#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
HOXB6	3216	genome.wustl.edu	37	17	46675273	46675273	+	Silent	SNP	G	G	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr17:46675273G>A	ENST00000484302.2	-	2	862	c.240C>T	c.(238-240)ttC>ttT	p.F80F	HOXB-AS3_ENST00000481995.1_RNA|HOXB-AS3_ENST00000465846.2_RNA|HOXB-AS3_ENST00000466037.2_RNA|HOXB6_ENST00000490419.1_5'Flank|HOXB-AS3_ENST00000460041.1_RNA|HOXB-AS3_ENST00000477144.1_RNA|HOXB-AS3_ENST00000480872.1_RNA|HOXB3_ENST00000552000.2_Intron|HOXB-AS3_ENST00000487849.3_RNA|HOXB-AS3_ENST00000492897.3_RNA|HOXB6_ENST00000225648.3_Silent_p.F80F|HOXB-AS3_ENST00000476204.1_RNA|HOXB-AS3_ENST00000467155.2_RNA|HOXB-AS3_ENST00000429755.4_RNA|HOXB-AS3_ENST00000474324.1_RNA|HOXB-AS3_ENST00000474040.1_RNA			P17509	HXB6_HUMAN	homeobox B6	80					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|erythrocyte homeostasis (GO:0034101)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(1)|lung(4)	7						TCTCGCGGTAGAAGGCCGGCG	0.726																																																	0								ENSG00000108511						5.0	6.0	6.0					17																	46675273		2132	4143	6275	HOXB6	SO:0001819	synonymous_variant	0			-	HGNC		CCDS11531.1	17q21.32	2011-06-20	2005-12-22		ENSG00000108511	ENSG00000108511		"""Homeoboxes / ANTP class : HOXL subclass"""	5117	protein-coding gene	gene with protein product		142961	"""homeo box B6"""	HOX2, HOX2B		1973146, 1358459	Standard	XM_005257284		Approved		uc002ins.1	P17509	OTTHUMG00000159912	ENST00000484302.2:c.240C>T	17.37:g.46675273G>A		Somatic	0	37	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	19	20.83	A8K835|D3DTV5|P09068|Q9HB11|Q9UGH2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa,prints_Homeobox_antennapedia	p.F80	ENST00000484302.2	37	c.240	CCDS11531.1	17																																																																																			-	NULL		0.726	HOXB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB6	protein_coding	OTTHUMT00000358146.2	G		-		46675273	-1	no_errors	ENST00000225648	ensembl	human	known	74_37	silent	SNP	1.000	A
PIN1	5300	genome.wustl.edu	37	19	9960266	9960266	+	3'UTR	SNP	C	C	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr19:9960266C>T	ENST00000247970.4	+	0	905				AC008752.3_ENST00000582439.1_RNA|PIN1_ENST00000380889.6_3'UTR|PIN1_ENST00000588695.1_3'UTR	NM_006221.3	NP_006212.1	Q13526	PIN1_HUMAN	peptidylprolyl cis/trans isomerase, NIMA-interacting 1						cell cycle (GO:0007049)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|negative regulation of cell motility (GO:2000146)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of cytokinesis (GO:0032465)|regulation of mitosis (GO:0007088)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTPase activating protein binding (GO:0032794)|mitogen-activated protein kinase kinase binding (GO:0031434)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)			skin(3)	3						CTCCTCTGTTCAGTCGCAAAG	0.592																																																	0								ENSG00000127445						56.0	56.0	56.0					19																	9960266		876	1991	2867	PIN1	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS12220.1	19p13	2014-09-17	2008-03-25		ENSG00000127445	ENSG00000127445			8988	protein-coding gene	gene with protein product		601052	"""protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1"""			8606777	Standard	NM_006221		Approved	dod	uc002mml.2	Q13526		ENST00000247970.4:c.*391C>T	19.37:g.9960266C>T		Somatic	0	52	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	70	397	14.99	A8K4V9|Q53X75	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000247970.4	37	NULL	CCDS12220.1	19																																																																																			-	-		0.592	PIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIN1	protein_coding	OTTHUMT00000451107.1	C		-		9960266	+1	no_errors	ENST00000380889	ensembl	human	known	74_37	rna	SNP	0.806	T
NOTCH2	4853	genome.wustl.edu	37	1	120484302	120484302	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr1:120484302C>A	ENST00000256646.2	-	18	3047	c.2828G>T	c.(2827-2829)gGg>gTg	p.G943V		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	943	EGF-like 24; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCACTTATCCCCAGTGAAACC	0.478			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																															Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0								ENSG00000134250						96.0	81.0	86.0					1																	120484302		2203	4300	6503	NOTCH2	SO:0001583	missense	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	-	HGNC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.2828G>T	1.37:g.120484302C>A	ENSP00000256646:p.Gly943Val	Somatic	0	26	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.G943V	ENST00000256646.2	37	c.2828	CCDS908.1	1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.234231	0.79688	.	.	ENSG00000134250	ENST00000256646	D	0.98249	-4.82	6.08	5.18	0.71444	EGF (1);EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.38381	U	0.001702	D	0.99444	0.9803	H	0.99117	4.435	0.80722	D	1	D;D	0.89917	0.995;1.0	D;D	0.97110	0.986;1.0	D	0.97953	1.0333	10	0.87932	D	0	.	14.7263	0.69346	0.0:0.931:0.0:0.069	.	943;943	Q6IQ50;Q04721	.;NOTC2_HUMAN	V	943	ENSP00000256646:G943V	ENSP00000256646:G943V	G	-	2	0	NOTCH2	120285825	1.000000	0.71417	0.956000	0.39512	0.753000	0.42808	5.676000	0.68131	1.592000	0.50018	-0.216000	0.12614	GGG	-	pirsf_Notch,pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.478	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	protein_coding	OTTHUMT00000033679.1	C	NM_024408	-		120484302	-1	no_errors	ENST00000256646	ensembl	human	known	74_37	missense	SNP	1.000	A
PPIL1	51645	genome.wustl.edu	37	6	36823502	36823503	+	3'UTR	INS	-	-	A	rs3216837|rs397709399|rs397822691	byFrequency	TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr6:36823502_36823503insA	ENST00000373699.5	-	0	838_839				PPIL1_ENST00000483552.1_5'UTR	NM_016059.4	NP_057143.1	Q9Y3C6	PPIL1_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 1						mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			lung(1)|ovary(1)	2						AAGCCAAAATGAATTTAGCATT	0.446													AAA|AA|AAA|deletion	1747	0.348842	0.2504	0.3775	5008	,	,		21877	0.4097		0.4314	False		,,,				2504	0.3139																0								ENSG00000137168																																			PPIL1	SO:0001624	3_prime_UTR_variant	0				HGNC	AF090992	CCDS4826.1	6p21.1	2008-08-29			ENSG00000137168	ENSG00000137168			9260	protein-coding gene	gene with protein product		601301				10072585, 8978786	Standard	NM_016059		Approved	CYPL1	uc003omu.2	Q9Y3C6	OTTHUMG00000014612	ENST00000373699.5:c.*87->T	6.37:g.36823504_36823504dupA		Somatic	0	9	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	10	44.44	O15001|Q5TDC9	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373699.5	37	NULL	CCDS4826.1	6																																																																																			-	-		0.446	PPIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIL1	protein_coding	OTTHUMT00000040382.1	-				36823503	-1	no_errors	ENST00000483552	ensembl	human	known	74_37	rna	INS	0.000:0.000	A
YOD1	55432	genome.wustl.edu	37	1	207222921	207222921	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr1:207222921C>T	ENST00000315927.4	-	2	537	c.491G>A	c.(490-492)aGt>aAt	p.S164N	YOD1_ENST00000367084.1_Missense_Mutation_p.S120N|YOD1_ENST00000391927.1_Missense_Mutation_p.S120N|PFKFB2_ENST00000411990.2_5'UTR	NM_018566.3	NP_061036.3	Q5VVQ6	OTU1_HUMAN	YOD1 deubiquitinase	164	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				cellular amino acid metabolic process (GO:0006520)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein K11-linked deubiquitination (GO:0035871)|protein K27-linked deubiquitination (GO:1990167)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)		Lys48-specific deubiquitinase activity (GO:1990380)|metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			cervix(1)|endometrium(3)|large_intestine(1)|lung(3)|ovary(3)	11	Prostate(682;0.19)					ATAGTACACACTAGTAAAGAG	0.483																																																	0								ENSG00000180667						71.0	65.0	67.0					1																	207222921		2203	4300	6503	YOD1	SO:0001583	missense	0			-	HGNC		CCDS31002.1, CCDS60402.1	1q32.2	2013-06-04	2013-06-04		ENSG00000180667	ENSG00000180667		"""OTU domain containing"""	25035	protein-coding gene	gene with protein product		612023	"""YOD1 OTU deubiquinating enzyme 1 homolog ( yeast)"", ""YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)"""				Standard	NM_001276320		Approved	DKFZp451J1719, OTUD2, DUBA8	uc001hfe.1	Q5VVQ6	OTTHUMG00000036032	ENST00000315927.4:c.491G>A	1.37:g.207222921C>T	ENSP00000326813:p.Ser164Asn	Somatic	0	59	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	49	14.04	B2RNX3|Q5VVQ5|Q6ZRS6|Q86T63|Q9P1L8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_OTU,pfscan_OTU	p.S164N	ENST00000315927.4	37	c.491	CCDS31002.1	1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.967186	0.92855	.	.	ENSG00000180667	ENST00000367084;ENST00000315927;ENST00000391927	T;T;T	0.56103	0.48;0.48;0.48	5.97	5.97	0.96955	Ovarian tumour, otubain (2);	0.037718	0.85682	D	0.000000	T	0.77432	0.4129	M	0.86097	2.795	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.87578	0.994;0.998	T	0.79584	-0.1743	10	0.87932	D	0	-8.3519	19.4269	0.94746	0.0:1.0:0.0:0.0	.	120;164	Q5VVQ6-2;Q5VVQ6	.;OTU1_HUMAN	N	120;164;120	ENSP00000356051:S120N;ENSP00000326813:S164N;ENSP00000375793:S120N	ENSP00000326813:S164N	S	-	2	0	YOD1	205289544	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.724000	0.84798	2.836000	0.97738	0.655000	0.94253	AGT	-	pfam_OTU,pfscan_OTU		0.483	YOD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	YOD1	protein_coding	OTTHUMT00000087837.1	C	NM_018566	-		207222921	-1	no_errors	ENST00000315927	ensembl	human	known	74_37	missense	SNP	1.000	T
C9orf41	138199	genome.wustl.edu	37	9	77611400	77611400	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr9:77611400C>G	ENST00000376834.3	-	6	1139	c.987G>C	c.(985-987)tgG>tgC	p.W329C	RP11-197P3.4_ENST00000455609.1_RNA|C9orf41_ENST00000376837.3_3'UTR	NM_152420.1	NP_689633.1	Q8N4J0	CI041_HUMAN	chromosome 9 open reading frame 41	329										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|urinary_tract(2)	17						TGAGTATTTTCCATATTGTAT	0.294																																																	0								ENSG00000156017						90.0	93.0	92.0					9																	77611400		2203	4290	6493	C9orf41	SO:0001583	missense	0			-	HGNC	AK098661	CCDS6649.1	9q21.31	2012-03-15			ENSG00000156017	ENSG00000156017			23435	protein-coding gene	gene with protein product						12477932	Standard	NM_152420		Approved	FLJ25795	uc004ajq.3	Q8N4J0	OTTHUMG00000020032	ENST00000376834.3:c.987G>C	9.37:g.77611400C>G	ENSP00000366030:p.Trp329Cys	Somatic	0	49	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	108	484	18.21	Q7Z383|Q8N7C5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_N2227	p.W329C	ENST00000376834.3	37	c.987	CCDS6649.1	9	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703999	0.68501	.	.	ENSG00000156017	ENST00000376834	T	0.03801	3.8	5.67	4.77	0.60923	N2227-like (1);	0.000000	0.85682	D	0.000000	T	0.15478	0.0373	M	0.63843	1.955	0.80722	D	1	P	0.52061	0.95	P	0.58130	0.833	T	0.00819	-1.1553	10	0.41790	T	0.15	-5.6822	15.7033	0.77558	0.138:0.862:0.0:0.0	.	329	Q8N4J0	CI041_HUMAN	C	329	ENSP00000366030:W329C	ENSP00000366030:W329C	W	-	3	0	C9orf41	76801220	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.431000	0.80335	1.394000	0.46624	0.650000	0.86243	TGG	-	pfam_N2227		0.294	C9orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf41	protein_coding	OTTHUMT00000052703.1	C	NM_152420	-		77611400	-1	no_errors	ENST00000376834	ensembl	human	known	74_37	missense	SNP	1.000	G
KRT81	3887	genome.wustl.edu	37	12	52681806	52681806	+	Missense_Mutation	SNP	G	G	A	rs144716678	byFrequency	TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr12:52681806G>A	ENST00000327741.5	-	5	930	c.862C>T	c.(862-864)Cgc>Tgc	p.R288C	KRT86_ENST00000544024.1_Intron|KRT86_ENST00000423955.2_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	288	Coil 2.|Rod.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		GCCCGGCTGCGGGTGACAATG	0.572													.|||	3	0.000599042	0.0	0.0	5008	,	,		20689	0.0		0.0	False		,,,				2504	0.0031																0								ENSG00000205426	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	118.0	98.0	105.0		862	3.5	1.0	12	dbSNP_134	105	4,8596	3.7+/-12.6	0,4,4296	no	missense	KRT81	NM_002281.3	180	0,5,6498	AA,AG,GG		0.0465,0.0227,0.0384	probably-damaging	288/506	52681806	5,13001	2203	4300	6503	KRT81	SO:0001583	missense	0			-	HGNC	X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.862C>T	12.37:g.52681806G>A	ENSP00000369349:p.Arg288Cys	Somatic	0	54	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	55	14.06	Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.R288C	ENST00000327741.5	37	c.862	CCDS31805.1	12	.	.	.	.	.	.	.	.	.	.	G	14.45	2.539428	0.45176	2.27E-4	4.65E-4	ENSG00000205426	ENST00000327741;ENST00000389388	T	0.75821	-0.97	4.48	3.55	0.40652	Filament (1);	0.000000	0.42053	U	0.000779	T	0.74801	0.3764	M	0.83774	2.66	0.44807	D	0.99781	P	0.36633	0.562	B	0.36186	0.219	T	0.80108	-0.1520	10	0.72032	D	0.01	.	11.8153	0.52207	0.0:0.0:0.6857:0.3143	.	288	Q14533	KRT81_HUMAN	C	288	ENSP00000369349:R288C	ENSP00000369349:R288C	R	-	1	0	KRT81	50968073	1.000000	0.71417	1.000000	0.80357	0.667000	0.39255	1.881000	0.39638	2.052000	0.61016	0.556000	0.70494	CGC	-	pfam_IF,superfamily_Prefoldin		0.572	KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT81	protein_coding	OTTHUMT00000395128.2	G	NM_002281	rs144716678		52681806	-1	no_errors	ENST00000327741	ensembl	human	known	74_37	missense	SNP	1.000	A
C1orf86	199990	genome.wustl.edu	37	1	2115954	2115954	+	3'UTR	SNP	G	G	A	rs370078851		TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr1:2115954G>A	ENST00000400919.3	-	0	2275				RP11-181G12.2_ENST00000333854.2_RNA|RP11-181G12.2_ENST00000536678.1_RNA|PRKCZ_ENST00000400921.2_Intron|PRKCZ_ENST00000400920.1_Intron|RP11-181G12.2_ENST00000444529.1_RNA|PRKCZ_ENST00000479263.1_Intron	NM_001282671.1	NP_001269600.1	Q6NZ36	FAP20_HUMAN	chromosome 1 open reading frame 86						cellular response to DNA damage stimulus (GO:0006974)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	cell junction (GO:0030054)|chromosome (GO:0005694)|Fanconi anaemia nuclear complex (GO:0043240)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|metal ion binding (GO:0046872)|polyubiquitin binding (GO:0031593)|ubiquitin binding (GO:0043130)			central_nervous_system(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4	all_cancers(77;0.000134)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.09e-37)|OV - Ovarian serous cystadenocarcinoma(86;1.5e-23)|GBM - Glioblastoma multiforme(42;1.61e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00437)|STAD - Stomach adenocarcinoma(132;0.0134)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		TGAAGTGCGTGCAAAACACTC	0.448																																																	0								ENSG00000162585																																			C1orf86	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK126870	CCDS38.2, CCDS57965.1, CCDS72686.1, CCDS72687.1	1p36.33	2013-05-22			ENSG00000162585	ENSG00000162585			26428	protein-coding gene	gene with protein product		615183				14702039	Standard	NM_182533		Approved	FLJ31031, FAAP20	uc031pkt.1	Q6NZ36	OTTHUMG00000001404	ENST00000400919.3:c.*763C>T	1.37:g.2115954G>A		Somatic	0	33	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A6PW39|A6PW40|A6PW41|A8MQT6|F2Z2L4|Q6ZT64|Q71M24|Q96ND7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000400919.3	37	NULL		1																																																																																			-	-		0.448	C1orf86-202	KNOWN	basic	protein_coding	C1orf86	protein_coding		G	NM_182533	-		2115954	-1	no_errors	ENST00000469733	ensembl	human	known	74_37	rna	SNP	0.000	A
HOGA1	112817	genome.wustl.edu	37	10	99361669	99361669	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr10:99361669G>T	ENST00000370646.4	+	6	1117	c.756G>T	c.(754-756)caG>caT	p.Q252H	PI4K2A_ENST00000555577.1_Missense_Mutation_p.Q89H|PI4K2A_ENST00000370649.3_Missense_Mutation_p.Q89H|HOGA1_ENST00000370647.4_Missense_Mutation_p.Q89H	NM_138413.3	NP_612422.2	Q86XE5	HOGA1_HUMAN	4-hydroxy-2-oxoglutarate aldolase 1	252					4-hydroxyproline catabolic process (GO:0019470)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|oxalate metabolic process (GO:0033609)|pyruvate biosynthetic process (GO:0042866)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	4-hydroxy-2-oxoglutarate aldolase activity (GO:0008700)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|stomach(1)	14						AGGTGTGCCAGCTGGAGCGAC	0.652																																																	0								ENSG00000155252						36.0	35.0	36.0					10																	99361669		2203	4300	6503	PI4K2A	SO:0001583	missense	0			-	HGNC	BC011916	CCDS7467.1, CCDS44469.1	10q24.1	2010-12-19	2010-12-19	2010-12-19	ENSG00000241935	ENSG00000241935			25155	protein-coding gene	gene with protein product	"""dihydrodipicolinate synthetase homolog 2 (E. coli)"", ""N-acetylneuraminate pyruvate lyase 2 (putative)"""	613597	"""chromosome 10 open reading frame 65"", ""dihydrodipicolinate synthase-like, mitochondrial"""	C10orf65, DHDPSL		20797690	Standard	NM_001134670		Approved	FLJ37472, DHDPS2, NPL2		Q86XE5	OTTHUMG00000018859	ENST00000370646.4:c.756G>T	10.37:g.99361669G>T	ENSP00000359680:p.Gln252His	Somatic	0	33	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A8K075|Q5T680|Q5T684|Q711P0|Q8N9F2|Q96EV5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PI3/4_kinase_cat_dom	p.Q89H	ENST00000370646.4	37	c.267	CCDS7467.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.07|15.07	2.725376|2.725376	0.48833|0.48833	.|.	.|.	ENSG00000241935|ENSG00000241935;ENSG00000241935;ENSG00000155252;ENSG00000249967	ENST00000370642|ENST00000370647;ENST00000370646;ENST00000555577;ENST00000370649	.|D;D;D;D	.|0.94376	.|-3.41;-3.41;-2.13;-2.13	5.07|5.07	4.17|4.17	0.49024|0.49024	.|Aldolase-type TIM barrel (1);	.|0.053822	.|0.64402	.|D	.|0.000001	D|D	0.90717|0.90717	0.7087|0.7087	L|L	0.28400|0.28400	0.85|0.85	0.39736|0.39736	D|D	0.971689|0.971689	.|P;B;B	.|0.45396	.|0.857;0.274;0.02	.|P;B;B	.|0.49301	.|0.606;0.054;0.008	D|D	0.90670|0.90670	0.4597|0.4597	5|10	.|0.56958	.|D	.|0.05	-14.6721|-14.6721	10.1823|10.1823	0.42975|0.42975	0.154:0.0:0.846:0.0|0.154:0.0:0.846:0.0	.|.	.|89;89;252	.|E9PAM4;Q86XE5-3;Q86XE5	.|.;.;HOGA1_HUMAN	S|H	56|89;252;89;89	.|ENSP00000359681:Q89H;ENSP00000359680:Q252H;ENSP00000452243:Q89H;ENSP00000359683:Q89H	.|ENSP00000359680:Q252H	A|Q	+|+	1|3	0|2	HOGA1|PI4K2A;HOGA1;RP11-548K23.11	99351659|99351659	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	4.413000|4.413000	0.59795|0.59795	1.274000|1.274000	0.44362|0.44362	0.561000|0.561000	0.74099|0.74099	GCT|CAG	-	NULL		0.652	HOGA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PI4K2A	protein_coding	OTTHUMT00000049726.1	G	NM_138413	-		99361669	+1	no_errors	ENST00000555577	ensembl	human	known	74_37	missense	SNP	1.000	T
FCRL3	115352	genome.wustl.edu	37	1	157666077	157666077	+	Silent	SNP	G	G	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr1:157666077G>A	ENST00000368184.3	-	7	1176	c.885C>T	c.(883-885)acC>acT	p.T295T	RP11-367J7.3_ENST00000453692.1_RNA|FCRL3_ENST00000473231.1_5'UTR|FCRL3_ENST00000368186.5_Silent_p.T295T	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	295	Ig-like C2-type 4.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T295T(1)		autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					GCTGCCCTCCGGTGGGCCGGA	0.517																																																	1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000160856						95.0	91.0	93.0					1																	157666077		2203	4300	6503	FCRL3	SO:0001819	synonymous_variant	0			-	HGNC	AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.885C>T	1.37:g.157666077G>A		Somatic	0	43	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	31	29.55	A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T295	ENST00000368184.3	37	c.885	CCDS1167.1	1																																																																																			-	smart_Ig_sub,pfscan_Ig-like_dom		0.517	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	FCRL3	protein_coding	OTTHUMT00000051419.2	G	NM_052939	-		157666077	-1	no_errors	ENST00000492769	ensembl	human	known	74_37	silent	SNP	0.000	A
ARPC5	10092	genome.wustl.edu	37	1	183602270	183602270	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr1:183602270G>T	ENST00000359856.6	-	2	229	c.163C>A	c.(163-165)Cta>Ata	p.L55I	ARPC5_ENST00000294742.6_Missense_Mutation_p.L58I|RGL1_ENST00000536277.1_5'Flank|RGL1_ENST00000304685.4_5'Flank|ARPC5_ENST00000367534.1_Missense_Mutation_p.L55I|ARPC5_ENST00000462965.1_5'UTR	NM_005717.3	NP_005708.1	O15511	ARPC5_HUMAN	actin related protein 2/3 complex, subunit 5, 16kDa	55					actin cytoskeleton organization (GO:0030036)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|large_intestine(1)|lung(2)	4						GCTGCCTGTAGGGCAGCTGTC	0.468																																					Melanoma(136;1596 1789 3041 4830 41075)												0								ENSG00000162704						131.0	134.0	133.0					1																	183602270		2203	4300	6503	ARPC5	SO:0001583	missense	0			-	HGNC	AF017807	CCDS1357.1, CCDS58050.1	1q	2011-07-06	2002-08-29		ENSG00000162704	ENSG00000162704		"""Actin related protein 2/3 complex subunits"""	708	protein-coding gene	gene with protein product	"""Arp2/3 protein complex subunit p16"""	604227	"""actin related protein 2/3 complex, subunit 5 (16 kD)"""			9359840, 9230079	Standard	NM_005717		Approved	p16-Arc, ARC16, dJ127C7.3	uc021pgb.2	O15511	OTTHUMG00000035326	ENST00000359856.6:c.163C>A	1.37:g.183602270G>T	ENSP00000352918:p.Leu55Ile	Somatic	0	30	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A6NEC4|Q6PG42	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ARP2/3_p16_Arc,superfamily_ARP2/3_p16_Arc	p.L58I	ENST00000359856.6	37	c.172	CCDS1357.1	1	.	.	.	.	.	.	.	.	.	.	G	19.25	3.790845	0.70452	.	.	ENSG00000162704	ENST00000367534;ENST00000359856;ENST00000294742	.	.	.	5.78	4.78	0.61160	.	0.073722	0.56097	D	0.000035	T	0.77592	0.4153	M	0.85710	2.77	0.51233	D	0.999917	B	0.23735	0.09	B	0.44224	0.444	T	0.78188	-0.2301	9	0.59425	D	0.04	-2.6151	10.5342	0.44994	0.1556:0.0:0.8444:0.0	.	55	O15511	ARPC5_HUMAN	I	55;55;58	.	ENSP00000294742:L58I	L	-	1	2	ARPC5	181868893	0.986000	0.35501	0.787000	0.31911	0.983000	0.72400	1.920000	0.40025	2.732000	0.93576	0.655000	0.94253	CTA	-	pfam_ARP2/3_p16_Arc,superfamily_ARP2/3_p16_Arc		0.468	ARPC5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARPC5	protein_coding	OTTHUMT00000085477.1	G	NM_005717	-		183602270	-1	no_errors	ENST00000294742	ensembl	human	known	74_37	missense	SNP	0.857	T
MT-CO1	4512	genome.wustl.edu	37	M	3079	3079	+	5'Flank	SNP	G	G	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chrM:3079G>A	ENST00000361624.2	+	0	0				MT-TA_ENST00000387392.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-TM_ENST00000387377.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TGAGTTCAGACCGGAGTAATC	0.463																																																	0								ENSG00000210082																																			MT-RNR2	SO:0001631	upstream_gene_variant	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.3079G>A	Exception_encountered	Somatic	0	39	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	63	32.26	Q34770	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			-	-		0.463	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	protein_coding		G	YP_003024028	-		3079	+1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	SNP	NULL	A
CACNA1B	774	genome.wustl.edu	37	9	140777367	140777367	+	Intron	SNP	G	G	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr9:140777367G>A	ENST00000371372.1	+	3	675				CACNA1B_ENST00000277549.5_Intron|RP11-188C12.3_ENST00000371390.1_RNA|CACNA1B_ENST00000277551.2_Intron|CACNA1B_ENST00000371363.1_Intron|CACNA1B_ENST00000371355.4_Intron|CACNA1B_ENST00000371357.1_Intron	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit						calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GGCCCAGCGTGTGAGGCCCGG	0.642																																																	0								ENSG00000203987						120.0	132.0	128.0					9																	140777367		2145	4253	6398	RP11-188C12.3	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.530+32G>A	9.37:g.140777367G>A		Somatic	0	55	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	45	13.46	B1AQK5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371372.1	37	NULL	CCDS59522.1	9																																																																																			-	-		0.642	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	LOC100133077	protein_coding	OTTHUMT00000055380.1	G	NM_000718	-		140777367	-1	no_errors	ENST00000371390	ensembl	human	known	74_37	rna	SNP	0.000	A
CDH10	1008	genome.wustl.edu	37	5	24511594	24511594	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr5:24511594A>G	ENST00000264463.4	-	6	1351	c.844T>C	c.(844-846)Tcc>Ccc	p.S282P		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	282	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		CCAACTGGGGAGGATTCAAGA	0.433										HNSCC(23;0.051)																																							0								ENSG00000040731						86.0	78.0	81.0					5																	24511594		2203	4300	6503	CDH10	SO:0001583	missense	0			-	HGNC	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.844T>C	5.37:g.24511594A>G	ENSP00000264463:p.Ser282Pro	Somatic	0	44	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	Q9ULB3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S282P	ENST00000264463.4	37	c.844	CCDS3892.1	5	.	.	.	.	.	.	.	.	.	.	A	16.54	3.150873	0.57151	.	.	ENSG00000040731	ENST00000264463	T	0.01871	4.59	4.98	4.98	0.66077	Cadherin (3);Cadherin-like (1);	0.214071	0.42821	D	0.000646	T	0.08223	0.0205	M	0.80616	2.505	0.34144	D	0.666702	D	0.54772	0.968	P	0.53062	0.717	T	0.07214	-1.0784	10	0.72032	D	0.01	.	10.0797	0.42381	0.8314:0.1686:0.0:0.0	.	282	Q9Y6N8	CAD10_HUMAN	P	282	ENSP00000264463:S282P	ENSP00000264463:S282P	S	-	1	0	CDH10	24547351	0.526000	0.26298	0.996000	0.52242	0.938000	0.57974	1.285000	0.33261	1.859000	0.53934	0.528000	0.53228	TCC	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.433	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH10	protein_coding	OTTHUMT00000207345.2	A	NM_006727	-		24511594	-1	no_errors	ENST00000264463	ensembl	human	known	74_37	missense	SNP	0.699	G
DMWD	1762	genome.wustl.edu	37	19	46289542	46289544	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr19:46289542_46289544delCTC	ENST00000270223.6	-	3	1255_1257	c.1210_1212delGAG	c.(1210-1212)gagdel	p.E404del	DMWD_ENST00000601370.1_5'Flank|AC011530.4_ENST00000593999.1_5'Flank|DMWD_ENST00000377735.3_In_Frame_Del_p.E404del	NM_004943.1	NP_004934.1	Q09019	DMWD_HUMAN	dystrophia myotonica, WD repeat containing	404										central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00604)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.236)		CAGCCTCGGGCTCCTCCTCCTCC	0.695																																																	0								ENSG00000185800																																			DMWD	SO:0001651	inframe_deletion	0				HGNC	L19267	CCDS33054.1	19q13.32	2013-01-09	2007-02-20		ENSG00000185800	ENSG00000185800		"""WD repeat domain containing"""	2936	protein-coding gene	gene with protein product		609857	"""dystrophia myotonica-containing WD repeat motif"""			1302022	Standard	NM_004943		Approved	DMR-N9, gene59, D19S593E	uc021uwc.1	Q09019	OTTHUMG00000169044	ENST00000270223.6:c.1210_1212delGAG	19.37:g.46289551_46289553delCTC	ENSP00000270223:p.Glu404del	Somatic	0	17	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	22	8.33		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E404in_frame_del	ENST00000270223.6	37	c.1212_1210	CCDS33054.1	19																																																																																			-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat		0.695	DMWD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DMWD	protein_coding	OTTHUMT00000402063.1	CTC	NM_004943			46289544	-1	no_errors	ENST00000270223	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
MTAP	4507	genome.wustl.edu	37	9	21861902	21861903	+	Intron	INS	-	-	T	rs11356405|rs67222036	byFrequency	TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr9:21861902_21861903insT	ENST00000460874.2	+	8	1089				RP11-70L8.4_ENST00000581788.1_RNA|RP11-145E5.5_ENST00000404796.2_Intron|MTAP_ENST00000580900.1_Intron|MTAP_ENST00000380172.4_Intron					methylthioadenosine phosphorylase									p.0(1)|p.0?(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|lung(3)|pancreas(1)	10		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)		ATCAAAATCTGTTTTTTTTTTT	0.332																																																	2	Whole gene deletion(2)	lung(2)						ENSG00000265194																																			RP11-70L8.4	SO:0001627	intron_variant	0				Clone_based_vega_gene	AB062485	CCDS6509.1	9p21	2013-05-29			ENSG00000099810	ENSG00000099810	2.4.2.28		7413	protein-coding gene	gene with protein product	"""S-methyl-5'-thioadenosine phosphorylase"""	156540				11126361	Standard	NM_002451		Approved	MSAP, c86fus	uc003zph.3	Q13126	OTTHUMG00000019690	ENST00000460874.2:c.865-72->T	9.37:g.21861913_21861913dupT		Somatic	0	18	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000460874.2	37	NULL		9																																																																																			-	-		0.332	MTAP-003	PUTATIVE	basic|exp_conf	protein_coding	ENSG00000265194	protein_coding	OTTHUMT00000051929.2	-	NM_002451			21861903	-1	no_errors	ENST00000581788	ensembl	human	known	74_37	rna	INS	0.000:0.000	T
NYAP2	57624	genome.wustl.edu	37	2	226447163	226447163	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr2:226447163G>A	ENST00000272907.6	+	4	1443	c.1030G>A	c.(1030-1032)Gtg>Atg	p.V344M	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	344	Pro-rich.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												CCCCGCCCCCGTGCATTGCTC	0.632																																																	0								ENSG00000144460						19.0	21.0	20.0					2																	226447163		1880	4083	5963	NYAP2	SO:0001583	missense	0			-	HGNC	AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.1030G>A	2.37:g.226447163G>A	ENSP00000272907:p.Val344Met	Somatic	0	23	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	23	15.15	A2RRN4|Q96NL2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V344M	ENST00000272907.6	37	c.1030	CCDS46529.1	2	.	.	.	.	.	.	.	.	.	.	G	22.5	4.293486	0.80914	.	.	ENSG00000144460	ENST00000272907	T	0.52295	0.67	5.27	5.27	0.74061	.	0.147007	0.46758	D	0.000276	T	0.68007	0.2954	M	0.73962	2.25	0.80722	D	1	D	0.76494	0.999	P	0.62298	0.9	T	0.72093	-0.4394	10	0.72032	D	0.01	-16.0337	18.916	0.92506	0.0:0.0:1.0:0.0	.	344	Q9P242	K1486_HUMAN	M	344	ENSP00000272907:V344M	ENSP00000272907:V344M	V	+	1	0	KIAA1486	226155407	1.000000	0.71417	0.771000	0.31576	0.816000	0.46133	9.476000	0.97823	2.462000	0.83206	0.650000	0.86243	GTG	-	NULL		0.632	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYAP2	protein_coding	OTTHUMT00000331258.1	G	NM_020864	-		226447163	+1	no_errors	ENST00000272907	ensembl	human	known	74_37	missense	SNP	0.995	A
RAP1B	5908	genome.wustl.edu	37	12	69053162	69053162	+	3'UTR	SNP	C	C	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr12:69053162C>T	ENST00000250559.9	+	0	919				RAP1B_ENST00000450214.2_3'UTR|RAP1B_ENST00000543697.1_3'UTR|RAP1B_ENST00000542145.1_3'UTR|RAP1B_ENST00000537460.1_3'UTR|RAP1B_ENST00000540209.1_3'UTR|RAP1B_ENST00000463493.1_3'UTR|RAP1B_ENST00000539091.1_3'UTR|RAP1B_ENST00000543393.1_3'UTR|RAP1B_ENST00000393436.5_3'UTR	NM_001010942.2|NM_001251921.1|NM_001251922.1|NM_015646.5	NP_001010942.1|NP_001238850.1|NP_001238851.1|NP_056461.1	P61224	RAP1B_HUMAN	RAP1B, member of RAS oncogene family						blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cellular response to cAMP (GO:0071320)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of establishment of cell polarity (GO:2000114)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein complex binding (GO:0032403)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(2)|urinary_tract(2)	12	Breast(13;1.24e-05)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)	GBM - Glioblastoma multiforme(7;0.000306)		CTTTAAGAGGCGGATGAAAGC	0.388																																																	0								ENSG00000127314																																			RAP1B	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS8984.1, CCDS58252.1, CCDS58253.1, CCDS58254.1	12q14	2014-05-09			ENSG00000127314	ENSG00000127314			9857	protein-coding gene	gene with protein product		179530				3137530, 12089143	Standard	NM_015646		Approved	K-REV, RAL1B, DKFZp586H0723	uc001suc.3	P61224	OTTHUMG00000133660	ENST00000250559.9:c.*133C>T	12.37:g.69053162C>T		Somatic	0	38	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	165	336	32.93	B2R5Z2|B4DQI8|B4DW74|B4DW94|P09526|Q502X3|Q5TZR4|Q6DCA1|Q6LES0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000250559.9	37	NULL	CCDS8984.1	12																																																																																			-	-		0.388	RAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAP1B	protein_coding	OTTHUMT00000257821.3	C	NM_001010942	-		69053162	+1	no_errors	ENST00000463493	ensembl	human	known	74_37	rna	SNP	0.995	T
NDUFA7	4701	genome.wustl.edu	37	19	8386199	8386199	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr19:8386199G>T	ENST00000301457.2	-	1	81	c.44C>A	c.(43-45)gCg>gAg	p.A15E	RPS28_ENST00000600659.2_5'Flank|NDUFA7_ENST00000598884.1_Missense_Mutation_p.A15E	NM_005001.3	NP_004992.2	O95182	NDUA7_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa	15					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			NS(1)|central_nervous_system(1)|lung(2)|ovary(1)	5						CACCCCGGACGCCCAGTTCCG	0.716																																																	0								ENSG00000267855						5.0	9.0	8.0					19																	8386199		1855	4007	5862	NDUFA7	SO:0001583	missense	0			-	HGNC	AF050637	CCDS42492.1	19p13.2	2013-05-14	2002-08-29		ENSG00000267855	ENSG00000267855		"""Mitochondrial respiratory chain complex / Complex I"""	7691	protein-coding gene	gene with protein product	"""complex I B14.5a subunit"""	602139	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (14.5kD, B14.5a)"""			9763676	Standard	NM_005001		Approved	B14.5a	uc002mjm.2	O95182	OTTHUMG00000182459	ENST00000301457.2:c.44C>A	19.37:g.8386199G>T	ENSP00000301457:p.Ala15Glu	Somatic	0	25	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	18	30.77		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NADH-UbQ_OxRdtase_B14.5a_su	p.A15E	ENST00000301457.2	37	c.44	CCDS42492.1	19	.	.	.	.	.	.	.	.	.	.	G	17.62	3.435192	0.62955	.	.	ENSG00000167774	ENST00000301457	T	0.45276	0.9	5.54	4.51	0.55191	.	0.166015	0.41823	D	0.000817	T	0.37785	0.1016	L	0.40543	1.245	0.30085	N	0.808798	P	0.37038	0.579	B	0.41332	0.354	T	0.46205	-0.9208	10	0.72032	D	0.01	-5.6882	10.1648	0.42873	0.1583:0.0:0.8417:0.0	.	15	O95182	NDUA7_HUMAN	E	15	ENSP00000301457:A15E	ENSP00000301457:A15E	A	-	2	0	NDUFA7	8292199	0.495000	0.26051	0.888000	0.34837	0.310000	0.27922	3.319000	0.51983	1.584000	0.49913	0.655000	0.94253	GCG	-	pfam_NADH-UbQ_OxRdtase_B14.5a_su		0.716	NDUFA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFA7	protein_coding	OTTHUMT00000461373.1	G	NM_005001	-		8386199	-1	no_errors	ENST00000301457	ensembl	human	known	74_37	missense	SNP	0.759	T
AGO3	192669	genome.wustl.edu	37	1	36475026	36475027	+	Intron	INS	-	-	A	rs556239903|rs3834076|rs397840917	byFrequency	TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr1:36475026_36475027insA	ENST00000373191.4	+	9	1378				RP4-665N4.8_ENST00000479395.2_RNA|AGO3_ENST00000246314.6_Intron|RP4-665N4.8_ENST00000466576.2_RNA	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3						epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)										AAGTAAGAGCTAAAAAAAAAAG	0.277													|||unknown(HR)	192	0.0383387	0.0023	0.0187	5008	,	,		15573	0.1607		0.005	False		,,,				2504	0.0092																0								ENSG00000271554																																			RP4-665N4.8	SO:0001627	intron_variant	0				Clone_based_vega_gene	AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.1030-49->A	1.37:g.36475036_36475036dupA		Somatic	0	20	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34	B1ALI0|Q5TA55|Q9H1U6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373191.4	37	NULL	CCDS399.1	1																																																																																			-	-		0.277	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000271554	protein_coding	OTTHUMT00000019831.4	-	NM_024852			36475027	-1	no_errors	ENST00000479395	ensembl	human	known	74_37	rna	INS	0.026:0.011	A
SLC12A6	9990	genome.wustl.edu	37	15	34553189	34553189	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr15:34553189G>T	ENST00000354181.3	-	4	841	c.349C>A	c.(349-351)Ctc>Atc	p.L117I	SLC12A6_ENST00000560164.1_5'UTR|SLC12A6_ENST00000451844.2_5'UTR|SLC12A6_ENST00000397702.2_Missense_Mutation_p.L58I|SLC12A6_ENST00000558589.1_Missense_Mutation_p.L108I|SLC12A6_ENST00000458406.2_Missense_Mutation_p.L58I|SLC12A6_ENST00000558667.1_Missense_Mutation_p.L117I|SLC12A6_ENST00000560611.1_Missense_Mutation_p.L117I|SLC12A6_ENST00000290209.5_Missense_Mutation_p.L66I|SLC12A6_ENST00000397707.2_Missense_Mutation_p.L102I			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	117					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)			central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	GAATTATTGAGATAAGCATTT	0.348																																																	0								ENSG00000140199						68.0	73.0	72.0					15																	34553189		2201	4298	6499	SLC12A6	SO:0001583	missense	0			-	HGNC	AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.349C>A	15.37:g.34553189G>T	ENSP00000346112:p.Leu117Ile	Somatic	0	23	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AA-permease/SLC12A_dom,pfam_K/Cl_cotranspt_1/3,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.L108I	ENST00000354181.3	37	c.322	CCDS58352.1	15	.	.	.	.	.	.	.	.	.	.	G	5.657	0.305885	0.10733	.	.	ENSG00000140199	ENST00000290209;ENST00000397707;ENST00000354181;ENST00000397702;ENST00000458406	D;D;D;D	0.83075	-1.67;-1.67;-1.68;-1.68	5.09	5.09	0.68999	.	0.161370	0.42964	D	0.000640	T	0.65502	0.2697	N	0.04746	-0.17	0.80722	D	1	B;B;B	0.17038	0.0;0.02;0.0	B;B;B	0.14578	0.003;0.011;0.001	T	0.62992	-0.6736	10	0.06365	T	0.9	.	17.4339	0.87546	0.0:0.0:1.0:0.0	.	102;117;66	Q9UHW9-3;Q9UHW9;A0AV76	.;S12A6_HUMAN;.	I	66;102;108;58;58	ENSP00000290209:L66I;ENSP00000380819:L102I;ENSP00000380814:L58I;ENSP00000387725:L58I	ENSP00000290209:L66I	L	-	1	0	SLC12A6	32340481	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	5.381000	0.66208	2.648000	0.89879	0.563000	0.77884	CTC	-	tigrfam_Na/K/Cl_cotransptS		0.348	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	SLC12A6	protein_coding	OTTHUMT00000417991.1	G	NM_005135	-		34553189	-1	no_errors	ENST00000558589	ensembl	human	known	74_37	missense	SNP	1.000	T
OLFM2	93145	genome.wustl.edu	37	19	9968504	9968504	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr19:9968504C>G	ENST00000264833.4	-	3	432	c.247G>C	c.(247-249)Gag>Cag	p.E83Q	OLFM2_ENST00000590841.1_Missense_Mutation_p.E5Q	NM_058164.2	NP_477512.1	O95897	NOE2_HUMAN	olfactomedin 2	83					protein secretion (GO:0009306)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular region (GO:0005576)|synapse (GO:0045202)				breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	31						GTCCGCAACTCAAGGACCTCC	0.612																																																	0								ENSG00000105088						80.0	70.0	73.0					19																	9968504		2203	4300	6503	OLFM2	SO:0001583	missense	0			-	HGNC	AF131839	CCDS12221.1	19p13.2	2008-07-03				ENSG00000105088			17189	protein-coding gene	gene with protein product	"""noelin 2"""						Standard	NM_058164		Approved	OlfC, NOE2	uc002mmp.3	O95897		ENST00000264833.4:c.247G>C	19.37:g.9968504C>G	ENSP00000264833:p.Glu83Gln	Somatic	0	48	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	79	421	15.74	Q6IMJ3|Q96FC2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Olfac-like,pfam_Noelin-1,superfamily_Quinonprotein_ADH-like_supfam,smart_Olfac-like,pfscan_Olfac-like	p.E83Q	ENST00000264833.4	37	c.247	CCDS12221.1	19	.	.	.	.	.	.	.	.	.	.	c	14.09	2.431016	0.43122	.	.	ENSG00000105088	ENST00000264833	T	0.46063	0.88	3.91	3.91	0.45181	.	0.060593	0.64402	D	0.000005	T	0.29223	0.0727	N	0.22421	0.69	0.35252	D	0.77878	P	0.38788	0.647	B	0.38156	0.266	T	0.39099	-0.9630	9	.	.	.	.	13.4645	0.61245	0.0:1.0:0.0:0.0	.	83	O95897	NOE2_HUMAN	Q	83	ENSP00000264833:E83Q	.	E	-	1	0	OLFM2	9829504	0.997000	0.39634	1.000000	0.80357	0.476000	0.33039	1.823000	0.39062	2.021000	0.59480	0.306000	0.20318	GAG	-	pfam_Noelin-1		0.612	OLFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFM2	protein_coding	OTTHUMT00000451119.1	C		-		9968504	-1	no_errors	ENST00000264833	ensembl	human	known	74_37	missense	SNP	1.000	G
FBXO41	150726	genome.wustl.edu	37	2	73490860	73490860	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr2:73490860C>T	ENST00000521871.1	-	8	2436	c.2021G>A	c.(2020-2022)cGc>cAc	p.R674H	FBXO41_ENST00000295133.5_Missense_Mutation_p.R735H|FBXO41_ENST00000520530.2_Missense_Mutation_p.R674H			Q8TF61	FBX41_HUMAN	F-box protein 41	674										breast(2)|central_nervous_system(1)|endometrium(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)	13						CCAGAGCGAGCGGTCGGTGAG	0.637																																																	0								ENSG00000163013						68.0	85.0	79.0					2																	73490860		2153	4249	6402	FBXO41	SO:0001583	missense	0			-	HGNC	AB075820	CCDS46337.1, CCDS46337.2	2p13.2	2004-08-24				ENSG00000163013		"""F-boxes /  ""other"""""	29409	protein-coding gene	gene with protein product		609108				11853319	Standard	NM_001080410		Approved	KIAA1940, Fbx41	uc021vjh.1	Q8TF61		ENST00000521871.1:c.2021G>A	2.37:g.73490860C>T	ENSP00000428646:p.Arg674His	Somatic	0	27	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	G3V0Z7|Q2M1V8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_F-box_dom	p.R735H	ENST00000521871.1	37	c.2204	CCDS46337.2	2	.	.	.	.	.	.	.	.	.	.	C	33	5.226317	0.95173	.	.	ENSG00000163013	ENST00000295133;ENST00000521871	T;T	0.54071	0.59;0.59	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.66954	0.2842	L	0.44542	1.39	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.67205	-0.5729	10	0.62326	D	0.03	0.7957	17.897	0.88891	0.0:1.0:0.0:0.0	.	674	Q8TF61	FBX41_HUMAN	H	735;674	ENSP00000295133:R735H;ENSP00000428646:R674H	ENSP00000295133:R735H	R	-	2	0	FBXO41	73344368	1.000000	0.71417	0.973000	0.42090	0.974000	0.67602	5.751000	0.68720	2.813000	0.96785	0.561000	0.74099	CGC	-	NULL		0.637	FBXO41-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FBXO41	protein_coding	OTTHUMT00000377381.1	C		-		73490860	-1	no_errors	ENST00000295133	ensembl	human	known	74_37	missense	SNP	1.000	T
RIMS1	22999	genome.wustl.edu	37	6	73043350	73043350	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr6:73043350G>T	ENST00000521978.1	+	29	4178	c.4178G>T	c.(4177-4179)aGa>aTa	p.R1393I	RIMS1_ENST00000538414.1_Missense_Mutation_p.R199I|RIMS1_ENST00000520567.1_Intron|RIMS1_ENST00000518273.1_Intron|RIMS1_ENST00000517827.1_Intron|RIMS1_ENST00000491071.2_Missense_Mutation_p.R1216I|RIMS1_ENST00000401910.3_Missense_Mutation_p.R713I|RIMS1_ENST00000522291.1_Intron|RIMS1_ENST00000348717.5_Missense_Mutation_p.R1176I|RIMS1_ENST00000425662.2_Intron|RIMS1_ENST00000264839.7_Missense_Mutation_p.R1242I|RIMS1_ENST00000523963.1_Intron|RIMS1_ENST00000517960.1_Missense_Mutation_p.R1176I	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1393	Ser-rich.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				ACTTCAGGAAGATCCATCATG	0.453																																																	0								ENSG00000079841						66.0	66.0	66.0					6																	73043350		1971	4164	6135	RIMS1	SO:0001583	missense	0			-	HGNC	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.4178G>T	6.37:g.73043350G>T	ENSP00000428417:p.Arg1393Ile	Somatic	0	32	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	24	22.58	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.R1393I	ENST00000521978.1	37	c.4178	CCDS47449.1	6	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	15.83|15.83|15.83	2.949877|2.949877|2.949877	0.53186|0.53186|0.53186	.|.|.	.|.|.	ENSG00000079841|ENSG00000079841|ENSG00000079841	ENST00000522211|ENST00000517433|ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000264839;ENST00000517960;ENST00000521978;ENST00000401910;ENST00000453976;ENST00000370420;ENST00000538414	.|.|T;T;T;T;T;T;T;T;T	.|.|0.20463	.|.|2.36;2.47;2.47;2.47;2.42;2.5;2.31;2.12;2.07	5.4|5.4|5.4	5.4|5.4|5.4	0.78164|0.78164|0.78164	.|.|.	.|.|0.079158	.|.|0.53938	.|.|D	.|.|0.000060	T|T|T	0.24353|0.24353|0.24353	0.0590|0.0590|0.0590	L|L|L	0.31752|0.31752|0.31752	0.955|0.955|0.955	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|B;D;B;B;B;B;B	.|.|0.69078	.|.|0.001;0.997;0.001;0.001;0.002;0.004;0.002	.|.|B;D;B;B;B;B;B	.|.|0.73708	.|.|0.001;0.981;0.003;0.002;0.001;0.004;0.003	T|T|T	0.01238|0.01238|0.01238	-1.1409|-1.1409|-1.1409	5|5|10	.|.|0.51188	.|.|T	.|.|0.08	-27.4946|-27.4946|-27.4946	14.3911|14.3911|14.3911	0.66978|0.66978|0.66978	0.0:0.0:0.8523:0.1477|0.0:0.0:0.8523:0.1477|0.0:0.0:0.8523:0.1477	.|.|.	.|.|199;1242;713;1176;469;1216;1393	.|.|B7Z7W2;E9PHR1;E9PF48;E7ENC2;Q5JY21;C9JNW6;Q86UR5	.|.|.;.;.;.;.;.;RIMS1_HUMAN	Y|N|I	311|738|1216;1242;1216;1176;1242;1176;1393;713;558;441;199	.|.|ENSP00000430101:R1216I;ENSP00000275037:R1176I;ENSP00000264839:R1242I;ENSP00000429959:R1176I;ENSP00000428417:R1393I;ENSP00000385649:R713I;ENSP00000389503:R558I;ENSP00000359448:R441I;ENSP00000439730:R199I	.|.|ENSP00000264839:R1242I	D|K|R	+|+|+	1|3|2	0|2|0	RIMS1|RIMS1|RIMS1	73100071|73100071|73100071	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.981000|0.981000|0.981000	0.71138|0.71138|0.71138	5.042000|5.042000|5.042000	0.64202|0.64202|0.64202	2.683000|2.683000|2.683000	0.91414|0.91414|0.91414	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GAT|AAG|AGA	-	NULL		0.453	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	protein_coding	OTTHUMT00000374968.1	G		-		73043350	+1	no_errors	ENST00000521978	ensembl	human	known	74_37	missense	SNP	1.000	T
MIR130B	406920	genome.wustl.edu	37	22	22007679	22007679	+	RNA	SNP	C	C	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr22:22007679C>T	ENST00000385018.1	+	0	82				MIR301B_ENST00000390813.1_RNA	NR_029845.1				microRNA 130b																		CAGGTCCAGCCTGCTaccctg	0.577																																																	0								ENSG00000100023						17.0	19.0	19.0					22																	22007679		1538	3506	5044	PPIL2			0			-	HGNC			22	2011-09-12		2008-12-18	ENSG00000207751	ENSG00000207751		"""ncRNAs / Micro RNAs"""	31515	non-coding RNA	RNA, micro		613682		MIRN130B			Standard	NR_029845		Approved	hsa-mir-130b	uc011aii.1				22.37:g.22007679C>T		Somatic	0	81	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	79	28.18		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000385018.1	37	NULL		22																																																																																			-	-		0.577	MIR130B-201	KNOWN	basic	miRNA	PPIL2	miRNA		C	NR_029845	-		22007679	+1	no_errors	ENST00000498589	ensembl	human	known	74_37	rna	SNP	0.000	T
CCDC125	202243	genome.wustl.edu	37	5	68616304	68616304	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr5:68616304C>T	ENST00000396496.2	-	2	171	c.64G>A	c.(64-66)Gac>Aac	p.D22N	CCDC125_ENST00000460090.1_5'UTR|CCDC125_ENST00000383374.2_Missense_Mutation_p.D22N|CCDC125_ENST00000511257.1_5'UTR|CCDC125_ENST00000396499.1_Missense_Mutation_p.D22N			Q86Z20	CC125_HUMAN	coiled-coil domain containing 125	22						cytoplasm (GO:0005737)				breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|urinary_tract(1)	19		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		TCTGTCATGTCATCCTCTTCT	0.428																																																	0								ENSG00000183323						130.0	125.0	126.0					5																	68616304		2203	4300	6503	CCDC125	SO:0001583	missense	0			-	HGNC	AB024691	CCDS4000.1, CCDS75255.1	5q13.2	2008-02-05			ENSG00000183323	ENSG00000183323			28924	protein-coding gene	gene with protein product		613781					Standard	XM_005248461		Approved	KENAE	uc003jvv.1	Q86Z20	OTTHUMG00000131259	ENST00000396496.2:c.64G>A	5.37:g.68616304C>T	ENSP00000379754:p.Asp22Asn	Somatic	0	34	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	Q86Z19	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D22N	ENST00000396496.2	37	c.64	CCDS4000.1	5	.	.	.	.	.	.	.	.	.	.	c	22.6	4.307706	0.81247	.	.	ENSG00000183323	ENST00000396496;ENST00000396499;ENST00000383374	T;T;T	0.58506	0.44;0.44;0.33	4.67	4.67	0.58626	.	0.174808	0.39544	N	0.001329	T	0.73481	0.3592	M	0.72118	2.19	0.29542	N	0.852029	D;D	0.89917	0.999;1.0	D;D	0.87578	0.964;0.998	T	0.71213	-0.4659	10	0.59425	D	0.04	.	13.453	0.61182	0.0:1.0:0.0:0.0	.	22;22	F8W912;Q86Z20	.;CC125_HUMAN	N	22	ENSP00000379754:D22N;ENSP00000379756:D22N;ENSP00000372865:D22N	ENSP00000372865:D22N	D	-	1	0	CCDC125	68652060	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	4.261000	0.58841	2.334000	0.79466	0.457000	0.33378	GAC	-	NULL		0.428	CCDC125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC125	protein_coding	OTTHUMT00000254027.4	C	NM_176816	-		68616304	-1	no_errors	ENST00000396496	ensembl	human	known	74_37	missense	SNP	1.000	T
TIMP1	7076	genome.wustl.edu	37	X	47445973	47445973	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chrX:47445973G>T	ENST00000218388.4	+	6	677	c.507G>T	c.(505-507)ttG>ttT	p.L169F	TIMP1_ENST00000377017.1_Missense_Mutation_p.L105F|MIR4769_ENST00000584126.1_RNA|SYN1_ENST00000340666.4_Intron|SYN1_ENST00000295987.7_Intron	NM_003254.2	NP_003245.1	P01033	TIMP1_HUMAN	TIMP metallopeptidase inhibitor 1	169					aging (GO:0007568)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of trophoblast cell migration (GO:1901164)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell proliferation (GO:0008284)|regulation of integrin-mediated signaling pathway (GO:2001044)|response to cytokine (GO:0034097)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	cytokine activity (GO:0005125)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(1)|large_intestine(2)	3						CTCATTGCTTGTGGACGGACC	0.607																																																	0								ENSG00000102265						137.0	103.0	115.0					X																	47445973		2203	4300	6503	TIMP1	SO:0001583	missense	0			-	HGNC		CCDS14281.1	Xp11.3-p11.23	2008-07-29	2005-08-08		ENSG00000102265	ENSG00000102265			11820	protein-coding gene	gene with protein product		305370	"""tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor)"""	TIMP, CLGI			Standard	XM_005272645		Approved	EPO	uc004dif.3	P01033	OTTHUMG00000021447	ENST00000218388.4:c.507G>T	X.37:g.47445973G>T	ENSP00000218388:p.Leu169Phe	Somatic	0	23	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	Q14252|Q9UCU1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_inh_TIMP,superfamily_TIMP-like_OB-fold,smart_Prot_inh_TIMP,pfscan_Netrin_domain	p.L169F	ENST00000218388.4	37	c.507	CCDS14281.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.44|18.44	3.624267|3.624267	0.66901|0.66901	.|.	.|.	ENSG00000102265|ENSG00000102265	ENST00000445623|ENST00000218388;ENST00000377017	.|D;D	.|0.94650	.|-3.48;-3.48	5.23|5.23	3.46|3.46	0.39613|0.39613	.|Tissue inhibitor of metalloproteinases-like, OB-fold (1);	.|0.000000	.|0.44688	.|D	.|0.000439	D|D	0.96611|0.96611	0.8894|0.8894	M|M	0.84585|0.84585	2.705|2.705	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	D|D	0.94686|0.94686	0.7870|0.7870	5|10	.|0.46703	.|T	.|0.11	.|.	7.382|7.382	0.26862|0.26862	0.2072:0.0:0.7928:0.0|0.2072:0.0:0.7928:0.0	.|.	.|169	.|P01033	.|TIMP1_HUMAN	F|F	127|169;105	.|ENSP00000218388:L169F;ENSP00000366216:L105F	.|ENSP00000218388:L169F	C|L	+|+	2|3	0|2	TIMP1|TIMP1	47330917|47330917	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.992000|0.992000	0.81027|0.81027	2.618000|2.618000	0.46393|0.46393	0.435000|0.435000	0.26365|0.26365	0.523000|0.523000	0.50628|0.50628	TGT|TTG	-	pfam_Prot_inh_TIMP,superfamily_TIMP-like_OB-fold,smart_Prot_inh_TIMP		0.607	TIMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMP1	protein_coding	OTTHUMT00000056423.1	G	NM_003254	-		47445973	+1	no_errors	ENST00000218388	ensembl	human	known	74_37	missense	SNP	1.000	T
NINL	22981	genome.wustl.edu	37	20	25443278	25443279	+	Intron	INS	-	-	TTTGTTTTGT	rs200513281|rs377227803|rs113237945		TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr20:25443278_25443279insTTTGTTTTGT	ENST00000278886.6	-	20	3497				NINL_ENST00000422516.1_Intron	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						TTAAGTAGTCAtttgttttgtt	0.361																																																	0								ENSG00000101004																																			NINL	SO:0001627	intron_variant	0				HGNC		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.3424-101->ACAAAACAAA	20.37:g.25443279_25443288dupTTTGTTTTGT		Somatic	NA	NA	NA		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000278886.6	37	NULL	CCDS33452.1	20																																																																																			-	-		0.361	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NINL	protein_coding	OTTHUMT00000078445.3	-	NM_025176			25443279	-1	no_errors	ENST00000496509	ensembl	human	known	74_37	rna	INS	0.010:0.013	TTTGTTTTGT
SYT1	6857	genome.wustl.edu	37	12	79611315	79611315	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr12:79611315C>T	ENST00000261205.4	+	4	673	c.16C>T	c.(16-18)Cac>Tac	p.H6Y	SYT1_ENST00000552744.1_Missense_Mutation_p.H6Y|SYT1_ENST00000393240.3_Missense_Mutation_p.H6Y|SYT1_ENST00000457153.2_Missense_Mutation_p.H6Y	NM_005639.2	NP_005630.1	P21579	SYT1_HUMAN	synaptotagmin I	6					calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|detection of calcium ion (GO:0005513)|glutamate secretion (GO:0014047)|neurotransmitter secretion (GO:0007269)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of vesicle fusion (GO:0031340)|protein homooligomerization (GO:0051260)|regulation of exocytosis (GO:0017157)|regulation of regulated secretory pathway (GO:1903305)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|vesicle docking (GO:0048278)	cell junction (GO:0030054)|clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|endocytic vesicle membrane (GO:0030666)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol binding (GO:0005545)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|pancreas(2)|skin(6)	25						GAGCGAGAGTCACCATGAGGC	0.542																																																	0								ENSG00000067715						42.0	42.0	42.0					12																	79611315		2203	4300	6503	SYT1	SO:0001583	missense	0			-	HGNC		CCDS9017.1	12q21.2	2013-09-20			ENSG00000067715	ENSG00000067715		"""Synaptotagmins"""	11509	protein-coding gene	gene with protein product		185605		SYT, SVP65		1840599	Standard	NM_001135805		Approved	P65	uc001syv.3	P21579	OTTHUMG00000134326	ENST00000261205.4:c.16C>T	12.37:g.79611315C>T	ENSP00000261205:p.His6Tyr	Somatic	0	22	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	35	27.08	Q6AI31	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin,prints_C2_dom	p.H6Y	ENST00000261205.4	37	c.16	CCDS9017.1	12	.	.	.	.	.	.	.	.	.	.	C	17.53	3.411995	0.62511	.	.	ENSG00000067715	ENST00000393240;ENST00000261205;ENST00000457153;ENST00000552074;ENST00000547046;ENST00000549671;ENST00000551304;ENST00000552744;ENST00000552624;ENST00000446242	T;T;T;T;T;T	0.58797	0.32;0.32;0.31;0.32;1.96;2.54	5.51	5.51	0.81932	.	0.275440	0.40469	N	0.001082	T	0.49626	0.1568	L	0.29908	0.895	0.38538	D	0.949135	B;B	0.16603	0.018;0.018	B;B	0.12156	0.007;0.007	T	0.44236	-0.9341	10	0.39692	T	0.17	.	19.4105	0.94670	0.0:1.0:0.0:0.0	.	6;6	Q6AI31;P21579	.;SYT1_HUMAN	Y	6	ENSP00000376932:H6Y;ENSP00000261205:H6Y;ENSP00000391056:H6Y;ENSP00000447575:H6Y;ENSP00000448861:H6Y;ENSP00000401559:H6Y	ENSP00000261205:H6Y	H	+	1	0	SYT1	78135446	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.054000	0.76649	2.583000	0.87209	0.643000	0.83706	CAC	-	NULL		0.542	SYT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT1	protein_coding	OTTHUMT00000259415.1	C	NM_005639	-		79611315	+1	no_errors	ENST00000261205	ensembl	human	known	74_37	missense	SNP	1.000	T
TSC22D4	81628	genome.wustl.edu	37	7	100075194	100075194	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr7:100075194delG	ENST00000300181.2	-	2	1222	c.468delC	c.(466-468)cccfs	p.P156fs	TSC22D4_ENST00000393991.1_Intron|TSC22D4_ENST00000496728.1_5'Flank	NM_030935.3	NP_112197.1	Q9Y3Q8	T22D4_HUMAN	TSC22 domain family, member 4	156					negative regulation of transcription, DNA-templated (GO:0045892)|response to osmotic stress (GO:0006970)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CAGGAGAGGTGGGGGGTGGAC	0.692																																																	0								ENSG00000166925						8.0	10.0	10.0					7																	100075194		2114	4173	6287	TSC22D4	SO:0001589	frameshift_variant	0				HGNC	BC010406	CCDS5695.1	7p21-p15	2010-04-30			ENSG00000166925	ENSG00000166925			21696	protein-coding gene	gene with protein product		611914					Standard	NM_030935		Approved	THG-1, TILZ2	uc003uva.3	Q9Y3Q8	OTTHUMG00000150233	ENST00000300181.2:c.468delC	7.37:g.100075194delG	ENSP00000300181:p.Pro156fs	Somatic	0	8	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	13	13.33	A4D2C3|A8MWR6|D6W5V9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_TSC-22_Dip_Bun	p.T157fs	ENST00000300181.2	37	c.468	CCDS5695.1	7																																																																																			-	NULL		0.692	TSC22D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSC22D4	protein_coding	OTTHUMT00000316970.1	G	NM_030935			100075194	-1	no_errors	ENST00000300181	ensembl	human	known	74_37	frame_shift_del	DEL	0.536	-
PTPRO	5800	genome.wustl.edu	37	12	15704508	15704508	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr12:15704508G>T	ENST00000281171.4	+	15	2791	c.2461G>T	c.(2461-2463)Gta>Tta	p.V821L	PTPRO_ENST00000445537.2_Missense_Mutation_p.V10L|PTPRO_ENST00000442921.2_Missense_Mutation_p.V10L|PTPRO_ENST00000544244.1_Missense_Mutation_p.V10L|PTPRO_ENST00000348962.2_Missense_Mutation_p.V821L|PTPRO_ENST00000542557.1_Missense_Mutation_p.V10L	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	821					axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				TCCCAATGTGGTAGTGATCTC	0.403																																																	0								ENSG00000151490						271.0	239.0	250.0					12																	15704508		2203	4300	6503	PTPRO	SO:0001583	missense	0			-	HGNC	U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.2461G>T	12.37:g.15704508G>T	ENSP00000281171:p.Val821Leu	Somatic	0	65	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	55	15.38	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.V821L	ENST00000281171.4	37	c.2461	CCDS8675.1	12	.	.	.	.	.	.	.	.	.	.	G	18.17	3.564913	0.65651	.	.	ENSG00000151490	ENST00000281171;ENST00000348962;ENST00000442921;ENST00000542557;ENST00000445537;ENST00000544244	T;T;T;T;T;T	0.04406	3.81;3.8;3.63;3.74;3.63;3.74	5.2	5.2	0.72013	.	0.157339	0.29159	N	0.012969	T	0.04227	0.0117	N	0.14661	0.345	0.44834	D	0.997846	B;B;B	0.29037	0.231;0.012;0.007	B;B;B	0.22386	0.039;0.016;0.005	T	0.54853	-0.8231	10	0.34782	T	0.22	.	18.921	0.92525	0.0:0.0:1.0:0.0	.	10;821;821	Q9UBT5;Q16827-2;Q16827	.;.;PTPRO_HUMAN	L	821;821;10;10;10;10	ENSP00000281171:V821L;ENSP00000343434:V821L;ENSP00000404188:V10L;ENSP00000437571:V10L;ENSP00000393449:V10L;ENSP00000439234:V10L	ENSP00000281171:V821L	V	+	1	0	PTPRO	15595775	1.000000	0.71417	0.883000	0.34634	0.993000	0.82548	6.797000	0.75150	2.693000	0.91896	0.563000	0.77884	GTA	-	NULL		0.403	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRO	protein_coding	OTTHUMT00000401079.1	G		-		15704508	+1	no_errors	ENST00000281171	ensembl	human	known	74_37	missense	SNP	0.998	T
BAZ2B	29994	genome.wustl.edu	37	2	160317644	160317645	+	Intron	INS	-	-	T	rs532390970		TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr2:160317644_160317645insT	ENST00000392783.2	-	4	641				BAZ2B_ENST00000355831.2_Intron|BAZ2B_ENST00000343439.5_Intron|BAZ2B_ENST00000483316.1_5'UTR|BAZ2B_ENST00000392782.1_Intron	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						GCACAAACACGTTTTTTTTTTA	0.351																																																	0								ENSG00000123636																																			BAZ2B	SO:0001627	intron_variant	0				HGNC	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.146-7332->A	2.37:g.160317654_160317654dupT		Somatic	0	11	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	19	9.52	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392783.2	37	NULL	CCDS2209.2	2																																																																																			-	-		0.351	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	protein_coding	OTTHUMT00000255037.2	-				160317645	-1	no_errors	ENST00000483316	ensembl	human	known	74_37	rna	INS	0.005:0.155	T
SLC16A13	201232	genome.wustl.edu	37	17	6943237	6943237	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr17:6943237G>C	ENST00000308027.6	+	4	1545	c.1237G>C	c.(1237-1239)Gat>Cat	p.D413H		NM_201566.2	NP_963860.1	Q7RTY0	MOT13_HUMAN	solute carrier family 16, member 13	413						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						AGAAGCACTAGATACTAAAGT	0.537																																																	0								ENSG00000174327						124.0	132.0	130.0					17																	6943237		2203	4300	6503	SLC16A13	SO:0001583	missense	0			-	HGNC	BN000145	CCDS11085.1	17p13.1	2013-07-18	2013-07-18		ENSG00000174327	ENSG00000174327		"""Solute carriers"""	31037	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 13"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 13"""				Standard	NM_201566		Approved	MCT13	uc002geh.3	Q7RTY0	OTTHUMG00000102089	ENST00000308027.6:c.1237G>C	17.37:g.6943237G>C	ENSP00000309751:p.Asp413His	Somatic	0	28	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	16	65.22	A3KMG3|A5PKU5|Q2VP92	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MFS,pfam_Atg22-like,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.D413H	ENST00000308027.6	37	c.1237	CCDS11085.1	17	.	.	.	.	.	.	.	.	.	.	G	7.373	0.627196	0.14257	.	.	ENSG00000174327	ENST00000308027	T	0.09538	2.97	5.97	3.95	0.45737	.	1.213990	0.05842	N	0.619584	T	0.09379	0.0231	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33599	-0.9862	10	0.62326	D	0.03	.	8.4654	0.32953	0.0818:0.1536:0.7646:0.0	.	413	Q7RTY0	MOT13_HUMAN	H	413	ENSP00000309751:D413H	ENSP00000309751:D413H	D	+	1	0	SLC16A13	6883961	0.864000	0.29904	0.005000	0.12908	0.004000	0.04260	3.966000	0.56795	0.829000	0.34733	0.655000	0.94253	GAT	-	NULL		0.537	SLC16A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A13	protein_coding	OTTHUMT00000219923.2	G		-		6943237	+1	no_errors	ENST00000308027	ensembl	human	known	74_37	missense	SNP	0.005	C
FLG2	388698	genome.wustl.edu	37	1	152324804	152324804	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr1:152324804G>A	ENST00000388718.5	-	3	5530	c.5458C>T	c.(5458-5460)Cac>Tac	p.H1820Y	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1820					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTCGTGAGTGTGGTCTTTGT	0.527																																																	0								ENSG00000143520						315.0	277.0	290.0					1																	152324804		2203	4300	6503	FLG2	SO:0001583	missense	0			-	HGNC	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.5458C>T	1.37:g.152324804G>A	ENSP00000373370:p.His1820Tyr	Somatic	0	74	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	83	21.70	Q9H4U1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.H1820Y	ENST00000388718.5	37	c.5458	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	G	10.32	1.318271	0.23994	.	.	ENSG00000143520	ENST00000388718	T	0.08546	3.08	0.508	0.508	0.16972	.	.	.	.	.	T	0.01940	0.0061	L	0.33485	1.01	0.09310	N	1	P	0.38110	0.618	B	0.32805	0.153	T	0.44097	-0.9350	8	0.59425	D	0.04	.	.	.	.	.	1820	Q5D862	FILA2_HUMAN	Y	1820	ENSP00000373370:H1820Y	ENSP00000373370:H1820Y	H	-	1	0	FLG2	150591428	.	.	0.009000	0.14445	0.129000	0.20672	.	.	0.564000	0.29238	0.297000	0.19635	CAC	-	prints_Filaggrin		0.527	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	protein_coding	OTTHUMT00000034018.5	G	NM_001014342	-		152324804	-1	no_errors	ENST00000388718	ensembl	human	known	74_37	missense	SNP	0.006	A
PGA5	5222	genome.wustl.edu	37	11	61017218	61017218	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr11:61017218C>T	ENST00000312403.5	+	7	1036	c.851C>T	c.(850-852)aCc>aTc	p.T284I	PGA5_ENST00000541528.1_Missense_Mutation_p.T24I|PGA4_ENST00000422676.2_Missense_Mutation_p.T284I|CTD-2331C18.5_ENST00000537594.1_RNA|PGA5_ENST00000451616.2_Missense_Mutation_p.T130I	NM_014224.2	NP_055039.1	P0DJD9	PEPA5_HUMAN	pepsinogen 5, group I (pepsinogen A)	284					digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			large_intestine(1)|skin(1)	2						TCTCTGCTGACCGGCCCAACC	0.592																																																	0								ENSG00000256713						125.0	129.0	127.0					11																	61017218		2202	4297	6499	PGA5	SO:0001583	missense	0			-	HGNC	BC029055	CCDS8001.1	11q13	2012-10-02			ENSG00000256713	ENSG00000256713	3.4.23.1		8887	protein-coding gene	gene with protein product		169730					Standard	NM_014224		Approved		uc001nqz.3	P0DJD9	OTTHUMG00000168075	ENST00000312403.5:c.851C>T	11.37:g.61017218C>T	ENSP00000309542:p.Thr284Ile	Somatic	0	68	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	56	22.22	A8K749|B7ZW62|B7ZW75|P00790|Q7M4R0|Q8N1E3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aspartic_peptidase,pfam_Aspartic_peptidase_N,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase	p.T284I	ENST00000312403.5	37	c.851	CCDS8001.1	11	.	.	.	.	.	.	.	.	.	.	C	12.54	1.968571	0.34754	.	.	ENSG00000229183;ENSG00000256713;ENSG00000256713;ENSG00000256713;ENSG00000256713;ENSG00000256713	ENST00000422676;ENST00000312403;ENST00000537359;ENST00000544083;ENST00000451616;ENST00000541528	T;T;T;T	0.59083	0.29;0.29;0.29;0.29	2.91	-1.36	0.09085	.	1.093690	0.07037	N	0.829508	T	0.46619	0.1402	N	0.25426	0.745	0.09310	N	1	B	0.21225	0.053	B	0.37731	0.257	T	0.50118	-0.8865	10	0.26408	T	0.33	.	5.543	0.17049	0.0:0.5937:0.1432:0.2631	.	284	B7ZW62	.	I	284;284;241;143;130;24	ENSP00000395402:T284I;ENSP00000309542:T284I;ENSP00000408739:T130I;ENSP00000441981:T24I	ENSP00000395402:T284I	T	+	2	0	PGA4;PGA5	60773794	0.035000	0.19736	0.007000	0.13788	0.883000	0.51084	2.498000	0.45363	-0.258000	0.09446	0.420000	0.28162	ACC	-	pfam_Aspartic_peptidase,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase		0.592	PGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGA5	protein_coding	OTTHUMT00000397972.1	C	NM_014224	-		61017218	+1	no_errors	ENST00000312403	ensembl	human	known	74_37	missense	SNP	0.087	T
DCTN2	10540	genome.wustl.edu	37	12	57932336	57932336	+	Intron	SNP	C	C	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr12:57932336C>T	ENST00000548249.1	-	3	373				DCTN2_ENST00000551400.1_5'UTR|DCTN2_ENST00000543672.1_Intron|DCTN2_ENST00000537439.1_Intron|DCTN2_ENST00000434715.3_Intron	NM_001261412.1|NM_001261413.1	NP_001248341.1|NP_001248342.1	Q13561	DCTN2_HUMAN	dynactin 2 (p50)						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|vesicle (GO:0031982)	motor activity (GO:0003774)|spectrin binding (GO:0030507)			endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|upper_aerodigestive_tract(2)	11						GTGAGAAAATCAAAAGAGTTA	0.428																																																	0								ENSG00000175203						39.0	38.0	38.0					12																	57932336		1851	4098	5949	DCTN2	SO:0001627	intron_variant	0			-	HGNC	U50733	CCDS44930.1, CCDS58245.1, CCDS73489.1	12q13.3	2008-05-14				ENSG00000175203			2712	protein-coding gene	gene with protein product		607376				8647893	Standard	NM_001261412		Approved	RBP50, DCTN-50	uc001som.2	Q13561	OTTHUMG00000170124	ENST00000548249.1:c.106-2708G>A	12.37:g.57932336C>T		Somatic	0	49	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	57	165	25.68	B2RBK5|Q86YN2|Q9BW17	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000548249.1	37	NULL	CCDS58245.1	12																																																																																			-	-		0.428	DCTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCTN2	protein_coding	OTTHUMT00000407393.2	C	NM_006400	-		57932336	-1	no_errors	ENST00000551400	ensembl	human	known	74_37	rna	SNP	1.000	T
TM9SF2	9375	genome.wustl.edu	37	13	100192902	100192902	+	Intron	DEL	T	T	-			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr13:100192902delT	ENST00000376387.4	+	8	1018					NM_004800.1	NP_004791.1	Q99805	TM9S2_HUMAN	transmembrane 9 superfamily member 2						transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)	17	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)					TTGAATGGGATTTTTTTTTGT	0.348																																																	0								ENSG00000125304																																			TM9SF2	SO:0001627	intron_variant	0				HGNC	U81006	CCDS9493.1	13q32.2	2011-03-28			ENSG00000125304	ENSG00000125304			11865	protein-coding gene	gene with protein product		604678				9729438	Standard	NM_004800		Approved	P76	uc001voj.2	Q99805	OTTHUMG00000017272	ENST00000376387.4:c.829-66T>-	13.37:g.100192902delT		Somatic	0	15	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	A8K399|Q2TAY5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376387.4	37	NULL	CCDS9493.1	13																																																																																			-	-		0.348	TM9SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM9SF2	protein_coding	OTTHUMT00000045602.3	T				100192902	+1	no_errors	ENST00000466555	ensembl	human	known	74_37	rna	DEL	0.045	-
EFTUD2	9343	genome.wustl.edu	37	17	42962623	42962623	+	Splice_Site	SNP	C	C	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr17:42962623C>T	ENST00000426333.2	-	4	648		c.e4+1		EFTUD2_ENST00000591382.1_Splice_Site|EFTUD2_ENST00000589211.1_5'Flank|EFTUD2_ENST00000592576.1_Splice_Site|RN7SL405P_ENST00000582502.1_RNA|EFTUD2_ENST00000402521.3_Splice_Site	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2						gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				TTGTAACTTACTCCATCTCAT	0.388																																					Ovarian(10;65 485 10258 29980 30707)												0								ENSG00000108883						228.0	224.0	225.0					17																	42962623		2203	4300	6503	EFTUD2	SO:0001630	splice_region_variant	0			-	HGNC	D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.350+1G>A	17.37:g.42962623C>T		Somatic	0	45	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e3+1	ENST00000426333.2	37	c.350+1	CCDS11489.1	17	.	.	.	.	.	.	.	.	.	.	C	17.37	3.372953	0.61624	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6363	0.95735	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EFTUD2	40318149	1.000000	0.71417	1.000000	0.80357	0.493000	0.33554	7.336000	0.79245	2.648000	0.89879	0.585000	0.79938	.	-	-		0.388	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EFTUD2	protein_coding	OTTHUMT00000448672.1	C	NM_004247	-	Intron	42962623	-1	no_errors	ENST00000426333	ensembl	human	known	74_37	splice_site	SNP	1.000	T
TMEM25	84866	genome.wustl.edu	37	11	118403122	118403122	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr11:118403122C>A	ENST00000313236.5	+	3	381	c.328C>A	c.(328-330)Cag>Aag	p.Q110K	TMEM25_ENST00000524725.1_Missense_Mutation_p.Q110K|TMEM25_ENST00000544878.1_Missense_Mutation_p.Q110K|TMEM25_ENST00000533102.1_Missense_Mutation_p.Q110K|RP11-770J1.3_ENST00000532597.1_RNA|RP11-770J1.3_ENST00000525992.2_RNA|RP11-770J1.3_ENST00000528578.1_RNA|TMEM25_ENST00000354284.4_Missense_Mutation_p.Q110K|TMEM25_ENST00000529001.1_3'UTR|TMEM25_ENST00000359862.4_Missense_Mutation_p.Q110K|TMEM25_ENST00000411589.2_Missense_Mutation_p.Q110K|TMEM25_ENST00000442938.2_Missense_Mutation_p.Q110K|TMEM25_ENST00000354064.7_Intron|RP11-770J1.3_ENST00000556583.1_RNA|RP11-770J1.3_ENST00000554407.1_RNA	NM_032780.3	NP_116169.2	Q86YD3	TMM25_HUMAN	transmembrane protein 25	110	Ig-like.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|stomach(1)	13	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		CTGCTCTCTGCAGGACCCCAG	0.602																																																	0								ENSG00000149582						73.0	73.0	73.0					11																	118403122		2200	4295	6495	TMEM25	SO:0001583	missense	0			-	HGNC	AK075437	CCDS8398.1, CCDS44745.1, CCDS44746.1, CCDS44747.1, CCDS44748.1	11q23.3	2013-01-11			ENSG00000149582	ENSG00000149582		"""Immunoglobulin superfamily / C2-set domain containing"""	25890	protein-coding gene	gene with protein product		613934				15254712, 12975309	Standard	NM_001144034		Approved	FLJ14399	uc010rye.2	Q86YD3	OTTHUMG00000166339	ENST00000313236.5:c.328C>A	11.37:g.118403122C>A	ENSP00000315635:p.Gln110Lys	Somatic	0	29	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	A8K8J4|B0YJA6|B0YJA7|B0YJA9|G5E9U4|Q6UW89|Q86UA7|Q8NBL5|Q96KA6|Q96MW9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CD80_C2-set,pfscan_Ig-like_dom	p.Q110K	ENST00000313236.5	37	c.328	CCDS8398.1	11	.	.	.	.	.	.	.	.	.	.	C	18.91	3.723780	0.68959	.	.	ENSG00000149582	ENST00000411589;ENST00000442938;ENST00000359862;ENST00000528373;ENST00000544878;ENST00000354284;ENST00000533137;ENST00000532762;ENST00000533102;ENST00000313236;ENST00000524725;ENST00000533689	T;T;T;T;T;T;T;T;T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97;-0.97;-0.97;-0.97;-0.97;-0.97;-0.97;-0.97;-0.97	5.31	4.38	0.52667	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.499360	0.21032	N	0.081328	T	0.64427	0.2597	N	0.24115	0.695	0.23559	N	0.997413	B;P;B;P;P;P;P;B	0.52170	0.001;0.951;0.0;0.6;0.545;0.94;0.943;0.001	B;P;B;B;B;P;P;B	0.51615	0.003;0.675;0.002;0.296;0.196;0.546;0.506;0.002	T	0.56463	-0.7975	10	0.02654	T	1	-7.1141	10.8942	0.47012	0.341:0.659:0.0:0.0	.	110;110;110;110;110;110;110;110	F5H294;Q86YD3;B7Z4E4;Q8NBL5;G5E9U4;Q86YD3-4;E9PKP3;Q86YD3-2	.;TMM25_HUMAN;.;.;.;.;.;.	K	110;110;110;110;110;110;78;110;110;110;110;110	ENSP00000411882:Q110K;ENSP00000416071:Q110K;ENSP00000352924:Q110K;ENSP00000432040:Q110K;ENSP00000439408:Q110K;ENSP00000346237:Q110K;ENSP00000433938:Q78K;ENSP00000433906:Q110K;ENSP00000431548:Q110K;ENSP00000315635:Q110K;ENSP00000431205:Q110K;ENSP00000436746:Q110K	ENSP00000315635:Q110K	Q	+	1	0	TMEM25	117908332	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	0.997000	0.29731	1.178000	0.42870	0.561000	0.74099	CAG	-	pfam_CD80_C2-set,pfscan_Ig-like_dom		0.602	TMEM25-009	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM25	protein_coding	OTTHUMT00000389266.1	C	NM_032780	-		118403122	+1	no_errors	ENST00000533102	ensembl	human	known	74_37	missense	SNP	1.000	A
TRHDE	29953	genome.wustl.edu	37	12	73014948	73014948	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr12:73014948T>C	ENST00000261180.4	+	14	2491	c.2395T>C	c.(2395-2397)Ttt>Ctt	p.F799L		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	799					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						GAAAAATAATTTTAATGGATC	0.318																																																	0								ENSG00000072657						110.0	102.0	105.0					12																	73014948		2203	4299	6502	TRHDE	SO:0001583	missense	0			-	HGNC	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2395T>C	12.37:g.73014948T>C	ENSP00000261180:p.Phe799Leu	Somatic	0	47	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	61	335	15.40	A5PL19|Q6UWJ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.F799L	ENST00000261180.4	37	c.2395	CCDS9004.1	12	.	.	.	.	.	.	.	.	.	.	T	8.544	0.873999	0.17395	.	.	ENSG00000072657	ENST00000261180	T	0.05855	3.38	5.64	4.5	0.54988	.	0.394831	0.28425	N	0.015390	T	0.02418	0.0074	N	0.02539	-0.55	0.26427	N	0.976001	B	0.02656	0.0	B	0.01281	0.0	T	0.41574	-0.9501	10	0.27785	T	0.31	.	5.7766	0.18283	0.0:0.143:0.1422:0.7148	.	799	Q9UKU6	TRHDE_HUMAN	L	799	ENSP00000261180:F799L	ENSP00000261180:F799L	F	+	1	0	TRHDE	71301215	0.999000	0.42202	0.999000	0.59377	0.251000	0.25915	1.009000	0.29886	1.077000	0.40990	-0.263000	0.10527	TTT	-	NULL		0.318	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	protein_coding	OTTHUMT00000405380.1	T	NM_013381	-		73014948	+1	no_errors	ENST00000261180	ensembl	human	known	74_37	missense	SNP	0.981	C
COL11A2	1302	genome.wustl.edu	37	6	33144998	33144998	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr6:33144998A>C	ENST00000374708.4	-	22	1976	c.1718T>G	c.(1717-1719)cTt>cGt	p.L573R	COL11A2_ENST00000477772.1_5'UTR|COL11A2_ENST00000374714.1_Missense_Mutation_p.L633R|COL11A2_ENST00000357486.1_Missense_Mutation_p.L638R|COL11A2_ENST00000374712.1_Missense_Mutation_p.L578R|COL11A2_ENST00000395197.1_Missense_Mutation_p.L599R|COL11A2_ENST00000361917.1_Missense_Mutation_p.L552R|COL11A2_ENST00000374713.1_Missense_Mutation_p.L612R|COL11A2_ENST00000341947.2_Missense_Mutation_p.L659R	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	659	Collagen-like 3.|Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						GGGCCCGGGAAGACCCTACAT	0.562																																					Melanoma(1;90 116 3946 5341 17093)												0								ENSG00000204248						45.0	53.0	50.0					6																	33144998		1508	2706	4214	COL11A2	SO:0001583	missense	0			-	HGNC	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.1718T>G	6.37:g.33144998A>C	ENSP00000363840:p.Leu573Arg	Somatic	0	58	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	50	18.03	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.L659R	ENST00000374708.4	37	c.1976	CCDS43452.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.42|13.42	2.231338|2.231338	0.39399|0.39399	.|.	.|.	ENSG00000204248|ENSG00000204248	ENST00000395196|ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917	.|D;D;D;D;D;D;D;D	.|0.94000	.|-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33	4.16|4.16	2.97|2.97	0.34412|0.34412	.|.	.|0.067818	.|0.64402	.|D	.|0.000018	D|D	0.92348|0.92348	0.7572|0.7572	L|L	0.49571|0.49571	1.57|1.57	0.44711|0.44711	D|D	0.997705|0.997705	B|D;D;D	0.13594|0.89917	0.008|0.997;0.975;1.0	B|D;P;D	0.12156|0.76071	0.007|0.947;0.877;0.987	D|D	0.90948|0.90948	0.4803|0.4803	8|10	0.23302|0.46703	T|T	0.38|0.11	.|.	8.0806|8.0806	0.30741|0.30741	0.8189:0.0:0.0:0.1811|0.8189:0.0:0.0:0.1811	.|.	65|552;573;659	A2ABA7|P13942-8;P13942-6;P13942	.|.;.;COBA2_HUMAN	V|R	39|573;659;638;633;612;599;578;552	.|ENSP00000363840:L573R;ENSP00000339915:L659R;ENSP00000350079:L638R;ENSP00000363846:L633R;ENSP00000363845:L612R;ENSP00000378623:L599R;ENSP00000363844:L578R;ENSP00000355123:L552R	ENSP00000378622:F39V|ENSP00000339915:L659R	F|L	-|-	1|2	0|0	COL11A2|COL11A2	33252976|33252976	0.740000|0.740000	0.28207|0.28207	0.804000|0.804000	0.32291|0.32291	0.246000|0.246000	0.25737|0.25737	4.162000|4.162000	0.58177|0.58177	0.634000|0.634000	0.30469|0.30469	-0.350000|-0.350000	0.07774|0.07774	TTC|CTT	-	NULL		0.562	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	protein_coding	OTTHUMT00000076032.2	A		-		33144998	-1	no_errors	ENST00000341947	ensembl	human	known	74_37	missense	SNP	1.000	C
CELP	1057	genome.wustl.edu	37	9	135962585	135962586	+	RNA	INS	-	-	GCCCCATCGCCGCTACGGGTGATTTTTAGGCC	rs641386|rs372789499|rs143200085	byFrequency	TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr9:135962585_135962586insGCCCCATCGCCGCTACGGGTGATTTTTAGGCC	ENST00000411440.2	+	0	1092_1093					NR_001275.2				carboxyl ester lipase pseudogene																		ACACTGAGGCTGCCCCTGTGTC	0.629																																																	0								ENSG00000170827																																			CELP			0				HGNC	L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135962585_135962586insGCCCCATCGCCGCTACGGGTGATTTTTAGGCC		Somatic	NA	NA	NA		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000411440.2	37	NULL		9																																																																																			-	-		0.629	CELP-002	KNOWN	basic	processed_transcript	CELP	pseudogene	OTTHUMT00000339837.1	-	NM_001808			135962586	+1	no_errors	ENST00000411440	ensembl	human	known	74_37	rna	INS	0.130:0.000	GCCCCATCGCCGCTACGGGTGATTTTTAGGCC
NKAIN3	286183	genome.wustl.edu	37	8	63659614	63659614	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr8:63659614G>A	ENST00000523211.1	+	4	529	c.397G>A	c.(397-399)Gtc>Atc	p.V133I	NKAIN3_ENST00000519049.1_3'UTR|NKAIN3_ENST00000328472.5_Missense_Mutation_p.V133I	NM_173688.2	NP_775959.1	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3	133						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(3)|large_intestine(2)|lung(8)	13	Breast(64;0.127)	Lung NSC(129;0.187)				TTACACGTACGTCTCTGTCAC	0.498																																																	0								ENSG00000185942						128.0	130.0	129.0					8																	63659614		2085	4223	6308	NKAIN3	SO:0001583	missense	0			-	HGNC	AK096949	CCDS55239.1	8q12.3	2014-08-12	2007-10-04	2007-10-04	ENSG00000185942	ENSG00000185942		"""Na+/K+ transporting ATPase interacting"""	26829	protein-coding gene	gene with protein product		612872	"""family with sequence similarity 77, member D"""	FAM77D		17606467	Standard	NM_173688		Approved	FLJ39630	uc010lyq.1	Q8N8D7	OTTHUMG00000164361	ENST00000523211.1:c.397G>A	8.37:g.63659614G>A	ENSP00000429073:p.Val133Ile	Somatic	0	43	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	40	20.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/K-Atpase_Interacting	p.V133I	ENST00000523211.1	37	c.397	CCDS55239.1	8	.	.	.	.	.	.	.	.	.	.	G	4.022	0.001510	0.07819	.	.	ENSG00000185942	ENST00000545532;ENST00000523211;ENST00000328472	T;T	0.13196	2.61;2.61	5.49	4.62	0.57501	.	0.168540	0.41194	N	0.000937	T	0.05686	0.0149	N	0.04805	-0.155	0.30287	N	0.790765	B	0.22800	0.075	B	0.20767	0.031	T	0.28364	-1.0046	10	0.07644	T	0.81	-21.9403	9.4637	0.38800	0.1595:0.0:0.8405:0.0	.	133	Q8N8D7	NKAI3_HUMAN	I	133	ENSP00000429073:V133I;ENSP00000333627:V133I	ENSP00000333627:V133I	V	+	1	0	NKAIN3	63822168	1.000000	0.71417	0.058000	0.19502	0.549000	0.35272	4.750000	0.62162	1.324000	0.45282	0.650000	0.86243	GTC	-	pfam_Na/K-Atpase_Interacting		0.498	NKAIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAIN3	protein_coding	OTTHUMT00000378447.2	G	NM_173688	-		63659614	+1	no_errors	ENST00000328472	ensembl	human	known	74_37	missense	SNP	0.974	A
GNA11	2767	genome.wustl.edu	37	19	3121300	3121300	+	3'UTR	DEL	T	T	-			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr19:3121300delT	ENST00000078429.4	+	0	1445				AC005262.2_ENST00000585980.1_RNA|AC005262.3_ENST00000587701.1_RNA|GNA11_ENST00000586180.1_3'UTR	NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)						action potential (GO:0001508)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cellular response to pH (GO:0071467)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|regulation of melanocyte differentiation (GO:0045634)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)			endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)		CGGGAGGAGATTTTTTTTTTT	0.557			Mis		uveal melanoma																																			Dom	yes		19	19p13.3	2767	"""guanine nucleotide binding protein (G protein), alpha 11 (Gq class)"""		E	0								ENSG00000088256																																			GNA11	SO:0001624	3_prime_UTR_variant	0				HGNC	AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256			4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2		1302014, 23802516	Standard	NM_002067		Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.*123T>-	19.37:g.3121300delT		Somatic	0	14	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	O15109|Q14350|Q6IB00	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000078429.4	37	NULL	CCDS12103.1	19																																																																																			-	-		0.557	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNA11	protein_coding	OTTHUMT00000452261.2	T	NM_002067			3121300	+1	no_errors	ENST00000586180	ensembl	human	known	74_37	rna	DEL	0.000	-
TTC23	64927	genome.wustl.edu	37	15	99674046	99674047	+	IGR	INS	-	-	TTCTGTTATAGCCTAAG	rs34611478|rs376092037|rs11269259	byFrequency	TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr15:99674046_99674047insTTCTGTTATAGCCTAAG	ENST00000394132.2	-	0	3849				SYNM_ENST00000328642.7_3'UTR|SYNM_ENST00000336292.6_3'UTR|SYNM_ENST00000561323.1_3'UTR|SYNM_ENST00000560674.1_3'UTR|RP11-6O2.4_ENST00000566974.1_RNA			Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23											endometrium(2)|large_intestine(3)|lung(9)|urinary_tract(2)	16	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			TGAATGCCCTTTTCTGGAGTGG	0.465														1385	0.276558	0.5333	0.2608	5008	,	,		21485	0.0992		0.2127	False		,,,				2504	0.1892																0								ENSG00000182253																																			SYNM	SO:0001628	intergenic_variant	0				HGNC		CCDS10379.2	15q26.3	2013-01-11			ENSG00000103852	ENSG00000103852		"""Tetratricopeptide (TTC) repeat domain containing"""	25730	protein-coding gene	gene with protein product						12477932	Standard	NM_001288615		Approved	FLJ12572, HCC-8	uc002bux.3	Q5W5X9	OTTHUMG00000147344		15.37:g.99674046_99674047insTTCTGTTATAGCCTAAG		Somatic	NA	NA	NA		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K6M5|Q53HK0|Q96BC9|Q9H8W9|Q9H9S7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000394132.2	37	NULL	CCDS10379.2	15																																																																																			-	-		0.465	TTC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNM	protein_coding	OTTHUMT00000303953.2	-	NM_022905			99674047	+1	no_errors	ENST00000558420	ensembl	human	known	74_37	rna	INS	0.000:0.001	TTCTGTTATAGCCTAAG
SCN4A	6329	genome.wustl.edu	37	17	62049824	62049824	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr17:62049824T>C	ENST00000435607.1	-	2	356	c.280A>G	c.(280-282)Atc>Gtc	p.I94V	SCN4A_ENST00000578147.1_Missense_Mutation_p.I94V|CTC-264K15.6_ENST00000577329.1_lincRNA	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	94					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTGAGTACGATGAAGGTCTAA	0.597																																																	0								ENSG00000007314						71.0	78.0	75.0					17																	62049824		2180	4272	6452	SCN4A	SO:0001583	missense	0			-	HGNC	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.280A>G	17.37:g.62049824T>C	ENSP00000396320:p.Ile94Val	Somatic	0	51	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	56	15.15	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2	p.I94V	ENST00000435607.1	37	c.280	CCDS45761.1	17	.	.	.	.	.	.	.	.	.	.	T	14.91	2.676696	0.47886	.	.	ENSG00000007314	ENST00000435607	D	0.96073	-3.9	4.23	4.23	0.50019	.	0.104015	0.64402	D	0.000005	D	0.92756	0.7697	L	0.45581	1.43	0.42896	D	0.994217	P	0.37612	0.602	B	0.38954	0.286	D	0.91735	0.5399	10	0.33940	T	0.23	.	12.6526	0.56770	0.0:0.0:0.0:1.0	.	94	P35499	SCN4A_HUMAN	V	94	ENSP00000396320:I94V	ENSP00000396320:I94V	I	-	1	0	SCN4A	59403556	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	2.740000	0.47418	1.777000	0.52277	0.260000	0.18958	ATC	-	NULL		0.597	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	protein_coding		T	NM_000334	-		62049824	-1	no_errors	ENST00000435607	ensembl	human	known	74_37	missense	SNP	1.000	C
ASPN	54829	genome.wustl.edu	37	9	95237024	95237025	+	In_Frame_Ins	INS	-	-	TCA	rs113747060|rs71362392|rs111419727|rs3078372|rs397838876|rs376433743|rs557103556	byFrequency	TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr9:95237024_95237025insTCA	ENST00000375544.3	-	2	398_399	c.155_156insTGA	c.(154-156)gag>gaTGAg	p.51_52insD	ASPN_ENST00000450139.2_In_Frame_Ins_p.23_24insD|ASPN_ENST00000375543.1_In_Frame_Ins_p.51_52insD|ASPN_ENST00000395538.3_In_Frame_Ins_p.51_52insD|CENPP_ENST00000375587.3_Intron	NM_017680.4	NP_060150	Q9BXN1	ASPN_HUMAN	asporin	51	Poly-Asp.				bone mineralization (GO:0030282)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9						GAGAGTTGTCCtcatcatcatc	0.396																																																	0								ENSG00000106819																																			ASPN	SO:0001652	inframe_insertion	0				HGNC	AF316824		9q22.31	2008-05-14	2007-02-15		ENSG00000106819	ENSG00000106819		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	14872	protein-coding gene	gene with protein product	"""asporin proteoglycan"""	608135	"""asporin (LRR class 1)"""				Standard	NM_017680		Approved	FLJ20129, SLRR1C, PLAP1	uc004ase.2	Q9BXN1	OTTHUMG00000020227	ENST00000375544.3:c.153_155dupTGA	9.37:g.95237031_95237033dupTCA	ENSP00000364694:p.Asp52_Asp53dup	Somatic	0	40	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	45	18.18	Q5TBF3|Q96K79|Q96LD0|Q9NXP3	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,pirsf_SLRP_I_decor/aspor/byglycan	p.52in_frame_insD	ENST00000375544.3	37	c.156_155		9																																																																																			-	pirsf_SLRP_I_decor/aspor/byglycan		0.396	ASPN-001	KNOWN	basic|appris_principal	protein_coding	ASPN	protein_coding	OTTHUMT00000053094.1	-	NM_017680			95237025	-1	no_errors	ENST00000375544	ensembl	human	known	74_37	in_frame_ins	INS	0.335:0.340	TCA
EMC8	10328	genome.wustl.edu	37	16	85813472	85813472	+	Splice_Site	SNP	C	C	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr16:85813472C>A	ENST00000253457.3	-	5	719	c.475G>T	c.(475-477)Gac>Tac	p.D159Y	EMC8_ENST00000435200.2_Splice_Site_p.*127L|RNU1-103P_ENST00000516502.1_RNA	NM_006067.4	NP_006058.1	O43402	EMC8_HUMAN	ER membrane protein complex subunit 8	159						cytoplasm (GO:0005737)|ER membrane protein complex (GO:0072546)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											TCACAGTAGTCACTACGGGTC	0.527																																																	0								ENSG00000131148						58.0	53.0	55.0					16																	85813472		2198	4300	6498	EMC8	SO:0001630	splice_region_variant	0			-	HGNC	AF005888	CCDS10954.1, CCDS45541.1	16q24	2012-05-30	2012-05-30	2012-05-30	ENSG00000131148	ENSG00000131148			7864	protein-coding gene	gene with protein product	"""family with sequence similarity 158, member B"""	604886	"""chromosome 16 open reading frame 4"", ""neighbor of COX4"", ""chromosome 16 open reading frame 2"", ""COX4 neighbor"""	C16orf4, NOC4, C16orf2, COX4NB		10337626, 22119785	Standard	NM_006067		Approved	FAM158B	uc002fjd.3	O43402	OTTHUMG00000137647	ENST00000253457.3:c.474-1G>T	16.37:g.85813472C>A		Somatic	0	22	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	C9JB21	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UPF0172	p.D159Y	ENST00000253457.3	37	c.475	CCDS10954.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.12|15.12	2.737858|2.737858	0.49045|0.49045	.|.	.|.	ENSG00000131148|ENSG00000131148	ENST00000253457|ENST00000435200	T|.	0.44482|.	0.92|.	5.22|5.22	5.22|5.22	0.72569|0.72569	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.55146|.	0.1902|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	D|.	0.76494|.	0.999|.	D|.	0.77004|.	0.989|.	T|.	0.49960|.	-0.8883|.	9|.	0.59425|.	D|.	0.04|.	-32.5456|-32.5456	18.8005|18.8005	0.92015|0.92015	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	159|.	O43402|.	CX4NB_HUMAN|.	Y|L	159|127	ENSP00000253457:D159Y|.	ENSP00000253457:D159Y|.	D|X	-|-	1|2	0|2	COX4NB|COX4NB	84370973|84370973	1.000000|1.000000	0.71417|0.71417	0.945000|0.945000	0.38365|0.38365	0.645000|0.645000	0.38454|0.38454	7.380000|7.380000	0.79704|0.79704	2.435000|2.435000	0.82474|0.82474	0.561000|0.561000	0.74099|0.74099	GAC|TGA	-	pfam_UPF0172		0.527	EMC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMC8	protein_coding	OTTHUMT00000269099.1	C	NM_006067	-	Missense_Mutation	85813472	-1	no_errors	ENST00000253457	ensembl	human	known	74_37	missense	SNP	1.000	A
C9orf41	138199	genome.wustl.edu	37	9	77611441	77611441	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr9:77611441C>G	ENST00000376834.3	-	6	1098	c.946G>C	c.(946-948)Gac>Cac	p.D316H	RP11-197P3.4_ENST00000455609.1_RNA|C9orf41_ENST00000376837.3_3'UTR	NM_152420.1	NP_689633.1	Q8N4J0	CI041_HUMAN	chromosome 9 open reading frame 41	316										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|urinary_tract(2)	17						TGAGCTGTGTCTATGAAGAAA	0.284																																																	0								ENSG00000156017						91.0	96.0	94.0					9																	77611441		2203	4292	6495	C9orf41	SO:0001583	missense	0			-	HGNC	AK098661	CCDS6649.1	9q21.31	2012-03-15			ENSG00000156017	ENSG00000156017			23435	protein-coding gene	gene with protein product						12477932	Standard	NM_152420		Approved	FLJ25795	uc004ajq.3	Q8N4J0	OTTHUMG00000020032	ENST00000376834.3:c.946G>C	9.37:g.77611441C>G	ENSP00000366030:p.Asp316His	Somatic	0	54	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	87	454	16.08	Q7Z383|Q8N7C5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_N2227	p.D316H	ENST00000376834.3	37	c.946	CCDS6649.1	9	.	.	.	.	.	.	.	.	.	.	C	26.8	4.776274	0.90195	.	.	ENSG00000156017	ENST00000376834	T	0.03181	4.02	5.67	5.67	0.87782	N2227-like (1);	0.097766	0.64402	D	0.000002	T	0.27205	0.0667	M	0.91561	3.22	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.08106	-1.0738	10	0.87932	D	0	-15.9196	19.3831	0.94545	0.0:1.0:0.0:0.0	.	316	Q8N4J0	CI041_HUMAN	H	316	ENSP00000366030:D316H	ENSP00000366030:D316H	D	-	1	0	C9orf41	76801261	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.431000	0.80335	2.689000	0.91719	0.650000	0.86243	GAC	-	pfam_N2227		0.284	C9orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf41	protein_coding	OTTHUMT00000052703.1	C	NM_152420	-		77611441	-1	no_errors	ENST00000376834	ensembl	human	known	74_37	missense	SNP	1.000	G
MARCH2	51257	genome.wustl.edu	37	19	8495621	8495621	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr19:8495621T>A	ENST00000602117.1	+	4	907	c.452T>A	c.(451-453)cTg>cAg	p.L151Q	MARCH2_ENST00000601283.1_Intron|MARCH2_ENST00000215555.2_Missense_Mutation_p.L151Q|MARCH2_ENST00000381035.4_Intron|MARCH2_ENST00000393944.1_Missense_Mutation_p.L151Q|RP11-886P16.6_ENST00000595706.1_RNA			Q9P0N8	MARH2_HUMAN	membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase	151					endocytosis (GO:0006897)|protein ubiquitination (GO:0016567)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(3)|ovary(3)|skin(1)|urinary_tract(1)	10						ATCACACCGCTGGCCGCCATC	0.672																																																	0								ENSG00000099785						107.0	89.0	95.0					19																	8495621		2203	4300	6503	MARCH2	SO:0001583	missense	0			-	HGNC	AF151074	CCDS12202.1, CCDS32894.1	19p13.2	2013-01-09	2012-02-23			ENSG00000099785		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	28038	protein-coding gene	gene with protein product		613332	"""membrane-associated ring finger (C3HC4) 2"""			11042152, 14722266	Standard	NM_016496		Approved	HSPC240, MARCH-II, RNF172	uc002mjw.3	Q9P0N8		ENST00000602117.1:c.452T>A	19.37:g.8495621T>A	ENSP00000471536:p.Leu151Gln	Somatic	0	44	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	37	28.85	A6NP10|Q5H785|Q8N5A3|Q96B78	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,pfscan_Znf_RING	p.L151Q	ENST00000602117.1	37	c.452	CCDS12202.1	19	.	.	.	.	.	.	.	.	.	.	T	24.2	4.507307	0.85282	.	.	ENSG00000099785	ENST00000393944;ENST00000215555	T;T	0.23552	1.9;1.9	4.26	4.26	0.50523	.	0.087235	0.47455	D	0.000223	T	0.52092	0.1713	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.67231	0.95	T	0.60742	-0.7203	10	0.87932	D	0	-12.4912	12.6155	0.56573	0.0:0.0:0.0:1.0	.	151	Q9P0N8	MARH2_HUMAN	Q	151	ENSP00000377518:L151Q;ENSP00000215555:L151Q	ENSP00000215555:L151Q	L	+	2	0	MARCH2	8401621	1.000000	0.71417	0.969000	0.41365	0.978000	0.69477	7.817000	0.86213	1.915000	0.55452	0.368000	0.22195	CTG	-	NULL		0.672	MARCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH2	protein_coding	OTTHUMT00000460361.2	T	NM_016496	-		8495621	+1	no_errors	ENST00000215555	ensembl	human	known	74_37	missense	SNP	1.000	A
KIAA1109	84162	genome.wustl.edu	37	4	123280877	123280877	+	Splice_Site	SNP	G	G	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr4:123280877G>T	ENST00000264501.4	+	85	15174	c.14801G>T	c.(14800-14802)aGa>aTa	p.R4934I	KIAA1109_ENST00000388738.3_Splice_Site_p.R4934I			Q2LD37	K1109_HUMAN	KIAA1109	4934					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CCTACTCTTAGGTAAGTAATG	0.308																																																	0								ENSG00000138688						106.0	95.0	98.0					4																	123280877		1856	4090	5946	KIAA1109	SO:0001630	splice_region_variant	0			-	HGNC	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.14801+1G>T	4.37:g.123280877G>T		Somatic	0	36	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fragile_site-assoc_C	p.R4934I	ENST00000264501.4	37	c.14801	CCDS43267.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.454354|5.454354	0.96223|0.96223	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000306802|ENST00000264501;ENST00000388738;ENST00000438707;ENST00000431755	.|T;T;T	.|0.62364	.|0.03;0.03;0.03	5.94|5.94	5.94|5.94	0.96194|0.96194	.|Fragile site-associated protein, C-terminal (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80675|0.80675	0.4668|0.4668	M|M	0.74647|0.74647	2.275|2.275	0.80722|0.80722	D|D	1|1	.|D;D	.|0.69078	.|0.994;0.997	.|D;D	.|0.81914	.|0.975;0.995	T|T	0.81145|0.81145	-0.1066|-0.1066	5|10	.|0.87932	.|D	.|0	.|.	20.3731|20.3731	0.98895|0.98895	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|4933;4934	.|Q2LD37-4;Q2LD37	.|.;K1109_HUMAN	Y|I	1310|4934;4934;1603;535	.|ENSP00000264501:R4934I;ENSP00000373390:R4934I;ENSP00000410874:R1603I	.|ENSP00000264501:R4934I	D|R	+|+	1|2	0|0	KIAA1109|KIAA1109	123500327|123500327	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	9.789000|9.789000	0.99068|0.99068	2.829000|2.829000	0.97493|0.97493	0.650000|0.650000	0.86243|0.86243	GAT|AGA	-	pfam_Fragile_site-assoc_C		0.308	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	protein_coding	OTTHUMT00000316415.1	G	NM_020797	-	Missense_Mutation	123280877	+1	no_errors	ENST00000264501	ensembl	human	known	74_37	missense	SNP	1.000	T
VSIG10L	147645	genome.wustl.edu	37	19	51844520	51844520	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr19:51844520C>G	ENST00000335624.4	-	2	781	c.782G>C	c.(781-783)cGg>cCg	p.R261P	CTD-2616J11.16_ENST00000601148.1_RNA|CTD-2616J11.16_ENST00000594311.1_RNA	NM_001163922.1	NP_001157394.1	Q86VR7	VS10L_HUMAN	V-set and immunoglobulin domain containing 10 like	261						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)	4						CAGAACCCCCCGGGCCTGGTC	0.677																																																	0								ENSG00000186806						11.0	17.0	15.0					19																	51844520		691	1589	2280	VSIG10L	SO:0001583	missense	0			-	HGNC		CCDS54300.1	19q13.41	2013-01-11				ENSG00000186806		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27111	protein-coding gene	gene with protein product						12477932	Standard	NM_001163922		Approved		uc002pwf.3	Q86VR7		ENST00000335624.4:c.782G>C	19.37:g.51844520C>G	ENSP00000335623:p.Arg261Pro	Somatic	0	26	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	37	21.28		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R261P	ENST00000335624.4	37	c.782	CCDS54300.1	19	.	.	.	.	.	.	.	.	.	.	C	12.15	1.851824	0.32699	.	.	ENSG00000186806	ENST00000335624	T	0.27402	1.67	3.73	-4.82	0.03171	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.10981	0.0268	N	0.08118	0	0.09310	N	1	P	0.38280	0.625	B	0.33196	0.159	T	0.25047	-1.0143	9	0.30854	T	0.27	.	5.8846	0.18874	0.0:0.2702:0.5:0.2298	.	261	Q86VR7	VS10L_HUMAN	P	261	ENSP00000335623:R261P	ENSP00000335623:R261P	R	-	2	0	VSIG10L	56536332	0.000000	0.05858	0.003000	0.11579	0.984000	0.73092	-0.806000	0.04525	-0.421000	0.07416	0.313000	0.20887	CGG	-	smart_Ig_sub		0.677	VSIG10L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VSIG10L	protein_coding	OTTHUMT00000464535.1	C	NM_001163922	-		51844520	-1	no_errors	ENST00000335624	ensembl	human	novel	74_37	missense	SNP	0.000	G
KIAA1755	85449	genome.wustl.edu	37	20	36859721	36859721	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr20:36859721C>A	ENST00000279024.4	-	5	2025	c.1754G>T	c.(1753-1755)cGg>cTg	p.R585L		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	585										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				GGCCCTGTCCCGGCCACCTGG	0.632																																																	0								ENSG00000149633						33.0	34.0	34.0					20																	36859721		2202	4300	6502	KIAA1755	SO:0001583	missense	0			-	HGNC	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.1754G>T	20.37:g.36859721C>A	ENSP00000279024:p.Arg585Leu	Somatic	0	37	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q9C0A8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_CRAL-TRIO_dom	p.R585L	ENST00000279024.4	37	c.1754	CCDS33467.1	20	.	.	.	.	.	.	.	.	.	.	C	17.67	3.448015	0.63178	.	.	ENSG00000149633	ENST00000279024;ENST00000373398	T	0.26223	1.75	4.97	2.89	0.33648	.	0.347822	0.20881	N	0.083986	T	0.49864	0.1582	M	0.88906	2.99	0.20307	N	0.999914	D	0.76494	0.999	D	0.69307	0.963	T	0.36866	-0.9730	10	0.72032	D	0.01	.	6.363	0.21439	0.0:0.6406:0.1698:0.1897	.	585	Q5JYT7	K1755_HUMAN	L	585;132	ENSP00000279024:R585L	ENSP00000279024:R585L	R	-	2	0	KIAA1755	36293135	0.413000	0.25400	0.945000	0.38365	0.862000	0.49288	1.977000	0.40589	1.307000	0.44944	0.655000	0.94253	CGG	-	superfamily_CRAL-TRIO_dom		0.632	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1755	protein_coding	OTTHUMT00000079144.3	C	NM_001029864	-		36859721	-1	no_errors	ENST00000279024	ensembl	human	known	74_37	missense	SNP	0.131	A
BBS9	27241	genome.wustl.edu	37	7	33303966	33303966	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr7:33303966G>A	ENST00000242067.6	+	7	1203	c.682G>A	c.(682-684)Ggt>Agt	p.G228S	BBS9_ENST00000354265.4_Missense_Mutation_p.G228S|BBS9_ENST00000396127.2_Missense_Mutation_p.G228S|BBS9_ENST00000355070.2_Missense_Mutation_p.G228S|BBS9_ENST00000350941.3_Missense_Mutation_p.G228S|BBS9_ENST00000425508.2_Missense_Mutation_p.G183S	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	228					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			GCAAAAACTTGGTTCTGGAAA	0.294									Bardet-Biedl syndrome																																								0								ENSG00000122507						41.0	46.0	44.0					7																	33303966		2201	4299	6500	BBS9	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	-	HGNC		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.682G>A	7.37:g.33303966G>A	ENSP00000242067:p.Gly228Ser	Somatic	0	144	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	164	20.77	E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G228S	ENST00000242067.6	37	c.682	CCDS43566.1	7	.	.	.	.	.	.	.	.	.	.	G	13.92	2.381850	0.42207	.	.	ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132;ENST00000396125;ENST00000425508;ENST00000442858;ENST00000537775	T;T;T;T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47	5.24	5.24	0.73138	.	0.161449	0.53938	D	0.000041	T	0.63593	0.2524	N	0.17082	0.46	0.43555	D	0.995861	B;B;B;B;B	0.15930	0.003;0.002;0.007;0.002;0.015	B;B;B;B;B	0.20577	0.008;0.009;0.013;0.009;0.03	T	0.58103	-0.7695	10	0.02654	T	1	-7.8611	12.6537	0.56776	0.0865:0.0:0.9135:0.0	.	228;228;228;228;228	B3KQ86;Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4	.;.;.;.;PTHB1_HUMAN	S	228;228;228;228;228;228;228;183;106;106	ENSP00000242067:G228S;ENSP00000313122:G228S;ENSP00000379433:G228S;ENSP00000347182:G228S;ENSP00000346214:G228S;ENSP00000405151:G183S;ENSP00000388646:G106S	ENSP00000242067:G228S	G	+	1	0	BBS9	33270491	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.933000	0.56545	2.448000	0.82819	0.655000	0.94253	GGT	-	NULL		0.294	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BBS9	protein_coding	OTTHUMT00000329064.1	G		-		33303966	+1	no_errors	ENST00000242067	ensembl	human	known	74_37	missense	SNP	1.000	A
RIMBP3C	150221	genome.wustl.edu	37	22	21899852	21899852	+	IGR	SNP	C	C	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr22:21899852C>A	ENST00000433039.1	-	0	5784				SCARNA18_ENST00000516796.1_RNA|SCARNA17_ENST00000516334.1_RNA|RN7SKP221_ENST00000410420.1_RNA|RIMBP3C_ENST00000331505.5_3'UTR	NM_001128633.1	NP_001122105.1	A6NJZ7	RIM3C_HUMAN	RIMS binding protein 3C											large_intestine(1)	1						aaggggatacccgcctagtca	0.542																																																	0								ENSG00000222352																																			RN7SKP221	SO:0001628	intergenic_variant	0			-	HGNC		CCDS46669.1	22q11.21	2008-10-21			ENSG00000183246	ENSG00000183246			33892	protein-coding gene	gene with protein product		612701				17855024	Standard	NM_001128633		Approved		uc002zuq.4	A6NJZ7	OTTHUMG00000150825		22.37:g.21899852C>A		Somatic	0	38	0.00		0.5312841436125801	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000433039.1	37	NULL	CCDS46669.1	22																																																																																			-	-		0.542	RIMBP3C-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RN7SKP221	protein_coding		C	XM_036942	-		21899852	-1	no_errors	ENST00000410420	ensembl	human	known	74_37	rna	SNP	0.314	A
