#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
BAIAP2-AS1	440465	genome.wustl.edu	37	17	79005063	79005063	+	lincRNA	DEL	C	C	-			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr17:79005063delC	ENST00000577066.1	-	0	2331					NR_026857.1				BAIAP2 antisense RNA 1 (head to head)																		CCTGGCTCTGCCCCAGACACC	0.612																																																	0								ENSG00000226137																																			BAIAP2-AS1			0				HGNC	AK027350, AK056555, AK075238, AK096609		17q25.3	2012-10-15	2012-10-15		ENSG00000226137	ENSG00000226137		"""Long non-coding RNAs"""	44342	non-coding RNA	RNA, long non-coding			"""BAIAP2 antisense RNA 1 (non-protein coding)"", ""BAIAP2 antisense RNA 1"""				Standard	NR_026857		Approved		uc002jyy.2		OTTHUMG00000177697		17.37:g.79005063delC		Somatic	0	113	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	75	27.88		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000577066.1	37	NULL		17																																																																																			-	-		0.612	BAIAP2-AS1-001	KNOWN	basic	lincRNA	BAIAP2-AS1	lincRNA	OTTHUMT00000438544.1	C	NR_026857			79005063	-1	no_errors	ENST00000542745	ensembl	human	known	74_37	rna	DEL	0.027	-
RASAL2	9462	genome.wustl.edu	37	1	178427011	178427011	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr1:178427011G>T	ENST00000462775.1	+	12	2286	c.2161G>T	c.(2161-2163)Gag>Tag	p.E721*	RASAL2_ENST00000367649.3_Nonsense_Mutation_p.E862*|RASAL2_ENST00000448150.3_Nonsense_Mutation_p.E851*	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	721					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						TGCTCAAGTGGAGCATGCATC	0.522																																																	0								ENSG00000075391						91.0	84.0	87.0					1																	178427011		2203	4300	6503	RASAL2	SO:0001587	stop_gained	0			-	HGNC	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.2161G>T	1.37:g.178427011G>T	ENSP00000420558:p.Glu721*	Somatic	0	40	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	F8W755|O95174|Q2TB22|Q5TFU9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3498,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,superfamily_PP1_inhibitor,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.E862*	ENST00000462775.1	37	c.2584	CCDS1322.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.881017|5.881017	0.97062|0.97062	.|.	.|.	ENSG00000075391|ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775|ENST00000433130	.|.	.|.	.|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.255145|.	0.39146|.	N|.	0.001454|.	.|T	.|0.76169	.|0.3950	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74870	.|-0.3517	.|3	0.12430|.	T|.	0.62|.	.|.	19.2521|19.2521	0.93929|0.93929	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|V	851;862;721|271	.|.	ENSP00000356621:E862X|.	E|G	+|+	1|2	0|0	RASAL2|RASAL2	176693634|176693634	1.000000|1.000000	0.71417|0.71417	0.950000|0.950000	0.38849|0.38849	0.744000|0.744000	0.42396|0.42396	3.999000|3.999000	0.57031|0.57031	2.542000|2.542000	0.85734|0.85734	0.655000|0.655000	0.94253|0.94253	GAG|GGA	-	pfam_DUF3498		0.522	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RASAL2	protein_coding	OTTHUMT00000084758.3	G	NM_170692	-		178427011	+1	no_errors	ENST00000367649	ensembl	human	known	74_37	nonsense	SNP	0.985	T
EWSR1	2130	genome.wustl.edu	37	22	29693838	29693838	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr22:29693838A>T	ENST00000397938.2	+	13	1635	c.1316A>T	c.(1315-1317)aAa>aTa	p.K439I	EWSR1_ENST00000332035.6_Missense_Mutation_p.K383I|EWSR1_ENST00000331029.7_Missense_Mutation_p.K401I|EWSR1_ENST00000332050.6_Missense_Mutation_p.K366I|EWSR1_ENST00000406548.1_Missense_Mutation_p.K438I|EWSR1_ENST00000414183.2_Missense_Mutation_p.K444I	NM_001163285.1|NM_001163286.1|NM_005243.3|NM_013986.3	NP_001156757.1|NP_001156758.1|NP_005234.1|NP_053733.2	Q01844	EWS_HUMAN	EWS RNA-binding protein 1	439	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		EWSR1/ATF1(347)|EWSR1/POU5F1(10)|EWSR1/PBX1(3)|EWSR1/DDIT3(45)|EWSR1/FEV(11)|EWSR1/CREB1(44)|EWSR1/SMARCA5(2)|EWSR1/ETV4(6)|EWSR1/ERG(178)|EWSR1/ZNF384(4)|EWSR1/ETV1(7)|EWSR1/FLI1(2569)|EWSR1/NR4A3(146)|EWSR1/SP3(3)|EWSR1/PATZ1(2)|EWSR1/WT1(234)|EWSR1/NFATC2(9)	breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						CAAGGGAGCAAACTTAAAGTC	0.512			T	"""FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1,  PBX1"""	"""Ewing sarcoma,  desmoplastic small round cell tumor , ALL, clear cell sarcoma, sarcoma, myoepithelioma"""																																			Dom	yes		22	22q12	2130	Ewing sarcoma breakpoint region 1 (EWS)		"""L, M"""	0								ENSG00000182944						93.0	90.0	91.0					22																	29693838		2203	4300	6503	EWSR1	SO:0001583	missense	0			-	HGNC		CCDS13851.1, CCDS13852.1, CCDS13852.2, CCDS54512.1, CCDS54513.1, CCDS54514.1	22q12.2	2013-05-24	2013-05-24		ENSG00000182944	ENSG00000182944		"""RNA binding motif (RRM) containing"""	3508	protein-coding gene	gene with protein product		133450	"""Ewing sarcoma breakpoint region 1"""			1522903	Standard	NM_005243		Approved	EWS	uc003aev.3	Q01844	OTTHUMG00000151107	ENST00000397938.2:c.1316A>T	22.37:g.29693838A>T	ENSP00000381031:p.Lys439Ile	Somatic	0	82	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	51	10.53	B0QYK1|Q5THL0|Q92635|Q96FE8|Q96MN4|Q96MX4|Q9BWA2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_RanBP2,pfam_RRM_dom,smart_RRM_dom,smart_Znf_RanBP2,pfscan_Znf_RanBP2,pfscan_RRM_dom	p.K444I	ENST00000397938.2	37	c.1331	CCDS13851.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.66|14.66	2.601742|2.601742	0.46423|0.46423	.|.	.|.	ENSG00000182944|ENSG00000182944	ENST00000332050;ENST00000397938;ENST00000406548;ENST00000331029;ENST00000414183;ENST00000332035|ENST00000360091	T;T;T;T;T;T|.	0.09255|.	3.0;3.0;3.0;3.0;3.0;3.0|.	5.79|5.79	5.79|5.79	0.91817|0.91817	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);|.	0.059146|.	0.64402|.	U|.	0.000004|.	T|T	0.62171|0.62171	0.2406|0.2406	L|L	0.45228|0.45228	1.405|1.405	0.54753|0.54753	D|D	0.999983|0.999983	B;B;B;B;B|.	0.28324|.	0.007;0.014;0.007;0.207;0.014|.	B;P;B;P;P|.	0.49887|.	0.397;0.526;0.397;0.625;0.526|.	T|T	0.58702|0.58702	-0.7590|-0.7590	10|5	0.45353|.	T|.	0.12|.	.|.	16.1224|16.1224	0.81369|0.81369	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	383;438;383;444;439|.	Q96MN4;Q96FE8;B0QYK1;Q96MX4;Q01844|.	.;.;.;.;EWS_HUMAN|.	I|H	366;439;438;401;444;383|94	ENSP00000330896:K366I;ENSP00000381031:K439I;ENSP00000385726:K438I;ENSP00000330516:K401I;ENSP00000400142:K444I;ENSP00000331699:K383I|.	ENSP00000330516:K401I|.	K|Q	+|+	2|3	0|2	EWSR1|EWSR1	28023838|28023838	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	6.266000|6.266000	0.72540|0.72540	2.208000|2.208000	0.71279|0.71279	0.533000|0.533000	0.62120|0.62120	AAA|CAA	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.512	EWSR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EWSR1	protein_coding	OTTHUMT00000321345.1	A	NM_005243	-		29693838	+1	no_errors	ENST00000414183	ensembl	human	known	74_37	missense	SNP	1.000	T
FCHO1	23149	genome.wustl.edu	37	19	17877435	17877435	+	Intron	SNP	G	G	A			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr19:17877435G>A	ENST00000596536.1	+	7	477				FCHO1_ENST00000595033.1_Intron|FCHO1_ENST00000597512.1_Intron|FCHO1_ENST00000389133.4_Intron|FCHO1_ENST00000600676.1_Intron|FCHO1_ENST00000596951.1_Intron|FCHO1_ENST00000594202.1_Intron|FCHO1_ENST00000539407.1_Intron|FCHO1_ENST00000252771.7_Intron	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1						clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						CCCGGGGTGGGGTGAGCCTGA	0.607																																																	0								ENSG00000130475						28.0	26.0	27.0					19																	17877435		2203	4300	6503	FCHO1	SO:0001627	intron_variant	0			-	HGNC	AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.195-43G>A	19.37:g.17877435G>A		Somatic	0	78	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	101	30.34	A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000596536.1	37	NULL	CCDS32955.1	19																																																																																			-	-		0.607	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FCHO1	protein_coding	OTTHUMT00000466946.2	G	NM_015122	-		17877435	+1	no_errors	ENST00000601247	ensembl	human	known	74_37	rna	SNP	0.001	A
NDUFA13	51079	genome.wustl.edu	37	19	19627062	19627062	+	Missense_Mutation	SNP	G	G	C	rs137852869		TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr19:19627062G>C	ENST00000507754.4	+	1	499	c.15G>C	c.(13-15)aaG>aaC	p.K5N	CTC-260F20.3_ENST00000555938.1_Missense_Mutation_p.K5N|CTC-260F20.3_ENST00000586674.1_3'UTR|YJEFN3_ENST00000608404.1_Missense_Mutation_p.K5N|NDUFA13_ENST00000512771.3_Missense_Mutation_p.K5N|NDUFA13_ENST00000252576.5_Missense_Mutation_p.K88N|TSSK6_ENST00000360913.3_5'Flank|NDUFA13_ENST00000503283.1_Missense_Mutation_p.K5N|NDUFA13_ENST00000428459.2_Missense_Mutation_p.K5N|TSSK6_ENST00000585580.3_5'Flank			Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13	5			K -> N (in a Hurthle cell variant of papillary carcinoma sample). {ECO:0000269|PubMed:15841082}.		apoptotic signaling pathway (GO:0097190)|cellular metabolic process (GO:0044237)|cellular response to interferon-beta (GO:0035458)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of peptidase activity (GO:0010952)|positive regulation of protein catabolic process (GO:0045732)|protein import into mitochondrial inner membrane (GO:0045039)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	12						CGGCGTCAAAGGTGAAGCAGG	0.617																																																	0			GRCh37	CM055453	NDUFA13	M	rs137852869	ENSG00000250067						45.0	49.0	47.0					19																	19627062		2203	4300	6503	YJEFN3	SO:0001583	missense	0			-	HGNC	AF261134	CCDS12404.1, CCDS12404.2	19p13.11	2011-07-04			ENSG00000186010	ENSG00000186010		"""Mitochondrial respiratory chain complex / Complex I"""	17194	protein-coding gene	gene with protein product	"""complex I B16.6 subunit"""	609435				12837546, 10924506, 15367666	Standard	NM_015965		Approved	CGI-39, CDA016, GRIM-19, GRIM19, B16.6		Q9P0J0	OTTHUMG00000162211	ENST00000507754.4:c.15G>C	19.37:g.19627062G>C	ENSP00000423673:p.Lys5Asn	Somatic	0	89	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	55	40.86	B4DF76|K7EK58|Q6PKI0|Q9H2L3|Q9Y327	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GRIM-19,pfam_YjeF_N_dom,superfamily_YjeF_N_dom	p.K5N	ENST00000507754.4	37	c.15	CCDS12404.2	19	.	.	.	.	.	.	.	.	.	.	G	35	5.528338	0.96446	.	.	ENSG00000186010;ENSG00000186010;ENSG00000250067;ENSG00000258674	ENST00000507754;ENST00000252576;ENST00000553705;ENST00000555938	T;T;T	0.78003	-1.14;-1.14;-1.14	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.88912	0.6566	M	0.85542	2.76	0.35668	D	0.813118	D;D;D	0.89917	0.995;1.0;1.0	D;D;D	0.79784	0.951;0.989;0.993	D	0.92211	0.5776	10	0.49607	T	0.09	.	16.5154	0.84299	0.0:0.0:1.0:0.0	.	5;5;5	E7ENQ6;B4DF76;Q9P0J0	.;.;NDUAD_HUMAN	N	5;88;5;5	ENSP00000423673:K5N;ENSP00000252576:K88N;ENSP00000452549:K5N	ENSP00000252576:K88N	K	+	3	2	YJEFN3;NDUFA13;CTC-260F20.3	19488062	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	7.712000	0.84684	2.504000	0.84457	0.650000	0.86243	AAG	-	pfam_GRIM-19		0.617	NDUFA13-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	YJEFN3	protein_coding	OTTHUMT00000367916.6	G	NM_015965	rs137852869		19627062	+1	no_errors	ENST00000608404	ensembl	human	known	74_37	missense	SNP	1.000	C
IGF2BP1	10642	genome.wustl.edu	37	17	47121387	47121387	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr17:47121387T>C	ENST00000290341.3	+	11	1593	c.1259T>C	c.(1258-1260)aTc>aCc	p.I420T	IGF2BP1_ENST00000431824.2_Missense_Mutation_p.I281T	NM_006546.3	NP_006537.3	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding protein 1	420	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.|Necessary for interaction with ELAVL4 and binding to TAU mRNA. {ECO:0000250}.				CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of mRNA stability involved in response to stress (GO:0010610)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						GTGGGCGCCATCATCGGCAAG	0.602																																					Esophageal Squamous(198;1041 2123 8248 37119 38268)												0								ENSG00000159217						106.0	95.0	98.0					17																	47121387		2203	4300	6503	IGF2BP1	SO:0001583	missense	0			-	HGNC	AF198254	CCDS11543.1, CCDS54138.1	17q21.32	2013-02-12			ENSG00000159217	ENSG00000159217		"""RNA binding motif (RRM) containing"""	28866	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 1"""	608288				9891060, 11992722	Standard	NM_001160423		Approved	IMP-1	uc002iom.3	Q9NZI8	OTTHUMG00000161173	ENST00000290341.3:c.1259T>C	17.37:g.47121387T>C	ENSP00000290341:p.Ile420Thr	Somatic	0	110	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	68	28.42	C9JT33	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KH_dom_type_1,pfam_RRM_dom,smart_RRM_dom,smart_KH_dom,pfscan_KH_dom_type_1,pfscan_RRM_dom	p.I420T	ENST00000290341.3	37	c.1259	CCDS11543.1	17	.	.	.	.	.	.	.	.	.	.	T	34	5.321683	0.95682	.	.	ENSG00000159217	ENST00000290341;ENST00000431824	T;T	0.42900	0.96;0.96	6.17	6.17	0.99709	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.225856	0.44688	D	0.000430	T	0.72851	0.3512	M	0.94101	3.495	0.58432	D	0.999998	P;D	0.53885	0.941;0.963	P;D	0.65773	0.703;0.938	T	0.80238	-0.1465	10	0.87932	D	0	-22.3333	15.8048	0.78491	0.0:0.0:0.0:1.0	.	281;420	C9JT33;Q9NZI8	.;IF2B1_HUMAN	T	420;281	ENSP00000290341:I420T;ENSP00000389135:I281T	ENSP00000290341:I420T	I	+	2	0	IGF2BP1	44476386	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.013000	0.88655	2.371000	0.80710	0.533000	0.62120	ATC	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1		0.602	IGF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2BP1	protein_coding	OTTHUMT00000364046.1	T	NM_006546	-		47121387	+1	no_errors	ENST00000290341	ensembl	human	known	74_37	missense	SNP	1.000	C
CAPN9	10753	genome.wustl.edu	37	1	230898442	230898442	+	Missense_Mutation	SNP	G	G	A	rs201859022		TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr1:230898442G>A	ENST00000271971.2	+	4	559	c.446G>A	c.(445-447)cGc>cAc	p.R149H	CAPN9_ENST00000354537.1_Missense_Mutation_p.R149H|CAPN9_ENST00000366666.2_Missense_Mutation_p.R86H|RP11-99J16__A.2_ENST00000412344.1_RNA	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	149	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				ATCGATGACCGCCTGCCCACC	0.567																																																	0								ENSG00000135773						123.0	109.0	114.0					1																	230898442		2203	4300	6503	CAPN9	SO:0001583	missense	0			-	HGNC	AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.446G>A	1.37:g.230898442G>A	ENSP00000271971:p.Arg149His	Somatic	0	150	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	67	54	54.47	B1APS1|B1AQI0|Q9NS74	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_EF_hand_dom,prints_Calpain_cysteine_protease,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat	p.R149H	ENST00000271971.2	37	c.446	CCDS1586.1	1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.886442	0.91814	.	.	ENSG00000135773	ENST00000271971;ENST00000354537;ENST00000366666	T;T;T	0.18657	2.2;2.2;2.2	5.33	5.33	0.75918	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.57198	0.2037	H	0.94462	3.54	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.68569	-0.5374	10	0.72032	D	0.01	.	13.3397	0.60538	0.0762:0.0:0.9238:0.0	.	86;149;149	E7ESS6;O14815-2;O14815	.;.;CAN9_HUMAN	H	149;149;86	ENSP00000271971:R149H;ENSP00000346538:R149H;ENSP00000355626:R86H	ENSP00000271971:R149H	R	+	2	0	CAPN9	228965065	1.000000	0.71417	0.954000	0.39281	0.940000	0.58332	7.358000	0.79466	2.489000	0.83994	0.591000	0.81541	CGC	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease,pfscan_Peptidase_C2_calpain_cat		0.567	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN9	protein_coding	OTTHUMT00000092179.1	G	NM_006615	rs201859022		230898442	+1	no_errors	ENST00000271971	ensembl	human	known	74_37	missense	SNP	0.999	A
C3	718	genome.wustl.edu	37	19	6682024	6682024	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr19:6682024G>C	ENST00000245907.6	-	35	4370	c.4278C>G	c.(4276-4278)gaC>gaG	p.D1426E	C3_ENST00000599668.1_5'Flank	NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	1426	Properdin-binding.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)	p.D1426E(1)		breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	AGATGTATCTGTCAACACCAT	0.547																																																	1	Substitution - Missense(1)	prostate(1)						ENSG00000125730						163.0	147.0	152.0					19																	6682024		2203	4300	6503	C3	SO:0001583	missense	0			-	HGNC	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.4278C>G	19.37:g.6682024G>C	ENSP00000245907:p.Asp1426Glu	Somatic	0	254	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	64	356	15.24	A7E236	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A2M_comp,pfam_A-macroglobulin_rcpt-bd,pfam_Macroglobln_a2,pfam_Netrin_module_non-TIMP,pfam_A2M_N_2,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_TIMP-like_OB-fold,superfamily_A-macroglobulin_rcpt-bd,superfamily_Anaphylatoxin_comp_syst,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,prints_Anaphylatoxn_comp_syst_dom,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain	p.D1426E	ENST00000245907.6	37	c.4278	CCDS32883.1	19	.	.	.	.	.	.	.	.	.	.	G	3.408	-0.120878	0.06838	.	.	ENSG00000125730	ENST00000245907	T	0.20738	2.05	5.71	2.36	0.29203	Alpha-macroglobulin, receptor-binding (3);	0.363859	0.32488	N	0.006027	T	0.12050	0.0293	N	0.19112	0.55	0.27964	N	0.936663	B	0.17852	0.024	B	0.25506	0.061	T	0.25882	-1.0119	10	0.24483	T	0.36	.	7.2157	0.25959	0.0695:0.1236:0.6787:0.1282	.	1426	P01024	CO3_HUMAN	E	1426	ENSP00000245907:D1426E	ENSP00000245907:D1426E	D	-	3	2	C3	6633024	1.000000	0.71417	0.921000	0.36526	0.255000	0.26057	1.219000	0.32479	0.330000	0.23485	0.586000	0.80456	GAC	-	pfam_A-macroglobulin_rcpt-bd,superfamily_A-macroglobulin_rcpt-bd		0.547	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3	protein_coding	OTTHUMT00000317636.2	G	NM_000064	-		6682024	-1	no_errors	ENST00000245907	ensembl	human	known	74_37	missense	SNP	1.000	C
RINL	126432	genome.wustl.edu	37	19	39361491	39361491	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr19:39361491T>C	ENST00000591812.1	-	8	829	c.743A>G	c.(742-744)gAc>gGc	p.D248G	RINL_ENST00000598904.1_Missense_Mutation_p.D134G|RINL_ENST00000340740.3_Missense_Mutation_p.D134G|RINL_ENST00000602238.1_5'UTR|CTC-360G5.6_ENST00000593830.1_RNA			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	248	Glu-rich.				endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						TTCAGGGTCGTCCTCCCTTCC	0.632																																																	0								ENSG00000187994						80.0	73.0	75.0					19																	39361491		2203	4299	6502	RINL	SO:0001583	missense	0			-	HGNC	AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.743A>G	19.37:g.39361491T>C	ENSP00000467107:p.Asp248Gly	Somatic	0	79	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	59	74	44.03	B4DPG5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VPS9,smart_VPS9_subgr,pfscan_VPS9	p.D248G	ENST00000591812.1	37	c.743	CCDS59386.1	19	.	.	.	.	.	.	.	.	.	.	T	8.206	0.799245	0.16397	.	.	ENSG00000187994	ENST00000340740;ENST00000536520	T	0.42513	0.97	0.502	0.502	0.16932	.	3.019890	0.00832	N	0.001675	T	0.26340	0.0643	N	0.19112	0.55	0.09310	N	1	B;B	0.33073	0.396;0.396	B;B	0.26202	0.067;0.067	T	0.15263	-1.0443	9	0.27082	T	0.32	-0.2013	.	.	.	.	248;134	B4DPG5;Q6ZS11	.;RINL_HUMAN	G	134	ENSP00000340369:D134G	ENSP00000340369:D134G	D	-	2	0	RINL	44053331	0.042000	0.20092	0.054000	0.19295	0.030000	0.12068	2.551000	0.45820	0.437000	0.26423	0.260000	0.18958	GAC	-	NULL		0.632	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RINL	protein_coding	OTTHUMT00000460433.1	T	NM_198445	-		39361491	-1	no_errors	ENST00000591812	ensembl	human	known	74_37	missense	SNP	0.121	C
PCDH15	65217	genome.wustl.edu	37	10	55955488	55955488	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr10:55955488C>G	ENST00000320301.6	-	11	1654	c.1260G>C	c.(1258-1260)ttG>ttC	p.L420F	PCDH15_ENST00000373965.2_Missense_Mutation_p.L420F|PCDH15_ENST00000395430.1_Missense_Mutation_p.L420F|PCDH15_ENST00000373957.3_Missense_Mutation_p.L398F|PCDH15_ENST00000361849.3_Missense_Mutation_p.L420F|PCDH15_ENST00000395433.1_Missense_Mutation_p.L398F|PCDH15_ENST00000409834.1_Missense_Mutation_p.L24F|PCDH15_ENST00000395445.1_Missense_Mutation_p.L420F|PCDH15_ENST00000373955.1_Missense_Mutation_p.L420F|PCDH15_ENST00000395432.2_Missense_Mutation_p.L383F|PCDH15_ENST00000437009.1_Missense_Mutation_p.L420F|PCDH15_ENST00000414778.1_Missense_Mutation_p.L425F|PCDH15_ENST00000395446.1_Missense_Mutation_p.L420F|PCDH15_ENST00000395438.1_Missense_Mutation_p.L420F|PCDH15_ENST00000395440.1_Missense_Mutation_p.L420F|PCDH15_ENST00000395442.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	420	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				AAGGTGAAGTCAAATTGAGAC	0.363										HNSCC(58;0.16)																																							0								ENSG00000150275						124.0	116.0	119.0					10																	55955488		2203	4300	6503	PCDH15	SO:0001583	missense	0			-	HGNC	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1260G>C	10.37:g.55955488C>G	ENSP00000322604:p.Leu420Phe	Somatic	0	80	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	9	82.00	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L420F	ENST00000320301.6	37	c.1260	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	C	10.37	1.330140	0.24167	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395446;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.57595	0.45;0.7;0.7;0.39;0.42;0.7;0.58;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7	5.07	4.12	0.48240	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.66626	0.2808	M	0.65498	2.005	0.27584	N	0.949484	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0;0.985;1.0;0.999	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.999;0.999;0.998;0.998;1.0;0.998;0.999;1.0;0.996;0.993;0.998;1.0;0.943;1.0;0.995	T	0.56601	-0.7952	9	0.45353	T	0.12	.	7.3435	0.26650	0.0:0.771:0.0:0.229	.	398;420;420;425;420;383;420;420;420;420;420;425;420;398;420	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	F	420;425;420;420;24;420;420;420;383;420;398;398;420;420;425;420;420	ENSP00000363076:L420F;ENSP00000410304:L425F;ENSP00000378826:L420F;ENSP00000386693:L24F;ENSP00000378832:L420F;ENSP00000378833:L420F;ENSP00000378827:L420F;ENSP00000378820:L383F;ENSP00000354950:L420F;ENSP00000378821:L398F;ENSP00000363068:L398F;ENSP00000322604:L420F;ENSP00000378818:L420F;ENSP00000412628:L420F;ENSP00000363066:L420F	ENSP00000322604:L420F	L	-	3	2	PCDH15	55625494	0.999000	0.42202	0.971000	0.41717	0.094000	0.18550	0.584000	0.23864	0.980000	0.38523	0.591000	0.81541	TTG	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.363	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	protein_coding	OTTHUMT00000048121.2	C	NM_033056	-		55955488	-1	no_errors	ENST00000320301	ensembl	human	known	74_37	missense	SNP	1.000	G
COL4A3	1285	genome.wustl.edu	37	2	228148947	228148947	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr2:228148947G>A	ENST00000396578.3	+	34	2929	c.2767G>A	c.(2767-2769)Gta>Ata	p.V923I	AC097662.2_ENST00000439598.2_RNA|AC097662.2_ENST00000433324.1_RNA|AC097662.2_ENST00000396588.2_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	923	Triple-helical region.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		AATTCCAGGAGTAAAGGGCCA	0.483																																																	0								ENSG00000169031						53.0	60.0	58.0					2																	228148947		1831	4087	5918	COL4A3	SO:0001583	missense	0			-	HGNC		CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.2767G>A	2.37:g.228148947G>A	ENSP00000379823:p.Val923Ile	Somatic	0	68	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	100	14.53	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.V923I	ENST00000396578.3	37	c.2767	CCDS42829.1	2	.	.	.	.	.	.	.	.	.	.	G	9.990	1.230460	0.22542	.	.	ENSG00000169031	ENST00000396578;ENST00000328380;ENST00000335583;ENST00000396574;ENST00000315699	D	0.93307	-3.2	5.79	-3.15	0.05233	.	1.264450	0.05582	N	0.573076	T	0.81083	0.4749	N	0.03967	-0.31	0.09310	N	1	B;B;B;B	0.06786	0.001;0.001;0.001;0.001	B;B;B;B	0.12156	0.004;0.004;0.004;0.007	T	0.69738	-0.5064	10	0.23302	T	0.38	.	6.1142	0.20117	0.3896:0.3043:0.3061:0.0	.	923;923;923;923	Q01955-5;Q01955-4;Q01955-2;Q01955	.;.;.;CO4A3_HUMAN	I	923	ENSP00000379823:V923I	ENSP00000323334:V923I	V	+	1	0	COL4A3	227857191	0.000000	0.05858	0.022000	0.16811	0.410000	0.31052	-0.405000	0.07196	-0.268000	0.09312	0.655000	0.94253	GTA	-	pfam_Collagen		0.483	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A3	protein_coding	OTTHUMT00000331409.2	G	NM_000091	-		228148947	+1	no_errors	ENST00000396578	ensembl	human	known	74_37	missense	SNP	0.010	A
LRRC4	64101	genome.wustl.edu	37	7	127669285	127669285	+	Missense_Mutation	SNP	G	G	A	rs564369603		TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr7:127669285G>A	ENST00000249363.3	-	2	1666	c.1409C>T	c.(1408-1410)aCg>aTg	p.T470M	SND1_ENST00000354725.3_Intron	NM_022143.4	NP_071426.1	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4	470	Thr-rich.				postsynaptic density protein 95 clustering (GO:0097119)|regulation of synapse organization (GO:0050807)|synapse organization (GO:0050808)	cell junction (GO:0030054)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(4)|pancreas(1)|skin(2)	26				Lung(243;0.124)		GTACTTTCGCGTTGTGTCCTC	0.547																																																	0								ENSG00000128594						194.0	152.0	166.0					7																	127669285		2203	4300	6503	LRRC4	SO:0001583	missense	0			-	HGNC	AF196976	CCDS5799.1	7q31	2013-01-14	2003-11-19		ENSG00000128594	ENSG00000128594		"""Immunoglobulin superfamily / I-set domain containing"""	15586	protein-coding gene	gene with protein product		610486	"""leucine-rich repeat-containing 4"""			12969517	Standard	NM_022143		Approved	NAG14	uc003vmk.3	Q9HBW1	OTTHUMG00000157563	ENST00000249363.3:c.1409C>T	7.37:g.127669285G>A	ENSP00000249363:p.Thr470Met	Somatic	0	54	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	31	55.71	A4D0Y9|Q14DU9|Q6ZMI8|Q96A85	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T470M	ENST00000249363.3	37	c.1409	CCDS5799.1	7	.	.	.	.	.	.	.	.	.	.	G	6.644	0.487300	0.12641	.	.	ENSG00000128594	ENST00000249363	T	0.29397	1.57	4.68	3.8	0.43715	.	0.116273	0.32987	N	0.005416	T	0.16557	0.0398	N	0.12182	0.205	0.24394	N	0.994734	P	0.36110	0.537	B	0.33890	0.172	T	0.10706	-1.0618	10	0.49607	T	0.09	.	10.2112	0.43141	0.0966:0.0:0.9034:0.0	.	470	Q9HBW1	LRRC4_HUMAN	M	470	ENSP00000249363:T470M	ENSP00000249363:T470M	T	-	2	0	LRRC4	127456521	0.963000	0.33076	0.016000	0.15963	0.708000	0.40852	4.595000	0.61048	1.193000	0.43086	0.561000	0.74099	ACG	-	NULL		0.547	LRRC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC4	protein_coding	OTTHUMT00000349170.1	G	NM_022143	-		127669285	-1	no_errors	ENST00000249363	ensembl	human	known	74_37	missense	SNP	0.813	A
KIAA1210	57481	genome.wustl.edu	37	X	118284427	118284427	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chrX:118284427C>A	ENST00000402510.2	-	1	115	c.116G>T	c.(115-117)aGt>aTt	p.S39I		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	39										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						ATACGCTCGACTTCCAATCCT	0.602																																																	0								ENSG00000250423						43.0	48.0	46.0					X																	118284427		1980	4140	6120	KIAA1210	SO:0001583	missense	0			-	HGNC	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.116G>T	X.37:g.118284427C>A	ENSP00000384670:p.Ser39Ile	Somatic	0	91	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	44	50.00	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S39I	ENST00000402510.2	37	c.116	CCDS48156.1	X	.	.	.	.	.	.	.	.	.	.	C	8.951	0.968177	0.18659	.	.	ENSG00000250423	ENST00000402510	T	0.12774	2.65	3.12	1.25	0.21368	.	.	.	.	.	T	0.05593	0.0147	N	0.08118	0	0.09310	N	1	B	0.29508	0.246	B	0.20955	0.032	T	0.34204	-0.9838	9	0.87932	D	0	.	2.8115	0.05443	0.277:0.5597:0.0:0.1633	.	39	Q9ULL0	K1210_HUMAN	I	39	ENSP00000384670:S39I	ENSP00000384670:S39I	S	-	2	0	RP13-347D8.6	118168455	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.194000	0.09559	0.190000	0.20209	0.600000	0.82982	AGT	-	NULL		0.602	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	protein_coding	OTTHUMT00000371251.2	C	NM_020721	-		118284427	-1	no_errors	ENST00000402510	ensembl	human	known	74_37	missense	SNP	0.000	A
LOC401286	401286	genome.wustl.edu	37	6	168070051	168070051	+	lincRNA	SNP	G	G	C			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr6:168070051G>C	ENST00000609107.1	-	0	2037																											TGACAGTGGGGTCGGCAGAGC	0.627																																																	0								ENSG00000272549																																			RP11-351J23.2			0			-	Clone_based_vega_gene																													6.37:g.168070051G>C		Somatic	0	87	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	142	25.26		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000609107.1	37	NULL		6																																																																																			-	-		0.627	RP11-351J23.2-001	KNOWN	basic	lincRNA	LOC401286	lincRNA	OTTHUMT00000471574.1	G		-		168070051	-1	no_errors	ENST00000609107	ensembl	human	known	74_37	rna	SNP	0.000	C
NCOR1	9611	genome.wustl.edu	37	17	16004983	16004983	+	Silent	SNP	C	C	T			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr17:16004983C>T	ENST00000268712.3	-	20	2528	c.2271G>A	c.(2269-2271)acG>acA	p.T757T	NCOR1_ENST00000583226.1_5'Flank|NCOR1_ENST00000395851.1_Silent_p.T773T|RNU6-314P_ENST00000516574.1_RNA|NCOR1_ENST00000395848.1_Silent_p.T664T	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	757					CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GTGCAGTTTCCGTGGTGGGCT	0.517																																																	0								ENSG00000141027						150.0	139.0	143.0					17																	16004983		2203	4300	6503	NCOR1	SO:0001819	synonymous_variant	0			-	HGNC	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.2271G>A	17.37:g.16004983C>T		Somatic	0	141	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	79	192	29.15	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.T757	ENST00000268712.3	37	c.2271	CCDS11175.1	17																																																																																			-	NULL		0.517	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	protein_coding	OTTHUMT00000131751.5	C	NM_006311	-		16004983	-1	no_errors	ENST00000268712	ensembl	human	known	74_37	silent	SNP	0.000	T
NOP56	10528	genome.wustl.edu	37	20	2633378	2633379	+	Intron	INS	-	-	GAGCCTGGGCCT	rs71328095|rs149713688	byFrequency	TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr20:2633378_2633379insGAGCCTGGGCCT	ENST00000329276.5	+	1	519				SNORA51_ENST00000606420.1_RNA|MIR1292_ENST00000408135.1_RNA|SNORD110_ENST00000408189.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein						cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						GGCCGCAGACAgggcctgggcc	0.748														1743	0.348043	0.2655	0.3329	5008	,	,		12117	0.4038		0.325	False		,,,				2504	0.4366																0								ENSG00000101361			2444,1274		918,608,333						-1.2	0.0		dbSNP_134	7	4565,2715		1533,1499,608	no	intron	NOP56	NM_006392.3		2451,2107,941	A1A1,A1R,RR		37.294,34.2657,36.2702				7009,3989				NOP56	SO:0001627	intron_variant	0				HGNC	Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.3+69->GAGCCTGGGCCT	20.37:g.2633378_2633379insGAGCCTGGGCCT		Somatic	NA	NA	NA		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q2M3T6|Q9NQ05	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000329276.5	37	NULL	CCDS13030.1	20																																																																																			-	-		0.748	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP56	protein_coding	OTTHUMT00000077631.2	-	NM_006392			2633379	+1	no_errors	ENST00000469588	ensembl	human	known	74_37	rna	INS	0.000:0.000	GAGCCTGGGCCT
ALG13	79868	genome.wustl.edu	37	X	110996301	110996301	+	Intron	SNP	T	T	A			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chrX:110996301T>A	ENST00000394780.3	+	25	2985				ALG13_ENST00000251943.4_Intron|ALG13_ENST00000470971.1_Intron	NM_001099922.2|NM_001257231.1	NP_001093392.1|NP_001244160.1	Q9NP73	ALG13_HUMAN	ALG13, UDP-N-acetylglucosaminyltransferase subunit						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipid glycosylation (GO:0030259)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	carbohydrate binding (GO:0030246)|cysteine-type peptidase activity (GO:0008234)|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity (GO:0004577)|poly(A) RNA binding (GO:0044822)			endometrium(2)|lung(10)|skin(1)	13						AGCAGCACAATCAGCATATAT	0.343																																																	0								ENSG00000101901																																			ALG13	SO:0001627	intron_variant	0			-	HGNC	AF220051	CCDS14559.1, CCDS55477.1, CCDS59173.1, CCDS76011.1, CCDS76012.1, CCDS76013.1	Xq23	2014-02-24	2013-02-21	2006-11-07	ENSG00000101901	ENSG00000101901	2.4.1.141	"""Tudor domain containing"", ""OTU domain containing"""	30881	protein-coding gene	gene with protein product	"""tudor domain containing 13"", ""N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase"""	300776	"""glycosyltransferase 28 domain containing 1"", ""chromosome X open reading frame 45"", ""asparagine-linked glycosylation 13 homolog (S. cerevisiae)"""	GLT28D1, CXorf45		12477932	Standard	NM_018466		Approved	MDS031, YGL047W, FLJ23018, TDRD13	uc011msy.2	Q9NP73	OTTHUMG00000022209	ENST00000394780.3:c.2973+243T>A	X.37:g.110996301T>A		Somatic	0	21	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	12	47.83	B1AKD6|B1AKM1|B2R5L5|B7Z6J0|B7Z804|B7Z847|B7Z9A8|B7ZAJ1|B7ZB57|Q17RC3|Q5JXY9|Q9H5U8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000394780.3	37	NULL	CCDS55477.1	X																																																																																			-	-		0.343	ALG13-011	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ALG13	protein_coding	OTTHUMT00000272895.1	T	NM_018466	-		110996301	+1	no_errors	ENST00000474121	ensembl	human	known	74_37	rna	SNP	0.014	A
EIF4G3	8672	genome.wustl.edu	37	1	21183897	21183906	+	Splice_Site	DEL	TTAGTGATTT	TTAGTGATTT	-	rs202143636		TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	TTAGTGATTT	TTAGTGATTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr1:21183897_21183906delTTAGTGATTT	ENST00000264211.8	-	19	3355_3364	c.3161_3170delAAATCACTAA	c.(3160-3171)aaaatcactaag>ag	p.KITK1054fs	EIF4G3_ENST00000374937.3_Splice_Site_p.KITK1060fs|EIF4G3_ENST00000374935.3_Splice_Site_p.KITK774fs|EIF4G3_ENST00000400422.1_Splice_Site_p.KITK1054fs|EIF4G3_ENST00000602326.1_Splice_Site_p.KITK1060fs|EIF4G3_ENST00000537738.1_Splice_Site_p.KITK544fs|EIF4G3_ENST00000536266.1_Splice_Site_p.KITK658fs	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	1054					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		CAGACTCACCTTAGTGATTTTTAGGAATTT	0.438																																																	0								ENSG00000075151																																			EIF4G3	SO:0001630	splice_region_variant	0				HGNC	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.3171+1AAATCACTAA>-	1.37:g.21183897_21183906delTTAGTGATTT		Somatic	NA	NA	NA		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,pfam_W2_domain,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI,smart_W2_domain	p.K1060fs	ENST00000264211.8	37	c.3188_3179	CCDS214.1	1																																																																																			-	NULL		0.438	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EIF4G3	protein_coding	OTTHUMT00000007467.3	TTAGTGATTT	NM_003760		Frame_Shift_Del	21183906	-1	no_errors	ENST00000374937	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:0.999:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
TP53	7157	genome.wustl.edu	37	17	7578290	7578290	+	Splice_Site	SNP	C	C	T			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr17:7578290C>T	ENST00000269305.4	-	6	749		c.e6-1		TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(40)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGGCCAGACCTAAGAGCAAT	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	54	Unknown(40)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	upper_aerodigestive_tract(11)|lung(9)|large_intestine(6)|central_nervous_system(5)|ovary(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|liver(3)|oesophagus(2)|breast(2)|stomach(1)|genital_tract(1)|eye(1)	GRCh37	CD043957|CS011574|CS083991	TP53	D|S		ENSG00000141510						82.0	74.0	76.0					17																	7578290		2203	4300	6503	TP53	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.560-1G>A	17.37:g.7578290C>T		Somatic	0	93	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	51	14	77.27	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e5-1	ENST00000269305.4	37	c.560-1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	9.113	1.007143	0.19199	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	4.67	4.67	0.58626	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.89	0.79291	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519015	1.000000	0.71417	0.995000	0.50966	0.031000	0.12232	3.449000	0.52950	2.539000	0.85634	0.655000	0.94253	.	-	-		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	-	Intron	7578290	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site	SNP	1.000	T
ANKRD30A	91074	genome.wustl.edu	37	10	37488707	37488707	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr10:37488707G>C	ENST00000602533.1	+	30	2700	c.2601G>C	c.(2599-2601)tgG>tgC	p.W867C	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.W867C|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.W986C			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	923					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						AAAATTCTTGGGATTCTGAGG	0.299																																																	0								ENSG00000148513						86.0	77.0	80.0					10																	37488707		1786	4057	5843	ANKRD30A	SO:0001583	missense	0			-	HGNC	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2601G>C	10.37:g.37488707G>C	ENSP00000473551:p.Trp867Cys	Somatic	0	338	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	143	26	84.12	Q5W025	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.W867C	ENST00000602533.1	37	c.2601		10	.	.	.	.	.	.	.	.	.	.	g	4.263	0.047926	0.08243	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.05855	3.38;3.38	0.868	0.868	0.19090	.	.	.	.	.	T	0.02970	0.0088	N	0.22421	0.69	0.09310	N	1	P	0.50156	0.932	B	0.31337	0.128	T	0.45011	-0.9290	9	0.37606	T	0.19	.	5.1189	0.14851	0.0:0.0:1.0:0.0	.	923	Q9BXX3	AN30A_HUMAN	C	867;986	ENSP00000354432:W867C;ENSP00000363792:W986C	ENSP00000354432:W867C	W	+	3	0	ANKRD30A	37528713	0.992000	0.36948	0.003000	0.11579	0.002000	0.02628	1.526000	0.35964	0.775000	0.33450	0.162000	0.16502	TGG	-	NULL		0.299	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	protein_coding	OTTHUMT00000047588.2	G	NM_052997	-		37488707	+1	no_errors	ENST00000361713	ensembl	human	known	74_37	missense	SNP	0.004	C
CAPS2	84698	genome.wustl.edu	37	12	75676046	75676046	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr12:75676046A>T	ENST00000409445.3	-	17	1850	c.1654T>A	c.(1654-1656)Tct>Act	p.S552T	CAPS2_ENST00000393284.3_Missense_Mutation_p.S320T|CAPS2_ENST00000442339.2_Missense_Mutation_p.S142T|RP11-560G2.1_ENST00000549953.1_RNA|CAPS2_ENST00000409799.1_Missense_Mutation_p.S470T|CAPS2_ENST00000409004.1_5'UTR	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	552	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						ATTACTTGAGAATGCTTCTTT	0.279																																																	0								ENSG00000180881						101.0	106.0	105.0					12																	75676046		2203	4300	6503	CAPS2	SO:0001583	missense	0			-	HGNC	AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.1654T>A	12.37:g.75676046A>T	ENSP00000386959:p.Ser552Thr	Somatic	0	123	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	31	63.95	Q6PH84|Q8N242|Q8NAY5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_EF_hand_dom,pfscan_EF_hand_dom	p.S552T	ENST00000409445.3	37	c.1654	CCDS9008.2	12	.	.	.	.	.	.	.	.	.	.	A	15.78	2.935079	0.52866	.	.	ENSG00000180881	ENST00000409799;ENST00000409445;ENST00000378703;ENST00000393284;ENST00000442339	T;T;T;T	0.23147	1.94;1.92;1.97;1.97	5.96	5.04	0.67666	.	0.250282	0.35067	N	0.003473	T	0.16171	0.0389	N	0.08118	0	0.26352	N	0.977196	B;B;B;B;B	0.27679	0.001;0.003;0.185;0.027;0.027	B;B;B;B;B	0.32211	0.007;0.012;0.142;0.032;0.032	T	0.20472	-1.0274	10	0.56958	D	0.05	-7.4279	12.7069	0.57065	0.082:0.0:0.918:0.0	.	142;320;288;552;470	A2RRN2;Q9BXY5-2;Q9BXY5-3;Q9BXY5;B9A061	.;.;.;CAYP2_HUMAN;.	T	470;552;288;320;142	ENSP00000386977:S470T;ENSP00000386959:S552T;ENSP00000376963:S320T;ENSP00000389633:S142T	ENSP00000367975:S288T	S	-	1	0	CAPS2	73962313	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.955000	0.49121	1.449000	0.47699	0.523000	0.50628	TCT	-	NULL		0.279	CAPS2-001	KNOWN	basic|CCDS	protein_coding	CAPS2	protein_coding	OTTHUMT00000327880.2	A		-		75676046	-1	no_errors	ENST00000409445	ensembl	human	known	74_37	missense	SNP	1.000	T
COL6A1	1291	genome.wustl.edu	37	21	47421263	47421263	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr21:47421263A>G	ENST00000361866.3	+	30	2033	c.1919A>G	c.(1918-1920)aAg>aGg	p.K640R	COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	640	C-terminal globular domain.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		TTCGTCGTCAAGGTCATCGAC	0.652																																																	0								ENSG00000142156						119.0	119.0	119.0					21																	47421263		2203	4300	6503	COL6A1	SO:0001583	missense	0			-	HGNC	M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.1919A>G	21.37:g.47421263A>G	ENSP00000355180:p.Lys640Arg	Somatic	0	79	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	49	57	46.23	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.K640R	ENST00000361866.3	37	c.1919	CCDS13727.1	21	.	.	.	.	.	.	.	.	.	.	A	15.95	2.985337	0.53934	.	.	ENSG00000142156	ENST00000361866	D	0.83591	-1.74	5.2	4.05	0.47172	von Willebrand factor, type A (3);	0.136669	0.49305	D	0.000152	T	0.73900	0.3646	L	0.35487	1.065	0.43408	D	0.995546	P	0.34934	0.476	B	0.36378	0.223	T	0.67883	-0.5555	10	0.28530	T	0.3	-22.3611	10.8129	0.46557	0.925:0.0:0.075:0.0	.	640	P12109	CO6A1_HUMAN	R	640	ENSP00000355180:K640R	ENSP00000355180:K640R	K	+	2	0	COL6A1	46245691	1.000000	0.71417	1.000000	0.80357	0.187000	0.23431	3.875000	0.56108	0.831000	0.34780	-0.404000	0.06349	AAG	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.652	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A1	protein_coding	OTTHUMT00000206877.1	A	NM_001848	-		47421263	+1	no_errors	ENST00000361866	ensembl	human	known	74_37	missense	SNP	1.000	G
AP3B2	8120	genome.wustl.edu	37	15	83380050	83380050	+	5'Flank	SNP	G	G	C			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr15:83380050G>C	ENST00000261722.3	-	0	0				AP3B2_ENST00000535348.1_5'Flank|AP3B2_ENST00000561455.1_5'Flank|AP3B2_ENST00000535359.1_5'Flank|AP3B2_ENST00000542200.1_5'Flank|AC105339.1_ENST00000440479.1_lincRNA	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit						anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			TGGTGGGTCCGCGTCCGTCGC	0.637																																																	0								ENSG00000228141																																			AC105339.1	SO:0001631	upstream_gene_variant	0			-	Clone_based_vega_gene	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009		15.37:g.83380050G>C	Exception_encountered	Somatic	0	61	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	59	40	59.00	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000261722.3	37	NULL	CCDS45331.1	15																																																																																			-	-		0.637	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC338963	protein_coding	OTTHUMT00000397463.1	G		-		83380050	-1	no_errors	ENST00000440089	ensembl	human	known	74_37	rna	SNP	0.000	C
KCNG4	93107	genome.wustl.edu	37	16	84270722	84270722	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr16:84270722C>T	ENST00000308251.4	-	2	438	c.370G>A	c.(370-372)Gtg>Atg	p.V124M	KCNG4_ENST00000568181.1_Missense_Mutation_p.V124M	NM_172347.2	NP_758857.1	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G, member 4	124					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	31						AGGAAGCTCACGATCACCCCG	0.632																																																	0								ENSG00000168418						50.0	53.0	52.0					16																	84270722		2200	4300	6500	KCNG4	SO:0001583	missense	0			-	HGNC	AF348984	CCDS10945.1	16q24.1	2011-07-05			ENSG00000168418	ENSG00000168418		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19697	protein-coding gene	gene with protein product		607603				12060745, 16382104	Standard	NM_172347		Approved	Kv6.4	uc010voc.2	Q8TDN1	OTTHUMG00000137638	ENST00000308251.4:c.370G>A	16.37:g.84270722C>T	ENSP00000312129:p.Val124Met	Somatic	0	119	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	79	11	87.78	Q96H24	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.V124M	ENST00000308251.4	37	c.370	CCDS10945.1	16	.	.	.	.	.	.	.	.	.	.	C	14.36	2.511800	0.44660	.	.	ENSG00000168418	ENST00000308251	T	0.76316	-1.01	5.12	5.12	0.69794	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.196102	0.44285	D	0.000461	T	0.64000	0.2559	N	0.12663	0.25	0.34433	D	0.698795	P;P	0.47034	0.638;0.889	B;B	0.39876	0.312;0.236	T	0.76440	-0.2958	10	0.52906	T	0.07	.	17.5478	0.87867	0.0:1.0:0.0:0.0	.	124;124	Q8TDN1;Q8TDN1-2	KCNG4_HUMAN;.	M	124	ENSP00000312129:V124M	ENSP00000312129:V124M	V	-	1	0	KCNG4	82828223	1.000000	0.71417	0.983000	0.44433	0.991000	0.79684	2.297000	0.43593	2.374000	0.81015	0.549000	0.68633	GTG	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,prints_K_chnl,prints_K_chnl_volt-dep_Kv3		0.632	KCNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNG4	protein_coding	OTTHUMT00000269079.2	C	NM_172347	-		84270722	-1	no_errors	ENST00000308251	ensembl	human	known	74_37	missense	SNP	1.000	T
CAPNS1	826	genome.wustl.edu	37	19	36632024	36632025	+	In_Frame_Ins	INS	-	-	GGC	rs550053789|rs536693322	byFrequency	TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr19:36632024_36632025insGGC	ENST00000246533.3	+	2	709_710	c.111_112insGGC	c.(112-114)ggc>GGCggc	p.38_38G>GG	CAPNS1_ENST00000588780.1_In_Frame_Ins_p.38_38G>GG|CAPNS1_ENST00000587718.1_In_Frame_Ins_p.38_38G>GG|AD001527.7_ENST00000604228.1_RNA|CAPNS1_ENST00000589146.1_Intron|CAPNS1_ENST00000590874.1_In_Frame_Ins_p.38_38G>GG|CAPNS1_ENST00000588815.1_In_Frame_Ins_p.38_38G>GG	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1	38	Gly-rich (hydrophobic).|Poly-Gly.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GCGGGGCcgggggcggcggcgg	0.752														26	0.00519169	0.0023	0.0058	5008	,	,		4221	0.0		0.0169	False		,,,				2504	0.002				Esophageal Squamous(129;1541 1691 5780 18353 34150)												0								ENSG00000126247																																			CAPNS1	SO:0001652	inframe_insertion	0				HGNC	X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.139_141dupGGC	19.37:g.36632031_36632033dupGGC	ENSP00000246533:p.Gly56dup	Somatic	0	38	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	A8K0P1|Q8WTX3|Q96EW0	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfscan_EF_hand_dom	p.41in_frame_insG	ENST00000246533.3	37	c.111_112	CCDS12489.1	19																																																																																			-	NULL		0.752	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPNS1	protein_coding	OTTHUMT00000457411.2	-				36632025	+1	no_errors	ENST00000588780	ensembl	human	known	74_37	in_frame_ins	INS	0.001:0.907	GGC
KREMEN2	79412	genome.wustl.edu	37	16	3016141	3016141	+	Splice_Site	SNP	T	T	C			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr16:3016141T>C	ENST00000303746.5	+	3	847	c.270T>C	c.(268-270)cgT>cgC	p.R90R	KREMEN2_ENST00000575769.1_Splice_Site_p.R90R|PKMYT1_ENST00000571102.1_5'Flank|KREMEN2_ENST00000571007.1_Splice_Site_p.R90R|KREMEN2_ENST00000572045.1_Splice_Site_p.R90R|KREMEN2_ENST00000575885.1_Splice_Site_p.R90R|KREMEN2_ENST00000319500.6_Splice_Site_p.R90R			Q8NCW0	KREM2_HUMAN	kringle containing transmembrane protein 2	90	Kringle. {ECO:0000255|PROSITE- ProRule:PRU00121}.				Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|large_intestine(1)	4						CCACCCGCAGTAACCCAGACG	0.632																																																	0								ENSG00000131650						56.0	54.0	55.0					16																	3016141		2198	4299	6497	KREMEN2	SO:0001630	splice_region_variant	0			-	HGNC	BC003533	CCDS10483.1, CCDS10484.1, CCDS58412.1, CCDS58413.1	16p13.11	2008-08-04			ENSG00000131650	ENSG00000131650			18797	protein-coding gene	gene with protein product		609899				12050670	Standard	NM_172229		Approved	MGC10791, KRM2	uc002csg.3	Q8NCW0	OTTHUMG00000128976	ENST00000303746.5:c.270-1T>C	16.37:g.3016141T>C		Somatic	0	60	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	60	22.08	B4DXF6|I3L2S2|Q8N2J4|Q8NCW1|Q96GL8|Q9BTP9	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Kremen,pfam_WSC_carb-bd,pfam_Kringle,pfam_CUB_dom,superfamily_Kringle-like,superfamily_CUB_dom,smart_Kringle,smart_WSC_carb-bd_subgr,smart_CUB_dom,pfscan_CUB_dom,pfscan_Kringle,pfscan_WSC_carb-bd	p.R90	ENST00000303746.5	37	c.270	CCDS10483.1	16																																																																																			-	pirsf_Kremen,pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle		0.632	KREMEN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KREMEN2	protein_coding	OTTHUMT00000250964.2	T	NM_145347	-	Silent	3016141	+1	no_errors	ENST00000303746	ensembl	human	known	74_37	silent	SNP	1.000	C
THOC3	84321	genome.wustl.edu	37	5	175394547	175394548	+	Intron	INS	-	-	ACC	rs149268298|rs77670472|rs370589548		TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr5:175394547_175394548insACC	ENST00000265097.4	-	2	358				THOC3_ENST00000513482.1_Intron|THOC3_ENST00000514861.1_Intron|THOC3_ENST00000510300.1_5'UTR	NM_032361.2	NP_115737.1	Q96J01	THOC3_HUMAN	THO complex 3						mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(2)	4	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		accaccaacgtaccaccaccaa	0.55																																																	0								ENSG00000051596																																			THOC3	SO:0001627	intron_variant	0				HGNC	BC006849	CCDS4397.1	5q35.3	2013-02-11			ENSG00000051596	ENSG00000051596		"""WD repeat domain containing"", ""THO complex subunits"""	19072	protein-coding gene	gene with protein product		606929				11979277	Standard	NM_032361		Approved	TEX1, MGC5469	uc003mdg.5	Q96J01	OTTHUMG00000130658	ENST00000265097.4:c.268-277->GGT	5.37:g.175394554_175394556dupACC		Somatic	0	22	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	27	20.59	Q6NZ53	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000265097.4	37	NULL	CCDS4397.1	5																																																																																			-	-		0.550	THOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC3	protein_coding	OTTHUMT00000253148.1	-				175394548	-1	no_errors	ENST00000510300	ensembl	human	known	74_37	rna	INS	0.000:0.000	ACC
C1orf143	440714	genome.wustl.edu	37	1	218699060	218699061	+	3'UTR	DEL	AA	AA	-	rs76580018		TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr1:218699060_218699061delAA	ENST00000443836.1	+	0	502_503				C1orf143_ENST00000491260.1_3'UTR					chromosome 1 open reading frame 143																		CTGACACTTTaaaaaaaaaaaa	0.356																																																	0								ENSG00000228208																																			C1orf143	SO:0001624	3_prime_UTR_variant	0				HGNC			1q41	2013-03-14			ENSG00000228208	ENSG00000228208			32045	other	unknown							Standard			Approved				OTTHUMG00000039569	ENST00000443836.1:c.*191AA>-	1.37:g.218699070_218699071delAA		Somatic	0	29	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000443836.1	37	NULL		1																																																																																			-	-		0.356	C1orf143-001	PUTATIVE	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	C1orf143	protein_coding	OTTHUMT00000095456.2	AA				218699061	+1	no_errors	ENST00000491260	ensembl	human	putative	74_37	rna	DEL	0.028:0.000	-
MGAM2	93432	genome.wustl.edu	37	7	141859096	141859096	+	Missense_Mutation	SNP	G	G	A	rs559963400		TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr7:141859096G>A	ENST00000477922.3	+	20	2227	c.2173G>A	c.(2173-2175)Gaa>Aaa	p.E725K																	endometrium(1)|lung(5)	6						GGGTGTGGACGAAGTGAAAGC	0.463													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20334	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000257743																																			RP11-1220K2.2	SO:0001583	missense	0			-	Clone_based_vega_gene																												ENST00000477922.3:c.2173G>A	7.37:g.141859096G>A	ENSP00000420449:p.Glu725Lys	Somatic	0	80	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	61	63	49.19		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,superfamily_P_trefoil,smart_P_trefoil	p.E725K	ENST00000477922.3	37	c.2173		7	.	.	.	.	.	.	.	.	.	.	G	8.028	0.761121	0.15914	.	.	ENSG00000257743	ENST00000477922	.	.	.	5.45	0.113	0.14631	.	.	.	.	.	T	0.19046	0.0457	.	.	.	.	.	.	.	.	.	.	.	.	T	0.32613	-0.9900	4	0.10636	T	0.68	.	4.143	0.10203	0.2812:0.3147:0.3307:0.0734	.	.	.	.	K	725	.	ENSP00000420449:E725K	E	+	1	0	RP11-1220K2.2	141505565	0.000000	0.05858	0.000000	0.03702	0.128000	0.20619	0.342000	0.19926	0.097000	0.17492	-0.344000	0.07964	GAA	-	pfam_Glyco_hydro_31		0.463	RP11-1220K2.2-003	PUTATIVE	not_best_in_genome_evidence|basic|appris_principal|exp_conf	protein_coding	ENSG00000257743	protein_coding	OTTHUMT00000351325.3	G		-		141859096	+1	no_errors	ENST00000477922	ensembl	human	putative	74_37	missense	SNP	0.000	A
TEK	7010	genome.wustl.edu	37	9	27158026	27158026	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr9:27158026delA	ENST00000380036.4	+	2	692	c.250delA	c.(250-252)aaafs	p.K85fs	TEK_ENST00000406359.4_Frame_Shift_Del_p.K85fs|TEK_ENST00000519097.1_Intron	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	85	Ig-like C2-type 1.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	AGAATGGGCTAAAAAAGTTGT	0.468																																																	0								ENSG00000120156						98.0	99.0	99.0					9																	27158026		2203	4300	6503	TEK	SO:0001589	frameshift_variant	0				HGNC	L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.250delA	9.37:g.27158026delA	ENSP00000369375:p.Lys85fs	Somatic	0	147	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	136	20.47	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Tyr_kin_Tie2_Ig-like_dom-1_N,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V86fs	ENST00000380036.4	37	c.250	CCDS6519.1	9																																																																																			-	pfam_Tyr_kin_Tie2_Ig-like_dom-1_N		0.468	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEK	protein_coding	OTTHUMT00000051965.3	A				27158026	+1	no_errors	ENST00000380036	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
MBNL1	4154	genome.wustl.edu	37	3	152016827	152016827	+	Intron	SNP	G	G	C			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr3:152016827G>C	ENST00000282486.6	+	2	1053				MBNL1_ENST00000324196.5_5'Flank|MBNL1_ENST00000357472.3_5'Flank|MBNL1_ENST00000324210.5_Intron|MBNL1_ENST00000545754.1_5'Flank|MBNL1_ENST00000461436.1_Intron|MBNL1_ENST00000463374.1_5'Flank|MBNL1_ENST00000485509.1_5'Flank|MBNL1_ENST00000282488.7_Intron|MBNL1_ENST00000485910.1_5'Flank|MBNL1_ENST00000492948.1_5'Flank|MBNL1_ENST00000355460.2_Intron|MBNL1_ENST00000498502.1_5'Flank|MBNL1_ENST00000493459.1_Intron			Q9NR56	MBNL1_HUMAN	muscleblind-like splicing regulator 1						alternative mRNA splicing, via spliceosome (GO:0000380)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|mRNA splice site selection (GO:0006376)|myoblast differentiation (GO:0045445)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|skeletal muscle tissue development (GO:0007519)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			AGTGGAATAAGTCACATCTGA	0.433																																																	0								ENSG00000152601																																			MBNL1	SO:0001627	intron_variant	0			-	HGNC	Y13829	CCDS3163.1, CCDS3164.1, CCDS3165.1, CCDS3166.1, CCDS3167.1, CCDS3168.1, CCDS54656.1	3q25	2013-01-18	2012-02-23	2003-03-14	ENSG00000152601	ENSG00000152601		"""Zinc fingers, CCCH-type domain containing"""	6923	protein-coding gene	gene with protein product		606516	"""muscleblind (Drosophila)-like"", ""muscleblind-like (Drosophila)"""	MBNL			Standard	NM_021038		Approved	KIAA0428, EXP42, EXP40, EXP35, EXP	uc003ezm.3	Q9NR56	OTTHUMG00000159163	ENST00000282486.6:c.-789-367G>C	3.37:g.152016827G>C		Somatic	0	35	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	23	57.41	E9PBW7|O43311|O43797|Q86UV8|Q86UV9|Q96P92|Q96RE3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000282486.6	37	NULL	CCDS3165.1	3																																																																																			-	-		0.433	MBNL1-201	KNOWN	basic|CCDS	protein_coding	MBNL1	protein_coding		G	NM_021038	-		152016827	+1	no_errors	ENST00000466565	ensembl	human	putative	74_37	rna	SNP	1.000	C
PRKCE	5581	genome.wustl.edu	37	2	46378274	46378300	+	In_Frame_Del	DEL	CCGACAATGAGGACGACCTATTTGAGT	CCGACAATGAGGACGACCTATTTGAGT	-	rs369510461		TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	CCGACAATGAGGACGACCTATTTGAGT	CCGACAATGAGGACGACCTATTTGAGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr2:46378274_46378300delCCGACAATGAGGACGACCTATTTGAGT	ENST00000306156.3	+	13	2153_2179	c.1826_1852delCCGACAATGAGGACGACCTATTTGAGT	c.(1825-1854)gccgacaatgaggacgacctatttgagtcc>gcc	p.DNEDDLFES610del		NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	610	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)	p.N611N(1)	MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	CCCTTTGAGGCCGACAATGAGGACGACCTATTTGAGTCCATCCTCCA	0.581																																																	1	Substitution - coding silent(1)	kidney(1)						ENSG00000171132																																			PRKCE	SO:0001651	inframe_deletion	0				HGNC		CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.1826_1852delCCGACAATGAGGACGACCTATTTGAGT	2.37:g.46378274_46378300delCCGACAATGAGGACGACCTATTTGAGT	ENSP00000306124:p.Asp610_Ser618del	Somatic	NA	NA	NA		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.DNEDDLFES610in_frame_del	ENST00000306156.3	37	c.1826_1852	CCDS1824.1	2																																																																																			-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Prot_kin_PKC_delta,pfscan_Prot_kinase_dom		0.581	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCE	protein_coding	OTTHUMT00000250751.2	CCGACAATGAGGACGACCTATTTGAGT				46378300	+1	no_errors	ENST00000306156	ensembl	human	known	74_37	in_frame_del	DEL	1.000:0.054:1.000:1.000:1.000:1.000:1.000:0.814:1.000:1.000:1.000:1.000:1.000:0.979:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
EQTN	54586	genome.wustl.edu	37	9	27294315	27294315	+	Splice_Site	SNP	G	G	A	rs149742821		TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr9:27294315G>A	ENST00000380032.3	-	3	371	c.288C>T	c.(286-288)aaC>aaT	p.N96N	EQTN_ENST00000380031.1_Splice_Site_p.N96N|EQTN_ENST00000537675.1_Splice_Site_p.N96N|EQTN_ENST00000484994.1_5'UTR	NM_020641.2	NP_065692.2	Q9NQ60	EQTN_HUMAN	equatorin, sperm acrosome associated	96					acrosomal vesicle exocytosis (GO:0060478)|endocytosis (GO:0006897)|fusion of sperm to egg plasma membrane (GO:0007342)	early endosome (GO:0005769)|inner acrosomal membrane (GO:0002079)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|outer acrosomal membrane (GO:0002081)|plasma membrane (GO:0005886)		p.N96N(1)									ACTTCTTACCGTTTTTTAGAG	0.393																																																	1	Substitution - coding silent(1)	endometrium(1)						ENSG00000120160	G	,	0,4404		0,0,2202	149.0	123.0	132.0		288,288	1.7	0.5	9	dbSNP_134	132	1,8599	1.2+/-3.3	0,1,4299	yes	coding-synonymous-near-splice,coding-synonymous-near-splice	C9orf11	NM_001161585.1,NM_020641.2	,	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	,	96/266,96/295	27294315	1,13003	2202	4300	6502	EQTN	SO:0001630	splice_region_variant	0			-	HGNC	AJ278482	CCDS35001.1, CCDS55300.1	9p21	2012-09-20	2012-09-20	2012-09-20	ENSG00000120160	ENSG00000120160			1359	protein-coding gene	gene with protein product	"""Acr formation associated factor"", ""Acrosome formation associated factor"", ""sperm acrosome associated 8"""		"""chromosome 9 open reading frame 11"", ""equatorin"""	C9orf11			Standard	NM_020641		Approved	AFAF, SPACA8, equatorin	uc003zql.3	Q9NQ60	OTTHUMG00000021033	ENST00000380032.3:c.289+1C>T	9.37:g.27294315G>A		Somatic	0	190	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	51	166	23.39	B2RPB3|B7ZMK1|Q5TCU1|Q96L22	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.N96	ENST00000380032.3	37	c.288	CCDS35001.1	9																																																																																			-	NULL		0.393	EQTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EQTN	protein_coding	OTTHUMT00000055499.1	G	NM_020641	rs149742821	Silent	27294315	-1	no_errors	ENST00000380032	ensembl	human	known	74_37	silent	SNP	0.558	A
MYLK	4638	genome.wustl.edu	37	3	123368043	123368044	+	Splice_Site	INS	-	-	G	rs41431347|rs200371896	byFrequency	TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr3:123368043_123368044insG	ENST00000475616.1	-	22	4288		c.e22-2		MYLK_ENST00000360304.3_Splice_Site|MYLK_ENST00000346322.5_Splice_Site|MYLK_ENST00000359169.1_Splice_Site|MYLK_ENST00000354792.5_Splice_Site|MYLK_ENST00000360772.3_Splice_Site			Q15746	MYLK_HUMAN	myosin light chain kinase						actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		CCTTCGGCTCTGGGGGGGGCAC	0.624													?|GGGGGGGG|GGGGGGGGG|unsure	129	0.0257588	0.034	0.0303	5008	,	,		18148	0.0089		0.0348	False		,,,				2504	0.0194																0								ENSG00000065534																																			MYLK	SO:0001630	splice_region_variant	0				HGNC	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.4289-2->C	3.37:g.123368051_123368051dupG		Somatic	0	42	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	34	8.11	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e22-2	ENST00000475616.1	37	c.4289-3_4289-2	CCDS46896.1	3																																																																																			-	-		0.624	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYLK	protein_coding	OTTHUMT00000356464.1	-	NM_053025		Intron	123368044	-1	no_errors	ENST00000360304	ensembl	human	known	74_37	splice_site_ins	INS	0.975:0.100	G
CHD6	84181	genome.wustl.edu	37	20	40033612	40033612	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr20:40033612G>C	ENST00000373233.3	-	37	7946	c.7769C>G	c.(7768-7770)cCa>cGa	p.P2590R	CHD6_ENST00000480022.1_5'UTR	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2590					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				AAATGGACCTGGACCAGGCTT	0.463																																																	0								ENSG00000124177						152.0	155.0	154.0					20																	40033612		2203	4300	6503	CHD6	SO:0001583	missense	0			-	HGNC	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.7769C>G	20.37:g.40033612G>C	ENSP00000362330:p.Pro2590Arg	Somatic	0	124	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	130	21.21	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_BRK_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.P2590R	ENST00000373233.3	37	c.7769	CCDS13317.1	20	.	.	.	.	.	.	.	.	.	.	G	15.58	2.876214	0.51801	.	.	ENSG00000124177	ENST00000373233	D	0.85411	-1.98	5.46	4.5	0.54988	.	0.104499	0.43260	D	0.000592	D	0.82967	0.5152	L	0.53249	1.67	0.80722	D	1	B	0.12630	0.006	B	0.10450	0.005	T	0.80372	-0.1410	10	0.59425	D	0.04	-3.3385	16.3687	0.83346	0.0:0.1318:0.8682:0.0	.	2590	Q8TD26	CHD6_HUMAN	R	2590	ENSP00000362330:P2590R	ENSP00000362330:P2590R	P	-	2	0	CHD6	39467026	.	.	0.767000	0.31495	0.980000	0.70556	.	.	1.517000	0.48917	0.655000	0.94253	CCA	-	NULL		0.463	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD6	protein_coding	OTTHUMT00000079270.1	G		-		40033612	-1	no_errors	ENST00000373233	ensembl	human	known	74_37	missense	SNP	1.000	C
LAMB3	3914	genome.wustl.edu	37	1	209791807	209791807	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr1:209791807C>T	ENST00000356082.4	-	19	3033	c.2899G>A	c.(2899-2901)Gag>Aag	p.E967K	LAMB3_ENST00000367030.3_Missense_Mutation_p.E967K|LAMB3_ENST00000391911.1_Missense_Mutation_p.E967K	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	967	Domain I.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		CTGGCTTCCTCAGCCTCAGCC	0.617																																																	0								ENSG00000196878						48.0	50.0	49.0					1																	209791807		2203	4300	6503	LAMB3	SO:0001583	missense	0			-	HGNC	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.2899G>A	1.37:g.209791807C>T	ENSP00000348384:p.Glu967Lys	Somatic	0	75	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	63	30.77	D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_EGF_laminin,pfscan_Laminin_N	p.E967K	ENST00000356082.4	37	c.2899	CCDS1487.1	1	.	.	.	.	.	.	.	.	.	.	C	19.17	3.775167	0.70107	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030;ENST00000455193	T;T;T;T	0.21543	2.0;2.0;2.0;2.06	5.01	5.01	0.66863	.	0.057193	0.64402	D	0.000001	T	0.35098	0.0920	L	0.36672	1.1	0.42647	D	0.993436	D	0.76494	0.999	D	0.80764	0.994	T	0.04708	-1.0932	10	0.14252	T	0.57	.	17.9765	0.89129	0.0:1.0:0.0:0.0	.	967	Q13751	LAMB3_HUMAN	K	967;967;967;36	ENSP00000375778:E967K;ENSP00000348384:E967K;ENSP00000355997:E967K;ENSP00000398683:E36K	ENSP00000348384:E967K	E	-	1	0	LAMB3	207858430	0.991000	0.36638	0.987000	0.45799	0.639000	0.38242	2.663000	0.46774	2.344000	0.79699	0.555000	0.69702	GAG	-	NULL		0.617	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB3	protein_coding	OTTHUMT00000088525.2	C	NM_000228	-		209791807	-1	no_errors	ENST00000356082	ensembl	human	known	74_37	missense	SNP	0.971	T
OR9A4	130075	genome.wustl.edu	37	7	141618923	141618923	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr7:141618923G>T	ENST00000548136.1	+	1	307	c.248G>T	c.(247-249)gGa>gTa	p.G83V	MGAM_ENST00000497554.1_Intron	NM_001001656.1	NP_001001656.1	Q8NGU2	OR9A4_HUMAN	olfactory receptor, family 9, subfamily A, member 4	83						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|large_intestine(9)|lung(7)|prostate(1)|skin(2)	22	Melanoma(164;0.0171)					ATGCTTTGGGGATTGCTGCTC	0.517																																																	0								ENSG00000258083						112.0	114.0	113.0					7																	141618923		2203	4300	6503	OR9A4	SO:0001583	missense	0			-	HGNC		CCDS43661.1	7q34	2012-10-03			ENSG00000258083	ENSG00000258083		"""GPCR / Class A : Olfactory receptors"""	15095	protein-coding gene	gene with protein product							Standard	NM_001001656		Approved		uc003vwu.1	Q8NGU2	OTTHUMG00000158370	ENST00000548136.1:c.248G>T	7.37:g.141618923G>T	ENSP00000448789:p.Gly83Val	Somatic	0	137	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	78	121	39.20	B9EGV6|Q6IFI4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G83V	ENST00000548136.1	37	c.248	CCDS43661.1	7	.	.	.	.	.	.	.	.	.	.	.	10.08	1.251556	0.22880	.	.	ENSG00000258083	ENST00000548136	T	0.00882	5.58	3.8	3.8	0.43715	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01156	0.0038	L	0.37850	1.14	0.09310	N	0.999993	B	0.22800	0.075	B	0.23018	0.043	T	0.43442	-0.9391	9	0.87932	D	0	-3.9628	8.9047	0.35517	0.0:0.0:0.7774:0.2226	.	83	Q8NGU2	OR9A4_HUMAN	V	83	ENSP00000448789:G83V	ENSP00000386148:G83V	G	+	2	0	OR9A4	141265392	0.000000	0.05858	0.870000	0.34147	0.130000	0.20726	-0.288000	0.08377	2.121000	0.65114	0.655000	0.94253	GGA	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.517	OR9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR9A4	protein_coding	OTTHUMT00000350806.3	G	NM_001001656	-		141618923	+1	no_errors	ENST00000548136	ensembl	human	known	74_37	missense	SNP	0.000	T
LCAT	3931	genome.wustl.edu	37	16	67978141	67978141	+	5'Flank	SNP	G	G	A			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr16:67978141G>A	ENST00000264005.5	-	0	0				SLC12A4_ENST00000422611.2_3'UTR|CTC-479C5.17_ENST00000590594.1_lincRNA	NM_000229.1	NP_000220.1	P04180	LCAT_HUMAN	lecithin-cholesterol acyltransferase						cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of high-density lipoprotein particle assembly (GO:0090107)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)	apolipoprotein A-I binding (GO:0034186)|phosphatidylcholine-sterol O-acyltransferase activity (GO:0004607)			cervix(4)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)	16		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00418)|Epithelial(162;0.0183)|all cancers(182;0.12)		CCGGAAAGGGGCACAGCCTCA	0.667																																																	0								ENSG00000267660																																			CTC-479C5.17	SO:0001631	upstream_gene_variant	0			-	Clone_based_vega_gene		CCDS10854.1	16q22.1	2012-10-02			ENSG00000213398	ENSG00000213398	2.3.1.43		6522	protein-coding gene	gene with protein product		606967					Standard	NM_000229		Approved		uc002euy.1	P04180	OTTHUMG00000137551		16.37:g.67978141G>A	Exception_encountered	Somatic	0	47	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	5	87.50	Q53XQ3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000264005.5	37	NULL	CCDS10854.1	16																																																																																			-	-		0.667	LCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267660	protein_coding	OTTHUMT00000268885.3	G		-		67978141	-1	no_errors	ENST00000590594	ensembl	human	known	74_37	rna	SNP	0.083	A
CYP4F2	8529	genome.wustl.edu	37	19	16003201	16003201	+	Missense_Mutation	SNP	C	C	T	rs371325087		TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr19:16003201C>T	ENST00000221700.6	-	5	538	c.443G>A	c.(442-444)cGt>cAt	p.R148H	CYP4F2_ENST00000011989.7_5'UTR	NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2											NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CAGCATCCGACGGTGGCGGCT	0.567																																																	0								ENSG00000186115	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	90.0	90.0	90.0		443	2.7	0.9	19		90	0,8600		0,0,4300	no	missense	CYP4F2	NM_001082.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	148/521	16003201	1,13005	2203	4300	6503	CYP4F2	SO:0001583	missense	0			-	HGNC	U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.443G>A	19.37:g.16003201C>T	ENSP00000221700:p.Arg148His	Somatic	0	137	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	70	197	26.22		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.R148H	ENST00000221700.6	37	c.443	CCDS12336.1	19	.	.	.	.	.	.	.	.	.	.	c	16.22	3.060572	0.55432	2.27E-4	0.0	ENSG00000186115	ENST00000221700	D	0.85629	-2.01	2.7	2.7	0.31948	.	0.000000	0.64402	U	0.000012	D	0.94499	0.8229	H	0.98594	4.275	0.80722	D	1	D	0.76494	0.999	D	0.68765	0.96	D	0.95131	0.8255	10	0.87932	D	0	.	11.1194	0.48279	0.0:1.0:0.0:0.0	.	148	P78329	CP4F2_HUMAN	H	148	ENSP00000221700:R148H	ENSP00000221700:R148H	R	-	2	0	CYP4F2	15864201	1.000000	0.71417	0.918000	0.36340	0.401000	0.30781	6.048000	0.71046	1.486000	0.48398	0.289000	0.19496	CGT	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-II		0.567	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4F2	protein_coding	OTTHUMT00000460372.3	C	NM_001082	-		16003201	-1	no_errors	ENST00000221700	ensembl	human	known	74_37	missense	SNP	0.996	T
WDR87	83889	genome.wustl.edu	37	19	38379228	38379228	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr19:38379228C>T	ENST00000303868.5	-	6	5190	c.4966G>A	c.(4966-4968)Gag>Aag	p.E1656K	WDR87_ENST00000447313.2_Missense_Mutation_p.E1695K	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1656	Glu-rich.									NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						GCCAATTTCTCCGCCTCCTGG	0.502																																																	0								ENSG00000171804						106.0	80.0	88.0					19																	38379228		692	1591	2283	WDR87	SO:0001583	missense	0			-	HGNC	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.4966G>A	19.37:g.38379228C>T	ENSP00000368025:p.Glu1656Lys	Somatic	1	154	0.65		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	75	97	43.60	Q9BWV9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E1695K	ENST00000303868.5	37	c.5083	CCDS46063.1	19	.	.	.	.	.	.	.	.	.	.	C	12.92	2.082210	0.36758	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.24151	1.87;1.87	5.07	-0.0209	0.13954	.	.	.	.	.	T	0.12689	0.0308	N	0.19112	0.55	0.09310	N	1	B;B	0.26363	0.147;0.147	B;B	0.23150	0.044;0.044	T	0.35226	-0.9797	9	0.09843	T	0.71	.	8.0303	0.30461	0.0:0.5779:0.0:0.4221	.	1656;1695	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	K	1695;1656	ENSP00000405012:E1695K;ENSP00000368025:E1656K	ENSP00000368025:E1656K	E	-	1	0	WDR87	43071068	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.096000	0.11059	0.259000	0.21709	-0.417000	0.06048	GAG	-	superfamily_ARM-type_fold		0.502	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	protein_coding	OTTHUMT00000314628.2	C	XM_940478	-		38379228	-1	no_errors	ENST00000447313	ensembl	human	known	74_37	missense	SNP	0.000	T
BPTF	2186	genome.wustl.edu	37	17	65822267	65822269	+	In_Frame_Del	DEL	GAG	GAG	-	rs369989246		TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr17:65822267_65822269delGAG	ENST00000321892.4	+	1	488_490	c.427_429delGAG	c.(427-429)gagdel	p.E148del	BPTF_ENST00000306378.6_In_Frame_Del_p.E148del|BPTF_ENST00000424123.3_In_Frame_Del_p.E9del|BPTF_ENST00000335221.5_In_Frame_Del_p.E148del			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	148	Glu-rich.				anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.E143*(2)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			catggtctccgaggaggaggagg	0.635																																																	2	Substitution - Nonsense(2)	lung(2)						ENSG00000171634		,	0,111,0,4153		0,0,0,0,1,0,109,0,0,2022					,	-1.8	0.4			44	2,249,3,8000		0,0,0,2,5,0,239,0,3,3878	no	codingComplex,codingComplex	BPTF	NM_182641.3,NM_004459.6	,	0,0,0,2,6,0,348,0,3,5900	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		3.0773,2.6032,2.9158	,	,		2,360,3,12153				BPTF	SO:0001651	inframe_deletion	0				HGNC	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.427_429delGAG	17.37:g.65822276_65822278delGAG	ENSP00000315454:p.Glu148del	Somatic	0	17	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	20	9.09	Q6NX67|Q7Z7D6|Q9UIG2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.E146in_frame_del	ENST00000321892.4	37	c.427_429		17																																																																																			-	NULL		0.635	BPTF-201	KNOWN	basic	protein_coding	BPTF	protein_coding		GAG	NM_182641, NM_004459			65822269	+1	no_errors	ENST00000321892	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
SIX5	147912	genome.wustl.edu	37	19	46265047	46265048	+	IGR	INS	-	-	TCCAGC	rs139434566|rs59054027		TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr19:46265047_46265048insTCCAGC	ENST00000317578.6	-	0	3318				AC074212.5_ENST00000559756.1_RNA|AC074212.3_ENST00000457052.2_In_Frame_Ins_p.453_453S>SSS	NM_175875.4	NP_787071	Q8N196	SIX5_HUMAN	SIX homeobox 5						lens development in camera-type eye (GO:0002088)|negative regulation of cell proliferation (GO:0008285)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00783)|GBM - Glioblastoma multiforme(486;0.0802)|Epithelial(262;0.235)		GCAAGGCGCCAtccagctccag	0.658																																																	0								ENSG00000237452																																			AC074212.3	SO:0001628	intergenic_variant	0				Clone_based_vega_gene	L08835	CCDS12673.1	19q13.32	2011-06-20	2007-07-13			ENSG00000177045		"""Homeoboxes / SINE class"""	10891	protein-coding gene	gene with protein product		600963	"""sine oculis homeobox (Drosophila) homolog 5"", ""sine oculis homeobox homolog 5 (Drosophila)"""	DMAHP		8595416	Standard	NM_175875		Approved		uc002pdb.3	Q8N196			19.37:g.46265048_46265053dupTCCAGC		Somatic	NA	NA	NA		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,pfam_bHLH_dom,superfamily_HMG_box_dom,superfamily_bHLH_dom,smart_HMG_box_dom,pfscan_bHLH_dom,pfscan_HMG_box_dom	p.456in_frame_insSS	ENST00000317578.6	37	c.1356_1357	CCDS12673.1	19																																																																																			-	NULL		0.658	SIX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000237452	protein_coding	OTTHUMT00000417341.3	-	NM_175875			46265048	+1	no_errors	ENST00000457052	ensembl	human	putative	74_37	in_frame_ins	INS	0.000:0.004	TCCAGC
FGD5	152273	genome.wustl.edu	37	3	14861642	14861642	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr3:14861642delC	ENST00000285046.5	+	1	1174	c.1064delC	c.(1063-1065)accfs	p.T355fs	FGD5_ENST00000543601.1_Frame_Shift_Del_p.T114fs	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	355					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						ACTGAGAGCACCTCTTTTTGC	0.532																																																	0								ENSG00000154783						67.0	68.0	67.0					3																	14861642		1912	4145	6057	FGD5	SO:0001589	frameshift_variant	0				HGNC	AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.1064delC	3.37:g.14861642delC	ENSP00000285046:p.Thr355fs	Somatic	0	103	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	59	64	47.97	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.S356fs	ENST00000285046.5	37	c.1064	CCDS46767.1	3																																																																																			-	NULL		0.532	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD5	protein_coding	OTTHUMT00000340628.1	C	NM_152536			14861642	+1	no_errors	ENST00000285046	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
TMEM130	222865	genome.wustl.edu	37	7	98445133	98445142	+	3'UTR	DEL	GTGTGTGTGT	GTGTGTGTGT	-	rs148531068|rs541959324|rs147506687|rs200817399	byFrequency	TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	GTGTGTGTGT	GTGTGTGTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr7:98445133_98445142delGTGTGTGTGT	ENST00000416379.2	-	0	1849_1858				TMEM130_ENST00000474857.1_5'UTR|TMEM130_ENST00000450876.1_3'UTR|TMEM130_ENST00000339375.4_3'UTR|TMEM130_ENST00000345589.4_3'UTR			Q8N3G9	TM130_HUMAN	transmembrane protein 130							Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	25	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			ATTTCtgtgtgtgtgtgtgtgtgtgtgtgt	0.452																																																	0								ENSG00000166448																																			TMEM130	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS5658.1, CCDS47649.1, CCDS47650.1	7q22.1	2006-03-09			ENSG00000166448	ENSG00000166448			25429	protein-coding gene	gene with protein product						12975309	Standard	NM_152913		Approved	DKFZp761L1417, FLJ42643	uc003upo.3	Q8N3G9	OTTHUMG00000154419	ENST00000416379.2:c.*546ACACACACAC>-	7.37:g.98445143_98445152delGTGTGTGTGT		Somatic	NA	NA	NA		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A4D266|B7Z364|Q8IY46|Q8N0W9|Q8N3R2	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000416379.2	37	NULL	CCDS47650.1	7																																																																																			-	-		0.452	TMEM130-008	KNOWN	basic|CCDS	protein_coding	TMEM130	protein_coding	OTTHUMT00000380713.1	GTGTGTGTGT	NM_152913			98445142	-1	no_errors	ENST00000474857	ensembl	human	putative	74_37	rna	DEL	0.006:0.003:0.003:0.001:0.000:0.000:0.001:0.001:0.002:0.001	-
PCDHB15	56121	genome.wustl.edu	37	5	140626730	140626730	+	Silent	SNP	G	G	A			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr5:140626730G>A	ENST00000231173.3	+	1	1584	c.1584G>A	c.(1582-1584)gaG>gaA	p.E528E		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	528	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGCTTTCGAGTTCCGCGTGG	0.672																																																	0								ENSG00000113248						62.0	72.0	68.0					5																	140626730		2203	4300	6503	PCDHB15	SO:0001819	synonymous_variant	0			-	HGNC	AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.1584G>A	5.37:g.140626730G>A		Somatic	0	349	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	219	243	47.30	Q8IUX5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E528	ENST00000231173.3	37	c.1584	CCDS4257.1	5																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.672	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB15	protein_coding	OTTHUMT00000251804.2	G	NM_018935	-		140626730	+1	no_errors	ENST00000231173	ensembl	human	known	74_37	silent	SNP	0.735	A
ZBTB38	253461	genome.wustl.edu	37	3	141164801	141164801	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr3:141164801G>A	ENST00000514251.1	+	4	3850	c.3571G>A	c.(3571-3573)Gaa>Aaa	p.E1191K	ZBTB38_ENST00000321464.5_Missense_Mutation_p.E1192K|ZBTB38_ENST00000441582.2_Missense_Mutation_p.E1191K					zinc finger and BTB domain containing 38											breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						AACCGGTGTGGAAAATGTTGT	0.343																																																	0								ENSG00000177311						81.0	82.0	81.0					3																	141164801		1836	4085	5921	ZBTB38	SO:0001583	missense	0			-	HGNC	BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.3571G>A	3.37:g.141164801G>A	ENSP00000426387:p.Glu1191Lys	Somatic	0	45	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.E1192K	ENST00000514251.1	37	c.3574	CCDS43157.1	3	.	.	.	.	.	.	.	.	.	.	G	0.276	-0.989597	0.02162	.	.	ENSG00000177311	ENST00000514251;ENST00000441582;ENST00000321464	T;T;T	0.09350	2.99;2.99;2.99	5.5	5.5	0.81552	.	0.660676	0.13948	N	0.351707	T	0.06917	0.0176	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.06405	0.002;0.002	T	0.33445	-0.9868	9	.	.	.	-1.1738	15.9537	0.79865	0.0:0.1441:0.8559:0.0	.	1192;1191	B4DYR8;Q8NAP3	.;ZBT38_HUMAN	K	1191;1191;1192	ENSP00000426387:E1191K;ENSP00000406955:E1191K;ENSP00000372635:E1192K	.	E	+	1	0	ZBTB38	142647491	0.071000	0.21146	0.009000	0.14445	0.039000	0.13416	1.550000	0.36223	2.579000	0.87056	0.655000	0.94253	GAA	-	NULL		0.343	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB38	protein_coding	OTTHUMT00000359329.2	G		-		141164801	+1	no_errors	ENST00000321464	ensembl	human	known	74_37	missense	SNP	0.046	A
ZNF195	7748	genome.wustl.edu	37	11	3361794	3361794	+	Intron	SNP	G	G	A			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr11:3361794G>A	ENST00000528796.1	-	4	319				RP5-1173A5.1_ENST00000526922.1_RNA			O14628	ZN195_HUMAN	zinc finger protein 195						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		GACCTGCAGGGGAATTGGGAG	0.488																																																	0								ENSG00000254592																																			RP5-1173A5.1	SO:0001627	intron_variant	0			-	Clone_based_vega_gene		CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801		"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187				9344677	Standard	NM_001130520		Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000528796.1:c.227-742C>T	11.37:g.3361794G>A		Somatic	0	12	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	6	64.71	A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000528796.1	37	NULL		11																																																																																			-	-		0.488	ZNF195-027	PUTATIVE	basic	protein_coding	ENSG00000254592	protein_coding	OTTHUMT00000391813.1	G		-		3361794	+1	no_errors	ENST00000526922	ensembl	human	known	74_37	rna	SNP	0.077	A
MOCOS	55034	genome.wustl.edu	37	18	33828939	33828939	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr18:33828939G>T	ENST00000261326.5	+	10	2036	c.2015G>T	c.(2014-2016)cGc>cTc	p.R672L		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						ACTCAGATTCGCCAAAGCAGG	0.438																																																	0								ENSG00000075643						87.0	83.0	84.0					18																	33828939		2203	4300	6503	MOCOS	SO:0001583	missense	0			-	HGNC	AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.2015G>T	18.37:g.33828939G>T	ENSP00000261326:p.Arg672Leu	Somatic	0	47	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MOSC_N,pfam_MoCF_Sase_C,pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase,superfamily_Pyrv_Knase-like_insert_dom	p.R672L	ENST00000261326.5	37	c.2015	CCDS11919.1	18	.	.	.	.	.	.	.	.	.	.	G	10.33	1.321097	0.23994	.	.	ENSG00000075643	ENST00000261326	T	0.30981	1.51	5.28	2.5	0.30297	MOSC, N-terminal beta barrel (1);Pyruvate kinase-like, insert domain (1);	0.278863	0.41712	D	0.000832	T	0.13670	0.0331	N	0.13299	0.325	0.22112	N	0.999353	B	0.12013	0.005	B	0.18871	0.023	T	0.31668	-0.9935	10	0.10636	T	0.68	-4.9893	5.5386	0.17026	0.1792:0.163:0.6578:0.0	.	672	Q96EN8	MOCOS_HUMAN	L	672	ENSP00000261326:R672L	ENSP00000261326:R672L	R	+	2	0	MOCOS	32082937	1.000000	0.71417	1.000000	0.80357	0.720000	0.41350	4.248000	0.58760	0.217000	0.20800	0.561000	0.74099	CGC	-	pfam_MOSC_N,superfamily_Pyrv_Knase-like_insert_dom		0.438	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOCOS	protein_coding	OTTHUMT00000255801.1	G		-		33828939	+1	no_errors	ENST00000261326	ensembl	human	known	74_37	missense	SNP	1.000	T
MAN1B1	11253	genome.wustl.edu	37	9	139998693	139998693	+	Intron	DEL	G	G	-	rs377739094|rs4880207	byFrequency	TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr9:139998693delG	ENST00000371589.4	+	9	1327				MAN1B1_ENST00000474902.1_Intron|MAN1B1_ENST00000540391.1_3'UTR	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1						cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		tcctttttttgttttcgtttg	0.483																																																	0								ENSG00000177239																																			MAN1B1	SO:0001627	intron_variant	0				HGNC	AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.1255-1884G>-	9.37:g.139998693delG		Somatic	0	11	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	Q5VSG3|Q9BRS9|Q9Y5K7	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371589.4	37	NULL	CCDS7029.1	9																																																																																			-	-		0.483	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1B1	protein_coding	OTTHUMT00000055294.2	G	NM_016219			139998693	+1	no_errors	ENST00000540391	ensembl	human	known	74_37	rna	DEL	0.012	-
TBC1D29	26083	genome.wustl.edu	37	17	28887198	28887198	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr17:28887198delG	ENST00000580161.1	+	3	2573	c.76delG	c.(76-78)gggfs	p.G26fs	TBC1D29_ENST00000579181.1_Frame_Shift_Del_p.G26fs|TBC1D29_ENST00000584297.1_Frame_Shift_Del_p.G26fs|RP11-218M11.6_ENST00000582125.1_RNA			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	26	Rab-GAP TBC; truncated. {ECO:0000255|PROSITE-ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				GCTGAATGATGGGGTAAGGAG	0.627																																																	0								ENSG00000266733						41.0	38.0	39.0					17																	28887198		2203	4300	6503	TBC1D29	SO:0001589	frameshift_variant	0				HGNC	BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.76delG	17.37:g.28887198delG	ENSP00000462799:p.Gly26fs	Somatic	0	160	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	223	9.35		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.I27fs	ENST00000580161.1	37	c.76	CCDS32606.1	17																																																																																			-	superfamily_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom		0.627	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	TBC1D29	protein_coding	OTTHUMT00000443632.1	G	NM_015594			28887198	+1	no_errors	ENST00000579181	ensembl	human	known	74_37	frame_shift_del	DEL	0.001	-
SPTB	6710	genome.wustl.edu	37	14	65253407	65253407	+	Silent	SNP	G	G	A			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr14:65253407G>A	ENST00000389721.5	-	15	3308	c.3276C>T	c.(3274-3276)tcC>tcT	p.S1092S	SPTB_ENST00000556626.1_Silent_p.S1092S|SPTB_ENST00000542895.1_Silent_p.S1092S|SPTB_ENST00000389720.3_Silent_p.S1092S|SPTB_ENST00000389722.3_Silent_p.S1092S	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1092					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CCTCTGGGAGGGATTCGGGCA	0.587																																																	0								ENSG00000070182						63.0	62.0	62.0					14																	65253407		2203	4300	6503	SPTB	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.3276C>T	14.37:g.65253407G>A		Somatic	0	60	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	40	48.05	Q15510|Q15519	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Pleckstrin_homology,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.S1092	ENST00000389721.5	37	c.3276	CCDS32100.1	14																																																																																			-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.587	SPTB-004	KNOWN	basic|CCDS	protein_coding	SPTB	protein_coding	OTTHUMT00000414080.1	G		-		65253407	-1	no_errors	ENST00000389722	ensembl	human	known	74_37	silent	SNP	0.991	A
ADAMTSL3	57188	genome.wustl.edu	37	15	84652065	84652065	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr15:84652065A>C	ENST00000286744.5	+	21	3909	c.3685A>C	c.(3685-3687)Aag>Cag	p.K1229Q	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.K1229Q	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	1229	Ig-like C2-type 2.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			TACATGGACCAAGGATGGAAC	0.373																																																	0								ENSG00000156218						104.0	112.0	109.0					15																	84652065		2203	4300	6503	ADAMTSL3	SO:0001583	missense	0			-	HGNC	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.3685A>C	15.37:g.84652065A>C	ENSP00000286744:p.Lys1229Gln	Somatic	0	54	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	78	63	55.32	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom,prints_Peptidase_M12B_ADAM-TS	p.K1229Q	ENST00000286744.5	37	c.3685	CCDS10326.1	15	.	.	.	.	.	.	.	.	.	.	A	19.13	3.768745	0.69878	.	.	ENSG00000156218	ENST00000286744	T	0.18338	2.22	5.13	5.13	0.70059	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.184072	0.26442	N	0.024348	T	0.51958	0.1705	M	0.92122	3.275	0.48901	D	0.999729	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.64782	-0.6326	10	0.72032	D	0.01	.	15.2359	0.73430	1.0:0.0:0.0:0.0	.	1229;1229	P82987-2;P82987	.;ATL3_HUMAN	Q	1229	ENSP00000286744:K1229Q	ENSP00000286744:K1229Q	K	+	1	0	ADAMTSL3	82443069	1.000000	0.71417	1.000000	0.80357	0.576000	0.36127	6.641000	0.74324	2.045000	0.60652	0.455000	0.32223	AAG	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.373	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL3	protein_coding	OTTHUMT00000304007.2	A	NM_207517	-		84652065	+1	no_errors	ENST00000286744	ensembl	human	known	74_37	missense	SNP	1.000	C
FNDC1	84624	genome.wustl.edu	37	6	159650887	159650887	+	Silent	SNP	A	A	T			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr6:159650887A>T	ENST00000297267.9	+	10	1421	c.1221A>T	c.(1219-1221)ggA>ggT	p.G407G	FNDC1_ENST00000340366.6_Intron	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	407	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		AACCATTTGGAGCAAAGTCCC	0.498																																																	0								ENSG00000164694						175.0	180.0	179.0					6																	159650887		1911	4127	6038	FNDC1	SO:0001819	synonymous_variant	0			-	HGNC	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.1221A>T	6.37:g.159650887A>T		Somatic	0	130	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	66	108	37.93	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.G407	ENST00000297267.9	37	c.1221	CCDS47512.1	6																																																																																			-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.498	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC1	protein_coding	OTTHUMT00000042897.3	A	NM_032532	-		159650887	+1	no_errors	ENST00000297267	ensembl	human	known	74_37	silent	SNP	1.000	T
ITIH6	347365	genome.wustl.edu	37	X	54784926	54784926	+	Silent	SNP	A	A	G			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chrX:54784926A>G	ENST00000218436.6	-	8	1610	c.1581T>C	c.(1579-1581)gaT>gaC	p.D527D		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	527					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										CAAGAAGCTGATCCTTGGGGC	0.622																																																	0								ENSG00000102313						18.0	18.0	18.0					X																	54784926		2203	4299	6502	ITIH6	SO:0001819	synonymous_variant	0			-	HGNC	AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.1581T>C	X.37:g.54784926A>G		Somatic	0	13	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	17	45.16	A6NN03	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_VIT,pfam_ITI_HC_C,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.D527	ENST00000218436.6	37	c.1581	CCDS14361.1	X																																																																																			-	NULL		0.622	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH6	protein_coding	OTTHUMT00000056814.2	A	NM_198510	-		54784926	-1	no_errors	ENST00000218436	ensembl	human	known	74_37	silent	SNP	0.003	G
SALL3	27164	genome.wustl.edu	37	18	76755241	76755241	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr18:76755241G>A	ENST00000537592.2	+	2	3250	c.3250G>A	c.(3250-3252)Gtc>Atc	p.V1084I	SALL3_ENST00000536229.3_Missense_Mutation_p.V879I|SALL3_ENST00000575389.2_Missense_Mutation_p.V1012I	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	1084					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GCCCGCGGGCGTCCAGGTCCC	0.711																																																	0								ENSG00000256463						15.0	16.0	16.0					18																	76755241		2189	4286	6475	SALL3	SO:0001583	missense	0			-	HGNC	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.3250G>A	18.37:g.76755241G>A	ENSP00000441823:p.Val1084Ile	Somatic	0	29	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	2	88.89	Q9UGH1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V1084I	ENST00000537592.2	37	c.3250	CCDS12013.1	18	.	.	.	.	.	.	.	.	.	.	G	0.147	-1.095505	0.01858	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.09538	2.97	4.95	-2.74	0.05932	.	0.369779	0.21346	N	0.076050	T	0.02610	0.0079	N	0.02539	-0.55	0.20307	N	0.999918	B;B	0.18863	0.031;0.004	B;B	0.14023	0.01;0.001	T	0.43015	-0.9417	10	0.06891	T	0.86	-37.2201	6.9602	0.24593	0.6465:0.1398:0.2137:0.0	.	744;1084	F5GXY4;Q9BXA9	.;SALL3_HUMAN	I	1084;1012;744	ENSP00000441823:V1084I	ENSP00000299466:V1084I	V	+	1	0	SALL3	74856229	0.730000	0.28100	0.000000	0.03702	0.009000	0.06853	1.406000	0.34646	-0.474000	0.06862	-1.020000	0.02445	GTC	-	NULL		0.711	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SALL3	protein_coding	OTTHUMT00000256397.1	G	NM_171999	-		76755241	+1	no_errors	ENST00000537592	ensembl	human	known	74_37	missense	SNP	0.054	A
ALOX15	246	genome.wustl.edu	37	17	4541604	4541604	+	Missense_Mutation	SNP	C	C	T	rs3892408		TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr17:4541604C>T	ENST00000570836.1	-	7	811	c.715G>A	c.(715-717)Gtg>Atg	p.V239M	ALOX15_ENST00000545513.1_Missense_Mutation_p.V261M|ALOX15_ENST00000293761.3_Missense_Mutation_p.V239M|ALOX15_ENST00000574640.1_Missense_Mutation_p.V200M			P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase	239	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.		V -> M (in dbSNP:rs3892408).		apoptotic cell clearance (GO:0043277)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|cellular response to calcium ion (GO:0071277)|cellular response to interleukin-13 (GO:0035963)|hepoxilin biosynthetic process (GO:0051122)|inflammatory response (GO:0006954)|leukotriene metabolic process (GO:0006691)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxygenase pathway (GO:0019372)|negative regulation of adaptive immune response (GO:0002820)|ossification (GO:0001503)|phosphatidylethanolamine biosynthetic process (GO:0006646)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of engulfment of apoptotic cell (GO:1901074)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arachidonate 12-lipoxygenase activity (GO:0004052)|arachidonate 15-lipoxygenase activity (GO:0050473)|eoxin A4 synthase activity (GO:0097260)|iron ion binding (GO:0005506)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(5)	20				READ - Rectum adenocarcinoma(115;0.0327)		CTCAGCACCACGGGGTTGGCG	0.592																																																	0								ENSG00000161905						1.0	1.0	1.0					17																	4541604		903	1912	2815	ALOX15	SO:0001583	missense	0			-	HGNC	M23892	CCDS11049.1	17p13.3	2010-09-24			ENSG00000161905	ENSG00000161905	1.13.11.33	"""Arachidonate lipoxygenases"""	433	protein-coding gene	gene with protein product		152392				1570320	Standard	NM_001140		Approved	15-LOX-1	uc002fyh.3	P16050	OTTHUMG00000090746	ENST00000570836.1:c.715G>A	17.37:g.4541604C>T	ENSP00000458832:p.Val239Met	Somatic	0	30	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	16	23.81	A8K2P4|B7ZA11|Q8N6R7|Q99657	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,prints_LipOase_mml,prints_LipOase_C	p.V261M	ENST00000570836.1	37	c.781	CCDS11049.1	17	317	0.14514652014652016	95	0.19308943089430894	61	0.1685082872928177	74	0.12937062937062938	87	0.11477572559366754	C	0.005	-2.196159	0.00299	.	.	ENSG00000161905	ENST00000293761;ENST00000545513	T;T	0.07216	3.21;3.21	4.04	2.95	0.34219	Lipoxygenase, C-terminal (3);	0.316889	0.27469	N	0.019226	T	0.00012	0.0000	N	0.02266	-0.62	0.19775	N	0.99995	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.08055	0.002;0.003;0.002	T	0.48080	-0.9066	10	0.06236	T	0.91	-15.1749	4.1582	0.10272	0.0:0.1104:0.2079:0.6817	rs9890466;rs12937345;rs62061508	261;200;239	F5H0G8;B7ZA11;P16050	.;.;LOX15_HUMAN	M	239;261	ENSP00000293761:V239M;ENSP00000439855:V261M	ENSP00000293761:V239M	V	-	1	0	ALOX15	4488353	0.950000	0.32346	0.998000	0.56505	0.180000	0.23129	0.313000	0.19415	0.629000	0.30376	-0.358000	0.07595	GTG	-	pfam_LipOase_C,superfamily_LipOase_C		0.592	ALOX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX15	protein_coding	OTTHUMT00000207487.2	C		rs3892408		4541604	-1	no_errors	ENST00000545513	ensembl	human	known	74_37	missense	SNP	0.997	T
TTC7B	145567	genome.wustl.edu	37	14	91142581	91142582	+	Intron	INS	-	-	GAAATTAACT	rs201387742|rs33925185|rs200998826|rs6145442|rs5810517	byFrequency	TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr14:91142581_91142582insGAAATTAACT	ENST00000328459.6	-	9	1274				RP11-661G16.1_ENST00000554967.1_RNA|TTC7B_ENST00000357056.2_Intron	NM_001010854.1	NP_001010854.1	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B											NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	36		Melanoma(154;0.222)				TTCAGTTGGTGGAAAGAGAAAC	0.411														4849	0.968251	0.8941	0.987	5008	,	,		22431	0.997		0.995	False		,,,				2504	0.998																0								ENSG00000258437																																			RP11-661G16.1	SO:0001627	intron_variant	0				Clone_based_vega_gene	BC035865	CCDS32140.1	14q32.12	2013-01-11	2004-06-02	2004-06-04		ENSG00000165914		"""Tetratricopeptide (TTC) repeat domain containing"""	19858	protein-coding gene	gene with protein product			"""tetratricopeptide repeat domain 7 like 1"""	TTC7L1			Standard	XM_005267367		Approved		uc001xyp.3	Q86TV6		ENST00000328459.6:c.1152+284->AGTTAATTTC	14.37:g.91142581_91142582insGAAATTAACT		Somatic	NA	NA	NA		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q86U24|Q86VT3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000328459.6	37	NULL	CCDS32140.1	14																																																																																			-	-		0.411	TTC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000258437	protein_coding	OTTHUMT00000411364.2	-				91142582	+1	no_errors	ENST00000554967	ensembl	human	known	74_37	rna	INS	0.002:0.000	GAAATTAACT
AKNAD1	254268	genome.wustl.edu	37	1	109394841	109394842	+	In_Frame_Ins	INS	-	-	TAA			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr1:109394841_109394842insTAA	ENST00000370001.3	-	2	713_714	c.445_446insTTA	c.(445-447)aaa>aTTAaa	p.148_149insI	AKNAD1_ENST00000369994.1_In_Frame_Ins_p.148_149insI|AKNAD1_ENST00000369995.3_In_Frame_Ins_p.148_149insI|AKNAD1_ENST00000357393.4_Intron	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1	148						cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						AATAATACTTTTAATAATAGCT	0.386																																																	0								ENSG00000162641																																			AKNAD1	SO:0001652	inframe_insertion	0				HGNC	AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231	ENST00000370001.3:c.443_445dupTTA	1.37:g.109394845_109394847dupTAA	ENSP00000359018:p.Ile148_Ile148dup	Somatic	0	61	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	52	11.86	B9EK62|Q5T1N0|Q8N990|Q8NCN9	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_TF_AT-hook	p.149in_frame_insI	ENST00000370001.3	37	c.446_445	CCDS791.2	1																																																																																			-	NULL		0.386	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AKNAD1	protein_coding	OTTHUMT00000030923.2	-	NM_152763			109394842	-1	no_errors	ENST00000370001	ensembl	human	known	74_37	in_frame_ins	INS	0.324:0.324	TAA
FMO2	2327	genome.wustl.edu	37	1	171178052	171178052	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr1:171178052T>A	ENST00000209929.7	+	9	1534	c.1376T>A	c.(1375-1377)cTg>cAg	p.L459Q	FMO2_ENST00000441535.1_Missense_Mutation_p.L459Q|FMO2_ENST00000529935.1_3'UTR|RP1-127D3.4_ENST00000422841.1_RNA|RP1-127D3.4_ENST00000445909.1_RNA|RP1-127D3.4_ENST00000445290.1_RNA			P31512	FMO4_HUMAN	flavin containing monooxygenase 2 (non-functional)	457					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	22	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GATCCTAAACTGGCTGTGAGA	0.493																																																	0								ENSG00000094963						204.0	199.0	201.0					1																	171178052		2203	4300	6503	FMO2	SO:0001583	missense	0			-	HGNC	BC005894	CCDS1293.1	1q24.3	2011-08-04	2006-07-17		ENSG00000094963	ENSG00000094963			3770	protein-coding gene	gene with protein product		603955	"""flavin containing monooxygenase 2"""			1417778, 9804831	Standard	XR_426768		Approved		uc001ghk.1	Q99518	OTTHUMG00000035504	ENST00000209929.7:c.1376T>A	1.37:g.171178052T>A	ENSP00000209929:p.Leu459Gln	Somatic	0	133	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	64	59	52.03	Q53XR0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_Flavin_mOase,prints_Flavin_mOase_2,prints_Flavin_mOase_1,prints_Flavin_mOase_5	p.L459Q	ENST00000209929.7	37	c.1376	CCDS1293.1	1	.	.	.	.	.	.	.	.	.	.	T	16.20	3.054613	0.55218	.	.	ENSG00000094963	ENST00000209929;ENST00000441535	T;T	0.65364	-0.15;-0.15	5.99	4.83	0.62350	.	0.070231	0.64402	D	0.000016	T	0.80093	0.4560	H	0.94385	3.53	0.43647	D	0.996052	D	0.89917	1.0	D	0.97110	1.0	D	0.85435	0.1151	10	0.87932	D	0	-13.6966	12.34	0.55089	0.0:0.0:0.1413:0.8587	.	459	Q99518	FMO2_HUMAN	Q	459	ENSP00000209929:L459Q;ENSP00000405905:L459Q	ENSP00000209929:L459Q	L	+	2	0	FMO2	169444676	1.000000	0.71417	0.796000	0.32109	0.092000	0.18411	7.923000	0.87546	1.038000	0.40049	0.533000	0.62120	CTG	-	pfam_Flavin_mOase-like		0.493	FMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO2	protein_coding	OTTHUMT00000086216.2	T	NM_001460	-		171178052	+1	no_errors	ENST00000209929	ensembl	human	known	74_37	missense	SNP	1.000	A
ATP10D	57205	genome.wustl.edu	37	4	47563058	47563058	+	Silent	SNP	T	T	A			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr4:47563058T>A	ENST00000273859.3	+	14	2903	c.2634T>A	c.(2632-2634)tcT>tcA	p.S878S	AC092597.3_ENST00000508081.1_RNA	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	878					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						TACTTGAATCTGCCATGAGGT	0.383																																																	0								ENSG00000145246						172.0	161.0	165.0					4																	47563058		2203	4300	6503	ATP10D	SO:0001819	synonymous_variant	0			-	HGNC	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.2634T>A	4.37:g.47563058T>A		Somatic	0	143	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	72	119	37.50	A2RRC8|D6REN2|Q8NC70|Q96SR3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.S878	ENST00000273859.3	37	c.2634	CCDS3476.1	4																																																																																			-	pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp		0.383	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10D	protein_coding	OTTHUMT00000216900.1	T	NM_020453	-		47563058	+1	no_errors	ENST00000273859	ensembl	human	known	74_37	silent	SNP	1.000	A
GGH	8836	genome.wustl.edu	37	8	63938818	63938818	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr8:63938818G>A	ENST00000260118.6	-	5	800	c.398C>T	c.(397-399)aCa>aTa	p.T133I	GGH_ENST00000518113.1_5'UTR|RP11-659E9.4_ENST00000521556.1_RNA	NM_003878.2	NP_003869.1	Q92820	GGH_HUMAN	gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)	133	Gamma-glutamyl hydrolase. {ECO:0000255|PROSITE-ProRule:PRU00607}.				glutamine metabolic process (GO:0006541)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to zinc ion (GO:0010043)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	exopeptidase activity (GO:0008238)|gamma-glutamyl-peptidase activity (GO:0034722)|omega peptidase activity (GO:0008242)			breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(6)|stomach(1)	11	Breast(64;0.0716)	all_cancers(86;0.189)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.131)			Folic Acid(DB00158)|Methotrexate(DB00563)	TCCAAGGCATGTGCCCCACAC	0.393																																																	0								ENSG00000137563						113.0	100.0	105.0					8																	63938818		2203	4300	6503	GGH	SO:0001583	missense	0			-	HGNC	U55206	CCDS6177.1	8q12.3	2008-02-05			ENSG00000137563	ENSG00000137563	3.4.19.9		4248	protein-coding gene	gene with protein product		601509				8816764, 10570974	Standard	NM_003878		Approved		uc003xuw.3	Q92820	OTTHUMG00000164365	ENST00000260118.6:c.398C>T	8.37:g.63938818G>A	ENSP00000260118:p.Thr133Ile	Somatic	0	61	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	43	41.89		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C26,pfam_GATASE	p.T133I	ENST00000260118.6	37	c.398	CCDS6177.1	8	.	.	.	.	.	.	.	.	.	.	G	22.4	4.284925	0.80803	.	.	ENSG00000137563	ENST00000260118;ENST00000517622	T	0.21361	2.01	6.02	5.15	0.70609	.	0.084915	0.85682	D	0.000000	T	0.39733	0.1089	L	0.55834	1.745	0.80722	D	1	D	0.76494	0.999	D	0.67382	0.951	T	0.10683	-1.0619	9	.	.	.	-16.6995	14.4273	0.67225	0.0717:0.0:0.9283:0.0	.	133	Q92820	GGH_HUMAN	I	133;94	ENSP00000260118:T133I	.	T	-	2	0	GGH	64101372	1.000000	0.71417	0.945000	0.38365	0.967000	0.64934	6.700000	0.74619	1.561000	0.49584	0.655000	0.94253	ACA	-	pfam_Peptidase_C26,pfam_GATASE		0.393	GGH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGH	protein_coding	OTTHUMT00000378453.1	G		-		63938818	-1	no_errors	ENST00000260118	ensembl	human	known	74_37	missense	SNP	0.999	A
ABCA2	20	genome.wustl.edu	37	9	139910007	139910007	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr9:139910007C>T	ENST00000371605.3	-	23	3700	c.3553G>A	c.(3553-3555)Gac>Aac	p.D1185N	ABCA2_ENST00000492260.1_5'Flank|ABCA2_ENST00000265662.5_Missense_Mutation_p.D1186N|ABCA2_ENST00000341511.6_Missense_Mutation_p.D1186N			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	1185	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CCAAGCAGGTCAGCCTCATCC	0.667																																																	0								ENSG00000107331						40.0	44.0	42.0					9																	139910007		2197	4293	6490	ABCA2	SO:0001583	missense	0			-	HGNC	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.3553G>A	9.37:g.139910007C>T	ENSP00000360666:p.Asp1185Asn	Somatic	0	126	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	107	85	55.73	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.D1186N	ENST00000371605.3	37	c.3556		9	.	.	.	.	.	.	.	.	.	.	C	26.3	4.722883	0.89298	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	D;D;D	0.97941	-4.62;-4.62;-4.62	4.46	4.46	0.54185	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.113884	0.56097	U	0.000027	D	0.98400	0.9468	M	0.81112	2.525	0.51767	D	0.999931	D;D	0.67145	0.986;0.996	P;P	0.60541	0.742;0.876	D	0.99624	1.0984	10	0.87932	D	0	.	16.704	0.85367	0.0:1.0:0.0:0.0	.	1185;1216	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	N	1186;1185;1216;1186	ENSP00000265662:D1186N;ENSP00000360666:D1185N;ENSP00000344155:D1186N	ENSP00000265662:D1186N	D	-	1	0	ABCA2	139029828	1.000000	0.71417	0.967000	0.41034	0.862000	0.49288	7.632000	0.83247	2.034000	0.60081	0.313000	0.20887	GAC	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.667	ABCA2-202	KNOWN	basic	protein_coding	ABCA2	protein_coding		C	NM_001606	-		139910007	-1	no_errors	ENST00000265662	ensembl	human	known	74_37	missense	SNP	0.997	T
JOSD1	9929	genome.wustl.edu	37	22	39085422	39085422	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr22:39085422G>A	ENST00000216039.5	-	2	872	c.193C>T	c.(193-195)Cca>Tca	p.P65S		NM_014876.5	NP_055691.1	Q15040	JOS1_HUMAN	Josephin domain containing 1	65	Josephin. {ECO:0000255|PROSITE- ProRule:PRU00331}.					cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	omega peptidase activity (GO:0008242)			large_intestine(1)|lung(1)|ovary(2)|pancreas(1)	5	Melanoma(58;0.04)					ATGGTGTTTGGAGACAACCTA	0.507																																																	0								ENSG00000100221						141.0	106.0	118.0					22																	39085422		2203	4300	6503	JOSD1	SO:0001583	missense	0			-	HGNC		CCDS13976.1	22q13.1	2005-11-10			ENSG00000100221	ENSG00000100221			28953	protein-coding gene	gene with protein product		615323				7584044	Standard	NM_014876		Approved	KIAA0063	uc003awf.3	Q15040	OTTHUMG00000151030	ENST00000216039.5:c.193C>T	22.37:g.39085422G>A	ENSP00000216039:p.Pro65Ser	Somatic	0	129	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	57	16	78.08	A8K712	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Josephin,pfscan_Josephin	p.P65S	ENST00000216039.5	37	c.193	CCDS13976.1	22	.	.	.	.	.	.	.	.	.	.	G	23.4	4.414905	0.83449	.	.	ENSG00000100221	ENST00000216039;ENST00000427389;ENST00000412832	T;T;T	0.39592	1.07;1.07;1.07	5.91	3.79	0.43588	.	0.000000	0.85682	D	0.000000	T	0.59824	0.2222	M	0.67569	2.06	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.58769	-0.7578	10	0.46703	T	0.11	.	11.5814	0.50894	0.0666:0.1252:0.8081:0.0	.	65	Q15040	JOS1_HUMAN	S	65	ENSP00000216039:P65S;ENSP00000410010:P65S;ENSP00000415189:P65S	ENSP00000216039:P65S	P	-	1	0	JOSD1	37415368	1.000000	0.71417	0.984000	0.44739	0.928000	0.56348	8.004000	0.88535	0.802000	0.34089	0.655000	0.94253	CCA	-	pfam_Josephin,pfscan_Josephin		0.507	JOSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JOSD1	protein_coding	OTTHUMT00000321047.1	G	NM_014876	-		39085422	-1	no_errors	ENST00000216039	ensembl	human	known	74_37	missense	SNP	1.000	A
ZCCHC6	79670	genome.wustl.edu	37	9	88924912	88924912	+	Silent	SNP	A	A	G			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr9:88924912A>G	ENST00000375963.3	-	19	3571	c.3399T>C	c.(3397-3399)ctT>ctC	p.L1133L	ZCCHC6_ENST00000375960.2_Silent_p.L897L|ZCCHC6_ENST00000277141.6_Silent_p.L422L|ZCCHC6_ENST00000375961.2_Silent_p.L1133L|ZCCHC6_ENST00000375957.1_Silent_p.L71L	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	1133					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						AAGCAGATAAAAGCCTTGTGT	0.343																																																	0								ENSG00000083223						101.0	101.0	101.0					9																	88924912		2203	4300	6503	ZCCHC6	SO:0001819	synonymous_variant	0			-	HGNC	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.3399T>C	9.37:g.88924912A>G		Somatic	0	38	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	40	48.05	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PAP_assoc,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_U1,smart_Znf_CCHC,pfscan_Znf_CCHC	p.L1133	ENST00000375963.3	37	c.3399	CCDS35057.1	9																																																																																			-	NULL		0.343	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC6	protein_coding	OTTHUMT00000052918.1	A	NM_024617	-		88924912	-1	no_errors	ENST00000375963	ensembl	human	known	74_37	silent	SNP	0.956	G
ANO4	121601	genome.wustl.edu	37	12	101436131	101436131	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr12:101436131A>T	ENST00000392977.3	+	12	1249	c.1039A>T	c.(1039-1041)Att>Ttt	p.I347F	ANO4_ENST00000299222.9_5'UTR|ANO4_ENST00000392979.3_Missense_Mutation_p.I312F			Q32M45	ANO4_HUMAN	anoctamin 4	347					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						TGGAGAGAAGATTGGGTTATA	0.438										HNSCC(74;0.22)																																							0								ENSG00000151572						155.0	136.0	142.0					12																	101436131		2203	4300	6503	ANO4	SO:0001583	missense	0			-	HGNC	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.1039A>T	12.37:g.101436131A>T	ENSP00000376703:p.Ile347Phe	Somatic	0	243	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	71	174	28.98	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Anoctamin	p.I347F	ENST00000392977.3	37	c.1039		12	.	.	.	.	.	.	.	.	.	.	A	32	5.191789	0.94923	.	.	ENSG00000151572	ENST00000392979;ENST00000392977	T;T	0.73363	-0.74;-0.74	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.88654	0.6495	M	0.88105	2.93	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.997	D	0.90345	0.4362	10	0.72032	D	0.01	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	347;312	Q32M45;Q32M45-2	ANO4_HUMAN;.	F	312;347	ENSP00000376705:I312F;ENSP00000376703:I347F	ENSP00000376703:I347F	I	+	1	0	ANO4	99960262	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	9.339000	0.96797	2.371000	0.80710	0.533000	0.62120	ATT	-	pfam_Anoctamin		0.438	ANO4-002	KNOWN	basic	protein_coding	ANO4	protein_coding	OTTHUMT00000409295.1	A	NM_178826	-		101436131	+1	no_errors	ENST00000392977	ensembl	human	known	74_37	missense	SNP	1.000	T
VPS45	11311	genome.wustl.edu	37	1	150040903	150040903	+	Intron	SNP	T	T	C			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr1:150040903T>C	ENST00000369130.3	+	2	774				VPS45_ENST00000535106.1_Intron|VPS45_ENST00000369128.5_Intron	NM_001279354.1|NM_007259.3	NP_001266283.1|NP_009190.2	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45 homolog (S. cerevisiae)						blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|vesicle docking involved in exocytosis (GO:0006904)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAAAATAAATTTGTATTATCA	0.358																																																	0								ENSG00000136631																																			VPS45	SO:0001627	intron_variant	0			-	HGNC	U35246	CCDS944.1, CCDS60244.1, CCDS72904.1	1q21.2	2008-02-05	2006-12-19	2006-12-19	ENSG00000136631	ENSG00000136631			14579	protein-coding gene	gene with protein product		610035	"""vacuolar protein sorting 45A (yeast homolog)"", ""vacuolar protein sorting 45A (yeast)"""	VPS45B, VPS45A		8996080	Standard	NM_007259		Approved	h-vps45, H1	uc001etp.3	Q9NRW7	OTTHUMG00000012511	ENST00000369130.3:c.228+82T>C	1.37:g.150040903T>C		Somatic	0	23	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	9	55.00	D3DUZ9|F5H8K1|Q15715|Q53FR8|Q5T4P6|Q9Y4Z6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369130.3	37	NULL	CCDS944.1	1																																																																																			-	-		0.358	VPS45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS45	protein_coding	OTTHUMT00000034964.1	T	NM_007259	-		150040903	+1	no_errors	ENST00000478999	ensembl	human	known	74_37	rna	SNP	0.910	C
FOXC1	2296	genome.wustl.edu	37	6	1611233	1611233	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr6:1611233G>A	ENST00000380874.2	+	1	553	c.553G>A	c.(553-555)Gag>Aag	p.E185K		NM_001453.2	NP_001444.2	Q12948	FOXC1_HUMAN	forkhead box C1	185					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|eye development (GO:0001654)|germ cell migration (GO:0008354)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lacrimal gland development (GO:0032808)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of mitotic cell cycle (GO:0045930)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|paraxial mesoderm formation (GO:0048341)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		GGACAAGGAGGAGAAGGACAG	0.721																																					Pancreas(133;719 1821 3197 26645 35015)												0								ENSG00000054598						16.0	16.0	16.0					6																	1611233		2200	4299	6499	FOXC1	SO:0001583	missense	0			-	HGNC	AF048693	CCDS4473.1	6p25	2008-04-10			ENSG00000054598	ENSG00000054598		"""Forkhead boxes"""	3800	protein-coding gene	gene with protein product		601090		FKHL7, IRID1		7957066, 9620769	Standard	NM_001453		Approved	FREAC3, ARA, IGDA, IHG1	uc003mtp.3	Q12948	OTTHUMG00000016182	ENST00000380874.2:c.553G>A	6.37:g.1611233G>A	ENSP00000370256:p.Glu185Lys	Somatic	0	64	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	30	59.21	Q86UP7|Q9BYM1|Q9NUE5|Q9UDD0|Q9UP06	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.E185K	ENST00000380874.2	37	c.553	CCDS4473.1	6	.	.	.	.	.	.	.	.	.	.	g	17.74	3.464853	0.63513	.	.	ENSG00000054598	ENST00000541209;ENST00000380874	D	0.93019	-3.15	3.62	3.62	0.41486	.	0.351696	0.25037	U	0.033639	D	0.87649	0.6230	L	0.55213	1.73	0.58432	D	0.999999	P	0.40970	0.734	B	0.37731	0.257	D	0.88251	0.2916	10	0.46703	T	0.11	.	14.95	0.71064	0.0:0.0:1.0:0.0	.	185	Q12948	FOXC1_HUMAN	K	185	ENSP00000370256:E185K	ENSP00000370256:E185K	E	+	1	0	FOXC1	1556232	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.144000	0.71762	1.573000	0.49748	0.395000	0.25975	GAG	-	NULL		0.721	FOXC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXC1	protein_coding	OTTHUMT00000043450.1	G		-		1611233	+1	no_errors	ENST00000380874	ensembl	human	known	74_37	missense	SNP	1.000	A
KLRB1	3820	genome.wustl.edu	37	12	9754110	9754110	+	Silent	SNP	C	C	G			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr12:9754110C>G	ENST00000229402.3	-	2	217	c.171G>C	c.(169-171)ggG>ggC	p.G57G		NM_002258.2	NP_002249.1	Q12918	KLRB1_HUMAN	killer cell lectin-like receptor subfamily B, member 1	57					cell surface receptor signaling pathway (GO:0007166)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|large_intestine(6)|lung(4)	12						AAACACTCAACCCAGTAACAA	0.438																																																	0								ENSG00000111796						147.0	122.0	130.0					12																	9754110		2203	4300	6503	KLRB1	SO:0001819	synonymous_variant	0			-	HGNC	U11276	CCDS8601.1	12p13	2014-05-22			ENSG00000111796	ENSG00000111796		"""Killer cell lectin-like receptors"", ""CD molecules"", ""C-type lectin domain containing"""	6373	protein-coding gene	gene with protein product		602890		NKR		8077657	Standard	NM_002258		Approved	CD161, NKR-P1, NKR-P1A, hNKR-P1A, CLEC5B	uc010sgt.2	Q12918	OTTHUMG00000168581	ENST00000229402.3:c.171G>C	12.37:g.9754110C>G		Somatic	0	42	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	25	55.36	Q24K24	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.G57	ENST00000229402.3	37	c.171	CCDS8601.1	12																																																																																			-	superfamily_C-type_lectin_fold		0.438	KLRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRB1	protein_coding	OTTHUMT00000400280.1	C	NM_002258	-		9754110	-1	no_errors	ENST00000229402	ensembl	human	known	74_37	silent	SNP	0.339	G
ABCA5	23461	genome.wustl.edu	37	17	67266815	67266815	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr17:67266815T>A	ENST00000392676.3	-	22	3033	c.2969A>T	c.(2968-2970)tAc>tTc	p.Y990F	ABCA5_ENST00000588877.1_Missense_Mutation_p.Y990F|ABCA5_ENST00000392677.2_Missense_Mutation_p.Y991F			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	990					cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	ATAAAGATAGTAGTTACTAAT	0.303																																																	0								ENSG00000154265						97.0	110.0	106.0					17																	67266815		2203	4271	6474	ABCA5	SO:0001583	missense	0			-	HGNC	U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.2969A>T	17.37:g.67266815T>A	ENSP00000376443:p.Tyr990Phe	Somatic	0	123	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	78	22.00	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.Y991F	ENST00000392676.3	37	c.2972	CCDS11685.1	17	.	.	.	.	.	.	.	.	.	.	T	15.51	2.853786	0.51270	.	.	ENSG00000154265	ENST00000392677;ENST00000392676	D;D	0.83250	-1.7;-1.7	5.45	4.37	0.52481	.	0.338236	0.25558	N	0.029843	T	0.71829	0.3386	L	0.44542	1.39	0.23946	N	0.996384	B	0.26147	0.143	B	0.28553	0.091	T	0.56768	-0.7924	9	.	.	.	.	1.8664	0.03199	0.1423:0.0953:0.2211:0.5412	.	990	Q8WWZ7	ABCA5_HUMAN	F	991;990	ENSP00000376444:Y991F;ENSP00000376443:Y990F	.	Y	-	2	0	ABCA5	64778410	0.992000	0.36948	1.000000	0.80357	0.997000	0.91878	2.218000	0.42889	2.062000	0.61559	0.482000	0.46254	TAC	-	NULL		0.303	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCA5	protein_coding	OTTHUMT00000450654.1	T	NM_018672	-		67266815	-1	no_errors	ENST00000392677	ensembl	human	known	74_37	missense	SNP	0.935	A
RAPGEF2	9693	genome.wustl.edu	37	4	160216901	160216908	+	Intron	DEL	GTGTGTGC	GTGTGTGC	-	rs113715111|rs4690935|rs200354085|rs10024829|rs66478721|rs373967945|rs60091174		TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	GTGTGTGC	GTGTGTGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr4:160216901_160216908delGTGTGTGC	ENST00000264431.4	+	2	479				AC105316.1_ENST00000401270.1_RNA|RAPGEF2_ENST00000504604.1_Intron	NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2						adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		gtgtgtgtgtgtgtgtgcgcgcgcgcgc	0.428																																																	0								ENSG00000216089																																			AC105316.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.61-8586GTGTGTGC>-	4.37:g.160216901_160216908delGTGTGTGC		Somatic	NA	NA	NA		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	D3DP27	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000264431.4	37	NULL	CCDS43277.1	4																																																																																			-	-		0.428	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216089	protein_coding	OTTHUMT00000364980.2	GTGTGTGC	NM_014247			160216908	+1	no_errors	ENST00000401270	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.002:0.000:0.000:0.000	-
TCAIM	285343	genome.wustl.edu	37	3	44402983	44402983	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr3:44402983G>T	ENST00000342649.4	+	4	719	c.292G>T	c.(292-294)Gat>Tat	p.D98Y	TCAIM_ENST00000417237.1_Missense_Mutation_p.D98Y	NM_001282913.1|NM_173826.3	NP_001269842.1|NP_776187.2	Q8N3R3	TCAIM_HUMAN	T cell activation inhibitor, mitochondrial	98						mitochondrion (GO:0005739)											GAGTTCCTCCGATGGCCAGGA	0.398																																																	0								ENSG00000179152						66.0	65.0	66.0					3																	44402983		2203	4300	6503	TCAIM	SO:0001583	missense	0			-	HGNC		CCDS2712.1, CCDS43076.1	3p21.33-p21.32	2012-08-22	2012-08-22	2012-08-22	ENSG00000179152	ENSG00000179152			25241	protein-coding gene	gene with protein product	"""tolerance associated gene-1"""		"""chromosome 3 open reading frame 23"""	C3orf23		12477932	Standard	NM_001029840		Approved	DKFZp313N0621, TOAG-1	uc003cnd.4	Q8N3R3	OTTHUMG00000133049	ENST00000342649.4:c.292G>T	3.37:g.44402983G>T	ENSP00000341539:p.Asp98Tyr	Somatic	0	75	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	32	57.89	A8K9P1|Q0P5T9|Q495R1|Q495R3|Q4G0M4|Q6GMU8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D98Y	ENST00000342649.4	37	c.292	CCDS2712.1	3	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630369	0.67015	.	.	ENSG00000179152	ENST00000417237;ENST00000342649	T;T	0.47869	0.83;0.83	5.4	5.4	0.78164	.	0.655619	0.16337	N	0.218873	T	0.40222	0.1108	N	0.14661	0.345	0.40605	D	0.981614	P	0.45212	0.853	P	0.51324	0.666	T	0.37056	-0.9722	10	0.66056	D	0.02	.	7.0511	0.25073	0.2105:0.0:0.7895:0.0	.	98	Q8N3R3	CC023_HUMAN	Y	98	ENSP00000402581:D98Y;ENSP00000341539:D98Y	ENSP00000341539:D98Y	D	+	1	0	C3orf23	44377987	0.998000	0.40836	0.741000	0.31004	0.928000	0.56348	3.153000	0.50685	2.528000	0.85240	0.467000	0.42956	GAT	-	NULL		0.398	TCAIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCAIM	protein_coding	OTTHUMT00000256655.2	G	NM_173826	-		44402983	+1	no_errors	ENST00000342649	ensembl	human	known	74_37	missense	SNP	0.943	T
RP11-435B5.5	0	genome.wustl.edu	37	1	143380578	143380578	+	lincRNA	SNP	G	G	T			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr1:143380578G>T	ENST00000428624.1	+	0	1748				RP11-435B5.4_ENST00000423249.1_lincRNA																							TGAGACACAGGTCCCAAAGAA	0.343																																																	0								ENSG00000238261																																			RP11-435B5.5			0			-	Clone_based_vega_gene																													1.37:g.143380578G>T		Somatic	0	68	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	39	33.90		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			-	-		0.343	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	lincRNA	OTTHUMT00000037971.1	G		-		143380578	+1	no_errors	ENST00000423394	ensembl	human	known	74_37	rna	SNP	0.425	T
PNMA5	114824	genome.wustl.edu	37	X	152159721	152159721	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chrX:152159721T>G	ENST00000439251.1	-	2	860	c.422A>C	c.(421-423)cAa>cCa	p.Q141P	PNMA5_ENST00000535214.1_Missense_Mutation_p.Q141P|PNMA5_ENST00000452693.1_Missense_Mutation_p.Q141P|PNMA5_ENST00000361887.5_Missense_Mutation_p.Q141P	NM_001103150.1	NP_001096620.1	Q96PV4	PNMA5_HUMAN	paraneoplastic Ma antigen family member 5	141					positive regulation of apoptotic process (GO:0043065)					breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					GGATCTAACTTGGGGCATGAC	0.542																																																	0								ENSG00000198883						148.0	151.0	150.0					X																	152159721		2203	4300	6503	PNMA5	SO:0001583	missense	0			-	HGNC	AB067521	CCDS14718.1	Xq28	2012-02-09	2012-02-09		ENSG00000198883	ENSG00000198883		"""Paraneoplastic Ma antigens"""	18743	protein-coding gene	gene with protein product	"""paraneoplastic antigen family 5"""	300916	"""paraneoplastic antigen like 5"""			16214224	Standard	NM_052926		Approved	KIAA1934	uc004fgy.4	Q96PV4	OTTHUMG00000024184	ENST00000439251.1:c.422A>C	X.37:g.152159721T>G	ENSP00000388850:p.Gln141Pro	Somatic	0	84	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	62	34.04	B4DI72|B7Z9Y9|Q495L5|Q8NET3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q141P	ENST00000439251.1	37	c.422	CCDS14718.1	X	.	.	.	.	.	.	.	.	.	.	T	8.913	0.959267	0.18507	.	.	ENSG00000198883	ENST00000361887;ENST00000535214;ENST00000439251;ENST00000452693	T;T;T;T	0.10960	2.82;2.82;2.82;2.82	2.77	-5.54	0.02544	.	.	.	.	.	T	0.10981	0.0268	M	0.78637	2.42	0.09310	N	1	B	0.22851	0.076	B	0.22152	0.038	T	0.31138	-0.9954	9	0.41790	T	0.15	.	3.2033	0.06657	0.1499:0.1198:0.529:0.2013	.	141	Q96PV4	PNMA5_HUMAN	P	141	ENSP00000354834:Q141P;ENSP00000445775:Q141P;ENSP00000388850:Q141P;ENSP00000392342:Q141P	ENSP00000354834:Q141P	Q	-	2	0	PNMA5	151910377	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.743000	0.04845	-1.511000	0.01794	0.381000	0.24937	CAA	-	NULL		0.542	PNMA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PNMA5	protein_coding	OTTHUMT00000060925.1	T	NM_052926	-		152159721	-1	no_errors	ENST00000361887	ensembl	human	known	74_37	missense	SNP	0.000	G
BOLL	66037	genome.wustl.edu	37	2	198621169	198621169	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr2:198621169C>T	ENST00000392296.4	-	9	1021	c.712G>A	c.(712-714)Gaa>Aaa	p.E238K	BOLL_ENST00000282278.8_Missense_Mutation_p.E129K|AC011997.1_ENST00000409845.1_Intron|BOLL_ENST00000321801.7_Missense_Mutation_p.E250K|BOLL_ENST00000430004.1_Missense_Mutation_p.E260K|BOLL_ENST00000433157.1_Missense_Mutation_p.E238K	NM_033030.5	NP_149019.1	Q8N9W6	BOLL_HUMAN	boule-like RNA-binding protein	238					cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|positive regulation of translational initiation (GO:0045948)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|translation activator activity (GO:0008494)			central_nervous_system(1)|endometrium(2)|lung(6)|ovary(3)|prostate(1)	13						ACTGAAGTTTCCATCAGAGAC	0.358																																																	0								ENSG00000152430						78.0	76.0	77.0					2																	198621169		2203	4300	6503	BOLL	SO:0001583	missense	0			-	HGNC		CCDS2324.1, CCDS2325.1, CCDS63081.1	2q33	2013-10-17	2013-10-17		ENSG00000152430	ENSG00000152430		"""RNA binding motif (RRM) containing"""	14273	protein-coding gene	gene with protein product		606165	"""bol (Drosophila boule homolog)-like"", ""bol, boule-like (Drosophila)"""			11390979, 16001084	Standard	NM_197970		Approved	BOULE	uc002uut.2	Q8N9W6	OTTHUMG00000132747	ENST00000392296.4:c.712G>A	2.37:g.198621169C>T	ENSP00000376116:p.Glu238Lys	Somatic	0	34	0.00		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	27	46.00	B4DZA4|Q0JW32|Q53T62|Q969U3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,pfam_RRM_3,smart_RRM_dom,pfscan_RRM_dom	p.E250K	ENST00000392296.4	37	c.748	CCDS2325.1	2	.	.	.	.	.	.	.	.	.	.	C	23.8	4.457576	0.84317	.	.	ENSG00000152430	ENST00000430004;ENST00000392296;ENST00000321801;ENST00000282278;ENST00000433157	T;T;T;T	0.31769	1.48;1.81;1.81;1.81	5.46	5.46	0.80206	.	0.072565	0.52532	D	0.000070	T	0.42539	0.1207	N	0.24115	0.695	0.37336	D	0.910196	B;P;D;D;D	0.67145	0.449;0.95;0.99;0.965;0.996	B;P;D;P;P	0.72982	0.107;0.469;0.979;0.708;0.848	T	0.50355	-0.8838	10	0.87932	D	0	-21.8573	16.2217	0.82262	0.0:1.0:0.0:0.0	.	129;266;250;238;244	B4DZA4;Q8N9W6-2;Q8N9W6-3;Q8N9W6;Q8N9W6-4	.;.;.;BOLL_HUMAN;.	K	260;238;250;129;238	ENSP00000397711:E260K;ENSP00000376116:E238K;ENSP00000314792:E250K;ENSP00000396099:E238K	ENSP00000282278:E129K	E	-	1	0	BOLL	198329414	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.725000	0.61979	2.577000	0.86979	0.557000	0.71058	GAA	-	NULL		0.358	BOLL-001	KNOWN	basic|CCDS	protein_coding	BOLL	protein_coding	OTTHUMT00000256107.3	C	NM_033030	-		198621169	-1	no_errors	ENST00000321801	ensembl	human	known	74_37	missense	SNP	1.000	T
AP000525.9	0	genome.wustl.edu	37	22	16159315	16159324	+	RNA	DEL	TACAAATACT	TACAAATACT	-			TCGA-DX-A6BA-01A-11D-A307-09	TCGA-DX-A6BA-10A-01D-A307-09	TACAAATACT	TACAAATACT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98730fa6-9c2d-4fd3-8862-ba7f78473395	971c456f-5be0-4a53-9780-492252d16f2e	g.chr22:16159315_16159324delTACAAATACT	ENST00000447898.1	-	0	293				AP000525.10_ENST00000440946.1_RNA																							TCCATGTTCCTACAAATACTTACAAATCCC	0.581																																																	0								ENSG00000206195																																			AP000525.9			0				Clone_based_vega_gene																													22.37:g.16159315_16159324delTACAAATACT		Somatic	NA	NA	NA		0.6846825450841885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000447898.1	37	NULL		22																																																																																			-	-		0.581	AP000525.9-002	KNOWN	basic	lincRNA	ENSG00000206195	processed_transcript	OTTHUMT00000276780.1	TACAAATACT				16159324	-1	no_errors	ENST00000383038	ensembl	human	known	74_37	rna	DEL	0.244:0.231:0.217:0.220:0.222:0.223:0.223:0.223:0.222:0.220	-
