULL		0.393	ANKRD34C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD34C	protein_coding	OTTHUMT00000416713.2	A	NM_001146341	-		79587136	+1	no_errors	ENST00000421388	ensembl	human	known	74_37	missense	SNP	1.000	G
GLYATL3	389396	genome.wustl.edu	37	6	49494259	49494259	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr6:49494259C>T	ENST00000371197.4	+	6	612	c.499C>T	c.(499-501)Cgg>Tgg	p.R167W		NM_001010904.1	NP_001010904.1	Q5SZD4	GLYL3_HUMAN	glycine-N-acyltransferase-like 3	167						mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)			NS(1)|endometrium(1)|kidney(3)|lung(1)|skin(3)|stomach(2)	11						TCTACTCAACCGGACTTGGTC	0.532																																																	0								ENSG00000203972						98.0	87.0	90.0					6																	49494259		692	1591	2283	GLYATL3	SO:0001583	missense	0			-	HGNC		CCDS47440.1	6p12.3	2009-12-14	2009-12-14	2009-12-14	ENSG00000203972	ENSG00000203972			21349	protein-coding gene	gene with protein product		614763	"""chromosome 6 open reading frame 140"""	C6orf140			Standard	NM_001010904		Approved	bA28H17.2	uc003ozi.3	Q5SZD4	OTTHUMG00000014818	ENST00000371197.4:c.499C>T	6.37:g.49494259C>T	ENSP00000360240:p.Arg167Trp	Somatic	0	128	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	31	45.61		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glycine_N-acyltransferase_N,pfam_Glycine_N-acyltransferase_C,pfam_FR47,superfamily_Acyl_CoA_acyltransferase	p.R167W	ENST00000371197.4	37	c.499	CCDS47440.1	6	.	.	.	.	.	.	.	.	.	.	C	18.69	3.678725	0.68042	.	.	ENSG00000203972	ENST00000371197	T	0.18174	2.23	6.06	3.09	0.35607	Acyl-CoA N-acyltransferase (2);Glycine N-acyltransferase, N-terminal (1);	0.568884	0.19148	N	0.121526	T	0.19967	0.0480	M	0.65975	2.015	0.29497	N	0.855218	D	0.71674	0.998	P	0.61940	0.896	T	0.01791	-1.1273	10	0.87932	D	0	-9.2632	7.8141	0.29249	0.3649:0.4908:0.1443:0.0	.	167	Q5SZD4	GLYL3_HUMAN	W	167	ENSP00000360240:R167W	ENSP00000360240:R167W	R	+	1	2	GLYATL3	49602218	0.105000	0.21958	0.982000	0.44146	0.546000	0.35178	0.021000	0.13489	1.532000	0.49169	0.655000	0.94253	CGG	-	pfam_Glycine_N-acyltransferase_N,superfamily_Acyl_CoA_acyltransferase		0.532	GLYATL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLYATL3	protein_coding	OTTHUMT00000040866.3	C	NM_001010904	-		49494259	+1	no_errors	ENST00000371197	ensembl	human	known	74_37	missense	SNP	0.867	T
TMEM184B	25829	genome.wustl.edu	37	22	38643803	38643803	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr22:38643803delC	ENST00000361906.3	-	2	373	c.165delG	c.(163-165)tggfs	p.W55fs	TMEM184B_ENST00000361684.4_Frame_Shift_Del_p.W55fs	NM_001195072.1|NM_012264.4	NP_001182001.1|NP_036396.2	Q9Y519	T184B_HUMAN	transmembrane protein 184B	55						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(2)|skin(2)|upper_aerodigestive_tract(1)	8	Melanoma(58;0.045)					GCAGGGCCGTCCACACGAAGA	0.607																																																	0								ENSG00000198792						61.0	54.0	57.0					22																	38643803		2203	4300	6503	TMEM184B	SO:0001589	frameshift_variant	0				HGNC	AL096879	CCDS13969.2	22q12	2008-02-04	2007-07-11	2007-07-11	ENSG00000198792	ENSG00000198792			1310	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 5"""	C22orf5		10591208	Standard	NM_012264		Approved	HS5O6A, DKFZP586A1024, FM08	uc003avf.1	Q9Y519	OTTHUMG00000030557	ENST00000361906.3:c.165delG	22.37:g.38643803delC	ENSP00000355210:p.Trp55fs	Somatic	0	77	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	A8K9D7|Q63HM8|Q7Z421|Q8NBM5|Q9UGT8|Q9UGT9|Q9UGV5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ost-alpha	p.W55fs	ENST00000361906.3	37	c.165	CCDS13969.2	22																																																																																			-	pfam_Ost-alpha		0.607	TMEM184B-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM184B	protein_coding	OTTHUMT00000075445.4	C	NM_012264			38643803	-1	no_errors	ENST00000361684	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
XKR6	286046	genome.wustl.edu	37	8	11052720	11052720	+	Intron	SNP	G	G	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr8:11052720G>T	ENST00000416569.2	-	1	791				XKR6_ENST00000297303.4_Missense_Mutation_p.P259T	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6							integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		GGTACCAAAGGGTCttgccca	0.378																																																	0								ENSG00000171044																																			XKR6	SO:0001627	intron_variant	0			-	HGNC	BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.764+5364C>A	8.37:g.11052720G>T		Somatic	0	135	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	13	61.76	Q8TBA0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transport_prot_XK	p.P259T	ENST00000416569.2	37	c.775	CCDS5978.2	8	.	.	.	.	.	.	.	.	.	.	G	12.96	2.094218	0.36952	.	.	ENSG00000171044	ENST00000297303	.	.	.	3.22	0.292	0.15737	.	.	.	.	.	T	0.08447	0.0210	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.33929	-0.9849	5	0.02654	T	1	.	1.7889	0.03047	0.1237:0.2234:0.451:0.2018	.	.	.	.	T	259	.	ENSP00000297303:P259T	P	-	1	0	XKR6	11090130	0.000000	0.05858	0.000000	0.03702	0.312000	0.27988	-0.200000	0.09478	0.045000	0.15804	0.563000	0.77884	CCT	-	NULL		0.378	XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR6	protein_coding	OTTHUMT00000383958.1	G	NM_173683	-		11052720	-1	no_errors	ENST00000297303	ensembl	human	putative	74_37	missense	SNP	0.000	T
FAM3D	131177	genome.wustl.edu	37	3	58629402	58629402	+	Silent	SNP	G	G	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr3:58629402G>A	ENST00000358781.2	-	6	619	c.309C>T	c.(307-309)atC>atT	p.I103I		NM_138805.2	NP_620160.1	Q96BQ1	FAM3D_HUMAN	family with sequence similarity 3, member D	103					negative regulation of insulin secretion (GO:0046676)	extracellular region (GO:0005576)	cytokine activity (GO:0005125)			large_intestine(1)|lung(2)	3				BRCA - Breast invasive adenocarcinoma(55;0.000225)|Kidney(10;0.000667)|KIRC - Kidney renal clear cell carcinoma(10;0.000802)|OV - Ovarian serous cystadenocarcinoma(275;0.169)		TCACCAGGGCGATGTTTAGGC	0.498																																																	0								ENSG00000198643						215.0	168.0	184.0					3																	58629402		2203	4300	6503	FAM3D	SO:0001819	synonymous_variant	0			-	HGNC	AF494381	CCDS2893.1	3p21.1	2008-07-18			ENSG00000198643	ENSG00000198643			18665	protein-coding gene	gene with protein product		608619				12160727	Standard	NM_138805		Approved	EF7, OIT1	uc003dkq.3	Q96BQ1	OTTHUMG00000159148	ENST00000358781.2:c.309C>T	3.37:g.58629402G>A		Somatic	0	160	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	27	25.00	Q547G2	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I103	ENST00000358781.2	37	c.309	CCDS2893.1	3																																																																																			-	NULL		0.498	FAM3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM3D	protein_coding	OTTHUMT00000353494.1	G	NM_138805	-		58629402	-1	no_errors	ENST00000358781	ensembl	human	known	74_37	silent	SNP	0.988	A
ATP10D	57205	genome.wustl.edu	37	4	47537547	47537547	+	Silent	SNP	C	C	A	rs141284146	byFrequency	TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr4:47537547C>A	ENST00000273859.3	+	6	1067	c.798C>A	c.(796-798)cgC>cgA	p.R266R	ATP10D_ENST00000504445.1_Silent_p.R266R	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	266					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R266R(1)		NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						ACAAAGAACGCGTGGGTCTCA	0.378																																																	1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000145246						150.0	140.0	143.0					4																	47537547		2203	4300	6503	ATP10D	SO:0001819	synonymous_variant	0			-	HGNC	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.798C>A	4.37:g.47537547C>A		Somatic	0	94	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	4	78.95	A2RRC8|D6REN2|Q8NC70|Q96SR3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.R266	ENST00000273859.3	37	c.798	CCDS3476.1	4																																																																																			-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Plipid-transp		0.378	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10D	protein_coding	OTTHUMT00000216900.1	C	NM_020453	-		47537547	+1	no_errors	ENST00000273859	ensembl	human	known	74_37	silent	SNP	0.090	A
HMGB1	3146	genome.wustl.edu	37	13	31035551	31035551	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr13:31035551C>A	ENST00000405805.1	-	5	1531	c.591G>T	c.(589-591)gaG>gaT	p.E197D	HMGB1_ENST00000399489.1_3'UTR|HMGB1_ENST00000341423.5_Missense_Mutation_p.E197D|HMGB1_ENST00000399494.1_Missense_Mutation_p.E197D|HMGB1_ENST00000339872.4_Missense_Mutation_p.E197D|HMGB1_ENST00000468384.1_5'Flank			P09429	HMGB1_HUMAN	high mobility group box 1	197	Asp/Glu-rich (acidic).				apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dendritic cell chemotaxis (GO:0002407)|DNA ligation involved in DNA repair (GO:0051103)|DNA recombination (GO:0006310)|DNA topological change (GO:0006265)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|myeloid dendritic cell activation (GO:0001773)|negative regulation of apoptotic cell clearance (GO:2000426)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron projection development (GO:0031175)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|V(D)J recombination (GO:0033151)	cell surface (GO:0009986)|condensed chromosome (GO:0000793)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|damaged DNA binding (GO:0003684)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|ovary(1)	8		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		cctcctcctcctcatcctctt	0.388																																																	0								ENSG00000189403						15.0	14.0	14.0					13																	31035551		1887	4079	5966	HMGB1	SO:0001583	missense	0			-	HGNC	D63874	CCDS9335.1	13q12	2011-07-01	2011-04-05	2002-08-16	ENSG00000189403	ENSG00000189403		"""High-mobility group / Canonical"""	4983	protein-coding gene	gene with protein product	"""high mobility group box 1"", ""Sulfoglucuronyl carbohydrate binding protein"", ""Amphoterin"", ""high mobility group protein 1"""	163905	"""high-mobility group (nonhistone chromosomal) protein 1"", ""high-mobility group box 1"""	HMG1		8661151, 11279268	Standard	NM_002128		Approved	HMG3, SBP-1, DKFZp686A04236	uc001usx.3	P09429	OTTHUMG00000016670	ENST00000405805.1:c.591G>T	13.37:g.31035551C>A	ENSP00000384678:p.Glu197Asp	Somatic	0	54	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	9	18.18	A5D8W9|Q14321|Q5T7C3|Q6IBE1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.E197D	ENST00000405805.1	37	c.591	CCDS9335.1	13	.	.	.	.	.	.	.	.	.	.	C	7.381	0.628793	0.14257	.	.	ENSG00000189403	ENST00000405805;ENST00000339872;ENST00000341423;ENST00000399494	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	5.57	-1.36	0.09085	Armadillo-like helical (1);	0.150573	0.29684	N	0.011471	T	0.19565	0.0470	N	0.14661	0.345	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.02371	-1.1169	10	0.54805	T	0.06	.	4.1171	0.10086	0.1171:0.1913:0.1151:0.5765	.	158;197	B3KQ05;P09429	.;HMGB1_HUMAN	D	197	ENSP00000384678:E197D;ENSP00000343040:E197D;ENSP00000345347:E197D;ENSP00000382417:E197D	ENSP00000343040:E197D	E	-	3	2	HMGB1	29933551	0.000000	0.05858	0.992000	0.48379	0.963000	0.63663	-2.218000	0.01219	-0.283000	0.09115	-0.377000	0.06932	GAG	-	NULL		0.388	HMGB1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGB1	protein_coding	OTTHUMT00000303998.2	C	NM_002128	-		31035551	-1	no_errors	ENST00000339872	ensembl	human	known	74_37	missense	SNP	0.679	A
PROL1	58503	genome.wustl.edu	37	4	71265275	71265275	+	Intron	SNP	C	C	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr4:71265275C>T	ENST00000399575.2	+	2	225				PROL1_ENST00000514338.1_3'UTR	NM_021225.4	NP_067048.4	Q99935	PROL1_HUMAN	proline rich, lacrimal 1						negative regulation of endopeptidase activity (GO:0010951)|regulation of sensory perception of pain (GO:0051930)|retina homeostasis (GO:0001895)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)|peptidase inhibitor activity (GO:0030414)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	15		all_hematologic(202;0.196)				AGGAAGAGGACACAGGGCAGG	0.393																																																	0								ENSG00000171199																																			PROL1	SO:0001627	intron_variant	0			-	HGNC	S83198	CCDS43235.1	4q13.3	2011-10-28	2005-02-07		ENSG00000171199	ENSG00000171199			17279	protein-coding gene	gene with protein product		608936	"""proline rich 1"""			8670737	Standard	NM_021225		Approved	BPLP, PRL1, opiorphin	uc003hfi.3	Q99935	OTTHUMG00000160845	ENST00000399575.2:c.51+222C>T	4.37:g.71265275C>T		Somatic	0	9	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	2	77.78	A8MZ07|P85047	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000399575.2	37	NULL	CCDS43235.1	4																																																																																			-	-		0.393	PROL1-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	PROL1	protein_coding	OTTHUMT00000362639.1	C	NM_021225	-		71265275	+1	no_errors	ENST00000514338	ensembl	human	known	74_37	rna	SNP	0.019	T
LRP2	4036	genome.wustl.edu	37	2	170163909	170163909	+	Splice_Site	SNP	T	T	C			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr2:170163909T>C	ENST00000263816.3	-	4	596		c.e4-2		LRP2_ENST00000443831.1_Splice_Site	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2						cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TACTTTGTGCTGCGAAGAGaa	0.388																																																	0								ENSG00000081479						94.0	75.0	82.0					2																	170163909		2203	4300	6503	LRP2	SO:0001630	splice_region_variant	0			-	HGNC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.311-2A>G	2.37:g.170163909T>C		Somatic	0	52	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	1	92.31	O00711|Q16215	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e4-2	ENST00000263816.3	37	c.311-2	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	T	16.30	3.085224	0.55861	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9169	0.79527	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRP2	169872155	1.000000	0.71417	0.912000	0.35992	0.005000	0.04900	7.214000	0.77958	2.152000	0.67230	0.455000	0.32223	.	-	-		0.388	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	protein_coding	OTTHUMT00000255231.2	T	NM_004525	-	Intron	170163909	-1	no_errors	ENST00000263816	ensembl	human	known	74_37	splice_site	SNP	1.000	C
TRIM25	7706	genome.wustl.edu	37	17	54969002	54969002	+	3'UTR	SNP	T	T	C			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr17:54969002T>C	ENST00000316881.4	-	0	2001				TRIM25_ENST00000573108.1_5'Flank|TRIM25_ENST00000537230.1_3'UTR|MIR3614_ENST00000581261.1_RNA|RP11-670E13.5_ENST00000574826.1_RNA	NM_005082.4	NP_005073.2	Q14258	TRI25_HUMAN	tripartite motif containing 25						defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral entry into host cell (GO:0046596)|regulation of viral release from host cell (GO:1902186)|response to estrogen (GO:0043627)|response to vitamin D (GO:0033280)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Breast(9;6.15e-08)					CTGCCTGCTGTATTTTCACTA	0.572																																																	0								ENSG00000262112																																			RP11-670E13.5	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene	D21205	CCDS11591.1	17q23.1	2013-01-09	2011-01-25	2004-03-30				"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12932	protein-coding gene	gene with protein product		600453	"""zinc finger protein 147 (estrogen-responsive finger protein)"", ""tripartite motif-containing 25"""	ZNF147		7789997	Standard	NM_005082		Approved	EFP, RNF147	uc002iut.3	Q14258		ENST00000316881.4:c.*59A>G	17.37:g.54969002T>C		Somatic	0	19	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	1	87.50		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000316881.4	37	NULL	CCDS11591.1	17																																																																																			-	-		0.572	TRIM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000262112	protein_coding	OTTHUMT00000440609.1	T	NM_005082	-		54969002	+1	no_errors	ENST00000574826	ensembl	human	known	74_37	rna	SNP	0.000	C
C6orf10	10665	genome.wustl.edu	37	6	32283562	32283562	+	Intron	SNP	C	C	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr6:32283562C>T	ENST00000447241.2	-	19	753				C6orf10_ENST00000527965.1_Intron|C6orf10_ENST00000442822.2_Silent_p.S180S|C6orf10_ENST00000375015.4_Intron|C6orf10_ENST00000375007.4_Intron|C6orf10_ENST00000533191.1_Silent_p.S187S	NM_006781.3	NP_006772.3	Q5SRN2	CF010_HUMAN	chromosome 6 open reading frame 10							integral component of membrane (GO:0016021)|nucleus (GO:0005634)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	25						CAGTTCTCTGCGAAATTACTA	0.318																																																	0								ENSG00000204296																																			C6orf10	SO:0001627	intron_variant	0			-	HGNC	U60665	CCDS34422.1, CCDS69082.1, CCDS75430.1	6p21.32	2012-11-20			ENSG00000204296	ENSG00000204296			13922	protein-coding gene	gene with protein product	"""testis specific basic protein"""					10803852	Standard	XM_005248810		Approved	TSBP	uc021yvs.1	Q5SRN2	OTTHUMG00000031107	ENST00000447241.2:c.580+6700G>A	6.37:g.32283562C>T		Somatic	0	71	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	21	30.00	A2BET1|A2BET2|A6NME2|B0S7R2|B0S7R3|E9PMB1|Q5SPI9|Q5SPJ0|Q5SPK9|Q5SPL0|Q5SRN3|Q5TG25|Q5TG26|Q8N4B6	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S180	ENST00000447241.2	37	c.540	CCDS34422.1	6																																																																																			-	NULL		0.318	C6orf10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C6orf10	protein_coding	OTTHUMT00000076178.4	C	NM_006781	-		32283562	-1	no_errors	ENST00000442822	ensembl	human	putative	74_37	silent	SNP	0.861	T
CECR2	27443	genome.wustl.edu	37	22	17983960	17983960	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr22:17983960G>A	ENST00000400585.2	+	7	731	c.293G>A	c.(292-294)cGc>cAc	p.R98H	CECR2_ENST00000400573.5_Missense_Mutation_p.R239H|CECR2_ENST00000342247.5_Missense_Mutation_p.R219H|CECR2_ENST00000262608.8_Missense_Mutation_p.R220H			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	261					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)		p.R239H(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		GAGAGTTTTCGCGAGAGGACC	0.562																																																	1	Substitution - Missense(1)	central_nervous_system(1)						ENSG00000099954						81.0	88.0	86.0					22																	17983960		1964	4145	6109	CECR2	SO:0001583	missense	0			-	HGNC	AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.293G>A	22.37:g.17983960G>A	ENSP00000383428:p.Arg98His	Somatic	0	80	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	4	69.23	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R239H	ENST00000400585.2	37	c.716		22	.	.	.	.	.	.	.	.	.	.	G	23.8	4.458572	0.84317	.	.	ENSG00000099954	ENST00000342247;ENST00000400585;ENST00000400573;ENST00000262608	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	5.35	5.35	0.76521	.	0.000000	0.47852	D	0.000214	T	0.67468	0.2896	L	0.56769	1.78	0.40122	D	0.976617	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.993;0.966;0.987	T	0.69807	-0.5045	10	0.72032	D	0.01	-14.7554	19.4213	0.94723	0.0:0.0:1.0:0.0	.	261;98;261;239	Q9BXF3;B7WPH3;Q9BXF3-2;E2QRE6	CECR2_HUMAN;.;.;.	H	219;98;239;220	ENSP00000341219:R219H;ENSP00000383428:R98H;ENSP00000383417:R239H;ENSP00000262608:R220H	ENSP00000262608:R220H	R	+	2	0	CECR2	16363960	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	7.337000	0.79256	2.664000	0.90586	0.655000	0.94253	CGC	-	NULL		0.562	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	CECR2	protein_coding	OTTHUMT00000316226.2	G	NM_031413	-		17983960	+1	no_errors	ENST00000400573	ensembl	human	novel	74_37	missense	SNP	1.000	A
DMGDH	29958	genome.wustl.edu	37	5	78338141	78338141	+	Silent	SNP	C	C	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr5:78338141C>T	ENST00000255189.3	-	7	1186	c.1158G>A	c.(1156-1158)caG>caA	p.Q386Q	DMGDH_ENST00000380311.4_Silent_p.Q185Q|DMGDH_ENST00000540686.1_Intron	NM_013391.2	NP_037523.2	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase	386					amino-acid betaine catabolic process (GO:0006579)|choline metabolic process (GO:0019695)|glycine catabolic process (GO:0006546)|glycine metabolic process (GO:0006544)	mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|dimethylglycine dehydrogenase activity (GO:0047865)|electron carrier activity (GO:0009055)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(2)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	34		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		TTCTGACCCCCTGATGGGGCC	0.413																																																	0								ENSG00000132837						70.0	68.0	69.0					5																	78338141		2203	4300	6503	DMGDH	SO:0001819	synonymous_variant	0			-	HGNC	AF111858	CCDS4044.1	5q14.1	2008-02-05			ENSG00000132837	ENSG00000132837	1.5.99.2		24475	protein-coding gene	gene with protein product		605849				10767172, 11231903	Standard	NM_013391		Approved		uc003kfs.3	Q9UI17	OTTHUMG00000108159	ENST00000255189.3:c.1158G>A	5.37:g.78338141C>T		Somatic	0	79	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	11	67.65	B2RBN0|B4E1J9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C,pfam_SoxG	p.Q386	ENST00000255189.3	37	c.1158	CCDS4044.1	5																																																																																			-	pfam_FAD-dep_OxRdtase		0.413	DMGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMGDH	protein_coding	OTTHUMT00000226963.3	C	NM_013391	-		78338141	-1	no_errors	ENST00000255189	ensembl	human	known	74_37	silent	SNP	1.000	T
NLRP5	126206	genome.wustl.edu	37	19	56539567	56539567	+	Silent	SNP	C	C	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr19:56539567C>T	ENST00000390649.3	+	7	1968	c.1968C>T	c.(1966-1968)ccC>ccT	p.P656P		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	656					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TGGGCTGTCCCGTTCCCCTGG	0.592																																																	0								ENSG00000171487						62.0	65.0	64.0					19																	56539567		1991	4153	6144	NLRP5	SO:0001819	synonymous_variant	0			-	HGNC	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1968C>T	19.37:g.56539567C>T		Somatic	0	77	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	21	38.24	A8MTY4|Q86W29	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.P656	ENST00000390649.3	37	c.1968	CCDS12938.1	19																																																																																			-	NULL		0.592	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP5	protein_coding	OTTHUMT00000313735.1	C	NM_153447	-		56539567	+1	no_errors	ENST00000390649	ensembl	human	known	74_37	silent	SNP	0.000	T
ZFYVE27	118813	genome.wustl.edu	37	10	99511211	99511211	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr10:99511211G>T	ENST00000393677.4	+	8	1072	c.868G>T	c.(868-870)Gcg>Tcg	p.A290S	ZFYVE27_ENST00000453958.2_Missense_Mutation_p.A290S|ZFYVE27_ENST00000337540.7_Missense_Mutation_p.A258S|ZFYVE27_ENST00000370610.3_Missense_Mutation_p.A197S|ZFYVE27_ENST00000359980.3_Missense_Mutation_p.A290S|ZFYVE27_ENST00000357540.4_Missense_Mutation_p.A204S|ZFYVE27_ENST00000370613.3_Missense_Mutation_p.A172S|ZFYVE27_ENST00000356257.4_Missense_Mutation_p.A295S	NM_144588.6	NP_653189.3	Q5T4F4	ZFY27_HUMAN	zinc finger, FYVE domain containing 27	290	Necessary for interaction with VAPA and function in cell projections formation.				cell death (GO:0008219)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein localization to plasma membrane (GO:0072659)	axon (GO:0030424)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)	metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	8		Colorectal(252;0.0846)		Epithelial(162;7.08e-10)|all cancers(201;5.18e-08)		GTTTAAAGATGCGATTGAGGT	0.517																																																	0								ENSG00000155256						108.0	85.0	93.0					10																	99511211		2203	4300	6503	ZFYVE27	SO:0001583	missense	0			-	HGNC	BC030621	CCDS31263.1, CCDS31264.1, CCDS53562.1, CCDS53563.1, CCDS53564.1, CCDS53565.1	10q24.2	2013-09-11			ENSG00000155256	ENSG00000155256		"""Zinc fingers, FYVE domain containing"""	26559	protein-coding gene	gene with protein product	"""protrudin"""	610243				14702039	Standard	NM_144588		Approved	FLJ32919, SPG33	uc001kol.2	Q5T4F4	OTTHUMG00000018867	ENST00000393677.4:c.868G>T	10.37:g.99511211G>T	ENSP00000377282:p.Ala290Ser	Somatic	0	174	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	B7Z3S0|B7Z404|B7Z626|G8JLC3|G8JLF0|J3KP98|Q5T4F1|Q5T4F2|Q5T4F3|Q8N1K0|Q8N6D6|Q8NCA0|Q8NDE4|Q96M08	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.A295S	ENST00000393677.4	37	c.883	CCDS31263.1	10	.	.	.	.	.	.	.	.	.	.	G	23.6	4.436482	0.83885	.	.	ENSG00000155256	ENST00000337540;ENST00000357540;ENST00000370613;ENST00000370610;ENST00000393677;ENST00000453958;ENST00000359980;ENST00000356257;ENST00000423811	T;T;T;T;T;T;T	0.49139	0.8;0.79;0.98;0.84;1.36;1.18;1.2	5.55	5.55	0.83447	Zinc finger, FYVE/PHD-type (1);	0.046464	0.85682	D	0.000000	T	0.60209	0.2251	L	0.34521	1.04	0.58432	D	0.999999	D;D;D;D;D;D;D	0.76494	0.998;0.999;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D;D	0.78314	0.985;0.985;0.98;0.982;0.962;0.991;0.918	T	0.57183	-0.7855	10	0.39692	T	0.17	-25.3404	19.4978	0.95081	0.0:0.0:1.0:0.0	.	258;197;172;204;295;290;290	B7Z404;B7Z3S0;B7Z626;Q5T4F4-5;Q5T4F4-3;Q5T4F4-2;Q5T4F4	.;.;.;.;.;.;ZFY27_HUMAN	S	258;204;172;197;290;290;290;295;273	ENSP00000337993:A258S;ENSP00000359642:A197S;ENSP00000377282:A290S;ENSP00000401580:A290S;ENSP00000353069:A290S;ENSP00000348593:A295S;ENSP00000409594:A273S	ENSP00000337993:A258S	A	+	1	0	ZFYVE27	99501201	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	6.853000	0.75435	2.608000	0.88229	0.462000	0.41574	GCG	-	superfamily_Znf_FYVE_PHD		0.517	ZFYVE27-003	KNOWN	basic|CCDS	protein_coding	ZFYVE27	protein_coding	OTTHUMT00000049745.2	G	NM_144588	-		99511211	+1	no_errors	ENST00000356257	ensembl	human	known	74_37	missense	SNP	1.000	T
CPN1	1369	genome.wustl.edu	37	10	101841286	101841286	+	Missense_Mutation	SNP	G	G	A	rs567825978		TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr10:101841286G>A	ENST00000370418.3	-	1	348	c.97C>T	c.(97-99)Cgg>Tgg	p.R33W		NM_001308.2	NP_001299.1	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1	33	Catalytic.				response to glucocorticoid (GO:0051384)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	33		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		TACAGCGTCCGCACAAGATCA	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		19493	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000120054						81.0	70.0	74.0					10																	101841286		2203	4300	6503	CPN1	SO:0001583	missense	0			-	HGNC	X14329	CCDS7486.1	10q24.2	2012-02-10	2007-02-23		ENSG00000120054	ENSG00000120054	3.4.17.3		2312	protein-coding gene	gene with protein product	"""anaphylatoxin inactivator"", ""arginine carboxypeptidase"", ""carboxypeptidase K"", ""kininase I"", ""lysine carboxypeptidase"""	603103	"""carboxypeptidase N, polypeptide 1, 50kD"""			9628828, 2912725	Standard	NM_001308		Approved		uc001kql.2	P15169	OTTHUMG00000018896	ENST00000370418.3:c.97C>T	10.37:g.101841286G>A	ENSP00000359446:p.Arg33Trp	Somatic	0	99	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	B1AP59	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M14,pfam_DUF2817,superfamily_CarboxyPept-like_regulatory,smart_Peptidase_M14,prints_Peptidase_M14	p.R33W	ENST00000370418.3	37	c.97	CCDS7486.1	10	.	.	.	.	.	.	.	.	.	.	G	15.89	2.967330	0.53507	.	.	ENSG00000120054	ENST00000370418	T	0.03496	3.91	5.45	3.37	0.38596	Peptidase M14, carboxypeptidase A (2);	0.059738	0.64402	D	0.000003	T	0.15003	0.0362	M	0.75085	2.285	0.47476	D	0.999431	D	0.71674	0.998	P	0.61940	0.896	T	0.02093	-1.1215	10	0.52906	T	0.07	-14.6096	15.2683	0.73681	0.0:0.0:0.7058:0.2942	.	33	P15169	CBPN_HUMAN	W	33	ENSP00000359446:R33W	ENSP00000359446:R33W	R	-	1	2	CPN1	101831276	0.997000	0.39634	0.958000	0.39756	0.466000	0.32739	1.407000	0.34657	1.245000	0.43885	0.555000	0.69702	CGG	-	pfam_Peptidase_M14,smart_Peptidase_M14		0.577	CPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPN1	protein_coding	OTTHUMT00000049828.1	G	NM_001308	-		101841286	-1	no_errors	ENST00000370418	ensembl	human	known	74_37	missense	SNP	0.997	A
SMG6	23293	genome.wustl.edu	37	17	1968420	1968420	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr17:1968420C>T	ENST00000263073.6	-	18	4126	c.4076G>A	c.(4075-4077)tGc>tAc	p.C1359Y	SMG6_ENST00000573166.1_5'UTR|SMG6_ENST00000544865.1_Missense_Mutation_p.C1328Y|SMG6_ENST00000354901.4_Missense_Mutation_p.C451Y|SMG6_ENST00000536871.2_Missense_Mutation_p.C451Y	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	1359	PINc.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GTGGAGGCAGCAGGACAGGAT	0.577																																					Melanoma(59;28 1088 11621 25887 46638 50814)												0								ENSG00000070366						243.0	175.0	198.0					17																	1968420		2203	4300	6503	SMG6	SO:0001583	missense	0			-	HGNC	AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.4076G>A	17.37:g.1968420C>T	ENSP00000263073:p.Cys1359Tyr	Somatic	0	102	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B7Z874|O94837|Q86VH6|Q9UF60	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EST1,smart_PIN_dom	p.C1359Y	ENST00000263073.6	37	c.4076	CCDS11016.1	17	.	.	.	.	.	.	.	.	.	.	C	27.0	4.788470	0.90367	.	.	ENSG00000070366	ENST00000263073;ENST00000544865;ENST00000354901;ENST00000536871	T;T;T	0.24723	2.6;2.59;1.84	5.39	5.39	0.77823	Nucleotide binding protein, PINc (1);	0.000000	0.85682	D	0.000000	T	0.62270	0.2414	M	0.90977	3.165	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.71593	-0.4546	10	0.87932	D	0	-5.4549	19.1701	0.93574	0.0:1.0:0.0:0.0	.	1359	Q86US8	EST1A_HUMAN	Y	1359;1328;270;451	ENSP00000263073:C1359Y;ENSP00000443920:C1328Y;ENSP00000440283:C451Y	ENSP00000263073:C1359Y	C	-	2	0	SMG6	1915170	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.818000	0.86416	2.543000	0.85770	0.650000	0.86243	TGC	-	smart_PIN_dom		0.577	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG6	protein_coding	OTTHUMT00000437826.3	C		-		1968420	-1	no_errors	ENST00000263073	ensembl	human	known	74_37	missense	SNP	1.000	T
TAF1L	138474	genome.wustl.edu	37	9	32635336	32635336	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr9:32635336G>A	ENST00000242310.4	-	1	331	c.242C>T	c.(241-243)aCg>aTg	p.T81M	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	81					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.T81K(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TTCATTTGCCGTGAGTTCAGT	0.522																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000122728						161.0	156.0	158.0					9																	32635336		2203	4300	6503	TAF1L	SO:0001583	missense	0			-	HGNC	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.242C>T	9.37:g.32635336G>A	ENSP00000418379:p.Thr81Met	Somatic	0	207	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	77	11.36	Q0VG57	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.T81M	ENST00000242310.4	37	c.242	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	G	13.54	2.266356	0.40095	.	.	ENSG00000122728	ENST00000242310	T	0.08896	3.04	1.04	1.04	0.20106	TAFII-230 TBP-binding (2);	0.000000	0.85682	D	0.000000	T	0.16428	0.0395	L	0.47716	1.5	0.44395	D	0.997307	D	0.76494	0.999	D	0.75020	0.985	T	0.01305	-1.1390	10	0.45353	T	0.12	.	7.4859	0.27432	0.0:0.0:1.0:0.0	.	81	Q8IZX4	TAF1L_HUMAN	M	81	ENSP00000418379:T81M	ENSP00000418379:T81M	T	-	2	0	TAF1L	32625336	1.000000	0.71417	0.753000	0.31225	0.104000	0.19210	4.161000	0.58170	0.507000	0.28148	0.195000	0.17529	ACG	-	pirsf_TAF1_animal,pfam_TAF_II_230-bd,superfamily_TAF_II_230-bd		0.522	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	protein_coding	OTTHUMT00000052012.2	G		-		32635336	-1	no_errors	ENST00000242310	ensembl	human	known	74_37	missense	SNP	1.000	A
TAS1R2	80834	genome.wustl.edu	37	1	19181394	19181394	+	Silent	SNP	G	G	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr1:19181394G>A	ENST00000375371.3	-	3	591	c.570C>T	c.(568-570)caC>caT	p.H190H	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	190					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	TGGCCTCGATGTGGTGGTCGG	0.612																																																	0								ENSG00000179002						43.0	42.0	42.0					1																	19181394		2203	4300	6503	TAS1R2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.570C>T	1.37:g.19181394G>A		Somatic	0	73	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	21	22.22	Q5TZ19	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3	p.H190	ENST00000375371.3	37	c.570	CCDS187.1	1																																																																																			-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3		0.612	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TAS1R2	protein_coding	OTTHUMT00000006953.1	G		-		19181394	-1	no_errors	ENST00000375371	ensembl	human	novel	74_37	silent	SNP	0.003	A
WASH3P	374666	genome.wustl.edu	37	15	102515215	102515215	+	RNA	SNP	G	G	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr15:102515215G>A	ENST00000557932.1	+	0	1061				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						CCTGGCTCCAGTCCAGGGAGC	0.652																																																	0								ENSG00000185596																																			WASH3P			0			-	HGNC			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102515215G>A		Somatic	0	467	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	63	11.27		Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000557932.1	37	c.NULL		15	.	.	.	.	.	.	.	.	.	.	g	4.385	0.070970	0.08436	.	.	ENSG00000185596	ENST00000338304;ENST00000398121	.	.	.	1.01	0.0462	0.14233	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.5249	0.04689	0.2356:0.3212:0.4432:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	WASH3P	100332738	1.000000	0.71417	0.068000	0.19968	0.127000	0.20565	3.073000	0.50057	0.017000	0.15025	0.184000	0.17185	.	-	-		0.652	WASH3P-001	KNOWN	basic	processed_transcript	WASH3P	pseudogene	OTTHUMT00000417608.1	G	NM_199163	-		102515215	+1	no_errors	ENST00000557932	ensembl	human	known	74_37	splice_site	SNP	0.209	A
PCDHB1	29930	genome.wustl.edu	37	5	140431715	140431715	+	Silent	SNP	G	G	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr5:140431715G>A	ENST00000306549.3	+	1	737	c.660G>A	c.(658-660)ccG>ccA	p.P220P		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	220	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGGGTCCCCGCCTAAGTCTG	0.582																																																	0								ENSG00000171815						19.0	20.0	20.0					5																	140431715		2203	4300	6503	PCDHB1	SO:0001819	synonymous_variant	0			-	HGNC	AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.660G>A	5.37:g.140431715G>A		Somatic	0	45	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	5	44.44	Q2M257	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P220	ENST00000306549.3	37	c.660	CCDS4243.1	5																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.582	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB1	protein_coding	OTTHUMT00000251822.2	G	NM_013340	-		140431715	+1	no_errors	ENST00000306549	ensembl	human	known	74_37	silent	SNP	0.659	A
LAMB3	3914	genome.wustl.edu	37	1	209796433	209796433	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr1:209796433C>T	ENST00000356082.4	-	17	2584	c.2450G>A	c.(2449-2451)cGc>cAc	p.R817H	LAMB3_ENST00000367030.3_Missense_Mutation_p.R817H|MIR4260_ENST00000583107.1_RNA|LAMB3_ENST00000391911.1_Missense_Mutation_p.R817H	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	817	Domain I.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		ACCCCTGCAGCGGGAGCCACA	0.642																																																	0								ENSG00000196878						53.0	61.0	59.0					1																	209796433		2203	4300	6503	LAMB3	SO:0001583	missense	0			-	HGNC	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.2450G>A	1.37:g.209796433C>T	ENSP00000348384:p.Arg817His	Somatic	0	99	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	20	44.44	D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_EGF_laminin,pfscan_Laminin_N	p.R817H	ENST00000356082.4	37	c.2450	CCDS1487.1	1	.	.	.	.	.	.	.	.	.	.	T	10.34	1.322082	0.23994	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030	T;T;T	0.36699	1.24;1.24;1.24	5.21	2.9	0.33743	.	0.904972	0.09792	N	0.755254	T	0.11922	0.0290	N	0.01267	-0.92	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.34204	-0.9838	10	0.16896	T	0.51	.	4.6453	0.12568	0.1485:0.3755:0.0:0.476	.	817	Q13751	LAMB3_HUMAN	H	817	ENSP00000375778:R817H;ENSP00000348384:R817H;ENSP00000355997:R817H	ENSP00000348384:R817H	R	-	2	0	LAMB3	207863056	0.288000	0.24324	0.998000	0.56505	0.515000	0.34225	-0.502000	0.06390	0.043000	0.15746	-0.535000	0.04281	CGC	-	NULL		0.642	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB3	protein_coding	OTTHUMT00000088525.2	C	NM_000228	-		209796433	-1	no_errors	ENST00000356082	ensembl	human	known	74_37	missense	SNP	0.799	T
PCDH11Y	83259	genome.wustl.edu	37	Y	4925426	4925426	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chrY:4925426T>A	ENST00000333703.4	+	4	1042	c.529T>A	c.(529-531)Tct>Act	p.S177T	PCDH11Y_ENST00000215473.6_Missense_Mutation_p.S188T|PCDH11Y_ENST00000362095.5_Missense_Mutation_p.S188T	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	188	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						GGCTATAAACTCTAAATATAC	0.363																																																	0								ENSG00000099715						19.0	18.0	18.0					Y																	4925426		632	1930	2562	PCDH11Y	SO:0001583	missense	0			-	HGNC	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.529T>A	Y.37:g.4925426T>A	ENSP00000330552:p.Ser177Thr	Somatic	0	71	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	1	95.24	Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S188T	ENST00000333703.4	37	c.562	CCDS14776.1	Y																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.363	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH11Y	protein_coding	OTTHUMT00000084979.2	T	NM_032973	-		4925426	+1	no_errors	ENST00000215473	ensembl	human	known	74_37	missense	SNP	1.000	A
OR4X2	119764	genome.wustl.edu	37	11	48267306	48267306	+	Silent	SNP	G	G	C			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr11:48267306G>C	ENST00000302329.3	+	1	699	c.651G>C	c.(649-651)ctG>ctC	p.L217L		NM_001004727.1	NP_001004727.1	Q8NGF9	OR4X2_HUMAN	olfactory receptor, family 4, subfamily X, member 2	217						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(4)|lung(12)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	20						TGCTCCATCTGAGAACCTGGA	0.522																																																	0								ENSG00000172208						147.0	130.0	136.0					11																	48267306		2201	4298	6499	OR4X2	SO:0001819	synonymous_variant	0			-	HGNC	AB065847	CCDS31486.1	11p11.2	2012-08-09			ENSG00000172208	ENSG00000172208		"""GPCR / Class A : Olfactory receptors"""	15184	protein-coding gene	gene with protein product							Standard	NM_001004727		Approved		uc001ngs.1	Q8NGF9	OTTHUMG00000165302	ENST00000302329.3:c.651G>C	11.37:g.48267306G>C		Somatic	0	52	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	15	44.44	B2RNK3|Q6IF73|Q96R63	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L217	ENST00000302329.3	37	c.651	CCDS31486.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.522	OR4X2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4X2	protein_coding	OTTHUMT00000383376.2	G	NM_001004727	-		48267306	+1	no_errors	ENST00000302329	ensembl	human	known	74_37	silent	SNP	0.126	C
PPIP5K2	23262	genome.wustl.edu	37	5	102503855	102503855	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr5:102503855G>T	ENST00000358359.3	+	19	2651	c.2142G>T	c.(2140-2142)aaG>aaT	p.K714N	PPIP5K2_ENST00000414217.1_Missense_Mutation_p.K714N|PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000321521.9_Missense_Mutation_p.K714N	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	714					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TTAAAACAAAGAATGGAAGAT	0.303																																																	0								ENSG00000145725						103.0	110.0	108.0					5																	102503855		2201	4288	6489	PPIP5K2	SO:0001583	missense	0			-	HGNC	AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.2142G>T	5.37:g.102503855G>T	ENSP00000351126:p.Lys714Asn	Somatic	0	150	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	35	41.67	A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_His_Pase_superF_clade-2	p.K714N	ENST00000358359.3	37	c.2142		5	.	.	.	.	.	.	.	.	.	.	G	18.74	3.688746	0.68271	.	.	ENSG00000145725	ENST00000321521;ENST00000358359;ENST00000451606;ENST00000414217	T;T;T	0.32753	1.44;1.44;1.44	5.51	3.73	0.42828	.	0.000000	0.85682	D	0.000000	T	0.52885	0.1762	M	0.82823	2.61	0.58432	D	0.999998	P;B;P	0.50943	0.616;0.357;0.94	P;B;P	0.60068	0.574;0.155;0.868	T	0.57423	-0.7814	10	0.87932	D	0	.	11.1026	0.48184	0.2063:0.0:0.7937:0.0	.	714;714;714	E9PGM8;O43314-2;O43314	.;.;VIP2_HUMAN	N	714	ENSP00000313070:K714N;ENSP00000351126:K714N;ENSP00000416016:K714N	ENSP00000313070:K714N	K	+	3	2	PPIP5K2	102531754	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.585000	0.46111	0.807000	0.34208	0.460000	0.39030	AAG	-	pfam_His_Pase_superF_clade-2		0.303	PPIP5K2-003	KNOWN	basic	protein_coding	PPIP5K2	protein_coding	OTTHUMT00000370487.1	G	NM_015216	-		102503855	+1	no_errors	ENST00000358359	ensembl	human	known	74_37	missense	SNP	1.000	T
METTL16	79066	genome.wustl.edu	37	17	2310279	2310279	+	3'UTR	SNP	G	G	A	rs375396761		TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr17:2310279G>A	ENST00000609667.1	-	0	572																											GAAAGGTGACGGGAGAAAGGG	0.542																																																	0								ENSG00000127804	G		0,3844		0,0,1922	37.0	38.0	37.0			-4.1	0.0	17		37	1,8243		0,1,4121	no	intergenic				0,1,6043	AA,AG,GG		0.0121,0.0,0.0083			2310279	1,12087	1922	4122	6044	METTL16	SO:0001624	3_prime_UTR_variant	0			-	HGNC																												ENST00000609667.1:c.*19C>T	17.37:g.2310279G>A		Somatic	0	83	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	24	38.46		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000609667.1	37	NULL		17																																																																																			-	-		0.542	AC006435.1-201	KNOWN	basic|appris_principal	protein_coding	METTL16	protein_coding		G		-		2310279	-1	no_errors	ENST00000571332	ensembl	human	putative	74_37	rna	SNP	0.002	A
DDX43	55510	genome.wustl.edu	37	6	74125300	74125301	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr6:74125300_74125301insA	ENST00000370336.4	+	15	1984_1985	c.1826_1827insA	c.(1825-1830)gcaaatfs	p.N610fs	MB21D1_ENST00000370318.1_Intron	NM_018665.2	NP_061135.2	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43	610	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						CTGGAAAGAGCAAATCAGGTGA	0.391																																																	0								ENSG00000080007																																			DDX43	SO:0001589	frameshift_variant	0				HGNC		CCDS4977.1	6q13	2014-01-21			ENSG00000080007	ENSG00000080007		"""DEAD-boxes"""	18677	protein-coding gene	gene with protein product	"""cancer/testis antigen 13"""	606286				10919659	Standard	NM_018665		Approved	HAGE, DKFZp434H2114, CT13	uc003pgw.3	Q9NXZ2	OTTHUMG00000015033	ENST00000370336.4:c.1829dupA	6.37:g.74125303_74125303dupA	ENSP00000359361:p.Asn610fs	Somatic	0	95	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	B4E0C8|Q6NXR1	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_KH_dom_type_1,superfamily_P-loop_NTPase,smart_KH_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_KH_dom_type_1,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.N610fs	ENST00000370336.4	37	c.1826_1827	CCDS4977.1	6																																																																																			-	pfscan_Helicase_C		0.391	DDX43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX43	protein_coding	OTTHUMT00000041219.3	-	NM_018665			74125301	+1	no_errors	ENST00000370336	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
MMRN1	22915	genome.wustl.edu	37	4	90856549	90856549	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr4:90856549A>C	ENST00000394980.1	+	7	2037	c.1718A>C	c.(1717-1719)aAg>aCg	p.K573T	MMRN1_ENST00000394981.1_Intron|MMRN1_ENST00000508372.1_Missense_Mutation_p.K315T|MMRN1_ENST00000264790.2_Missense_Mutation_p.K573T			Q13201	MMRN1_HUMAN	multimerin 1	573					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		CAAGAAAGCAAGATTAACAAT	0.338																																																	0								ENSG00000138722						63.0	64.0	64.0					4																	90856549		2203	4300	6503	MMRN1	SO:0001583	missense	0			-	HGNC	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.1718A>C	4.37:g.90856549A>C	ENSP00000378431:p.Lys573Thr	Somatic	0	24	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	10	54.55	Q4W5L1|Q6P3T8|Q6ZUL9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C1q,pfam_EMI_domain,pfam_EG-like_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_C1q,prints_C1q,pfscan_C1q,pfscan_EG-like_dom,pfscan_EMI_domain	p.K573T	ENST00000394980.1	37	c.1718	CCDS3635.1	4	.	.	.	.	.	.	.	.	.	.	A	17.87	3.495705	0.64186	.	.	ENSG00000138722	ENST00000394980;ENST00000264790;ENST00000508372	T;T;T	0.72615	-0.38;-0.38;-0.67	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000001	D	0.82328	0.5013	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.82950	-0.0203	10	0.48119	T	0.1	.	15.6166	0.76773	1.0:0.0:0.0:0.0	.	573	Q13201	MMRN1_HUMAN	T	573;573;315	ENSP00000378431:K573T;ENSP00000264790:K573T;ENSP00000426461:K315T	ENSP00000264790:K573T	K	+	2	0	MMRN1	91075572	1.000000	0.71417	0.973000	0.42090	0.930000	0.56654	5.952000	0.70282	2.220000	0.72140	0.482000	0.46254	AAG	-	NULL		0.338	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMRN1	protein_coding	OTTHUMT00000253546.2	A	NM_007351	-		90856549	+1	no_errors	ENST00000264790	ensembl	human	known	74_37	missense	SNP	1.000	C
JUP	3728	genome.wustl.edu	37	17	39912102	39912103	+	Frame_Shift_Ins	INS	-	-	GGGGCACATCGCT			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr17:39912102_39912103insGGGGCACATCGCT	ENST00000393931.3	-	14	2249_2250	c.2131_2132insAGCGATGTGCCCC	c.(2131-2133)cttfs	p.L711fs	JUP_ENST00000393930.1_Frame_Shift_Ins_p.L711fs|JUP_ENST00000540235.1_Intron|JUP_ENST00000310706.5_Frame_Shift_Ins_p.L711fs	NM_002230.2	NP_002221.1	P14923	PLAK_HUMAN	junction plakoglobin	711					adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		CAGCGGGTCAAGGGGCACATCG	0.619																																					Colon(16;42 520 6044 17852 28530)												0								ENSG00000173801																																			JUP	SO:0001589	frameshift_variant	0				HGNC	AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000393931.3:c.2119_2131dupAGCGATGTGCCCC	17.37:g.39912102_39912103insGGGGCACATCGCT	ENSP00000377508:p.Leu711fs	Somatic	NA	NA	NA		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,prints_Beta-catenin	p.L711fs	ENST00000393931.3	37	c.2132_2131	CCDS11407.1	17																																																																																			-	NULL		0.619	JUP-008	KNOWN	basic|appris_principal|CCDS	protein_coding	JUP	protein_coding	OTTHUMT00000257406.1	-				39912103	-1	no_errors	ENST00000310706	ensembl	human	known	74_37	frame_shift_ins	INS	0.999:0.999	GGGGCACATCGCT
TP53	7157	genome.wustl.edu	37	17	7579470	7579471	+	Frame_Shift_Ins	INS	-	-	G	rs56275308|rs587782423		TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr17:7579470_7579471insG	ENST00000269305.4	-	4	405_406	c.216_217insC	c.(214-219)cccgtgfs	p.V73fs	TP53_ENST00000413465.2_Frame_Shift_Ins_p.V73fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.V73fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.V73fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.V73fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Frame_Shift_Ins_p.V73fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	73	Interaction with HRMT1L2.|Interaction with WWOX.		V -> E (in a sporadic cancer; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V73fs*76(11)|p.0?(8)|p.V73L(3)|p.G59fs*23(3)|p.R72fs*51(2)|p.V73M(2)|p.V73fs*9(1)|p.R65fs*38(1)|p.E68fs*76(1)|p.V73fs*50(1)|p.D48fs*55(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.D57_A76del20(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAGGGGCCACGGGGGGAGCAG	0.604		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	37	Insertion - Frameshift(11)|Deletion - Frameshift(9)|Whole gene deletion(8)|Substitution - Missense(5)|Complex - frameshift(3)|Deletion - In frame(1)	upper_aerodigestive_tract(6)|lung(6)|breast(4)|bone(4)|central_nervous_system(3)|biliary_tract(3)|urinary_tract(3)|large_intestine(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|ovary(1)|prostate(1)|liver(1)	GRCh37	CI920954	TP53	I		ENSG00000141510																																			TP53	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.217dupC	17.37:g.7579476_7579476dupG	ENSP00000269305:p.Val73fs	Somatic	0	78	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	13	71.74	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.V72fs	ENST00000269305.4	37	c.217_216	CCDS11118.1	17																																																																																			-	NULL		0.604	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	-	NM_000546			7579471	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.001	G
SNED1	25992	genome.wustl.edu	37	2	241988519	241988519	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr2:241988519T>C	ENST00000310397.8	+	11	1585	c.1585T>C	c.(1585-1587)Tgc>Cgc	p.C529R	SNED1_ENST00000469006.1_3'UTR|SNED1_ENST00000405547.3_Missense_Mutation_p.C529R|AC005237.4_ENST00000458377.1_RNA|SNED1_ENST00000401884.1_Missense_Mutation_p.C529R|SNED1_ENST00000342631.6_Missense_Mutation_p.C529R	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	529	Follistatin-like 2.				cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.C529R(1)		NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		GAGCTACCTCTGCGTCTGCCA	0.622																																																	1	Substitution - Missense(1)	ovary(1)						ENSG00000162804						22.0	28.0	26.0					2																	241988519		2062	4187	6249	SNED1	SO:0001583	missense	0			-	HGNC	AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.1585T>C	2.37:g.241988519T>C	ENSP00000308893:p.Cys529Arg	Somatic	0	99	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	2	80.00	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EG-like_dom,pfam_Fibronectin_type3,pfam_Nidogen_extracell_dom,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_Fibronectin_type3,superfamily_Sushi_SCR_CCP,smart_Nidogen_extracell_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Sushi_SCR_CCP,smart_Fibronectin_type3,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Sushi_SCR_CCP	p.C529R	ENST00000310397.8	37	c.1585	CCDS46562.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.96|19.96	3.923428|3.923428	0.73213|0.73213	.|.	.|.	ENSG00000162804|ENSG00000162804	ENST00000401884;ENST00000405547;ENST00000310397;ENST00000342631|ENST00000401644	D;D;D;D|D	0.84442|0.94138	-1.77;-1.85;-1.85;-1.79|-3.36	5.09|5.09	5.09|5.09	0.68999|0.68999	Follistatin-like, N-terminal (1);|.	0.000000|.	0.64402|.	D|.	0.000016|.	D|D	0.96642|0.96642	0.8904|0.8904	M|M	0.92077|0.92077	3.27|3.27	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	D|D	0.96210|0.96210	0.9152|0.9152	10|7	0.87932|0.24483	D|T	0|0.36	.|.	14.5708|14.5708	0.68210|0.68210	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	529|.	Q8TER0|.	SNED1_HUMAN|.	R|P	529|225	ENSP00000384871:C529R;ENSP00000386007:C529R;ENSP00000308893:C529R;ENSP00000342992:C529R|ENSP00000384789:L225P	ENSP00000308893:C529R|ENSP00000384789:L225P	C|L	+|+	1|2	0|0	SNED1|SNED1	241637192|241637192	1.000000|1.000000	0.71417|0.71417	0.913000|0.913000	0.36048|0.36048	0.801000|0.801000	0.45260|0.45260	6.344000|6.344000	0.72991|0.72991	1.919000|1.919000	0.55581|0.55581	0.460000|0.460000	0.39030|0.39030	TGC|CTG	-	NULL		0.622	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SNED1	protein_coding	OTTHUMT00000323935.2	T	XM_059482	-		241988519	+1	no_errors	ENST00000310397	ensembl	human	known	74_37	missense	SNP	0.990	C
INADL	10207	genome.wustl.edu	37	1	62253620	62253620	+	Silent	SNP	T	T	G			TCGA-DX-A6B8-01A-11D-A307-09	TCGA-DX-A6B8-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f06f79b3-53f9-4c0a-935f-e721ebcada6b	b50283e5-96cd-4cf4-a35d-6a07340996aa	g.chr1:62253620T>G	ENST00000371158.2	+	8	1158	c.1044T>G	c.(1042-1044)acT>acG	p.T348T	INADL_ENST00000316485.6_Silent_p.T348T	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	348					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						CCCTGCCTACTGTAGCCAGCA	0.488																																																	0								ENSG00000132849						68.0	65.0	66.0					1																	62253620		2203	4300	6503	INADL	SO:0001819	synonymous_variant	0			-	HGNC	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.1044T>G	1.37:g.62253620T>G		Somatic	0	80	0.00		0.73195998727305	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	31	45.61	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_L27,smart_PDZ,pfscan_L27,pfscan_PDZ	p.T348	ENST00000371158.2	37	c.1044	CCDS617.2	1																																																																																			-	superfamily_PDZ		0.488	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INADL	protein_coding	OTTHUMT00000023639.2	T	NM_170605	-		62253620	+1	no_errors	ENST00000371158	ensembl	human	known	74_37	silent	SNP	0.001	G
