#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
RBMXL2	27288	genome.wustl.edu	37	11	7110476	7110476	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr11:7110476A>G	ENST00000306904.5	+	1	312	c.125A>G	c.(124-126)gAc>gGc	p.D42G		NM_014469.4	NP_055284.3	O75526	RMXL2_HUMAN	RNA binding motif protein, X-linked-like 2	42	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CTGATGAAAGACCGAGAAACC	0.582																																																	0								ENSG00000170748						44.0	43.0	43.0					11																	7110476		2201	4296	6497	RBMXL2	SO:0001583	missense	0			-	HGNC	AF069682	CCDS7777.1	11p15	2013-07-16				ENSG00000170748		"""RNA binding motif (RRM) containing"""	17886	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G T"""	605444				10958650	Standard	NM_014469		Approved	HNRNPG-T, HNRPGT	uc001mfc.2	O75526		ENST00000306904.5:c.125A>G	11.37:g.7110476A>G	ENSP00000304139:p.Asp42Gly	Somatic	0	72	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	60	9.09	Q6PEZ2|Q9NQU0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.D42G	ENST00000306904.5	37	c.125	CCDS7777.1	11	.	.	.	.	.	.	.	.	.	.	A	18.65	3.668814	0.67814	.	.	ENSG00000170748	ENST00000306904	D	0.91792	-2.91	2.39	2.39	0.29439	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	U	0.000000	D	0.94899	0.8351	M	0.81942	2.565	0.58432	D	0.999999	D	0.64830	0.994	D	0.77004	0.989	D	0.94111	0.7371	10	0.66056	D	0.02	.	8.6459	0.34005	1.0:0.0:0.0:0.0	.	42	O75526	HNRGT_HUMAN	G	42	ENSP00000304139:D42G	ENSP00000304139:D42G	D	+	2	0	RBMXL2	7067052	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	8.685000	0.91246	1.330000	0.45394	0.374000	0.22700	GAC	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom		0.582	RBMXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL2	protein_coding	OTTHUMT00000384552.1	A	NM_014469	-		7110476	+1	no_errors	ENST00000306904	ensembl	human	known	74_37	missense	SNP	1.000	G
DEFB104B	503618	genome.wustl.edu	37	8	7332563	7332563	+	Missense_Mutation	SNP	T	T	C	rs200740890		TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr8:7332563T>C	ENST00000316169.2	-	1	41	c.28A>G	c.(28-30)Att>Gtt	p.I10V		NM_001040702.1	NP_001035792.1	Q8WTQ1	D104A_HUMAN	defensin, beta 104B	10			I -> V (in dbSNP:rs2680507). {ECO:0000269|PubMed:11481241, ECO:0000269|PubMed:15489334}.		defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)									COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		AGAAGAGAAATGGCTAATAGC	0.502																																																	0								ENSG00000177023						5.0	4.0	4.0					8																	7332563		1628	2812	4440	DEFB104B	SO:0001583	missense	0			-	HGNC		CCDS34812.1	8p23.1	2011-03-29			ENSG00000177023	ENSG00000177023		"""Defensins, beta"""	26165	protein-coding gene	gene with protein product							Standard	NM_001040702		Approved		uc003wrn.3	Q8WTQ1	OTTHUMG00000149986	ENST00000316169.2:c.28A>G	8.37:g.7332563T>C	ENSP00000322191:p.Ile10Val	Somatic	0	27	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	Q496I2|Q496I3|Q496I4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I10V	ENST00000316169.2	37	c.28	CCDS34812.1	8	.	.	.	.	.	.	.	.	.	.	T	2.033	-0.421928	0.04734	.	.	ENSG00000177023	ENST00000316169	T	0.14144	2.53	2.6	-1.3	0.09259	.	.	.	.	.	T	0.07683	0.0193	.	.	.	0.80722	P	0.0	B	0.11235	0.004	B	0.04013	0.001	T	0.32322	-0.9911	7	0.32370	T	0.25	.	5.6826	0.17784	0.0:0.4706:0.0:0.5294	.	10	Q8WTQ1	D104A_HUMAN	V	10	ENSP00000322191:I10V	ENSP00000322191:I10V	I	-	1	0	DEFB104B	7319973	0.000000	0.05858	0.005000	0.12908	0.026000	0.11368	-0.670000	0.05256	-0.133000	0.11537	0.369000	0.22263	ATT	-	NULL		0.502	DEFB104B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB104B	protein_coding	OTTHUMT00000315230.1	T		rs200740890		7332563	-1	no_errors	ENST00000316169	ensembl	human	known	74_37	missense	SNP	0.005	C
TTC16	158248	genome.wustl.edu	37	9	130493785	130493785	+	3'UTR	SNP	A	A	G			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr9:130493785A>G	ENST00000373289.3	+	0	2803				TOR2A_ENST00000472723.1_5'Flank|TTC16_ENST00000489226.1_3'UTR	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16											central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						GAGCAATTAAAAGTCTTAGCA	0.493																																																	0								ENSG00000167094																																			TTC16	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.*101A>G	9.37:g.130493785A>G		Somatic	0	25	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	19	20.83	B4DYG4|B5ME24|Q5JU66|Q96M72	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373289.3	37	NULL	CCDS6875.1	9																																																																																			-	-		0.493	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC16	protein_coding	OTTHUMT00000054224.1	A	NM_144965	-		130493785	+1	no_errors	ENST00000488285	ensembl	human	known	74_37	rna	SNP	0.004	G
ITPKB	3707	genome.wustl.edu	37	1	226924876	226924884	+	In_Frame_Del	DEL	CTGCCGCTG	CTGCCGCTG	-	rs147889095	byFrequency	TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	CTGCCGCTG	CTGCCGCTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr1:226924876_226924884delCTGCCGCTG	ENST00000272117.3	-	1	275_283	c.276_284delCAGCGGCAG	c.(274-285)agcagcggcagt>agt	p.92_95SSGS>S	ITPKB_ENST00000429204.1_In_Frame_Del_p.92_95SSGS>S|ITPKB_ENST00000366784.1_In_Frame_Del_p.92_95SSGS>S			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	92					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				GCTCACgctactgccgctgctgccgctgc	0.746														1412	0.281949	0.2428	0.317	5008	,	,		9854	0.2659		0.3141	False		,,,				2504	0.2935				Colon(84;110 1851 5306 33547)												0								ENSG00000143772			530,2426		156,218,1104						0.6	1.0		dbSNP_120	7	1381,4925		379,623,2151	no	coding	ITPKB	NM_002221.3		535,841,3255	A1A1,A1R,RR		21.8998,17.9296,20.6327				1911,7351				ITPKB	SO:0001651	inframe_deletion	0				HGNC	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.276_284delCAGCGGCAG	1.37:g.226924885_226924893delCTGCCGCTG	ENSP00000272117:p.Ser92_Gly94del	Somatic	NA	NA	NA		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_IPK	p.GSS94in_frame_del	ENST00000272117.3	37	c.284_276	CCDS1555.1	1																																																																																			-	NULL		0.746	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKB	protein_coding	OTTHUMT00000091632.1	CTGCCGCTG	NM_002221			226924884	-1	no_errors	ENST00000272117	ensembl	human	known	74_37	in_frame_del	DEL	0.902:0.650:0.630:0.440:0.081:0.083:0.088:0.089:0.091	-
ZNF382	84911	genome.wustl.edu	37	19	37119864	37119864	+	IGR	DEL	T	T	-			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr19:37119864delT	ENST00000292928.2	+	0	2813				CTD-3234P18.2_ENST00000585467.1_lincRNA	NM_001256838.1|NM_032825.4	NP_001243767.1|NP_116214.2	Q96SR6	ZN382_HUMAN	zinc finger protein 382						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	34	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GTCTTGGGACttttttttttt	0.408																																																	0								ENSG00000266935																																			CTD-3234P18.2	SO:0001628	intergenic_variant	0				Clone_based_vega_gene	AF513816	CCDS33004.1, CCDS58659.1	19q13.13	2013-01-08			ENSG00000161298	ENSG00000161298		"""Zinc fingers, C2H2-type"", ""-"""	17409	protein-coding gene	gene with protein product		609516					Standard	NM_032825		Approved	FLJ14686, KS1	uc010efb.4	Q96SR6	OTTHUMG00000048153		19.37:g.37119864delT		Somatic	0	31	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	27	15.62	A3KMP6|A8MT55|C9K0V5|Q53ZY8|Q5JPJ2	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000292928.2	37	NULL	CCDS33004.1	19																																																																																			-	-		0.408	ZNF382-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000266935	protein_coding	OTTHUMT00000109562.2	T	NM_032825			37119864	+1	no_errors	ENST00000585467	ensembl	human	known	74_37	rna	DEL	0.241	-
RABEP1	9135	genome.wustl.edu	37	17	5253801	5253801	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr17:5253801G>A	ENST00000546142.2	+	7	1027	c.840G>A	c.(838-840)tgG>tgA	p.W280*	RABEP1_ENST00000341923.6_Nonsense_Mutation_p.W280*|RABEP1_ENST00000408982.2_Nonsense_Mutation_p.W280*|RABEP1_ENST00000262477.6_Nonsense_Mutation_p.W280*|RABEP1_ENST00000537505.1_Nonsense_Mutation_p.W237*			Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1	280					apoptotic process (GO:0006915)|endocytosis (GO:0006897)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	8						AACATACGTGGCAGAAGGCCA	0.448																																																	0								ENSG00000029725						89.0	87.0	88.0					17																	5253801		1945	4145	6090	RABEP1	SO:0001587	stop_gained	0			-	HGNC	AF098638	CCDS42243.1, CCDS45592.1	17p13.2	2008-02-05				ENSG00000029725			17677	protein-coding gene	gene with protein product		603616				8521472	Standard	NM_001291582		Approved	neurocrescin, RAB5EP, RABPT5, rabaptin-5	uc002gbm.4	Q15276		ENST00000546142.2:c.840G>A	17.37:g.5253801G>A	ENSP00000437701:p.Trp280*	Somatic	0	74	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	44	10.20	B2RAG7|O95369|Q8IVX3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rabaptin_coiled-coil,pfam_Rabaptin_Rab5-bd_dom,prints_Rabaptin	p.W280*	ENST00000546142.2	37	c.840	CCDS45592.1	17	.	.	.	.	.	.	.	.	.	.	G	39	7.378856	0.98248	.	.	ENSG00000029725	ENST00000262477;ENST00000408982;ENST00000539669;ENST00000546142;ENST00000341923;ENST00000537505	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-7.8874	19.2026	0.93717	0.0:0.0:1.0:0.0	.	.	.	.	X	280;280;273;280;280;237	.	ENSP00000262477:W280X	W	+	3	0	RABEP1	5194525	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.266000	0.95659	2.850000	0.98022	0.650000	0.86243	TGG	-	NULL		0.448	RABEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABEP1	protein_coding	OTTHUMT00000439349.1	G	NM_004703	-		5253801	+1	no_errors	ENST00000262477	ensembl	human	known	74_37	nonsense	SNP	1.000	A
DTX3	196403	genome.wustl.edu	37	12	58002321	58002321	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr12:58002321G>A	ENST00000548198.1	+	4	2273	c.769G>A	c.(769-771)Gga>Aga	p.G257R	DTX3_ENST00000337737.3_Missense_Mutation_p.G257R|ARHGEF25_ENST00000286494.4_5'Flank|DTX3_ENST00000551632.1_Missense_Mutation_p.G260R|ARHGEF25_ENST00000333972.7_5'Flank|DTX3_ENST00000548804.1_Missense_Mutation_p.G257R			Q8N9I9	DTX3_HUMAN	deltex 3, E3 ubiquitin ligase	257					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)|urinary_tract(1)	12	Melanoma(17;0.122)					CCCAAACCCAGGAGTTCGGTA	0.617																																																	0								ENSG00000178498						62.0	65.0	64.0					12																	58002321		2077	4212	6289	DTX3	SO:0001583	missense	0			-	HGNC	AK094385	CCDS41800.1, CCDS66410.1	12q13.2	2014-01-28	2014-01-28			ENSG00000178498		"""RING-type (C3HC4) zinc fingers"""	24457	protein-coding gene	gene with protein product		613142	"""deltex 3 homolog (Drosophila)"", ""deltex homolog 3 (Drosophila)"""			12670957	Standard	XM_005268697		Approved	FLJ34766, RNF154	uc001sow.1	Q8N9I9		ENST00000548198.1:c.769G>A	12.37:g.58002321G>A	ENSP00000447873:p.Gly257Arg	Somatic	0	80	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	321	386	45.40	Q53ZZ2|Q8NAU6|Q8NDS8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.G260R	ENST00000548198.1	37	c.778	CCDS41800.1	12	.	.	.	.	.	.	.	.	.	.	G	26.0	4.694607	0.88830	.	.	ENSG00000178498	ENST00000548804;ENST00000337737;ENST00000548198;ENST00000551632;ENST00000550300	T;T;T;T;T	0.27256	1.68;1.68;1.68;1.68;1.68	4.16	4.16	0.48862	.	0.000000	0.85682	D	0.000000	T	0.59418	0.2192	M	0.91090	3.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71652	-0.4528	10	0.87932	D	0	-3.6819	15.6095	0.76704	0.0:0.0:1.0:0.0	.	257	Q8N9I9	DTX3_HUMAN	R	257;257;257;260;45	ENSP00000449294:G257R;ENSP00000338050:G257R;ENSP00000447873:G257R;ENSP00000448696:G260R;ENSP00000446996:G45R	ENSP00000338050:G257R	G	+	1	0	DTX3	56288588	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.504000	0.97986	2.044000	0.60594	0.585000	0.79938	GGA	-	NULL		0.617	DTX3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DTX3	protein_coding	OTTHUMT00000407848.1	G	NM_178502	-		58002321	+1	no_errors	ENST00000551632	ensembl	human	known	74_37	missense	SNP	1.000	A
GJD2	57369	genome.wustl.edu	37	15	35044752	35044752	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr15:35044752C>T	ENST00000290374.4	-	2	1369	c.893G>A	c.(892-894)cGt>cAt	p.R298H	RP11-814P5.1_ENST00000503496.1_RNA|RP11-814P5.1_ENST00000558707.1_RNA	NM_020660.2	NP_065711.1	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	298					action potential (GO:0001508)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	19		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		GTCCTTGTTACGAATCTCATA	0.537																																																	0								ENSG00000159248						87.0	73.0	77.0					15																	35044752		2201	4298	6499	GJD2	SO:0001583	missense	0			-	HGNC	AB037509	CCDS10040.1	15q13.1	2008-02-04	2007-11-06	2007-11-06	ENSG00000159248	ENSG00000159248		"""Ion channels / Gap junction proteins (connexins)"""	19154	protein-coding gene	gene with protein product	"""connexin 36"""	607058	"""gap junction protein, alpha 9, 36kDa"""	GJA9		10462698	Standard	NM_020660		Approved	CX36	uc001zis.2	Q9UKL4	OTTHUMG00000129674	ENST00000290374.4:c.893G>A	15.37:g.35044752C>T	ENSP00000290374:p.Arg298His	Somatic	0	106	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	57	25.97	Q2M241|Q9P2R0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin36	p.R298H	ENST00000290374.4	37	c.893	CCDS10040.1	15	.	.	.	.	.	.	.	.	.	.	C	21.9	4.217329	0.79352	.	.	ENSG00000159248	ENST00000290374	D	0.98221	-4.8	5.86	5.86	0.93980	.	1.877190	0.02285	N	0.069770	D	0.98416	0.9473	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.64410	0.925	D	0.90709	0.4626	10	0.36615	T	0.2	.	20.1864	0.98220	0.0:1.0:0.0:0.0	.	298	Q9UKL4	CXD2_HUMAN	H	298	ENSP00000290374:R298H	ENSP00000290374:R298H	R	-	2	0	GJD2	32832044	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.818000	0.86416	2.781000	0.95711	0.650000	0.86243	CGT	-	NULL		0.537	GJD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJD2	protein_coding	OTTHUMT00000251875.2	C		-		35044752	-1	no_errors	ENST00000290374	ensembl	human	known	74_37	missense	SNP	1.000	T
FRS3	10817	genome.wustl.edu	37	6	41745817	41745817	+	5'UTR	SNP	G	G	A			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr6:41745817G>A	ENST00000373018.3	-	0	182				PRICKLE4_ENST00000458694.1_5'Flank|FRS3_ENST00000259748.2_5'UTR|FRS3_ENST00000466420.1_5'UTR|PRICKLE4_ENST00000359201.5_5'Flank	NM_006653.3	NP_006644.1	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3						fibroblast growth factor receptor signaling pathway (GO:0008543)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GCATGGGGAAGGGTTCCCACT	0.582											OREG0004072	type=REGULATORY REGION|Gene=FRS3|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0								ENSG00000137218																																			FRS3	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF036718	CCDS4860.1	6p21.1	2010-08-05			ENSG00000137218	ENSG00000137218			16970	protein-coding gene	gene with protein product		607744				8761293, 9660748	Standard	NM_006653		Approved	SNT-2, FRS2beta, FRS2B	uc003orc.1	O43559	OTTHUMG00000014686	ENST00000373018.3:c.-70C>T	6.37:g.41745817G>A		Somatic	0	86	0.00	903	0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	210	985	17.56	Q5T3D5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373018.3	37	NULL	CCDS4860.1	6																																																																																			-	-		0.582	FRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRS3	protein_coding	OTTHUMT00000040532.2	G	NM_006653	-		41745817	-1	no_errors	ENST00000466420	ensembl	human	known	74_37	rna	SNP	0.538	A
GOLGA6L6	727832	genome.wustl.edu	37	15	20740571	20740571	+	Missense_Mutation	SNP	T	T	C	rs200650686		TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr15:20740571T>C	ENST00000427390.2	-	8	1269	c.1179A>G	c.(1177-1179)atA>atG	p.I393M		NM_001145004.1	NP_001138476.1	A8MZA4	GG6L6_HUMAN	golgin A6 family-like 6	393	Glu-rich.									NS(3)|endometrium(4)|kidney(1)|skin(3)	11						ccagctcccgtatcttctcct	0.562																																																	0								ENSG00000215405						1.0	1.0	1.0					15																	20740571		66	48	114	GOLGA6L6	SO:0001583	missense	0			-	HGNC	AK093450	CCDS45184.1	15q11.2	2014-02-12	2010-02-12		ENSG00000215405	ENSG00000277322			37225	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 6"""				Standard	NM_001145004		Approved	FLJ36131	uc001ytk.2	A8MZA4	OTTHUMG00000171663	ENST00000427390.2:c.1179A>G	15.37:g.20740571T>C	ENSP00000398615:p.Ile393Met	Somatic	0	14	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	7	30.00	D3YTC0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.I393M	ENST00000427390.2	37	c.1179	CCDS45184.1	15	.	.	.	.	.	.	.	.	.	.	t	1.235	-0.622956	0.03636	.	.	ENSG00000215405	ENST00000427390	T	0.12039	2.72	.	.	.	.	.	.	.	.	T	0.04272	0.0118	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.35351	-0.9792	6	0.33141	T	0.24	.	.	.	.	.	393	A8MZA4	GG6L6_HUMAN	M	393	ENSP00000398615:I393M	ENSP00000398615:I393M	I	-	3	3	GOLGA6L6	19000585	0.254000	0.23992	0.018000	0.16275	0.018000	0.09664	0.755000	0.26405	-1.371000	0.02141	-1.353000	0.01230	ATA	-	prints_Tropomyosin		0.562	GOLGA6L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6L6	protein_coding	OTTHUMT00000414660.3	T	NM_001145004	rs200650686		20740571	-1	no_errors	ENST00000427390	ensembl	human	known	74_37	missense	SNP	0.096	C
SP8	221833	genome.wustl.edu	37	7	20824941	20824943	+	In_Frame_Del	DEL	GCC	GCC	-	rs372591893	byFrequency	TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	GCC	GCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr7:20824941_20824943delGCC	ENST00000361443.4	-	3	676_678	c.439_441delGGC	c.(439-441)ggcdel	p.G147del	SP8_ENST00000418710.2_In_Frame_Del_p.G165del	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	147					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G165delG(1)|p.G147delG(1)		NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						GCGCGGAGGAgccgccgccgccg	0.729														461	0.0920527	0.0098	0.1124	5008	,	,		5525	0.002		0.2664	False		,,,				2504	0.1022																2	Deletion - In frame(2)	central_nervous_system(2)						ENSG00000164651		,	50,654		19,12,321					,	0.5	0.3			2	602,1424		217,168,628	no	coding,coding	SP8	NM_198956.2,NM_182700.4	,	236,180,949	A1A1,A1R,RR		29.7137,7.1023,23.8828	,	,		652,2078				SP8	SO:0001651	inframe_deletion	0				HGNC		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.439_441delGGC	7.37:g.20824950_20824952delGCC	ENSP00000354482:p.Gly147del	Somatic	0	10	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33	Q7Z615|Q7Z616|Q96MJ1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2,prints_Antifreeze_1	p.G165in_frame_del	ENST00000361443.4	37	c.495_493	CCDS5372.1	7																																																																																			-	NULL		0.729	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SP8	protein_coding	OTTHUMT00000326904.2	GCC				20824943	-1	no_errors	ENST00000418710	ensembl	human	known	74_37	in_frame_del	DEL	0.025:0.971:0.997	-
C1QTNF1	114897	genome.wustl.edu	37	17	77044218	77044219	+	3'UTR	INS	-	-	GCTGACCCCAGGGCTCAGCACCAG	rs3833103|rs11271151	byFrequency	TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr17:77044218_77044219insGCTGACCCCAGGGCTCAGCACCAG	ENST00000339142.2	+	0	1449_1450				C1QTNF1_ENST00000582625.1_3'UTR|C1QTNF1_ENST00000311661.4_3'UTR|C1QTNF1_ENST00000583904.1_3'UTR|C1QTNF1_ENST00000354124.3_3'UTR|C1QTNF1_ENST00000580454.1_3'UTR|C1QTNF1_ENST00000581774.1_3'UTR|C1QTNF1_ENST00000579760.1_3'UTR|C1QTNF1_ENST00000578229.1_3'UTR|C1QTNF1_ENST00000580474.1_3'UTR|C1QTNF1_ENST00000392445.2_3'UTR	NM_198593.3	NP_940995.1	Q9BXJ1	C1QT1_HUMAN	C1q and tumor necrosis factor related protein 1						negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase B signaling (GO:0051897)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)|regulation of glucose metabolic process (GO:0010906)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	collagen binding (GO:0005518)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(2)	14			BRCA - Breast invasive adenocarcinoma(99;0.0294)|OV - Ovarian serous cystadenocarcinoma(97;0.201)			CCCTGCGCTGTGCTGACCCCAC	0.629														1705	0.340455	0.2844	0.3732	5008	,	,		18061	0.5694		0.166	False		,,,				2504	0.3364																0								ENSG00000173918																																			C1QTNF1	SO:0001624	3_prime_UTR_variant	0				HGNC	AF329840	CCDS11761.1, CCDS11762.1	17q25	2012-07-02			ENSG00000173918	ENSG00000173918			14324	protein-coding gene	gene with protein product	"""G protein coupled receptor interacting protein"""	610365				12409230	Standard	NM_198593		Approved	CTRP1, ZSIG37, GIP, FLJ90694	uc002jwp.4	Q9BXJ1	OTTHUMG00000177533	ENST00000339142.2:c.*49->GCTGACCCCAGGGCTCAGCACCAG	17.37:g.77044218_77044219insGCTGACCCCAGGGCTCAGCACCAG		Somatic	NA	NA	NA		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6ZMH6|Q96NF2|Q9GZR4	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000339142.2	37	NULL	CCDS11761.1	17																																																																																			-	-		0.629	C1QTNF1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C1QTNF1	protein_coding	OTTHUMT00000437388.2	-	NM_030968			77044219	+1	no_errors	ENST00000582625	ensembl	human	known	74_37	rna	INS	0.000:0.002	GCTGACCCCAGGGCTCAGCACCAG
SCPEP1	59342	genome.wustl.edu	37	17	55062464	55062465	+	Intron	INS	-	-	GAAAA	rs34242828|rs397829366|rs3056052|rs573491470	byFrequency	TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr17:55062464_55062465insGAAAA	ENST00000262288.3	+	3	280				SCPEP1_ENST00000571898.1_Intron|RP5-1107A17.4_ENST00000572877.1_RNA	NM_021626.2	NP_067639.1	Q9HB40	RISC_HUMAN	serine carboxypeptidase 1						negative regulation of blood pressure (GO:0045776)|positive regulation of vasodilation (GO:0045909)|retinoic acid metabolic process (GO:0042573)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	14	Breast(9;2.86e-08)					agactctgtctgaaaagaaaag	0.475																																																	0								ENSG00000263120																																			RP5-1107A17.4	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF282618	CCDS11593.1	17q22	2012-09-20			ENSG00000121064	ENSG00000121064			29507	protein-coding gene	gene with protein product	"""retinoid inducible serine carboxypeptidase"""					11447226, 12975309	Standard	NM_021626		Approved	RISC	uc002iuv.4	Q9HB40	OTTHUMG00000178129	ENST00000262288.3:c.226-274->GAAAA	17.37:g.55062470_55062474dupGAAAA		Somatic	NA	NA	NA		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q96A94|Q9H3F0	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000262288.3	37	NULL	CCDS11593.1	17																																																																																			-	-		0.475	SCPEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000263120	protein_coding	OTTHUMT00000440622.1	-	NM_021626			55062465	+1	no_errors	ENST00000572877	ensembl	human	known	74_37	rna	INS	0.001:0.001	GAAAA
MAPKBP1	23005	genome.wustl.edu	37	15	42110432	42110432	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr15:42110432G>T	ENST00000456763.2	+	19	2235	c.2039G>T	c.(2038-2040)tGt>tTt	p.C680F	MAPKBP1_ENST00000457542.2_Missense_Mutation_p.C674F|MAPKBP1_ENST00000221214.6_Missense_Mutation_p.C557F|MAPKBP1_ENST00000260357.7_Missense_Mutation_p.C513F|MAPKBP1_ENST00000514566.1_Missense_Mutation_p.C674F	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	680										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		GCCACCAGCTGTTCTGACAAG	0.557																																																	0								ENSG00000137802						132.0	111.0	119.0					15																	42110432		2203	4300	6503	MAPKBP1	SO:0001583	missense	0			-	HGNC	AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.2039G>T	15.37:g.42110432G>T	ENSP00000393099:p.Cys680Phe	Somatic	0	46	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.C680F	ENST00000456763.2	37	c.2039	CCDS45239.1	15	.	.	.	.	.	.	.	.	.	.	g	22.1	4.241916	0.79912	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000260357;ENST00000456763;ENST00000514566	T;T;T;T;T	0.65732	1.59;1.59;1.04;-0.17;1.04	5.5	5.5	0.81552	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.81927	0.4926	M	0.83603	2.65	0.80722	D	1	D;P;D;D;B	0.89917	0.999;0.923;1.0;0.989;0.39	D;P;D;D;B	0.91635	0.987;0.903;0.999;0.92;0.434	D	0.84277	0.0492	10	0.87932	D	0	-9.5229	19.3937	0.94596	0.0:0.0:1.0:0.0	.	513;557;674;680;674	F8WC21;O60336-3;O60336-2;O60336;O60336-6	.;.;.;MABP1_HUMAN;.	F	674;557;513;680;674	ENSP00000397570:C674F;ENSP00000221214:C557F;ENSP00000260357:C513F;ENSP00000393099:C680F;ENSP00000426154:C674F	ENSP00000221214:C557F	C	+	2	0	MAPKBP1	39897724	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.866000	0.99616	2.574000	0.86865	0.561000	0.74099	TGT	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.557	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	MAPKBP1	protein_coding	OTTHUMT00000359745.1	G	NM_014994	-		42110432	+1	no_errors	ENST00000456763	ensembl	human	known	74_37	missense	SNP	1.000	T
HAUS7	55559	genome.wustl.edu	37	X	152722238	152722238	+	Intron	SNP	C	C	T			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chrX:152722238C>T	ENST00000370211.4	-	6	520				TREX2_ENST00000338525.2_Intron|TREX2_ENST00000370232.1_Intron|HAUS7_ENST00000421080.2_Intron|TREX2_ENST00000334497.2_Intron|HAUS7_ENST00000484394.1_Intron|TREX2_ENST00000330912.2_Intron|HAUS7_ENST00000370212.3_Intron	NM_017518.7	NP_059988.3	Q99871	HAUS7_HUMAN	HAUS augmin-like complex, subunit 7						centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	thioesterase binding (GO:0031996)			endometrium(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)	19						AGCCCCACCGCGCAGAATCCT	0.667																																																	0								ENSG00000213397																																			HAUS7	SO:0001627	intron_variant	0			-	HGNC	AF267739	CCDS35438.1	Xq28	2011-10-24	2009-04-20	2009-04-20		ENSG00000213397		"""HAUS augmin-like complex subunits"""	32979	protein-coding gene	gene with protein product	"""UCH37 interacting protein 1"", ""26S proteasome-associated UCH interacting protein 1"""	300540	"""UCHL5 interacting protein"""	UCHL5IP		11163772, 16395595, 19427217	Standard	NM_017518		Approved	UIP1	uc004fho.2	Q99871		ENST00000370211.4:c.477-129G>A	X.37:g.152722238C>T		Somatic	0	25	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	2	85.71	B4DUH6|D3DWT9|Q96HS8|Q9NP54|Q9UFH9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370211.4	37	NULL	CCDS35438.1	X																																																																																			-	-		0.667	HAUS7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HAUS7	protein_coding	OTTHUMT00000060963.2	C	NM_017518	-		152722238	-1	no_errors	ENST00000464993	ensembl	human	known	74_37	rna	SNP	0.001	T
FAM163A	148753	genome.wustl.edu	37	1	179783087	179783087	+	Silent	SNP	G	G	T			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr1:179783087G>T	ENST00000341785.4	+	5	663	c.267G>T	c.(265-267)ggG>ggT	p.G89G	RP11-12M5.3_ENST00000415218.1_RNA|RP11-12M5.3_ENST00000453051.1_RNA	NM_173509.2	NP_775780.1	Q96GL9	F163A_HUMAN	family with sequence similarity 163, member A	89						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)	15						AGCCCTGTGGGGTGGCCGCGA	0.667																																																	0								ENSG00000143340						33.0	31.0	32.0					1																	179783087		2203	4300	6503	FAM163A	SO:0001819	synonymous_variant	0			-	HGNC	BC009382	CCDS1333.1	1q25.2	2008-06-05	2008-06-05	2008-06-05	ENSG00000143340	ENSG00000143340			28274	protein-coding gene	gene with protein product		611727	"""chromosome 1 open reading frame 76"""	C1orf76		12477932	Standard	NM_173509		Approved	MGC16664	uc001gnj.3	Q96GL9	OTTHUMG00000035262	ENST00000341785.4:c.267G>T	1.37:g.179783087G>T		Somatic	0	78	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	34	43.33	A8K8R7	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G89	ENST00000341785.4	37	c.267	CCDS1333.1	1																																																																																			-	NULL		0.667	FAM163A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM163A	protein_coding	OTTHUMT00000085300.1	G	NM_173509	-		179783087	+1	no_errors	ENST00000341785	ensembl	human	known	74_37	silent	SNP	0.638	T
SLC17A6	57084	genome.wustl.edu	37	11	22363276	22363276	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr11:22363276G>A	ENST00000263160.3	+	2	726	c.289G>A	c.(289-291)Gac>Aac	p.D97N		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	97					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						GGCCATTGTGGACATGGTCAA	0.647																																																	0								ENSG00000091664						76.0	62.0	67.0					11																	22363276		2203	4300	6503	SLC17A6	SO:0001583	missense	0			-	HGNC	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.289G>A	11.37:g.22363276G>A	ENSP00000263160:p.Asp97Asn	Somatic	0	212	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	160	10.11	A6NKS2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.D97N	ENST00000263160.3	37	c.289	CCDS7856.1	11	.	.	.	.	.	.	.	.	.	.	G	18.41	3.618470	0.66787	.	.	ENSG00000091664	ENST00000263160	T	0.57752	0.38	5.86	5.86	0.93980	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.044121	0.85682	D	0.000000	T	0.61689	0.2367	M	0.76170	2.325	0.47245	D	0.999367	B	0.20780	0.048	B	0.33121	0.158	T	0.56697	-0.7936	10	0.34782	T	0.22	.	20.1986	0.98248	0.0:0.0:1.0:0.0	.	97	Q9P2U8	VGLU2_HUMAN	N	97	ENSP00000263160:D97N	ENSP00000263160:D97N	D	+	1	0	SLC17A6	22319852	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.298000	0.51818	2.781000	0.95711	0.650000	0.86243	GAC	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.647	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	protein_coding	OTTHUMT00000387671.1	G	NM_020346	-		22363276	+1	no_errors	ENST00000263160	ensembl	human	known	74_37	missense	SNP	1.000	A
FLNA	2316	genome.wustl.edu	37	X	153591107	153591107	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chrX:153591107C>T	ENST00000369850.3	-	16	2562	c.2326G>A	c.(2326-2328)Ggc>Agc	p.G776S	FLNA_ENST00000344736.4_Missense_Mutation_p.G776S|FLNA_ENST00000360319.4_Missense_Mutation_p.G776S|FLNA_ENST00000422373.1_Missense_Mutation_p.G776S	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	776					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ACTCCGGGGCCGTATACTTTG	0.637																																																	0								ENSG00000196924						25.0	28.0	27.0					X																	153591107		2029	4152	6181	FLNA	SO:0001583	missense	0			-	HGNC	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.2326G>A	X.37:g.153591107C>T	ENSP00000358866:p.Gly776Ser	Somatic	0	182	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	98	43	69.50	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.G776S	ENST00000369850.3	37	c.2326	CCDS48194.1	X	.	.	.	.	.	.	.	.	.	.	C	22.9	4.352607	0.82132	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.91740	-2.9;-2.9;-2.9;-2.9	5.43	5.43	0.79202	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	D	0.97346	0.9132	H	0.94808	3.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98487	1.0608	10	0.87932	D	0	.	18.3446	0.90317	0.0:1.0:0.0:0.0	.	776;776	P21333-2;P21333	.;FLNA_HUMAN	S	776;749;776;776;776	ENSP00000353467:G776S;ENSP00000416926:G776S;ENSP00000358866:G776S;ENSP00000358863:G776S	ENSP00000358863:G776S	G	-	1	0	FLNA	153244301	1.000000	0.71417	0.846000	0.33378	0.405000	0.30901	7.818000	0.86416	2.272000	0.75746	0.529000	0.55759	GGC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like		0.637	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNA	protein_coding	OTTHUMT00000058942.3	C		-		153591107	-1	no_errors	ENST00000369850	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF850	342892	genome.wustl.edu	37	19	37266238	37266238	+	5'Flank	DEL	C	C	-			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr19:37266238delC	ENST00000591344.1	-	0	0				CTD-2162K18.3_ENST00000588717.1_lincRNA|CTD-2162K18.4_ENST00000590750.1_Intron|ZNF850_ENST00000589390.1_5'Flank	NM_001193552.1|NM_001267779.1	NP_001180481.1|NP_001254708.1	A8MQ14	ZN850_HUMAN	zinc finger protein 850						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										ACCAAATACACCTACAGGAGT	0.438																																																	0								ENSG00000267353																																			CTD-2162K18.3	SO:0001631	upstream_gene_variant	0				Clone_based_vega_gene	BC052603	CCDS59379.1, CCDS74350.1	19q13.12	2013-01-08	2010-08-02	2010-08-02		ENSG00000267041		"""Zinc fingers, C2H2-type"", ""-"""	27994	protein-coding gene	gene with protein product			"""zinc finger protein 850 pseudogene"", ""zinc finger protein 850 (pseudogene)"""	ZNF850P		12477932	Standard	NM_001193552		Approved		uc010efc.3	A8MQ14			19.37:g.37266238delC	Exception_encountered	Somatic	0	71	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	26	31.58		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000591344.1	37	NULL	CCDS59379.1	19																																																																																			-	-		0.438	ZNF850-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267353	protein_coding	OTTHUMT00000453557.1	C	XM_001720258			37266238	-1	no_errors	ENST00000588717	ensembl	human	known	74_37	rna	DEL	0.043	-
HEATR4	399671	genome.wustl.edu	37	14	73957841	73957841	+	Intron	SNP	G	G	T			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr14:73957841G>T	ENST00000553558.1	-	17	3166				C14orf169_ENST00000531973.1_RNA|HEATR4_ENST00000334988.2_Intron|HEATR4_ENST00000560393.1_Intron	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4											breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		AGGAAGATACGAAAGCAGCTG	0.672																																																	0								ENSG00000255242						43.0	48.0	46.0					14																	73957841		1948	4146	6094	C14orf169	SO:0001627	intron_variant	0			-	HGNC	BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.2844+1928C>A	14.37:g.73957841G>T		Somatic	0	63	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	38	11.63	B7Z7V9|E9KL41	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000553558.1	37	NULL	CCDS9815.2	14																																																																																			-	-		0.672	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C14orf169	protein_coding	OTTHUMT00000414422.2	G	NM_203309	-		73957841	+1	no_errors	ENST00000531973	ensembl	human	known	74_37	rna	SNP	0.997	T
UPK3B	80761	genome.wustl.edu	37	7	76144537	76144538	+	Frame_Shift_Ins	INS	-	-	GGGGCTGGGGGAGATGG			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr7:76144537_76144538insGGGGCTGGGGGAGATGG	ENST00000257632.5	+	4	1060_1061	c.932_933insGGGGCTGGGGGAGATGG	c.(931-936)atggggfs	p.MG311fs	UPK3B_ENST00000419923.2_Frame_Shift_Ins_p.MG311fs|UPK3B_ENST00000394849.1_Frame_Shift_Ins_p.MG256fs|UPK3B_ENST00000334348.3_3'UTR|UPK3B_ENST00000448265.3_Frame_Shift_Ins_p.MG311fs|UPK3B_ENST00000443097.2_3'UTR			Q9BT76	UPK3B_HUMAN	uroplakin 3B	311					negative regulation of gene expression (GO:0010629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(1)|skin(2)	8		Myeloproliferative disorder(862;0.204)				CCTCTTTGCATGGGGCTGGGGG	0.693																																																	0								ENSG00000243566																																			UPK3B	SO:0001589	frameshift_variant	0				HGNC	BC004304	CCDS5588.1, CCDS5589.1, CCDS64693.1	7q11.2	2003-07-29			ENSG00000243566	ENSG00000243566			21444	protein-coding gene	gene with protein product	"""uroplakin IIIb"""	611887				12446744	Standard	XM_005250612		Approved	MGC10902, p35, UPIIIb, FLJ32198	uc003ufq.3	Q9BT76	OTTHUMG00000149929	ENST00000257632.5:c.933_949dupGGGGCTGGGGGAGATGG	7.37:g.76144537_76144538insGGGGCTGGGGGAGATGG	ENSP00000257632:p.Met311fs	Somatic	NA	NA	NA		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NHH5|A8K231|A8MZA8|B3KPU5|Q75MM5|Q86W06	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.G315fs	ENST00000257632.5	37	c.932_933	CCDS5588.1	7																																																																																			-	NULL		0.693	UPK3B-002	KNOWN	basic|CCDS	protein_coding	UPK3B	protein_coding	OTTHUMT00000313978.2	-	NM_030570			76144538	+1	no_errors	ENST00000257632	ensembl	human	known	74_37	frame_shift_ins	INS	0.004:0.021	GGGGCTGGGGGAGATGG
MTTP	4547	genome.wustl.edu	37	4	100521804	100521804	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr4:100521804G>A	ENST00000265517.5	+	9	1353	c.1150G>A	c.(1150-1152)Gac>Aac	p.D384N	MTTP_ENST00000457717.1_Missense_Mutation_p.D384N|MTTP_ENST00000511045.1_Missense_Mutation_p.D411N|RP11-766F14.1_ENST00000508578.1_RNA			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	384	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.		D -> A (in dbSNP:rs17029215). {ECO:0000269|PubMed:8939939}.		cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	TTTCAAAAGTGACAGCAGCAT	0.433																																																	0								ENSG00000138823						109.0	108.0	108.0					4																	100521804		2203	4300	6503	MTTP	SO:0001583	missense	0			-	HGNC		CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.1150G>A	4.37:g.100521804G>A	ENSP00000265517:p.Asp384Asn	Somatic	0	134	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	73	38.66	A8K428|Q08AM4|Q6P5T3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,superfamily_Lipid_transp_b-sht_shell,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.D384N	ENST00000265517.5	37	c.1150	CCDS3651.1	4	.	.	.	.	.	.	.	.	.	.	G	11.89	1.772568	0.31411	.	.	ENSG00000138823	ENST00000511045;ENST00000457717;ENST00000265517;ENST00000538053	T;T;T	0.39229	1.09;1.09;1.09	4.86	3.14	0.36123	Lipid transport protein, N-terminal (3);Vitellinogen, superhelical (2);	0.664814	0.16092	N	0.230019	T	0.33789	0.0875	L	0.57536	1.79	0.09310	N	1	P;B	0.35226	0.491;0.351	B;B	0.32022	0.139;0.061	T	0.14282	-1.0478	10	0.15066	T	0.55	-13.1503	9.1662	0.37052	0.235:0.0:0.765:0.0	.	411;384	E9PBP6;P55157	.;MTP_HUMAN	N	411;384;384;384	ENSP00000427679:D411N;ENSP00000400821:D384N;ENSP00000265517:D384N	ENSP00000265517:D384N	D	+	1	0	MTTP	100740827	0.814000	0.29104	0.528000	0.27938	0.896000	0.52359	2.506000	0.45433	0.461000	0.27071	0.655000	0.94253	GAC	-	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N		0.433	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTTP	protein_coding	OTTHUMT00000253662.3	G		-		100521804	+1	no_errors	ENST00000265517	ensembl	human	known	74_37	missense	SNP	0.190	A
RTL1	388015	genome.wustl.edu	37	14	101347411	101347411	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr14:101347411C>T	ENST00000534062.1	-	1	3773	c.3715G>A	c.(3715-3717)Gac>Aac	p.D1239N	MIR433_ENST00000384837.1_RNA|MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	1239					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						CGTTGCAGGTCGTCTTGCAGG	0.637																																																	0								ENSG00000254656						18.0	19.0	19.0					14																	101347411		1568	3580	5148	RTL1	SO:0001583	missense	0			-	HGNC		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.3715G>A	14.37:g.101347411C>T	ENSP00000435342:p.Asp1239Asn	Somatic	0	136	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	83	33.86	E9PKS8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Retrotrans_gag_dom,superfamily_Peptidase_aspartic_dom	p.D1239N	ENST00000534062.1	37	c.3715	CCDS53910.1	14	.	.	.	.	.	.	.	.	.	.	C	25.6	4.651895	0.88056	.	.	ENSG00000254656	ENST00000534062	T	0.46451	0.87	3.48	3.48	0.39840	.	0.000000	0.36555	N	0.002533	T	0.46833	0.1413	L	0.29908	0.895	0.26988	N	0.965217	D	0.89917	1.0	D	0.67103	0.949	T	0.21895	-1.0232	10	0.42905	T	0.14	.	10.771	0.46323	0.0:1.0:0.0:0.0	.	1239	E9PKS8	.	N	1239	ENSP00000435342:D1239N	ENSP00000435342:D1239N	D	-	1	0	RTL1	100417164	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.960000	0.29253	2.239000	0.73571	0.655000	0.94253	GAC	-	NULL		0.637	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	protein_coding	OTTHUMT00000395127.1	C	NM_001134888	-		101347411	-1	no_errors	ENST00000534062	ensembl	human	known	74_37	missense	SNP	1.000	T
BMP8B	656	genome.wustl.edu	37	1	40230633	40230633	+	Intron	SNP	T	T	A			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr1:40230633T>A	ENST00000372827.3	-	4	1049				BMP8B_ENST00000397360.2_Missense_Mutation_p.M241L	NM_001720.3	NP_001711.2	P34820	BMP8B_HUMAN	bone morphogenetic protein 8b						cartilage development (GO:0051216)|cell differentiation (GO:0030154)|growth (GO:0040007)|ossification (GO:0001503)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)				endometrium(1)|liver(1)|ovary(1)|urinary_tract(1)	4	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AGTTTCCACATCTGAAGCCTG	0.652																																																	0								ENSG00000116985																																			BMP8B	SO:0001627	intron_variant	0			-	HGNC	BC023526	CCDS444.1	1p35-p32	2014-01-30	2008-05-22	2003-10-22	ENSG00000116985	ENSG00000116985		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1075	protein-coding gene	gene with protein product	"""osteogenic protein 2"""	602284	"""bone morphogenetic protein 8 (osteogenic protein 2)"""	BMP8		1460021, 9070944	Standard	NM_001720		Approved	OP-2	uc001cdz.1	P34820	OTTHUMG00000009247	ENST00000372827.3:c.674-144A>T	1.37:g.40230633T>A		Somatic	0	100	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	58	12.12	E7EMY8|Q32NE5|Q53ZM7|Q9NUF0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TGF-b_N	p.M241L	ENST00000372827.3	37	c.721	CCDS444.1	1	.	.	.	.	.	.	.	.	.	.	T	9.146	1.014961	0.19355	.	.	ENSG00000116985	ENST00000397360	T	0.57107	0.42	3.04	0.699	0.18093	.	.	.	.	.	T	0.37461	0.1004	.	.	.	0.80722	P	0.0	B	0.25850	0.136	B	0.24394	0.053	T	0.36578	-0.9742	7	0.52906	T	0.07	.	4.7925	0.13256	0.0:0.2801:0.0:0.7199	.	241	E7EMY8	.	L	241	ENSP00000380518:M241L	ENSP00000380518:M241L	M	-	1	0	BMP8B	40003220	0.014000	0.17966	0.224000	0.23877	0.017000	0.09413	1.013000	0.29937	0.120000	0.18254	-0.376000	0.06991	ATG	-	NULL		0.652	BMP8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP8B	protein_coding	OTTHUMT00000025641.1	T	NM_001720	-		40230633	-1	no_errors	ENST00000397360	ensembl	human	known	74_37	missense	SNP	0.658	A
ATXN8OS	6315	genome.wustl.edu	37	13	70713513	70713533	+	RNA	DEL	CTACTGCTGCTGCTGCTGCTG	CTACTGCTGCTGCTGCTGCTG	-	rs566930154|rs143757288|rs633100|rs5002471|rs4296152|rs377274687|rs547120017|rs370770198|rs112128542	byFrequency	TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	CTACTGCTGCTGCTGCTGCTG	CTACTGCTGCTGCTGCTGCTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr13:70713513_70713533delCTACTGCTGCTGCTGCTGCTG	ENST00000414504.2	+	0	1100_1120					NR_002717.2				ATXN8 opposite strand (non-protein coding)																		actactactactactgctgctgctgctgctgctgctgctgc	0.398																																																	0								ENSG00000230223																																			ATXN8OS			0				HGNC	AF126749		13q21	2012-10-19	2008-08-13	2006-07-18	ENSG00000230223	ENSG00000230223		"""Long non-coding RNAs"", ""-"""	10561	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 3"""	603680	"""spinocerebellar ataxia 8"", ""kelch-like 1 antisense (Drosophila)"""	SCA8, KLHL1AS		10192387, 16804541	Standard	NR_002717		Approved	NCRNA00003	uc010aej.1		OTTHUMG00000017057		13.37:g.70713513_70713533delCTACTGCTGCTGCTGCTGCTG		Somatic	NA	NA	NA		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000414504.2	37	NULL		13																																																																																			-	-		0.398	ATXN8OS-002	KNOWN	basic	antisense	ATXN8OS	antisense	OTTHUMT00000045233.2	CTACTGCTGCTGCTGCTGCTG	NR_002717			70713533	+1	no_errors	ENST00000414504	ensembl	human	known	74_37	rna	DEL	0.000:0.001:0.001:0.001:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.001:0.000	-
NOTCH4	4855	genome.wustl.edu	37	6	32188317	32188317	+	Missense_Mutation	SNP	C	C	T	rs144492578	byFrequency	TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr6:32188317C>T	ENST00000375023.3	-	6	1162	c.1024G>A	c.(1024-1026)Gtg>Atg	p.V342M		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	342	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CTCACACACACGCAGTGAAAG	0.612													C|||	2	0.000399361	0.0015	0.0	5008	,	,		18417	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000204301	C	MET/VAL	3,3019		0,3,1508	102.0	100.0	101.0		1024	4.9	1.0	6	dbSNP_134	101	0,5418		0,0,2709	yes	missense	NOTCH4	NM_004557.3	21	0,3,4217	TT,TC,CC		0.0,0.0993,0.0355	probably-damaging	342/2004	32188317	3,8437	1511	2709	4220	NOTCH4	SO:0001583	missense	0			-	HGNC		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1024G>A	6.37:g.32188317C>T	ENSP00000364163:p.Val342Met	Somatic	0	111	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	41	50.60	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Notch,pfam_EG-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd_dom,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_4,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.V342M	ENST00000375023.3	37	c.1024	CCDS34420.1	6	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154163	0.78114	9.93E-4	0.0	ENSG00000204301	ENST00000375023	D	0.91894	-2.93	4.9	4.9	0.64082	EGF-like region, conserved site (2);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.39687	N	0.001289	D	0.93779	0.8011	L	0.55103	1.725	0.80722	D	1	D;P	0.89917	1.0;0.915	D;B	0.97110	1.0;0.378	D	0.93414	0.6771	10	0.48119	T	0.1	.	15.6115	0.76721	0.0:1.0:0.0:0.0	.	342;342	Q6P3V5;Q99466	.;NOTC4_HUMAN	M	342	ENSP00000364163:V342M	ENSP00000364163:V342M	V	-	1	0	NOTCH4	32296295	1.000000	0.71417	0.999000	0.59377	0.949000	0.60115	5.366000	0.66122	2.539000	0.85634	0.491000	0.48974	GTG	-	pirsf_Notch,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.612	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	protein_coding	OTTHUMT00000076045.2	C		rs144492578		32188317	-1	no_errors	ENST00000375023	ensembl	human	known	74_37	missense	SNP	1.000	T
OR8B8	26493	genome.wustl.edu	37	11	124310339	124310339	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr11:124310339A>G	ENST00000328064.2	-	1	715	c.643T>C	c.(643-645)Ttc>Ctc	p.F215L		NM_012378.1	NP_036510.1	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B, member 8	215					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		TAGGAAATGAAGATGGTGACT	0.493																																																	0								ENSG00000197125						188.0	161.0	170.0					11																	124310339		2201	4299	6500	OR8B8	SO:0001583	missense	0			-	HGNC	AF238488	CCDS8446.1	11q24.2	2012-08-09			ENSG00000197125	ENSG00000197125		"""GPCR / Class A : Olfactory receptors"""	8477	protein-coding gene	gene with protein product						9119360	Standard	NM_012378		Approved	TPCR85	uc010sal.2	Q15620	OTTHUMG00000165917	ENST00000328064.2:c.643T>C	11.37:g.124310339A>G	ENSP00000330280:p.Phe215Leu	Somatic	0	88	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	A1L446|Q96RC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F215L	ENST00000328064.2	37	c.643	CCDS8446.1	11	.	.	.	.	.	.	.	.	.	.	A	7.878	0.729657	0.15507	.	.	ENSG00000197125	ENST00000328064	T	0.00017	9.09	3.67	3.67	0.42095	GPCR, rhodopsin-like superfamily (1);	0.128358	0.35495	N	0.003169	T	0.00039	0.0001	N	0.01352	-0.895	0.37093	D	0.899541	B	0.26512	0.151	B	0.30782	0.12	T	0.14227	-1.0480	10	0.05525	T	0.97	.	3.2323	0.06752	0.5588:0.0:0.1038:0.3374	.	215	Q15620	OR8B8_HUMAN	L	215	ENSP00000330280:F215L	ENSP00000330280:F215L	F	-	1	0	OR8B8	123815549	0.000000	0.05858	1.000000	0.80357	0.748000	0.42578	-0.228000	0.09114	1.896000	0.54893	0.455000	0.32223	TTC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.493	OR8B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B8	protein_coding	OTTHUMT00000387056.1	A	NM_012378	-		124310339	-1	no_errors	ENST00000328064	ensembl	human	known	74_37	missense	SNP	0.998	G
EVPLL	645027	genome.wustl.edu	37	17	18286742	18286742	+	Intron	DEL	G	G	-			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr17:18286742delG	ENST00000399134.4	+	8	1138				RP1-37N7.1_ENST00000579352.1_RNA	NM_001145127.1	NP_001138599.1	A8MZ36	EVPLL_HUMAN	envoplakin-like											NS(1)|endometrium(1)|large_intestine(1)|lung(2)	5						gggcggggaaggggggggtgg	0.731																																																	0								ENSG00000264177			34,91,2697		10,0,14,18,55,1314	5.0	6.0	6.0			0.5	0.0	17		6	52,156,5780		10,0,32,18,120,2814	no	intron	EVPLL	NM_001145127.1		20,0,46,36,175,4128	A1A1,A1A2,A1R,A2A2,A2R,RR		3.4736,4.4295,3.7798			18286742	86,247,8477	657	1510	2167	RP1-37N7.1	SO:0001627	intron_variant	0				Clone_based_vega_gene		CCDS45626.1	17p11.2	2009-08-25			ENSG00000214860	ENSG00000214860			35236	protein-coding gene	gene with protein product							Standard	NM_001145127		Approved		uc002gte.3	A8MZ36	OTTHUMG00000059095	ENST00000399134.4:c.780+50G>-	17.37:g.18286742delG		Somatic	0	25	0.00		0.5497171876852348	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	19	9.52	B4DPD4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000399134.4	37	NULL	CCDS45626.1	17																																																																																			-	-		0.731	EVPLL-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LOC101928729	protein_coding	OTTHUMT00000130836.2	G	NM_001145127			18286742	-1	no_errors	ENST00000579352	ensembl	human	known	74_37	rna	DEL	0.026	-
