#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
RP11-435B5.5	0	genome.wustl.edu	37	1	143378628	143378628	+	lincRNA	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:143378628G>A	ENST00000428624.1	+	0	1348				RP11-435B5.3_ENST00000430699.1_lincRNA|RP11-435B5.4_ENST00000423249.1_lincRNA																							TGAAAGAGATGTATGAAAATG	0.388																																																	0								ENSG00000238261																																			RP11-435B5.5			0			-	Clone_based_vega_gene																													1.37:g.143378628G>A		Somatic	0	58	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	52	20.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			-	-		0.388	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	lincRNA	OTTHUMT00000037971.1	G		-		143378628	+1	no_errors	ENST00000428624	ensembl	human	known	74_37	rna	SNP	0.061	A
DPY19L2P2	349152	genome.wustl.edu	37	7	102883486	102883486	+	RNA	SNP	C	C	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr7:102883486C>G	ENST00000312132.4	-	0	2623							Q6ZN68	D19P2_HUMAN	DPY19L2 pseudogene 2							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										CCTCCCAGTTCAGTACCACTG	0.313																																																	0								ENSG00000170629																																			DPY19L2P2			0			-	HGNC	AL834175		7q22.1	2013-09-12	2013-09-12		ENSG00000170629	ENSG00000170629			21764	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 2 (C. elegans)"""				Standard	NR_027768		Approved	DKFZp434E092, FLJ36166	uc003vbh.4	Q6ZN68	OTTHUMG00000157200		7.37:g.102883486C>G		Somatic	0	115	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	87	16.35	Q8N9V4|Q8ND62	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000312132.4	37	NULL		7																																																																																			-	-		0.313	DPY19L2P2-002	KNOWN	basic	processed_transcript	DPY19L2P2	pseudogene	OTTHUMT00000347877.1	C	NM_182634	-		102883486	-1	no_errors	ENST00000312132	ensembl	human	known	74_37	rna	SNP	0.992	G
MAPK10	5602	genome.wustl.edu	37	4	87010638	87010640	+	Intron	DEL	AAC	AAC	-	rs375243864|rs139887286	byFrequency	TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	AAC	AAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr4:87010638_87010640delAAC	ENST00000359221.3	-	9	1329				MAPK10_ENST00000361569.2_Intron|MAPK10_ENST00000395160.3_Intron|MAPK10_ENST00000395157.3_Intron|MAPK10_ENST00000395161.2_Intron|MAPK10_ENST00000395166.1_Intron|MAPK10_ENST00000395169.3_Intron|MAPK10_ENST00000449047.2_Intron			P53779	MK10_HUMAN	mitogen-activated protein kinase 10						activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)			breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		TAACAGAAATAACAACACTACCC	0.345														1861	0.371605	0.5499	0.2666	5008	,	,		19237	0.244		0.3708	False		,,,				2504	0.3374																0								ENSG00000109339																																			MAPK10	SO:0001627	intron_variant	0				HGNC	U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.802+9036GTT>-	4.37:g.87010641_87010643delAAC		Somatic	0	9	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	10	44.44	A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000359221.3	37	NULL	CCDS34026.1	4																																																																																			-	-		0.345	MAPK10-012	KNOWN	basic|CCDS	protein_coding	MAPK10	protein_coding	OTTHUMT00000361363.2	AAC				87010640	-1	no_errors	ENST00000489368	ensembl	human	putative	74_37	rna	DEL	0.179:0.223:0.217	-
MED15P1	326615	genome.wustl.edu	37	14	19499917	19499917	+	RNA	SNP	G	G	T	rs371711655		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr14:19499917G>T	ENST00000552968.1	-	0	652									mediator complex subunit 15 pseudogene 1																		CCTCCTGGACGCTCGCCCAGC	0.652																																																	0								ENSG00000257853																																			MED15P1			0			-	HGNC			14q11.2	2013-06-03	2010-02-25	2010-02-25	ENSG00000257853	ENSG00000257853			19271	pseudogene	pseudogene			"""PCQAP pseudogene"", ""mediator complex subunit 15 pseudogene"""	PCQAPP, MED15P			Standard	NG_002605		Approved				OTTHUMG00000170337		14.37:g.19499917G>T		Somatic	0	13	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	14	26.32		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000552968.1	37	NULL		14																																																																																			-	-		0.652	MED15P1-002	KNOWN	basic	processed_transcript	MED15P1	pseudogene	OTTHUMT00000408573.1	G	NG_002605	-		19499917	-1	no_errors	ENST00000552968	ensembl	human	known	74_37	rna	SNP	0.917	T
PLEKHA6	22874	genome.wustl.edu	37	1	204210828	204210828	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:204210828C>G	ENST00000272203.3	-	16	2603	c.2287G>C	c.(2287-2289)Gca>Cca	p.A763P	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.A783P	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	763										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			TTGAGAGCTGCCTGCTTCTCT	0.552																																																	0								ENSG00000143850						142.0	128.0	132.0					1																	204210828		2203	4300	6503	PLEKHA6	SO:0001583	missense	0			-	HGNC	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.2287G>C	1.37:g.204210828C>G	ENSP00000272203:p.Ala763Pro	Somatic	1	118	0.84		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	100	30.56	A7MD51|Q5VTI6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A763P	ENST00000272203.3	37	c.2287	CCDS1444.1	1	.	.	.	.	.	.	.	.	.	.	C	14.95	2.688429	0.48097	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.10477	2.87;3.34	5.24	3.37	0.38596	.	0.457832	0.21336	N	0.076218	T	0.08133	0.0203	L	0.36672	1.1	0.29491	N	0.855623	P	0.47409	0.895	B	0.39706	0.307	T	0.14035	-1.0487	10	0.20046	T	0.44	-2.4044	9.792	0.40710	0.0:0.8394:0.0:0.1606	.	763	Q9Y2H5	PKHA6_HUMAN	P	763;783	ENSP00000272203:A763P;ENSP00000402046:A783P	ENSP00000272203:A763P	A	-	1	0	PLEKHA6	202477451	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.258000	0.32944	0.797000	0.33971	0.644000	0.83932	GCA	-	NULL		0.552	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA6	protein_coding	OTTHUMT00000087889.3	C	NM_014935	-		204210828	-1	no_errors	ENST00000272203	ensembl	human	known	74_37	missense	SNP	1.000	G
VEGFC	7424	genome.wustl.edu	37	4	177609025	177609025	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr4:177609025C>T	ENST00000280193.2	-	5	1176	c.761G>A	c.(760-762)tGc>tAc	p.C254Y	RP11-313E19.2_ENST00000504017.1_RNA|VEGFC_ENST00000507638.1_5'Flank|RP11-313E19.2_ENST00000509194.1_RNA	NM_005429.2	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	254					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|induction of positive chemotaxis (GO:0050930)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein secretion (GO:0050714)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to drug (GO:0042493)|signal transduction (GO:0007165)|substrate-dependent cell migration (GO:0006929)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)			biliary_tract(1)|cervix(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(2)|skin(2)	41		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		CAGGCATCTGCAGATGTGATT	0.453																																																	0								ENSG00000150630						112.0	107.0	109.0					4																	177609025		1915	4132	6047	VEGFC	SO:0001583	missense	0			-	HGNC	BC035212	CCDS43285.1	4q34.3	2013-02-18				ENSG00000150630			12682	protein-coding gene	gene with protein product	"""vascular endothelial growth factor-related protein"""	601528				8617204	Standard	NM_005429		Approved	VRP	uc003ius.1	P49767		ENST00000280193.2:c.761G>A	4.37:g.177609025C>T	ENSP00000280193:p.Cys254Tyr	Somatic	0	109	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	115	175	39.66	B2R9Q8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDGF/VEGF_dom,pfam_CXCXC_repeat,smart_PDGF/VEGF_dom,pfscan_PDGF/VEGF_dom	p.C254Y	ENST00000280193.2	37	c.761	CCDS43285.1	4	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046127	0.75846	.	.	ENSG00000150630	ENST00000280193	.	.	.	5.57	4.73	0.59995	.	0.051100	0.85682	N	0.000000	T	0.79185	0.4403	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.82468	-0.0442	9	0.87932	D	0	-13.7135	14.8702	0.70450	0.0:0.9308:0.0:0.0692	.	254	P49767	VEGFC_HUMAN	Y	254	.	ENSP00000280193:C254Y	C	-	2	0	VEGFC	177846019	1.000000	0.71417	0.997000	0.53966	0.877000	0.50540	6.478000	0.73596	1.490000	0.48466	0.650000	0.86243	TGC	-	NULL		0.453	VEGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VEGFC	protein_coding	OTTHUMT00000361991.1	C	NM_005429	-		177609025	-1	no_errors	ENST00000280193	ensembl	human	known	74_37	missense	SNP	1.000	T
APCS	325	genome.wustl.edu	37	1	159558150	159558150	+	Silent	SNP	G	G	C	rs28383572	byFrequency	TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:159558150G>C	ENST00000255040.2	+	2	421	c.324G>C	c.(322-324)ccG>ccC	p.P108P		NM_001639.3	NP_001630.1	P02743	SAMP_HUMAN	amyloid P component, serum	108	Pentaxin.				acute-phase response (GO:0006953)|chaperone-mediated protein complex assembly (GO:0051131)|innate immune response (GO:0045087)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral process (GO:0048525)|negative regulation of wound healing (GO:0061045)|protein folding (GO:0006457)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|unfolded protein binding (GO:0051082)|virion binding (GO:0046790)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_hematologic(112;0.0429)					AAAAGTTCCCGGCTCCAGTGC	0.433																																																	0								ENSG00000132703						81.0	82.0	82.0					1																	159558150		2203	4300	6503	APCS	SO:0001819	synonymous_variant	0			-	HGNC		CCDS1186.1	1q21-q23	2012-10-02			ENSG00000132703	ENSG00000132703			584	protein-coding gene	gene with protein product	"""pentaxin-related"", ""9.5S alpha-1-glycoprotein"""	104770				2987268	Standard	NM_001639		Approved	SAP, PTX2, MGC88159	uc001ftv.3	P02743	OTTHUMG00000022741	ENST00000255040.2:c.324G>C	1.37:g.159558150G>C		Somatic	0	164	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	143	16.37		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.P108	ENST00000255040.2	37	c.324	CCDS1186.1	1																																																																																			-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin		0.433	APCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APCS	protein_coding	OTTHUMT00000059024.2	G	NM_001639	-		159558150	+1	no_errors	ENST00000255040	ensembl	human	known	74_37	silent	SNP	0.000	C
RABGEF1	27342	genome.wustl.edu	37	7	66274900	66274900	+	3'UTR	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr7:66274900C>T	ENST00000284957.5	+	0	2182				RABGEF1_ENST00000484547.2_3'UTR|KCTD7_ENST00000380828.2_3'UTR|RABGEF1_ENST00000439720.2_3'UTR|KCTD7_ENST00000510829.2_3'UTR|GTF2IRD1P1_ENST00000457166.1_RNA			Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1						endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein targeting to membrane (GO:0006612)	early endosome (GO:0005769)	DNA binding (GO:0003677)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|stomach(1)	27						TCTTTAAGAACGTGTTAGCCT	0.368																																																	0								ENSG00000154710																																			RABGEF1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AJ250042	CCDS5535.1, CCDS69308.1, CCDS75610.1	7q11.21	2010-07-09			ENSG00000154710	ENSG00000154710			17676	protein-coding gene	gene with protein product		609700				12505986, 11098082	Standard	NM_014504		Approved	rabex-5, RABEX5	uc003tvh.3	Q9UJ41	OTTHUMG00000129547	ENST00000284957.5:c.*629C>T	7.37:g.66274900C>T		Somatic	0	57	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	104	11.86	B4DZM7|Q3HKR2|Q3HKR3|Q53FG0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000284957.5	37	NULL	CCDS5535.1	7																																																																																			-	-		0.368	RABGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGEF1	protein_coding	OTTHUMT00000251737.3	C	NM_014504	-		66274900	+1	no_errors	ENST00000484547	ensembl	human	known	74_37	rna	SNP	0.000	T
CDK14	5218	genome.wustl.edu	37	7	90355898	90355898	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr7:90355898G>A	ENST00000380050.3	+	3	272	c.141G>A	c.(139-141)atG>atA	p.M47I	CDK14_ENST00000496279.1_3'UTR|CDK14_ENST00000436577.2_5'UTR|CDK14_ENST00000406263.1_Start_Codon_SNP_p.M1I|CDK14_ENST00000265741.3_Missense_Mutation_p.M29I			O94921	CDK14_HUMAN	cyclin-dependent kinase 14	47					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						TCACAAAGATGTCTACACGGA	0.388																																					GBM(83;1228 1256 8311 16577 31299)												0								ENSG00000058091						79.0	72.0	74.0					7																	90355898		2203	4300	6503	CDK14	SO:0001583	missense	0			-	HGNC		CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.141G>A	7.37:g.90355898G>A	ENSP00000369390:p.Met47Ile	Somatic	0	141	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	76	19.15	A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.M47I	ENST00000380050.3	37	c.141		7	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756667	0.49362	.	.	ENSG00000058091	ENST00000449528;ENST00000446224;ENST00000430760;ENST00000456689;ENST00000380050;ENST00000446790;ENST00000265741;ENST00000406263	T;T;T;T;T;T;T	0.69306	2.15;2.15;2.15;2.15;-0.39;-0.37;-0.38	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.66167	0.2762	L	0.27053	0.805	0.80722	D	1	P;P	0.39044	0.656;0.525	P;P	0.48627	0.584;0.48	T	0.59947	-0.7358	10	0.23891	T	0.37	-19.0256	19.8788	0.96888	0.0:0.0:1.0:0.0	.	29;47	O94921-2;O94921	.;CDK14_HUMAN	I	1;1;1;1;47;1;29;1	ENSP00000393616:M1I;ENSP00000410770:M1I;ENSP00000394570:M1I;ENSP00000406848:M1I;ENSP00000369390:M47I;ENSP00000265741:M29I;ENSP00000385034:M1I	ENSP00000265741:M29I	M	+	3	0	CDK14	90193834	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.998000	0.93550	2.704000	0.92352	0.563000	0.77884	ATG	-	NULL		0.388	CDK14-001	KNOWN	basic|appris_principal	protein_coding	CDK14	protein_coding	OTTHUMT00000059970.5	G	NM_012395	-		90355898	+1	no_errors	ENST00000380050	ensembl	human	known	74_37	missense	SNP	1.000	A
SIRT7	51547	genome.wustl.edu	37	17	79872574	79872574	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr17:79872574T>C	ENST00000328666.6	-	6	547	c.485A>G	c.(484-486)cAg>cGg	p.Q162R		NM_016538.2	NP_057622.1	Q9NRC8	SIR7_HUMAN	sirtuin 7	162	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription on exit from mitosis (GO:0007072)|rRNA transcription (GO:0009303)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleolus organizer region (GO:0005731)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0165)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			CACCACATGCTGCACCTGGAA	0.647																																																	0								ENSG00000187531						54.0	51.0	52.0					17																	79872574		2202	4294	6496	SIRT7	SO:0001583	missense	0			-	HGNC	AF233395	CCDS11792.1	17q25.3	2010-06-25	2010-06-25			ENSG00000187531			14935	protein-coding gene	gene with protein product		606212	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 7"", ""sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae)"""			10873683, 16618798	Standard	NM_016538		Approved		uc002kcj.2	Q9NRC8		ENST00000328666.6:c.485A>G	17.37:g.79872574T>C	ENSP00000329466:p.Gln162Arg	Somatic	0	72	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	76	64	54.29	A8K2K0|B3KSU8|Q3MIK4|Q9NSZ6|Q9NUS6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sirtuin,pfscan_Ssirtuin_cat_dom	p.Q162R	ENST00000328666.6	37	c.485	CCDS11792.1	17	.	.	.	.	.	.	.	.	.	.	T	10.06	1.245898	0.22796	.	.	ENSG00000187531	ENST00000328666;ENST00000536038	T	0.16743	2.32	4.2	4.2	0.49525	.	0.131711	0.52532	D	0.000076	T	0.08403	0.0209	N	0.04260	-0.245	0.51482	D	0.999926	B;B	0.09022	0.002;0.001	B;B	0.11329	0.006;0.006	T	0.22836	-1.0205	10	0.21014	T	0.42	-24.8158	13.4573	0.61206	0.0:0.0:0.0:1.0	.	162;162	A8K2K0;Q9NRC8	.;SIRT7_HUMAN	R	162;145	ENSP00000329466:Q162R	ENSP00000329466:Q162R	Q	-	2	0	SIRT7	77465866	0.998000	0.40836	1.000000	0.80357	0.983000	0.72400	1.450000	0.35134	1.762000	0.52044	0.459000	0.35465	CAG	-	pfam_Sirtuin,pfscan_Ssirtuin_cat_dom		0.647	SIRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT7	protein_coding	OTTHUMT00000439961.1	T	NM_016538	-		79872574	-1	no_errors	ENST00000328666	ensembl	human	known	74_37	missense	SNP	1.000	C
FMNL3	91010	genome.wustl.edu	37	12	50050265	50050265	+	Silent	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:50050265G>T	ENST00000293590.5	-	9	1040	c.807C>A	c.(805-807)gtC>gtA	p.V269V	FMNL3_ENST00000335154.5_Silent_p.V269V|FMNL3_ENST00000550488.1_Silent_p.V269V|FMNL3_ENST00000352151.5_Silent_p.V218V			Q8IVF7	FMNL3_HUMAN	formin-like 3	269	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)	GTPase activating protein binding (GO:0032794)			breast(4)|endometrium(7)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|stomach(1)	39						GAAGCTCTAAGACAAGGGCTT	0.493																																																	0								ENSG00000161791						69.0	70.0	70.0					12																	50050265		2041	4218	6259	FMNL3	SO:0001819	synonymous_variant	0			-	HGNC	AK128195	CCDS41780.1, CCDS44874.1	12q13.12	2006-04-10							23698	protein-coding gene	gene with protein product						12684686	Standard	NM_198900		Approved	DKFZp762B245, MGC45819, WBP3	uc001ruv.1	Q8IVF7	OTTHUMG00000169651	ENST00000293590.5:c.807C>A	12.37:g.50050265G>T		Somatic	0	137	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	49	58	45.79	B0JZA7|Q6ZRJ1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin	p.V269	ENST00000293590.5	37	c.807		12																																																																																			-	pfam_GTPase-bd,superfamily_ARM-type_fold		0.493	FMNL3-201	KNOWN	basic	protein_coding	FMNL3	protein_coding		G	NM_175736	-		50050265	-1	no_errors	ENST00000293590	ensembl	human	known	74_37	silent	SNP	0.998	T
LINC00521	256369	genome.wustl.edu	37	14	94468031	94468031	+	RNA	SNP	A	A	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr14:94468031A>G	ENST00000444118.1	+	0	1109					NR_024182.1		Q8NCU1	CN048_HUMAN	long intergenic non-protein coding RNA 521																		cctagttgctagcgtccttgc	0.493																																																	0								ENSG00000175699																																			LINC00521			0			-	HGNC	BI463117		14q32.12	2012-10-12	2011-11-29	2011-11-29	ENSG00000175699	ENSG00000175699		"""Long non-coding RNAs"""	19860	non-coding RNA	RNA, long non-coding			"""chromosome 14 open reading frame 48"""	C14orf48			Standard	NR_024182		Approved		uc001ycg.1	Q8NCU1	OTTHUMG00000156974		14.37:g.94468031A>G		Somatic	0	68	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	32	36.00	Q8N7S1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000444118.1	37	NULL		14																																																																																			-	-		0.493	LINC00521-003	KNOWN	basic	processed_transcript	LINC00521	processed_transcript	OTTHUMT00000346916.1	A		-		94468031	+1	no_errors	ENST00000444118	ensembl	human	known	74_37	rna	SNP	0.002	G
LOC283683	283683	genome.wustl.edu	37	15	23114586	23114586	+	RNA	SNP	A	A	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr15:23114586A>C	ENST00000557922.1	-	0	140					NR_040057.1																						GTACACACACACATGACAGAA	0.517																																																	0								ENSG00000259344																																			RP11-566K19.6			0			-	Clone_based_vega_gene																													15.37:g.23114586A>C		Somatic	0	19	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	17	22.73		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000557922.1	37	NULL		15																																																																																			-	-		0.517	RP11-566K19.6-003	KNOWN	basic	processed_transcript	LOC283683	pseudogene	OTTHUMT00000415896.1	A		-		23114586	-1	no_errors	ENST00000561118	ensembl	human	known	74_37	rna	SNP	0.000	C
MYO1D	4642	genome.wustl.edu	37	17	31094749	31094749	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr17:31094749C>T	ENST00000318217.5	-	7	1040	c.736G>A	c.(736-738)Gaa>Aaa	p.E246K	MYO1D_ENST00000583621.1_Missense_Mutation_p.E246K|MYO1D_ENST00000579584.1_Missense_Mutation_p.E246K|MYO1D_ENST00000394649.4_Missense_Mutation_p.E158K	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	246	Myosin motor.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.E246K(2)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			ACTCTGAATTCGGCAGCATCA	0.363																																																	2	Substitution - Missense(2)	large_intestine(2)						ENSG00000176658						88.0	77.0	81.0					17																	31094749		2203	4300	6503	MYO1D	SO:0001583	missense	0			-	HGNC	AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.736G>A	17.37:g.31094749C>T	ENSP00000324527:p.Glu246Lys	Somatic	0	27	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	A6H8V3|Q8NHP9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E246K	ENST00000318217.5	37	c.736	CCDS32615.1	17	.	.	.	.	.	.	.	.	.	.	C	18.20	3.571597	0.65765	.	.	ENSG00000176658	ENST00000318217	T	0.72835	-0.69	6.0	5.01	0.66863	Myosin head, motor domain (2);	0.187967	0.25099	U	0.033151	T	0.70064	0.3181	M	0.62723	1.935	0.50467	D	0.999873	B;B	0.22080	0.064;0.064	B;B	0.26202	0.067;0.067	T	0.68534	-0.5383	10	0.56958	D	0.05	.	14.8407	0.70220	0.0:0.8553:0.1447:0.0	.	157;246	Q7Z3N6;O94832	.;MYO1D_HUMAN	K	246	ENSP00000324527:E246K	ENSP00000324527:E246K	E	-	1	0	MYO1D	28118862	1.000000	0.71417	0.942000	0.38095	0.967000	0.64934	7.487000	0.81328	1.505000	0.48720	0.655000	0.94253	GAA	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.363	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1D	protein_coding	OTTHUMT00000447457.1	C		-		31094749	-1	no_errors	ENST00000318217	ensembl	human	known	74_37	missense	SNP	0.985	T
ITGB1BP2	26548	genome.wustl.edu	37	X	70524458	70524458	+	Intron	SNP	A	A	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chrX:70524458A>C	ENST00000373829.3	+	10	889				ITGB1BP2_ENST00000465388.1_3'UTR|ITGB1BP2_ENST00000538820.1_Intron	NM_012278.1	NP_036410.1	Q9UKP3	ITBP2_HUMAN	integrin beta 1 binding protein (melusin) 2						muscle organ development (GO:0007517)|signal transduction (GO:0007165)	Z disc (GO:0030018)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)	14	Renal(35;0.156)					CTGGGGGGTAAGTGAAGACCA	0.483																																																	0								ENSG00000147166						82.0	65.0	71.0					X																	70524458		2203	4300	6503	ITGB1BP2	SO:0001627	intron_variant	0			-	HGNC	AF140690	CCDS14411.1	Xq12.1-q13	2008-02-05			ENSG00000147166	ENSG00000147166			6154	protein-coding gene	gene with protein product		300332				10506186	Standard	XM_005262255		Approved	CHORDC3	uc004dzr.1	Q9UKP3	OTTHUMG00000021793	ENST00000373829.3:c.816+4A>C	X.37:g.70524458A>C		Somatic	0	144	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	121	12.32	Q32N04|Q549J7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373829.3	37	NULL	CCDS14411.1	X																																																																																			-	-		0.483	ITGB1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB1BP2	protein_coding	OTTHUMT00000057126.1	A	NM_012278	-		70524458	+1	no_errors	ENST00000465388	ensembl	human	known	74_37	rna	SNP	1.000	C
MYB	4602	genome.wustl.edu	37	6	135515004	135515004	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr6:135515004C>A	ENST00000367814.4	+	7	977	c.791C>A	c.(790-792)gCg>gAg	p.A264E	MYB_ENST00000533624.1_Missense_Mutation_p.A264E|MYB_ENST00000525369.1_Missense_Mutation_p.A264E|MYB-AS1_ENST00000455534.1_RNA|MYB_ENST00000527615.1_Missense_Mutation_p.A264E|MYB_ENST00000534121.1_Missense_Mutation_p.A264E|MYB_ENST00000420123.2_Missense_Mutation_p.A240E|MYB_ENST00000316528.8_Missense_Mutation_p.A264E|MYB_ENST00000341911.5_Missense_Mutation_p.A264E|MYB_ENST00000528774.1_Missense_Mutation_p.A264E|MYB_ENST00000531845.1_3'UTR|MYB_ENST00000534044.1_Missense_Mutation_p.A264E|MYB_ENST00000442647.2_Missense_Mutation_p.A264E	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog	264					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		TACCCTGTAGCGTTACATGTA	0.448			T	NFIB	adenoid cystic carcinoma																																			Dom	yes		6	6q22-23	4602	v-myb myeloblastosis viral oncogene homolog		E	0								ENSG00000118513						235.0	206.0	216.0					6																	135515004		2203	4300	6503	MYB	SO:0001583	missense	0			-	HGNC		CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.791C>A	6.37:g.135515004C>A	ENSP00000356788:p.Ala264Glu	Somatic	0	181	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	87	185	31.99	E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-myb_C,pfam_SANT/Myb,pfam_Tscrpt_reg_Wos2-domain,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.A264E	ENST00000367814.4	37	c.791	CCDS5174.1	6	.	.	.	.	.	.	.	.	.	.	C	26.7	4.764782	0.90020	.	.	ENSG00000118513	ENST00000341911;ENST00000442647;ENST00000316528;ENST00000237302;ENST00000367814;ENST00000527615;ENST00000420123;ENST00000525369;ENST00000528774;ENST00000534121;ENST00000534044;ENST00000533624;ENST00000430686	T;T;T;T;T;T;T;T;T;T	0.31769	2.77;2.25;2.23;2.24;1.48;1.97;2.77;2.76;1.9;2.27	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.51381	0.1671	M	0.74258	2.255	0.80722	D	1	D;D;D;D;D;D;P;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;0.989;0.892;1.0;0.987;1.0	D;D;D;D;D;P;B;D;P;D	0.91635	0.994;0.987;0.998;0.991;0.999;0.867;0.334;0.999;0.698;0.998	T	0.56396	-0.7986	10	0.72032	D	0.01	-7.0423	18.8089	0.92050	0.0:1.0:0.0:0.0	.	264;264;240;264;264;264;264;264;264;264	E9PI07;E9PLZ5;E9PMQ0;P10242-2;E9PNL6;E9PRS2;E9PNA4;P10242-4;P10242;Q708E1	.;.;.;.;.;.;.;.;MYB_HUMAN;.	E	264;264;264;264;264;264;240;264;264;264;264;264;218	ENSP00000339992:A264E;ENSP00000410825:A264E;ENSP00000326328:A264E;ENSP00000356788:A264E;ENSP00000433227:A264E;ENSP00000435938:A264E;ENSP00000434723:A264E;ENSP00000432851:A264E;ENSP00000435055:A264E;ENSP00000436605:A264E	ENSP00000237302:A264E	A	+	2	0	MYB	135556697	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.204000	0.72143	2.437000	0.82529	0.650000	0.86243	GCG	-	NULL		0.448	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYB	protein_coding	OTTHUMT00000042347.4	C		-		135515004	+1	no_errors	ENST00000341911	ensembl	human	known	74_37	missense	SNP	1.000	A
MMP7	4316	genome.wustl.edu	37	11	102398334	102398334	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr11:102398334C>A	ENST00000260227.4	-	3	457	c.405G>T	c.(403-405)atG>atT	p.M135I		NM_002423.3	NP_002414.1	P09237	MMP7_HUMAN	matrix metallopeptidase 7 (matrilysin, uterine)	135					antibacterial peptide secretion (GO:0002779)|collagen catabolic process (GO:0030574)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_cancers(8;2.04e-05)|all_epithelial(12;0.00053)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0105)|all cancers(10;0.0496)|Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0147)	Marimastat(DB00786)	CTTTGCCCCACATGTTTAAAG	0.438																																																	0								ENSG00000137673						124.0	120.0	121.0					11																	102398334		2203	4299	6502	MMP7	SO:0001583	missense	0			-	HGNC	Z11887	CCDS8317.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000137673	ENSG00000137673	3.4.24.23		7174	protein-coding gene	gene with protein product		178990	"""matrix metalloproteinase 7 (matrilysin, uterine)"""	MPSL1		8978768	Standard	NM_002423		Approved	PUMP-1	uc001phb.3	P09237	OTTHUMG00000048193	ENST00000260227.4:c.405G>T	11.37:g.102398334C>A	ENSP00000260227:p.Met135Ile	Somatic	0	150	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	52	42	55.32	Q9BTK9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_M10_metallopeptidase,pfam_Peptidoglycan-bd-like,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,prints_Pept_M10A	p.M135I	ENST00000260227.4	37	c.405	CCDS8317.1	11	.	.	.	.	.	.	.	.	.	.	C	11.24	1.579246	0.28180	.	.	ENSG00000137673	ENST00000260227	T	0.48836	0.8	4.85	1.9	0.25705	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.671381	0.13295	N	0.398721	T	0.27134	0.0665	L	0.28192	0.835	0.24613	N	0.993714	B;B;B	0.30914	0.3;0.001;0.006	B;B;B	0.25987	0.065;0.005;0.026	T	0.17077	-1.0381	10	0.44086	T	0.13	0.6303	1.5284	0.02530	0.1362:0.4069:0.1331:0.3239	.	135;135;135	B4DDW4;Q53GF1;P09237	.;.;MMP7_HUMAN	I	135	ENSP00000260227:M135I	ENSP00000260227:M135I	M	-	3	0	MMP7	101903544	0.010000	0.17322	0.629000	0.29254	0.963000	0.63663	-1.190000	0.03058	0.461000	0.27071	0.563000	0.77884	ATG	-	pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo,prints_Pept_M10A		0.438	MMP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP7	protein_coding	OTTHUMT00000109633.2	C		-		102398334	-1	no_errors	ENST00000260227	ensembl	human	known	74_37	missense	SNP	0.104	A
CH25H	9023	genome.wustl.edu	37	10	90966518	90966518	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr10:90966518C>T	ENST00000371852.2	-	1	553	c.532G>A	c.(532-534)Gaa>Aaa	p.E178K		NM_003956.3	NP_003947.1	O95992	CH25H_HUMAN	cholesterol 25-hydroxylase	178					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol metabolic process (GO:0008203)|fatty acid biosynthetic process (GO:0006633)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholesterol 25-hydroxylase activity (GO:0001567)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)			kidney(1)|large_intestine(2)|lung(3)|stomach(1)	7		Colorectal(252;0.0161)		GBM - Glioblastoma multiforme(2;0.000133)		GAAAACAGTTCCCAGACGCTC	0.577																																																	0								ENSG00000138135						161.0	157.0	158.0					10																	90966518		2203	4300	6503	CH25H	SO:0001583	missense	0			-	HGNC	AF059212	CCDS7400.1	10q23	2013-03-04			ENSG00000138135	ENSG00000138135	1.14.99.38	"""Fatty acid hydroxylase domain containing"""	1907	protein-coding gene	gene with protein product		604551				9852097	Standard	NM_003956		Approved		uc001kfz.3	O95992	OTTHUMG00000018705	ENST00000371852.2:c.532G>A	10.37:g.90966518C>T	ENSP00000360918:p.Glu178Lys	Somatic	0	81	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	58	30.12	B2RBY3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fatty_acid_hydroxylase	p.E178K	ENST00000371852.2	37	c.532	CCDS7400.1	10	.	.	.	.	.	.	.	.	.	.	C	35	5.422104	0.96111	.	.	ENSG00000138135	ENST00000371852	D	0.85861	-2.04	4.88	4.88	0.63580	Fatty acid hydroxylase (1);	0.000000	0.85682	D	0.000000	D	0.95201	0.8444	H	0.96633	3.855	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96684	0.9506	10	0.87932	D	0	-39.757	17.8989	0.88897	0.0:1.0:0.0:0.0	.	178	O95992	CH25H_HUMAN	K	178	ENSP00000360918:E178K	ENSP00000360918:E178K	E	-	1	0	CH25H	90956498	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.625000	0.83145	2.628000	0.89032	0.563000	0.77884	GAA	-	pfam_Fatty_acid_hydroxylase		0.577	CH25H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CH25H	protein_coding	OTTHUMT00000049291.1	C	NM_003956	-		90966518	-1	no_errors	ENST00000371852	ensembl	human	known	74_37	missense	SNP	1.000	T
CRHR2	1395	genome.wustl.edu	37	7	30721617	30721617	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr7:30721617C>T	ENST00000471646.1	-	2	560	c.143G>A	c.(142-144)gGa>gAa	p.G48E	CRHR2_ENST00000506074.2_Missense_Mutation_p.G48E|CRHR2_ENST00000348438.4_Missense_Mutation_p.G75E|CRHR2_ENST00000341843.4_Missense_Mutation_p.G34E	NM_001202482.1|NM_001202483.1|NM_001883.4	NP_001189411.1|NP_001189412.1|NP_001874.2	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	48					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CCAGCACGTTCCGATCTGGTC	0.692																																																	0								ENSG00000106113						30.0	28.0	28.0					7																	30721617		2200	4295	6495	CRHR2	SO:0001583	missense	0			-	HGNC		CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000471646.1:c.143G>A	7.37:g.30721617C>T	ENSP00000418722:p.Gly48Glu	Somatic	0	205	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	195	158	55.24	B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,prints_GPCR_2_CRF_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CRF2_rcpt,prints_GPCR_2_diuretic_rcpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.G75E	ENST00000471646.1	37	c.224	CCDS5429.1	7	.	.	.	.	.	.	.	.	.	.	C	32	5.173737	0.94807	.	.	ENSG00000106113	ENST00000471646;ENST00000348438;ENST00000341843;ENST00000506074	T;T;T;T	0.54675	0.56;0.56;0.56;0.56	4.27	4.27	0.50696	GPCR, family 2, secretin-like, conserved site (1);GPCR, family 2, extracellular hormone receptor domain (3);	0.000000	0.64402	D	0.000001	T	0.74107	0.3673	M	0.84585	2.705	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;1.0	D;D;D;D;D	0.85130	0.997;0.995;0.991;0.981;0.997	T	0.77890	-0.2419	10	0.52906	T	0.07	.	14.6183	0.68565	0.0:1.0:0.0:0.0	.	48;48;75;34;48	B3SXT0;B3SXS6;Q13324-2;Q13324-3;Q13324	.;.;.;.;CRFR2_HUMAN	E	48;75;34;48	ENSP00000418722:G48E;ENSP00000340943:G75E;ENSP00000344304:G34E;ENSP00000426498:G48E	ENSP00000344304:G34E	G	-	2	0	CRHR2	30688142	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.521000	0.73778	2.379000	0.81126	0.655000	0.94253	GGA	-	pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom		0.692	CRHR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CRHR2	protein_coding	OTTHUMT00000250448.3	C		-		30721617	-1	no_errors	ENST00000348438	ensembl	human	known	74_37	missense	SNP	1.000	T
OR13C5	138799	genome.wustl.edu	37	9	107360878	107360878	+	Silent	SNP	A	A	G	rs141268591		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr9:107360878A>G	ENST00000374779.2	-	1	910	c.817T>C	c.(817-819)Ttg>Ctg	p.L273L		NM_001004482.1	NP_001004482.1	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C, member 5	273						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L273M(1)		endometrium(4)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(4)	28						GTGGCATCCAAGTCATCTGAA	0.428																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000255800	A		1,4405	2.1+/-5.4	0,1,2202	136.0	126.0	129.0		817	-6.3	0.0	9	dbSNP_134	129	0,8600		0,0,4300	no	coding-synonymous	OR13C5	NM_001004482.1		0,1,6502	GG,GA,AA		0.0,0.0227,0.0077		273/319	107360878	1,13005	2203	4300	6503	OR13C5	SO:0001819	synonymous_variant	0			-	HGNC		CCDS35091.1	9q31.1	2012-10-03			ENSG00000255800	ENSG00000277556		"""GPCR / Class A : Olfactory receptors"""	15100	protein-coding gene	gene with protein product							Standard	NM_001004482		Approved		uc011lvp.2	Q8NGS8	OTTHUMG00000020408	ENST00000374779.2:c.817T>C	9.37:g.107360878A>G		Somatic	0	185	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	240	15.49	B2RNE5|B9EGW5|Q6IF53	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L273	ENST00000374779.2	37	c.817	CCDS35091.1	9																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.428	OR13C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C5	protein_coding	OTTHUMT00000053479.2	A	NM_001004482	rs141268591		107360878	-1	no_errors	ENST00000374779	ensembl	human	known	74_37	silent	SNP	0.000	G
DPY19L2	283417	genome.wustl.edu	37	12	63991687	63991687	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:63991687G>A	ENST00000324472.4	-	14	1546	c.1363C>T	c.(1363-1365)Cgc>Tgc	p.R455C		NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	455					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		TCACTCAGGCGAATCTGGGAG	0.313																																																	0								ENSG00000177990						35.0	39.0	38.0					12																	63991687		2195	4277	6472	DPY19L2	SO:0001583	missense	0			-	HGNC		CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.1363C>T	12.37:g.63991687G>A	ENSP00000315988:p.Arg455Cys	Somatic	1	135	0.74		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	1866	1411	56.92	A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dpy-19	p.R455C	ENST00000324472.4	37	c.1363	CCDS31851.1	12	.	.	.	.	.	.	.	.	.	.	G	11.44	1.639038	0.29157	.	.	ENSG00000177990	ENST00000324472;ENST00000541083	T;T	0.56275	0.47;0.47	3.14	3.14	0.36123	.	0.175210	0.49305	D	0.000149	T	0.34978	0.0916	.	.	.	0.80722	D	1	B	0.22080	0.064	B	0.18561	0.022	T	0.12708	-1.0537	8	.	.	.	.	9.9551	0.41661	0.0:0.0:1.0:0.0	.	455	Q6NUT2	D19L2_HUMAN	C	455;121	ENSP00000315988:R455C;ENSP00000443126:R121C	.	R	-	1	0	DPY19L2	62277954	1.000000	0.71417	0.964000	0.40570	0.846000	0.48090	2.984000	0.49353	1.748000	0.51833	0.580000	0.79431	CGC	-	pfam_Dpy-19		0.313	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L2	protein_coding	OTTHUMT00000400689.2	G	NM_173812	-		63991687	-1	no_errors	ENST00000324472	ensembl	human	known	74_37	missense	SNP	0.996	A
ANKZF1	55139	genome.wustl.edu	37	2	220098857	220098857	+	Missense_Mutation	SNP	G	G	A	rs375422658		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr2:220098857G>A	ENST00000323348.5	+	9	1225	c.1051G>A	c.(1051-1053)Gaa>Aaa	p.E351K	GLB1L_ENST00000497855.1_5'Flank|ANKZF1_ENST00000409849.1_Missense_Mutation_p.E141K|ANKZF1_ENST00000410034.3_Missense_Mutation_p.E351K	NM_018089.2	NP_060559.2	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing 1	351						membrane (GO:0016020)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	23		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TATGGCAGAAGAAGACCCTCG	0.463																																																	0								ENSG00000163516	G	LYS/GLU,LYS/GLU	1,3761		0,1,1880	41.0	40.0	40.0		1051,1051	4.1	1.0	2		40	0,8238		0,0,4119	no	missense,missense	ANKZF1	NM_001042410.1,NM_018089.2	56,56	0,1,5999	AA,AG,GG		0.0,0.0266,0.0083	benign,benign	351/727,351/727	220098857	1,11999	1881	4119	6000	ANKZF1	SO:0001583	missense	0			-	HGNC	AF364318	CCDS42821.1, CCDS63129.1	2q35	2013-01-10			ENSG00000163516	ENSG00000163516		"""Zinc fingers, C2H2-type"", ""Ankyrin repeat domain containing"""	25527	protein-coding gene	gene with protein product						12477932	Standard	NM_018089		Approved	FLJ10415, ZNF744	uc002vkg.3	Q9H8Y5	OTTHUMG00000154533	ENST00000323348.5:c.1051G>A	2.37:g.220098857G>A	ENSP00000321617:p.Glu351Lys	Somatic	0	51	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	38	26.92	Q9NVZ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E351K	ENST00000323348.5	37	c.1051	CCDS42821.1	2	.	.	.	.	.	.	.	.	.	.	G	3.456	-0.110993	0.06924	2.66E-4	0.0	ENSG00000163516	ENST00000323348;ENST00000409849;ENST00000410034	T;T;T	0.25579	1.79;2.03;1.79	4.94	4.07	0.47477	.	0.383548	0.30528	N	0.009423	T	0.17831	0.0428	L	0.45698	1.435	0.29762	N	0.835455	P;B;B	0.37330	0.59;0.05;0.053	B;B;B	0.36378	0.223;0.009;0.026	T	0.08806	-1.0704	10	0.06099	T	0.92	-5.9175	8.76	0.34669	0.1007:0.0:0.8993:0.0	.	295;141;351	B4DZT1;B4E0V1;Q9H8Y5	.;.;ANKZ1_HUMAN	K	351;141;351	ENSP00000321617:E351K;ENSP00000386815:E141K;ENSP00000386337:E351K	ENSP00000321617:E351K	E	+	1	0	ANKZF1	219807101	1.000000	0.71417	0.995000	0.50966	0.274000	0.26718	2.213000	0.42844	1.299000	0.44798	0.655000	0.94253	GAA	-	NULL		0.463	ANKZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKZF1	protein_coding	OTTHUMT00000335790.1	G	NM_018089	-		220098857	+1	no_errors	ENST00000323348	ensembl	human	known	74_37	missense	SNP	1.000	A
DCAF7	10238	genome.wustl.edu	37	17	61666657	61666664	+	3'UTR	DEL	TTACCAGA	TTACCAGA	-			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	TTACCAGA	TTACCAGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr17:61666657_61666664delTTACCAGA	ENST00000310827.4	+	0	1369_1376				DCAF7_ENST00000577702.1_3'UTR|DCAF7_ENST00000431926.1_Frame_Shift_Del_p.CYQK160fs|DCAF7_ENST00000415273.2_3'UTR	NM_005828.3	NP_005819.3	P61962	DCAF7_HUMAN	DDB1 and CUL4 associated factor 7						multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(6)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	18						GCACCCACTGTTACCAGAAGCTGCTCTA	0.534																																																	0								ENSG00000136485																																			DCAF7	SO:0001624	3_prime_UTR_variant	0				HGNC	U94747	CCDS74127.1	17q23.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000136485		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30915	protein-coding gene	gene with protein product	"""seven-WD-repeat protein of the AN11 family-1"", ""human anthocyanin"""	605973	"""WD repeat domain 68"""	WDR68		9192870, 20940704	Standard	NM_005828		Approved	HAN11, SWAN-1	uc002jbc.4	P61962		ENST00000310827.4:c.*130TTACCAGA>-	17.37:g.61666657_61666664delTTACCAGA		Somatic	NA	NA	NA		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4E039|D3DU14|O15491|Q9DAE4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_WD40_repeat_dom	p.C160fs	ENST00000310827.4	37	c.480_487		17																																																																																			-	NULL		0.534	DCAF7-201	KNOWN	basic|appris_principal	protein_coding	DCAF7	protein_coding		TTACCAGA	NM_005828			61666664	+1	no_errors	ENST00000431926	ensembl	human	known	74_37	frame_shift_del	DEL	0.998:0.970:0.969:0.992:0.999:1.000:1.000:1.000	-
PHF12	57649	genome.wustl.edu	37	17	27246285	27246285	+	Missense_Mutation	SNP	C	C	T	rs202119121		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr17:27246285C>T	ENST00000332830.4	-	6	1655	c.845G>A	c.(844-846)cGt>cAt	p.R282H	PHF12_ENST00000577226.1_Missense_Mutation_p.R282H|PHF12_ENST00000582655.1_5'UTR|PHF12_ENST00000268756.3_Missense_Mutation_p.R282H	NM_001033561.1	NP_001028733.1			PHD finger protein 12											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			AGGAGCCACACGGCAACTCCT	0.517																																																	0								ENSG00000109118						59.0	50.0	53.0					17																	27246285		2203	4300	6503	PHF12	SO:0001583	missense	0			-	HGNC	AB040956	CCDS11247.1, CCDS32598.1	17q11.2	2013-01-28			ENSG00000109118	ENSG00000109118		"""Zinc fingers, PHD-type"""	20816	protein-coding gene	gene with protein product						11390640	Standard	XM_005258015		Approved	PF1, KIAA1523	uc002hdg.1	Q96QT6	OTTHUMG00000132676	ENST00000332830.4:c.845G>A	17.37:g.27246285C>T	ENSP00000329933:p.Arg282His	Somatic	0	60	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,superfamily_SMAD_FHA_domain,smart_Znf_PHD,pfscan_FHA_dom,pfscan_Znf_PHD-finger	p.R282H	ENST00000332830.4	37	c.845	CCDS32598.1	17	.	.	.	.	.	.	.	.	.	.	C	35	5.504816	0.96371	.	.	ENSG00000109118	ENST00000332830;ENST00000378879;ENST00000268756	T;T;T	0.32753	1.44;1.44;1.44	5.65	5.65	0.86999	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.51329	0.1668	L	0.46885	1.475	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.997;0.999;0.998;0.998	T	0.48980	-0.8986	10	0.72032	D	0.01	-16.4675	18.302	0.90167	0.0:1.0:0.0:0.0	.	264;282;282;282;282	B4DFE2;Q96QT6-2;Q2TAK2;C9J9G2;Q96QT6	.;.;.;.;PHF12_HUMAN	H	282	ENSP00000329933:R282H;ENSP00000368157:R282H;ENSP00000268756:R282H	ENSP00000268756:R282H	R	-	2	0	PHF12	24270411	1.000000	0.71417	0.983000	0.44433	0.964000	0.63967	7.772000	0.85439	2.679000	0.91253	0.555000	0.69702	CGT	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger		0.517	PHF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF12	protein_coding	OTTHUMT00000255941.1	C	NM_020889	rs202119121		27246285	-1	no_errors	ENST00000332830	ensembl	human	known	74_37	missense	SNP	0.999	T
FADS1	3992	genome.wustl.edu	37	11	61569925	61569925	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr11:61569925C>G	ENST00000350997.7	-	12	1696	c.1464G>C	c.(1462-1464)aaG>aaC	p.K488N	FADS1_ENST00000542506.1_Missense_Mutation_p.K347N|FADS1_ENST00000460649.1_Missense_Mutation_p.K133N|FADS1_ENST00000536991.1_Missense_Mutation_p.K179N|FADS2_ENST00000574708.1_Intron|FADS1_ENST00000433932.1_Missense_Mutation_p.K347N	NM_013402.4	NP_037534.3	O60427	FADS1_HUMAN	fatty acid desaturase 1	431					alpha-linolenic acid metabolic process (GO:0036109)|cell-cell signaling (GO:0007267)|cellular lipid metabolic process (GO:0044255)|cellular response to starvation (GO:0009267)|icosanoid biosynthetic process (GO:0046456)|linoleic acid metabolic process (GO:0043651)|phospholipid biosynthetic process (GO:0008654)|regulation of cell differentiation (GO:0045595)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	C-5 sterol desaturase activity (GO:0000248)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(1)|lung(1)|urinary_tract(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GCCCTGACTCCTTTAGTGAGC	0.542																																																	0								ENSG00000149485						33.0	34.0	33.0					11																	61569925		2056	4212	6268	FADS1	SO:0001583	missense	0			-	HGNC		CCDS8011.2	11q12-q13.1	2013-01-25			ENSG00000149485	ENSG00000149485	1.14.19.3	"""Fatty acid desaturases"""	3574	protein-coding gene	gene with protein product	"""delta-5 desaturase"""	606148		LLCDL1			Standard	NM_013402		Approved	D5D, FADSD5, TU12, FADS6	uc010rlm.2	O60427	OTTHUMG00000157155	ENST00000350997.7:c.1464G>C	11.37:g.61569925C>G	ENSP00000322229:p.Lys488Asn	Somatic	0	157	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	66	118	35.87	A8K0I7|B2RAI0|Q53GM5|Q8N3A6|Q8NCC7|Q8NCG0|Q96I39|Q96SV3|Q96T10|Q9NRP8|Q9NYX1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fatty_acid_desaturase-1,pfam_Cyt_B5-like_heme/steroid-bd,superfamily_Cyt_B5-like_heme/steroid-bd,pirsf_Fatty_acid/sphinglp_desaturase,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Cyt_B5-like_heme/steroid-bd	p.K488N	ENST00000350997.7	37	c.1464	CCDS8011.2	11	.	.	.	.	.	.	.	.	.	.	C	19.35	3.811074	0.70797	.	.	ENSG00000149485	ENST00000543488;ENST00000350997;ENST00000412725;ENST00000536991;ENST00000433932;ENST00000460649;ENST00000542506	T;T;T;T	0.60672	0.17;0.78;1.79;1.79	5.21	3.33	0.38152	.	0.000000	0.50627	U	0.000111	T	0.69575	0.3126	L	0.55990	1.75	0.45852	D	0.998716	D	0.89917	1.0	D	0.85130	0.997	T	0.70952	-0.4732	10	0.87932	D	0	-11.0637	12.061	0.53562	0.0:0.8562:0.0:0.1438	.	431	O60427	FADS1_HUMAN	N	363;488;347;179;347;133;347	ENSP00000322229:K488N;ENSP00000439097:K179N;ENSP00000405087:K347N;ENSP00000441403:K347N	ENSP00000322229:K488N	K	-	3	2	FADS1	61326501	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	1.254000	0.32897	0.712000	0.32039	-0.137000	0.14449	AAG	-	pirsf_Fatty_acid/sphinglp_desaturase		0.542	FADS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FADS1	protein_coding	OTTHUMT00000347648.2	C	NM_013402	-		61569925	-1	no_errors	ENST00000350997	ensembl	human	known	74_37	missense	SNP	1.000	G
CRHR2	1395	genome.wustl.edu	37	7	30721808	30721808	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr7:30721808G>T	ENST00000471646.1	-	1	506	c.89C>A	c.(88-90)cCc>cAc	p.P30H	CRHR2_ENST00000506074.2_Missense_Mutation_p.P30H|CRHR2_ENST00000348438.4_Intron|CRHR2_ENST00000341843.4_Intron	NM_001202482.1|NM_001202483.1|NM_001883.4	NP_001189411.1|NP_001189412.1|NP_001874.2	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	30					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GGGGTCCAGGGGTGGCCCCCA	0.741																																																	0								ENSG00000106113						8.0	11.0	10.0					7																	30721808		2180	4266	6446	CRHR2	SO:0001583	missense	0			-	HGNC		CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000471646.1:c.89C>A	7.37:g.30721808G>T	ENSP00000418722:p.Pro30His	Somatic	0	37	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	28	48.15	B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_CRF_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CRF2_rcpt,prints_GPCR_2_diuretic_rcpt	p.P30H	ENST00000471646.1	37	c.89	CCDS5429.1	7	.	.	.	.	.	.	.	.	.	.	G	11.40	1.628719	0.28978	.	.	ENSG00000106113	ENST00000471646;ENST00000506074	T;T	0.42513	0.97;1.06	4.45	2.65	0.31530	GPCR, family 2, extracellular hormone receptor domain (1);	.	.	.	.	T	0.19525	0.0469	N	0.08118	0	0.09310	N	1	B;P;B	0.34815	0.196;0.47;0.196	B;B;B	0.28784	0.039;0.094;0.039	T	0.09122	-1.0689	9	0.42905	T	0.14	.	6.8834	0.24187	0.2093:0.0:0.7907:0.0	.	30;30;30	B3SXT0;B3SXS6;Q13324	.;.;CRFR2_HUMAN	H	30	ENSP00000418722:P30H;ENSP00000426498:P30H	ENSP00000418722:P30H	P	-	2	0	CRHR2	30688333	0.029000	0.19370	0.065000	0.19835	0.876000	0.50452	1.499000	0.35671	0.635000	0.30488	0.563000	0.77884	CCC	-	pfscan_GPCR_2_extracellular_dom,prints_GPCR_2_CRF2_rcpt		0.741	CRHR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CRHR2	protein_coding	OTTHUMT00000250448.3	G		-		30721808	-1	no_errors	ENST00000471646	ensembl	human	known	74_37	missense	SNP	0.128	T
ACTRT3	84517	genome.wustl.edu	37	3	169482775	169482775	+	IGR	SNP	G	G	A	rs199422264		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr3:169482775G>A	ENST00000330368.2	-	0	2005				TERC_ENST00000602385.1_lincRNA	NM_032487.4	NP_115876.3	Q9BYD9	ACTT3_HUMAN	actin-related protein T3							cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)											CAAAAGCACGGCGCCTACGCC	0.607																																																	0								ENSG00000270141						30.0	33.0	32.0					3																	169482775		876	1991	2867	TERC	SO:0001628	intergenic_variant	0			-	HGNC	AK055346	CCDS3206.1	3q26.2	2012-04-10			ENSG00000184378	ENSG00000184378			24022	protein-coding gene	gene with protein product	"""actin related protein M1"""	608534				11750065, 18692047	Standard	NM_032487		Approved	ARPM1	uc003ffs.2	Q9BYD9			3.37:g.169482775G>A		Somatic	0	222	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	64	234	21.40	Q96IS0|Q96NJ0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000330368.2	37	NULL	CCDS3206.1	3																																																																																			-	-		0.607	ACTRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TERC	protein_coding	OTTHUMT00000467797.1	G	NM_032487	-		169482775	-1	no_errors	ENST00000363312	ensembl	human	known	74_37	rna	SNP	0.027	A
CADPS2	93664	genome.wustl.edu	37	7	122526253	122526253	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr7:122526253G>T	ENST00000449022.2	-	1	158	c.139C>A	c.(139-141)Cgc>Agc	p.R47S	CADPS2_ENST00000412584.2_Missense_Mutation_p.R47S|CADPS2_ENST00000334010.7_Missense_Mutation_p.R47S|CADPS2_ENST00000313070.7_Missense_Mutation_p.R47S	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	47				APGR -> GRG (in Ref. 2; AAN38707). {ECO:0000305}.	cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						ccgcccgcgcgccccggcgcg	0.751																																																	0								ENSG00000081803						2.0	3.0	3.0					7																	122526253		1020	2374	3394	CADPS2	SO:0001583	missense	0			-	HGNC		CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.139C>A	7.37:g.122526253G>T	ENSP00000398481:p.Arg47Ser	Somatic	0	33	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	17	40.00	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ca-dep_secretion_activator,pfam_Pleckstrin_homology,superfamily_C2_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R47S	ENST00000449022.2	37	c.139	CCDS55158.1	7	.	.	.	.	.	.	.	.	.	.	G	10.31	1.314229	0.23908	.	.	ENSG00000081803	ENST00000313070;ENST00000334010;ENST00000420900;ENST00000412584;ENST00000449022	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	4.09	4.09	0.47781	.	0.682414	0.13327	N	0.396231	T	0.13798	0.0334	N	0.01874	-0.695	0.34396	D	0.694766	B;B	0.31625	0.081;0.332	B;B	0.26693	0.072;0.049	T	0.21075	-1.0256	10	0.02654	T	1	-5.4813	9.1409	0.36903	0.0:0.0:0.7823:0.2177	.	47;47	Q86UW7-2;Q86UW7	.;CAPS2_HUMAN	S	47	ENSP00000325581:R47S;ENSP00000333940:R47S;ENSP00000400401:R47S;ENSP00000398481:R47S	ENSP00000325581:R47S	R	-	1	0	CADPS2	122313489	1.000000	0.71417	0.976000	0.42696	0.673000	0.39480	1.841000	0.39240	2.080000	0.62538	0.557000	0.71058	CGC	-	NULL		0.751	CADPS2-001	KNOWN	basic|CCDS	protein_coding	CADPS2	protein_coding	OTTHUMT00000347414.2	G	NM_017954	-		122526253	-1	no_errors	ENST00000449022	ensembl	human	known	74_37	missense	SNP	1.000	T
ING4	51147	genome.wustl.edu	37	12	6760372	6760372	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:6760372T>A	ENST00000396807.4	-	8	777	c.739A>T	c.(739-741)Aag>Tag	p.K247*	ING4_ENST00000423703.2_3'UTR|ING4_ENST00000412586.2_Nonsense_Mutation_p.K244*|ING4_ENST00000446105.2_Nonsense_Mutation_p.K243*|ING4_ENST00000444704.2_Nonsense_Mutation_p.K223*|ING4_ENST00000486287.1_5'UTR|ING4_ENST00000341550.4_Nonsense_Mutation_p.K246*	NM_001127582.1|NM_001127585.1|NM_001127586.1|NM_016162.3	NP_001121054.1|NP_001121057.1|NP_001121058.1|NP_057246.2	Q9UNL4	ING4_HUMAN	inhibitor of growth family, member 4	247					apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|protein acetylation (GO:0006473)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(3)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	10						TATTTCTTCTTCCGTTCTTGG	0.527																																																	0								ENSG00000111653						98.0	89.0	92.0					12																	6760372		2203	4300	6503	ING4	SO:0001587	stop_gained	0			-	HGNC	AF063594	CCDS8555.1, CCDS44812.1, CCDS44813.1, CCDS44814.1, CCDS44815.1, CCDS44816.1	12p13.32	2013-01-28			ENSG00000111653	ENSG00000111653		"""Zinc fingers, PHD-type"""	19423	protein-coding gene	gene with protein product		608524				12750254	Standard	NM_001127582		Approved	p29ING4, my036	uc001qpw.4	Q9UNL4	OTTHUMG00000141274	ENST00000396807.4:c.739A>T	12.37:g.6760372T>A	ENSP00000380024:p.Lys247*	Somatic	0	227	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	98	191	33.91	A4KYM4|A4KYM6|D3DUR8|Q0EF62|Q0EF63|Q4VBQ6|Q96E15|Q9H3J0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.K247*	ENST00000396807.4	37	c.739	CCDS44813.1	12	.	.	.	.	.	.	.	.	.	.	T	19.21	3.783834	0.70222	.	.	ENSG00000111653	ENST00000341550;ENST00000396807;ENST00000446105;ENST00000444704;ENST00000412586	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.39297	D	0.964849	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.006	13.5557	0.61757	0.0:0.0:0.0:1.0	.	.	.	.	X	246;247;243;223;244	.	ENSP00000343396:K246X	K	-	1	0	ING4	6630633	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.625000	0.74248	2.068000	0.61886	0.459000	0.35465	AAG	-	superfamily_Znf_FYVE_PHD		0.527	ING4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ING4	protein_coding	OTTHUMT00000280467.2	T	NM_198287	-		6760372	-1	no_errors	ENST00000396807	ensembl	human	known	74_37	nonsense	SNP	1.000	A
HELB	92797	genome.wustl.edu	37	12	66725161	66725161	+	Silent	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:66725161G>T	ENST00000247815.4	+	12	2957	c.2898G>T	c.(2896-2898)ccG>ccT	p.P966P		NM_033647.3	NP_387467.2	Q8NG08	HELB_HUMAN	helicase (DNA) B	966			P -> L (in dbSNP:rs1185244). {ECO:0000269|PubMed:14702039}.		DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication, synthesis of RNA primer (GO:0006269)		ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|single-stranded DNA-dependent ATP-dependent DNA helicase activity (GO:0017116)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	40			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		CAGATTTTCCGTCCCCACGGA	0.498																																																	0								ENSG00000127311						68.0	61.0	63.0					12																	66725161		2203	4300	6503	HELB	SO:0001819	synonymous_variant	0			-	HGNC	AF319995	CCDS8976.1	12q14.2	2009-01-15			ENSG00000127311	ENSG00000127311			17196	protein-coding gene	gene with protein product		614539				12181327	Standard	NM_033647		Approved		uc001sti.3	Q8NG08	OTTHUMG00000169006	ENST00000247815.4:c.2898G>T	12.37:g.66725161G>T		Somatic	0	52	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	32	17.95	A8K4C9|Q4G0T2|Q9H7L5	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase	p.P966	ENST00000247815.4	37	c.2898	CCDS8976.1	12																																																																																			-	NULL		0.498	HELB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HELB	protein_coding	OTTHUMT00000401919.1	G		-		66725161	+1	no_errors	ENST00000247815	ensembl	human	known	74_37	silent	SNP	0.000	T
SOX3	6658	genome.wustl.edu	37	X	139586329	139586329	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chrX:139586329C>T	ENST00000370536.2	-	1	896	c.897G>A	c.(895-897)atG>atA	p.M299I		NM_005634.2	NP_005625.2	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	299				Missing (in Ref. 2; CAA50465). {ECO:0000305}.	central nervous system development (GO:0007417)|face development (GO:0060324)|hypothalamus development (GO:0021854)|negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|sensory organ development (GO:0007423)|Sertoli cell development (GO:0060009)|sex determination (GO:0007530)|spermatid differentiation (GO:0048515)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	10	Acute lymphoblastic leukemia(192;7.65e-05)					CGTAGCGGTGCATcggcggca	0.741																																																	0								ENSG00000134595						2.0	3.0	2.0					X																	139586329		1469	3005	4474	SOX3	SO:0001583	missense	0			-	HGNC		CCDS14669.1	Xq27.1	2013-10-17			ENSG00000134595	ENSG00000134595		"""SRY (sex determining region Y)-boxes"""	11199	protein-coding gene	gene with protein product		313430	"""panhypopituitarism"""	PHP		15800844	Standard	NM_005634		Approved		uc004fbd.1	P41225	OTTHUMG00000022544	ENST00000370536.2:c.897G>A	X.37:g.139586329C>T	ENSP00000359567:p.Met299Ile	Somatic	0	10	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	7	41.67	P35714|Q5JWI3|Q9NP49	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,pfam_TF_SOX,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.M299I	ENST00000370536.2	37	c.897	CCDS14669.1	X	.	.	.	.	.	.	.	.	.	.	c	12.74	2.029407	0.35797	.	.	ENSG00000134595	ENST00000370536	D	0.98120	-4.73	3.34	3.34	0.38264	.	0.098210	0.64402	U	0.000002	D	0.96046	0.8712	M	0.64404	1.975	0.50813	D	0.999896	B	0.28400	0.21	B	0.31869	0.137	D	0.94786	0.7958	9	.	.	.	.	13.2044	0.59787	0.0:1.0:0.0:0.0	.	299	P41225	SOX3_HUMAN	I	299	ENSP00000359567:M299I	.	M	-	3	0	SOX3	139413995	1.000000	0.71417	1.000000	0.80357	0.394000	0.30568	6.773000	0.75006	1.515000	0.48885	0.173000	0.16961	ATG	-	NULL		0.741	SOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX3	protein_coding	OTTHUMT00000058577.1	C		-		139586329	-1	no_errors	ENST00000370536	ensembl	human	known	74_37	missense	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179442717	179442717	+	Missense_Mutation	SNP	A	A	G	rs368301580		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr2:179442717A>G	ENST00000591111.1	-	272	63826	c.63602T>C	c.(63601-63603)aTt>aCt	p.I21201T	TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.I13902T|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.I13969T|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.I22842T|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.I20274T|RP11-171I2.5_ENST00000604215.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.I13777T|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21201					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGACTTACCAATTGGGTCCAG	0.408																																																	0								ENSG00000155657	A	THR/ILE,THR/ILE,THR/ILE,THR/ILE	0,3766		0,0,1883	70.0	66.0	67.0		41330,60821,41705,41906	5.7	1.0	2		67	1,8217		0,1,4108	no	missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	89,89,89,89	0,1,5991	GG,GA,AA		0.0122,0.0,0.0083	probably-damaging,probably-damaging,probably-damaging,probably-damaging	13777/26927,20274/33424,13902/27052,13969/27119	179442717	1,11983	1883	4109	5992	TTN	SO:0001583	missense	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.63602T>C	2.37:g.179442717A>G	ENSP00000465570:p.Ile21201Thr	Somatic	0	128	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	112	32.12	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.I20274T	ENST00000591111.1	37	c.60821		2	.	.	.	.	.	.	.	.	.	.	A	11.30	1.597209	0.28445	0.0	1.22E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.62498	0.02;0.28;0.24;0.25	5.68	5.68	0.88126	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77961	0.4209	M	0.65975	2.015	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.87578	0.991;0.998;0.998;0.991	T	0.80398	-0.1399	9	0.87932	D	0	.	15.9184	0.79542	1.0:0.0:0.0:0.0	.	13777;13902;13969;21201	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	20274;13777;13969;13902;13775	ENSP00000343764:I20274T;ENSP00000434586:I13777T;ENSP00000340554:I13969T;ENSP00000352154:I13902T	ENSP00000340554:I13969T	I	-	2	0	TTN	179150963	1.000000	0.71417	1.000000	0.80357	0.625000	0.37756	9.339000	0.96797	2.175000	0.68902	0.528000	0.53228	ATT	-	superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	A	NM_133378	-		179442717	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	SNP	1.000	G
SLC35F4	341880	genome.wustl.edu	37	14	58063546	58063546	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr14:58063546G>A	ENST00000339762.6	-	1	69	c.70C>T	c.(70-72)Ctt>Ttt	p.L24F	SLC35F4_ENST00000556826.1_Intron|SLC35F4_ENST00000557430.1_Intron|SLC35F4_ENST00000554729.1_5'UTR			A4IF30	S35F4_HUMAN	solute carrier family 35, member F4	24					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|large_intestine(3)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ATACCGCAAAGCCCATTGCCT	0.418																																																	0								ENSG00000151812						78.0	79.0	79.0					14																	58063546		2012	4190	6202	SLC35F4	SO:0001583	missense	0			-	HGNC			14q22.3	2013-05-22		2003-11-28	ENSG00000151812	ENSG00000151812		"""Solute carriers"""	19845	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 36"""	C14orf36			Standard	NM_001206920		Approved	FLJ37712	uc021rtp.1	A4IF30	OTTHUMG00000171317	ENST00000339762.6:c.70C>T	14.37:g.58063546G>A	ENSP00000342518:p.Leu24Phe	Somatic	0	99	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	82	31.67	A6NDQ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DMT,pfam_SLC35_F1/F2/F6	p.L24F	ENST00000339762.6	37	c.70		14	.	.	.	.	.	.	.	.	.	.	G	9.844	1.191738	0.21954	.	.	ENSG00000151812	ENST00000339762	T	0.53640	0.61	4.01	0.683	0.17998	.	.	.	.	.	T	0.30792	0.0776	.	.	.	0.09310	N	1	B	0.16802	0.019	B	0.11329	0.006	T	0.29488	-1.0010	8	0.59425	D	0.04	.	1.6694	0.02808	0.1394:0.189:0.4771:0.1944	.	24	A4IF30	S35F4_HUMAN	F	24	ENSP00000342518:L24F	ENSP00000342518:L24F	L	-	1	0	SLC35F4	57133299	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-1.280000	0.02804	0.113000	0.18004	0.557000	0.71058	CTT	-	NULL		0.418	SLC35F4-201	KNOWN	basic	protein_coding	SLC35F4	protein_coding		G	XM_292260	-		58063546	-1	no_errors	ENST00000339762	ensembl	human	known	74_37	missense	SNP	0.000	A
SLC22A10	387775	genome.wustl.edu	37	11	63064875	63064875	+	Missense_Mutation	SNP	C	C	T	rs200183991		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr11:63064875C>T	ENST00000332793.6	+	3	609	c.607C>T	c.(607-609)Cgc>Tgc	p.R203C	SLC22A10_ENST00000544661.1_Missense_Mutation_p.R48C|SLC22A10_ENST00000526800.1_Intron|SLC22A10_ENST00000535888.1_5'UTR|SLC22A10_ENST00000525620.1_3'UTR	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	203						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	CTGTGTACTACGCTTCTTGGC	0.408																																																	0								ENSG00000184999	C	CYS/ARG	2,4092		0,2,2045	170.0	169.0	169.0		607	2.3	0.3	11		169	0,8428		0,0,4214	yes	missense	SLC22A10	NM_001039752.3	180	0,2,6259	TT,TC,CC		0.0,0.0489,0.016	probably-damaging	203/542	63064875	2,12520	2047	4214	6261	SLC22A10	SO:0001583	missense	0			-	HGNC	AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.607C>T	11.37:g.63064875C>T	ENSP00000327569:p.Arg203Cys	Somatic	0	122	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	65	54	54.62	Q68CJ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.R203C	ENST00000332793.6	37	c.607	CCDS41661.1	11	.	.	.	.	.	.	.	.	.	.	C	17.11	3.306314	0.60305	4.89E-4	0.0	ENSG00000184999	ENST00000544661;ENST00000332793	D;D	0.90261	-2.64;-2.64	3.26	2.34	0.29019	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.066213	0.64402	N	0.000009	D	0.93341	0.7877	M	0.92077	3.27	0.80722	D	1	P	0.50819	0.939	P	0.50352	0.638	D	0.92539	0.6040	10	0.72032	D	0.01	.	8.4548	0.32893	0.0:0.8776:0.0:0.1224	.	203	Q63ZE4	S22AA_HUMAN	C	48;203	ENSP00000445667:R48C;ENSP00000327569:R203C	ENSP00000327569:R203C	R	+	1	0	SLC22A10	62821451	0.772000	0.28567	0.265000	0.24526	0.132000	0.20833	1.238000	0.32707	0.751000	0.32900	0.447000	0.29281	CGC	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.408	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A10	protein_coding	OTTHUMT00000382622.3	C	NM_001039752	rs200183991		63064875	+1	no_errors	ENST00000332793	ensembl	human	known	74_37	missense	SNP	0.874	T
TNR	7143	genome.wustl.edu	37	1	175372358	175372358	+	Silent	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:175372358C>T	ENST00000367674.2	-	4	1602	c.894G>A	c.(892-894)ctG>ctA	p.L298L	TNR_ENST00000263525.2_Silent_p.L298L			Q92752	TENR_HUMAN	tenascin R	298	Cys-rich.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					TGCAGGCATTCAGACACTGCC	0.627																																																	0								ENSG00000116147						107.0	78.0	88.0					1																	175372358		2203	4300	6503	TNR	SO:0001819	synonymous_variant	0			-	HGNC	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.894G>A	1.37:g.175372358C>T		Somatic	0	58	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	83	62	57.24	C9J563|Q15568|Q5R3G0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.L298	ENST00000367674.2	37	c.894	CCDS1318.1	1																																																																																			-	pfam_EGF_extracell,smart_EG-like_dom		0.627	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	protein_coding	OTTHUMT00000084414.4	C	NM_003285	-		175372358	-1	no_errors	ENST00000263525	ensembl	human	known	74_37	silent	SNP	1.000	T
CCDC141	285025	genome.wustl.edu	37	2	179733848	179733848	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr2:179733848T>C	ENST00000420890.2	-	15	2507	c.2390A>G	c.(2389-2391)gAa>gGa	p.E797G	CCDC141_ENST00000295723.5_Missense_Mutation_p.E222G	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	797										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			CCTTACCTCTTCCTTGACTTG	0.353																																																	0								ENSG00000163492						171.0	155.0	161.0					2																	179733848		2203	4300	6503	CCDC141	SO:0001583	missense	0			-	HGNC	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.2390A>G	2.37:g.179733848T>C	ENSP00000395995:p.Glu797Gly	Somatic	0	167	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	195	17.37	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Spectrin_repeat,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.E797G	ENST00000420890.2	37	c.2390		2	.	.	.	.	.	.	.	.	.	.	T	21.2	4.111778	0.77210	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723;ENST00000443758	T;T;T;T	0.51817	0.69;1.3;1.29;1.31	5.49	5.49	0.81192	.	0.098719	0.44285	D	0.000463	T	0.53498	0.1800	L	0.29908	0.895	0.80722	D	1	D	0.63046	0.992	P	0.62560	0.904	T	0.55490	-0.8133	10	0.54805	T	0.06	-8.4263	13.3938	0.60838	0.0:0.0:0.0:1.0	.	222	Q6ZP82	CC141_HUMAN	G	797;241;222;797	ENSP00000395995:E797G;ENSP00000344627:E241G;ENSP00000295723:E222G;ENSP00000390190:E797G	ENSP00000295723:E222G	E	-	2	0	CCDC141	179442093	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	4.639000	0.61361	2.194000	0.70268	0.533000	0.62120	GAA	-	NULL		0.353	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	CCDC141	protein_coding		T	NM_173648	-		179733848	-1	no_errors	ENST00000420890	ensembl	human	known	74_37	missense	SNP	1.000	C
KIAA1217	56243	genome.wustl.edu	37	10	24834028	24834028	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr10:24834028G>A	ENST00000376454.3	+	20	5360	c.5330G>A	c.(5329-5331)cGt>cAt	p.R1777H	KIAA1217_ENST00000307544.6_Missense_Mutation_p.R927H|KIAA1217_ENST00000396445.1_Missense_Mutation_p.R901H|KIAA1217_ENST00000376451.2_Missense_Mutation_p.R1460H|KIAA1217_ENST00000396446.1_Missense_Mutation_p.R861H|KIAA1217_ENST00000458595.1_Missense_Mutation_p.R1183H|KIAA1217_ENST00000376452.3_Missense_Mutation_p.R1208H|KIAA1217_ENST00000376462.1_Missense_Mutation_p.R1098H	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1777					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						CGCCAATATCGTCAGGTAGTT	0.473																																																	0								ENSG00000120549						60.0	65.0	63.0					10																	24834028		2203	4300	6503	KIAA1217	SO:0001583	missense	0			-	HGNC	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.5330G>A	10.37:g.24834028G>A	ENSP00000365637:p.Arg1777His	Somatic	0	70	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	57	16.18	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AIP3_C	p.R1777H	ENST00000376454.3	37	c.5330	CCDS31165.1	10	.	.	.	.	.	.	.	.	.	.	G	29.8	5.040141	0.93630	.	.	ENSG00000120549	ENST00000376462;ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451;ENST00000396446	T;T;T;T;T;T;T;T	0.64618	1.14;0.86;0.61;0.97;-0.11;-0.02;0.31;0.57	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.79885	0.4523	M	0.70275	2.135	0.39623	D	0.970059	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;P;D;D;D;D	0.91635	0.999;0.996;0.999;0.904;0.999;0.999;0.999;0.999	T	0.80311	-0.1436	10	0.54805	T	0.06	.	19.9915	0.97366	0.0:0.0:1.0:0.0	.	1183;1208;861;901;1460;927;1777;1178	Q5T5P2-7;A6NLF3;Q5T5P2-4;Q5T5P2-8;Q5T5P2-3;Q5T5P2-6;Q5T5P2;Q5T5P2-2	.;.;.;.;.;.;SKT_HUMAN;.	H	1098;1183;1460;1777;1208;927;1366;901;1460;861	ENSP00000365645:R1098H;ENSP00000392625:R1183H;ENSP00000365637:R1777H;ENSP00000365635:R1208H;ENSP00000302343:R927H;ENSP00000379722:R901H;ENSP00000365634:R1460H;ENSP00000379723:R861H	ENSP00000302343:R927H	R	+	2	0	KIAA1217	24874034	1.000000	0.71417	0.990000	0.47175	0.968000	0.65278	9.443000	0.97568	2.723000	0.93209	0.655000	0.94253	CGT	-	NULL		0.473	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1217	protein_coding	OTTHUMT00000047223.2	G	NM_019590	-		24834028	+1	no_errors	ENST00000376454	ensembl	human	known	74_37	missense	SNP	1.000	A
ABCA3	21	genome.wustl.edu	37	16	2338234	2338234	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr16:2338234G>T	ENST00000301732.5	-	21	3497	c.2797C>A	c.(2797-2799)Cct>Act	p.P933T	ABCA3_ENST00000382381.3_Missense_Mutation_p.P875T	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	933					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	CAGGTCAGAGGCACCAGGACC	0.627																																																	0								ENSG00000167972						51.0	42.0	45.0					16																	2338234		2196	4298	6494	ABCA3	SO:0001583	missense	0			-	HGNC	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.2797C>A	16.37:g.2338234G>T	ENSP00000301732:p.Pro933Thr	Somatic	0	96	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	84	23.64	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.P933T	ENST00000301732.5	37	c.2797	CCDS10466.1	16	.	.	.	.	.	.	.	.	.	.	G	15.60	2.882623	0.51908	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.93426	-3.22	5.54	4.59	0.56863	.	0.000000	0.85682	D	0.000000	D	0.96488	0.8854	M	0.85710	2.77	0.80722	D	1	B;D	0.76494	0.417;0.999	P;D	0.76575	0.472;0.988	D	0.96176	0.9127	10	0.44086	T	0.13	.	12.9976	0.58657	0.0775:0.0:0.9225:0.0	.	937;933	Q4LE27;Q99758	.;ABCA3_HUMAN	T	933;937	ENSP00000301732:P933T	ENSP00000301732:P933T	P	-	1	0	ABCA3	2278235	1.000000	0.71417	0.245000	0.24217	0.277000	0.26821	9.331000	0.96430	1.570000	0.49709	0.655000	0.94253	CCT	-	NULL		0.627	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	protein_coding	OTTHUMT00000250784.2	G	NM_001089	-		2338234	-1	no_errors	ENST00000301732	ensembl	human	known	74_37	missense	SNP	1.000	T
ATXN7	6314	genome.wustl.edu	37	3	63981233	63981233	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr3:63981233C>T	ENST00000295900.6	+	12	2285	c.1735C>T	c.(1735-1737)Cac>Tac	p.H579Y	ATXN7_ENST00000487717.1_Missense_Mutation_p.H579Y|ATXN7_ENST00000398590.3_Missense_Mutation_p.H579Y|ATXN7_ENST00000538065.1_Missense_Mutation_p.H579Y|ATXN7_ENST00000484332.1_Missense_Mutation_p.H434Y	NM_000333.3	NP_000324.1	O15265	ATX7_HUMAN	ataxin 7	579					cell death (GO:0008219)|chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|nucleus organization (GO:0006997)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|stomach(1)|urinary_tract(3)	35		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		ACGTATTCCTCACCGGACAAA	0.517																																																	0								ENSG00000163635						91.0	96.0	94.0					3																	63981233		2192	4296	6488	ATXN7	SO:0001583	missense	0			-	HGNC	AJ000517	CCDS43102.1, CCDS46861.1, CCDS46861.2, CCDS54603.1	3p21.1-p12	2014-09-17	2004-08-12	2004-08-12	ENSG00000163635	ENSG00000163635		"""Ataxins"""	10560	protein-coding gene	gene with protein product		607640	"""spinocerebellar ataxia 7 (olivopontocerebellar atrophy with retinal degeneration)"""	SCA7		7647798, 10598805	Standard	NM_000333		Approved	OPCA3, ADCAII	uc021wzy.1	O15265	OTTHUMG00000158763	ENST00000295900.6:c.1735C>T	3.37:g.63981233C>T	ENSP00000295900:p.His579Tyr	Somatic	0	63	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	50	41.86	B4E207|E9PHP9|O75328|O75329|Q9Y6P8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SCA7_dom	p.H579Y	ENST00000295900.6	37	c.1735	CCDS43102.1	3	.	.	.	.	.	.	.	.	.	.	C	17.81	3.481920	0.63849	.	.	ENSG00000163635	ENST00000398590;ENST00000295900;ENST00000487717;ENST00000538065;ENST00000484332	T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94	5.2	5.2	0.72013	.	0.050736	0.85682	D	0.000000	T	0.55049	0.1896	L	0.53249	1.67	0.80722	D	1	B;D;D	0.65815	0.31;0.995;0.976	B;P;P	0.55161	0.133;0.77;0.454	T	0.55891	-0.8069	10	0.51188	T	0.08	-4.1977	18.7972	0.91999	0.0:1.0:0.0:0.0	.	434;579;579	E9PHP9;O15265-2;O15265	.;.;ATX7_HUMAN	Y	579;579;579;579;434	ENSP00000381590:H579Y;ENSP00000295900:H579Y;ENSP00000420234:H579Y;ENSP00000439585:H579Y;ENSP00000428277:H434Y	ENSP00000295900:H579Y	H	+	1	0	ATXN7	63956273	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	7.192000	0.77771	2.442000	0.82660	0.558000	0.71614	CAC	-	NULL		0.517	ATXN7-001	KNOWN	basic|CCDS	protein_coding	ATXN7	protein_coding	OTTHUMT00000352070.1	C	NM_000333	-		63981233	+1	no_errors	ENST00000398590	ensembl	human	known	74_37	missense	SNP	1.000	T
TMC2	117532	genome.wustl.edu	37	20	2591222	2591222	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr20:2591222T>G	ENST00000358864.1	+	12	1586	c.1571T>G	c.(1570-1572)cTg>cGg	p.L524R	TMC2_ENST00000496948.1_3'UTR	NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	524					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						CTCTTGGCCCTGATGGATGAC	0.488																																																	0								ENSG00000149488						98.0	80.0	86.0					20																	2591222		2203	4300	6503	TMC2	SO:0001583	missense	0			-	HGNC	AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.1571T>G	20.37:g.2591222T>G	ENSP00000351732:p.Leu524Arg	Somatic	0	133	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	158	14.44	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TMC	p.L524R	ENST00000358864.1	37	c.1571	CCDS13029.2	20	.	.	.	.	.	.	.	.	.	.	T	22.2	4.252978	0.80135	.	.	ENSG00000149488	ENST00000358864	T	0.78246	-1.16	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.89238	0.6658	M	0.88640	2.97	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.91635	0.98;0.999;0.994;0.989	D	0.91144	0.4948	10	0.87932	D	0	-10.8242	13.3454	0.60571	0.0:0.0:0.0:1.0	.	355;356;524;524	B4DFB3;B7ZAE6;Q8TDI7-3;Q8TDI7	.;.;.;TMC2_HUMAN	R	524	ENSP00000351732:L524R	ENSP00000351732:L524R	L	+	2	0	TMC2	2539222	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	7.977000	0.88081	2.103000	0.63969	0.528000	0.53228	CTG	-	NULL		0.488	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC2	protein_coding	OTTHUMT00000077601.2	T		-		2591222	+1	no_errors	ENST00000358864	ensembl	human	known	74_37	missense	SNP	1.000	G
CAPS2	84698	genome.wustl.edu	37	12	75678836	75678836	+	Silent	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:75678836G>A	ENST00000409445.3	-	16	1673	c.1477C>T	c.(1477-1479)Ctg>Ttg	p.L493L	CAPS2_ENST00000393284.3_Silent_p.L261L|CAPS2_ENST00000409004.1_5'UTR|CAPS2_ENST00000442339.2_Silent_p.L83L|CAPS2_ENST00000409799.1_Silent_p.L411L|RP11-560G2.1_ENST00000549953.1_RNA	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	493	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						TTGTCATTCAGAATTAGCCAT	0.333																																																	0								ENSG00000180881						132.0	120.0	124.0					12																	75678836		2202	4298	6500	CAPS2	SO:0001819	synonymous_variant	0			-	HGNC	AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.1477C>T	12.37:g.75678836G>A		Somatic	0	78	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	481	1793	21.15	Q6PH84|Q8N242|Q8NAY5	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_EF_hand_dom,pfscan_EF_hand_dom	p.L493	ENST00000409445.3	37	c.1477	CCDS9008.2	12																																																																																			-	smart_EF_hand_dom,pfscan_EF_hand_dom		0.333	CAPS2-001	KNOWN	basic|CCDS	protein_coding	CAPS2	protein_coding	OTTHUMT00000327880.2	G		-		75678836	-1	no_errors	ENST00000409445	ensembl	human	known	74_37	silent	SNP	0.948	A
CTBS	1486	genome.wustl.edu	37	1	85039999	85040007	+	In_Frame_Del	DEL	GCAGCGCCA	GCAGCGCCA	-	rs142534762|rs3217269|rs199701060|rs201060055	byFrequency	TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	GCAGCGCCA	GCAGCGCCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:85039999_85040007delGCAGCGCCA	ENST00000370630.5	-	1	140_148	c.92_100delTGGCGCTGC	c.(91-102)ctggcgctgcgg>cgg	p.LAL31del	CTBS_ENST00000477677.1_5'UTR	NM_004388.2	NP_004379.1	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl-	31					chitin catabolic process (GO:0006032)|oligosaccharide catabolic process (GO:0009313)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	chitinase activity (GO:0004568)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	9				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		GCCGCGAGCCgcagcgccagcagcgccag	0.718														1537	0.306909	0.5038	0.2954	5008	,	,		11352	0.0556		0.2624	False		,,,				2504	0.3538																0								ENSG00000117151			865,21,1798		349,2,165,3,13,810						-3.6	0.0		dbSNP_134	4	1279,4,4361		415,1,448,1,1,1956	no	codingComplex	CTBS	NM_004388.2		764,3,613,4,14,2766	A1A1,A1A2,A1R,A2A2,A2R,RR		22.7321,33.0104,26.0447				2144,25,6159				CTBS	SO:0001651	inframe_deletion	0				HGNC	M95767	CCDS698.1	1p22	2010-05-04			ENSG00000117151	ENSG00000117151	3.2.1.-		2496	protein-coding gene	gene with protein product		600873		CTB		1549114, 7606925	Standard	NM_004388		Approved		uc001dka.2	Q01459	OTTHUMG00000009922	ENST00000370630.5:c.92_100delTGGCGCTGC	1.37:g.85040008_85040016delGCAGCGCCA	ENSP00000359664:p.Leu31_Leu33del	Somatic	NA	NA	NA		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5VX50	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	p.LAL31in_frame_del	ENST00000370630.5	37	c.100_92	CCDS698.1	1																																																																																			-	NULL		0.718	CTBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTBS	protein_coding	OTTHUMT00000027457.2	GCAGCGCCA	NM_004388			85040007	-1	no_errors	ENST00000370630	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.011:0.000:0.000:0.002:0.000:0.000:0.649:0.644	-
PANK1	53354	genome.wustl.edu	37	10	91344218	91344218	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr10:91344218T>C	ENST00000307534.4	-	7	1897	c.1742A>G	c.(1741-1743)tAt>tGt	p.Y581C	PANK1_ENST00000342512.3_Missense_Mutation_p.Y356C|PANK1_ENST00000371774.2_Missense_Mutation_p.Y383C|PANK1_ENST00000322191.6_Missense_Mutation_p.Y297C	NM_148977.2	NP_683878.1	Q8TE04	PANK1_HUMAN	pantothenate kinase 1	581					coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell periphery (GO:0071944)|clathrin coat (GO:0030118)|cytosol (GO:0005829)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			cervix(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	11						GGCTCCAAAATAACCCTACGA	0.393																																																	0								ENSG00000152782						135.0	133.0	134.0					10																	91344218		2203	4300	6503	PANK1	SO:0001583	missense	0			-	HGNC	AF355198	CCDS7405.1, CCDS7406.1, CCDS31244.1	10q23.31	2008-05-14	2002-11-13	2002-11-15	ENSG00000152782	ENSG00000152782			8598	protein-coding gene	gene with protein product		606160	"""pantothenate kinase"""	PANK		11809413	Standard	NM_148977		Approved	MGC24596, PANK1a, PANK1b	uc001kgp.2	Q8TE04	OTTHUMG00000018718	ENST00000307534.4:c.1742A>G	10.37:g.91344218T>C	ENSP00000302108:p.Tyr581Cys	Somatic	0	127	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	95	11.21	A6NIP0|Q7RTX6|Q7Z495|Q8TBQ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Type_II_PanK,tigrfam_Type_II_PanK	p.Y581C	ENST00000307534.4	37	c.1742	CCDS31244.1	10	.	.	.	.	.	.	.	.	.	.	T	18.61	3.660135	0.67586	.	.	ENSG00000152782	ENST00000342512;ENST00000322191;ENST00000371774;ENST00000307534;ENST00000371775	D;D;D;D	0.99809	-6.86;-6.48;-6.86;-6.86	4.8	4.8	0.61643	.	0.123295	0.56097	D	0.000023	D	0.99816	0.9919	M	0.93678	3.445	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;1.0	D;D;D;D	0.97110	0.997;1.0;0.975;0.999	D	0.96792	0.9583	10	0.87932	D	0	-21.2291	13.9575	0.64160	0.0:0.0:0.0:1.0	.	383;581;297;356	Q8TE04-4;Q8TE04;Q8TE04-3;Q8TE04-2	.;PANK1_HUMAN;.;.	C	356;297;383;581;444	ENSP00000345118:Y356C;ENSP00000318526:Y297C;ENSP00000360839:Y383C;ENSP00000302108:Y581C	ENSP00000302108:Y581C	Y	-	2	0	PANK1	91334198	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.333000	0.79214	2.134000	0.65973	0.533000	0.62120	TAT	-	pfam_Type_II_PanK,tigrfam_Type_II_PanK		0.393	PANK1-201	KNOWN	basic|CCDS	protein_coding	PANK1	protein_coding		T		-		91344218	-1	no_errors	ENST00000307534	ensembl	human	known	74_37	missense	SNP	1.000	C
ANKRD18A	253650	genome.wustl.edu	37	9	38595594	38595594	+	Silent	SNP	A	A	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr9:38595594A>C	ENST00000399703.5	-	9	2117	c.1743T>G	c.(1741-1743)ctT>ctG	p.L581L		NM_147195.2	NP_671728.2	Q8IVF6	AN18A_HUMAN	ankyrin repeat domain 18A	581										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	16						TTCCATTCTCAAGACAGTCTC	0.318																																																	0								ENSG00000180071						38.0	30.0	33.0					9																	38595594		692	1590	2282	ANKRD18A	SO:0001819	synonymous_variant	0			-	HGNC	AB095935	CCDS55311.1	9p13.1	2013-01-10			ENSG00000180071	ENSG00000180071		"""Ankyrin repeat domain containing"""	23643	protein-coding gene	gene with protein product							Standard	NM_147195		Approved	KIAA2015, FLJ35740	uc004abg.4	Q8IVF6	OTTHUMG00000019950	ENST00000399703.5:c.1743T>G	9.37:g.38595594A>C		Somatic	0	156	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	145	16.67	A7MD11|A8MVU5|Q5SY86|Q7Z468|Q8NA88	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L581	ENST00000399703.5	37	c.1743	CCDS55311.1	9																																																																																			-	NULL		0.318	ANKRD18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD18A	protein_coding	OTTHUMT00000052506.3	A		-		38595594	-1	no_errors	ENST00000399703	ensembl	human	known	74_37	silent	SNP	0.000	C
SOX3	6658	genome.wustl.edu	37	X	139586328	139586328	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chrX:139586328G>A	ENST00000370536.2	-	1	897	c.898C>T	c.(898-900)Cac>Tac	p.H300Y		NM_005634.2	NP_005625.2	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	300					central nervous system development (GO:0007417)|face development (GO:0060324)|hypothalamus development (GO:0021854)|negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|sensory organ development (GO:0007423)|Sertoli cell development (GO:0060009)|sex determination (GO:0007530)|spermatid differentiation (GO:0048515)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	10	Acute lymphoblastic leukemia(192;7.65e-05)					TCGTAGCGGTGCATcggcggc	0.736																																																	0								ENSG00000134595						2.0	3.0	2.0					X																	139586328		1471	2999	4470	SOX3	SO:0001583	missense	0			-	HGNC		CCDS14669.1	Xq27.1	2013-10-17			ENSG00000134595	ENSG00000134595		"""SRY (sex determining region Y)-boxes"""	11199	protein-coding gene	gene with protein product		313430	"""panhypopituitarism"""	PHP		15800844	Standard	NM_005634		Approved		uc004fbd.1	P41225	OTTHUMG00000022544	ENST00000370536.2:c.898C>T	X.37:g.139586328G>A	ENSP00000359567:p.His300Tyr	Somatic	0	11	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	7	41.67	P35714|Q5JWI3|Q9NP49	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,pfam_TF_SOX,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.H300Y	ENST00000370536.2	37	c.898	CCDS14669.1	X	.	.	.	.	.	.	.	.	.	.	g	15.76	2.929862	0.52759	.	.	ENSG00000134595	ENST00000370536	D	0.98313	-4.86	3.34	3.34	0.38264	.	0.060315	0.64402	U	0.000003	D	0.98394	0.9466	M	0.69358	2.11	0.58432	D	0.999999	D	0.67145	0.996	D	0.72982	0.979	D	0.98216	1.0475	9	.	.	.	.	13.2044	0.59787	0.0:0.0:1.0:0.0	.	300	P41225	SOX3_HUMAN	Y	300	ENSP00000359567:H300Y	.	H	-	1	0	SOX3	139413994	1.000000	0.71417	1.000000	0.80357	0.393000	0.30537	8.507000	0.90522	1.515000	0.48885	0.173000	0.16961	CAC	-	NULL		0.736	SOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX3	protein_coding	OTTHUMT00000058577.1	G		-		139586328	-1	no_errors	ENST00000370536	ensembl	human	known	74_37	missense	SNP	1.000	A
IL27RA	9466	genome.wustl.edu	37	19	14161662	14161662	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr19:14161662C>A	ENST00000263379.2	+	11	1620	c.1495C>A	c.(1495-1497)Cct>Act	p.P499T		NM_004843.3	NP_004834.1	Q6UWB1	I27RA_HUMAN	interleukin 27 receptor, alpha	499	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T-helper 1 type immune response (GO:0002827)|regulation of isotype switching to IgG isotypes (GO:0048302)	integral component of plasma membrane (GO:0005887)	interleukin-27 receptor activity (GO:0045509)|transmembrane signaling receptor activity (GO:0004888)			breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	26						TGGACAGGGCCCTCCTGGTCC	0.597																																					Colon(164;1849 1896 4443 37792 47834)												0								ENSG00000104998						88.0	67.0	74.0					19																	14161662		2203	4300	6503	IL27RA	SO:0001583	missense	0			-	HGNC	AF053004	CCDS12303.1	19p13.11	2013-02-11				ENSG00000104998		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	17290	protein-coding gene	gene with protein product	"""T-cell cytokine receptor type 1"""	605350				9600072, 11057672	Standard	NM_004843		Approved	WSX-1, TCCR, CRL1, WSX1, zcytor1, IL-27R	uc002mxx.4	Q6UWB1		ENST00000263379.2:c.1495C>A	19.37:g.14161662C>A	ENSP00000263379:p.Pro499Thr	Somatic	0	95	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	86	22.52	A0N0L1|O60624	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.P499T	ENST00000263379.2	37	c.1495	CCDS12303.1	19	.	.	.	.	.	.	.	.	.	.	C	13.18	2.160515	0.38119	.	.	ENSG00000104998	ENST00000263379	T	0.57595	0.39	4.69	3.66	0.41972	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.39407	N	0.001368	T	0.48677	0.1513	L	0.32530	0.975	0.24148	N	0.995704	D	0.62365	0.991	P	0.58013	0.831	T	0.32481	-0.9905	10	0.12766	T	0.61	-18.475	7.814	0.29247	0.0:0.8869:0.0:0.1131	.	499	Q6UWB1	I27RA_HUMAN	T	499	ENSP00000263379:P499T	ENSP00000263379:P499T	P	+	1	0	IL27RA	14022662	0.044000	0.20184	0.991000	0.47740	0.052000	0.14988	2.146000	0.42216	2.151000	0.67156	0.461000	0.40582	CCT	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3		0.597	IL27RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL27RA	protein_coding	OTTHUMT00000458539.1	C	NM_004843	-		14161662	+1	no_errors	ENST00000263379	ensembl	human	known	74_37	missense	SNP	0.417	A
ITPR2	3709	genome.wustl.edu	37	12	26985713	26985713	+	Start_Codon_SNP	SNP	A	A	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:26985713A>C	ENST00000381340.3	-	1	418	c.2T>G	c.(1-3)aTg>aGg	p.M1R	ITPR2_ENST00000242737.5_Start_Codon_SNP_p.M1R	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TTTCTCAGTCATGCTGCTTCA	0.622																																																	0								ENSG00000123104						96.0	108.0	104.0					12																	26985713		2189	4300	6489	ITPR2	SO:0001582	initiator_codon_variant	0			-	HGNC	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.2T>G	12.37:g.26985713A>C	ENSP00000370744:p.Met1Arg	Somatic	0	148	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	62	116	34.83	O94773	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.M1R	ENST00000381340.3	37	c.2	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	A	24.0	4.487359	0.84854	.	.	ENSG00000123104	ENST00000381340;ENST00000242737	D	0.92149	-2.98	3.97	3.97	0.46021	.	0.122605	0.64402	D	0.000001	D	0.95360	0.8494	.	.	.	0.31851	N	0.62229	D;P	0.76494	0.999;0.932	D;D	0.83275	0.996;0.917	D	0.95042	0.8179	9	0.87932	D	0	.	12.2742	0.54724	1.0:0.0:0.0:0.0	.	1;1	Q14571-2;Q14571	.;ITPR2_HUMAN	R	1	ENSP00000370744:M1R	ENSP00000242737:M1R	M	-	2	0	ITPR2	26876980	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.271000	0.72569	1.798000	0.52647	0.477000	0.44152	ATG	-	NULL		0.622	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	protein_coding	OTTHUMT00000402732.1	A	NM_002223	-	Missense_Mutation	26985713	-1	no_errors	ENST00000381340	ensembl	human	known	74_37	missense	SNP	1.000	C
LINC00208	83655	genome.wustl.edu	37	8	11438470	11438470	+	lincRNA	SNP	C	C	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr8:11438470C>A	ENST00000304233.3	+	0	1769					NR_040035.1		Q96KT6	CH014_HUMAN	long intergenic non-protein coding RNA 208																		CTGGCCTCACCAAGTGAGGTG	0.532																																																	0								ENSG00000170983																																			LINC00208			0			-	HGNC	AJ291678		8p23.1	2012-10-12	2011-08-11	2011-08-11	ENSG00000170983	ENSG00000170983		"""Long non-coding RNAs"""	15535	non-coding RNA	RNA, long non-coding			"""chromosome 8 open reading frame 14"", ""non-protein coding RNA 208"""	C8orf14, NCRNA00208			Standard	NR_040035		Approved		uc022arx.1	Q96KT6	OTTHUMG00000161738		8.37:g.11438470C>A		Somatic	0	84	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	79	31.30		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000304233.3	37	NULL		8																																																																																			-	-		0.532	LINC00208-001	KNOWN	basic	lincRNA	LINC00208	lincRNA	OTTHUMT00000365946.2	C		-		11438470	+1	no_errors	ENST00000304233	ensembl	human	known	74_37	rna	SNP	0.000	A
DNAJB11	51726	genome.wustl.edu	37	3	186299271	186299271	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr3:186299271G>C	ENST00000439351.1	+	6	1497	c.568G>C	c.(568-570)Gag>Cag	p.E190Q	DNAJB11_ENST00000265028.3_Missense_Mutation_p.E190Q			Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	190					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|mRNA modification (GO:0016556)|protein folding (GO:0006457)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|urinary_tract(2)	15	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		AATGACCCAGGAGGTGGTCTG	0.507																																																	0								ENSG00000090520						83.0	86.0	85.0					3																	186299271		2203	4300	6503	DNAJB11	SO:0001583	missense	0			-	HGNC	AB028859	CCDS3277.1	3q27	2011-09-02			ENSG00000090520	ENSG00000090520		"""Heat shock proteins / DNAJ (HSP40)"""	14889	protein-coding gene	gene with protein product		611341				10827079, 11147971	Standard	NM_016306		Approved	EDJ, HEDJ, ERdj3	uc003fqi.3	Q9UBS4	OTTHUMG00000156614	ENST00000439351.1:c.568G>C	3.37:g.186299271G>C	ENSP00000414398:p.Glu190Gln	Somatic	0	58	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	62	21.52	Q542Y5|Q542Y9|Q6IAQ8|Q96JC6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DnaJ_C,pfam_DnaJ_domain,superfamily_DnaJ_domain,superfamily_HSP40/DnaJ_pept-bd,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.E190Q	ENST00000439351.1	37	c.568	CCDS3277.1	3	.	.	.	.	.	.	.	.	.	.	G	15.00	2.702322	0.48307	.	.	ENSG00000090520	ENST00000439351;ENST00000265028	T;T	0.68181	-0.31;-0.31	5.85	5.85	0.93711	HSP40/DnaJ peptide-binding (1);	0.000000	0.85682	D	0.000000	T	0.44307	0.1287	N	0.02960	-0.455	0.80722	D	1	B	0.16396	0.017	B	0.21708	0.036	T	0.42137	-0.9469	10	0.14252	T	0.57	-27.0675	17.6588	0.88185	0.0:0.0:1.0:0.0	.	190	Q9UBS4	DJB11_HUMAN	Q	190	ENSP00000414398:E190Q;ENSP00000265028:E190Q	ENSP00000265028:E190Q	E	+	1	0	DNAJB11	187781965	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.753000	0.94483	0.655000	0.94253	GAG	-	superfamily_HSP40/DnaJ_pept-bd		0.507	DNAJB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB11	protein_coding	OTTHUMT00000344779.1	G		-		186299271	+1	no_errors	ENST00000265028	ensembl	human	known	74_37	missense	SNP	1.000	C
DEFB134	613211	genome.wustl.edu	37	8	11853731	11853731	+	Silent	SNP	A	A	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr8:11853731A>G	ENST00000526438.1	-	1	90	c.30T>C	c.(28-30)ttT>ttC	p.F10F	DEFB134_ENST00000382205.4_Silent_p.F10F	NM_001033019.1	NP_001028191.1	Q4QY38	DB134_HUMAN	defensin, beta 134	10					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				kidney(1)|large_intestine(1)|lung(1)	3			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.159)		AAAGGAAAAGAAAGACAAACA	0.478																																																	0								ENSG00000205882						142.0	142.0	142.0					8																	11853731		2203	4300	6503	DEFB134	SO:0001819	synonymous_variant	0			-	HGNC	AY621331, DQ012024	CCDS34847.1	8p23.1	2010-04-15			ENSG00000205882	ENSG00000205882		"""Defensins, beta"""	32399	protein-coding gene	gene with protein product						16033865	Standard	NM_001033019		Approved		uc011kxn.2	Q4QY38	OTTHUMG00000158718	ENST00000526438.1:c.30T>C	8.37:g.11853731A>G		Somatic	0	266	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	272	16.31	A1L4A4	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.F10	ENST00000526438.1	37	c.30	CCDS34847.1	8																																																																																			-	NULL		0.478	DEFB134-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB134	protein_coding	OTTHUMT00000351887.2	A	NM_001033019	-		11853731	-1	no_errors	ENST00000526438	ensembl	human	known	74_37	silent	SNP	0.026	G
MIER3	166968	genome.wustl.edu	37	5	56224844	56224845	+	Intron	INS	-	-	CACACACACACACACACACACACACTCTCTCTCT			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr5:56224844_56224845insCACACACACACACACACACACACACTCTCTCTCT	ENST00000381199.3	-	10	840				MIER3_ENST00000381213.3_Intron|MIER3_ENST00000409421.1_Intron|CTD-2310F14.1_ENST00000606813.1_RNA|MIER3_ENST00000381226.3_Intron			Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family member 3						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(2)|urinary_tract(1)	19		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		tctctctctctctctctctctG	0.386																																																	0								ENSG00000271828																																			CTD-2310F14.1	SO:0001627	intron_variant	0				Clone_based_vega_gene	BX537798	CCDS3973.2, CCDS75248.1	5q11.2	2009-03-19			ENSG00000155545	ENSG00000155545			26678	protein-coding gene	gene with protein product						12477932	Standard	XM_005248448		Approved	FLJ35954, DKFZp686L09111, DKFZp781I1119	uc003jra.1	Q7Z3K6	OTTHUMG00000059589	ENST00000381199.3:c.830-156->AGAGAGAGAGTGTGTGTGTGTGTGTGTGTGTGTG	5.37:g.56224844_56224845insCACACACACACACACACACACACACTCTCTCTCT		Somatic	NA	NA	NA		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DRI9|B8ZZQ0|Q5CZI0|Q68CS3|Q6MZS7|Q86YG8|Q8NA13	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000381199.3	37	NULL		5																																																																																			-	-		0.386	MIER3-004	KNOWN	basic|appris_candidate	protein_coding	ENSG00000271828	protein_coding	OTTHUMT00000132523.2	-	NM_152622			56224845	+1	no_errors	ENST00000606813	ensembl	human	known	74_37	rna	INS	0.005:0.014	CACACACACACACACACACACACACTCTCTCTCT
KRT83	3889	genome.wustl.edu	37	12	52708514	52708514	+	Silent	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:52708514G>A	ENST00000293670.3	-	9	1445	c.1383C>T	c.(1381-1383)ccC>ccT	p.P461P	AC121757.1_ENST00000594763.1_5'Flank	NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	461	Tail.				aging (GO:0007568)|epidermis development (GO:0008544)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TCCCGTTGCAGGGGGCACTGC	0.667																																					GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)												0								ENSG00000170523						26.0	23.0	24.0					12																	52708514		2197	4298	6495	KRT83	SO:0001819	synonymous_variant	0			-	HGNC	X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3		9084137, 16831889	Standard	NM_002282		Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.1383C>T	12.37:g.52708514G>A		Somatic	0	140	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	98	22.83	A1A4S9|B2RC21|Q6NT21|Q9NSB3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.P461	ENST00000293670.3	37	c.1383	CCDS8823.1	12																																																																																			-	NULL		0.667	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT83	protein_coding	OTTHUMT00000405182.1	G	NM_002282	-		52708514	-1	no_errors	ENST00000293670	ensembl	human	known	74_37	silent	SNP	0.984	A
SLC25A44	9673	genome.wustl.edu	37	1	156180814	156180814	+	3'UTR	SNP	T	T	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:156180814T>A	ENST00000359511.4	+	0	1709				PMF1_ENST00000368273.4_5'Flank|PMF1_ENST00000567140.1_5'Flank|PMF1_ENST00000368277.3_5'Flank|PMF1_ENST00000368279.3_5'Flank|PMF1-BGLAP_ENST00000368276.4_5'Flank|PMF1-BGLAP_ENST00000320139.5_5'Flank|PMF1-BGLAP_ENST00000490491.1_5'Flank|SLC25A44_ENST00000469537.1_3'UTR|PMF1_ENST00000565805.1_5'Flank	NM_014655.2	NP_055470.1	Q96H78	S2544_HUMAN	solute carrier family 25, member 44						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Hepatocellular(266;0.158)					TTGGAGGGGTTATTAGGTTGG	0.463																																																	0								ENSG00000160785																																			SLC25A44	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AB007915	CCDS1133.1, CCDS72943.1	1q22	2013-05-22			ENSG00000160785	ENSG00000160785		"""Solute carriers"""	29036	protein-coding gene	gene with protein product		610824				16949250	Standard	NM_001286184		Approved	FLJ90431, KIAA0446	uc001fnp.3	Q96H78	OTTHUMG00000014816	ENST00000359511.4:c.*592T>A	1.37:g.156180814T>A		Somatic	0	33	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	41	18.00	O75034	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000359511.4	37	NULL	CCDS1133.1	1																																																																																			-	-		0.463	SLC25A44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A44	protein_coding	OTTHUMT00000040856.1	T	NM_014655	-		156180814	+1	no_errors	ENST00000469537	ensembl	human	known	74_37	rna	SNP	0.086	A
DPY19L2P2	349152	genome.wustl.edu	37	7	102898150	102898150	+	RNA	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr7:102898150G>A	ENST00000312132.4	-	0	2422							Q6ZN68	D19P2_HUMAN	DPY19L2 pseudogene 2							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										ATGAATGTGCGATACCAGGAG	0.308																																																	0								ENSG00000170629																																			DPY19L2P2			0			-	HGNC	AL834175		7q22.1	2013-09-12	2013-09-12		ENSG00000170629	ENSG00000170629			21764	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 2 (C. elegans)"""				Standard	NR_027768		Approved	DKFZp434E092, FLJ36166	uc003vbh.4	Q6ZN68	OTTHUMG00000157200		7.37:g.102898150G>A		Somatic	1	256	0.39		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	108	165	39.56	Q8N9V4|Q8ND62	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000312132.4	37	NULL		7																																																																																			-	-		0.308	DPY19L2P2-002	KNOWN	basic	processed_transcript	DPY19L2P2	pseudogene	OTTHUMT00000347877.1	G	NM_182634	-		102898150	-1	no_errors	ENST00000312132	ensembl	human	known	74_37	rna	SNP	0.725	A
DKC1	1736	genome.wustl.edu	37	X	153994771	153994771	+	Intron	DEL	A	A	-			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chrX:153994771delA	ENST00000369550.5	+	5	658				SNORA36A_ENST00000384221.1_RNA	NM_001142463.1|NM_001363.3	NP_001135935.1|NP_001354.1	O60832	DKC1_HUMAN	dyskeratosis congenita 1, dyskerin						cell proliferation (GO:0008283)|pseudouridine synthesis (GO:0001522)|RNA processing (GO:0006396)|rRNA processing (GO:0006364)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)|telomerase activity (GO:0003720)			breast(2)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)	15	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CTTCATTAAGAAAAAAAAAAA	0.418									Congenital Dyskeratosis																																								0								ENSG00000130826																																			DKC1	SO:0001627	intron_variant	0	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita		HGNC	AJ224481	CCDS14761.1, CCDS76062.1	Xq28	2014-09-17			ENSG00000130826	ENSG00000130826			2890	protein-coding gene	gene with protein product		300126		DKC		9590285, 9888995	Standard	NM_001142463		Approved	XAP101, dyskerin, NAP57, NOLA4	uc004fmm.3	O60832	OTTHUMG00000024242	ENST00000369550.5:c.448+96A>-	X.37:g.153994771delA		Somatic	0	34	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	F5BSB3|O43845|Q96G67|Q9Y505	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369550.5	37	NULL	CCDS14761.1	X																																																																																			-	-		0.418	DKC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKC1	protein_coding	OTTHUMT00000061180.5	A	NM_001363			153994771	+1	no_errors	ENST00000473552	ensembl	human	known	74_37	rna	DEL	0.000	-
LILRA5	353514	genome.wustl.edu	37	19	54823155	54823155	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr19:54823155G>T	ENST00000301219.3	-	4	507	c.388C>A	c.(388-390)Ccc>Acc	p.P130T	LILRA5_ENST00000446712.3_Missense_Mutation_p.P118T|AC008984.2_ENST00000507363.1_RNA|LILRA5_ENST00000432233.3_Missense_Mutation_p.P130T|LILRA5_ENST00000346508.3_Missense_Mutation_p.P118T	NM_021250.2	NP_067073.1	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5	130	Ig-like C2-type 1.				innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGCTCCAGGGGGTCGCTGGGC	0.612																																																	0								ENSG00000187116						130.0	123.0	126.0					19																	54823155		2203	4300	6503	LILRA5	SO:0001583	missense	0			-	HGNC	AF212842	CCDS12888.1, CCDS12889.1	19q13.4	2013-01-11	2005-05-13	2005-05-13	ENSG00000187116	ENSG00000187116		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16309	protein-coding gene	gene with protein product		606047		LILRB7		10941842	Standard	NM_181986		Approved	ILT11, LIR9, CD85, CD85f	uc002qfe.3	A6NI73	OTTHUMG00000065357	ENST00000301219.3:c.388C>A	19.37:g.54823155G>T	ENSP00000301219:p.Pro130Thr	Somatic	1	162	0.61		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	70	110	38.67	A6NHI3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,smart_Ig_sub2	p.P130T	ENST00000301219.3	37	c.388	CCDS12888.1	19	.	.	.	.	.	.	.	.	.	.	G	10.03	1.239551	0.22711	.	.	ENSG00000187116	ENST00000301219;ENST00000346508;ENST00000446712;ENST00000432233	T;T;T;T	0.13089	2.62;2.62;2.62;2.62	3.16	-2.38	0.06622	Immunoglobulin-like fold (1);	0.357134	0.20065	U	0.099994	T	0.16257	0.0391	M	0.81802	2.56	0.21527	N	0.99965	P;P;P;P	0.48589	0.638;0.48;0.912;0.761	B;B;P;P	0.46299	0.13;0.268;0.511;0.459	T	0.09618	-1.0666	10	0.62326	D	0.03	.	1.8919	0.03249	0.1299:0.3789:0.299:0.1922	.	118;130;118;130	A6NI73-4;A6NI73-3;A6NI73-2;A6NI73	.;.;.;LIRA5_HUMAN	T	130;118;118;130	ENSP00000301219:P130T;ENSP00000302948:P118T;ENSP00000389499:P118T;ENSP00000404236:P130T	ENSP00000301219:P130T	P	-	1	0	LILRA5	59514967	0.000000	0.05858	0.232000	0.24009	0.786000	0.44442	-0.947000	0.03901	-0.351000	0.08249	0.411000	0.27672	CCC	-	smart_Ig_sub		0.612	LILRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA5	protein_coding	OTTHUMT00000140231.1	G	NM_181985	-		54823155	-1	no_errors	ENST00000301219	ensembl	human	known	74_37	missense	SNP	0.668	T
GBE1	2632	genome.wustl.edu	37	3	81548345	81548345	+	Silent	SNP	T	T	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr3:81548345T>C	ENST00000429644.2	-	15	2611	c.1968A>G	c.(1966-1968)gaA>gaG	p.E656E	GBE1_ENST00000489715.1_Silent_p.E615E	NM_000158.3	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1	656					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	1,4-alpha-glucan branching enzyme activity (GO:0003844)|cation binding (GO:0043169)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|endometrium(5)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		GCCCTCCATATTCCGCTGCAT	0.408									Glycogen Storage Disease, type IV																																								0								ENSG00000114480						99.0	94.0	96.0					3																	81548345		1889	4115	6004	GBE1	SO:0001819	synonymous_variant	0	Familial Cancer Database	Andersen Disease, Brancher deficiency	-	HGNC		CCDS54612.1	3p12.2	2013-09-20	2008-08-01		ENSG00000114480	ENSG00000114480	2.4.1.18		4180	protein-coding gene	gene with protein product	"""glycogen branching enzyme"", ""Andersen disease"", ""glycogen storage disease type IV"""	607839				8463281	Standard	NM_000158		Approved		uc021xav.1	Q04446	OTTHUMG00000158978	ENST00000429644.2:c.1968A>G	3.37:g.81548345T>C		Somatic	0	140	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	56	110	33.53	B3KWV3|Q96EN0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_A-amylase_b_C,pfam_Glyco_hydro_13_cat_dom,pfam_Glyco_hydro_13_N,superfamily_Glycoside_hydrolase_SF,superfamily_Ig_E-set,smart_Glyco_hydro_13_sub_cat_dom	p.E656	ENST00000429644.2	37	c.1968	CCDS54612.1	3																																																																																			-	pfam_A-amylase_b_C		0.408	GBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBE1	protein_coding	OTTHUMT00000352760.2	T		-		81548345	-1	no_errors	ENST00000429644	ensembl	human	known	74_37	silent	SNP	0.449	C
RBM11	54033	genome.wustl.edu	37	21	15596712	15596712	+	Intron	SNP	A	A	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr21:15596712A>G	ENST00000400577.3	+	4	341				RBM11_ENST00000468643.1_Intron	NM_144770.3	NP_658983.3	P57052	RBM11_HUMAN	RNA binding motif protein 11						cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|mRNA processing (GO:0006397)|multicellular organismal development (GO:0007275)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(U) RNA binding (GO:0008266)|protein homodimerization activity (GO:0042803)			endometrium(3)|kidney(3)|lung(7)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16				Epithelial(23;0.000314)|COAD - Colon adenocarcinoma(22;0.00242)|Colorectal(24;0.0129)|Lung(58;0.141)		TGACATTTGTAATAGGAATTT	0.358																																																	0								ENSG00000185272						69.0	61.0	63.0					21																	15596712		692	1586	2278	RBM11	SO:0001627	intron_variant	0			-	HGNC	AF130358	CCDS46635.1	21q11	2013-02-12			ENSG00000185272	ENSG00000185272		"""RNA binding motif (RRM) containing"""	9897	protein-coding gene	gene with protein product						12036298	Standard	NM_144770		Approved		uc002yjo.4	P57052	OTTHUMG00000074263	ENST00000400577.3:c.333-47A>G	21.37:g.15596712A>G		Somatic	0	68	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	60	14.29	Q6YNC2|Q8NBA1|Q8NFF6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000400577.3	37	NULL	CCDS46635.1	21																																																																																			-	-		0.358	RBM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM11	protein_coding	OTTHUMT00000157818.1	A	NM_144770	-		15596712	+1	no_errors	ENST00000475864	ensembl	human	putative	74_37	rna	SNP	0.000	G
GAK	2580	genome.wustl.edu	37	4	862361	862361	+	Silent	SNP	G	G	A	rs112202640		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr4:862361G>A	ENST00000314167.4	-	20	2471	c.2361C>T	c.(2359-2361)gaC>gaT	p.D787D	GAK_ENST00000511163.1_Silent_p.D708D|GAK_ENST00000509566.1_5'UTR	NM_005255.2	NP_005246.2	O14976	GAK_HUMAN	cyclin G associated kinase	787			D -> Y (in dbSNP:rs34585705). {ECO:0000269|PubMed:17344846}.		cell cycle (GO:0007049)|cell development (GO:0048468)|clathrin coat disassembly (GO:0072318)|clathrin-mediated endocytosis (GO:0072583)|endoplasmic reticulum organization (GO:0007029)|epidermal cell differentiation (GO:0009913)|establishment of skin barrier (GO:0061436)|forebrain morphogenesis (GO:0048853)|Golgi organization (GO:0007030)|intrahepatic bile duct development (GO:0035622)|positive regulation of neural precursor cell proliferation (GO:2000179)	cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(16)|skin(7)|urinary_tract(2)	39				Colorectal(103;0.219)		AGCGACTGGCGTCCGCGCTGC	0.687													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16189	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000178950	G		4,4398	9.9+/-24.2	0,4,2197	37.0	35.0	36.0		2361	-2.2	0.0	4	dbSNP_132	36	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous	GAK	NM_005255.2		0,5,6494	AA,AG,GG		0.0116,0.0909,0.0385		787/1312	862361	5,12993	2201	4298	6499	GAK	SO:0001819	synonymous_variant	0			-	HGNC	D88435	CCDS3340.1	4p16	2011-09-07			ENSG00000178950	ENSG00000178950		"""Heat shock proteins / DNAJ (HSP40)"""	4113	protein-coding gene	gene with protein product	"""auxilin-2"""	602052				9299234	Standard	NM_005255		Approved	DNAJC26	uc003gbm.4	O14976	OTTHUMG00000088301	ENST00000314167.4:c.2361C>T	4.37:g.862361G>A		Somatic	0	127	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	94	109	46.31	Q5U4P5|Q9BVY6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Tensin_phosphatase_C2-dom,pfam_DnaJ_domain,superfamily_Kinase-like_dom,superfamily_DnaJ_domain,superfamily_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_DnaJ_domain,pfscan_Prot_kinase_dom,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom,pfscan_DnaJ_domain	p.D787	ENST00000314167.4	37	c.2361	CCDS3340.1	4																																																																																			-	NULL		0.687	GAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAK	protein_coding	OTTHUMT00000239188.1	G	NM_005255	rs112202640		862361	-1	no_errors	ENST00000314167	ensembl	human	known	74_37	silent	SNP	0.003	A
XRCC6BP1	91419	genome.wustl.edu	37	12	58335516	58335525	+	Frame_Shift_Del	DEL	GCCCCGCGGC	GCCCCGCGGC	-	rs369268420		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	GCCCCGCGGC	GCCCCGCGGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:58335516_58335525delGCCCCGCGGC	ENST00000300145.3	+	1	157_166	c.32_41delGCCCCGCGGC	c.(31-42)ggccccgcggcafs	p.GPAA11fs		NM_033276.2	NP_150592.1	Q9Y6H3	ATP23_HUMAN	XRCC6 binding protein 1	11					double-strand break repair via nonhomologous end joining (GO:0006303)|protein phosphorylation (GO:0006468)	DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)	DNA-dependent protein kinase activity (GO:0004677)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	11						cgccggcggggccccgcggcAGGGGAGCAG	0.686																																																	0								ENSG00000166896																																			XRCC6BP1	SO:0001589	frameshift_variant	0				HGNC	AF078164	CCDS41802.1	12q14.1	2006-01-09				ENSG00000166896			29452	protein-coding gene	gene with protein product	"""Ku70 binding protein 3"""					10219089	Standard	XM_005269223		Approved	KUB3	uc001sqp.3	Q9Y6H3	OTTHUMG00000170493	ENST00000300145.3:c.32_41delGCCCCGCGGC	12.37:g.58335516_58335525delGCCCCGCGGC	ENSP00000300145:p.Gly11fs	Somatic	NA	NA	NA		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q1RLM4|Q96E81	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M76_ATP23	p.G11fs	ENST00000300145.3	37	c.32_41	CCDS41802.1	12																																																																																			-	NULL		0.686	XRCC6BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRCC6BP1	protein_coding	OTTHUMT00000409390.1	GCCCCGCGGC	NM_033276			58335525	+1	no_errors	ENST00000300145	ensembl	human	known	74_37	frame_shift_del	DEL	0.092:0.099:0.094:0.074:0.002:0.002:0.000:0.001:0.003:0.000	-
HDGFRP3	50810	genome.wustl.edu	37	15	83826716	83826716	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr15:83826716C>T	ENST00000299633.4	-	3	842	c.239G>A	c.(238-240)gGa>gAa	p.G80E		NM_016073.3	NP_057157.1	Q9Y3E1	HDGR3_HUMAN		80					cell proliferation (GO:0008283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(1)|large_intestine(1)|lung(4)|prostate(1)	7						TTCGTTAAATCCTTTCCGTTT	0.368																																																	0								ENSG00000166503						155.0	138.0	144.0					15																	83826716		2203	4300	6503	HDGFRP3	SO:0001583	missense	0			-	Uniprot_gn																												ENST00000299633.4:c.239G>A	15.37:g.83826716C>T	ENSP00000299633:p.Gly80Glu	Somatic	0	250	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	109	155	41.29		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom	p.G80E	ENST00000299633.4	37	c.239	CCDS32314.1	15	.	.	.	.	.	.	.	.	.	.	C	28.8	4.951441	0.92660	.	.	ENSG00000166503	ENST00000299633	T	0.70164	-0.46	5.28	5.28	0.74379	PWWP (1);	0.000000	0.85682	D	0.000000	D	0.85544	0.5721	M	0.89904	3.07	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.86817	0.2002	10	0.48119	T	0.1	.	19.2734	0.94019	0.0:1.0:0.0:0.0	.	80	Q9Y3E1	HDGR3_HUMAN	E	80	ENSP00000299633:G80E	ENSP00000299633:G80E	G	-	2	0	AC024270.1	81617720	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.702000	0.84576	2.629000	0.89072	0.563000	0.77884	GGA	-	pfam_PWWP_dom		0.368	HDGFRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDGFRP3	protein_coding	OTTHUMT00000419898.1	C		-		83826716	-1	no_errors	ENST00000299633	ensembl	human	known	74_37	missense	SNP	1.000	T
ALK	238	genome.wustl.edu	37	2	29456563	29456563	+	Splice_Site	SNP	C	C	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr2:29456563C>G	ENST00000389048.3	-	14	3262		c.e14-1		ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase						activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	ACTGGTTTGTCTGTAGAAACA	0.448			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																														yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	0								ENSG00000171094						128.0	126.0	127.0					2																	29456563		2203	4300	6503	ALK	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	-	HGNC	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.2356-1G>C	2.37:g.29456563C>G		Somatic	0	127	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	49	106	31.61	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e14-1	ENST00000389048.3	37	c.2356-1	CCDS33172.1	2	.	.	.	.	.	.	.	.	.	.	C	23.1	4.380951	0.82792	.	.	ENSG00000171094	ENST00000389048	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5908	0.91212	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ALK	29310067	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.229000	0.65316	2.395000	0.81488	0.561000	0.74099	.	-	-		0.448	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALK	protein_coding	OTTHUMT00000324994.1	C	NM_004304	-	Intron	29456563	-1	no_errors	ENST00000389048	ensembl	human	known	74_37	splice_site	SNP	1.000	G
WNK4	65266	genome.wustl.edu	37	17	40934869	40934869	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr17:40934869G>A	ENST00000246914.5	+	2	733	c.712G>A	c.(712-714)Gat>Aat	p.D238N		NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	238	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		CCGCTTCTATGATTCGTGGAA	0.597																																					Esophageal Squamous(6;201 374 4964 23855 42828)												0								ENSG00000126562						104.0	91.0	95.0					17																	40934869		2203	4300	6503	WNK4	SO:0001583	missense	0			-	HGNC	AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.712G>A	17.37:g.40934869G>A	ENSP00000246914:p.Asp238Asn	Somatic	0	92	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	102	30.61	B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D238N	ENST00000246914.5	37	c.712	CCDS11439.1	17	.	.	.	.	.	.	.	.	.	.	G	34	5.394699	0.96009	.	.	ENSG00000126562	ENST00000246914	T	0.27720	1.65	3.97	3.97	0.46021	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.166856	0.28914	N	0.013727	T	0.52677	0.1749	M	0.66297	2.02	0.46376	D	0.999016	D	0.54047	0.964	D	0.65684	0.937	T	0.59177	-0.7503	10	0.72032	D	0.01	-9.3159	16.2013	0.82084	0.0:0.0:1.0:0.0	.	238	Q96J92	WNK4_HUMAN	N	238	ENSP00000246914:D238N	ENSP00000246914:D238N	D	+	1	0	WNK4	38188395	1.000000	0.71417	0.980000	0.43619	0.956000	0.61745	9.616000	0.98359	2.045000	0.60652	0.462000	0.41574	GAT	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.597	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK4	protein_coding	OTTHUMT00000452389.1	G		-		40934869	+1	no_errors	ENST00000246914	ensembl	human	known	74_37	missense	SNP	1.000	A
KLHL32	114792	genome.wustl.edu	37	6	97561755	97561755	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr6:97561755C>A	ENST00000369261.4	+	7	1087	c.724C>A	c.(724-726)Cat>Aat	p.H242N	KLHL32_ENST00000544166.1_Intron|KLHL32_ENST00000539200.1_Missense_Mutation_p.H173N|KLHL32_ENST00000536676.1_Missense_Mutation_p.H206N	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	242								p.H242N(1)		breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		GGATACTCTCCATACAGTTGC	0.537																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000186231						163.0	134.0	144.0					6																	97561755		2203	4300	6503	KLHL32	SO:0001583	missense	0			-	HGNC	AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.724C>A	6.37:g.97561755C>A	ENSP00000358265:p.His242Asn	Somatic	0	97	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	87	35.56	B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.H242N	ENST00000369261.4	37	c.724	CCDS5038.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.53|13.53	2.264738|2.264738	0.40095|0.40095	.|.	.|.	ENSG00000186231|ENSG00000186231	ENST00000369261;ENST00000536676;ENST00000539200|ENST00000369255;ENST00000447886	T;T;T|T	0.68025|0.34072	-0.3;-0.3;-0.3|1.38	5.09|5.09	5.09|5.09	0.68999|0.68999	BTB/Kelch-associated (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.32645|0.32645	0.0836|0.0836	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	D;D;B;P|.	0.53619|.	0.959;0.961;0.006;0.943|.	B;P;B;P|.	0.49192|.	0.37;0.484;0.006;0.602|.	T|T	0.09729|0.09729	-1.0661|-1.0661	10|7	0.72032|0.54805	D|T	0.01|0.06	.|.	18.6745|18.6745	0.91524|0.91524	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	173;206;242;242|.	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08|.	.;.;KLH32_HUMAN;.|.	N|Q	242;206;173|194;164	ENSP00000358265:H242N;ENSP00000440382:H206N;ENSP00000441527:H173N|ENSP00000389310:P164Q	ENSP00000358265:H242N|ENSP00000358259:P194Q	H|P	+|+	1|2	0|0	KLHL32|KLHL32	97668476|97668476	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.896000|0.896000	0.52359|0.52359	6.892000|6.892000	0.75644|0.75644	2.632000|2.632000	0.89209|0.89209	0.655000|0.655000	0.94253|0.94253	CAT|CCA	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin		0.537	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL32	protein_coding	OTTHUMT00000041570.1	C	NM_052904	-		97561755	+1	no_errors	ENST00000369261	ensembl	human	known	74_37	missense	SNP	1.000	A
SPATA17	128153	genome.wustl.edu	37	1	217955579	217955579	+	Missense_Mutation	SNP	C	C	T	rs200145412		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:217955579C>T	ENST00000366933.4	+	8	842	c.787C>T	c.(787-789)Cgg>Tgg	p.R263W	RP11-415L24.1_ENST00000415765.1_RNA	NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	263						cytoplasm (GO:0005737)		p.R263W(1)		endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		GCCAACGTTGCGGGTGGCAGA	0.453																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000162814						92.0	95.0	94.0					1																	217955579		2203	4300	6503	SPATA17	SO:0001583	missense	0			-	HGNC	AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.787C>T	1.37:g.217955579C>T	ENSP00000355900:p.Arg263Trp	Somatic	1	100	0.99		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	59	23.38	A5D6N2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.R263W	ENST00000366933.4	37	c.787	CCDS1519.1	1	.	.	.	.	.	.	.	.	.	.	C	17.79	3.475316	0.63737	.	.	ENSG00000162814	ENST00000366933	T	0.61510	0.1	4.73	-2.29	0.06805	.	0.224021	0.37530	N	0.002041	T	0.69548	0.3123	M	0.81942	2.565	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.63233	-0.6683	10	0.62326	D	0.03	-20.1943	7.058	0.25109	0.1875:0.5633:0.0:0.2492	.	263	Q96L03	SPT17_HUMAN	W	263	ENSP00000355900:R263W	ENSP00000355900:R263W	R	+	1	2	SPATA17	216022202	1.000000	0.71417	0.000000	0.03702	0.531000	0.34715	0.845000	0.27668	-1.105000	0.03011	-1.969000	0.00466	CGG	-	NULL		0.453	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA17	protein_coding	OTTHUMT00000092433.2	C	NM_138796	rs200145412		217955579	+1	no_errors	ENST00000366933	ensembl	human	known	74_37	missense	SNP	0.068	T
RAPGEF4	11069	genome.wustl.edu	37	2	173608905	173608905	+	Intron	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr2:173608905G>T	ENST00000397081.3	+	1	208				RAPGEF4_ENST00000409036.1_Intron|RAPGEF4_ENST00000264111.6_Intron	NM_007023.3	NP_008954.2	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4						blood coagulation (GO:0007596)|calcium ion-dependent exocytosis (GO:0017156)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|insulin secretion (GO:0030073)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of exocytosis (GO:0017157)|regulation of insulin secretion (GO:0050796)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(14)|lung(13)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47			OV - Ovarian serous cystadenocarcinoma(117;0.194)			GTCACTAATTGTCTTGACTTT	0.368																																																	0								ENSG00000091428																																			RAPGEF4	SO:0001627	intron_variant	0			-	HGNC	U78516	CCDS42775.1, CCDS42776.1, CCDS63060.1, CCDS63061.1, CCDS74604.1	2q31-q32	2008-02-05	2004-03-26		ENSG00000091428	ENSG00000091428			16626	protein-coding gene	gene with protein product	"""cAMP-regulated guanine nucleotide exchange factor II"", "" exchange protein directly activated by cAMP 2"""	606058	"""RAP guanine-nucleotide-exchange factor (GEF) 4"""			10777494, 9856955	Standard	NM_007023		Approved	cAMP-GEFII, CGEF2	uc002uhv.4	Q8WZA2	OTTHUMG00000133677	ENST00000397081.3:c.65+8129G>T	2.37:g.173608905G>T		Somatic	0	34	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	26	55.93	B2R7R3|B7Z283|B7Z3T6|B7Z912|O95636|Q8IXK6|Q8TAA4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000397081.3	37	NULL	CCDS42775.1	2																																																																																			-	-		0.368	RAPGEF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPGEF4	protein_coding	OTTHUMT00000257864.2	G	NM_007023	-		173608905	+1	no_errors	ENST00000464976	ensembl	human	known	74_37	rna	SNP	0.003	T
ZMAT4	79698	genome.wustl.edu	37	8	40532319	40532319	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr8:40532319G>T	ENST00000297737.6	-	5	627	c.481C>A	c.(481-483)Cag>Aag	p.Q161K	ZMAT4_ENST00000315769.7_Intron	NM_024645.2	NP_078921.1	Q9H898	ZMAT4_HUMAN	zinc finger, matrin-type 4	161						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	18	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			TAATGTTGCTGGGCCATCAGA	0.483																																																	0								ENSG00000165061						199.0	192.0	195.0					8																	40532319		2203	4300	6503	ZMAT4	SO:0001583	missense	0			-	HGNC	AK023904	CCDS34885.1, CCDS47848.1	8p11.21	2012-10-05	2010-09-15		ENSG00000165061	ENSG00000165061		"""Zinc fingers, matrin-type"""	25844	protein-coding gene	gene with protein product						12477932	Standard	NM_024645		Approved	FLJ13842	uc003xnr.3	Q9H898	OTTHUMG00000164049	ENST00000297737.6:c.481C>A	8.37:g.40532319G>T	ENSP00000297737:p.Gln161Lys	Somatic	0	173	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	172	18.10	Q8WUT8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.Q161K	ENST00000297737.6	37	c.481	CCDS34885.1	8	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541691	0.85917	.	.	ENSG00000165061	ENST00000297737;ENST00000519406	T;T	0.42513	0.97;0.97	5.94	5.94	0.96194	Zinc finger, C2H2-like (1);Zinc finger, double-stranded RNA binding (1);Zinc finger, U1-type (1);Zinc finger, C2H2 (1);	0.119769	0.64402	D	0.000007	T	0.48277	0.1491	L	0.59436	1.845	0.54753	D	0.999986	P	0.46859	0.885	P	0.45538	0.484	T	0.35375	-0.9791	10	0.36615	T	0.2	-27.6248	18.9244	0.92538	0.0:0.0:1.0:0.0	.	161	Q9H898	ZMAT4_HUMAN	K	161	ENSP00000297737:Q161K;ENSP00000428423:Q161K	ENSP00000297737:Q161K	Q	-	1	0	ZMAT4	40651476	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	9.366000	0.97143	2.817000	0.96982	0.557000	0.71058	CAG	-	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like		0.483	ZMAT4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMAT4	protein_coding	OTTHUMT00000376950.1	G	NM_024645	-		40532319	-1	no_errors	ENST00000297737	ensembl	human	known	74_37	missense	SNP	1.000	T
TNR	7143	genome.wustl.edu	37	1	175372402	175372402	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:175372402C>T	ENST00000367674.2	-	4	1558	c.850G>A	c.(850-852)Gag>Aag	p.E284K	TNR_ENST00000263525.2_Missense_Mutation_p.E284K			Q92752	TENR_HUMAN	tenascin R	284	Cys-rich.|EGF-like 4.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					TAGCCCTCCTCGCATAAACAG	0.612																																																	0								ENSG00000116147						134.0	88.0	103.0					1																	175372402		2203	4300	6503	TNR	SO:0001583	missense	0			-	HGNC	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.850G>A	1.37:g.175372402C>T	ENSP00000356646:p.Glu284Lys	Somatic	0	68	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	92	83	52.57	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.E284K	ENST00000367674.2	37	c.850	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.502289	0.26949	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.04454	3.62;3.62	6.04	5.13	0.70059	EGF-like region, conserved site (2);	0.360210	0.29602	N	0.011688	T	0.05593	0.0147	L	0.33137	0.985	0.23988	N	0.996254	B;B	0.14805	0.011;0.0	B;B	0.04013	0.001;0.001	T	0.30880	-0.9963	10	0.28530	T	0.3	.	16.1971	0.82040	0.0:0.2611:0.7389:0.0	.	284;284	B4DIX8;Q92752	.;TENR_HUMAN	K	284	ENSP00000356646:E284K;ENSP00000263525:E284K	ENSP00000263525:E284K	E	-	1	0	TNR	173639025	0.997000	0.39634	1.000000	0.80357	0.224000	0.24922	1.520000	0.35899	1.564000	0.49628	-0.311000	0.09066	GAG	-	pfam_EGF_extracell,smart_EG-like_dom		0.612	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	protein_coding	OTTHUMT00000084414.4	C	NM_003285	-		175372402	-1	no_errors	ENST00000263525	ensembl	human	known	74_37	missense	SNP	1.000	T
ADCK5	203054	genome.wustl.edu	37	8	145617535	145617549	+	Splice_Site	DEL	GGGGGTGCAAGGTGA	GGGGGTGCAAGGTGA	-	rs563415390|rs148509143|rs374281647	byFrequency	TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	GGGGGTGCAAGGTGA	GGGGGTGCAAGGTGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr8:145617535_145617549delGGGGGTGCAAGGTGA	ENST00000308860.6	+	12	1301_1311	c.1257_1267delGGGGGTGCAAGGTGA	c.(1255-1269)ctgggggtgcaaggt>ctgt	p.GVQG420del	CPSF1_ENST00000531727.1_5'Flank|MIR939_ENST00000401314.1_RNA	NM_174922.3	NP_777582.4	Q3MIX3	ADCK5_HUMAN	aarF domain containing kinase 5	420						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	protein serine/threonine kinase activity (GO:0004674)	p.?(2)		endometrium(1)|lung(2)|prostate(2)|skin(1)|stomach(2)	8	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;8.96e-41)|Epithelial(56;4.08e-40)|all cancers(56;4.51e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CAGCCGCACTGGGGGTGCAAGGTGAGGGGGTGCAA	0.73														3140	0.626997	0.8109	0.562	5008	,	,		8769	0.6577		0.4205	False		,,,				2504	0.6053																2	Unknown(2)	prostate(2)						ENSG00000173137			1836,894		805,226,334						4.5	0.7		dbSNP_120	4	2015,4403		639,737,1833	no	coding-near-splice	ADCK5	NM_174922.3		1444,963,2167	A1A1,A1R,RR		31.3961,32.7473,42.0966				3851,5297				ADCK5	SO:0001630	splice_region_variant	0				HGNC	BC032402	CCDS34965.1, CCDS34965.2	8q24.3	2004-07-06			ENSG00000173137	ENSG00000173137			21738	protein-coding gene	gene with protein product							Standard	NM_174922		Approved	FLJ35454	uc003zch.3	Q3MIX3	OTTHUMG00000165190	ENST00000308860.6:c.1267+1GGGGGTGCAAGGTGA>-	8.37:g.145617535_145617549delGGGGGTGCAAGGTGA		Somatic	NA	NA	NA		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KS46|Q5U4P1|Q6P2S4|Q8N5V3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_UbiB_dom,superfamily_Kinase-like_dom	p.G420fs	ENST00000308860.6	37	c.1257_1267	CCDS34965.1	8																																																																																			-	NULL		0.730	ADCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCK5	protein_coding	OTTHUMT00000382556.2	GGGGGTGCAAGGTGA	NM_174922		In_Frame_Del	145617549	+1	no_errors	ENST00000308860	ensembl	human	known	74_37	frame_shift_del	DEL	0.999:0.998:1.000:0.999:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
KHDC1	80759	genome.wustl.edu	37	6	74000787	74000787	+	Intron	SNP	C	C	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr6:74000787C>A	ENST00000370384.3	-	2	707				KHDC1_ENST00000484801.1_Intron|RP11-398K22.12_ENST00000421315.1_RNA|RP11-398K22.12_ENST00000441363.1_RNA	NM_001251874.1	NP_001238803.1	Q4VXA5	KHDC1_HUMAN	KH homology domain containing 1							integral component of membrane (GO:0016021)	RNA binding (GO:0003723)			large_intestine(1)|lung(4)|skin(1)	6						GGAGGAATTTCAAAGTGAATG	0.448																																																	0								ENSG00000229852																																			RP11-398K22.12	SO:0001627	intron_variant	0			-	Clone_based_vega_gene		CCDS43480.1, CCDS59027.1	6q13	2014-05-15	2007-11-13	2007-11-13	ENSG00000135314	ENSG00000135314			21366	protein-coding gene	gene with protein product		611688	"""chromosome 6 open reading frame 148"""	C6orf148		17913455	Standard	NM_030568		Approved	MGC10818, bA257K9.4, NDG1	uc003pgn.4	Q4VXA5	OTTHUMG00000015030	ENST00000370384.3:c.206+933G>T	6.37:g.74000787C>A		Somatic	0	59	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	58	21.62	Q5JSQ7|Q8WTV2|Q96NQ5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370384.3	37	NULL	CCDS59027.1	6																																																																																			-	-		0.448	KHDC1-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000229852	protein_coding	OTTHUMT00000148103.2	C	NM_030568	-		74000787	+1	no_errors	ENST00000421315	ensembl	human	known	74_37	rna	SNP	1.000	A
TNR	7143	genome.wustl.edu	37	1	175372327	175372327	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:175372327C>T	ENST00000367674.2	-	4	1633	c.925G>A	c.(925-927)Gag>Aag	p.E309K	TNR_ENST00000263525.2_Missense_Mutation_p.E309K			Q92752	TENR_HUMAN	tenascin R	309	Cys-rich.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.E309K(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CAGAGCCCCTCCTCACATTGT	0.607																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000116147						97.0	78.0	84.0					1																	175372327		2203	4300	6503	TNR	SO:0001583	missense	0			-	HGNC	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.925G>A	1.37:g.175372327C>T	ENSP00000356646:p.Glu309Lys	Somatic	0	43	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	61	42	59.22	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.E309K	ENST00000367674.2	37	c.925	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	C	19.20	3.781250	0.70222	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.03441	3.93;3.93	6.04	6.04	0.98038	EGF, extracellular (1);	0.059909	0.64402	D	0.000003	T	0.04227	0.0117	N	0.26042	0.785	0.42105	D	0.991354	P;P	0.37594	0.501;0.601	B;B	0.34038	0.081;0.174	T	0.57774	-0.7753	10	0.28530	T	0.3	.	20.1743	0.98175	0.0:1.0:0.0:0.0	.	309;309	B4DIX8;Q92752	.;TENR_HUMAN	K	309	ENSP00000356646:E309K;ENSP00000263525:E309K	ENSP00000263525:E309K	E	-	1	0	TNR	173638950	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	3.239000	0.51360	2.873000	0.98535	0.561000	0.74099	GAG	-	pfam_EGF_extracell,smart_EG-like_dom		0.607	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	protein_coding	OTTHUMT00000084414.4	C	NM_003285	-		175372327	-1	no_errors	ENST00000263525	ensembl	human	known	74_37	missense	SNP	1.000	T
GRIA1	2890	genome.wustl.edu	37	5	153078447	153078447	+	Silent	SNP	C	C	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr5:153078447C>G	ENST00000285900.5	+	10	1609	c.1266C>G	c.(1264-1266)ctC>ctG	p.L422L	GRIA1_ENST00000518142.1_Silent_p.L342L|GRIA1_ENST00000448073.4_Silent_p.L432L|GRIA1_ENST00000521843.2_Silent_p.L353L|GRIA1_ENST00000340592.5_Silent_p.L422L|GRIA1_ENST00000518783.1_Silent_p.L432L	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	422					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	ATGTGATGCTCAAGAAGAACG	0.507																																																	0								ENSG00000155511						124.0	106.0	112.0					5																	153078447		2203	4300	6503	GRIA1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1266C>G	5.37:g.153078447C>G		Somatic	0	90	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	103	18.25	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.L432	ENST00000285900.5	37	c.1296	CCDS4322.1	5																																																																																			-	pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd		0.507	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	protein_coding	OTTHUMT00000252456.3	C		-		153078447	+1	no_errors	ENST00000448073	ensembl	human	known	74_37	silent	SNP	1.000	G
UGT1A10	54575	genome.wustl.edu	37	2	234545737	234545737	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr2:234545737delT	ENST00000344644.5	+	1	638	c.569delT	c.(568-570)gtcfs	p.V190fs	UGT1A10_ENST00000373445.1_Frame_Shift_Del_p.V190fs|UGT1A1_ENST00000373450.4_Intron	NM_019075.2	NP_061948.1	Q9HAW8	UD110_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A10	190					cellular glucuronidation (GO:0052695)|flavone metabolic process (GO:0051552)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(2)|skin(3)	32		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)	Acetaminophen(DB00316)|Etodolac(DB00749)|Losartan(DB00678)|Mycophenolate mofetil(DB00688)|Valproic Acid(DB00313)	CTTTCCTATGTCCCCAATGAT	0.468																																																	0								ENSG00000242515						167.0	170.0	169.0					2																	234545737		2203	4300	6503	UGT1A10	SO:0001589	frameshift_variant	0				HGNC	U39550	CCDS33403.1	2q37	2010-03-05	2005-07-20		ENSG00000242515	ENSG00000242515		"""UDP glucuronosyltransferases"""	12531	other	complex locus constituent		606435	"""UDP glycosyltransferase 1 family, polypeptide A10"""			9295054, 9325166	Standard	NM_019075		Approved	UGT1J		Q9HAW8	OTTHUMG00000059121	ENST00000344644.5:c.569delT	2.37:g.234545737delT	ENSP00000343838:p.Val190fs	Somatic	0	205	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	115	27.22	O00474|Q6NT91|Q7Z6H8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.V190fs	ENST00000344644.5	37	c.569	CCDS33403.1	2																																																																																			-	pfam_UDP_glucos_trans		0.468	UGT1A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT1A10	protein_coding	OTTHUMT00000130986.1	T	NM_019075			234545737	+1	no_errors	ENST00000344644	ensembl	human	known	74_37	frame_shift_del	DEL	0.999	-
OR1C1	26188	genome.wustl.edu	37	1	247921188	247921188	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:247921188A>G	ENST00000408896.2	-	1	794	c.521T>C	c.(520-522)aTc>aCc	p.I174T		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	174					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			GAAATGATGGATGATATTGGA	0.478																																																	0								ENSG00000221888						67.0	67.0	67.0					1																	247921188		2115	4243	6358	OR1C1	SO:0001583	missense	0			-	HGNC	X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.521T>C	1.37:g.247921188A>G	ENSP00000386138:p.Ile174Thr	Somatic	0	48	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	63	18.18	B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I174T	ENST00000408896.2	37	c.521	CCDS41481.1	1	.	.	.	.	.	.	.	.	.	.	A	18.13	3.555262	0.65425	.	.	ENSG00000221888	ENST00000408896	T	0.00211	8.54	3.19	3.19	0.36642	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00967	0.0032	H	0.97896	4.1	0.22240	N	0.99927	D	0.76494	0.999	D	0.77557	0.99	T	0.18085	-1.0348	9	0.87932	D	0	.	11.5853	0.50914	1.0:0.0:0.0:0.0	.	174	Q15619	OR1C1_HUMAN	T	174	ENSP00000386138:I174T	ENSP00000386138:I174T	I	-	2	0	OR1C1	245987811	0.173000	0.23056	0.978000	0.43139	0.973000	0.67179	4.748000	0.62148	1.459000	0.47892	0.473000	0.43528	ATC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.478	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1C1	protein_coding	OTTHUMT00000096855.1	A		-		247921188	-1	no_errors	ENST00000408896	ensembl	human	known	74_37	missense	SNP	0.749	G
CFAP54	144535	genome.wustl.edu	37	12	97043825	97043825	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:97043825T>G	ENST00000524981.4	+	35	4870	c.4847T>G	c.(4846-4848)aTc>aGc	p.I1616S				Q96N23	CL055_HUMAN		0																	TTTATGAAAATCTTTTTATAC	0.368																																																	0								ENSG00000188596						111.0	116.0	114.0					12																	97043825		2203	4300	6503	C12orf55	SO:0001583	missense	0			-	HGNC																												ENST00000524981.4:c.4847T>G	12.37:g.97043825T>G	ENSP00000431759:p.Ile1616Ser	Somatic	0	136	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	181	15.42		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Fibronectin_type3	p.I1616S	ENST00000524981.4	37	c.4847		12	.	.	.	.	.	.	.	.	.	.	T	12.36	1.915735	0.33815	.	.	ENSG00000188596	ENST00000524981;ENST00000342887	.	.	.	5.75	3.09	0.35607	.	0.194613	0.35646	N	0.003080	T	0.38746	0.1052	L	0.55481	1.735	0.30000	N	0.816127	P	0.49358	0.923	B	0.43916	0.436	T	0.42799	-0.9430	9	0.56958	D	0.05	-5.1623	8.9103	0.35548	0.0:0.1726:0.0:0.8274	.	41	Q6ZTY8	CL063_HUMAN	S	1616;41	.	ENSP00000345466:I41S	I	+	2	0	C12orf63	95567956	1.000000	0.71417	1.000000	0.80357	0.075000	0.17131	1.441000	0.35035	1.019000	0.39547	0.533000	0.62120	ATC	-	NULL		0.368	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	protein_coding	OTTHUMT00000395046.4	T		-		97043825	+1	no_errors	ENST00000524981	ensembl	human	putative	74_37	missense	SNP	0.972	G
CDC16	8881	genome.wustl.edu	37	13	115012590	115012591	+	Intron	INS	-	-	T	rs5807004		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr13:115012590_115012591insT	ENST00000356221.3	+	11	1079				CDC16_ENST00000375310.1_Intron|MIR548AR_ENST00000582191.1_RNA|CDC16_ENST00000252458.6_Intron|CDC16_ENST00000360383.3_Intron|CDC16_ENST00000375312.3_Intron|CDC16_ENST00000375308.1_Intron|CDC16_ENST00000252457.5_Intron			Q13042	CDC16_HUMAN	cell division cycle 16						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of mitosis (GO:0007088)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|spindle (GO:0005819)				endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)			AAGAATAAATGttttttttttt	0.351																																																	0								ENSG00000130177																																			CDC16	SO:0001627	intron_variant	0				HGNC	U18291	CCDS9542.2	13q34	2013-01-17	2013-01-17		ENSG00000130177	ENSG00000130177		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1720	protein-coding gene	gene with protein product	"""anaphase-promoting complex, subunit 6"""	603461	"""CDC16 (cell division cycle 16, S. cerevisiae, homolog)"", ""CDC16 cell division cycle 16 homolog (S. cerevisiae)"", ""cell division cycle 16 homolog (S. cerevisiae)"""			7736578	Standard	NM_001078645		Approved	APC6, ANAPC6, CUT9	uc001vul.1	Q13042	OTTHUMG00000017402	ENST00000356221.3:c.971+111->T	13.37:g.115012601_115012601dupT		Somatic	0	57	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	41	10.87	A2A365|Q5T8C8|Q96AE6|Q9Y564	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000356221.3	37	NULL	CCDS9542.2	13																																																																																			-	-		0.351	CDC16-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDC16	protein_coding	OTTHUMT00000276737.1	-	NM_003903			115012591	+1	no_errors	ENST00000494581	ensembl	human	known	74_37	rna	INS	0.000:0.004	T
MON2	23041	genome.wustl.edu	37	12	62931931	62931931	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:62931931G>T	ENST00000393632.2	+	17	2565	c.2174G>T	c.(2173-2175)gGg>gTg	p.G725V	MON2_ENST00000552115.1_Missense_Mutation_p.G725V|MON2_ENST00000393630.3_Missense_Mutation_p.G725V|MON2_ENST00000546600.1_Missense_Mutation_p.G725V|MON2_ENST00000393629.2_Missense_Mutation_p.G725V|MON2_ENST00000280379.6_Missense_Mutation_p.G725V|MON2_ENST00000552738.1_Missense_Mutation_p.G702V	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	725					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TTGAAACCTGGGAGAGCTGTA	0.358																																																	0								ENSG00000061987						52.0	63.0	59.0					12																	62931931		2203	4300	6503	MON2	SO:0001583	missense	0			-	HGNC		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.2174G>T	12.37:g.62931931G>T	ENSP00000377252:p.Gly725Val	Somatic	0	162	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	116	737	13.60	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1981_Sec7_assoc,superfamily_ARM-type_fold	p.G725V	ENST00000393632.2	37	c.2174	CCDS31849.1	12	.	.	.	.	.	.	.	.	.	.	G	19.62	3.861111	0.71949	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000261188;ENST00000552738;ENST00000393629;ENST00000552115	T;T;T;T;T;T;T	0.58060	0.36;0.36;0.36;0.36;0.38;0.36;0.4	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.59932	0.2230	L	0.58101	1.795	0.80722	D	1	P;P;B;P	0.50528	0.604;0.724;0.39;0.936	B;B;B;P	0.48921	0.205;0.284;0.439;0.595	T	0.58335	-0.7654	9	.	.	.	-11.5637	19.4611	0.94918	0.0:0.0:1.0:0.0	.	725;702;725;725	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-4	.;.;.;.	V	725;725;725;725;653;702;725;725	ENSP00000377252:G725V;ENSP00000377250:G725V;ENSP00000280379:G725V;ENSP00000447407:G725V;ENSP00000449215:G702V;ENSP00000377249:G725V;ENSP00000446635:G725V	.	G	+	2	0	MON2	61218198	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.718000	0.84743	2.657000	0.90304	0.655000	0.94253	GGG	-	NULL		0.358	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON2	protein_coding	OTTHUMT00000406767.3	G	NM_015026	-		62931931	+1	no_errors	ENST00000393630	ensembl	human	known	74_37	missense	SNP	1.000	T
FAM71A	149647	genome.wustl.edu	37	1	212798632	212798632	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:212798632A>T	ENST00000294829.3	+	1	844	c.413A>T	c.(412-414)cAg>cTg	p.Q138L	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	138						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		GAGAAACAACAGCTGCGCCTG	0.483																																																	0								ENSG00000162771						98.0	103.0	101.0					1																	212798632		2203	4300	6503	FAM71A	SO:0001583	missense	0			-	HGNC		CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.413A>T	1.37:g.212798632A>T	ENSP00000294829:p.Gln138Leu	Somatic	0	69	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	39	44.29	Q5VTZ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3699	p.Q138L	ENST00000294829.3	37	c.413	CCDS1507.1	1	.	.	.	.	.	.	.	.	.	.	A	18.44	3.623629	0.66901	.	.	ENSG00000162771	ENST00000294829	T	0.17691	2.26	4.29	4.29	0.51040	.	0.000000	0.49916	D	0.000136	T	0.43188	0.1236	M	0.85299	2.745	0.38450	D	0.946945	D	0.76494	0.999	D	0.91635	0.999	T	0.51888	-0.8648	10	0.72032	D	0.01	-22.3147	10.0499	0.42210	1.0:0.0:0.0:0.0	.	138	Q8IYT1	FA71A_HUMAN	L	138	ENSP00000294829:Q138L	ENSP00000294829:Q138L	Q	+	2	0	FAM71A	210865255	0.992000	0.36948	1.000000	0.80357	0.694000	0.40290	2.083000	0.41615	1.949000	0.56562	0.455000	0.32223	CAG	-	pfam_DUF3699		0.483	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71A	protein_coding	OTTHUMT00000098529.1	A	NM_153606	-		212798632	+1	no_errors	ENST00000294829	ensembl	human	known	74_37	missense	SNP	1.000	T
TENM4	26011	genome.wustl.edu	37	11	78780916	78780916	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr11:78780916G>A	ENST00000278550.7	-	5	536	c.74C>T	c.(73-75)tCg>tTg	p.S25L	TENM4_ENST00000533038.1_5'UTR	NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	25	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										GTCCGCGGACGAGCTGGTGTA	0.687																																																	0								ENSG00000149256						32.0	38.0	36.0					11																	78780916		692	1591	2283	TENM4	SO:0001583	missense	0			-	HGNC	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.74C>T	11.37:g.78780916G>A	ENSP00000278550:p.Ser25Leu	Somatic	0	141	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	94	36.05	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.S25L	ENST00000278550.7	37	c.74	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	G	36	5.877602	0.97055	.	.	ENSG00000149256	ENST00000278550	T	0.41400	1.0	4.54	4.54	0.55810	Teneurin intracellular, N-terminal (2);	0.000000	0.64402	D	0.000001	T	0.64057	0.2564	M	0.71581	2.175	0.58432	D	0.999998	D;D	0.76494	0.999;0.997	D;D	0.77557	0.99;0.968	T	0.65076	-0.6256	9	.	.	.	.	17.8567	0.88765	0.0:0.0:1.0:0.0	.	25;25	G3CAT1;Q6N022	.;TEN4_HUMAN	L	25	ENSP00000278550:S25L	.	S	-	2	0	ODZ4	78458564	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.229000	0.95273	2.525000	0.85131	0.655000	0.94253	TCG	-	pfam_Ten_N		0.687	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	protein_coding	OTTHUMT00000391406.2	G		-		78780916	-1	no_errors	ENST00000278550	ensembl	human	known	74_37	missense	SNP	1.000	A
KIAA1210	57481	genome.wustl.edu	37	X	118221164	118221164	+	Silent	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chrX:118221164C>T	ENST00000402510.2	-	11	4028	c.4029G>A	c.(4027-4029)caG>caA	p.Q1343Q		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1343										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						ACATCTGTGGCTGGAATTTAG	0.483																																																	0								ENSG00000250423						211.0	199.0	203.0					X																	118221164		1931	4138	6069	KIAA1210	SO:0001819	synonymous_variant	0			-	HGNC	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.4029G>A	X.37:g.118221164C>T		Somatic	0	122	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	98	20.33	B7ZCI8|Q5JPN4	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q1343	ENST00000402510.2	37	c.4029	CCDS48156.1	X	.	.	.	.	.	.	.	.	.	.	C	1.808	-0.475486	0.04414	.	.	ENSG00000248857	ENST00000440399	.	.	.	4.38	1.65	0.23941	.	.	.	.	.	T	0.31295	0.0792	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23368	-1.0190	4	.	.	.	.	5.9841	0.19423	0.0:0.6576:0.0:0.3424	.	.	.	.	T	750	.	.	A	-	1	0	KIAA1210	118105192	0.021000	0.18746	0.000000	0.03702	0.010000	0.07245	0.453000	0.21811	0.210000	0.20664	0.513000	0.50165	GCC	-	NULL		0.483	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	protein_coding	OTTHUMT00000371251.2	C	NM_020721	-		118221164	-1	no_errors	ENST00000402510	ensembl	human	known	74_37	silent	SNP	0.000	T
DNAJC8	22826	genome.wustl.edu	37	1	28535045	28535045	+	Intron	DEL	A	A	-			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:28535045delA	ENST00000263697.4	-	6	426				DNAJC8_ENST00000489277.1_Intron	NM_014280.2	NP_055095.2	O75937	DNJC8_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 8						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)				kidney(1)|large_intestine(3)|lung(2)	6		Colorectal(325;3.46e-05)|Lung NSC(340;4.08e-05)|all_lung(284;4.29e-05)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.0105)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		OV - Ovarian serous cystadenocarcinoma(117;2.81e-22)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00275)|BRCA - Breast invasive adenocarcinoma(304;0.0059)|STAD - Stomach adenocarcinoma(196;0.00671)|READ - Rectum adenocarcinoma(331;0.0649)		AGTTTTCATTAAAAAAAAAAA	0.363																																																	0								ENSG00000126698																																			DNAJC8	SO:0001627	intron_variant	0				HGNC	AF083190	CCDS41292.1	1p35	2011-09-02			ENSG00000126698	ENSG00000126698		"""Heat shock proteins / DNAJ (HSP40)"""	15470	protein-coding gene	gene with protein product						11147971	Standard	NM_014280		Approved	SPF31	uc001bpn.3	O75937	OTTHUMG00000003538	ENST00000263697.4:c.400-121T>-	1.37:g.28535045delA		Somatic	0	19	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	29	17.14	B4DUU4|D3DPM0|Q6IBA4|Q8N4Z5|Q9P051|Q9P067	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000263697.4	37	NULL	CCDS41292.1	1																																																																																			-	-		0.363	DNAJC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC8	protein_coding	OTTHUMT00000009860.1	A	NM_014280			28535045	-1	no_errors	ENST00000470967	ensembl	human	known	74_37	rna	DEL	0.000	-
NR1H4	9971	genome.wustl.edu	37	12	100926316	100926316	+	Nonsense_Mutation	SNP	C	C	T	rs113090017		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:100926316C>T	ENST00000551379.1	+	3	584	c.556C>T	c.(556-558)Cga>Tga	p.R186*	NR1H4_ENST00000392986.3_Nonsense_Mutation_p.R176*|NR1H4_ENST00000548884.1_Nonsense_Mutation_p.R176*|NR1H4_ENST00000188403.7_Nonsense_Mutation_p.R186*|NR1H4_ENST00000549996.1_Intron			Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	186					bile acid metabolic process (GO:0008206)|cellular response to acid chemical (GO:0071229)|cellular response to organonitrogen compound (GO:0071417)|digestive tract development (GO:0048565)|gene expression (GO:0010467)|intracellular bile acid receptor signaling pathway (GO:0038185)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitrogen catabolite activation of transcription from RNA polymerase II promoter (GO:0001080)|positive regulation of ammonia assimilation cycle (GO:2001250)|positive regulation of glutamate metabolic process (GO:2000213)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of carbohydrate metabolic process (GO:0006109)|regulation of cholesterol metabolic process (GO:0090181)|regulation of urea metabolic process (GO:0034255)|response to glucose (GO:0009749)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)	bile acid binding (GO:0032052)|bile acid receptor activity (GO:0038181)|chenodeoxycholic acid binding (GO:1902122)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor binding (GO:0016922)|peptide binding (GO:0042277)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	44					Chenodeoxycholic acid(DB06777)	TATGTACATGCGAAGAAAGTG	0.408																																																	0								ENSG00000012504						213.0	189.0	197.0					12																	100926316		2203	4300	6503	NR1H4	SO:0001587	stop_gained	0			-	HGNC	U68233	CCDS9078.1, CCDS55873.1, CCDS55874.1, CCDS55875.1, CCDS55876.1	12q23.1	2013-01-16				ENSG00000012504		"""Nuclear hormone receptors"""	7967	protein-coding gene	gene with protein product		603826				7774010, 9223286	Standard	NM_001206977		Approved	FXR, RIP14, HRR1, HRR-1	uc001tht.2	Q96RI1	OTTHUMG00000170359	ENST00000551379.1:c.556C>T	12.37:g.100926316C>T	ENSP00000447149:p.Arg186*	Somatic	0	159	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	695	149	82.15	A1L4K5|B7Z412|B7ZM06|F8VYG8|Q8NFP5|Q8NFP6|Q92943	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_ThyrH_rcpt	p.R186*	ENST00000551379.1	37	c.556	CCDS55876.1	12	.	.	.	.	.	.	.	.	.	.	C	38	6.639807	0.97726	.	.	ENSG00000012504	ENST00000548884;ENST00000392986;ENST00000551379;ENST00000188403	.	.	.	5.67	-0.234	0.13074	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.6076	0.88042	0.6927:0.3073:0.0:0.0	.	.	.	.	X	176;176;186;186	.	ENSP00000188403:R186X	R	+	1	2	NR1H4	99450447	0.997000	0.39634	0.575000	0.28536	0.909000	0.53808	0.545000	0.23268	-0.168000	0.10853	-1.367000	0.01198	CGA	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt		0.408	NR1H4-006	KNOWN	basic|CCDS	protein_coding	NR1H4	protein_coding	OTTHUMT00000409140.1	C	NM_005123	-		100926316	+1	no_errors	ENST00000551379	ensembl	human	known	74_37	nonsense	SNP	0.997	T
MCM10	55388	genome.wustl.edu	37	10	13214625	13214626	+	Splice_Site	INS	-	-	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr10:13214625_13214626insA	ENST00000484800.2	+	5	558_559	c.455_456insA	c.(454-459)gtagag>gtAagag	p.E153fs	MCM10_ENST00000378694.1_Intron|MCM10_ENST00000378714.3_Intron			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	153	N-terminal domain. {ECO:0000250}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						TTTGATTAAGTAGAGAAGTCTC	0.431																																																	0								ENSG00000065328																																			MCM10	SO:0001630	splice_region_variant	0				HGNC	AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.455-1->A	10.37:g.13214626_13214626dupA		Somatic	0	67	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	57	32.14	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Rep_factor_Mcm10,pfam_Znf_Mcm10/DnaG	p.E153fs	ENST00000484800.2	37	c.455_456	CCDS7096.1	10																																																																																			-	NULL		0.431	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MCM10	protein_coding	OTTHUMT00000356853.1	-	NM_182751		Frame_Shift_Ins	13214626	+1	no_errors	ENST00000484800	ensembl	human	known	74_37	frame_shift_ins	INS	0.076:0.155	A
ARC	23237	genome.wustl.edu	37	8	143693600	143693600	+	3'UTR	SNP	G	G	A	rs587661771		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr8:143693600G>A	ENST00000356613.2	-	0	3002				ARC_ENST00000581404.1_5'UTR	NM_015193.4	NP_056008.1	O60936	NOL3_HUMAN	activity-regulated cytoskeleton-associated protein						apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|response to hypoxia (GO:0001666)|response to injury involved in regulation of muscle adaptation (GO:0014876)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|sarcoplasm (GO:0016528)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	13	all_cancers(97;3.55e-12)|all_epithelial(106;1.03e-08)|Lung NSC(106;0.000353)|all_lung(105;0.00092)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.0279)				CCAGGCGGGCGTGAATCACTG	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		14883	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000198576																																			ARC	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF193421	CCDS34950.1	8q24.3	2008-08-01			ENSG00000198576	ENSG00000198576			648	protein-coding gene	gene with protein product		612461				10970730, 17466953	Standard	NM_015193		Approved	KIAA0278, Arg3.1	uc003ywn.2	Q7LC44	OTTHUMG00000134310	ENST00000356613.2:c.*611C>T	8.37:g.143693600G>A		Somatic	0	75	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	59	20	74.68	B4DFL0|O60937	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000356613.2	37	NULL	CCDS34950.1	8																																																																																			-	-		0.642	ARC-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	ARC	protein_coding	OTTHUMT00000259274.2	G		-		143693600	-1	no_errors	ENST00000581404	ensembl	human	known	74_37	rna	SNP	0.249	A
MEGF6	1953	genome.wustl.edu	37	1	3418451	3418451	+	Silent	SNP	C	C	A	rs200439973	byFrequency	TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:3418451C>A	ENST00000356575.4	-	18	2449	c.2223G>T	c.(2221-2223)tcG>tcT	p.S741S	MEGF6_ENST00000294599.4_Silent_p.S636S	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	741	EGF-like 12. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		AGCAGGAGCTCGAGCAGTTCA	0.682																																					Ovarian(73;978 3658)												0								ENSG00000162591						23.0	32.0	29.0					1																	3418451		2000	4141	6141	MEGF6	SO:0001819	synonymous_variant	0			-	HGNC	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.2223G>T	1.37:g.3418451C>A		Somatic	0	77	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	48	35.14	Q4AC86|Q5VV39	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.S741	ENST00000356575.4	37	c.2223	CCDS41237.1	1																																																																																			-	smart_EG-like_dom		0.682	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF6	protein_coding	OTTHUMT00000354866.1	C	NM_001409	-		3418451	-1	no_errors	ENST00000356575	ensembl	human	known	74_37	silent	SNP	0.000	A
RABGAP1L	9910	genome.wustl.edu	37	1	174769479	174769479	+	Silent	SNP	A	A	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:174769479A>G	ENST00000489615.1	+	1	410	c.9A>G	c.(7-9)gaA>gaG	p.E3E	RABGAP1L_ENST00000367686.3_Intron|RABGAP1L_ENST00000367687.1_Intron|RABGAP1L_ENST00000325589.5_Intron|RABGAP1L_ENST00000347255.2_Intron|RABGAP1L_ENST00000251507.4_Intron	NM_001243765.1	NP_001230694.1	B7ZAP0	RBG10_HUMAN	RAB GTPase activating protein 1-like	0										NS(1)|breast(2)|endometrium(4)|kidney(5)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(2)	45						TCATGGAAGAAGGGGTGCCCT	0.522																																																	0								ENSG00000152061																																			RABGAP1L	SO:0001819	synonymous_variant	0			-	HGNC	AF279778	CCDS1314.1, CCDS41437.1, CCDS55662.1, CCDS58046.1	1q24	2011-11-21			ENSG00000152061	ENSG00000152061			24663	protein-coding gene	gene with protein product		609238				10585558	Standard	NM_014857		Approved	HHL, TBC1D18, KIAA0471, FLJ38519	uc001gjx.3	B7ZAP0	OTTHUMG00000034899	ENST00000489615.1:c.9A>G	1.37:g.174769479A>G		Somatic	0	108	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	88	94	48.35	B7ZAA4	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_Rab-GTPase-TBC_dom	p.E3	ENST00000489615.1	37	c.9	CCDS58046.1	1																																																																																			-	NULL		0.522	RABGAP1L-006	KNOWN	basic|CCDS	protein_coding	RABGAP1L	protein_coding	OTTHUMT00000084502.3	A	NM_001243765	-		174769479	+1	no_errors	ENST00000489615	ensembl	human	known	74_37	silent	SNP	1.000	G
NAV3	89795	genome.wustl.edu	37	12	78515848	78515848	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:78515848C>A	ENST00000397909.2	+	16	4051	c.3878C>A	c.(3877-3879)tCc>tAc	p.S1293Y	NAV3_ENST00000228327.6_Missense_Mutation_p.S1293Y|NAV3_ENST00000266692.7_Intron|NAV3_ENST00000536525.2_Missense_Mutation_p.S1293Y			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1293	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TCACCGTCGTCCGGTACGGGC	0.532										HNSCC(70;0.22)																																							0								ENSG00000067798						50.0	51.0	51.0					12																	78515848		2108	4229	6337	NAV3	SO:0001583	missense	0			-	HGNC	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.3878C>A	12.37:g.78515848C>A	ENSP00000381007:p.Ser1293Tyr	Somatic	0	55	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	193	1505	11.37	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.S1293Y	ENST00000397909.2	37	c.3878		12	.	.	.	.	.	.	.	.	.	.	C	23.5	4.421873	0.83559	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327	T;T;T	0.29655	1.57;1.58;1.56	5.96	5.96	0.96718	.	0.000000	0.38326	U	0.001739	T	0.53818	0.1820	L	0.50333	1.59	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.961;0.997;0.952	T	0.50092	-0.8868	10	0.72032	D	0.01	-13.2083	20.4082	0.99013	0.0:1.0:0.0:0.0	.	1293;1293;1293	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	Y	1293	ENSP00000446132:S1293Y;ENSP00000381007:S1293Y;ENSP00000228327:S1293Y	ENSP00000228327:S1293Y	S	+	2	0	NAV3	77039979	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.590000	0.82653	2.814000	0.96858	0.655000	0.94253	TCC	-	NULL		0.532	NAV3-001	KNOWN	basic	protein_coding	NAV3	protein_coding	OTTHUMT00000406812.1	C	NM_001024383	-		78515848	+1	no_errors	ENST00000397909	ensembl	human	known	74_37	missense	SNP	1.000	A
GOLGA2P5	55592	genome.wustl.edu	37	12	100560181	100560181	+	RNA	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:100560181G>A	ENST00000397112.4	-	0	599					NR_036632.1		Q9HBQ8	GGA2B_HUMAN								Golgi apparatus (GO:0005794)				large_intestine(1)|lung(3)	4						GCACGTGGCTGATGGTGGTGC	0.582																																																	0								ENSG00000238105																																			GOLGA2B			0			-	Clone_based_vega_gene																													12.37:g.100560181G>A		Somatic	0	278	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	999	1383	41.92	Q9NSV2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000397112.4	37	NULL		12																																																																																			-	-		0.582	GOLGA2B-004	KNOWN	basic	processed_transcript	GOLGA2P5	pseudogene	OTTHUMT00000396439.2	G		-		100560181	-1	no_errors	ENST00000421840	ensembl	human	known	74_37	rna	SNP	1.000	A
RNASE10	338879	genome.wustl.edu	37	14	20979050	20979050	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr14:20979050C>A	ENST00000328444.5	+	1	439	c.420C>A	c.(418-420)ttC>ttA	p.F140L	RNASE10_ENST00000430083.1_Missense_Mutation_p.F168L	NM_001012975.1	NP_001012993.1	Q5GAN6	RNS10_HUMAN	ribonuclease, RNase A family, 10 (non-active)	140					epithelial cell morphogenesis (GO:0003382)|heterotypic cell-cell adhesion (GO:0034113)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of sperm motility (GO:1902093)|regulation of fertilization (GO:0080154)|seminiferous tubule development (GO:0072520)|single fertilization (GO:0007338)	extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(2)|lung(8)|urinary_tract(1)	12	all_cancers(95;0.00123)		Epithelial(56;1.81e-07)|all cancers(55;1.86e-06)	GBM - Glioblastoma multiforme(265;0.022)|READ - Rectum adenocarcinoma(17;0.191)		AGTATGCATTCATCCATGAGG	0.458																																																	0								ENSG00000182545						136.0	98.0	111.0					14																	20979050		2203	4300	6503	RNASE10	SO:0001583	missense	0			-	HGNC		CCDS32035.1	14q11.1	2004-11-16				ENSG00000182545		"""Ribonucleases, RNase A"""	19275	protein-coding gene	gene with protein product						12920233	Standard	XM_005267584		Approved	RNASE9	uc010tlj.2	Q5GAN6		ENST00000328444.5:c.420C>A	14.37:g.20979050C>A	ENSP00000333358:p.Phe140Leu	Somatic	0	36	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	39	30.36	A2RUQ3|B4DKY4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	p.F140L	ENST00000328444.5	37	c.420	CCDS32035.1	14	.	.	.	.	.	.	.	.	.	.	C	13.29	2.191938	0.38707	.	.	ENSG00000182545	ENST00000430083;ENST00000328444	T;T	0.38240	1.15;1.15	4.82	1.71	0.24356	Ribonuclease A, domain (3);	0.000000	0.85682	D	0.000000	T	0.58293	0.2112	M	0.87547	2.89	0.33160	D	0.54679	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	T	0.66913	-0.5803	10	0.87932	D	0	-9.3092	6.523	0.22285	0.0:0.6737:0.0:0.3263	.	140;168	Q5GAN6;B4DKY4	RNS10_HUMAN;.	L	168;140	ENSP00000392996:F168L;ENSP00000333358:F140L	ENSP00000333358:F140L	F	+	3	2	RNASE10	20048890	1.000000	0.71417	0.993000	0.49108	0.038000	0.13279	0.734000	0.26101	0.632000	0.30432	0.655000	0.94253	TTC	-	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA		0.458	RNASE10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASE10	protein_coding	OTTHUMT00000411088.1	C	XM_292225	-		20979050	+1	no_errors	ENST00000328444	ensembl	human	known	74_37	missense	SNP	0.995	A
GPR156	165829	genome.wustl.edu	37	3	119900165	119900165	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr3:119900165C>A	ENST00000464295.1	-	8	1185	c.740G>T	c.(739-741)gGc>gTc	p.G247V	GPR156_ENST00000315843.3_Missense_Mutation_p.G247V|GPR156_ENST00000461057.1_Missense_Mutation_p.G243V			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	247						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		GCTGACATGGCCAGTCAGGCC	0.562																																																	0								ENSG00000175697						69.0	65.0	66.0					3																	119900165		2203	4300	6503	GPR156	SO:0001583	missense	0			-	HGNC	AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.740G>T	3.37:g.119900165C>A	ENSP00000417261:p.Gly247Val	Somatic	0	62	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	51	37.04	B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3_GABA_rcpt_B	p.G247V	ENST00000464295.1	37	c.740	CCDS2997.1	3	.	.	.	.	.	.	.	.	.	.	C	15.35	2.806265	0.50421	.	.	ENSG00000175697	ENST00000464295;ENST00000315843;ENST00000461057	D;D;D	0.87571	-2.27;-2.27;-2.27	6.08	3.62	0.41486	GPCR, family 3, C-terminal (2);	0.306556	0.31685	N	0.007240	T	0.73249	0.3563	N	0.08118	0	0.42125	D	0.991442	P;P	0.42584	0.784;0.784	B;B	0.42138	0.377;0.377	T	0.69266	-0.5190	9	.	.	.	-6.1148	8.5445	0.33413	0.0:0.1725:0.0:0.8275	.	243;247	E9PFZ4;Q8NFN8	.;GP156_HUMAN	V	247;247;243	ENSP00000417261:G247V;ENSP00000324553:G247V;ENSP00000418758:G243V	.	G	-	2	0	GPR156	121382855	1.000000	0.71417	0.921000	0.36526	0.958000	0.62258	3.427000	0.52785	1.027000	0.39758	-0.345000	0.07892	GGC	-	pfam_GPCR_3_C,pfscan_GPCR_3_C		0.562	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR156	protein_coding	OTTHUMT00000355139.1	C	NM_153002	-		119900165	-1	no_errors	ENST00000315843	ensembl	human	known	74_37	missense	SNP	0.994	A
AVIL	10677	genome.wustl.edu	37	12	58204272	58204272	+	Silent	SNP	C	C	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:58204272C>G	ENST00000257861.3	-	6	1051	c.621G>C	c.(619-621)gtG>gtC	p.V207V	AVIL_ENST00000537081.1_Silent_p.V200V	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	207	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					CTCCCTCGATCACTCCTATTT	0.562																																																	0								ENSG00000135407						115.0	100.0	105.0					12																	58204272		2203	4300	6503	AVIL	SO:0001819	synonymous_variant	0			-	HGNC	AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.621G>C	12.37:g.58204272C>G		Somatic	0	68	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	492	88	84.83	B2RAU7|Q2NKM9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.V207	ENST00000257861.3	37	c.621	CCDS8959.1	12																																																																																			-	pfam_Gelsolin_dom,smart_Villin/Gelsolin		0.562	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVIL	protein_coding	OTTHUMT00000409276.1	C	NM_006576	-		58204272	-1	no_errors	ENST00000257861	ensembl	human	known	74_37	silent	SNP	1.000	G
TUBB8	347688	genome.wustl.edu	37	10	95173	95173	+	Silent	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr10:95173C>T	ENST00000309812.4	-	1	68	c.6G>A	c.(4-6)agG>agA	p.R2R	TUBB8_ENST00000413237.3_Intron|TUBB8_ENST00000447903.2_Intron|TUBB8_ENST00000332708.5_Silent_p.R2R	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	2					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		GCACGATCTCCCTCATGGCCA	0.672																																					Pancreas(192;2041 3010 9013 18103)												0								ENSG00000173876						18.0	16.0	17.0					10																	95173		2196	4295	6491	TUBB8	SO:0001819	synonymous_variant	0			-	HGNC	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.6G>A	10.37:g.95173C>T		Somatic	0	212	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	81	131	38.03	Q5SQX9|Q8WZ78	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.R2	ENST00000309812.4	37	c.6	CCDS7051.1	10																																																																																			-	pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase		0.672	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB8	protein_coding	OTTHUMT00000467795.1	C	NM_177987	-		95173	-1	no_errors	ENST00000309812	ensembl	human	known	74_37	silent	SNP	1.000	T
TRIP12	9320	genome.wustl.edu	37	2	230683116	230683116	+	Silent	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr2:230683116C>T	ENST00000283943.5	-	8	1597	c.1419G>A	c.(1417-1419)ctG>ctA	p.L473L	TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389045.3_Silent_p.L176L|TRIP12_ENST00000389044.4_Silent_p.L521L	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	473					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		GAAACCCTCCCAGTGTCTCCT	0.438																																																	0								ENSG00000153827						149.0	143.0	145.0					2																	230683116		2203	4300	6503	TRIP12	SO:0001819	synonymous_variant	0			-	HGNC	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.1419G>A	2.37:g.230683116C>T		Somatic	0	70	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	20	65.52	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HECT,superfamily_HECT,superfamily_ARM-type_fold,smart_HECT,pfscan_HECT,pfscan_WWE-dom	p.L473	ENST00000283943.5	37	c.1419	CCDS33391.1	2																																																																																			-	superfamily_ARM-type_fold		0.438	TRIP12-001	KNOWN	basic|CCDS	protein_coding	TRIP12	protein_coding	OTTHUMT00000331861.3	C	NM_004238	-		230683116	-1	no_errors	ENST00000283943	ensembl	human	known	74_37	silent	SNP	1.000	T
FAT3	120114	genome.wustl.edu	37	11	92523332	92523332	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr11:92523332C>T	ENST00000298047.6	+	7	4576	c.4559C>T	c.(4558-4560)aCt>aTt	p.T1520I	FAT3_ENST00000525166.1_Missense_Mutation_p.T1370I|FAT3_ENST00000409404.2_Missense_Mutation_p.T1520I			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1520	Cadherin 14. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GTGCTCTATACTGCCGAGAGG	0.488										TCGA Ovarian(4;0.039)																																							0								ENSG00000165323						157.0	153.0	154.0					11																	92523332		2034	4194	6228	FAT3	SO:0001583	missense	0			-	HGNC	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.4559C>T	11.37:g.92523332C>T	ENSP00000298047:p.Thr1520Ile	Somatic	0	52	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	B5MDB0|Q96AU6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.T1520I	ENST00000298047.6	37	c.4559		11	.	.	.	.	.	.	.	.	.	.	C	15.43	2.830117	0.50845	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.01613	4.73;4.73;4.73	6.17	4.0	0.46444	.	.	.	.	.	T	0.03348	0.0097	M	0.66297	2.02	0.80722	D	1	B	0.22800	0.075	B	0.27608	0.081	T	0.45249	-0.9274	9	0.21014	T	0.42	.	14.0278	0.64597	0.0:0.8588:0.0:0.1412	.	1520	Q8TDW7-3	.	I	1520;1520;1370	ENSP00000298047:T1520I;ENSP00000387040:T1520I;ENSP00000432586:T1370I	ENSP00000298047:T1520I	T	+	2	0	FAT3	92162980	1.000000	0.71417	0.597000	0.28824	0.321000	0.28281	4.894000	0.63206	1.616000	0.50265	0.655000	0.94253	ACT	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.488	FAT3-201	KNOWN	basic	protein_coding	FAT3	protein_coding		C	NM_001008781	-		92523332	+1	no_errors	ENST00000298047	ensembl	human	known	74_37	missense	SNP	0.992	T
RNF31	55072	genome.wustl.edu	37	14	24620802	24620802	+	Missense_Mutation	SNP	C	C	T	rs374504041		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr14:24620802C>T	ENST00000324103.6	+	10	2166	c.1846C>T	c.(1846-1848)Cgc>Tgc	p.R616C	RNF31_ENST00000559275.1_Missense_Mutation_p.R465C|RNF31_ENST00000382687.3_Missense_Mutation_p.R465C|RP11-468E2.4_ENST00000558468.1_Missense_Mutation_p.R91C	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	616	Interaction with RBCK1.				CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		ACAGCGCCAACGCCTAGAGCC	0.647																																																	0								ENSG00000092098	C	CYS/ARG	0,3998		0,0,1999	44.0	47.0	46.0		1846	5.4	1.0	14		46	1,8339		0,1,4169	no	missense	RNF31	NM_017999.4	180	0,1,6168	TT,TC,CC		0.012,0.0,0.0081	probably-damaging	616/1073	24620802	1,12337	1999	4170	6169	RNF31	SO:0001583	missense	0			-	HGNC	AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.1846C>T	14.37:g.24620802C>T	ENSP00000315112:p.Arg616Cys	Somatic	0	66	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	66	24.14	A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PUB_domain,pfam_Znf_C6HC,superfamily_UBA-like,superfamily_DEATH-like_dom,superfamily_Znf_FYVE_PHD,smart_Znf_RanBP2,smart_Znf_C6HC,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RanBP2	p.R616C	ENST00000324103.6	37	c.1846	CCDS41931.1	14	.	.	.	.	.	.	.	.	.	.	C	22.6	4.317757	0.81469	0.0	1.2E-4	ENSG00000092098	ENST00000324103;ENST00000382687	T;T	0.45276	0.9;0.9	5.42	5.42	0.78866	.	0.070986	0.64402	D	0.000014	T	0.50871	0.1641	L	0.36672	1.1	0.58432	D	0.999999	D;D;D	0.76494	0.965;0.999;0.999	B;P;P	0.56700	0.443;0.549;0.804	T	0.50964	-0.8765	10	0.72032	D	0.01	-14.5947	18.1527	0.89679	0.0:1.0:0.0:0.0	.	375;616;465	B3KV71;Q96EP0;Q96EP0-3	.;RNF31_HUMAN;.	C	616;465	ENSP00000315112:R616C;ENSP00000372134:R465C	ENSP00000315112:R616C	R	+	1	0	RNF31	23690642	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.462000	0.53042	2.819000	0.97034	0.655000	0.94253	CGC	-	superfamily_DEATH-like_dom		0.647	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF31	protein_coding	OTTHUMT00000071921.3	C	NM_017999	-		24620802	+1	no_errors	ENST00000324103	ensembl	human	known	74_37	missense	SNP	1.000	T
TRIM42	287015	genome.wustl.edu	37	3	140401456	140401456	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr3:140401456T>C	ENST00000286349.3	+	2	685	c.494T>C	c.(493-495)cTg>cCg	p.L165P		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	165						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						AACCACAGCCTGTGCGAGAAG	0.602																																																	0								ENSG00000155890						111.0	101.0	104.0					3																	140401456		2203	4300	6503	TRIM42	SO:0001583	missense	0			-	HGNC	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.494T>C	3.37:g.140401456T>C	ENSP00000286349:p.Leu165Pro	Somatic	0	50	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	34	20.93	A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Znf_B-box,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.L165P	ENST00000286349.3	37	c.494	CCDS3113.1	3	.	.	.	.	.	.	.	.	.	.	T	16.78	3.216675	0.58452	.	.	ENSG00000155890	ENST00000286349	T	0.40756	1.02	5.22	5.22	0.72569	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);	0.202363	0.24886	N	0.034812	T	0.51109	0.1655	L	0.52011	1.625	0.58432	D	0.999995	D	0.67145	0.996	P	0.56700	0.804	T	0.54397	-0.8300	10	0.87932	D	0	-4.5405	11.4966	0.50413	0.0:0.0:0.0:1.0	.	165	Q8IWZ5	TRI42_HUMAN	P	165	ENSP00000286349:L165P	ENSP00000286349:L165P	L	+	2	0	TRIM42	141884146	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	4.703000	0.61824	1.978000	0.57642	0.459000	0.35465	CTG	-	pfscan_Znf_RING		0.602	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM42	protein_coding	OTTHUMT00000359531.2	T	NM_152616	-		140401456	+1	no_errors	ENST00000286349	ensembl	human	known	74_37	missense	SNP	1.000	C
OR2T8	343172	genome.wustl.edu	37	1	248084655	248084655	+	Silent	SNP	C	C	T	rs112164391		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:248084655C>T	ENST00000319968.4	+	1	336	c.336C>T	c.(334-336)ctC>ctT	p.L112L		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	112						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			AGTGCTTCCTCTTAGCAGCCA	0.597																																																	0								ENSG00000177462						5.0	2.0	3.0					1																	248084655		1551	3034	4585	OR2T8	SO:0001819	synonymous_variant	0			-	HGNC		CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.336C>T	1.37:g.248084655C>T		Somatic	0	34	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	31	13.89		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L112	ENST00000319968.4	37	c.336	CCDS31100.1	1																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.597	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T8	protein_coding	OTTHUMT00000096862.1	C	NM_001005522	rs112164391		248084655	+1	no_errors	ENST00000319968	ensembl	human	known	74_37	silent	SNP	0.314	T
CAND1	55832	genome.wustl.edu	37	12	67675789	67675790	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:67675789_67675790insG	ENST00000545606.1	+	2	605_606	c.168_169insG	c.(169-171)ttgfs	p.L57fs		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	57					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		TTTTGAAGTTATTGGAAGATAA	0.361																																																	0								ENSG00000111530																																			CAND1	SO:0001589	frameshift_variant	0				HGNC		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	Exception_encountered	12.37:g.67675789_67675790insG	ENSP00000442318:p.Leu57fs	Somatic	0	120	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	76	510	12.97	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_TATA-bd_TIP120,pfam_HEAT,superfamily_ARM-type_fold	p.L56fs	ENST00000545606.1	37	c.168_169	CCDS8977.1	12																																																																																			-	pfam_HEAT,superfamily_ARM-type_fold		0.361	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAND1	protein_coding	OTTHUMT00000402105.1	-	NM_018448			67675790	+1	no_errors	ENST00000545606	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	G
PBRM1	55193	genome.wustl.edu	37	3	52643669	52643669	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr3:52643669A>T	ENST00000296302.7	-	16	2228	c.2227T>A	c.(2227-2229)Tct>Act	p.S743T	PBRM1_ENST00000356770.4_Missense_Mutation_p.S711T|PBRM1_ENST00000409114.3_Missense_Mutation_p.S758T|PBRM1_ENST00000409767.1_Missense_Mutation_p.S758T|PBRM1_ENST00000409057.1_Missense_Mutation_p.S743T|PBRM1_ENST00000410007.1_Missense_Mutation_p.S743T|PBRM1_ENST00000394830.3_Missense_Mutation_p.S743T|PBRM1_ENST00000337303.4_Missense_Mutation_p.S743T			Q86U86	PB1_HUMAN	polybromo 1	743	Bromo 5. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TAGATCAAAGACTCCGGCTCA	0.428			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0								ENSG00000163939						125.0	122.0	123.0					3																	52643669		2203	4300	6503	PBRM1	SO:0001583	missense	0			-	HGNC	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.2227T>A	3.37:g.52643669A>T	ENSP00000296302:p.Ser743Thr	Somatic	0	88	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	62	42.59	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Bromodomain,pfam_BAH_dom,pfam_HMG_box_dom,superfamily_Bromodomain,superfamily_HMG_box_dom,smart_Bromodomain,smart_BAH_dom,smart_HMG_box_dom,pfscan_BAH_dom,pfscan_HMG_box_dom,pfscan_Bromodomain,prints_Bromodomain	p.S743T	ENST00000296302.7	37	c.2227		3	.	.	.	.	.	.	.	.	.	.	A	19.16	3.773904	0.69992	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	T;T;T;T;T;T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84	6.17	6.17	0.99709	Bromodomain (5);	0.000000	0.85682	D	0.000000	T	0.47303	0.1438	L	0.49640	1.575	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.76494	0.994;0.987;0.998;0.999;0.987;0.987;0.984;0.999;0.999;0.984;0.984	D;D;D;D;D;D;D;D;D;D;D	0.85130	0.985;0.982;0.996;0.997;0.978;0.978;0.969;0.994;0.997;0.969;0.969	T	0.34502	-0.9826	10	0.54805	T	0.06	-39.086	16.8222	0.85835	1.0:0.0:0.0:0.0	.	743;118;743;743;743;743;758;758;743;711;743	Q86U86-9;Q6IRX1;Q86U86-6;E7EVG2;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;.;.;.;PB1_HUMAN;.;.	T	711;743;743;743;743;743;758;758;743;702	ENSP00000349213:S711T;ENSP00000378307:S743T;ENSP00000296302:S743T;ENSP00000338302:S743T;ENSP00000386593:S743T;ENSP00000386529:S743T;ENSP00000386643:S758T;ENSP00000386601:S758T;ENSP00000387775:S743T;ENSP00000397662:S702T	ENSP00000296302:S743T	S	-	1	0	PBRM1	52618709	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	9.307000	0.96226	2.371000	0.80710	0.533000	0.62120	TCT	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain		0.428	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	PBRM1	protein_coding	OTTHUMT00000327232.1	A	NM_018165	-		52643669	-1	no_errors	ENST00000296302	ensembl	human	known	74_37	missense	SNP	1.000	T
CDH9	1007	genome.wustl.edu	37	5	26988429	26988429	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr5:26988429G>T	ENST00000231021.4	-	2	184	c.12C>A	c.(10-12)taC>taA	p.Y4*		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	4					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y4Y(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						GTATATAATGGTAAGTCCTCA	0.323																																					Melanoma(8;187 585 15745 40864 52829)												1	Substitution - coding silent(1)	ovary(1)						ENSG00000113100						115.0	121.0	119.0					5																	26988429		2203	4300	6503	CDH9	SO:0001587	stop_gained	0			-	HGNC	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.12C>A	5.37:g.26988429G>T	ENSP00000231021:p.Tyr4*	Somatic	0	83	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	64	34.69	Q3B7I5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Y4*	ENST00000231021.4	37	c.12	CCDS3893.1	5	.	.	.	.	.	.	.	.	.	.	G	20.6	4.013996	0.75161	.	.	ENSG00000113100	ENST00000231021;ENST00000513289;ENST00000511822	.	.	.	5.64	-0.691	0.11305	.	1.118860	0.06498	N	0.735813	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.6663	0.23042	0.5324:0.0:0.3457:0.1218	.	.	.	.	X	4	.	.	Y	-	3	2	CDH9	27024186	0.010000	0.17322	0.046000	0.18839	0.396000	0.30629	-0.197000	0.09518	-0.188000	0.10499	0.591000	0.81541	TAC	-	NULL		0.323	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	protein_coding	OTTHUMT00000207352.1	G	NM_016279	-		26988429	-1	no_errors	ENST00000231021	ensembl	human	known	74_37	nonsense	SNP	0.001	T
CAND1	55832	genome.wustl.edu	37	12	67675783	67675786	+	Frame_Shift_Del	DEL	GAAG	GAAG	-			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	GAAG	GAAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:67675783_67675786delGAAG	ENST00000545606.1	+	2	599_602	c.162_165delGAAG	c.(160-165)ttgaagfs	p.LK54fs		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	54					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		AAATGATTTTGAAGTTATTGGAAG	0.363																																																	0								ENSG00000111530																																			CAND1	SO:0001589	frameshift_variant	0				HGNC		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.162_165delGAAG	12.37:g.67675783_67675786delGAAG	ENSP00000442318:p.Leu54fs	Somatic	0	115	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	74	479	13.38	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_TATA-bd_TIP120,pfam_HEAT,superfamily_ARM-type_fold	p.L54fs	ENST00000545606.1	37	c.162_165	CCDS8977.1	12																																																																																			-	pfam_HEAT,superfamily_ARM-type_fold		0.363	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAND1	protein_coding	OTTHUMT00000402105.1	GAAG	NM_018448			67675786	+1	no_errors	ENST00000545606	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000	-
CRHR2	1395	genome.wustl.edu	37	7	30721622	30721622	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr7:30721622C>G	ENST00000471646.1	-	2	555	c.138G>C	c.(136-138)caG>caC	p.Q46H	CRHR2_ENST00000506074.2_Missense_Mutation_p.Q46H|CRHR2_ENST00000348438.4_Missense_Mutation_p.Q73H|CRHR2_ENST00000341843.4_Missense_Mutation_p.Q32H	NM_001202482.1|NM_001202483.1|NM_001883.4	NP_001189411.1|NP_001189412.1|NP_001874.2	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	46					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						ACGTTCCGATCTGGTCCAAGG	0.687																																																	0								ENSG00000106113						29.0	27.0	28.0					7																	30721622		2200	4293	6493	CRHR2	SO:0001583	missense	0			-	HGNC		CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000471646.1:c.138G>C	7.37:g.30721622C>G	ENSP00000418722:p.Gln46His	Somatic	0	209	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	200	165	54.79	B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,prints_GPCR_2_CRF_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CRF2_rcpt,prints_GPCR_2_diuretic_rcpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.Q73H	ENST00000471646.1	37	c.219	CCDS5429.1	7	.	.	.	.	.	.	.	.	.	.	C	14.88	2.667219	0.47677	.	.	ENSG00000106113	ENST00000471646;ENST00000348438;ENST00000341843;ENST00000506074	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	4.27	2.44	0.29823	GPCR, family 2, secretin-like, conserved site (1);GPCR, family 2, extracellular hormone receptor domain (3);	0.369023	0.25514	N	0.030146	T	0.61800	0.2376	L	0.49126	1.545	0.37606	D	0.920756	P;P;P;P;P	0.48089	0.681;0.792;0.905;0.837;0.681	B;B;P;P;B	0.52217	0.311;0.404;0.693;0.605;0.311	T	0.62153	-0.6914	10	0.41790	T	0.15	.	7.7429	0.28851	0.0:0.7416:0.165:0.0934	.	46;46;73;32;46	B3SXT0;B3SXS6;Q13324-2;Q13324-3;Q13324	.;.;.;.;CRFR2_HUMAN	H	46;73;32;46	ENSP00000418722:Q46H;ENSP00000340943:Q73H;ENSP00000344304:Q32H;ENSP00000426498:Q46H	ENSP00000344304:Q32H	Q	-	3	2	CRHR2	30688147	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	2.326000	0.43849	0.552000	0.29026	-0.140000	0.14226	CAG	-	pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom		0.687	CRHR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CRHR2	protein_coding	OTTHUMT00000250448.3	C		-		30721622	-1	no_errors	ENST00000348438	ensembl	human	known	74_37	missense	SNP	1.000	G
MUC16	94025	genome.wustl.edu	37	19	9068845	9068845	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr19:9068845T>G	ENST00000397910.4	-	3	18804	c.18601A>C	c.(18601-18603)Aac>Cac	p.N6201H		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6203	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGATCATTGTTCATGACACTG	0.478																																																	0								ENSG00000181143						114.0	116.0	116.0					19																	9068845		2075	4191	6266	MUC16	SO:0001583	missense	0			-	HGNC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.18601A>C	19.37:g.9068845T>G	ENSP00000381008:p.Asn6201His	Somatic	0	199	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	108	174	38.16	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.N6201H	ENST00000397910.4	37	c.18601	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	t	0.889	-0.726098	0.03158	.	.	ENSG00000181143	ENST00000397910	T	0.22743	1.94	1.09	-2.17	0.07059	.	.	.	.	.	T	0.08358	0.0208	N	0.08118	0	.	.	.	D	0.53462	0.96	B	0.41299	0.353	T	0.16335	-1.0406	8	0.87932	D	0	.	2.2608	0.04067	0.0:0.2886:0.3088:0.4026	.	6201	B5ME49	.	H	6201	ENSP00000381008:N6201H	ENSP00000381008:N6201H	N	-	1	0	MUC16	8929845	0.001000	0.12720	0.001000	0.08648	0.007000	0.05969	0.365000	0.20348	-0.823000	0.04301	0.317000	0.21355	AAC	-	NULL		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	T	NM_024690	-		9068845	-1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	SNP	0.000	G
TOX	9760	genome.wustl.edu	37	8	59851920	59851920	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr8:59851920T>A	ENST00000361421.1	-	3	572	c.352A>T	c.(352-354)Atc>Ttc	p.I118F		NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	118						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				GAGACTGTGATTTCAGGGAGG	0.473																																					Pancreas(161;610 1969 17913 21374 22725)												0								ENSG00000198846						137.0	130.0	132.0					8																	59851920		2203	4300	6503	TOX	SO:0001583	missense	0			-	HGNC		CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.352A>T	8.37:g.59851920T>A	ENSP00000354842:p.Ile118Phe	Somatic	0	278	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	103	165	38.43	Q96AV5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.I118F	ENST00000361421.1	37	c.352	CCDS34897.1	8	.	.	.	.	.	.	.	.	.	.	T	14.89	2.669984	0.47677	.	.	ENSG00000198846	ENST00000361421	T	0.42131	0.98	5.56	5.56	0.83823	.	0.054103	0.64402	D	0.000001	T	0.40956	0.1138	L	0.60455	1.87	0.53005	D	0.999962	P	0.39480	0.675	B	0.36567	0.228	T	0.29971	-0.9994	9	.	.	.	.	15.7046	0.77569	0.0:0.0:0.0:1.0	.	118	O94900	TOX_HUMAN	F	118	ENSP00000354842:I118F	.	I	-	1	0	TOX	60014474	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.705000	0.61838	2.123000	0.65237	0.482000	0.46254	ATC	-	NULL		0.473	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOX	protein_coding	OTTHUMT00000378307.1	T	NM_014729	-		59851920	-1	no_errors	ENST00000361421	ensembl	human	known	74_37	missense	SNP	1.000	A
CD97	976	genome.wustl.edu	37	19	14507287	14507287	+	Splice_Site	SNP	T	T	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr19:14507287T>C	ENST00000242786.5	+	5	558		c.e5+2		CD97_ENST00000587728.1_Intron|CD97_ENST00000358600.3_Intron|CD97_ENST00000357355.3_Splice_Site	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule						cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						TCTGCACAGGTAGAGGCCCCA	0.612																																																	0								ENSG00000123146						101.0	83.0	89.0					19																	14507287		2203	4300	6503	CD97	SO:0001630	splice_region_variant	0			-	HGNC		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.478+2T>C	19.37:g.14507287T>C		Somatic	1	182	0.55		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	56	142	28.14	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e5+2	ENST00000242786.5	37	c.478+2	CCDS32929.1	19	.	.	.	.	.	.	.	.	.	.	T	10.13	1.266603	0.23136	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000393059	.	.	.	4.09	4.09	0.47781	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.3798	0.38306	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	CD97	14368287	0.962000	0.33011	0.919000	0.36401	0.077000	0.17291	1.078000	0.30754	1.713000	0.51359	0.454000	0.30748	.	-	-		0.612	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CD97	protein_coding	OTTHUMT00000459821.2	T	NM_078481	-	Intron	14507287	+1	no_errors	ENST00000242786	ensembl	human	known	74_37	splice_site	SNP	0.995	C
KRR1	11103	genome.wustl.edu	37	12	75905323	75905323	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:75905323G>A	ENST00000229214.4	-	1	78	c.55C>T	c.(55-57)Cgt>Tgt	p.R19C	KRR1_ENST00000438169.2_Missense_Mutation_p.R19C	NM_007043.6	NP_008974.5	Q13601	KRR1_HUMAN	KRR1, small subunit (SSU) processome component, homolog (yeast)	19					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	11						TTCTGGTTACGAAATTCACTT	0.502																																																	0								ENSG00000111615						117.0	107.0	110.0					12																	75905323		2203	4300	6503	KRR1	SO:0001583	missense	0			-	HGNC	U55766	CCDS9012.1	12q	2011-03-15	2006-05-18	2006-05-18	ENSG00000111615	ENSG00000111615			5176	protein-coding gene	gene with protein product		612817	"""HIV-1 rev binding protein 2"", ""HIV-1 Rev binding protein 2"""	HRB2		7505766, 11027267, 11359931, 8675026	Standard	NM_007043		Approved	RIP-1	uc001sxt.3	Q13601	OTTHUMG00000169759	ENST00000229214.4:c.55C>T	12.37:g.75905323G>A	ENSP00000229214:p.Arg19Cys	Somatic	0	79	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	269	744	26.55	A0FIK6|A0JLP0|B2R989|E7EUQ0|Q8NEA8|Q8TC37|Q96AT5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KH_dom_type_1,smart_KH_dom	p.R19C	ENST00000229214.4	37	c.55	CCDS9012.1	12	.	.	.	.	.	.	.	.	.	.	G	16.79	3.221026	0.58560	.	.	ENSG00000111615	ENST00000229214;ENST00000438169	T;T	0.51071	0.73;0.72	4.27	4.27	0.50696	.	0.389989	0.24645	N	0.036769	T	0.56108	0.1963	M	0.83603	2.65	0.28453	N	0.916252	D;D;D	0.61697	0.987;0.975;0.99	P;B;B	0.47015	0.534;0.333;0.425	T	0.62072	-0.6931	10	0.87932	D	0	16.4917	12.5093	0.55999	0.0:0.0:1.0:0.0	.	19;19;19	B4DMS5;E7EUQ0;Q13601	.;.;KRR1_HUMAN	C	19	ENSP00000229214:R19C;ENSP00000411740:R19C	ENSP00000229214:R19C	R	-	1	0	KRR1	74191590	0.260000	0.24053	0.387000	0.26183	0.134000	0.20937	2.168000	0.42424	2.661000	0.90470	0.650000	0.86243	CGT	-	NULL		0.502	KRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRR1	protein_coding	OTTHUMT00000405727.1	G	NM_007043	-		75905323	-1	no_errors	ENST00000229214	ensembl	human	known	74_37	missense	SNP	0.414	A
MUC16	94025	genome.wustl.edu	37	19	9056656	9056656	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr19:9056656T>C	ENST00000397910.4	-	3	30993	c.30790A>G	c.(30790-30792)Aca>Gca	p.T10264A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10266	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGCAAATCTGTACTCAGATGA	0.463																																																	0								ENSG00000181143						75.0	76.0	75.0					19																	9056656		1990	4143	6133	MUC16	SO:0001583	missense	0			-	HGNC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.30790A>G	19.37:g.9056656T>C	ENSP00000381008:p.Thr10264Ala	Somatic	0	67	0.00		0.6252645868475969	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	67	27.17	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.T10264A	ENST00000397910.4	37	c.30790	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	t	6.422	0.446073	0.12164	.	.	ENSG00000181143	ENST00000397910	T	0.02301	4.35	3.23	2.21	0.28008	.	.	.	.	.	T	0.04363	0.0120	N	0.19112	0.55	.	.	.	D	0.76494	0.999	D	0.80764	0.994	T	0.39272	-0.9622	8	0.87932	D	0	.	4.8723	0.13639	0.0:0.1418:0.0:0.8582	.	10264	B5ME49	.	A	10264	ENSP00000381008:T10264A	ENSP00000381008:T10264A	T	-	1	0	MUC16	8917656	0.005000	0.15991	0.006000	0.13384	0.033000	0.12548	0.931000	0.28871	0.641000	0.30601	0.378000	0.23410	ACA	-	NULL		0.463	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	T	NM_024690	-		9056656	-1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	SNP	0.007	C
