#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CLCN7	1186	genome.wustl.edu	37	16	1497076	1497076	+	Silent	SNP	G	G	C			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr16:1497076G>C	ENST00000382745.4	-	24	2867	c.2262C>G	c.(2260-2262)ctC>ctG	p.L754L	CCDC154_ENST00000389176.3_5'Flank|CLCN7_ENST00000448525.1_Silent_p.L730L|LA16c-390E6.5_ENST00000566287.1_RNA|CCDC154_ENST00000409671.1_5'Flank|CLCN7_ENST00000262318.8_Missense_Mutation_p.P731A	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	754	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				ACACCCGTGGGAGCGACGCCT	0.706																																																	0								ENSG00000103249						19.0	20.0	20.0					16																	1497076		2178	4285	6463	CLCN7	SO:0001819	synonymous_variant	0			-	HGNC	Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.2262C>G	16.37:g.1497076G>C		Somatic	0	30	0.00		0.6487880846458666	134	14.65	23	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	16	20.00	A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cl-channel_volt-gated,pfam_CBS_dom,superfamily_Cl-channel_core,smart_CBS_dom,prints_Cl-channel_volt-gated,prints_Cl_channel-7	p.P731A	ENST00000382745.4	37	c.2191	CCDS32361.1	16																																																																																			-	NULL		0.706	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN7	protein_coding	OTTHUMT00000103598.2	G	NM_001287	-		1497076	-1	no_errors	ENST00000262318	ensembl	human	putative	74_37	missense	SNP	0.098	C
SNX27	81609	genome.wustl.edu	37	1	151611519	151611519	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr1:151611519A>G	ENST00000458013.2	+	2	587	c.467A>G	c.(466-468)gAt>gGt	p.D156G	SNX27_ENST00000368838.1_Missense_Mutation_p.D63G|SNX27_ENST00000368843.3_Missense_Mutation_p.D156G			Q96L92	SNX27_HUMAN	sorting nexin family member 27	156					endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TCATTTTATGATTACACAGAA	0.473																																					Colon(46;291 966 40145 41237 41888)												0								ENSG00000143376						114.0	104.0	107.0					1																	151611519		2203	4300	6503	SNX27	SO:0001583	missense	0			-	HGNC	AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.467A>G	1.37:g.151611519A>G	ENSP00000400333:p.Asp156Gly	Somatic	0	65	0.00		0.6487880846458666	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	43	20.37	Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Phox,pfam_PDZ,pfam_Ras-assoc,superfamily_Phox,superfamily_PDZ,smart_PDZ,smart_Phox,pfscan_PDZ,pfscan_Phox,pfscan_Ras-assoc	p.D156G	ENST00000458013.2	37	c.467		1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.173871	0.78452	.	.	ENSG00000143376	ENST00000458013;ENST00000368843;ENST00000368838	T;T;T	0.29397	1.57;1.57;1.57	4.66	4.66	0.58398	Phox homologous domain (3);	0.000000	0.85682	D	0.000000	T	0.46580	0.1400	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79784	0.962;0.993	T	0.51973	-0.8637	10	0.59425	D	0.04	.	13.0435	0.58913	1.0:0.0:0.0:0.0	.	156;156	Q96L92;Q96L92-3	SNX27_HUMAN;.	G	156;156;63	ENSP00000400333:D156G;ENSP00000357836:D156G;ENSP00000357831:D63G	ENSP00000357831:D63G	D	+	2	0	SNX27	149878143	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.735000	0.91549	1.954000	0.56735	0.482000	0.46254	GAT	-	superfamily_Phox,smart_Phox		0.473	SNX27-003	NOVEL	basic	protein_coding	SNX27	protein_coding	OTTHUMT00000036624.3	A	NM_030918	-		151611519	+1	no_errors	ENST00000368843	ensembl	human	known	74_37	missense	SNP	1.000	G
C2orf91	400950	genome.wustl.edu	37	2	42181266	42181266	+	5'Flank	SNP	G	G	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr2:42181266G>A	ENST00000378711.2	-	0	0				C2orf91_ENST00000403980.1_5'UTR	NM_001242815.1	NP_001229744.1	Q6ZV80	CB091_HUMAN	chromosome 2 open reading frame 91																		tggatgcctggtgtatagcag	0.483																																																	0								ENSG00000205086																																			C2orf91	SO:0001631	upstream_gene_variant	0			-	HGNC		CCDS56116.1	2p21	2012-02-17			ENSG00000205086	ENSG00000205086			42966	protein-coding gene	gene with protein product							Standard	NM_001242815		Approved		uc002rsf.1	Q6ZV80	OTTHUMG00000152307		2.37:g.42181266G>A	Exception_encountered	Somatic	0	29	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000378711.2	37	NULL	CCDS56116.1	2																																																																																			-	-		0.483	C2orf91-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	C2orf91	protein_coding	OTTHUMT00000325755.1	G	NM_001242815	-		42181266	-1	no_errors	ENST00000403980	ensembl	human	putative	74_37	rna	SNP	0.000	A
DPPA2	151871	genome.wustl.edu	37	3	109028041	109028041	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr3:109028041T>G	ENST00000478945.1	-	4	564	c.318A>C	c.(316-318)caA>caC	p.Q106H		NM_138815.3	NP_620170.3	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	106	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				lung-associated mesenchyme development (GO:0060484)|positive regulation of stem cell proliferation (GO:2000648)|regulation of histone methylation (GO:0031060)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TCAAACCGAGTTGTTGACACC	0.438																																																	0								ENSG00000163530						215.0	222.0	219.0					3																	109028041		2203	4300	6503	DPPA2	SO:0001583	missense	0			-	HGNC	AY283672	CCDS2956.1	3q13.13	2010-05-04			ENSG00000163530	ENSG00000163530			19197	protein-coding gene	gene with protein product	"""cancer/testis antigen 100"""	614445				15583978	Standard	NM_138815		Approved	PESCRG1, CT100	uc003dxo.3	Q7Z7J5	OTTHUMG00000159227	ENST00000478945.1:c.318A>C	3.37:g.109028041T>G	ENSP00000417710:p.Gln106His	Somatic	0	75	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	57	25.00	Q8WVF0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfscan_SAP_dom	p.Q106H	ENST00000478945.1	37	c.318	CCDS2956.1	3	.	.	.	.	.	.	.	.	.	.	T	10.71	1.426287	0.25726	.	.	ENSG00000163530	ENST00000478945	T	0.50001	0.76	4.48	-2.3	0.06785	DNA-binding SAP (2);	0.796261	0.11023	N	0.608169	T	0.38878	0.1057	M	0.65498	2.005	0.09310	N	1	B	0.16396	0.017	B	0.10450	0.005	T	0.42965	-0.9420	10	0.72032	D	0.01	-3.9934	3.1136	0.06367	0.436:0.1919:0.0:0.372	.	106	Q7Z7J5	DPPA2_HUMAN	H	106	ENSP00000417710:Q106H	ENSP00000417710:Q106H	Q	-	3	2	DPPA2	110510731	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.161000	0.10026	-0.452000	0.07087	-0.441000	0.05720	CAA	-	pfscan_SAP_dom		0.438	DPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPPA2	protein_coding	OTTHUMT00000353938.1	T	NM_138815	-		109028041	-1	no_errors	ENST00000478945	ensembl	human	known	74_37	missense	SNP	0.000	G
TCHH	7062	genome.wustl.edu	37	1	152086555	152086556	+	Start_Codon_Ins	INS	-	-	T	rs141946179	byFrequency	TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr1:152086555_152086556insT	ENST00000368804.1	-	0	0_1					NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin						keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AAGTGGAGACATTTTTTTTTCT	0.361																																																	0								ENSG00000159450																																			TCHH	SO:0001582	initiator_codon_variant	0				HGNC	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.2dupA	1.37:g.152086564_152086564dupT		Somatic	0	23	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	24	17.24	Q5VUI3	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.M1fs	ENST00000368804.1	37	c.2_1	CCDS41396.1	1																																																																																			-	NULL		0.361	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	protein_coding	OTTHUMT00000036671.2	-	NM_007113			152086556	-1	no_errors	ENST00000368804	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	T
ARHGAP17	55114	genome.wustl.edu	37	16	24964277	24964277	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr16:24964277G>T	ENST00000289968.6	-	11	1008	c.939C>A	c.(937-939)ttC>ttA	p.F313L	ARHGAP17_ENST00000575975.1_5'Flank|ARHGAP17_ENST00000441763.2_3'UTR|ARHGAP17_ENST00000303665.5_Missense_Mutation_p.F313L	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	313	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		GGTCTGAATAGAACTCATCCA	0.502																																																	0								ENSG00000140750						93.0	93.0	93.0					16																	24964277		2197	4300	6497	ARHGAP17	SO:0001583	missense	0			-	HGNC	AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.939C>A	16.37:g.24964277G>T	ENSP00000289968:p.Phe313Leu	Somatic	0	40	0.00		0.6487880846458666	18	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BAR_dom,pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_BAR_dom,smart_RhoGAP_dom,pfscan_BAR_dom,pfscan_RhoGAP_dom	p.F313L	ENST00000289968.6	37	c.939	CCDS32409.1	16	.	.	.	.	.	.	.	.	.	.	G	23.2	4.390134	0.82902	.	.	ENSG00000140750	ENST00000289968;ENST00000303665;ENST00000455311	T;T	0.16597	2.33;2.33	5.95	3.81	0.43845	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.46145	D	0.000302	T	0.27419	0.0673	L	0.41356	1.27	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.997	D;D;D	0.80764	0.994;0.987;0.994	T	0.01532	-1.1331	10	0.33940	T	0.23	.	8.3362	0.32217	0.2242:0.0:0.7758:0.0	.	313;313;313	C9IZD3;Q68EM7-2;Q68EM7	.;.;RHG17_HUMAN	L	313	ENSP00000289968:F313L;ENSP00000303130:F313L	ENSP00000289968:F313L	F	-	3	2	ARHGAP17	24871778	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.857000	0.39399	1.520000	0.48965	0.563000	0.77884	TTC	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.502	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP17	protein_coding	OTTHUMT00000436548.3	G	NM_018054	-		24964277	-1	no_errors	ENST00000289968	ensembl	human	known	74_37	missense	SNP	1.000	T
IGFN1	91156	genome.wustl.edu	37	1	201166387	201166387	+	Silent	SNP	C	C	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr1:201166387C>T	ENST00000335211.4	+	5	439	c.309C>T	c.(307-309)tgC>tgT	p.C103C	IGFN1_ENST00000451870.2_Silent_p.C103C|IGFN1_ENST00000295591.8_5'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	103	Ig-like 1.					nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						TGTACCGCTGCACAGCAGTAA	0.552																																																	0								ENSG00000163395						152.0	139.0	143.0					1																	201166387		692	1591	2283	IGFN1	SO:0001819	synonymous_variant	0			-	HGNC	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.309C>T	1.37:g.201166387C>T		Somatic	0	44	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	F8WAI1|Q9NT72	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.C103	ENST00000335211.4	37	c.309	CCDS53455.1	1																																																																																			-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.552	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	protein_coding		C	NM_178275	-		201166387	+1	no_errors	ENST00000335211	ensembl	human	known	74_37	silent	SNP	0.676	T
SYNGR4	23546	genome.wustl.edu	37	19	48876925	48876925	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr19:48876925C>T	ENST00000344846.2	+	3	495	c.245C>T	c.(244-246)gCc>gTc	p.A82V	SYNGR4_ENST00000601610.1_Missense_Mutation_p.A33V|SYNGR4_ENST00000595322.1_Missense_Mutation_p.A33V	NM_012451.3	NP_036583.2	O95473	SNG4_HUMAN	synaptogyrin 4	82	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.					integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(4)|lung(2)|skin(1)	10		all_epithelial(76;5.08e-07)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|Prostate(7;0.0143)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.00017)|Epithelial(262;0.0138)|GBM - Glioblastoma multiforme(486;0.0146)		AGCTGCCTGGCCTTCCTCGTC	0.627																																																	0								ENSG00000105467						91.0	83.0	86.0					19																	48876925		2203	4300	6503	SYNGR4	SO:0001583	missense	0			-	HGNC	AJ011733	CCDS12717.1	19q13.3	2008-07-04				ENSG00000105467			11502	protein-coding gene	gene with protein product		608373					Standard	NM_012451		Approved		uc002piz.3	O95473		ENST00000344846.2:c.245C>T	19.37:g.48876925C>T	ENSP00000344041:p.Ala82Val	Somatic	0	20	0.00		0.6487880846458666	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	13	40.91	Q3KP58	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Marvel,pirsf_Synaptogyrin	p.A82V	ENST00000344846.2	37	c.245	CCDS12717.1	19	.	.	.	.	.	.	.	.	.	.	C	9.988	1.229932	0.22542	.	.	ENSG00000105467	ENST00000344846	T	0.25579	1.79	3.96	-7.92	0.01160	Marvel (1);MARVEL-like domain (1);	0.618562	0.16849	N	0.197037	T	0.09642	0.0237	L	0.28274	0.84	0.24034	N	0.996107	B	0.10296	0.003	B	0.12156	0.007	T	0.29119	-1.0022	10	0.13108	T	0.6	-13.9006	3.3676	0.07208	0.1111:0.1114:0.2234:0.5541	.	82	O95473	SNG4_HUMAN	V	82	ENSP00000344041:A82V	ENSP00000344041:A82V	A	+	2	0	SYNGR4	53568737	0.000000	0.05858	0.654000	0.29608	0.933000	0.57130	-1.562000	0.02156	-1.393000	0.02079	-0.378000	0.06908	GCC	-	pfam_Marvel,pirsf_Synaptogyrin		0.627	SYNGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGR4	protein_coding	OTTHUMT00000465704.1	C		-		48876925	+1	no_errors	ENST00000344846	ensembl	human	known	74_37	missense	SNP	0.877	T
PRPF4B	8899	genome.wustl.edu	37	6	4037782	4037782	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr6:4037782A>G	ENST00000337659.6	+	3	1490	c.1390A>G	c.(1390-1392)Aga>Gga	p.R464G	PRPF4B_ENST00000538861.1_Missense_Mutation_p.R450G	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	464	Arg/Lys-rich (basic).				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				TCCAAGAAGAAGAAGCAGATC	0.458																																																	0								ENSG00000112739						97.0	80.0	86.0					6																	4037782		2203	4300	6503	PRPF4B	SO:0001583	missense	0			-	HGNC	U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.1390A>G	6.37:g.4037782A>G	ENSP00000337194:p.Arg464Gly	Somatic	0	34	0.00		0.6487880846458666	4	78.95	15	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	0	100.00	A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R464G	ENST00000337659.6	37	c.1390	CCDS4488.1	6	.	.	.	.	.	.	.	.	.	.	A	15.44	2.834768	0.50951	.	.	ENSG00000112739	ENST00000337659;ENST00000538861	T;T	0.70749	-0.51;-0.51	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.68815	0.3042	L	0.58810	1.83	0.51767	D	0.999938	D	0.54601	0.967	P	0.60789	0.879	T	0.67337	-0.5696	10	0.19590	T	0.45	.	12.0582	0.53548	0.8564:0.1436:0.0:0.0	.	464	Q13523	PRP4B_HUMAN	G	464;450	ENSP00000337194:R464G;ENSP00000439331:R450G	ENSP00000337194:R464G	R	+	1	2	PRPF4B	3982781	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.766000	0.47629	1.898000	0.54952	0.459000	0.35465	AGA	-	NULL		0.458	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF4B	protein_coding	OTTHUMT00000314018.2	A		-		4037782	+1	no_errors	ENST00000337659	ensembl	human	known	74_37	missense	SNP	1.000	G
RUNX3	864	genome.wustl.edu	37	1	25229150	25229150	+	Silent	SNP	C	C	T	rs567207182		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr1:25229150C>T	ENST00000308873.6	-	5	719	c.711G>A	c.(709-711)tcG>tcA	p.S237S	RUNX3_ENST00000399916.1_Silent_p.S251S|RUNX3_ENST00000540420.1_Silent_p.S144S|RUNX3_ENST00000338888.3_Silent_p.S251S|RUNX3_ENST00000496967.1_5'UTR	NM_004350.2	NP_004341.1	Q13761	RUNX3_HUMAN	runt-related transcription factor 3	237	Pro/Ser/Thr-rich.				axon guidance (GO:0007411)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|hair follicle morphogenesis (GO:0031069)|interferon-gamma production (GO:0032609)|negative regulation of cell cycle (GO:0045786)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system neuron development (GO:0048935)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(3)	18		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		GGTTCAGTTCCGAGGTGCCTG	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		14814	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000020633						60.0	54.0	56.0					1																	25229150		2170	4261	6431	RUNX3	SO:0001819	synonymous_variant	0			-	HGNC	BC013362	CCDS257.1, CCDS30633.1	1p36	2008-02-05			ENSG00000020633	ENSG00000020633			10473	protein-coding gene	gene with protein product		600210		CBFA3		7835892	Standard	NM_001031680		Approved	AML2, PEBP2A3	uc001bjq.3	Q13761	OTTHUMG00000003316	ENST00000308873.6:c.711G>A	1.37:g.25229150C>T		Somatic	0	166	0.00		0.6487880846458666	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	39	38.10	B1AJV5|Q12969|Q13760	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Runt_dom,pfam_RunxI_C_dom,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_Runt_dom,prints_AML1_Runt	p.S251	ENST00000308873.6	37	c.753	CCDS257.1	1																																																																																			-	pirsf_TF_Runt-rel_RUNX		0.617	RUNX3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RUNX3	protein_coding	OTTHUMT00000009284.1	C	NM_004350	-		25229150	-1	no_errors	ENST00000338888	ensembl	human	known	74_37	silent	SNP	0.997	T
TOX	9760	genome.wustl.edu	37	8	59727987	59727987	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr8:59727987C>A	ENST00000361421.1	-	7	1522	c.1302G>T	c.(1300-1302)caG>caT	p.Q434H	RNU4-50P_ENST00000364361.1_RNA	NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	434						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				GCTGGTGCTGCTGCATGTTGA	0.567																																					Pancreas(161;610 1969 17913 21374 22725)												0								ENSG00000198846						64.0	67.0	66.0					8																	59727987		2203	4300	6503	TOX	SO:0001583	missense	0			-	HGNC		CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.1302G>T	8.37:g.59727987C>A	ENSP00000354842:p.Gln434His	Somatic	0	50	0.00		0.6487880846458666	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	46	23.33	Q96AV5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.Q434H	ENST00000361421.1	37	c.1302	CCDS34897.1	8	.	.	.	.	.	.	.	.	.	.	C	11.50	1.657589	0.29425	.	.	ENSG00000198846	ENST00000361421;ENST00000456290	T	0.12569	2.67	5.91	5.04	0.67666	.	0.115474	0.64402	D	0.000014	T	0.09642	0.0237	N	0.02247	-0.625	0.48901	D	0.999723	D	0.56521	0.976	P	0.53809	0.735	T	0.45963	-0.9225	9	.	.	.	.	12.0087	0.53274	0.0:0.8611:0.0:0.1389	.	434	O94900	TOX_HUMAN	H	434;184	ENSP00000354842:Q434H	.	Q	-	3	2	TOX	59890541	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	1.167000	0.31847	1.500000	0.48636	0.591000	0.81541	CAG	-	NULL		0.567	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOX	protein_coding	OTTHUMT00000378307.1	C	NM_014729	-		59727987	-1	no_errors	ENST00000361421	ensembl	human	known	74_37	missense	SNP	1.000	A
MYCBP2	23077	genome.wustl.edu	37	13	77799597	77799597	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr13:77799597G>A	ENST00000544440.2	-	19	2733	c.2716C>T	c.(2716-2718)Caa>Taa	p.Q906*	MYCBP2_ENST00000407578.2_Nonsense_Mutation_p.Q944*|MYCBP2_ENST00000357337.6_Nonsense_Mutation_p.Q906*|MYCBP2_ENST00000360084.5_5'UTR					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CAGCTGACTTGGACTGCCCGG	0.453																																																	0								ENSG00000005810						164.0	139.0	147.0					13																	77799597		2203	4300	6503	MYCBP2	SO:0001587	stop_gained	0			-	HGNC	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.2716C>T	13.37:g.77799597G>A	ENSP00000444596:p.Gln906*	Somatic	0	61	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	78	29.09		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_RCC1/BLIP-II,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.Q944*	ENST00000544440.2	37	c.2830		13	.	.	.	.	.	.	.	.	.	.	G	42	9.477140	0.99181	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	.	.	.	X	906;944;906	.	ENSP00000349892:Q906X	Q	-	1	0	MYCBP2	76697598	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.452000	0.97615	2.861000	0.98227	0.655000	0.94253	CAA	-	superfamily_RCC1/BLIP-II,superfamily_ARM-type_fold		0.453	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	protein_coding	OTTHUMT00000045326.1	G	NM_015057	-		77799597	-1	no_errors	ENST00000407578	ensembl	human	known	74_37	nonsense	SNP	1.000	A
SLC26A4	5172	genome.wustl.edu	37	7	107353040	107353040	+	Silent	SNP	G	G	A	rs139556627		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr7:107353040G>A	ENST00000265715.3	+	20	2516	c.2292G>A	c.(2290-2292)acG>acA	p.T764T	SLC26A4_ENST00000543100.1_Silent_p.T333T|SLC26A4_ENST00000544569.1_Silent_p.T351T|SLC26A4_ENST00000541474.1_Silent_p.T325T	NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	764					chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)	p.T764T(1)		central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						CAGAGCTGACGGAAGAAGAAC	0.323									Pendred syndrome				G|||	1	0.000199681	0.0008	0.0	5008	,	,		18435	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	lung(1)						ENSG00000091137	G		1,4405	2.1+/-5.4	0,1,2202	130.0	129.0	130.0		2292	0.3	0.2	7	dbSNP_134	130	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC26A4	NM_000441.1		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		764/781	107353040	2,13004	2203	4300	6503	SLC26A4	SO:0001819	synonymous_variant	0	Familial Cancer Database	Goiter-Deafness syndrome	-	HGNC	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.2292G>A	7.37:g.107353040G>A		Somatic	0	62	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	59	19.18	B7Z266|O43170	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.T764	ENST00000265715.3	37	c.2292	CCDS5746.1	7																																																																																			-	NULL		0.323	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A4	protein_coding	OTTHUMT00000337148.1	G	NM_000441	rs139556627		107353040	+1	no_errors	ENST00000265715	ensembl	human	known	74_37	silent	SNP	0.076	A
CCT8	10694	genome.wustl.edu	37	21	30434490	30434490	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr21:30434490C>A	ENST00000286788.4	-	11	1377	c.1171G>T	c.(1171-1173)Gca>Tca	p.A391S	AF129075.5_ENST00000457162.2_RNA|CCT8_ENST00000540844.1_Missense_Mutation_p.A318S|CCT8_ENST00000470450.1_5'UTR|CCT8_ENST00000542732.1_Missense_Mutation_p.A372S	NM_006585.2	NP_006576.2	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)	391				A -> V (in Ref. 1; BAA02792). {ECO:0000305}.	'de novo' posttranslational protein folding (GO:0051084)|ATP catabolic process (GO:0006200)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	aggresome (GO:0016235)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|prostate(3)	14						TCGTCTACTGCCCTTTCTATG	0.353																																																	0								ENSG00000156261						176.0	169.0	171.0					21																	30434490		2203	4300	6503	CCT8	SO:0001583	missense	0			-	HGNC	Z37163	CCDS33528.1, CCDS68180.1	21q21.3	2011-09-02			ENSG00000156261	ENSG00000156261		"""Heat Shock Proteins / Chaperonins"""	1623	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 112"""	C21orf112		7890169	Standard	NM_006585		Approved	Cctq, PRED71	uc002ynb.3	P50990	OTTHUMG00000044595	ENST00000286788.4:c.1171G>T	21.37:g.30434490C>A	ENSP00000286788:p.Ala391Ser	Somatic	0	40	0.00		0.6487880846458666	363	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	A6NN54|B4DEM7|B4DQH4|Q4VBP8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,tigrfam_Chap_CCT_theta	p.A391S	ENST00000286788.4	37	c.1171	CCDS33528.1	21	.	.	.	.	.	.	.	.	.	.	C	34	5.356340	0.95854	.	.	ENSG00000156261	ENST00000389159;ENST00000286788;ENST00000542732;ENST00000540844	T;T;T	0.13420	2.59;2.59;2.59	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.29914	0.0748	L	0.42529	1.33	0.80722	D	1	D;D;P;P;P	0.61080	0.989;0.97;0.947;0.934;0.767	D;P;P;P;B	0.65010	0.931;0.888;0.888;0.821;0.341	T	0.00239	-1.1888	10	0.44086	T	0.13	-21.4844	19.1736	0.93590	0.0:1.0:0.0:0.0	.	318;372;391;390;391	B4DQH4;B4DEM7;Q53HU0;G5E9B2;P50990	.;.;.;.;TCPQ_HUMAN	S	390;391;372;318	ENSP00000286788:A391S;ENSP00000444984:A372S;ENSP00000442730:A318S	ENSP00000286788:A391S	A	-	1	0	CCT8	29356361	1.000000	0.71417	0.999000	0.59377	0.950000	0.60333	7.183000	0.77697	2.836000	0.97738	0.655000	0.94253	GCA	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,tigrfam_Chap_CCT_theta		0.353	CCT8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT8	protein_coding	OTTHUMT00000171822.1	C		-		30434490	-1	no_errors	ENST00000286788	ensembl	human	known	74_37	missense	SNP	1.000	A
EBI3	10148	genome.wustl.edu	37	19	4236994	4236994	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr19:4236994A>G	ENST00000221847.5	+	5	652	c.599A>G	c.(598-600)tAc>tGc	p.Y200C		NM_005755.2	NP_005746.2	Q14213	IL27B_HUMAN	Epstein-Barr virus induced 3	200	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|humoral immune response (GO:0006959)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|T-helper 1 type immune response (GO:0042088)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)			large_intestine(1)|lung(2)|ovary(1)|urinary_tract(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0336)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCAGGTACTACGTCCAAGTG	0.602																																																	0								ENSG00000105246						55.0	55.0	55.0					19																	4236994		2203	4300	6503	EBI3	SO:0001583	missense	0			-	HGNC	L08187	CCDS12123.1	19p13	2013-02-11	2008-09-12		ENSG00000105246	ENSG00000105246		"""Fibronectin type III domain containing"""	3129	protein-coding gene	gene with protein product	"""IL27 subunit"", ""IL35 subunit"""	605816				8551575	Standard	NM_005755		Approved		uc002lzu.3	Q14213		ENST00000221847.5:c.599A>G	19.37:g.4236994A>G	ENSP00000221847:p.Tyr200Cys	Somatic	0	28	0.00		0.6487880846458666	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	17.65	A0N0N2|O75269	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.Y200C	ENST00000221847.5	37	c.599	CCDS12123.1	19	.	.	.	.	.	.	.	.	.	.	A	8.628	0.893023	0.17613	.	.	ENSG00000105246	ENST00000221847	T	0.57273	0.41	5.41	-6.19	0.02078	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.682853	0.14562	N	0.312016	T	0.11110	0.0271	N	0.00210	-1.845	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.36138	-0.9760	10	0.34782	T	0.22	-9.3604	4.1764	0.10353	0.3694:0.0:0.2954:0.3352	.	200	Q14213	IL27B_HUMAN	C	200	ENSP00000221847:Y200C	ENSP00000221847:Y200C	Y	+	2	0	EBI3	4187994	0.002000	0.14202	0.001000	0.08648	0.000000	0.00434	-0.144000	0.10280	-0.519000	0.06444	-2.009000	0.00441	TAC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.602	EBI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EBI3	protein_coding	OTTHUMT00000458005.1	A		-		4236994	+1	no_errors	ENST00000221847	ensembl	human	known	74_37	missense	SNP	0.000	G
KANK4	163782	genome.wustl.edu	37	1	62737171	62737171	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr1:62737171T>G	ENST00000371153.4	-	4	2369	c.1991A>C	c.(1990-1992)cAg>cCg	p.Q664P	KANK4_ENST00000354381.3_Missense_Mutation_p.Q36P|KANK4_ENST00000371150.1_Missense_Mutation_p.Q20P	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	664						cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						CCCAACAAACTGAAGGTTCTT	0.473																																																	0								ENSG00000132854						210.0	193.0	199.0					1																	62737171		2203	4300	6503	KANK4	SO:0001583	missense	0			-	HGNC	AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.1991A>C	1.37:g.62737171T>G	ENSP00000360195:p.Gln664Pro	Somatic	0	119	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	68	149	31.19	B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KN_motif,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Q664P	ENST00000371153.4	37	c.1991	CCDS620.1	1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.575873	0.86645	.	.	ENSG00000132854	ENST00000371153;ENST00000354381;ENST00000371150	T;T;T	0.61040	0.14;0.33;0.29	5.67	5.67	0.87782	.	0.206588	0.24573	N	0.037370	T	0.79499	0.4456	M	0.86420	2.815	0.53005	D	0.999969	D;D	0.76494	0.999;0.999	D;D	0.75484	0.961;0.986	T	0.83343	-0.0007	10	0.87932	D	0	-13.621	15.924	0.79597	0.0:0.0:0.0:1.0	.	36;664	Q5T7N3-2;Q5T7N3	.;KANK4_HUMAN	P	664;36;20	ENSP00000360195:Q664P;ENSP00000346352:Q36P;ENSP00000360192:Q20P	ENSP00000346352:Q36P	Q	-	2	0	KANK4	62509759	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.532000	0.81985	2.163000	0.67991	0.459000	0.35465	CAG	-	NULL		0.473	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK4	protein_coding	OTTHUMT00000024877.1	T	NM_181712	-		62737171	-1	no_errors	ENST00000371153	ensembl	human	known	74_37	missense	SNP	1.000	G
MMP9	4318	genome.wustl.edu	37	20	44641114	44641114	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr20:44641114G>T	ENST00000372330.3	+	8	1242	c.1223G>T	c.(1222-1224)gGc>gTc	p.G408V	RP11-465L10.10_ENST00000535913.1_RNA	NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	408					collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	CACGCGCTGGGCTTAGATCAT	0.637																																																	0								ENSG00000100985						77.0	70.0	72.0					20																	44641114		2203	4300	6503	MMP9	SO:0001583	missense	0			-	HGNC		CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.1223G>T	20.37:g.44641114G>T	ENSP00000361405:p.Gly408Val	Somatic	0	66	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	72	16.28	B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_M10_metallopeptidase,pfam_FN_type2_col-bd,pfam_Hemopexin-like_repeat,pfam_PT,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Kringle-like,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_FN_type2_col-bd,smart_Hemopexin-like_repeat,pfscan_FN_type2_col-bd,prints_Pept_M10A	p.G408V	ENST00000372330.3	37	c.1223	CCDS13390.1	20	.	.	.	.	.	.	.	.	.	.	G	27.7	4.854531	0.91355	.	.	ENSG00000100985	ENST00000372330;ENST00000545925	D	0.84730	-1.89	4.99	4.99	0.66335	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94984	0.8377	H	0.96489	3.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96392	0.9290	10	0.87932	D	0	.	17.4497	0.87588	0.0:0.0:1.0:0.0	.	408	P14780	MMP9_HUMAN	V	408;53	ENSP00000361405:G408V	ENSP00000361405:G408V	G	+	2	0	MMP9	44074521	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	9.519000	0.98025	2.606000	0.88127	0.561000	0.74099	GGC	-	pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo,prints_Pept_M10A		0.637	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP9	protein_coding	OTTHUMT00000080337.1	G		-		44641114	+1	no_errors	ENST00000372330	ensembl	human	known	74_37	missense	SNP	1.000	T
TXNRD2	10587	genome.wustl.edu	37	22	19882492	19882493	+	5'UTR	INS	-	-	A	rs35599379|rs60076017	byFrequency	TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr22:19882492_19882493insA	ENST00000491939.1	-	0	1169_1170				TXNRD2_ENST00000400518.1_Intron|TXNRD2_ENST00000535882.1_Intron|TXNRD2_ENST00000542719.1_Intron|TXNRD2_ENST00000400521.1_Intron|TXNRD2_ENST00000334363.9_3'UTR|TXNRD2_ENST00000400519.1_Intron			Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2						cell redox homeostasis (GO:0045454)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|response to oxygen radical (GO:0000305)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|thioredoxin-disulfide reductase activity (GO:0004791)			breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|urinary_tract(2)	30	Colorectal(54;0.0993)					gactccatctcaaaaaaaaaaa	0.485																																																	0								ENSG00000184470																																			TXNRD2	SO:0001623	5_prime_UTR_variant	0				HGNC	AF106697	CCDS42981.1, CCDS63402.1	22q11.21	2014-09-17			ENSG00000184470	ENSG00000184470			18155	protein-coding gene	gene with protein product	"""thioredoxin reductase beta"", ""selenoprotein Z"""	606448				9923614, 10215850, 11012661	Standard	NM_006440		Approved	TR, TRXR2, TR3	uc021wlj.1	Q9NNW7	OTTHUMG00000149975	ENST00000491939.1:c.-711->T	22.37:g.19882503_19882503dupA		Somatic	0	12	0.00		0.6487880846458666	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	15	11.76	O95840|Q96IJ2|Q9H2Z5|Q9NZV3|Q9NZV4|Q9P2Y0|Q9P2Y1|Q9UQU8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000491939.1	37	NULL		22																																																																																			-	-		0.485	TXNRD2-005	KNOWN	basic	processed_transcript	TXNRD2	protein_coding	OTTHUMT00000314905.2	-	NM_006440			19882493	-1	no_errors	ENST00000491939	ensembl	human	known	74_37	rna	INS	0.022:0.027	A
TRPC7	57113	genome.wustl.edu	37	5	135651380	135651380	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr5:135651380T>C	ENST00000513104.1	-	3	1150	c.868A>G	c.(868-870)Att>Gtt	p.I290V	TRPC7_ENST00000426057.2_Intron|TRPC7_ENST00000355180.3_Intron|TRPC7-AS2_ENST00000513958.1_RNA	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	290					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCGTTTAAAATTGCTTCCACC	0.458																																																	0								ENSG00000069018						106.0	109.0	108.0					5																	135651380		2062	4221	6283	TRPC7	SO:0001583	missense	0			-	HGNC	AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.868A>G	5.37:g.135651380T>C	ENSP00000426070:p.Ile290Val	Somatic	0	72	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	52	8.77	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,prints_TRPC7_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.I290V	ENST00000513104.1	37	c.868	CCDS47267.2	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.69|18.69	3.678041|3.678041	0.68042|0.68042	.|.	.|.	ENSG00000069018|ENSG00000069018	ENST00000513104;ENST00000265193|ENST00000502753	T|.	0.66460|.	-0.21|.	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.57666|0.57666	0.2069|0.2069	L|L	0.35288|0.35288	1.05|1.05	0.80722|0.80722	D|D	1|1	B;B|.	0.23128|.	0.08;0.078|.	B;B|.	0.28011|.	0.085;0.078|.	T|T	0.53620|0.53620	-0.8413|-0.8413	10|5	0.29301|.	T|.	0.29|.	-13.7912|-13.7912	16.0238|16.0238	0.80522|0.80522	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	290;290|.	Q70T25;Q9HCX4|.	.;TRPC7_HUMAN|.	V|S	290|289	ENSP00000426070:I290V|.	ENSP00000265193:I290V|.	I|N	-|-	1|2	0|0	TRPC7|TRPC7	135679279|135679279	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.967000|0.967000	0.64934|0.64934	7.868000|7.868000	0.87116|0.87116	2.367000|2.367000	0.80283|0.80283	0.528000|0.528000	0.53228|0.53228	ATT|AAT	-	tigrfam_TRP_channel		0.458	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC7	protein_coding	OTTHUMT00000366975.1	T	NM_020389	-		135651380	-1	no_errors	ENST00000513104	ensembl	human	known	74_37	missense	SNP	1.000	C
NOP9	161424	genome.wustl.edu	37	14	24769849	24769850	+	In_Frame_Ins	INS	-	-	GAGGAG	rs113258190|rs544761261|rs71119069	byFrequency	TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr14:24769849_24769850insGAGGAG	ENST00000267425.3	+	2	576_577	c.483_484insGAGGAG	c.(484-486)gag>GAGGAGgag	p.162_162E>EEE	NOP9_ENST00000396802.3_In_Frame_Ins_p.162_162E>EEE|DHRS1_ENST00000396813.1_5'Flank|DHRS1_ENST00000288111.7_5'Flank	NM_174913.1	NP_777573.1	Q86U38	NOP9_HUMAN	NOP9 nucleolar protein	162	Poly-Glu.						poly(A) RNA binding (GO:0044822)	p.A161_E162insG(1)									GGAGTGCTGCAgaggaggagga	0.579																																																	1	Insertion - In frame(1)	liver(1)						ENSG00000196943																																			NOP9	SO:0001652	inframe_insertion	0				HGNC		CCDS9624.1, CCDS66616.1	14q12	2012-12-10	2012-12-10	2012-06-06	ENSG00000196943	ENSG00000196943			19826	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 21"", ""NOP9 nucleolar protein homolog (yeast)"""	C14orf21		21653694	Standard	XM_005267385		Approved		uc001wol.1	Q86U38	OTTHUMG00000029342	ENST00000267425.3:c.502_507dupGAGGAG	14.37:g.24769850_24769855dupGAGGAG	ENSP00000267425:p.GluGlu168dup	Somatic	NA	NA	NA		0.6487880846458666	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8MY76|Q8IVF0|Q8TBS6	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt	p.165in_frame_insEE	ENST00000267425.3	37	c.483_484	CCDS9624.1	14																																																																																			-	superfamily_ARM-type_fold		0.579	NOP9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP9	protein_coding	OTTHUMT00000073186.2	-				24769850	+1	no_errors	ENST00000267425	ensembl	human	known	74_37	in_frame_ins	INS	0.000:0.015	GAGGAG
RPN2	6185	genome.wustl.edu	37	20	35807790	35807791	+	Intron	INS	-	-	CTTATAGACAGGGCCCCGCGGCCGGCACT	rs57415986|rs11467214	byFrequency	TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr20:35807790_35807791insCTTATAGACAGGGCCCCGCGGCCGGCACT	ENST00000237530.6	+	1	324				MROH8_ENST00000400441.3_Splice_Site|MROH8_ENST00000441008.2_Frame_Shift_Ins_p.S17fs|RPN2_ENST00000373622.5_Intron	NM_002951.3	NP_002942.2	P04844	RPN2_HUMAN	ribophorin II						aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(2)|stomach(1)	24		Myeloproliferative disorder(115;0.00878)				GTTGCGCGTGGCTTTGGGGAGA	0.708														3247	0.648363	0.7753	0.6556	5008	,	,		16123	0.4673		0.6829	False		,,,				2504	0.6227																0								ENSG00000101353																																			MROH8	SO:0001627	intron_variant	0				HGNC	Y00282	CCDS13291.1, CCDS46599.1	20q12-q13.1	2013-03-06			ENSG00000118705	ENSG00000118705			10382	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	180490					Standard	NM_002951		Approved	SWP1, RPNII, RIBIIR, RPN-II	uc002xgp.3	P04844	OTTHUMG00000032409	ENST00000237530.6:c.13+18->CTTATAGACAGGGCCCCGCGGCCGGCACT	20.37:g.35807790_35807791insCTTATAGACAGGGCCCCGCGGCCGGCACT		Somatic	NA	NA	NA		0.6487880846458666	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5JYR6|Q6IBA5|Q96E21|Q9BUQ3|Q9UBE1	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.H31fs	ENST00000237530.6	37	c.94_93	CCDS13291.1	20																																																																																			-	NULL		0.708	RPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH8	protein_coding	OTTHUMT00000079076.2	-	NM_002951			35807791	-1	no_errors	ENST00000400441	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:0.052	CTTATAGACAGGGCCCCGCGGCCGGCACT
CHTF18	63922	genome.wustl.edu	37	16	841936	841936	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr16:841936A>G	ENST00000262315.9	+	9	1253	c.1190A>G	c.(1189-1191)gAg>gGg	p.E397G	CHTF18_ENST00000455171.2_Missense_Mutation_p.E425G|CHTF18_ENST00000317063.6_Missense_Mutation_p.E592G	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	397					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				TCTGTGGTGGAGATGAACGCC	0.627																																																	0								ENSG00000127586						51.0	54.0	53.0					16																	841936		2168	4272	6440	CHTF18	SO:0001583	missense	0			-	HGNC	BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.1190A>G	16.37:g.841936A>G	ENSP00000262315:p.Glu397Gly	Somatic	0	46	0.00		0.6487880846458666	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.E592G	ENST00000262315.9	37	c.1775	CCDS45371.1	16	.	.	.	.	.	.	.	.	.	.	A	25.2	4.610956	0.87258	.	.	ENSG00000127586	ENST00000317063;ENST00000455171;ENST00000262315	D;D;D	0.94280	-3.39;-3.39;-3.39	5.04	5.04	0.67666	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.96632	0.8901	M	0.84773	2.715	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97145	0.9827	10	0.87932	D	0	-24.8415	12.7304	0.57195	1.0:0.0:0.0:0.0	rs35825134	425;397	Q8WVB6-2;Q8WVB6	.;CTF18_HUMAN	G	592;425;397	ENSP00000313029:E592G;ENSP00000406252:E425G;ENSP00000262315:E397G	ENSP00000262315:E397G	E	+	2	0	CHTF18	781937	1.000000	0.71417	1.000000	0.80357	0.687000	0.40016	9.075000	0.94004	1.899000	0.54978	0.482000	0.46254	GAG	-	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.627	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHTF18	protein_coding	OTTHUMT00000109061.3	A	NM_022092	-		841936	+1	no_errors	ENST00000317063	ensembl	human	known	74_37	missense	SNP	1.000	G
FBN1	2200	genome.wustl.edu	37	15	48797234	48797234	+	Missense_Mutation	SNP	G	G	A	rs193922185		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr15:48797234G>A	ENST00000316623.5	-	16	2403	c.1948C>T	c.(1948-1950)Cgt>Tgt	p.R650C		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	650	EGF-like 10; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		ACACACACACGGCCATCCAGA	0.498																																																	0								ENSG00000166147						146.0	130.0	136.0					15																	48797234		2197	4296	6493	FBN1	SO:0001583	missense	0			-	HGNC	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.1948C>T	15.37:g.48797234G>A	ENSP00000325527:p.Arg650Cys	Somatic	0	38	0.00		0.6487880846458666	11	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	42	12.50	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.R650C	ENST00000316623.5	37	c.1948	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	G	32	5.156145	0.94686	.	.	ENSG00000166147	ENST00000316623	D	0.93019	-3.15	5.68	5.68	0.88126	Matrix fibril-associated (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.97009	0.9023	M	0.85945	2.785	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.96987	0.9719	10	0.56958	D	0.05	.	18.3597	0.90371	0.0:0.0:1.0:0.0	.	650	P35555	FBN1_HUMAN	C	650	ENSP00000325527:R650C	ENSP00000325527:R650C	R	-	1	0	FBN1	46584526	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	7.932000	0.87634	2.689000	0.91719	0.655000	0.94253	CGT	-	pfam_EGF-like_Ca-bd_dom,superfamily_TB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom		0.498	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	protein_coding	OTTHUMT00000417355.1	G		rs193922185		48797234	-1	no_errors	ENST00000316623	ensembl	human	known	74_37	missense	SNP	1.000	A
GUCY1A2	2977	genome.wustl.edu	37	11	106672147	106672147	+	Intron	SNP	G	G	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr11:106672147G>T	ENST00000526355.2	-	5	2161				GUCY1A2_ENST00000282249.2_Intron|AP001282.1_ENST00000578526.1_RNA|GUCY1A2_ENST00000347596.2_Intron	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	CTCATTTTATGTattaaaatt	0.308																																																	0								ENSG00000264542																																			AP001282.1	SO:0001627	intron_variant	0			-	Clone_based_ensembl_gene	X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.1692+8571C>A	11.37:g.106672147G>T		Somatic	0	63	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	41	30.51	A1L4C4|B7ZLT5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000526355.2	37	NULL	CCDS8335.1	11																																																																																			-	-		0.308	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	ENSG00000264542	protein_coding	OTTHUMT00000389003.2	G		-		106672147	-1	no_errors	ENST00000578526	ensembl	human	novel	74_37	rna	SNP	0.000	T
NSUN3	63899	genome.wustl.edu	37	3	93795203	93795203	+	Intron	SNP	C	C	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr3:93795203C>A	ENST00000314622.4	+	3	333				NSUN3_ENST00000485793.1_Intron	NM_022072.3	NP_071355.1	Q9H649	NSUN3_HUMAN	NOP2/Sun domain family, member 3								methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	18						TTCACTTCAGCAGTGTGAGCG	0.428																																																	0								ENSG00000178694																																			NSUN3	SO:0001627	intron_variant	0			-	HGNC	BC020602	CCDS2927.1	3q11.2	2009-11-23	2009-11-23		ENSG00000178694	ENSG00000178694		"""NOP2/Sun domain containing"""	26208	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 3"", ""NOL1/NOP2/Sun domain family, member 3"""			12477932	Standard	NM_022072		Approved	FLJ22609	uc003drl.1	Q9H649	OTTHUMG00000159025	ENST00000314622.4:c.123-7748C>A	3.37:g.93795203C>A		Somatic	0	35	0.00		0.6487880846458666	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	Q6PG41|Q8IXG9|Q9H6M2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000314622.4	37	NULL	CCDS2927.1	3																																																																																			-	-		0.428	NSUN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN3	protein_coding	OTTHUMT00000352934.1	C	NM_022072	-		93795203	+1	no_errors	ENST00000494128	ensembl	human	putative	74_37	rna	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578	ENSG00000141510						50.0	50.0	50.0					17																	7578406		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His	Somatic	0	27	0.00		0.6487880846458666	6	86.67	39	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	4	86.21	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	rs28934578		7578406	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	T
DLX1	1745	genome.wustl.edu	37	2	172950516	172950516	+	Silent	SNP	C	C	T	rs377533627		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr2:172950516C>T	ENST00000361725.4	+	1	563	c.111C>T	c.(109-111)caC>caT	p.H37H	DLX1_ENST00000341900.6_Silent_p.H37H	NM_178120.4	NP_835221.2	P56177	DLX1_HUMAN	distal-less homeobox 1	37					cerebral cortex GABAergic interneuron fate commitment (GO:0021893)|embryonic skeletal system development (GO:0048706)|hippocampus development (GO:0021766)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|proximal/distal pattern formation (GO:0009954)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|subpallium development (GO:0021544)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|lung(4)|prostate(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.216)			CCATGTCCCACGGGCACTACT	0.622																																																	0								ENSG00000144355						144.0	136.0	139.0					2																	172950516		2203	4300	6503	DLX1	SO:0001819	synonymous_variant	0			-	HGNC	BC013010	CCDS2247.2, CCDS33328.1	2q31.1	2011-06-20	2005-12-22		ENSG00000144355	ENSG00000144355		"""Homeoboxes / ANTP class : NKL subclass"""	2914	protein-coding gene	gene with protein product		600029	"""distal-less homeo box 1"""			7907794	Standard	NM_001038493		Approved		uc002uhl.3	P56177	OTTHUMG00000073951	ENST00000361725.4:c.111C>T	2.37:g.172950516C>T		Somatic	0	73	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	51	21.54	D3DPD7|Q53ZU4|Q7Z724|Q8IYB2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.H37	ENST00000361725.4	37	c.111	CCDS2247.2	2																																																																																			-	NULL		0.622	DLX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX1	protein_coding	OTTHUMT00000405916.1	C	XM_087198	-		172950516	+1	no_errors	ENST00000361725	ensembl	human	known	74_37	silent	SNP	1.000	T
AGTPBP1	23287	genome.wustl.edu	37	9	88247722	88247722	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr9:88247722G>T	ENST00000357081.3	-	14	2014	c.1870C>A	c.(1870-1872)Ctc>Atc	p.L624I	AGTPBP1_ENST00000432218.1_Missense_Mutation_p.L462I|AGTPBP1_ENST00000337006.4_3'UTR|AGTPBP1_ENST00000376083.3_Missense_Mutation_p.L584I|AGTPBP1_ENST00000376109.3_Missense_Mutation_p.L636I			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	624					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						GGGTCATGGAGTGTTGGTCCA	0.433																																																	0								ENSG00000135049						172.0	141.0	151.0					9																	88247722		2203	4300	6503	AGTPBP1	SO:0001583	missense	0			-	HGNC	AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.1870C>A	9.37:g.88247722G>T	ENSP00000349592:p.Leu624Ile	Somatic	0	63	0.00		0.6487880846458666	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	67	36.19	B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.L636I	ENST00000357081.3	37	c.1906		9	.	.	.	.	.	.	.	.	.	.	G	17.11	3.306121	0.60305	.	.	ENSG00000135049	ENST00000357081;ENST00000376083;ENST00000376109;ENST00000432218	T;T;T;T	0.53423	2.0;1.99;1.96;0.62	6.03	6.03	0.97812	.	0.114304	0.64402	D	0.000011	T	0.48696	0.1514	L	0.54323	1.7	0.80722	D	1	P;P;P;P	0.48294	0.843;0.908;0.906;0.721	B;B;B;B	0.43123	0.36;0.232;0.409;0.26	T	0.46596	-0.9180	10	0.45353	T	0.12	-10.9082	16.9745	0.86309	0.0:0.1354:0.8646:0.0	.	636;624;462;584	Q9UPW5-3;Q9UPW5;B4DHX2;Q9UPW5-2	.;CBPC1_HUMAN;.;.	I	624;584;636;462	ENSP00000349592:L624I;ENSP00000365251:L584I;ENSP00000365277:L636I;ENSP00000402804:L462I	ENSP00000349592:L624I	L	-	1	0	AGTPBP1	87437542	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	5.889000	0.69766	2.861000	0.98227	0.655000	0.94253	CTC	-	NULL		0.433	AGTPBP1-004	KNOWN	basic	protein_coding	AGTPBP1	protein_coding	OTTHUMT00000052893.1	G	NM_015239	-		88247722	-1	no_errors	ENST00000376109	ensembl	human	known	74_37	missense	SNP	1.000	T
RALGDS	5900	genome.wustl.edu	37	9	135976920	135976920	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr9:135976920T>C	ENST00000372050.3	-	16	2462	c.2441A>G	c.(2440-2442)tAc>tGc	p.Y814C	RALGDS_ENST00000372047.3_Missense_Mutation_p.Y802C|RALGDS_ENST00000393160.3_Missense_Mutation_p.Y759C|RALGDS_ENST00000542690.1_Missense_Mutation_p.Y885C|RALGDS_ENST00000393157.3_Missense_Mutation_p.Y813C|RALGDS_ENST00000372062.3_Missense_Mutation_p.Y785C|RALGDS_ENST00000469972.1_5'UTR	NM_006266.2	NP_006257.1	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator	814	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)		GATGCTCTTGTACATGTTGCC	0.647			T	CIITA	"""PMBL, Hodgkin Lymphona, """																																Melanoma(189;762 2088 15384 21931 52515)			Dom	yes		9	9q34.3	5900	ral guanine nucleotide dissociation stimulator		L	0								ENSG00000160271						117.0	121.0	120.0					9																	135976920		2203	4300	6503	RALGDS	SO:0001583	missense	0			-	HGNC	AB037729	CCDS6959.1, CCDS43897.1, CCDS65172.1, CCDS65173.1, CCDS65174.1	9q34.3	2009-04-08			ENSG00000160271	ENSG00000160271			9842	protein-coding gene	gene with protein product		601619				7972015	Standard	NM_006266		Approved	RGF, RalGEF, RGDS	uc004ccr.3	Q12967	OTTHUMG00000020858	ENST00000372050.3:c.2441A>G	9.37:g.135976920T>C	ENSP00000361120:p.Tyr814Cys	Somatic	0	29	0.00		0.6487880846458666	65	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B7Z753|E7ER93|E7ERZ0|Q5T7V4|Q6KH11|Q6PCE1|Q6ZSD5|Q9HAX7|Q9HAY1|Q9HCT1|Q9P2N8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_Ras-assoc,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.Y885C	ENST00000372050.3	37	c.2654	CCDS6959.1	9	.	.	.	.	.	.	.	.	.	.	T	20.4	3.978779	0.74360	.	.	ENSG00000160271	ENST00000372050;ENST00000372047;ENST00000393160;ENST00000393157;ENST00000542690;ENST00000372062	T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16;-0.16	5.12	3.98	0.46160	Ras-association (3);	0.000000	0.64402	D	0.000002	T	0.79616	0.4476	M	0.86864	2.845	0.80722	D	1	P;D;D;D;D;D;D	0.89917	0.603;1.0;1.0;1.0;1.0;1.0;1.0	B;D;D;D;D;D;D	0.91635	0.206;0.974;0.999;0.986;0.993;0.993;0.998	T	0.81158	-0.1060	10	0.87932	D	0	.	10.1356	0.42704	0.0:0.0793:0.0:0.9206	.	885;785;802;759;813;802;814	F5H6M6;E7ER93;Q8TEK9;Q6KH11;E7ERZ0;Q6PCE1;Q12967	.;.;.;.;.;.;GNDS_HUMAN	C	814;802;759;813;885;785	ENSP00000361120:Y814C;ENSP00000361117:Y802C;ENSP00000376867:Y759C;ENSP00000376864:Y813C;ENSP00000437518:Y885C;ENSP00000361132:Y785C	ENSP00000361117:Y802C	Y	-	2	0	RALGDS	134966741	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.934000	0.87649	0.894000	0.36317	0.379000	0.24179	TAC	-	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc		0.647	RALGDS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALGDS	protein_coding	OTTHUMT00000054837.1	T	NM_006266	-		135976920	-1	no_errors	ENST00000542690	ensembl	human	known	74_37	missense	SNP	1.000	C
PKHD1	5314	genome.wustl.edu	37	6	51892681	51892681	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr6:51892681T>A	ENST00000371117.3	-	31	3849	c.3574A>T	c.(3574-3576)Atc>Ttc	p.I1192F	PKHD1_ENST00000340994.4_Missense_Mutation_p.I1192F	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1192	IPT/TIG 6; atypical.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					AGGTACTGGATGTGGAGATCA	0.433																																																	0								ENSG00000170927						73.0	72.0	72.0					6																	51892681		2203	4300	6503	PKHD1	SO:0001583	missense	0			-	HGNC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.3574A>T	6.37:g.51892681T>A	ENSP00000360158:p.Ile1192Phe	Somatic	0	47	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	6	50.00	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.I1192F	ENST00000371117.3	37	c.3574	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	T	23.1	4.375138	0.82682	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.88509	-2.23;-2.39	5.71	5.71	0.89125	Cell surface receptor IPT/TIG (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.92606	0.7651	M	0.72894	2.215	0.41973	D	0.990761	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.96	D	0.93029	0.6447	10	0.52906	T	0.07	.	15.1592	0.72767	0.0:0.0:0.0:1.0	.	1192;1192	P08F94-2;P08F94	.;PKHD1_HUMAN	F	1192	ENSP00000360158:I1192F;ENSP00000341097:I1192F	ENSP00000341097:I1192F	I	-	1	0	PKHD1	52000640	1.000000	0.71417	0.386000	0.26170	0.959000	0.62525	5.258000	0.65479	2.171000	0.68590	0.533000	0.62120	ATC	-	superfamily_Ig_E-set,smart_IPT		0.433	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	protein_coding	OTTHUMT00000040893.1	T	NM_138694	-		51892681	-1	no_errors	ENST00000371117	ensembl	human	known	74_37	missense	SNP	0.984	A
STAU2	27067	genome.wustl.edu	37	8	74351352	74351352	+	Intron	SNP	C	C	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr8:74351352C>A	ENST00000524300.1	-	14	1881				STAU2_ENST00000521210.1_Intron|STAU2_ENST00000522695.1_Intron|STAU2_ENST00000523558.1_Intron|STAU2-AS1_ENST00000517604.1_lincRNA	NM_001164380.1|NM_001164381.1	NP_001157852.1|NP_001157853.1	Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2						transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			aaatatttaacaactgactct	0.483																																																	0								ENSG00000253302																																			STAU2-AS1	SO:0001627	intron_variant	0			-	HGNC	Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499	ENST00000524300.1:c.1531-16415G>T	8.37:g.74351352C>A		Somatic	0	26	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	10	52.38	B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000524300.1	37	NULL	CCDS55247.1	8																																																																																			-	-		0.483	STAU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAU2-AS1	protein_coding	OTTHUMT00000379000.2	C	NM_001164380	-		74351352	+1	no_errors	ENST00000522703	ensembl	human	known	74_37	rna	SNP	0.024	A
ATP7B	540	genome.wustl.edu	37	13	52523831	52523831	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr13:52523831delA	ENST00000242839.4	-	12	2988	c.2832delT	c.(2830-2832)tttfs	p.F944fs	ATP7B_ENST00000418097.2_Frame_Shift_Del_p.F944fs|ATP7B_ENST00000482841.1_Intron|ATP7B_ENST00000448424.2_Frame_Shift_Del_p.F866fs|ATP7B_ENST00000344297.5_Intron|ATP7B_ENST00000417240.2_Frame_Shift_Del_p.F216fs|ATP7B_ENST00000400366.3_Frame_Shift_Del_p.F833fs|ATP7B_ENST00000400370.3_Frame_Shift_Del_p.F514fs	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	944					cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	CAAAATCGATAAAACCGATTA	0.398									Wilson disease																																								0								ENSG00000123191						127.0	115.0	119.0					13																	52523831		1891	4121	6012	ATP7B	SO:0001589	frameshift_variant	0	Familial Cancer Database			HGNC	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.2832delT	13.37:g.52523831delA	ENSP00000242839:p.Phe944fs	Somatic	0	35	0.00		0.6487880846458666	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_HeavyMe-assoc_HMA,pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,prints_Cation_transp_P_typ_ATPase,tigrfam_Cation_transp_P-typ_ATPase_IB,tigrfam_Cation_transp_P_typ_ATPase,tigrfam_HMA_Cu_ion-bd	p.F944fs	ENST00000242839.4	37	c.2832	CCDS41892.1	13																																																																																			-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_Cation_transp_P-typ_ATPase_IB		0.398	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP7B	protein_coding	OTTHUMT00000045981.1	A	NM_000053			52523831	-1	no_errors	ENST00000242839	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
OCEL1	79629	genome.wustl.edu	37	19	17339619	17339619	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr19:17339619G>A	ENST00000215061.4	+	6	724	c.680G>A	c.(679-681)gGc>gAc	p.G227D	OCEL1_ENST00000601529.1_3'UTR|OCEL1_ENST00000597836.1_Missense_Mutation_p.G171D	NM_024578.1	NP_078854.1	Q9H607	OCEL1_HUMAN	occludin/ELL domain containing 1	227										central_nervous_system(2)|endometrium(2)|kidney(1)|lung(2)	7						TAGGATCCTGGCTTCCTGGAC	0.552																																																	0								ENSG00000099330						62.0	59.0	60.0					19																	17339619		2203	4300	6503	OCEL1	SO:0001583	missense	0			-	HGNC	BC029361	CCDS12351.1	19p13.11	2008-02-05				ENSG00000099330			26221	protein-coding gene	gene with protein product						12477932	Standard	NM_024578		Approved	FLJ22709	uc002nfp.3	Q9H607		ENST00000215061.4:c.680G>A	19.37:g.17339619G>A	ENSP00000215061:p.Gly227Asp	Somatic	0	46	0.00		0.6487880846458666	192	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Occludin_RNApol2_elong_fac_ELL	p.G227D	ENST00000215061.4	37	c.680	CCDS12351.1	19	.	.	.	.	.	.	.	.	.	.	G	15.95	2.984931	0.53934	.	.	ENSG00000099330	ENST00000215061	T	0.20738	2.05	4.12	1.89	0.25635	Occludin/RNA polymerase II elongation factor, ELL domain (1);	1.110570	0.06616	N	0.756546	T	0.19127	0.0459	L	0.29908	0.895	0.27491	N	0.952298	P	0.37914	0.611	B	0.41036	0.346	T	0.24476	-1.0159	10	0.49607	T	0.09	-6.7488	8.3554	0.32327	0.0:0.1662:0.6641:0.1697	.	227	Q9H607	OCEL1_HUMAN	D	227	ENSP00000215061:G227D	ENSP00000215061:G227D	G	+	2	0	OCEL1	17200619	0.390000	0.25213	0.997000	0.53966	0.971000	0.66376	1.532000	0.36029	2.140000	0.66376	0.491000	0.48974	GGC	-	pfam_Occludin_RNApol2_elong_fac_ELL		0.552	OCEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCEL1	protein_coding	OTTHUMT00000463307.1	G	NM_024578	-		17339619	+1	no_errors	ENST00000215061	ensembl	human	known	74_37	missense	SNP	0.433	A
MEX3C	51320	genome.wustl.edu	37	18	48723146	48723154	+	Intron	DEL	GCCGCCGCG	GCCGCCGCG	-	rs78074704|rs530394988|rs147438518|rs201868643|rs62092914|rs530602218	byFrequency	TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	GCCGCCGCG	GCCGCCGCG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr18:48723146_48723154delGCCGCCGCG	ENST00000591040.1	-	2	43				MEX3C_ENST00000592416.1_5'Flank			Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C						chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		CCccgccgccgccgccgcggccgccgccT	0.78																																																	0								ENSG00000176624			429,1467		144,141,663						-0.2	0.9		dbSNP_131	4	2100,2286		804,492,897	no	coding	MEX3C	NM_016626.4		948,633,1560	A1A1,A1R,RR		47.8796,22.6266,40.2579				2529,3753				MEX3C	SO:0001627	intron_variant	0				HGNC	BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693	ENST00000591040.1:c.757-19200CGCGGCGGC>-	18.37:g.48723146_48723154delGCCGCCGCG		Somatic	NA	NA	NA		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A1L022|Q9NZE3	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_KH_dom_type_1,smart_KH_dom,smart_Znf_RING,pfscan_Znf_RING,pfscan_KH_dom_type_1	p.AAA182in_frame_del	ENST00000591040.1	37	c.545_537		18																																																																																			-	NULL		0.780	MEX3C-003	KNOWN	mRNA_end_NF|basic	processed_transcript	MEX3C	protein_coding	OTTHUMT00000449559.1	GCCGCCGCG	NM_016626			48723154	-1	no_errors	ENST00000406189	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.997	-
CCSER1	401145	genome.wustl.edu	37	4	92520141	92520141	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr4:92520141A>T	ENST00000509176.1	+	11	2924	c.2636A>T	c.(2635-2637)aAg>aTg	p.K879M	CCSER1_ENST00000333691.8_Missense_Mutation_p.K879M	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	879																	TACAGCAGGAAGAATGTGTTT	0.493																																																	0								ENSG00000184305						48.0	42.0	44.0					4																	92520141		692	1591	2283	CCSER1	SO:0001583	missense	0			-	HGNC		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.2636A>T	4.37:g.92520141A>T	ENSP00000425040:p.Lys879Met	Somatic	0	55	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	36	18.18	Q4W5M0|Q86V57	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K879M	ENST00000509176.1	37	c.2636	CCDS47099.1	4	.	.	.	.	.	.	.	.	.	.	A	17.72	3.459845	0.63401	.	.	ENSG00000184305	ENST00000509176;ENST00000333691	T;T	0.37411	1.2;1.2	5.49	5.49	0.81192	.	.	.	.	.	T	0.42063	0.1186	N	0.19112	0.55	0.33422	D	0.57994	D	0.69078	0.997	P	0.60345	0.873	T	0.57195	-0.7853	9	0.87932	D	0	-11.6829	14.4428	0.67330	1.0:0.0:0.0:0.0	.	879	Q9C0I3	F190A_HUMAN	M	879	ENSP00000425040:K879M;ENSP00000329482:K879M	ENSP00000329482:K879M	K	+	2	0	FAM190A	92739164	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.648000	0.74359	2.205000	0.71048	0.528000	0.53228	AAG	-	NULL		0.493	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCSER1	protein_coding	OTTHUMT00000363109.3	A	NM_001145065	-		92520141	+1	no_errors	ENST00000333691	ensembl	human	known	74_37	missense	SNP	1.000	T
ALMS1	7840	genome.wustl.edu	37	2	73676274	73676274	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr2:73676274A>T	ENST00000264448.6	+	8	2728	c.2617A>T	c.(2617-2619)Acc>Tcc	p.T873S	ALMS1_ENST00000409009.1_Missense_Mutation_p.T831S|ALMS1_ENST00000377715.1_Missense_Mutation_p.T873S	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	873	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CTATCAGCAGACCTTACCCAA	0.483																																																	0								ENSG00000116127						87.0	91.0	90.0					2																	73676274		1888	4108	5996	ALMS1	SO:0001583	missense	0			-	HGNC	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.2617A>T	2.37:g.73676274A>T	ENSP00000264448:p.Thr873Ser	Somatic	0	36	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	38	22.45	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T873S	ENST00000264448.6	37	c.2617	CCDS42697.1	2	.	.	.	.	.	.	.	.	.	.	A	5.780	0.328326	0.10956	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.16073	3.25;3.25;2.37	3.66	-7.32	0.01436	.	6.448260	0.00541	N	0.000233	T	0.09335	0.0230	N	0.22421	0.69	0.09310	N	1	P;P;P	0.44241	0.825;0.829;0.683	B;B;B	0.38264	0.255;0.269;0.181	T	0.23619	-1.0183	10	0.10377	T	0.69	.	9.4102	0.38487	0.2543:0.1308:0.6149:0.0	.	873;831;873	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	S	831;873;873	ENSP00000386627:T831S;ENSP00000264448:T873S;ENSP00000366944:T873S	ENSP00000264448:T873S	T	+	1	0	ALMS1	73529782	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-2.893000	0.00708	-1.956000	0.01022	0.482000	0.46254	ACC	-	NULL		0.483	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	protein_coding	OTTHUMT00000327776.1	A	NM_015120	-		73676274	+1	no_errors	ENST00000264448	ensembl	human	known	74_37	missense	SNP	0.000	T
ZFHX4	79776	genome.wustl.edu	37	8	77768255	77768255	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr8:77768255C>G	ENST00000521891.2	+	10	9546	c.9098C>G	c.(9097-9099)tCa>tGa	p.S3033*	ZFHX4_ENST00000518282.1_Nonsense_Mutation_p.S3007*|ZFHX4_ENST00000050961.6_Nonsense_Mutation_p.S2988*|ZFHX4_ENST00000455469.2_Nonsense_Mutation_p.S2988*	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2988			V -> G (in dbSNP:rs16939380).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CAGCACATTTCAAAAGTGAGG	0.537										HNSCC(33;0.089)																																							0								ENSG00000091656						66.0	66.0	66.0					8																	77768255		1959	4144	6103	ZFHX4	SO:0001587	stop_gained	0			-	HGNC		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9098C>G	8.37:g.77768255C>G	ENSP00000430497:p.Ser3033*	Somatic	0	38	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	39	18.75	G3V138|Q18PS0|Q6ZN20	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.S3033*	ENST00000521891.2	37	c.9098	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	C	51	18.191760	0.99901	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	.	.	.	5.33	4.46	0.54185	.	0.204155	0.24492	U	0.038046	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	10.2922	0.43603	0.0:0.8508:0.0:0.1492	.	.	.	.	X	3033;3017;2988;2988;3007	.	ENSP00000050961:S2988X	S	+	2	0	ZFHX4	77930810	0.998000	0.40836	0.976000	0.42696	0.972000	0.66771	4.678000	0.61641	1.491000	0.48482	0.655000	0.94253	TCA	-	smart_Znf_U1		0.537	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	protein_coding	OTTHUMT00000379197.2	C	NM_024721	-		77768255	+1	no_errors	ENST00000521891	ensembl	human	known	74_37	nonsense	SNP	0.983	G
SLC39A10	57181	genome.wustl.edu	37	2	196581640	196581640	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr2:196581640C>T	ENST00000409086.3	+	7	2251	c.1976C>T	c.(1975-1977)tCc>tTc	p.S659F	SLC39A10_ENST00000359634.5_Missense_Mutation_p.S659F|SLC39A10_ENST00000541054.1_Missense_Mutation_p.S209F	NM_001127257.1	NP_001120729.1	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter), member 10	659					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(16)|pancreas(1)|prostate(1)|skin(2)	34			OV - Ovarian serous cystadenocarcinoma(117;0.221)			CATTCTGGATCCGATCTGAAA	0.488																																																	0								ENSG00000196950						136.0	127.0	130.0					2																	196581640		2203	4300	6503	SLC39A10	SO:0001583	missense	0			-	HGNC		CCDS33353.1	2q33.1	2013-05-22			ENSG00000196950	ENSG00000196950		"""Solute carriers"""	20861	protein-coding gene	gene with protein product		608733	"""solute carrier family 39 (metal ion transporter), member 10"""			12659941	Standard	NM_020342		Approved	KIAA1265, FLJ90515, DKFZp564L2123	uc002utg.4	Q9ULF5	OTTHUMG00000154380	ENST00000409086.3:c.1976C>T	2.37:g.196581640C>T	ENSP00000386766:p.Ser659Phe	Somatic	0	80	0.00		0.6487880846458666	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	58	12.12	A8K5C6|B4DGU0|Q3MJA4|Q68CR5|Q6DKH6|Q9Y3Z1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ZIP	p.S659F	ENST00000409086.3	37	c.1976	CCDS33353.1	2	.	.	.	.	.	.	.	.	.	.	C	19.46	3.831824	0.71258	.	.	ENSG00000196950	ENST00000409086;ENST00000359634;ENST00000541054	T;T;T	0.50813	0.73;0.73;0.73	5.54	5.54	0.83059	.	0.249082	0.39687	N	0.001290	T	0.55242	0.1908	L	0.39898	1.24	0.37215	D	0.904984	D	0.61080	0.989	P	0.61070	0.883	T	0.61033	-0.7144	10	0.66056	D	0.02	.	12.275	0.54730	0.2788:0.7212:0.0:0.0	.	659	Q9ULF5	S39AA_HUMAN	F	659;659;209	ENSP00000386766:S659F;ENSP00000352655:S659F;ENSP00000437787:S209F	ENSP00000352655:S659F	S	+	2	0	SLC39A10	196289885	0.999000	0.42202	0.782000	0.31804	0.587000	0.36485	6.194000	0.72082	2.890000	0.99128	0.650000	0.86243	TCC	-	pfam_ZIP		0.488	SLC39A10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC39A10	protein_coding	OTTHUMT00000335186.1	C	XM_047707	-		196581640	+1	no_errors	ENST00000359634	ensembl	human	known	74_37	missense	SNP	0.989	T
BPIFB6	128859	genome.wustl.edu	37	20	31622058	31622058	+	Silent	SNP	C	C	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr20:31622058C>T	ENST00000349552.1	+	3	264	c.264C>T	c.(262-264)ttC>ttT	p.F88F		NM_174897.2	NP_777557.1	Q8NFQ5	BPIB6_HUMAN	BPI fold containing family B, member 6	88						extracellular region (GO:0005576)	lipid binding (GO:0008289)										TGGGCATCTTCCAATGTGTGT	0.562																																																	0								ENSG00000167104						171.0	132.0	145.0					20																	31622058		2203	4300	6503	BPIFB6	SO:0001819	synonymous_variant	0			-	HGNC	AF465767	CCDS13211.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000167104	ENSG00000167104		"""BPI fold containing"""	16504	protein-coding gene	gene with protein product		614110	"""bactericidal/permeability-increasing protein-like 3"""	BPIL3		12185532, 21787333	Standard	NM_174897		Approved	LPLUNC6	uc010zuc.2	Q8NFQ5	OTTHUMG00000032238	ENST00000349552.1:c.264C>T	20.37:g.31622058C>T		Somatic	0	44	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	50	15.25		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_C	p.F88	ENST00000349552.1	37	c.264	CCDS13211.1	20																																																																																			-	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom		0.562	BPIFB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB6	protein_coding	OTTHUMT00000078658.2	C	NM_174897	-		31622058	+1	no_errors	ENST00000349552	ensembl	human	known	74_37	silent	SNP	1.000	T
NRDE2	55051	genome.wustl.edu	37	14	90756883	90756883	+	Silent	SNP	C	C	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr14:90756883C>T	ENST00000354366.3	-	10	2143	c.1911G>A	c.(1909-1911)gtG>gtA	p.V637V	NRDE2_ENST00000357904.3_Silent_p.V406V	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	637																	GGAAGGCCTCCACCAGCTGGA	0.468																																																	0								ENSG00000119720						82.0	84.0	83.0					14																	90756883		2203	4300	6503	NRDE2	SO:0001819	synonymous_variant	0			-	HGNC	AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.1911G>A	14.37:g.90756883C>T		Somatic	0	29	0.00		0.6487880846458666	6	14.29	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	22	21.43	B4DH71|Q4G0A7|Q9NWH6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_NRDE-2	p.V637	ENST00000354366.3	37	c.1911	CCDS9890.1	14																																																																																			-	NULL		0.468	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRDE2	protein_coding	OTTHUMT00000411264.1	C	NM_017970	-		90756883	-1	no_errors	ENST00000354366	ensembl	human	known	74_37	silent	SNP	0.000	T
SIGLEC9	27180	genome.wustl.edu	37	19	51631241	51631241	+	Frame_Shift_Del	DEL	G	G	-	rs372152063		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr19:51631241delG	ENST00000250360.3	+	5	1118	c.1051delG	c.(1051-1053)gggfs	p.G352fs	SIGLEC9_ENST00000440804.3_Frame_Shift_Del_p.G352fs	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	352					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		GGGGGTGGTCGGGGGAGCTGG	0.547																																																	0								ENSG00000129450						137.0	140.0	139.0					19																	51631241		2203	4300	6503	SIGLEC9	SO:0001589	frameshift_variant	0				HGNC	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.1051delG	19.37:g.51631241delG	ENSP00000250360:p.Gly352fs	Somatic	0	55	0.00		0.6487880846458666	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	Q6GTU4|Q9BYI9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom	p.G352fs	ENST00000250360.3	37	c.1051	CCDS12825.1	19																																																																																			-	NULL		0.547	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIGLEC9	protein_coding	OTTHUMT00000464224.1	G	NM_014441			51631241	+1	no_errors	ENST00000440804	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
UBXN10	127733	genome.wustl.edu	37	1	20517768	20517768	+	Silent	SNP	C	C	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr1:20517768C>T	ENST00000375099.3	+	2	798	c.714C>T	c.(712-714)caC>caT	p.H238H		NM_152376.3	NP_689589.1	Q96LJ8	UBX10_HUMAN	UBX domain protein 10	238	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.									endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)|skin(2)	14						CCTACCGACACTGCAGCATTG	0.502																																																	0								ENSG00000162543						74.0	75.0	75.0					1																	20517768		2203	4300	6503	UBXN10	SO:0001819	synonymous_variant	0			-	HGNC	AK058158	CCDS205.1	1p36.13	2008-07-25	2008-07-25	2008-07-25	ENSG00000162543	ENSG00000162543		"""UBX domain containing"""	26354	protein-coding gene	gene with protein product			"""UBX domain containing 3"""	UBXD3		12477932	Standard	NM_152376		Approved	FLJ25429	uc001bdb.3	Q96LJ8	OTTHUMG00000002708	ENST00000375099.3:c.714C>T	1.37:g.20517768C>T		Somatic	0	47	0.00		0.6487880846458666	5	28.57	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	13	40.91	Q5R386	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_UBX,smart_UBX,pfscan_UBX	p.H238	ENST00000375099.3	37	c.714	CCDS205.1	1																																																																																			-	pfam_UBX,smart_UBX,pfscan_UBX		0.502	UBXN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN10	protein_coding	OTTHUMT00000007693.1	C	NM_152376	-		20517768	+1	no_errors	ENST00000375099	ensembl	human	known	74_37	silent	SNP	0.976	T
CHRFAM7A	89832	genome.wustl.edu	37	15	30665316	30665316	+	Missense_Mutation	SNP	G	G	A	rs527713019		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr15:30665316G>A	ENST00000299847.2	-	6	646	c.193C>T	c.(193-195)Cgc>Tgc	p.R65C	CHRFAM7A_ENST00000401522.3_De_novo_Start_OutOfFrame|CHRFAM7A_ENST00000567722.1_5'Flank|CHRFAM7A_ENST00000397827.3_De_novo_Start_OutOfFrame	NM_139320.1	NP_647536.1	Q494W8	CRFM7_HUMAN	CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion	65						integral component of membrane (GO:0016021)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(1)|skin(2)	6		all_lung(180;3.42e-11)|Breast(32;0.000153)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		GGAAACCAGCGTACATCGATG	0.493													.|||	1	0.000199681	0.0	0.0	5008	,	,		21469	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000166664																																			CHRFAM7A	SO:0001583	missense	0			-	HGNC	AF029838	CCDS32184.1, CCDS42008.1	15q13.2	2013-04-24	2006-02-01		ENSG00000166664	ENSG00000166664			15781	protein-coding gene	gene with protein product		609756				11829490	Standard	NM_139320		Approved	D-10, CHRNA7-DR1	uc001zdt.1	Q494W8	OTTHUMG00000175645	ENST00000299847.2:c.193C>T	15.37:g.30665316G>A	ENSP00000299847:p.Arg65Cys	Somatic	0	65	0.00		0.6487880846458666	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	57	13.64	A8KAB9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	p.R65C	ENST00000299847.2	37	c.193	CCDS32184.1	15	.	.	.	.	.	.	.	.	.	.	.	13.66	2.303252	0.40795	.	.	ENSG00000166664	ENST00000299847	T	0.80393	-1.37	1.94	1.94	0.25998	Neurotransmitter-gated ion-channel ligand-binding (3);Neurotransmitter-gated ion-channel, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.89473	0.6725	M	0.89658	3.05	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.90009	0.4120	10	0.72032	D	0.01	.	9.9401	0.41576	0.0:0.0:1.0:0.0	.	65	Q494W8	CRFM7_HUMAN	C	65	ENSP00000299847:R65C	ENSP00000299847:R65C	R	-	1	0	CHRFAM7A	28452608	1.000000	0.71417	0.985000	0.45067	0.180000	0.23129	5.561000	0.67339	1.400000	0.46741	0.184000	0.17185	CGC	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.493	CHRFAM7A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRFAM7A	protein_coding	OTTHUMT00000430700.1	G	NM_148911	-		30665316	-1	no_errors	ENST00000299847	ensembl	human	known	74_37	missense	SNP	1.000	A
FAM65B	9750	genome.wustl.edu	37	6	24874015	24874015	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr6:24874015G>T	ENST00000259698.4	-	3	289	c.114C>A	c.(112-114)ttC>ttA	p.F38L	FAM65B_ENST00000510784.2_Missense_Mutation_p.F72L|FAM65B_ENST00000540914.1_Missense_Mutation_p.F38L|FAM65B_ENST00000538035.1_Missense_Mutation_p.F67L|FAM65B_ENST00000378023.4_Missense_Mutation_p.F38L	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	38					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						AATTTTCAATGAAGGAGTTAC	0.398																																																	0								ENSG00000111913						81.0	72.0	75.0					6																	24874015		1835	4095	5930	FAM65B	SO:0001583	missense	0			-	HGNC	U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.114C>A	6.37:g.24874015G>T	ENSP00000259698:p.Phe38Leu	Somatic	0	42	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.F38L	ENST00000259698.4	37	c.114	CCDS47383.1	6	.	.	.	.	.	.	.	.	.	.	G	16.09	3.025328	0.54683	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	T;T;T;T;T	0.02032	4.49;4.49;4.49;4.49;4.49	5.53	3.77	0.43336	.	0.000000	0.85682	D	0.000000	T	0.02083	0.0065	N	0.24115	0.695	0.58432	D	0.999994	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.80764	0.994;0.994;0.994;0.994	T	0.64183	-0.6467	10	0.32370	T	0.25	-30.3837	8.9113	0.35555	0.2804:0.0:0.7196:0.0	.	72;67;38;38	B7Z6U4;F5GX51;Q9Y4F9-2;Q9Y4F9	.;.;.;FA65B_HUMAN	L	38;67;38;38;72	ENSP00000259698:F38L;ENSP00000441138:F67L;ENSP00000367262:F38L;ENSP00000438425:F38L;ENSP00000441305:F72L	ENSP00000259698:F38L	F	-	3	2	FAM65B	24981994	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.614000	0.54160	0.719000	0.32188	-0.126000	0.14955	TTC	-	NULL		0.398	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM65B	protein_coding	OTTHUMT00000040024.2	G		-		24874015	-1	no_errors	ENST00000259698	ensembl	human	known	74_37	missense	SNP	1.000	T
LINGO1	84894	genome.wustl.edu	37	15	77907078	77907078	+	Missense_Mutation	SNP	G	G	A	rs199628078		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr15:77907078G>A	ENST00000355300.6	-	2	1345	c.1171C>T	c.(1171-1173)Cgg>Tgg	p.R391W	LINGO1_ENST00000561030.1_Missense_Mutation_p.R385W	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	391	LRRCT.				central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						GGCTGCTGCCGGTTGAAGTTG	0.652																																																	0								ENSG00000169783	G	TRP/ARG	0,4128		0,0,2064	20.0	24.0	23.0		1171	2.7	1.0	15		23	2,8378		0,2,4188	yes	missense	LINGO1	NM_032808.5	101	0,2,6252	AA,AG,GG		0.0239,0.0,0.016	benign	391/621	77907078	2,12506	2064	4190	6254	LINGO1	SO:0001583	missense	0			-	HGNC	AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.1171C>T	15.37:g.77907078G>A	ENSP00000347451:p.Arg391Trp	Somatic	0	68	0.00		0.6487880846458666	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	47	16.07	D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_Ig_I-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R391W	ENST00000355300.6	37	c.1171	CCDS45313.1	15	.	.	.	.	.	.	.	.	.	.	G	11.35	1.613981	0.28712	0.0	2.39E-4	ENSG00000169783	ENST00000355300	T	0.55760	0.5	4.93	2.72	0.32119	Cysteine-rich flanking region, C-terminal (1);	0.222919	0.40640	N	0.001046	T	0.46946	0.1419	L	0.51422	1.61	0.51482	D	0.999929	B	0.12013	0.005	B	0.04013	0.001	T	0.51741	-0.8667	10	0.72032	D	0.01	.	13.7055	0.62636	0.0:0.0:0.6353:0.3647	.	391	Q96FE5	LIGO1_HUMAN	W	391	ENSP00000347451:R391W	ENSP00000347451:R391W	R	-	1	2	LINGO1	75694133	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.058000	0.41374	1.001000	0.39076	0.462000	0.41574	CGG	-	NULL		0.652	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO1	protein_coding	OTTHUMT00000419546.1	G	NM_032808	rs199628078		77907078	-1	no_errors	ENST00000355300	ensembl	human	known	74_37	missense	SNP	0.995	A
LY75	4065	genome.wustl.edu	37	2	160750457	160750457	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr2:160750457T>C	ENST00000263636.4	-	3	632	c.605A>G	c.(604-606)tAt>tGt	p.Y202C	LY75-CD302_ENST00000504764.1_Missense_Mutation_p.Y202C|LY75_ENST00000553424.1_Missense_Mutation_p.Y202C|LY75_ENST00000554112.1_Missense_Mutation_p.Y202C|LY75-CD302_ENST00000505052.1_Missense_Mutation_p.Y202C	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	202	Fibronectin type-II. {ECO:0000255|PROSITE-ProRule:PRU00479}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		CTTTCGGTCATATTCATAATT	0.408																																																	0								ENSG00000054219						101.0	95.0	97.0					2																	160750457		2203	4300	6503	LY75	SO:0001583	missense	0			-	HGNC	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.605A>G	2.37:g.160750457T>C	ENSP00000263636:p.Tyr202Cys	Somatic	0	39	0.00		0.6487880846458666	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	29	40.82	O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.Y202C	ENST00000263636.4	37	c.605	CCDS2211.1	2	.	.	.	.	.	.	.	.	.	.	T	12.47	1.948141	0.34377	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77	5.54	5.54	0.83059	Fibronectin, type II, collagen-binding (5);Kringle-like fold (1);	0.000000	0.32190	N	0.006453	T	0.61148	0.2324	M	0.72118	2.19	0.09310	N	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.65573	0.936;0.935;0.912	T	0.58335	-0.7654	10	0.46703	T	0.11	-11.1798	6.8042	0.23768	0.0:0.082:0.1536:0.7643	.	202;202;202	O60449-3;O60449;O60449-2	.;LY75_HUMAN;.	C	202	ENSP00000451511:Y202C;ENSP00000451446:Y202C;ENSP00000263636:Y202C;ENSP00000423463:Y202C;ENSP00000421035:Y202C	ENSP00000423463:Y202C	Y	-	2	0	LY75;LY75-CD302	160458703	0.001000	0.12720	0.996000	0.52242	0.676000	0.39594	0.092000	0.15066	2.230000	0.72887	0.455000	0.32223	TAT	-	pfam_FN_type2_col-bd,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd		0.408	LY75-001	KNOWN	basic|CCDS	protein_coding	LY75	protein_coding	OTTHUMT00000255035.1	T		-		160750457	-1	no_errors	ENST00000554112	ensembl	human	known	74_37	missense	SNP	0.159	C
BCS1L	617	genome.wustl.edu	37	2	219526532	219526532	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr2:219526532G>T	ENST00000431802.1	+	4	1210	c.511G>T	c.(511-513)Gct>Tct	p.A171S	BCS1L_ENST00000412366.1_Missense_Mutation_p.A171S|BCS1L_ENST00000392110.2_Missense_Mutation_p.A171S|BCS1L_ENST00000392111.2_Missense_Mutation_p.A171S|BCS1L_ENST00000439945.1_Missense_Mutation_p.A171S|BCS1L_ENST00000359273.3_Missense_Mutation_p.A171S|ZNF142_ENST00000449707.1_5'Flank|BCS1L_ENST00000392109.1_Missense_Mutation_p.A171S|ZNF142_ENST00000411696.2_5'Flank			Q9Y276	BCS1_HUMAN	BC1 (ubiquinol-cytochrome c reductase) synthesis-like	171					mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex III assembly (GO:0034551)|mitochondrial respiratory chain complex IV assembly (GO:0033617)|mitochondrion organization (GO:0007005)	mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	8		Renal(207;0.0474)		Epithelial(149;7.12e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GATGTACACAGCTGTGGGCTC	0.537																																																	0								ENSG00000074582						97.0	87.0	90.0					2																	219526532		2203	4300	6503	BCS1L	SO:0001583	missense	0			-	HGNC	AF026849	CCDS2419.1	2q35	2014-09-17	2012-10-12		ENSG00000074582	ENSG00000074582		"""ATPases / AAA-type"", ""Mitochondrial respiratory chain complex assembly factors"""	1020	protein-coding gene	gene with protein product	"""GRACILE syndrome"", ""Bjornstad syndrome"""	603647	"""BCS1 (yeast homolog)-like"", ""BCS1-like (yeast)"", ""BCS1-like (S. cerevisiae)"""			9878253, 17314340	Standard	NM_001079866		Approved	Hs.6719, BCS, h-BCS, BJS	uc002viq.3	Q9Y276	OTTHUMG00000133114	ENST00000431802.1:c.511G>T	2.37:g.219526532G>T	ENSP00000413908:p.Ala171Ser	Somatic	0	31	0.00		0.6487880846458666	144	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	B3KTW9|Q7Z2V7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BCS1_N,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.A171S	ENST00000431802.1	37	c.511	CCDS2419.1	2	.	.	.	.	.	.	.	.	.	.	G	13.51	2.258616	0.39896	.	.	ENSG00000074582	ENST00000430322;ENST00000456050;ENST00000443791;ENST00000359273;ENST00000392109;ENST00000392110;ENST00000392111;ENST00000412366;ENST00000439945;ENST00000431802	D;D;D;D;D;D;D;D;D;D	0.96200	-3.94;-3.94;-3.94;-3.94;-3.94;-3.94;-3.94;-3.94;-3.94;-3.94	5.33	5.33	0.75918	BCS1, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92176	0.7519	L	0.28014	0.82	0.80722	D	1	B	0.28026	0.198	B	0.35607	0.206	D	0.88499	0.3081	10	0.09084	T	0.74	-18.6979	19.2185	0.93788	0.0:0.0:1.0:0.0	.	171	Q9Y276	BCS1_HUMAN	S	171;171;51;171;171;171;171;171;171;171	ENSP00000398957:A171S;ENSP00000395440:A171S;ENSP00000412729:A51S;ENSP00000352219:A171S;ENSP00000375957:A171S;ENSP00000375958:A171S;ENSP00000375959:A171S;ENSP00000406494:A171S;ENSP00000404999:A171S;ENSP00000413908:A171S	ENSP00000352219:A171S	A	+	1	0	BCS1L	219234776	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.649000	0.83500	2.774000	0.95407	0.650000	0.86243	GCT	-	pfam_BCS1_N		0.537	BCS1L-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BCS1L	protein_coding	OTTHUMT00000336756.1	G	NM_004328	-		219526532	+1	no_errors	ENST00000359273	ensembl	human	known	74_37	missense	SNP	1.000	T
AL358813.2	0	genome.wustl.edu	37	1	149673265	149673265	+	5'Flank	SNP	C	C	G	rs71620900	byFrequency	TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr1:149673265C>G	ENST00000369173.2	+	0	0				RP11-353N4.4_ENST00000443602.2_lincRNA|RNU1-68P_ENST00000517116.1_RNA|RP11-353N4.5_ENST00000608683.1_lincRNA																							CGGGTCGCCGCGTCCGGAGCC	0.697																																																	0								ENSG00000223759																																			RP11-353N4.4	SO:0001631	upstream_gene_variant	0			-	Clone_based_vega_gene																													1.37:g.149673265C>G	Exception_encountered	Somatic	0	15	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	11	31.25		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369173.2	37	NULL		1																																																																																			-	-		0.697	AL358813.2-201	NOVEL	basic|appris_principal	protein_coding	ENSG00000223759	protein_coding		C		-		149673265	+1	no_errors	ENST00000443602	ensembl	human	known	74_37	rna	SNP	0.001	G
SMG1	23049	genome.wustl.edu	37	16	18840640	18840640	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr16:18840640G>A	ENST00000446231.2	-	54	9983	c.9571C>T	c.(9571-9573)Cag>Tag	p.Q3191*	SMG1_ENST00000389467.3_Nonsense_Mutation_p.Q3191*			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	3191					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TGAACCCGCTGCAGGCTTGTC	0.418																																																	0								ENSG00000157106						45.0	42.0	43.0					16																	18840640		1881	4109	5990	SMG1	SO:0001587	stop_gained	0			-	HGNC	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.9571C>T	16.37:g.18840640G>A	ENSP00000402515:p.Gln3191*	Somatic	0	50	0.00		0.6487880846458666	5	28.57	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	38	32.14	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.Q3191*	ENST00000446231.2	37	c.9571	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	G	52	19.984588	0.99925	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	.	.	.	5.71	5.71	0.89125	.	0.097264	0.45867	D	0.000332	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	19.9183	0.97074	0.0:0.0:1.0:0.0	.	.	.	.	X	3191	.	ENSP00000374118:Q3191X	Q	-	1	0	SMG1	18748141	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.827000	0.99397	2.697000	0.92050	0.579000	0.79373	CAG	-	NULL		0.418	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	protein_coding	OTTHUMT00000391817.1	G	NM_015092	-		18840640	-1	no_errors	ENST00000389467	ensembl	human	known	74_37	nonsense	SNP	1.000	A
VPS8	23355	genome.wustl.edu	37	3	184647436	184647436	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr3:184647436G>A	ENST00000437079.3	+	33	2954	c.2783G>A	c.(2782-2784)cGt>cAt	p.R928H	VPS8_ENST00000446204.2_Missense_Mutation_p.R836H|VPS8_ENST00000287546.4_Missense_Mutation_p.R928H|VPS8_ENST00000463687.1_3'UTR|VPS8_ENST00000436792.2_Missense_Mutation_p.R926H	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	928							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			TGCTACTTACGTGACCCTCTG	0.328																																																	0								ENSG00000156931						84.0	79.0	80.0					3																	184647436		1840	4073	5913	VPS8	SO:0001583	missense	0			-	HGNC	AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.2783G>A	3.37:g.184647436G>A	ENSP00000397879:p.Arg928His	Somatic	0	36	0.00		0.6487880846458666	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Quinonprotein_ADH-like_supfam,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R928H	ENST00000437079.3	37	c.2783	CCDS46971.1	3	.	.	.	.	.	.	.	.	.	.	G	12.36	1.913715	0.33815	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.18960	2.19;2.19;2.19;2.18	5.53	3.72	0.42706	Quinonprotein alcohol dehydrogenase-like (1);	0.213578	0.48286	N	0.000187	T	0.19366	0.0465	L	0.59436	1.845	0.39426	D	0.967002	B;B;B	0.24317	0.003;0.101;0.002	B;B;B	0.21360	0.003;0.034;0.002	T	0.04900	-1.0919	10	0.33141	T	0.24	-10.8025	8.0323	0.30472	0.3201:0.0:0.6799:0.0	.	928;836;926	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	H	928;928;926;836	ENSP00000287546:R928H;ENSP00000397879:R928H;ENSP00000404704:R926H;ENSP00000405483:R836H	ENSP00000287546:R928H	R	+	2	0	VPS8	186130130	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	1.477000	0.35431	0.680000	0.31366	-0.244000	0.11960	CGT	-	superfamily_Quinonprotein_ADH-like_supfam,superfamily_ARM-type_fold		0.328	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS8	protein_coding		G	NM_015303	-		184647436	+1	no_errors	ENST00000287546	ensembl	human	known	74_37	missense	SNP	0.989	A
LIM2	3982	genome.wustl.edu	37	19	51890427	51890427	+	Intron	SNP	G	G	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr19:51890427G>A	ENST00000596399.1	-	2	223				LIM2_ENST00000221973.3_Missense_Mutation_p.R91W	NM_001161748.1	NP_001155220.1	P55344	LMIP_HUMAN	lens intrinsic membrane protein 2, 19kDa						cell-cell junction assembly (GO:0007043)|lens development in camera-type eye (GO:0002088)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	structural constituent of eye lens (GO:0005212)			endometrium(1)|large_intestine(3)|lung(2)|skin(1)	7		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000214)|OV - Ovarian serous cystadenocarcinoma(262;0.00985)		tctttgagccgcagagttctc	0.622																																																	0								ENSG00000105370						49.0	43.0	45.0					19																	51890427		2203	4300	6503	LIM2	SO:0001627	intron_variant	0			-	HGNC		CCDS12831.1, CCDS59415.1	19q13.4	2008-07-17	2002-08-29			ENSG00000105370			6610	protein-coding gene	gene with protein product		154045	"""lens intrinsic membrane protein 2 (19kD)"""			1606837	Standard	NM_030657		Approved	MP19, MP17	uc002pwl.2	P55344		ENST00000596399.1:c.175+95C>T	19.37:g.51890427G>A		Somatic	0	53	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q6B083|Q9BXD0|Q9HAR5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PMP22/EMP/MP20/Claudin,prints_LMIP,prints_PMP22_EMP_MP20	p.R91W	ENST00000596399.1	37	c.271	CCDS59415.1	19	.	.	.	.	.	.	.	.	.	.	G	11.49	1.655382	0.29425	.	.	ENSG00000105370	ENST00000221973	.	.	.	3.97	-1.24	0.09435	.	4.661830	0.01204	N	0.007660	T	0.22244	0.0536	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16630	-1.0396	8	0.44086	T	0.13	.	0.2938	0.00262	0.3344:0.2049:0.261:0.1997	.	91	P55344-2	.	W	91	.	ENSP00000221973:R91W	R	-	1	2	LIM2	56582239	0.003000	0.15002	0.006000	0.13384	0.425000	0.31504	-0.084000	0.11268	0.054000	0.16065	-0.302000	0.09304	CGG	-	NULL		0.622	LIM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LIM2	protein_coding	OTTHUMT00000464247.1	G	NM_030657	-		51890427	-1	no_errors	ENST00000221973	ensembl	human	known	74_37	missense	SNP	0.018	A
ATP13A5	344905	genome.wustl.edu	37	3	193036811	193036811	+	Missense_Mutation	SNP	C	C	A	rs144655859		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr3:193036811C>A	ENST00000342358.4	-	17	2119	c.2002G>T	c.(2002-2004)Ggg>Tgg	p.G668W		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	668						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		GAAAGATTCCCCATCTTTAAG	0.498																																																	0								ENSG00000187527						134.0	135.0	135.0					3																	193036811		2203	4300	6503	ATP13A5	SO:0001583	missense	0			-	HGNC	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.2002G>T	3.37:g.193036811C>A	ENSP00000341942:p.Gly668Trp	Somatic	0	90	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	49	9.26	Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.G668W	ENST00000342358.4	37	c.2002	CCDS33914.1	3	.	.	.	.	.	.	.	.	.	.	C	11.11	1.541057	0.27563	.	.	ENSG00000187527	ENST00000342358	T	0.69175	-0.38	5.89	-1.47	0.08772	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	1.711220	0.02294	N	0.070529	T	0.66127	0.2758	L	0.39245	1.2	0.09310	N	1	D	0.56521	0.976	P	0.51918	0.684	T	0.56438	-0.7979	10	0.62326	D	0.03	2.1934	6.4243	0.21760	0.0:0.4099:0.1241:0.466	.	668	Q4VNC0	AT135_HUMAN	W	668	ENSP00000341942:G668W	ENSP00000341942:G668W	G	-	1	0	ATP13A5	194519505	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.752000	0.04797	-0.365000	0.08076	0.655000	0.94253	GGG	-	superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Cation_typ_V		0.498	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A5	protein_coding	OTTHUMT00000343012.1	C	NM_198505	-		193036811	-1	no_errors	ENST00000342358	ensembl	human	known	74_37	missense	SNP	0.000	A
PAK1	5058	genome.wustl.edu	37	11	77048422	77048422	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr11:77048422C>A	ENST00000356341.3	-	12	1694	c.1163G>T	c.(1162-1164)aGa>aTa	p.R388I	PAK1_ENST00000525542.1_5'UTR|PAK1_ENST00000278568.4_Missense_Mutation_p.R388I|PAK1_ENST00000528203.1_Missense_Mutation_p.R290I|PAK1_ENST00000530617.1_Missense_Mutation_p.R388I	NM_002576.4	NP_002567.3	Q13153	PAK1_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 1	388	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to insulin stimulus (GO:0032869)|dendrite development (GO:0016358)|exocytosis (GO:0006887)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor clustering (GO:0043113)|response to hypoxia (GO:0001666)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|wound healing (GO:0042060)	axon (GO:0030424)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|Z disc (GO:0030018)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(13)|skin(2)|stomach(1)	29	all_cancers(14;1.75e-18)					CTTGATGTCTCTGTGAATGAC	0.458																																																	0								ENSG00000149269						99.0	80.0	86.0					11																	77048422		2200	4292	6492	PAK1	SO:0001583	missense	0			-	HGNC	U51120	CCDS8250.1, CCDS44687.1	11q13-q14	2008-06-17	2008-06-17						8590	protein-coding gene	gene with protein product	"""STE20 homolog, yeast"""	602590	"""p21/Cdc42/Rac1-activated kinase 1 (yeast Ste20-related)"", ""p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)"""			8805275, 9533029	Standard	NM_002576		Approved		uc001oyg.4	Q13153		ENST00000356341.3:c.1163G>T	11.37:g.77048422C>A	ENSP00000348696:p.Arg388Ile	Somatic	0	40	0.00		0.6487880846458666	88	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	O75561|Q13567|Q32M53|Q32M54|Q86W79	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CRIB_dom,superfamily_Kinase-like_dom,superfamily_WASP_C,smart_CRIB_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRIB_dom,pfscan_Prot_kinase_dom	p.R388I	ENST00000356341.3	37	c.1163	CCDS8250.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.273678|5.273678	0.95459|0.95459	.|.	.|.	ENSG00000149269|ENSG00000149269	ENST00000533285|ENST00000356341;ENST00000530617;ENST00000278568;ENST00000528203	.|T;T;T;T	.|0.30182	.|1.54;1.54;1.54;1.54	5.55|5.55	5.55|5.55	0.83447|0.83447	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.047154	.|0.85682	.|D	.|0.000000	T|T	0.72977|0.72977	0.3528|0.3528	H|H	0.97783|0.97783	4.075|4.075	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|0.999;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.995;1.0;1.0;1.0	D|D	0.83829|0.83829	0.0251|0.0251	5|10	.|0.87932	.|D	.|0	.|.	19.5071|19.5071	0.95124|0.95124	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|290;388;388;388	.|E9PM17;B3KNX7;Q13153;Q13153-2	.|.;.;PAK1_HUMAN;.	H|I	109|388;388;388;290	.|ENSP00000348696:R388I;ENSP00000433423:R388I;ENSP00000278568:R388I;ENSP00000433211:R290I	.|ENSP00000278568:R388I	Q|R	-|-	3|2	2|0	PAK1|PAK1	76726070|76726070	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.480000|7.480000	0.81109|0.81109	2.617000|2.617000	0.88574|0.88574	0.557000|0.557000	0.71058|0.71058	CAG|AGA	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.458	PAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAK1	protein_coding	OTTHUMT00000382083.2	C	NM_002576	-		77048422	-1	no_errors	ENST00000278568	ensembl	human	known	74_37	missense	SNP	1.000	A
DKK2	27123	genome.wustl.edu	37	4	107845150	107845150	+	Silent	SNP	G	G	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr4:107845150G>A	ENST00000285311.3	-	4	1446	c.741C>T	c.(739-741)taC>taT	p.Y247Y	DKK2_ENST00000510463.1_Silent_p.Y201Y|DKK2_ENST00000513208.1_Silent_p.Y147Y	NM_014421.2	NP_055236.1	Q9UBU2	DKK2_HUMAN	dickkopf WNT signaling pathway inhibitor 2	247	DKK-type Cys-2.				multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)				autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		CTTTGGAGGAGTAGGTGGCAT	0.448																																																	0								ENSG00000155011						147.0	136.0	140.0					4																	107845150		2203	4300	6503	DKK2	SO:0001819	synonymous_variant	0			-	HGNC	AB033208	CCDS3675.1	4q25	2013-05-15	2013-05-15		ENSG00000155011	ENSG00000155011			2892	protein-coding gene	gene with protein product		605415	"""dickkopf (Xenopus laevis) homolog 2"", ""dickkopf 2 homolog (Xenopus laevis)"""			10570958	Standard	NM_014421		Approved		uc003hyi.3	Q9UBU2	OTTHUMG00000131216	ENST00000285311.3:c.741C>T	4.37:g.107845150G>A		Somatic	0	34	0.00		0.6487880846458666	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	10	41.18	A0AVE9|B2R6S7|Q9UIU3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Dickkopf_N,superfamily_Zn2-C6_fun-type_DNA-bd	p.Y247	ENST00000285311.3	37	c.741	CCDS3675.1	4																																																																																			-	NULL		0.448	DKK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	DKK2	protein_coding	OTTHUMT00000253959.4	G		-		107845150	-1	no_errors	ENST00000285311	ensembl	human	novel	74_37	silent	SNP	1.000	A
MUC21	394263	genome.wustl.edu	37	6	30955050	30955050	+	Silent	SNP	C	C	T	rs56365660	byFrequency	TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr6:30955050C>T	ENST00000376296.3	+	2	1339	c.1098C>T	c.(1096-1098)agC>agT	p.S366S	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	366	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CTGGGTCCAGCACGACCTCCA	0.637																																																	0								ENSG00000204544						145.0	141.0	142.0					6																	30955050		2187	4282	6469	MUC21	SO:0001819	synonymous_variant	0			-	HGNC	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.1098C>T	6.37:g.30955050C>T		Somatic	0	75	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	8	33.33	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S366	ENST00000376296.3	37	c.1098	CCDS34388.1	6																																																																																			-	NULL		0.637	MUC21-001	KNOWN	basic|CCDS	protein_coding	MUC21	protein_coding	OTTHUMT00000128579.3	C	NM_001010909	rs56365660		30955050	+1	no_errors	ENST00000376296	ensembl	human	known	74_37	silent	SNP	0.000	T
SLC44A5	204962	genome.wustl.edu	37	1	75669436	75669436	+	Silent	SNP	T	T	C			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr1:75669436T>C	ENST00000370859.3	-	24	2275	c.2130A>G	c.(2128-2130)gaA>gaG	p.E710E		NM_001130058.1	NP_001123530.1	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	710					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						TTTGTGGATTTTCCTCCTGGA	0.408																																																	0								ENSG00000137968						226.0	228.0	227.0					1																	75669436		692	1591	2283	SLC44A5	SO:0001819	synonymous_variant	0			-	HGNC	BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370859.3:c.2130A>G	1.37:g.75669436T>C		Somatic	0	55	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	60	30	66.67	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Choline_transptr-like	p.E710	ENST00000370859.3	37	c.2130	CCDS44164.1	1																																																																																			-	NULL		0.408	SLC44A5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC44A5	protein_coding	OTTHUMT00000026823.3	T	NM_152697	-		75669436	-1	no_errors	ENST00000370859	ensembl	human	known	74_37	silent	SNP	0.000	C
C5orf45	51149	genome.wustl.edu	37	5	179268934	179268934	+	Missense_Mutation	SNP	C	C	T	rs373245055	byFrequency	TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr5:179268934C>T	ENST00000292586.6	-	5	512	c.422G>A	c.(421-423)cGc>cAc	p.R141H	C5orf45_ENST00000520698.1_Missense_Mutation_p.R86H|C5orf45_ENST00000521333.1_Intron|C5orf45_ENST00000523267.1_Intron|C5orf45_ENST00000518235.1_Missense_Mutation_p.R141H|C5orf45_ENST00000376931.2_Missense_Mutation_p.R86H|C5orf45_ENST00000523084.1_Missense_Mutation_p.R7H|C5orf45_ENST00000403396.2_Missense_Mutation_p.R183H|C5orf45_ENST00000518219.1_Missense_Mutation_p.R141H	NM_016175.3	NP_057259.2	Q6NTE8	CE045_HUMAN	chromosome 5 open reading frame 45	141										breast(2)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12						TTGACTGAAGCGGGGGCCTGG	0.567													c|||	2	0.000399361	0.0015	0.0	5008	,	,		18572	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000161010	T	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	167.0	178.0	174.0		257,422	0.5	0.0	5		174	0,8600		0,0,4300	no	missense,missense	C5orf45	NM_001017987.2,NM_016175.3	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	86/289,141/344	179268934	1,13005	2203	4300	6503	C5orf45	SO:0001583	missense	0			-	HGNC		CCDS34318.1, CCDS34319.1	5q35.3	2008-07-10			ENSG00000161010	ENSG00000161010			30817	protein-coding gene	gene with protein product	"""truncated calcium binding protein"""						Standard	NM_016175		Approved	MGC65027, MGC78537, DKFZp686L2452, LOC51149	uc003mla.3	Q6NTE8	OTTHUMG00000163490	ENST00000292586.6:c.422G>A	5.37:g.179268934C>T	ENSP00000292586:p.Arg141His	Somatic	0	46	0.00		0.6487880846458666	49	47.87	45	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	13	61.76	B5MD09|E9PAK6|Q7Z3D8|Q9BUC1|Q9UN54	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R141H	ENST00000292586.6	37	c.422	CCDS34319.1	5	.	.	.	.	.	.	.	.	.	.	c	5.961	0.361326	0.11296	2.27E-4	0.0	ENSG00000161010	ENST00000403396;ENST00000518235;ENST00000520698;ENST00000376931;ENST00000518219;ENST00000523084;ENST00000292586	T;T;T;T;T;T;T	0.34072	1.95;1.95;1.95;2.13;1.95;1.38;1.95	4.61	0.509	0.16977	.	0.642318	0.13077	N	0.415634	T	0.17534	0.0421	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.06786	0.001;0.001;0.0;0.001;0.001	B;B;B;B;B	0.04013	0.0;0.001;0.0;0.001;0.0	T	0.18871	-1.0323	10	0.39692	T	0.17	-1.1032	8.0651	0.30657	0.0:0.2736:0.3231:0.4033	.	86;141;86;141;183	E7EMV9;B7Z1T6;E9PAK6;Q6NTE8;Q6NTE8-2	.;.;.;CE045_HUMAN;.	H	183;141;86;86;141;7;141	ENSP00000384599:R183H;ENSP00000430298:R141H;ENSP00000427849:R86H;ENSP00000366130:R86H;ENSP00000428460:R141H;ENSP00000429107:R7H;ENSP00000292586:R141H	ENSP00000292586:R141H	R	-	2	0	C5orf45	179201540	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	0.044000	0.13992	-0.228000	0.09869	-3.833000	0.00019	CGC	-	NULL		0.567	C5orf45-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C5orf45	protein_coding	OTTHUMT00000373760.2	C	NM_016175	-		179268934	-1	no_errors	ENST00000292586	ensembl	human	known	74_37	missense	SNP	0.000	T
MT-CO1	4512	genome.wustl.edu	37	M	7198	7198	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chrM:7198G>A	ENST00000361624.2	+	1	1295	c.1295G>A	c.(1294-1296)gGc>gAc	p.G432D	MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO2_ENST00000361739.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TM_ENST00000387377.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	432					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						ACACTTTCTCGGCCTATCCGG	0.458																																																	0								ENSG00000198804																																			MT-CO1	SO:0001583	missense	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1295G>A	M.37:g.7198G>A	ENSP00000354499:p.Gly432Asp	Somatic	0	47	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	13	13.33	Q34770	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.G432D	ENST00000361624.2	37	c.1295		MT																																																																																			-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1		0.458	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	protein_coding		G	YP_003024028	-		7198	+1	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	SNP	NULL	A
ZEB1	6935	genome.wustl.edu	37	10	31812861	31812861	+	Splice_Site	SNP	G	G	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr10:31812861G>A	ENST00000320985.10	+	8	2712	c.2602G>A	c.(2602-2604)Gat>Aat	p.D868N	ZEB1_ENST00000446923.2_Splice_Site_p.D852N|ZEB1_ENST00000542815.3_Splice_Site_p.D801N|ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000560721.2_Splice_Site_p.D848N|ZEB1_ENST00000361642.5_Splice_Site_p.D869N			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	868					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				CTCCCTCTAGGATGAAAGACA	0.333																																					Ovarian(40;423 959 14296 36701 49589)												0								ENSG00000148516						60.0	60.0	60.0					10																	31812861		2203	4300	6503	ZEB1	SO:0001630	splice_region_variant	0			-	HGNC	AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.2602-1G>A	10.37:g.31812861G>A		Somatic	0	22	0.00		0.6487880846458666	29	42.00	21	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	25	16.67	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.D869N	ENST00000320985.10	37	c.2605	CCDS7169.1	10	.	.	.	.	.	.	.	.	.	.	G	17.77	3.470067	0.63625	.	.	ENSG00000148516	ENST00000542879;ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000543514;ENST00000446923	T;T;T;T;T	0.12039	3.03;2.72;2.76;2.72;2.78	5.57	5.57	0.84162	.	0.803616	0.11117	N	0.597829	T	0.15046	0.0363	L	0.29908	0.895	0.80722	D	1	B;P;B;P;P	0.36282	0.046;0.546;0.027;0.546;0.546	B;B;B;B;B	0.37239	0.015;0.244;0.011;0.164;0.136	T	0.30534	-0.9975	9	.	.	.	-10.7713	19.5459	0.95297	0.0:0.0:1.0:0.0	.	801;852;848;869;868	F5H4I8;E9PCM7;Q5VZ84;Q2KJ05;P37275	.;.;.;.;ZEB1_HUMAN	N	650;868;869;863;801;868;848;759;852	ENSP00000444282:D650N;ENSP00000354487:D869N;ENSP00000444891:D801N;ENSP00000319248:D868N;ENSP00000391612:D852N	.	D	+	1	0	ZEB1	31852867	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	9.230000	0.95299	2.635000	0.89317	0.585000	0.79938	GAT	-	NULL		0.333	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZEB1	protein_coding	OTTHUMT00000419083.2	G	NM_030751	-	Missense_Mutation	31812861	+1	no_errors	ENST00000361642	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF286A	57335	genome.wustl.edu	37	17	15604684	15604685	+	Intron	INS	-	-	G	rs375159888	byFrequency	TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr17:15604684_15604685insG	ENST00000464847.2	+	2	679				ZNF286A_ENST00000395893.2_Intron|ZNF286A_ENST00000580259.1_Intron|ZNF286A_ENST00000472486.1_Intron|ZNF286A_ENST00000581529.1_Intron|ZNF286A_ENST00000421016.1_Intron|ZNF286A_ENST00000585171.1_Intron|ZNF286A_ENST00000583566.1_Intron|ZNF286A_ENST00000413242.2_Intron|ZNF286A_ENST00000593105.1_Intron|ZNF286A_ENST00000585194.1_Intron|ZNF286A_ENST00000395894.2_Intron			Q9HBT8	Z286A_HUMAN	zinc finger protein 286A						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)		TCTAAGAGACTAGTCAGGAGAC	0.386													-|-|G|insertion	514	0.102636	0.1876	0.0965	5008	,	,		20890	0.0089		0.0845	False		,,,				2504	0.1074																0								ENSG00000187607																																			ZNF286A	SO:0001627	intron_variant	0				Uniprot_gn	AF217226	CCDS11172.1, CCDS73997.1	17p11.2	2013-02-14	2007-01-05	2007-01-05		ENSG00000187607		"""Zinc fingers, C2H2-type"", ""-"""	13501	protein-coding gene	gene with protein product			"""zinc finger protein 286"""	ZNF286		11347906	Standard	NM_020652		Approved	KIAA1874	uc010cot.3	Q9HBT8	OTTHUMG00000166448	ENST00000464847.2:c.126+130->G	17.37:g.15604684_15604685insG		Somatic	0	10	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	16	40.74	B4DKF9|Q96JF3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000464847.2	37	NULL	CCDS11172.1	17																																																																																			-	-		0.386	ZNF286A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF286A	protein_coding	OTTHUMT00000130696.4	-	NM_020652			15604685	+1	no_errors	ENST00000580136	ensembl	human	known	74_37	rna	INS	0.002:0.001	G
SYCP1	6847	genome.wustl.edu	37	1	115537600	115537601	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr1:115537600_115537601insA	ENST00000369522.3	+	32	3131_3132	c.2891_2892insA	c.(2890-2895)agaaaafs	p.RK964fs	SYCP1_ENST00000369518.1_Frame_Shift_Ins_p.RK964fs|SYCP1_ENST00000477590.1_3'UTR	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	964	Arg/Lys-rich (basic).				chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAAATGGATAGAAAAAAAAAAC	0.356																																																	0								ENSG00000198765																																			SYCP1	SO:0001589	frameshift_variant	0				HGNC	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.2901dupA	1.37:g.115537610_115537610dupA	ENSP00000358535:p.Arg964fs	Somatic	0	44	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	31	8.82	O14963|Q5VXJ6	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_SCP-1	p.K968fs	ENST00000369522.3	37	c.2891_2892	CCDS879.1	1																																																																																			-	NULL		0.356	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP1	protein_coding	OTTHUMT00000033386.1	-	NM_003176			115537601	+1	no_errors	ENST00000369518	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
GPX5	2880	genome.wustl.edu	37	6	28500188	28500188	+	Silent	SNP	T	T	C			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr6:28500188T>C	ENST00000412168.2	+	4	539	c.450T>C	c.(448-450)agT>agC	p.S150S	GPX5_ENST00000442674.2_3'UTR|GPX5_ENST00000469384.1_3'UTR	NM_001509.2	NP_001500.1	O75715	GPX5_HUMAN	glutathione peroxidase 5 (epididymal androgen-related protein)	150					lipid metabolic process (GO:0006629)|response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)			endometrium(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16					Glutathione(DB00143)	AAGTCTTCAGTTTCTTGAAGG	0.443																																																	0								ENSG00000224586						128.0	122.0	124.0					6																	28500188		2203	4300	6503	GPX5	SO:0001819	synonymous_variant	0			-	HGNC	AJ005277	CCDS4652.1, CCDS4653.1	6p22.1	2008-02-05			ENSG00000224586	ENSG00000224586	1.11.1.9		4557	protein-coding gene	gene with protein product		603435				9639555	Standard	NM_001509		Approved		uc003nll.2	O75715	OTTHUMG00000016307	ENST00000412168.2:c.450T>C	6.37:g.28500188T>C		Somatic	0	76	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	33	26.67	A1A4Y0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Glutathione_peroxidase,superfamily_Thioredoxin-like_fold,pirsf_Glutathione_peroxidase,prints_Glutathione_peroxidase	p.S150	ENST00000412168.2	37	c.450	CCDS4652.1	6																																																																																			-	pfam_Glutathione_peroxidase,superfamily_Thioredoxin-like_fold,pirsf_Glutathione_peroxidase		0.443	GPX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPX5	protein_coding	OTTHUMT00000043672.2	T		-		28500188	+1	no_errors	ENST00000412168	ensembl	human	known	74_37	silent	SNP	0.971	C
MLLT3	4300	genome.wustl.edu	37	9	20346393	20346393	+	3'UTR	SNP	C	C	A	rs552028867|rs375169457|rs367551063	byFrequency	TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr9:20346393C>A	ENST00000380338.4	-	0	2041				MLLT3_ENST00000429426.2_3'UTR|MLLT3_ENST00000355930.6_3'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3						anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		aaaaaaaaaccaaaaaaaaaa	0.308			T	MLL	ALL								C|||	2051	0.409545	0.4085	0.3934	5008	,	,		18261	0.4246		0.3986	False		,,,				2504	0.4182							Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	0								ENSG00000171843						33.0	33.0	33.0					9																	20346393		2203	4299	6502	MLLT3	SO:0001624	3_prime_UTR_variant	0			-	HGNC	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.*48G>T	9.37:g.20346393C>A		Somatic	0	59	0.00		0.6487880846458666	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	58	14.71	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000380338.4	37	NULL	CCDS6494.1	9																																																																																			-	-		0.308	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT3	protein_coding	OTTHUMT00000051872.1	C	NM_004529	-		20346393	-1	no_errors	ENST00000380323	ensembl	human	known	74_37	rna	SNP	0.035	A
FAM120A	23196	genome.wustl.edu	37	9	96291677	96291677	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr9:96291677G>A	ENST00000277165.6	+	9	1743	c.1549G>A	c.(1549-1551)Gaa>Aaa	p.E517K	FAM120A_ENST00000333936.5_Missense_Mutation_p.E545K|FAM120A_ENST00000375389.3_Missense_Mutation_p.E517K|FAM120A_ENST00000340893.4_Missense_Mutation_p.E517K	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	517				EGKG -> DSRR (in Ref. 1; AAF72867). {ECO:0000305}.		cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						CCAACTAGCCGAAGGCAAGGG	0.562																																																	0								ENSG00000048828						66.0	59.0	61.0					9																	96291677		2203	4300	6503	FAM120A	SO:0001583	missense	0			-	HGNC	AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.1549G>A	9.37:g.96291677G>A	ENSP00000277165:p.Glu517Lys	Somatic	0	45	0.00		0.6487880846458666	59	18.92	14	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	66	9.46	A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E545K	ENST00000277165.6	37	c.1633	CCDS6706.1	9	.	.	.	.	.	.	.	.	.	.	G	22.9	4.353619	0.82243	.	.	ENSG00000048828	ENST00000375389;ENST00000277165;ENST00000333936;ENST00000340893	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.41	5.41	0.78517	.	0.252635	0.34700	N	0.003756	T	0.35219	0.0924	N	0.22421	0.69	0.49798	D	0.999826	P;B;P;B;P	0.52577	0.641;0.308;0.82;0.165;0.954	B;B;B;B;B	0.42062	0.079;0.084;0.054;0.023;0.374	T	0.13098	-1.0522	10	0.09338	T	0.73	-15.8002	19.1972	0.93695	0.0:0.0:1.0:0.0	.	517;545;517;517;517	Q9NZB2-4;Q9NZB2-6;Q9NZB2-5;Q9NZB2;Q9NZB2-2	.;.;.;F120A_HUMAN;.	K	517;517;545;517	ENSP00000364538:E517K;ENSP00000277165:E517K;ENSP00000334918:E545K;ENSP00000344698:E517K	ENSP00000277165:E517K	E	+	1	0	FAM120A	95331498	1.000000	0.71417	0.976000	0.42696	0.997000	0.91878	7.517000	0.81783	2.532000	0.85374	0.655000	0.94253	GAA	-	NULL		0.562	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM120A	protein_coding	OTTHUMT00000053160.2	G	NM_014612	-		96291677	+1	no_errors	ENST00000333936	ensembl	human	known	74_37	missense	SNP	1.000	A
SOX5	6660	genome.wustl.edu	37	12	23998927	23998927	+	Silent	SNP	G	G	A	rs149450279		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr12:23998927G>A	ENST00000451604.2	-	3	572	c.471C>T	c.(469-471)aaC>aaT	p.N157N	SOX5_ENST00000545921.1_Silent_p.N147N|SOX5_ENST00000441133.2_Silent_p.N122N|SOX5_ENST00000541536.1_Silent_p.N144N|SOX5_ENST00000537393.1_Silent_p.N122N|SOX5_ENST00000381381.2_Silent_p.N144N|SOX5_ENST00000309359.1_Silent_p.N144N|SOX5_ENST00000546136.1_Silent_p.N144N|SOX5_ENST00000541847.1_Silent_p.N147N			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	157					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.N157N(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						CTTCCGGCTCGTTTTTGATGA	0.403													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17504	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000134532	G	,	0,4406		0,0,2203	105.0	96.0	99.0		471,432	-3.0	1.0	12	dbSNP_134	99	2,8598	2.2+/-6.3	0,2,4298	yes	coding-synonymous,coding-synonymous	SOX5	NM_006940.4,NM_152989.2	,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,	157/764,144/751	23998927	2,13004	2203	4300	6503	SOX5	SO:0001819	synonymous_variant	0			-	HGNC	AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.471C>T	12.37:g.23998927G>A		Somatic	0	28	0.00		0.6487880846458666	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.N157	ENST00000451604.2	37	c.471	CCDS8699.1	12																																																																																			-	NULL		0.403	SOX5-002	KNOWN	basic|CCDS	protein_coding	SOX5	protein_coding	OTTHUMT00000402006.2	G	NM_006940	rs149450279		23998927	-1	no_errors	ENST00000451604	ensembl	human	known	74_37	silent	SNP	0.994	A
IGSF9	57549	genome.wustl.edu	37	1	159899796	159899796	+	Intron	SNP	G	G	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr1:159899796G>A	ENST00000368094.1	-	16	2262				IGSF9_ENST00000493195.1_Intron|IGSF9_ENST00000361509.3_Intron	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9						dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			CAGGAGGGAGGTCAGGGCCCA	0.647																																																	0								ENSG00000085552						19.0	18.0	18.0					1																	159899796		2202	4297	6499	IGSF9	SO:0001627	intron_variant	0			-	HGNC	AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.2065-31C>T	1.37:g.159899796G>A		Somatic	0	68	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	38	51.28		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368094.1	37	NULL	CCDS44254.1	1																																																																																			-	-		0.647	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF9	protein_coding	OTTHUMT00000059115.1	G	NM_020789	-		159899796	-1	no_errors	ENST00000496645	ensembl	human	known	74_37	rna	SNP	0.000	A
TDRD6	221400	genome.wustl.edu	37	6	46657281	46657281	+	Missense_Mutation	SNP	G	G	C	rs200948216		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr6:46657281G>C	ENST00000316081.6	+	1	1416	c.1416G>C	c.(1414-1416)gaG>gaC	p.E472D	RP11-446F17.3_ENST00000571590.1_RNA|RP11-446F17.3_ENST00000434329.2_RNA|RP11-446F17.3_ENST00000422284.2_RNA|TDRD6_ENST00000544460.1_Missense_Mutation_p.E472D	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	472					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			TAGATGAAGAGATTTCACTCC	0.458																																																	0								ENSG00000180113						98.0	89.0	92.0					6																	46657281		2203	4300	6503	TDRD6	SO:0001583	missense	0			-	HGNC	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.1416G>C	6.37:g.46657281G>C	ENSP00000346065:p.Glu472Asp	Somatic	0	39	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	22	26.67	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.E472D	ENST00000316081.6	37	c.1416	CCDS34470.1	6	.	.	.	.	.	.	.	.	.	.	G	0.889	-0.726282	0.03158	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.16324	2.35;2.36	5.88	-2.08	0.07254	.	0.767350	0.12638	N	0.451550	T	0.02047	0.0064	N	0.22421	0.69	0.09310	N	1	B;B	0.15930	0.015;0.009	B;B	0.18871	0.023;0.01	T	0.46062	-0.9218	10	0.12430	T	0.62	-0.6945	2.5396	0.04722	0.1404:0.2977:0.3498:0.2122	.	472;472	F5H5M3;O60522	.;TDRD6_HUMAN	D	472	ENSP00000443299:E472D;ENSP00000346065:E472D	ENSP00000346065:E472D	E	+	3	2	TDRD6	46765240	0.002000	0.14202	0.010000	0.14722	0.280000	0.26924	0.022000	0.13511	-0.094000	0.12374	0.655000	0.94253	GAG	-	NULL		0.458	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TDRD6	protein_coding	OTTHUMT00000040800.1	G	XM_166443	-		46657281	+1	no_errors	ENST00000316081	ensembl	human	known	74_37	missense	SNP	0.003	C
BX119917.1	0	genome.wustl.edu	37	X	71372202	71372211	+	RNA	DEL	CGCGCGCACA	CGCGCGCACA	-	rs6625958|rs72357649|rs72197346|rs59980083|rs6625957|rs200056633|rs10856127|rs199642163		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	CGCGCGCACA	CGCGCGCACA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chrX:71372202_71372211delCGCGCGCACA	ENST00000401114.1	-	0	53_62																											TGTGCATGCGCGCGCGcacacacacacaca	0.5																																																	0								ENSG00000215933																																			BX119917.1			0				Clone_based_ensembl_gene																													X.37:g.71372202_71372211delCGCGCGCACA		Somatic	NA	NA	NA		0.6487880846458666	70	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401114.1	37	NULL		X																																																																																			-	-		0.500	BX119917.1-201	NOVEL	basic	miRNA	ENSG00000215933	miRNA		CGCGCGCACA				71372211	-1	no_errors	ENST00000401114	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.015:0.009:0.008:0.004	-
MRGPRX4	117196	genome.wustl.edu	37	11	18195098	18195098	+	Missense_Mutation	SNP	G	G	A	rs376982271		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr11:18195098G>A	ENST00000314254.3	+	1	715	c.295G>A	c.(295-297)Gtt>Att	p.V99I	RP11-113D6.6_ENST00000527671.1_Intron	NM_054032.3	NP_473373.2	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	99						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						CAAAATCCTCGTTTCTGTGAT	0.532													G|||	1	0.000199681	0.0008	0.0	5008	,	,		23921	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000179817	G	ILE/VAL	1,4397	2.1+/-5.4	0,1,2198	127.0	103.0	111.0		295	-5.7	0.0	11		111	0,8586		0,0,4293	no	missense	MRGPRX4	NM_054032.3	29	0,1,6491	AA,AG,GG		0.0,0.0227,0.0077	benign	99/323	18195098	1,12983	2199	4293	6492	MRGPRX4	SO:0001583	missense	0			-	HGNC	AY042216	CCDS7831.1	11p15.1	2013-10-10			ENSG00000179817	ENSG00000179817		"""GPCR / Class A : Orphans"""	17617	protein-coding gene	gene with protein product		607230				11551509	Standard	NM_054032		Approved	MRGX4	uc001mnv.1	Q96LA9	OTTHUMG00000166442	ENST00000314254.3:c.295G>A	11.37:g.18195098G>A	ENSP00000314042:p.Val99Ile	Somatic	0	43	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	20	31.03	Q3KNU3|Q3KNU4|Q502W0|Q8TDD6|Q8TDD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.V99I	ENST00000314254.3	37	c.295	CCDS7831.1	11	.	.	.	.	.	.	.	.	.	.	G	1.273	-0.612531	0.03690	2.27E-4	0.0	ENSG00000179817	ENST00000314254	T	0.09911	2.93	2.82	-5.65	0.02459	GPCR, rhodopsin-like superfamily (1);	2.205680	0.01516	N	0.018124	T	0.04543	0.0124	N	0.10809	0.05	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29912	-0.9996	10	0.21540	T	0.41	.	1.0297	0.01535	0.179:0.3617:0.2077:0.2516	.	99	Q96LA9	MRGX4_HUMAN	I	99	ENSP00000314042:V99I	ENSP00000314042:V99I	V	+	1	0	MRGPRX4	18151674	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-11.026000	0.00004	-1.777000	0.01283	-2.811000	0.00111	GTT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.532	MRGPRX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX4	protein_coding	OTTHUMT00000389788.1	G	NM_054032	-		18195098	+1	no_errors	ENST00000314254	ensembl	human	known	74_37	missense	SNP	0.000	A
MTAP	4507	genome.wustl.edu	37	9	21861902	21861903	+	Intron	INS	-	-	T	rs11356405|rs67222036	byFrequency	TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr9:21861902_21861903insT	ENST00000460874.2	+	8	1089				RP11-145E5.5_ENST00000404796.2_Intron|MTAP_ENST00000380172.4_Intron|RP11-70L8.4_ENST00000581788.1_RNA|MTAP_ENST00000580900.1_Intron					methylthioadenosine phosphorylase									p.0(1)|p.0?(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|lung(3)|pancreas(1)	10		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)		ATCAAAATCTGTTTTTTTTTTT	0.332																																																	2	Whole gene deletion(2)	lung(2)						ENSG00000265194																																			RP11-70L8.4	SO:0001627	intron_variant	0				Clone_based_vega_gene	AB062485	CCDS6509.1	9p21	2013-05-29			ENSG00000099810	ENSG00000099810	2.4.2.28		7413	protein-coding gene	gene with protein product	"""S-methyl-5'-thioadenosine phosphorylase"""	156540				11126361	Standard	NM_002451		Approved	MSAP, c86fus	uc003zph.3	Q13126	OTTHUMG00000019690	ENST00000460874.2:c.865-72->T	9.37:g.21861913_21861913dupT		Somatic	0	12	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000460874.2	37	NULL		9																																																																																			-	-		0.332	MTAP-003	PUTATIVE	basic|exp_conf	protein_coding	ENSG00000265194	protein_coding	OTTHUMT00000051929.2	-	NM_002451			21861903	-1	no_errors	ENST00000581788	ensembl	human	known	74_37	rna	INS	0.000:0.000	T
CCNH	902	genome.wustl.edu	37	5	86707051	86707051	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr5:86707051C>T	ENST00000256897.4	-	2	454	c.230G>A	c.(229-231)aGa>aAa	p.R77K	CCNH_ENST00000504878.1_Missense_Mutation_p.R3K|CCNH_ENST00000508855.1_Missense_Mutation_p.R3K|CCNH_ENST00000513499.1_5'UTR	NM_001239.3	NP_001230.1	P51946	CCNH_HUMAN	cyclin H	77					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cyclin-dependent protein kinase activating kinase holoenzyme complex (GO:0019907)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|TFIIK complex (GO:0070985)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)	p.R77K(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(2)	15		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;9.01e-39)|Epithelial(54;5.08e-33)|all cancers(79;4.28e-28)		CACAACAGATCTTGGCATTGC	0.383								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)																																									1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)						ENSG00000134480						159.0	149.0	152.0					5																	86707051		2203	4300	6503	CCNH	SO:0001583	missense	0			-	HGNC	U12685	CCDS4064.1	5q13.3-q14	2014-03-28			ENSG00000134480	ENSG00000134480		"""General transcription factor IIH complex subunits"""	1594	protein-coding gene	gene with protein product	"""CDK-activating kinase complex subunit"", ""cyclin-dependent kinase-activating kinase complex subunit"", ""MO15-associated protein"", ""CAK complex subunit"""	601953				9465303	Standard	NM_001239		Approved	p34, p37, CycH	uc003kjb.3	P51946	OTTHUMG00000119077	ENST00000256897.4:c.230G>A	5.37:g.86707051C>T	ENSP00000256897:p.Arg77Lys	Somatic	0	74	0.00		0.6487880846458666	34	40.35	23	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	41	40.58	Q53X72|Q8TBL9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_CyclinC,tigrfam_CyclinH/Ccl1	p.R77K	ENST00000256897.4	37	c.230	CCDS4064.1	5	.	.	.	.	.	.	.	.	.	.	C	8.400	0.841665	0.16963	.	.	ENSG00000134480	ENST00000508855;ENST00000256897;ENST00000504878	T;T;T	0.10860	2.83;2.83;2.83	6.07	4.29	0.51040	Cyclin, N-terminal (1);Cyclin-like (3);	0.134405	0.64402	N	0.000002	T	0.03434	0.0099	N	0.01631	-0.79	0.32090	N	0.591985	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.24368	-1.0162	10	0.14656	T	0.56	-13.2357	8.6305	0.33917	0.0:0.7265:0.0:0.2735	.	77;24	P51946;E9PDB6	CCNH_HUMAN;.	K	3;77;3	ENSP00000426454:R3K;ENSP00000256897:R77K;ENSP00000426075:R3K	ENSP00000256897:R77K	R	-	2	0	CCNH	86742807	0.901000	0.30685	0.998000	0.56505	0.996000	0.88848	2.337000	0.43947	1.581000	0.49865	0.655000	0.94253	AGA	-	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_CyclinC,tigrfam_CyclinH/Ccl1		0.383	CCNH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNH	protein_coding	OTTHUMT00000239291.3	C	NM_001239	-		86707051	-1	no_errors	ENST00000256897	ensembl	human	known	74_37	missense	SNP	0.999	T
ATXN8OS	6315	genome.wustl.edu	37	13	70713512	70713512	+	RNA	SNP	A	A	G	rs2021426|rs143757288		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr13:70713512A>G	ENST00000414504.2	+	0	1099					NR_002717.2				ATXN8 opposite strand (non-protein coding)																		tactactactactactgctgc	0.408																																																	0								ENSG00000230223																																			ATXN8OS			0			-	HGNC	AF126749		13q21	2012-10-19	2008-08-13	2006-07-18	ENSG00000230223	ENSG00000230223		"""Long non-coding RNAs"", ""-"""	10561	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 3"""	603680	"""spinocerebellar ataxia 8"", ""kelch-like 1 antisense (Drosophila)"""	SCA8, KLHL1AS		10192387, 16804541	Standard	NR_002717		Approved	NCRNA00003	uc010aej.1		OTTHUMG00000017057		13.37:g.70713512A>G		Somatic	0	36	0.00		0.6487880846458666	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	41	12.77		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000414504.2	37	NULL		13																																																																																			-	-		0.408	ATXN8OS-002	KNOWN	basic	antisense	ATXN8OS	antisense	OTTHUMT00000045233.2	A	NR_002717	rs2021426		70713512	+1	no_errors	ENST00000414504	ensembl	human	known	74_37	rna	SNP	0.000	G
