#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
VWF	7450	genome.wustl.edu	37	12	6153547	6153547	+	Silent	SNP	T	T	C			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr12:6153547T>C	ENST00000261405.5	-	18	2606	c.2352A>G	c.(2350-2352)gaA>gaG	p.E784E		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	784	Amino-terminal.|TIL 3.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	ACTCGAGCCCTTCAGCCCGCA	0.582																																																	0								ENSG00000110799						99.0	82.0	88.0					12																	6153547		2203	4300	6503	VWF	SO:0001819	synonymous_variant	0			-	HGNC		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.2352A>G	12.37:g.6153547T>C		Somatic	0	84	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	137	8.67	Q8TCE8|Q99806	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.E784	ENST00000261405.5	37	c.2352	CCDS8539.1	12																																																																																			-	pirsf_VWF,superfamily_TIL_dom		0.582	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	protein_coding	OTTHUMT00000399020.1	T	NM_000552	-		6153547	-1	no_errors	ENST00000261405	ensembl	human	known	74_37	silent	SNP	0.229	C
COL18A1	80781	genome.wustl.edu	37	21	46908330	46908330	+	Splice_Site	SNP	A	A	G			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr21:46908330A>G	ENST00000359759.4	+	17	3162		c.e17-1		COL18A1_ENST00000400337.2_Splice_Site|COL18A1_ENST00000355480.5_Splice_Site			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1						angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CTGCCCTGACAGGGACCTCCC	0.577																																																	0								ENSG00000182871						95.0	104.0	101.0					21																	46908330		2024	4160	6184	COL18A1	SO:0001630	splice_region_variant	0			-	HGNC		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.3142-1A>G	21.37:g.46908330A>G		Somatic	0	79	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	67	9.46	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e17-2	ENST00000359759.4	37	c.3142-2		21	.	.	.	.	.	.	.	.	.	.	A	12.84	2.059152	0.36373	.	.	ENSG00000182871	ENST00000400337;ENST00000355480;ENST00000359759;ENST00000539645	.	.	.	3.39	3.39	0.38822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.4738	0.33001	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL18A1	45732758	0.995000	0.38212	0.799000	0.32177	0.019000	0.09904	3.467000	0.53078	1.575000	0.49775	0.529000	0.55759	.	-	-		0.577	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	COL18A1	protein_coding	OTTHUMT00000206827.1	A		-	Intron	46908330	+1	no_errors	ENST00000359759	ensembl	human	known	74_37	splice_site	SNP	0.936	G
PLCG1	5335	genome.wustl.edu	37	20	39793948	39793948	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr20:39793948A>T	ENST00000373271.1	+	14	1855	c.1450A>T	c.(1450-1452)Aac>Tac	p.N484Y	PLCG1_ENST00000373272.2_Missense_Mutation_p.N484Y|PLCG1_ENST00000244007.3_Missense_Mutation_p.N484Y	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	484					activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)			breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				GTACTCTGAGAACGACATCAG	0.577																																																	0								ENSG00000124181						104.0	95.0	98.0					20																	39793948		2203	4300	6503	PLCG1	SO:0001583	missense	0			-	HGNC	M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.1450A>T	20.37:g.39793948A>T	ENSP00000362368:p.Asn484Tyr	Somatic	0	112	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	150	12.79	B7ZLY7|B9EGH4|E1P5W4|Q2V575	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PLipase_C_PInositol-sp_X_dom,pfam_SH2,pfam_PLipase_C_Pinositol-sp_Y,pfam_Pleckstrin_homology,pfam_C2_dom,pfam_SH3_domain,pfam_SH3_2,pfam_PLipase_C_EF-hand-like,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_SH2,smart_SH3_domain,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pirsf_PLC-gamma,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C,prints_SH2	p.N484Y	ENST00000373271.1	37	c.1450	CCDS13314.1	20	.	.	.	.	.	.	.	.	.	.	A	20.5	3.992833	0.74703	.	.	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	T;T;T	0.67523	-0.27;-0.27;-0.27	5.66	5.66	0.87406	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.72542	0.3473	L	0.60455	1.87	0.80722	D	1	P;P;P	0.47034	0.889;0.732;0.823	P;B;B	0.50314	0.637;0.321;0.434	T	0.75396	-0.3332	10	0.62326	D	0.03	.	15.8839	0.79226	1.0:0.0:0.0:0.0	.	484;484;484	P19174-2;P19174;A2A284	.;PLCG1_HUMAN;.	Y	484	ENSP00000244007:N484Y;ENSP00000362368:N484Y;ENSP00000362369:N484Y	ENSP00000244007:N484Y	N	+	1	0	PLCG1	39227362	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.730000	0.91510	2.158000	0.67659	0.533000	0.62120	AAC	-	superfamily_PLC-like_Pdiesterase_TIM-brl,pirsf_PLC-gamma		0.577	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCG1	protein_coding	OTTHUMT00000080514.3	A	NM_182811	-		39793948	+1	no_errors	ENST00000244007	ensembl	human	known	74_37	missense	SNP	1.000	T
RNF38	152006	genome.wustl.edu	37	9	36390530	36390530	+	Silent	SNP	G	G	A			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr9:36390530G>A	ENST00000259605.6	-	2	203	c.96C>T	c.(94-96)ttC>ttT	p.F32F	RNF38_ENST00000357058.3_5'UTR|RNF38_ENST00000350199.4_Intron|RNF38_ENST00000377885.2_5'UTR|RNF38_ENST00000353739.4_Intron|RNF38_ENST00000377877.4_Intron|RNF38_ENST00000491349.1_5'UTR	NM_022781.4	NP_073618.3	Q9H0F5	RNF38_HUMAN	ring finger protein 38	32					male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)|sperm flagellum (GO:0036126)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(1)|lung(3)|stomach(1)	11			STAD - Stomach adenocarcinoma(86;0.228)			GGAGGAGAGGGAACAGGCTCT	0.473																																																	0								ENSG00000137075						137.0	135.0	136.0					9																	36390530		2203	4300	6503	RNF38	SO:0001819	synonymous_variant	0			-	HGNC		CCDS6603.1, CCDS6604.1	9p	2013-01-09			ENSG00000137075	ENSG00000137075		"""RING-type (C3HC4) zinc fingers"""	18052	protein-coding gene	gene with protein product		612488					Standard	XM_005251364		Approved		uc003zzh.3	Q9H0F5	OTTHUMG00000019905	ENST00000259605.6:c.96C>T	9.37:g.36390530G>A		Somatic	0	81	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	80	13.83	A6PVP9|B1AM81|B1AM82|B3KSG4|E7EVL3|Q7LB33|Q8N0Y0|Q9H748	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.F32	ENST00000259605.6	37	c.96	CCDS6603.1	9																																																																																			-	NULL		0.473	RNF38-001	KNOWN	basic|CCDS	protein_coding	RNF38	protein_coding	OTTHUMT00000052422.3	G	NM_022781	-		36390530	-1	no_errors	ENST00000259605	ensembl	human	known	74_37	silent	SNP	1.000	A
MYL6	4637	genome.wustl.edu	37	12	56552164	56552164	+	5'UTR	SNP	C	C	G			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr12:56552164C>G	ENST00000550697.1	+	0	220				MYL6_ENST00000548400.1_5'Flank|MYL6_ENST00000536128.1_5'UTR|MYL6_ENST00000551589.1_5'UTR|RP11-603J24.14_ENST00000548731.1_RNA|MYL6_ENST00000547649.1_5'UTR|MYL6_ENST00000293422.5_5'UTR|MYL6_ENST00000548580.1_5'UTR|MYL6_ENST00000348108.4_5'UTR|MYL6_ENST00000547408.1_5'UTR|MYL6_ENST00000548293.1_5'Flank|MYL6_ENST00000549566.1_5'UTR|MYL6_ENST00000549017.1_5'UTR	NM_021019.4	NP_066299.2	P60660	MYL6_HUMAN	myosin, light chain 6, alkali, smooth muscle and non-muscle						ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle tissue development (GO:0007519)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|myosin complex (GO:0016459)|unconventional myosin complex (GO:0016461)|vesicle (GO:0031982)	actin-dependent ATPase activity (GO:0030898)|calcium ion binding (GO:0005509)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			large_intestine(1)|lung(1)|ovary(1)|prostate(3)|skin(1)	7			OV - Ovarian serous cystadenocarcinoma(18;0.0979)			AGGAAAAGGTCCCGGAGAGCT	0.612																																																	0								ENSG00000092841						59.0	51.0	54.0					12																	56552164		2203	4300	6503	MYL6	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AB046613	CCDS8906.1, CCDS31834.1	12q13.13	2013-01-10	2006-09-29			ENSG00000092841		"""Myosins / Light chain"", ""EF-hand domain containing"""	7587	protein-coding gene	gene with protein product		609931	"""myosin, light polypeptide 6, alkali, smooth muscle and non-muscle"""			8188229, 2304459, 2722814	Standard	NM_021019		Approved	ESMLC, MLC3NM, MLC1SM	uc001sjx.2	P60660		ENST00000550697.1:c.-22C>G	12.37:g.56552164C>G		Somatic	0	95	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	85	19.81	P16475|P24572|P24573|Q12790|Q561V9|Q6IAZ0|Q6IPY5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000550697.1	37	NULL	CCDS8906.1	12																																																																																			-	-		0.612	MYL6-003	KNOWN	NAGNAG_splice_site|basic|CCDS	protein_coding	MYL6	protein_coding	OTTHUMT00000407928.3	C		-		56552164	+1	no_errors	ENST00000550639	ensembl	human	known	74_37	rna	SNP	0.992	G
NAA10	8260	genome.wustl.edu	37	X	153197421	153197421	+	Intron	SNP	G	G	A			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chrX:153197421G>A	ENST00000464845.1	-	6	705				NAA10_ENST00000393712.3_Intron|NAA10_ENST00000370015.4_Intron|NAA10_ENST00000370009.1_Intron|NAA10_ENST00000393710.3_5'UTR	NM_001256120.1|NM_003491.3	NP_001243049.1|NP_003482.1	P41227	NAA10_HUMAN	N(alpha)-acetyltransferase 10, NatA catalytic subunit						DNA packaging (GO:0006323)|internal protein amino acid acetylation (GO:0006475)|N-terminal protein amino acid acetylation (GO:0006474)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleolus (GO:0005730)|nucleus (GO:0005634)	N-acetyltransferase activity (GO:0008080)|peptide alpha-N-acetyltransferase activity (GO:0004596)			breast(1)|endometrium(3)|kidney(1)|lung(3)|ovary(1)|prostate(1)	10						CCCCACAGCCGGCCCACCCCC	0.607																																					Ovarian(94;1099 1433 38814 45882 51063)												0								ENSG00000102030																																			NAA10	SO:0001627	intron_variant	0			-	HGNC	BC000308	CCDS14737.1, CCDS59179.1	Xq28	2010-05-07	2010-01-14	2010-01-14	ENSG00000102030	ENSG00000102030	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	18704	protein-coding gene	gene with protein product		300013	"""ARD1 homolog, N-acetyltransferase (S. cerevisiae)"", ""ARD1 homolog A, N-acetyltransferase (S. cerevisiae)"""	ARD1, ARD1A		7981673, 19660095	Standard	NM_003491		Approved	DXS707, TE2	uc004fjm.2	P41227	OTTHUMG00000024225	ENST00000464845.1:c.386+102C>T	X.37:g.153197421G>A		Somatic	0	145	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	136	19.53	A6NM98	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000464845.1	37	NULL	CCDS14737.1	X																																																																																			-	-		0.607	NAA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA10	protein_coding	OTTHUMT00000061108.2	G	NM_003491	-		153197421	-1	no_errors	ENST00000393710	ensembl	human	known	74_37	rna	SNP	0.000	A
RP1L1	94137	genome.wustl.edu	37	8	10467754	10467754	+	Missense_Mutation	SNP	G	G	A	rs201382029		TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr8:10467754G>A	ENST00000382483.3	-	4	4077	c.3854C>T	c.(3853-3855)gCg>gTg	p.A1285V		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1285			A -> S (in allele RP1L1-3). {ECO:0000269|PubMed:12724644}.		cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GTTCGAGCTCGCCCTCTGCTC	0.507																																																	0								ENSG00000183638	G	VAL/ALA	6,4168		0,6,2081	164.0	166.0	166.0		3854	-4.6	0.0	8		166	1,8423		0,1,4211	yes	missense	RP1L1	NM_178857.5	64	0,7,6292	AA,AG,GG		0.0119,0.1437,0.0556	benign	1285/2401	10467754	7,12591	2087	4212	6299	RP1L1	SO:0001583	missense	0			-	HGNC	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.3854C>T	8.37:g.10467754G>A	ENSP00000371923:p.Ala1285Val	Somatic	1	238	0.42		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	217	8.44	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.A1285V	ENST00000382483.3	37	c.3854	CCDS43708.1	8	.	.	.	.	.	.	.	.	.	.	G	6.384	0.438940	0.12104	0.001437	1.19E-4	ENSG00000183638	ENST00000382483	T	0.03860	3.78	4.17	-4.58	0.03410	.	4.365480	0.00993	N	0.003548	T	0.01870	0.0059	N	0.03608	-0.345	0.09310	N	1	B	0.26363	0.147	B	0.06405	0.002	T	0.38457	-0.9660	10	0.31617	T	0.26	0.6041	1.0446	0.01567	0.2432:0.3253:0.2718:0.1597	.	1285	A6NKC6	.	V	1285	ENSP00000371923:A1285V	ENSP00000371923:A1285V	A	-	2	0	RP1L1	10505164	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.694000	0.05115	-0.498000	0.06632	-0.424000	0.05967	GCG	-	NULL		0.507	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	protein_coding	OTTHUMT00000375673.1	G		rs201382029		10467754	-1	no_errors	ENST00000382483	ensembl	human	known	74_37	missense	SNP	0.000	A
CSH2	1443	genome.wustl.edu	37	17	61950102	61950102	+	Splice_Site	SNP	C	C	T			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr17:61950102C>T	ENST00000392886.2	-	4	443		c.e4-1		CSH2_ENST00000345366.7_Intron|CSH2_ENST00000560142.1_Splice_Site|CSH2_ENST00000336844.5_Splice_Site	NM_020991.3	NP_066271.1	P0DML3	CSH2_HUMAN	chorionic somatomammotropin hormone 2							extracellular region (GO:0005576)	metal ion binding (GO:0046872)			endometrium(2)|large_intestine(1)|lung(3)	6						GCTCTAGATTCTGCAGGGGAA	0.622																																																	0								ENSG00000213218						4.0	4.0	4.0					17																	61950102		1787	3699	5486	CSH2	SO:0001630	splice_region_variant	0			-	HGNC	V00573	CCDS11646.1, CCDS42368.1, CCDS42369.1	17q22-q24	2012-10-02							2441	protein-coding gene	gene with protein product	"""placental lactogen"", ""chorionic somatomammotropin B"""	118820				593368, 6208192	Standard	NM_020991		Approved	hCS-B, CSB, CS-2	uc002jch.3	P0DML3		ENST00000392886.2:c.292-1G>A	17.37:g.61950102C>T		Somatic	0	45	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	65	10.96	P01243|Q0VDB1|Q14407	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e4-1	ENST00000392886.2	37	c.292-1	CCDS42369.1	17	.	.	.	.	.	.	.	.	.	.	C	8.340	0.828436	0.16749	.	.	ENSG00000213218	ENST00000336844;ENST00000392886	.	.	.	3.77	3.77	0.43336	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3045	0.66375	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CSH2	59303834	1.000000	0.71417	0.676000	0.29932	0.030000	0.12068	5.169000	0.64984	1.924000	0.55735	0.462000	0.41574	.	-	-		0.622	CSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSH2	protein_coding	OTTHUMT00000417657.1	C	NM_020991	-	Intron	61950102	-1	no_errors	ENST00000392886	ensembl	human	known	74_37	splice_site	SNP	0.999	T
TRIP6	7205	genome.wustl.edu	37	7	100470808	100470808	+	Silent	SNP	G	G	A			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr7:100470808G>A	ENST00000200457.4	+	9	1674	c.1314G>A	c.(1312-1314)ctG>ctA	p.L438L	SRRT_ENST00000388793.4_5'Flank|SRRT_ENST00000432932.1_5'Flank|SRRT_ENST00000347433.4_5'Flank|SRRT_ENST00000457580.2_5'Flank	NM_003302.2	NP_003293.2	Q15654	TRIP6_HUMAN	thyroid hormone receptor interactor 6	438	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				focal adhesion assembly (GO:0048041)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|kinase binding (GO:0019900)|poly(A) RNA binding (GO:0044822)|thyroid hormone receptor binding (GO:0046966)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|liver(1)|lung(5)	14	Lung NSC(181;0.041)|all_lung(186;0.0581)					GTGGGCTGCTGCTCTCCTCTG	0.612																																																	0								ENSG00000087077						60.0	55.0	56.0					7																	100470808		2203	4300	6503	TRIP6	SO:0001819	synonymous_variant	0			-	HGNC	L40374, AF000974	CCDS5708.1	7q22	2006-09-05			ENSG00000087077	ENSG00000087077			12311	protein-coding gene	gene with protein product		602933				9598321, 7776974	Standard	NM_003302		Approved	ZRP-1, OIP1, MGC10556, MGC10558, MGC29959, MGC3837, MGC4423	uc003uww.3	Q15654	OTTHUMG00000157029	ENST00000200457.4:c.1314G>A	7.37:g.100470808G>A		Somatic	0	98	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	81	19.80	A4D2E7|F2ZC07|F2ZC08|O15170|O15275|Q9BTB2|Q9BUE5|Q9BXP3|Q9UNT4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.L438	ENST00000200457.4	37	c.1314	CCDS5708.1	7																																																																																			-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM		0.612	TRIP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP6	protein_coding	OTTHUMT00000347151.2	G	NM_003302	-		100470808	+1	no_errors	ENST00000200457	ensembl	human	known	74_37	silent	SNP	1.000	A
RNF38	152006	genome.wustl.edu	37	9	36390529	36390529	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr9:36390529G>A	ENST00000259605.6	-	2	204	c.97C>T	c.(97-99)Cct>Tct	p.P33S	RNF38_ENST00000357058.3_5'UTR|RNF38_ENST00000350199.4_Intron|RNF38_ENST00000377885.2_5'UTR|RNF38_ENST00000353739.4_Intron|RNF38_ENST00000377877.4_Intron|RNF38_ENST00000491349.1_5'UTR	NM_022781.4	NP_073618.3	Q9H0F5	RNF38_HUMAN	ring finger protein 38	33					male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)|sperm flagellum (GO:0036126)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(1)|lung(3)|stomach(1)	11			STAD - Stomach adenocarcinoma(86;0.228)			GGGAGGAGAGGGAACAGGCTC	0.468																																																	0								ENSG00000137075						138.0	135.0	136.0					9																	36390529		2203	4300	6503	RNF38	SO:0001583	missense	0			-	HGNC		CCDS6603.1, CCDS6604.1	9p	2013-01-09			ENSG00000137075	ENSG00000137075		"""RING-type (C3HC4) zinc fingers"""	18052	protein-coding gene	gene with protein product		612488					Standard	XM_005251364		Approved		uc003zzh.3	Q9H0F5	OTTHUMG00000019905	ENST00000259605.6:c.97C>T	9.37:g.36390529G>A	ENSP00000259605:p.Pro33Ser	Somatic	0	81	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	80	13.98	A6PVP9|B1AM81|B1AM82|B3KSG4|E7EVL3|Q7LB33|Q8N0Y0|Q9H748	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.P33S	ENST00000259605.6	37	c.97	CCDS6603.1	9	.	.	.	.	.	.	.	.	.	.	G	17.63	3.437302	0.62955	.	.	ENSG00000137075	ENST00000259605	T	0.13420	2.59	5.73	5.73	0.89815	.	0.198451	0.34700	N	0.003757	T	0.14399	0.0348	N	0.08118	0	0.80722	D	1	D	0.57571	0.98	P	0.59424	0.857	T	0.25641	-1.0126	10	0.10636	T	0.68	-7.4734	15.3962	0.74794	0.0:0.0:1.0:0.0	.	33	Q9H0F5	RNF38_HUMAN	S	33	ENSP00000259605:P33S	ENSP00000259605:P33S	P	-	1	0	RNF38	36380529	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.489000	0.60309	2.699000	0.92147	0.655000	0.94253	CCT	-	NULL		0.468	RNF38-001	KNOWN	basic|CCDS	protein_coding	RNF38	protein_coding	OTTHUMT00000052422.3	G	NM_022781	-		36390529	-1	no_errors	ENST00000259605	ensembl	human	known	74_37	missense	SNP	1.000	A
APEH	327	genome.wustl.edu	37	3	49714115	49714115	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr3:49714115G>A	ENST00000296456.5	+	8	1218	c.818G>A	c.(817-819)cGc>cAc	p.R273H	APEH_ENST00000438011.1_Missense_Mutation_p.R273H	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase	273					beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TTGGGCATCCGCTTTTGCACC	0.597																																																	0								ENSG00000164062						142.0	132.0	136.0					3																	49714115		2203	4300	6503	APEH	SO:0001583	missense	0			-	HGNC	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882	ENST00000296456.5:c.818G>A	3.37:g.49714115G>A	ENSP00000296456:p.Arg273His	Somatic	0	316	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	335	8.47	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S9,pfam_AB_hydrolase_1,pfam_Dienelactn_hydro	p.R273H	ENST00000296456.5	37	c.818	CCDS2801.1	3	.	.	.	.	.	.	.	.	.	.	G	19.82	3.898592	0.72639	.	.	ENSG00000164062	ENST00000296456;ENST00000449966;ENST00000442186;ENST00000438011;ENST00000457042	T;T;T;T;T	0.42900	0.96;0.96;1.0;0.96;0.96	5.62	5.62	0.85841	Six-bladed beta-propeller, TolB-like (1);Peptidase S9A/B/C, oligopeptidase, N-terminal beta-propeller (1);	0.054049	0.85682	D	0.000000	T	0.52853	0.1760	L	0.58101	1.795	0.41544	D	0.988532	D;D	0.67145	0.996;0.996	P;P	0.55871	0.786;0.786	T	0.51671	-0.8676	10	0.45353	T	0.12	-34.4157	12.9303	0.58282	0.0738:0.0:0.9262:0.0	.	273;273	C9JIF9;P13798	.;ACPH_HUMAN	H	273;172;198;273;224	ENSP00000296456:R273H;ENSP00000414369:R172H;ENSP00000402365:R198H;ENSP00000415862:R273H;ENSP00000410366:R224H	ENSP00000296456:R273H	R	+	2	0	APEH	49689119	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.754000	0.68743	2.665000	0.90641	0.650000	0.86243	CGC	-	NULL		0.597	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APEH	protein_coding	OTTHUMT00000346415.2	G		-		49714115	+1	no_errors	ENST00000296456	ensembl	human	known	74_37	missense	SNP	1.000	A
PKHD1L1	93035	genome.wustl.edu	37	8	110487369	110487369	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr8:110487369G>T	ENST00000378402.5	+	51	8732	c.8628G>T	c.(8626-8628)caG>caT	p.Q2876H		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2876					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TTCCATTTCAGAAGAAACGAC	0.348										HNSCC(38;0.096)																																							0								ENSG00000205038						110.0	103.0	105.0					8																	110487369		1883	4118	6001	PKHD1L1	SO:0001583	missense	0			-	HGNC	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.8628G>T	8.37:g.110487369G>T	ENSP00000367655:p.Gln2876His	Somatic	0	78	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	107	13.01	Q567P2|Q9UF27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.Q2876H	ENST00000378402.5	37	c.8628	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	11.21	1.572067	0.28092	.	.	ENSG00000205038	ENST00000378402	D	0.85861	-2.04	5.69	3.58	0.41010	.	0.083581	0.50627	D	0.000102	T	0.73853	0.3640	L	0.29908	0.895	0.23572	N	0.997389	B	0.30763	0.294	B	0.35859	0.212	T	0.58440	-0.7636	10	0.14656	T	0.56	.	5.705	0.17903	0.1837:0.0:0.6556:0.1607	.	2876	Q86WI1	PKHL1_HUMAN	H	2876	ENSP00000367655:Q2876H	ENSP00000367655:Q2876H	Q	+	3	2	PKHD1L1	110556545	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.212000	0.42835	1.400000	0.46741	0.655000	0.94253	CAG	-	NULL		0.348	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	protein_coding	OTTHUMT00000381017.1	G	NM_177531	-		110487369	+1	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	SNP	0.999	T
DOCK8	81704	genome.wustl.edu	37	9	371527	371527	+	Silent	SNP	G	G	A			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr9:371527G>A	ENST00000453981.1	+	17	2080	c.1968G>A	c.(1966-1968)caG>caA	p.Q656Q	DOCK8_ENST00000382331.1_Intron|DOCK8_ENST00000382329.1_Silent_p.Q123Q|DOCK8_ENST00000432829.2_Silent_p.Q588Q|DOCK8_ENST00000469391.1_Silent_p.Q588Q			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	656	DHR-1.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		GCTGTCAGCAGAAGCAAGGAG	0.493																																																	0								ENSG00000107099						98.0	87.0	91.0					9																	371527		2203	4300	6503	DOCK8	SO:0001819	synonymous_variant	0			-	HGNC	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.1968G>A	9.37:g.371527G>A		Somatic	0	66	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	58	23.68	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_DOCK_C/D_N,superfamily_ARM-type_fold	p.Q656	ENST00000453981.1	37	c.1968	CCDS6440.2	9																																																																																			-	NULL		0.493	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	protein_coding	OTTHUMT00000171792.5	G	XM_036307	-		371527	+1	no_errors	ENST00000453981	ensembl	human	known	74_37	silent	SNP	1.000	A
SIM1	6492	genome.wustl.edu	37	6	100838449	100838449	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr6:100838449T>G	ENST00000369208.3	-	12	2871	c.2089A>C	c.(2089-2091)Aac>Cac	p.N697H	SIM1_ENST00000262901.4_Missense_Mutation_p.N697H			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	697	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		CCAAAGCAGTTTGGAGAGACA	0.438																																																	0								ENSG00000112246						106.0	105.0	105.0					6																	100838449		2203	4300	6503	SIM1	SO:0001583	missense	0			-	HGNC	U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.2089A>C	6.37:g.100838449T>G	ENSP00000358210:p.Asn697His	Somatic	0	84	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	99	16.81	Q5TDP7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SIM_C,pfam_PAS_fold_3,pfam_PAS_fold,pfam_bHLH_dom,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,pfscan_PAS,pfscan_bHLH_dom	p.N697H	ENST00000369208.3	37	c.2089	CCDS5045.1	6	.	.	.	.	.	.	.	.	.	.	T	13.77	2.336978	0.41398	.	.	ENSG00000112246	ENST00000369208;ENST00000262901	T;T	0.03580	3.88;3.88	6.16	6.16	0.99307	Single-minded, C-terminal (1);	0.110120	0.64402	D	0.000009	T	0.02083	0.0065	N	0.22421	0.69	0.41298	D	0.987025	P	0.46277	0.875	B	0.41510	0.359	T	0.57423	-0.7814	10	0.72032	D	0.01	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	697	P81133	SIM1_HUMAN	H	697	ENSP00000358210:N697H;ENSP00000262901:N697H	ENSP00000262901:N697H	N	-	1	0	SIM1	100945170	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.181000	0.71988	2.367000	0.80283	0.528000	0.53228	AAC	-	NULL		0.438	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIM1	protein_coding	OTTHUMT00000041628.3	T	NM_005068	-		100838449	-1	no_errors	ENST00000262901	ensembl	human	known	74_37	missense	SNP	1.000	G
LINC01579	283682	genome.wustl.edu	37	15	94304116	94304116	+	lincRNA	DEL	T	T	-			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr15:94304116delT	ENST00000557481.2	-	0	780				RP11-739G5.1_ENST00000554318.2_lincRNA																							GCCAAATACATTTTTTTAAAA	0.413																																																	0								ENSG00000258754																																			CTD-3049M7.1			0				Clone_based_vega_gene																													15.37:g.94304116delT		Somatic	0	43	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	53	8.62		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000557481.2	37	NULL		15																																																																																			-	-		0.413	CTD-3049M7.1-001	KNOWN	basic	lincRNA	LOC101927091	lincRNA	OTTHUMT00000415163.2	T				94304116	-1	no_errors	ENST00000557481	ensembl	human	known	74_37	rna	DEL	0.000	-
ZNF467	168544	genome.wustl.edu	37	7	149461818	149461818	+	Silent	SNP	G	G	C			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr7:149461818G>C	ENST00000302017.3	-	5	2186	c.1773C>G	c.(1771-1773)ccC>ccG	p.P591P	ZNF467_ENST00000484747.1_Intron	NM_207336.1	NP_997219.1	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	591					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|urinary_tract(1)	13	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGAAGAGCGGGGGCGGCGCCA	0.701																																																	0								ENSG00000181444																																			ZNF467	SO:0001819	synonymous_variant	0			-	HGNC	BC029296	CCDS5899.1	7q36.1	2013-01-08			ENSG00000181444	ENSG00000181444		"""Zinc fingers, C2H2-type"""	23154	protein-coding gene	gene with protein product		614040				12426389	Standard	NM_207336		Approved	EZI, Zfp467	uc003wgd.2	Q7Z7K2	OTTHUMG00000157883	ENST00000302017.3:c.1773C>G	7.37:g.149461818G>C		Somatic	0	64	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	73	9.88		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P591	ENST00000302017.3	37	c.1773	CCDS5899.1	7																																																																																			-	NULL		0.701	ZNF467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF467	protein_coding	OTTHUMT00000349833.1	G	NM_207336	-		149461818	-1	no_errors	ENST00000302017	ensembl	human	known	74_37	silent	SNP	0.004	C
DOCK8	81704	genome.wustl.edu	37	9	371452	371452	+	Silent	SNP	G	G	A			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr9:371452G>A	ENST00000453981.1	+	17	2005	c.1893G>A	c.(1891-1893)gtG>gtA	p.V631V	DOCK8_ENST00000382331.1_Intron|DOCK8_ENST00000382329.1_Silent_p.V98V|DOCK8_ENST00000432829.2_Silent_p.V563V|DOCK8_ENST00000469391.1_Silent_p.V563V			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	631	DHR-1.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		ATGAAGAAGTGAAAATTAAGC	0.428																																																	0								ENSG00000107099						98.0	93.0	94.0					9																	371452		2203	4300	6503	DOCK8	SO:0001819	synonymous_variant	0			-	HGNC	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.1893G>A	9.37:g.371452G>A		Somatic	0	55	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	53	19.70	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_DOCK_C/D_N,superfamily_ARM-type_fold	p.V631	ENST00000453981.1	37	c.1893	CCDS6440.2	9																																																																																			-	NULL		0.428	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	protein_coding	OTTHUMT00000171792.5	G	XM_036307	-		371452	+1	no_errors	ENST00000453981	ensembl	human	known	74_37	silent	SNP	0.998	A
BRIX1	55299	genome.wustl.edu	37	5	34925328	34925329	+	Intron	INS	-	-	A	rs112241293|rs66875519	byFrequency	TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr5:34925328_34925329insA	ENST00000336767.5	+	10	1155				BRIX1_ENST00000506023.1_Intron	NM_018321.3	NP_060791.3	Q8TDN6	BRX1_HUMAN	BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)						ribosome biogenesis (GO:0042254)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|large_intestine(2)|lung(1)	4						TTTTTTTTTTTAGCATCGGCGT	0.332													|||unknown(HR)	735	0.146765	0.0719	0.1455	5008	,	,		16270	0.1131		0.2058	False		,,,				2504	0.2229																0								ENSG00000113460			312,517,55,3344		15,38,7,237,60,6,353,4,34,1360						0.4	0.3		dbSNP_130	11	1360,691,230,5903		125,93,69,948,47,18,486,8,127,2171	no	splice-3	BRIX1	NM_018321.3		140,131,76,1185,107,24,839,12,161,3531	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		27.8715,20.9082,25.4995				1672,1208,285,9247				BRIX1	SO:0001627	intron_variant	0				HGNC		CCDS34143.1	5p13.2	2009-09-25	2009-09-25	2009-09-25	ENSG00000113460	ENSG00000113460			24170	protein-coding gene	gene with protein product			"""brix domain containing 2"""	BXDC2		12477932	Standard	NM_018321		Approved	BRIX, FLJ11100	uc003jja.3	Q8TDN6	OTTHUMG00000162021	ENST00000336767.5:c.793-2->A	5.37:g.34925329_34925329dupA		Somatic	0	32	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	20	20.00	A8K0P5|Q3ZTT4|Q8N453|Q96DH1	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e10-2	ENST00000336767.5	37	c.793-3_793-2	CCDS34143.1	5																																																																																			-	-		0.332	BRIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRIX1	protein_coding	OTTHUMT00000366826.2	-	NM_018321			34925329	+1	no_errors	ENST00000336767	ensembl	human	known	74_37	splice_site_ins	INS	0.213:0.997	A
EGFLAM	133584	genome.wustl.edu	37	5	38431329	38431329	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr5:38431329G>A	ENST00000354891.3	+	15	2451	c.2105G>A	c.(2104-2106)cGc>cAc	p.R702H	EGFLAM_ENST00000336740.6_Missense_Mutation_p.R468H|EGFLAM_ENST00000397202.2_Missense_Mutation_p.R68H|EGFLAM_ENST00000322350.5_Missense_Mutation_p.R702H	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	702	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					CGTGTATCTCGCACAGCAAAG	0.443																																					Colon(62;485 1295 3347 17454)												0								ENSG00000164318						143.0	122.0	129.0					5																	38431329		2203	4300	6503	EGFLAM	SO:0001583	missense	0			-	HGNC	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.2105G>A	5.37:g.38431329G>A	ENSP00000346964:p.Arg702His	Somatic	0	171	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	177	14.08	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_Fibronectin_type3,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Laminin_G	p.R702H	ENST00000354891.3	37	c.2105	CCDS56363.1	5	.	.	.	.	.	.	.	.	.	.	G	34	5.319935	0.95682	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000397202;ENST00000339580	D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54	5.78	5.78	0.91487	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.92886	0.7737	M	0.93328	3.405	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93987	0.7263	10	0.87932	D	0	-11.9526	20.0139	0.97470	0.0:0.0:1.0:0.0	.	468;702;702	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	H	702;702;468;68;468	ENSP00000346964:R702H;ENSP00000313084:R702H;ENSP00000337607:R468H;ENSP00000380385:R68H	ENSP00000313084:R702H	R	+	2	0	EGFLAM	38467086	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	9.062000	0.93920	2.724000	0.93272	0.563000	0.77884	CGC	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.443	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	EGFLAM	protein_coding	OTTHUMT00000367323.1	G	NM_152403	-		38431329	+1	no_errors	ENST00000354891	ensembl	human	known	74_37	missense	SNP	1.000	A
PRKACA	5566	genome.wustl.edu	37	19	14204564	14204564	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr19:14204564A>T	ENST00000308677.4	-	9	1002	c.806T>A	c.(805-807)cTg>cAg	p.L269Q	PRKACA_ENST00000590853.1_Intron|SAMD1_ENST00000541938.1_5'Flank|PRKACA_ENST00000589994.1_Missense_Mutation_p.L261Q|PRKACA_ENST00000350356.3_5'UTR	NM_002730.3	NP_002721.1	P17612	KAPCA_HUMAN	protein kinase, cAMP-dependent, catalytic, alpha	269	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|carbohydrate metabolic process (GO:0005975)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to glucagon stimulus (GO:0071377)|cellular response to glucose stimulus (GO:0071333)|cellular response to parathyroid hormone stimulus (GO:0071374)|cytosolic calcium ion homeostasis (GO:0051480)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|mitotic cell cycle (GO:0000278)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of protein export from nucleus (GO:0046827)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of insulin secretion (GO:0050796)|regulation of osteoblast differentiation (GO:0045667)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein binding (GO:0043393)|regulation of protein processing (GO:0070613)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic transmission (GO:0050804)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|calcium channel complex (GO:0034704)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|protein kinase A regulatory subunit binding (GO:0034237)|protein kinase binding (GO:0019901)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16						GTTCCGCAGCAGGTCCTTCAA	0.547																																																	0								ENSG00000072062						91.0	83.0	86.0					19																	14204564		2203	4300	6503	PRKACA	SO:0001583	missense	0			-	HGNC		CCDS12304.1, CCDS12305.1	19p13.1	2012-10-02				ENSG00000072062	2.7.11.1		9380	protein-coding gene	gene with protein product		601639				8884279	Standard	NM_002730		Approved	PKACa	uc002myc.3	P17612		ENST00000308677.4:c.806T>A	19.37:g.14204564A>T	ENSP00000309591:p.Leu269Gln	Somatic	0	107	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	114	14.93	Q32P54|Q9H2Y0|Q9NRB4|Q9NRH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L269Q	ENST00000308677.4	37	c.806	CCDS12304.1	19	.	.	.	.	.	.	.	.	.	.	A	23.4	4.407917	0.83340	.	.	ENSG00000072062	ENST00000308677;ENST00000350356;ENST00000535695	T	0.73363	-0.74	4.89	4.89	0.63831	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.41712	D	0.000839	D	0.90452	0.7010	H	0.97365	3.99	0.46901	D	0.999245	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.971	D	0.93112	0.6517	10	0.87932	D	0	.	12.4877	0.55883	1.0:0.0:0.0:0.0	.	269;261	P17612;P17612-2	KAPCA_HUMAN;.	Q	269;261;269	ENSP00000309591:L269Q	ENSP00000309591:L269Q	L	-	2	0	PRKACA	14065564	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.153000	0.94687	1.843000	0.53566	0.402000	0.26972	CTG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.547	PRKACA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKACA	protein_coding	OTTHUMT00000459004.1	A	NM_002730	-		14204564	-1	no_errors	ENST00000308677	ensembl	human	known	74_37	missense	SNP	1.000	T
FBXL16	146330	genome.wustl.edu	37	16	747263	747265	+	In_Frame_Del	DEL	TGG	TGG	-			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	TGG	TGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr16:747263_747265delTGG	ENST00000397621.1	-	2	472_474	c.141_143delCCA	c.(139-144)tgccag>tgg	p.47_48CQ>W	FBXL16_ENST00000562563.1_5'Flank|FBXL16_ENST00000324361.5_In_Frame_Del_p.47_48CQ>W|FBXL16_ENST00000562585.1_5'Flank	NM_153350.3	NP_699181.2	Q8N461	FXL16_HUMAN	F-box and leucine-rich repeat protein 16	47	Pro-rich.									endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(1)	10		Hepatocellular(780;0.0218)				GGGTGGTGGCTGGCAGGGGCGGT	0.729																																																	0								ENSG00000127585																																			FBXL16	SO:0001651	inframe_deletion	0				HGNC	BC036680	CCDS10421.1	16p13.3	2011-06-09	2004-06-15	2004-06-16	ENSG00000127585	ENSG00000127585		"""F-boxes / Leucine-rich repeats"""	14150	protein-coding gene	gene with protein product		609082	"""chromosome 16 open reading frame 22"""	C16orf22		11157797	Standard	NM_153350		Approved	MGC33974, Fbl16	uc021taa.1	Q8N461	OTTHUMG00000090420	ENST00000397621.1:c.141_143delCCA	16.37:g.747263_747265delTGG	ENSP00000380746:p.Cys47_Gln48delinsTrp	Somatic	0	9	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	7	41.67	B3KR59|D3DU60|Q2MHR2|Q96S14|Q9UJI0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_F-box_dom,smart_Leu-rich_rpt_Cys-con_subtyp	p.CQ47in_frame_delW	ENST00000397621.1	37	c.143_141	CCDS10421.1	16																																																																																			-	NULL		0.729	FBXL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL16	protein_coding	OTTHUMT00000206851.2	TGG	NM_153350			747265	-1	no_errors	ENST00000324361	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
OR10H1	26539	genome.wustl.edu	37	19	15918231	15918231	+	Missense_Mutation	SNP	G	G	A	rs371707981		TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr19:15918231G>A	ENST00000334920.2	-	1	705	c.617C>T	c.(616-618)aCg>aTg	p.T206M		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						CAGCAGGGCCGTGATACACAC	0.562													.|||	1	0.000199681	0.0008	0.0	5008	,	,		22617	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000186723	A	MET/THR	1,4405		0,1,2202	148.0	116.0	127.0		617	-2.7	0.0	19		127	0,8596		0,0,4298	no	missense	OR10H1	NM_013940.2	81	0,1,6500	AA,AG,GG		0.0,0.0227,0.0077	benign	206/319	15918231	1,13001	2203	4298	6501	OR10H1	SO:0001583	missense	0			-	HGNC	AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.617C>T	19.37:g.15918231G>A	ENSP00000335596:p.Thr206Met	Somatic	0	370	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	112	318	26.05	Q6IFQ2|Q96R59	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T206M	ENST00000334920.2	37	c.617	CCDS12335.1	19	.	.	.	.	.	.	.	.	.	.	.	1.907	-0.451753	0.04572	2.27E-4	0.0	ENSG00000186723	ENST00000334920	T	0.37584	1.19	4.71	-2.73	0.05950	GPCR, rhodopsin-like superfamily (1);	0.917063	0.09119	N	0.845926	T	0.24160	0.0585	N	0.17764	0.52	0.09310	N	1	B	0.25105	0.118	B	0.32090	0.14	T	0.41016	-0.9532	10	0.62326	D	0.03	.	8.6121	0.33808	0.5579:0.0:0.4421:0.0	.	206	Q9Y4A9	O10H1_HUMAN	M	206	ENSP00000335596:T206M	ENSP00000335596:T206M	T	-	2	0	OR10H1	15779231	0.000000	0.05858	0.004000	0.12327	0.075000	0.17131	-1.174000	0.03105	-0.413000	0.07507	-1.817000	0.00601	ACG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.562	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H1	protein_coding	OTTHUMT00000460364.1	G		-		15918231	-1	no_errors	ENST00000334920	ensembl	human	known	74_37	missense	SNP	0.006	A
ZNF716	441234	genome.wustl.edu	37	7	57528451	57528451	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr7:57528451A>T	ENST00000420713.1	+	4	396	c.284A>T	c.(283-285)cAa>cTa	p.Q95L		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	95					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(20)|ovary(2)	24						CATTTCACCCAAGACCTTCAG	0.323																																																	0								ENSG00000182111						59.0	58.0	59.0					7																	57528451		692	1591	2283	ZNF716	SO:0001583	missense	0			-	HGNC	AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.284A>T	7.37:g.57528451A>T	ENSP00000394248:p.Gln95Leu	Somatic	0	135	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	120	18.37		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q95L	ENST00000420713.1	37	c.284	CCDS55112.1	7	.	.	.	.	.	.	.	.	.	.	A	12.88	2.069074	0.36470	.	.	ENSG00000182111	ENST00000420713;ENST00000418732	T	0.05513	3.43	0.195	0.195	0.15151	.	.	.	.	.	T	0.13329	0.0323	L	0.47078	1.49	0.19575	N	0.999963	D	0.60160	0.987	D	0.67725	0.953	T	0.16158	-1.0412	9	0.66056	D	0.02	.	4.8229	0.13400	0.9998:0.0:2.0E-4:0.0	.	83	A6NP11	ZN716_HUMAN	L	95;83	ENSP00000394248:Q95L	ENSP00000387687:Q83L	Q	+	2	0	ZNF716	57532393	0.009000	0.17119	0.049000	0.19019	0.049000	0.14656	0.806000	0.27126	0.257000	0.21650	0.254000	0.18369	CAA	-	NULL		0.323	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF716	protein_coding	OTTHUMT00000345309.1	A	NM_001159279	-		57528451	+1	no_errors	ENST00000420713	ensembl	human	known	74_37	missense	SNP	0.458	T
ACTN4	81	genome.wustl.edu	37	19	39214576	39214576	+	Splice_Site	SNP	G	G	C			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr19:39214576G>C	ENST00000252699.2	+	14	1627		c.e14-1		ACTN4_ENST00000424234.2_Splice_Site|ACTN4_ENST00000390009.3_Splice_Site	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4						actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCACACACTAGAAAACAGAGA	0.627																																					Colon(168;199 1940 10254 46213 46384)												0								ENSG00000130402						26.0	29.0	28.0					19																	39214576		2203	4300	6503	ACTN4	SO:0001630	splice_region_variant	0			-	HGNC	D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.1552-1G>C	19.37:g.39214576G>C		Somatic	1	112	0.88		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	137	25.95	A4K467|D6PXK4|O76048	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e14-1	ENST00000252699.2	37	c.1552-1	CCDS12518.1	19	.	.	.	.	.	.	.	.	.	.	G	15.89	2.967246	0.53507	.	.	ENSG00000130402	ENST00000252699;ENST00000424234;ENST00000390009	.	.	.	3.73	3.73	0.42828	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8109	0.69994	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACTN4	43906416	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	9.536000	0.98067	2.092000	0.63282	0.561000	0.74099	.	-	-		0.627	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN4	protein_coding	OTTHUMT00000268091.1	G		-	Intron	39214576	+1	no_errors	ENST00000252699	ensembl	human	known	74_37	splice_site	SNP	1.000	C
AC018755.1	0	genome.wustl.edu	37	19	52097256	52097256	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr19:52097256T>C	ENST00000301439.3	-	1	374	c.319A>G	c.(319-321)Atc>Gtc	p.I107V	AC018755.16_ENST00000598755.1_RNA																							AGAAAGACGATTGTGCGTAAC	0.582																																																	0								ENSG00000167765																																			AC018755.1	SO:0001583	missense	0			-	Clone_based_ensembl_gene																												ENST00000301439.3:c.319A>G	19.37:g.52097256T>C	ENSP00000301439:p.Ile107Val	Somatic	0	156	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	161	10.06		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I107V	ENST00000301439.3	37	c.319		19	.	.	.	.	.	.	.	.	.	.	T	5.537	0.283982	0.10458	.	.	ENSG00000167765	ENST00000301439	.	.	.	2.37	-1.93	0.07594	.	.	.	.	.	T	0.25195	0.0612	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.32851	-0.9891	7	0.87932	D	0	.	0.4823	0.00550	0.2659:0.3337:0.2133:0.1871	.	107	Q96NP5	.	V	107	.	ENSP00000301439:I107V	I	-	1	0	AC018755.11	56789068	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.333000	0.02667	-0.304000	0.08843	0.361000	0.22055	ATC	-	NULL		0.582	AC018755.1-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	ENSG00000167765	protein_coding		T		-		52097256	-1	no_errors	ENST00000301439	ensembl	human	known	74_37	missense	SNP	0.000	C
CLCN1	1180	genome.wustl.edu	37	7	143048760	143048760	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr7:143048760C>T	ENST00000343257.2	+	23	2756	c.2669C>T	c.(2668-2670)aCg>aTg	p.T890M		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	890					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					TTCCGGAACACGACTTCAACT	0.582																																																	0								ENSG00000188037						46.0	43.0	44.0					7																	143048760		2203	4300	6503	CLCN1	SO:0001583	missense	0			-	HGNC	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.2669C>T	7.37:g.143048760C>T	ENSP00000339867:p.Thr890Met	Somatic	0	83	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	90	8.16	A4D2H5|Q2M202	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cl-channel_volt-gated,pfam_CBS_dom,superfamily_Cl-channel_core,prints_Cl-channel_volt-gated,prints_Cl_channel-1	p.T890M	ENST00000343257.2	37	c.2669	CCDS5881.1	7	.	.	.	.	.	.	.	.	.	.	C	13.98	2.397568	0.42512	.	.	ENSG00000188037	ENST00000343257	D	0.86097	-2.07	4.8	4.8	0.61643	.	0.128581	0.50627	D	0.000108	D	0.89591	0.6759	M	0.62723	1.935	0.34906	D	0.74699	D;D	0.89917	1.0;0.999	D;D	0.74674	0.984;0.947	D	0.91645	0.5330	10	0.44086	T	0.13	.	10.9786	0.47480	0.0:0.9089:0.0:0.0911	.	89;890	Q75L28;P35523	.;CLCN1_HUMAN	M	890	ENSP00000339867:T890M	ENSP00000339867:T890M	T	+	2	0	CLCN1	142758882	0.376000	0.25098	0.068000	0.19968	0.193000	0.23685	3.858000	0.55979	2.378000	0.81104	0.561000	0.74099	ACG	-	NULL		0.582	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN1	protein_coding	OTTHUMT00000327420.1	C	NM_000083	-		143048760	+1	no_errors	ENST00000343257	ensembl	human	known	74_37	missense	SNP	0.835	T
SPHKAP	80309	genome.wustl.edu	37	2	228883090	228883090	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr2:228883090G>T	ENST00000392056.3	-	7	2526	c.2480C>A	c.(2479-2481)aCa>aAa	p.T827K	SPHKAP_ENST00000344657.5_Missense_Mutation_p.T827K	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	827						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GGAGGATGTTGTAGCAGTTGA	0.473																																																	0								ENSG00000153820						726.0	689.0	702.0					2																	228883090		2203	4300	6503	SPHKAP	SO:0001583	missense	0			-	HGNC		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.2480C>A	2.37:g.228883090G>T	ENSP00000375909:p.Thr827Lys	Somatic	0	196	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	122	21.29	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AKAP_110_C	p.T827K	ENST00000392056.3	37	c.2480	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	G	0	-2.744411	0.00087	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.08282	3.11;3.11	5.97	3.53	0.40419	.	0.560547	0.21611	N	0.071791	T	0.01387	0.0045	N	0.00092	-2.175	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.44065	-0.9352	10	0.02654	T	1	-7.7737	8.6558	0.34062	0.0:0.0679:0.1317:0.8004	.	827;827	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	K	827	ENSP00000375909:T827K;ENSP00000339886:T827K	ENSP00000339886:T827K	T	-	2	0	SPHKAP	228591334	0.263000	0.24083	0.003000	0.11579	0.145000	0.21501	0.883000	0.28200	0.477000	0.27464	-0.266000	0.10368	ACA	-	NULL		0.473	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	protein_coding	OTTHUMT00000331750.1	G	NM_030623	-		228883090	-1	no_errors	ENST00000392056	ensembl	human	known	74_37	missense	SNP	0.003	T
SCPEP1	59342	genome.wustl.edu	37	17	55062464	55062465	+	Intron	INS	-	-	GAAAA	rs34242828|rs397829366|rs3056052|rs573491470	byFrequency	TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr17:55062464_55062465insGAAAA	ENST00000262288.3	+	3	280				SCPEP1_ENST00000571898.1_Intron|RP5-1107A17.4_ENST00000572877.1_RNA	NM_021626.2	NP_067639.1	Q9HB40	RISC_HUMAN	serine carboxypeptidase 1						negative regulation of blood pressure (GO:0045776)|positive regulation of vasodilation (GO:0045909)|retinoic acid metabolic process (GO:0042573)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	14	Breast(9;2.86e-08)					agactctgtctgaaaagaaaag	0.475																																																	0								ENSG00000263120																																			RP5-1107A17.4	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF282618	CCDS11593.1	17q22	2012-09-20			ENSG00000121064	ENSG00000121064			29507	protein-coding gene	gene with protein product	"""retinoid inducible serine carboxypeptidase"""					11447226, 12975309	Standard	NM_021626		Approved	RISC	uc002iuv.4	Q9HB40	OTTHUMG00000178129	ENST00000262288.3:c.226-274->GAAAA	17.37:g.55062470_55062474dupGAAAA		Somatic	NA	NA	NA		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q96A94|Q9H3F0	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000262288.3	37	NULL	CCDS11593.1	17																																																																																			-	-		0.475	SCPEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000263120	protein_coding	OTTHUMT00000440622.1	-	NM_021626			55062465	+1	no_errors	ENST00000572877	ensembl	human	known	74_37	rna	INS	0.001:0.001	GAAAA
KRT32	3882	genome.wustl.edu	37	17	39623131	39623131	+	Silent	SNP	G	G	T			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr17:39623131G>T	ENST00000225899.3	-	1	550	c.447C>A	c.(445-447)acC>acA	p.T149T	RNU2-32P_ENST00000411193.1_RNA	NM_002278.3	NP_002269.3	Q14532	K1H2_HUMAN	keratin 32	149	Coil 1B.|Rod.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(137;0.000812)				GCTCCTCAATGGTCCTGAAAT	0.557																																																	0								ENSG00000108759						76.0	68.0	71.0					17																	39623131		2203	4300	6503	KRT32	SO:0001819	synonymous_variant	0			-	HGNC	X90761	CCDS11393.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000108759	ENSG00000108759		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6449	protein-coding gene	gene with protein product	"""hard keratin type I"""	602760	"""keratin, hair, acidic, 2"""	KRTHA2		7556444, 8823373, 16831889	Standard	NM_002278		Approved	Ha-2	uc002hwr.3	Q14532	OTTHUMG00000133430	ENST00000225899.3:c.447C>A	17.37:g.39623131G>T		Somatic	0	167	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	131	21.08		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.T149	ENST00000225899.3	37	c.447	CCDS11393.1	17																																																																																			-	pfam_IF		0.557	KRT32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT32	protein_coding	OTTHUMT00000257293.1	G	NM_002278	-		39623131	-1	no_errors	ENST00000225899	ensembl	human	known	74_37	silent	SNP	0.974	T
ARHGAP27	201176	genome.wustl.edu	37	17	43507621	43507621	+	Missense_Mutation	SNP	C	C	T	rs546150279		TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr17:43507621C>T	ENST00000428638.1	-	1	24	c.25G>A	c.(25-27)Gtg>Atg	p.V9M	ARHGAP27_ENST00000532891.2_Missense_Mutation_p.V9M|ARHGAP27_ENST00000290470.3_Missense_Mutation_p.V9M|ARHGAP27_ENST00000442348.1_Missense_Mutation_p.V9M|ARHGAP27_ENST00000528273.1_Missense_Mutation_p.V9M			Q6ZUM4	RHG27_HUMAN	Rho GTPase activating protein 27	9	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of Rac GTPase activity (GO:0032855)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|SH3 domain binding (GO:0017124)			endometrium(4)|large_intestine(9)|lung(3)|skin(1)	17	Renal(3;0.0405)					AGCACGTACACGTCCCCCACC	0.697													C|||	1	0.000199681	0.0008	0.0	5008	,	,		10975	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000159314						5.0	5.0	5.0					17																	43507621		1758	3677	5435	ARHGAP27	SO:0001583	missense	0			-	HGNC	AK125535	CCDS11498.1, CCDS74082.1	17q21.31	2013-01-10			ENSG00000159314	ENSG00000159314		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	31813	protein-coding gene	gene with protein product		610591	"""SH3 domain containing 20"""	SH3D20		15147912	Standard	NM_199282		Approved	CAMGAP1, FLJ43547, SH3P20	uc002iix.3	Q6ZUM4	OTTHUMG00000166982	ENST00000428638.1:c.25G>A	17.37:g.43507621C>T	ENSP00000403323:p.Val9Met	Somatic	0	140	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	167	12.11	A4FU35|A8K3N5|C9JTF3|Q494U0|Q6NWZ8|Q8WY58	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_WW_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_WW_dom,smart_WW_dom,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_WW_dom,pfscan_RhoGAP_dom	p.V9M	ENST00000428638.1	37	c.25		17	.	.	.	.	.	.	.	.	.	.	C	23.8	4.454466	0.84209	.	.	ENSG00000159314	ENST00000532891;ENST00000428638;ENST00000442348;ENST00000528273;ENST00000290470	T;T;T;T;T	0.54279	2.78;2.8;2.76;0.58;0.58	3.43	3.43	0.39272	.	.	.	.	.	T	0.54631	0.1870	M	0.67397	2.05	0.29661	N	0.843205	D	0.56521	0.976	P	0.45119	0.47	T	0.59752	-0.7395	9	0.72032	D	0.01	.	12.5738	0.56352	0.0:1.0:0.0:0.0	.	9	Q6ZUM4-4	.	M	9	ENSP00000433942:V9M;ENSP00000403323:V9M;ENSP00000409330:V9M;ENSP00000436137:V9M;ENSP00000290470:V9M	ENSP00000290470:V9M	V	-	1	0	ARHGAP27	40863404	0.995000	0.38212	1.000000	0.80357	0.977000	0.68977	2.743000	0.47442	1.816000	0.52996	0.449000	0.29647	GTG	-	superfamily_SH3_domain		0.697	ARHGAP27-202	KNOWN	basic	protein_coding	ARHGAP27	protein_coding		C	NM_199282	-		43507621	-1	no_errors	ENST00000428638	ensembl	human	known	74_37	missense	SNP	1.000	T
MEN1	4221	genome.wustl.edu	37	11	64572627	64572627	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr11:64572627delA	ENST00000337652.1	-	9	1747	c.1244delT	c.(1243-1245)ttcfs	p.F415fs	MEN1_ENST00000394376.1_Frame_Shift_Del_p.F415fs|MAP4K2_ENST00000468062.1_5'Flank|MAP4K2_ENST00000294066.2_5'Flank|MEN1_ENST00000377326.3_Frame_Shift_Del_p.F410fs|MEN1_ENST00000312049.6_Frame_Shift_Del_p.F410fs|MEN1_ENST00000394374.2_Frame_Shift_Del_p.F415fs|MEN1_ENST00000377321.1_Frame_Shift_Del_p.F375fs|MAP4K2_ENST00000377350.3_5'Flank|MEN1_ENST00000377313.1_Frame_Shift_Del_p.F415fs|MEN1_ENST00000443283.1_Frame_Shift_Del_p.F415fs|MEN1_ENST00000478548.1_5'UTR|MEN1_ENST00000315422.4_Frame_Shift_Del_p.F410fs|MEN1_ENST00000377316.2_Intron	NM_130803.2	NP_570715	O00255	MEN1_HUMAN	multiple endocrine neoplasia I	415					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(7)|adrenal_gland(5)|breast(2)|central_nervous_system(5)|endometrium(1)|gastrointestinal_tract_(site_indeterminate)(15)|large_intestine(2)|lung(21)|ovary(1)|pancreas(64)|parathyroid(181)|pituitary(7)|prostate(4)|retroperitoneum(1)|skin(1)|small_intestine(13)|soft_tissue(4)|stomach(1)|thymus(2)	337						CAGGTGGGCGAAGCACTCAGG	0.627			"""D, Mis, N, F, S"""		"""parathyroid tumors, Pancreatic neuroendocrine tumors"""	"""parathyroid adenoma, pituitary adenoma, pancreatic islet cell, carcinoid"""			Multiple Endocrine Neoplasia, type 1;Hyperparathyroidism, Familial Isolated																												Esophageal Squamous(1;83 158 15500 18603 18803 29295)		yes	Rec	yes	Multiple Endocrine Neoplasia Type 1	11	11q13	4221	multiple endocrine neoplasia type 1 gene		E	0								ENSG00000133895						72.0	67.0	69.0					11																	64572627		2201	4297	6498	MEN1	SO:0001589	frameshift_variant	0	Familial Cancer Database	MEN1, Wermer disease;FIHP, FIHPT, HRPT1, Familial Isolated Primary Hyperparathyroidism		HGNC	U93236	CCDS8083.1, CCDS31600.1	11q13	2014-09-17			ENSG00000133895	ENSG00000133895			7010	protein-coding gene	gene with protein product	"""menin"""	613733					Standard	NM_130799		Approved		uc001obn.3	O00255	OTTHUMG00000045366	ENST00000337652.1:c.1244delT	11.37:g.64572627delA	ENSP00000337088:p.Phe415fs	Somatic	0	105	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	51	28.17	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Menin	p.F415fs	ENST00000337652.1	37	c.1244	CCDS8083.1	11																																																																																			-	pfam_Menin		0.627	MEN1-201	KNOWN	basic|CCDS	protein_coding	MEN1	protein_coding	OTTHUMT00000143881.1	A				64572627	-1	no_errors	ENST00000337652	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
FAM184B	27146	genome.wustl.edu	37	4	17706653	17706653	+	Silent	SNP	G	G	A			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr4:17706653G>A	ENST00000265018.3	-	5	1559	c.1347C>T	c.(1345-1347)tcC>tcT	p.S449S		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	449										NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						CAGCCTCCACGGACGAGCGAA	0.448																																																	0								ENSG00000047662						280.0	240.0	253.0					4																	17706653		692	1591	2283	FAM184B	SO:0001819	synonymous_variant	0			-	HGNC		CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.1347C>T	4.37:g.17706653G>A		Somatic	0	188	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	218	16.79		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S449	ENST00000265018.3	37	c.1347	CCDS47033.1	4																																																																																			-	NULL		0.448	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM184B	protein_coding	OTTHUMT00000360137.1	G	NM_015688	-		17706653	-1	no_errors	ENST00000265018	ensembl	human	known	74_37	silent	SNP	0.000	A
GEMIN4	50628	genome.wustl.edu	37	17	650858	650858	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr17:650858T>G	ENST00000319004.5	-	2	543	c.425A>C	c.(424-426)gAg>gCg	p.E142A	GEMIN4_ENST00000437269.1_Missense_Mutation_p.E142A|GEMIN4_ENST00000576778.1_Missense_Mutation_p.E131A	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	142					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		CAGAAAGCGCTCTAGTTCTGC	0.562																																																	0								ENSG00000179409						93.0	96.0	95.0					17																	650858		2046	4188	6234	GEMIN4	SO:0001583	missense	0			-	HGNC	AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.425A>C	17.37:g.650858T>G	ENSP00000321706:p.Glu142Ala	Somatic	0	128	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	97	21.14	Q9NZS7|Q9UG32|Q9Y4Q2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E142A	ENST00000319004.5	37	c.425	CCDS45559.1	17	.	.	.	.	.	.	.	.	.	.	T	10.75	1.438363	0.25900	.	.	ENSG00000179409	ENST00000319004;ENST00000437269	T;T	0.13089	2.62;2.62	5.66	5.66	0.87406	.	0.543529	0.20350	N	0.094070	T	0.13329	0.0323	L	0.54323	1.7	0.09310	N	1	B;P	0.38827	0.167;0.649	B;B	0.33454	0.085;0.164	T	0.24870	-1.0148	10	0.49607	T	0.09	-17.7694	9.9704	0.41749	0.0:0.0795:0.0:0.9205	.	142;142	E7EN12;P57678	.;GEMI4_HUMAN	A	142	ENSP00000321706:E142A;ENSP00000392460:E142A	ENSP00000321706:E142A	E	-	2	0	GEMIN4	597608	0.041000	0.20044	0.994000	0.49952	0.485000	0.33311	2.164000	0.42387	2.173000	0.68751	0.533000	0.62120	GAG	-	NULL		0.562	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN4	protein_coding	OTTHUMT00000437181.1	T	NM_015721	-		650858	-1	no_errors	ENST00000319004	ensembl	human	known	74_37	missense	SNP	0.128	G
LAMC3	10319	genome.wustl.edu	37	9	133914292	133914292	+	Missense_Mutation	SNP	C	C	T	rs146887458		TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr9:133914292C>T	ENST00000361069.4	+	5	1151	c.1018C>T	c.(1018-1020)Cgg>Tgg	p.R340W	LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	340	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CACGTTTGATCGGGAGCTCTT	0.607																																																	0								ENSG00000050555						72.0	74.0	74.0					9																	133914292		2203	4300	6503	LAMC3	SO:0001583	missense	0			-	HGNC	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.1018C>T	9.37:g.133914292C>T	ENSP00000354360:p.Arg340Trp	Somatic	0	42	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	61	17.57	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_B_type_IV,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.R340W	ENST00000361069.4	37	c.1018	CCDS6938.1	9	.	.	.	.	.	.	.	.	.	.	C	11.30	1.598470	0.28445	.	.	ENSG00000050555	ENST00000361069;ENST00000355048;ENST00000320021	T	0.28255	1.62	4.85	2.89	0.33648	EGF-like, laminin (3);	0.797278	0.11827	N	0.525646	T	0.27278	0.0669	L	0.49640	1.575	0.35140	D	0.768801	B	0.18968	0.032	B	0.20955	0.032	T	0.30880	-0.9963	10	0.62326	D	0.03	.	6.2969	0.21091	0.1396:0.6526:0.1283:0.0795	.	340	Q9Y6N6	LAMC3_HUMAN	W	340	ENSP00000354360:R340W	ENSP00000325873:R340W	R	+	1	2	LAMC3	132904113	0.002000	0.14202	0.987000	0.45799	0.600000	0.36913	0.337000	0.19841	1.081000	0.41110	0.650000	0.86243	CGG	-	pfam_EGF_laminin,smart_EG-like_dom,smart_EGF_laminin,pfscan_EGF_laminin		0.607	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC3	protein_coding	OTTHUMT00000054717.3	C	NM_006059	rs146887458		133914292	+1	no_errors	ENST00000361069	ensembl	human	known	74_37	missense	SNP	0.990	T
FAM47C	442444	genome.wustl.edu	37	X	37027354	37027354	+	Missense_Mutation	SNP	G	G	A	rs182976429		TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chrX:37027354G>A	ENST00000358047.3	+	1	923	c.871G>A	c.(871-873)Gta>Ata	p.V291I		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	291										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CAAGACTCGCGTATCTCATCT	0.602																																																	0								ENSG00000198173						76.0	66.0	69.0					X																	37027354		2202	4300	6502	FAM47C	SO:0001583	missense	0			-	HGNC	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.871G>A	X.37:g.37027354G>A	ENSP00000367913:p.Val291Ile	Somatic	1	274	0.36		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	58	282	17.01	Q6ZU46	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V291I	ENST00000358047.3	37	c.871	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	g	7.728	0.698554	0.15106	.	.	ENSG00000198173	ENST00000358047	T	0.18502	2.21	0.998	-2.0	0.07433	.	.	.	.	.	T	0.11196	0.0273	L	0.61218	1.895	0.09310	N	1	P	0.36535	0.557	B	0.20184	0.028	T	0.13656	-1.0501	9	0.37606	T	0.19	.	2.7803	0.05359	0.4751:0.2575:0.2674:0.0	.	291	Q5HY64	FA47C_HUMAN	I	291	ENSP00000367913:V291I	ENSP00000367913:V291I	V	+	1	0	FAM47C	36937275	0.004000	0.15560	0.001000	0.08648	0.001000	0.01503	0.841000	0.27613	-0.798000	0.04444	-0.799000	0.03217	GTA	-	NULL		0.602	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	protein_coding	OTTHUMT00000060508.1	G	NM_001013736	-		37027354	+1	no_errors	ENST00000358047	ensembl	human	known	74_37	missense	SNP	0.001	A
MUC19	283463	genome.wustl.edu	37	12	40821225	40821225	+	Silent	SNP	C	C	T			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr12:40821225C>T	ENST00000454784.4	+	12	1180	c.447C>T	c.(445-447)tcC>tcT	p.S149S	RP11-115F18.1_ENST00000552757.1_RNA			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric	149					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						GTGGACCCTCCAACCCTGCAA	0.413																																																	0								ENSG00000205592																																			MUC19	SO:0001819	synonymous_variant	0			-	HGNC	AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.447C>T	12.37:g.40821225C>T		Somatic	1	143	0.69		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	112	16.42	Q8NA85	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich	p.S149	ENST00000454784.4	37	c.447		12																																																																																			-	pfam_TIL_dom,superfamily_TIL_dom		0.413	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	protein_coding	OTTHUMT00000384257.6	C	XM_003403524	-		40821225	+1	no_errors	ENST00000454784	ensembl	human	novel	74_37	silent	SNP	0.973	T
PTP4A2	8073	genome.wustl.edu	37	1	32385072	32385072	+	5'UTR	DEL	A	A	-	rs3215721|rs78917114		TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr1:32385072delA	ENST00000602725.1	-	0	12				PTP4A2_ENST00000470404.1_5'Flank|PTP4A2_ENST00000356536.3_5'UTR|PTP4A2_ENST00000344035.6_5'UTR|PTP4A2_ENST00000526960.1_5'UTR|RP11-84A19.4_ENST00000602889.1_lincRNA|PTP4A2_ENST00000457805.2_5'Flank			Q12974	TP4A2_HUMAN	protein tyrosine phosphatase type IVA, member 2						peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	prenylated protein tyrosine phosphatase activity (GO:0004727)			kidney(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)				GCTTGCAATTAAAAAAAAAAA	0.373																																																	0								ENSG00000184007																																			PTP4A2	SO:0001623	5_prime_UTR_variant	0				HGNC	L48723	CCDS348.1, CCDS53292.1, CCDS59193.1	1p35	2011-06-09			ENSG00000184007	ENSG00000184007		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9635	protein-coding gene	gene with protein product		601584		PTP4A		8661118, 9514946	Standard	NM_080391		Approved	HU-PP-1, PTPCAAX2, OV-1, ptp-IV1a, PRL-2	uc001bty.2	Q12974	OTTHUMG00000003801	ENST00000602725.1:c.-406T>-	1.37:g.32385072delA		Somatic	0	16	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	A8K9I8|B4DM39|D3DPP0|E9PGJ6|O00649|Q15197|Q15259|Q15260|Q15261|R4GN50	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000602725.1	37	NULL	CCDS348.1	1																																																																																			-	-		0.373	PTP4A2-019	KNOWN	basic|appris_principal|CCDS	protein_coding	PTP4A2	protein_coding	OTTHUMT00000468092.1	A	NM_080391			32385072	-1	no_errors	ENST00000494444	ensembl	human	known	74_37	rna	DEL	0.787	-
BCORL1	63035	genome.wustl.edu	37	X	129147217	129147217	+	Missense_Mutation	SNP	G	G	A	rs147775035		TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chrX:129147217G>A	ENST00000218147.7	+	4	666	c.469G>A	c.(469-471)Gcc>Acc	p.A157T	BCORL1_ENST00000303743.5_Missense_Mutation_p.A157T|BCORL1_ENST00000540052.1_Missense_Mutation_p.A157T|BCORL1_ENST00000359304.2_Missense_Mutation_p.A157T			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	157					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						CTGCTCACCCGCCGGAGTAAA	0.577													G|||	0	0.0	0.0	0.0	3775	,	,		15151	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000085185	G	THR/ALA	0,3835		0,0,1632,571	54.0	48.0	50.0		469	4.4	0.0	X	dbSNP_134	50	1,6727		0,1,2427,1872	no	missense	BCORL1	NM_021946.4	58	0,1,4059,2443	AA,AG,GG,G		0.0149,0.0,0.0095	benign	157/1712	129147217	1,10562	2203	4300	6503	BCORL1	SO:0001583	missense	0			-	HGNC	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.469G>A	X.37:g.129147217G>A	ENSP00000218147:p.Ala157Thr	Somatic	0	110	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	127	22.89	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A157T	ENST00000218147.7	37	c.469	CCDS14616.1	X	.	.	.	.	.	.	.	.	.	.	G	8.450	0.852860	0.17106	0.0	1.49E-4	ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052	T;T;T;T	0.50548	0.75;1.12;0.74;0.75	5.28	4.4	0.53042	.	0.000000	0.35151	N	0.003415	T	0.28134	0.0694	N	0.14661	0.345	0.09310	N	1	B;B	0.23442	0.073;0.085	B;B	0.21360	0.034;0.007	T	0.14811	-1.0459	9	.	.	.	-4.0007	10.3573	0.43972	0.077:0.1327:0.7903:0.0	.	157;157	Q5H9F3-2;Q5H9F3	.;BCORL_HUMAN	T	157	ENSP00000218147:A157T;ENSP00000307541:A157T;ENSP00000352253:A157T;ENSP00000437775:A157T	.	A	+	1	0	BCORL1	128974898	0.018000	0.18449	0.002000	0.10522	0.006000	0.05464	1.485000	0.35519	0.982000	0.38575	0.529000	0.55759	GCC	-	NULL		0.577	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCORL1	protein_coding	OTTHUMT00000058223.1	G	NM_021946	rs147775035		129147217	+1	no_errors	ENST00000303743	ensembl	human	known	74_37	missense	SNP	0.042	A
RNF38	152006	genome.wustl.edu	37	9	36390607	36390607	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr9:36390607G>A	ENST00000259605.6	-	2	126	c.19C>T	c.(19-21)Ccc>Tcc	p.P7S	RNF38_ENST00000357058.3_5'UTR|RNF38_ENST00000350199.4_Intron|RNF38_ENST00000377885.2_5'UTR|RNF38_ENST00000353739.4_Intron|RNF38_ENST00000377877.4_Intron|RNF38_ENST00000491349.1_5'UTR	NM_022781.4	NP_073618.3	Q9H0F5	RNF38_HUMAN	ring finger protein 38	7					male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)|sperm flagellum (GO:0036126)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(1)|lung(3)|stomach(1)	11			STAD - Stomach adenocarcinoma(86;0.228)			TTGGCCCCGGGAGATATCTGG	0.468																																																	0								ENSG00000137075						91.0	92.0	92.0					9																	36390607		2203	4300	6503	RNF38	SO:0001583	missense	0			-	HGNC		CCDS6603.1, CCDS6604.1	9p	2013-01-09			ENSG00000137075	ENSG00000137075		"""RING-type (C3HC4) zinc fingers"""	18052	protein-coding gene	gene with protein product		612488					Standard	XM_005251364		Approved		uc003zzh.3	Q9H0F5	OTTHUMG00000019905	ENST00000259605.6:c.19C>T	9.37:g.36390607G>A	ENSP00000259605:p.Pro7Ser	Somatic	0	62	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	60	13.04	A6PVP9|B1AM81|B1AM82|B3KSG4|E7EVL3|Q7LB33|Q8N0Y0|Q9H748	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.P7S	ENST00000259605.6	37	c.19	CCDS6603.1	9	.	.	.	.	.	.	.	.	.	.	G	17.63	3.436287	0.62955	.	.	ENSG00000137075	ENST00000259605	T	0.13420	2.59	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000006	T	0.08626	0.0214	N	0.08118	0	0.80722	D	1	B	0.25667	0.131	B	0.13407	0.009	T	0.19128	-1.0315	10	0.87932	D	0	-4.4408	15.3962	0.74794	0.0:0.0:1.0:0.0	.	7	Q9H0F5	RNF38_HUMAN	S	7	ENSP00000259605:P7S	ENSP00000259605:P7S	P	-	1	0	RNF38	36380607	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.010000	0.49559	2.699000	0.92147	0.655000	0.94253	CCC	-	NULL		0.468	RNF38-001	KNOWN	basic|CCDS	protein_coding	RNF38	protein_coding	OTTHUMT00000052422.3	G	NM_022781	-		36390607	-1	no_errors	ENST00000259605	ensembl	human	known	74_37	missense	SNP	1.000	A
RAB11FIP5	26056	genome.wustl.edu	37	2	73316055	73316055	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr2:73316055G>C	ENST00000258098.6	-	2	1060	c.820C>G	c.(820-822)Ctc>Gtc	p.L274V	RAB11FIP5_ENST00000493523.2_5'UTR	NM_015470.2	NP_056285.1	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	274					cellular response to acidic pH (GO:0071468)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|regulation of protein localization to cell surface (GO:2000008)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)			biliary_tract(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	23						CGGGTGAGGAGTTCGGCGCCA	0.692																																																	0								ENSG00000135631						25.0	25.0	25.0					2																	73316055		2203	4300	6503	RAB11FIP5	SO:0001583	missense	0			-	HGNC	AF334812	CCDS1923.1	2p13	2008-02-05			ENSG00000135631	ENSG00000135631			24845	protein-coding gene	gene with protein product		605536				10048485, 11163216	Standard	NM_015470		Approved	GAF1, KIAA0857, RIP11, pp75	uc002sis.4	Q9BXF6	OTTHUMG00000129779	ENST00000258098.6:c.820C>G	2.37:g.73316055G>C	ENSP00000258098:p.Leu274Val	Somatic	0	107	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	105	11.76	O94939|Q9P0M1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-bd_FIP-RBD,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.L274V	ENST00000258098.6	37	c.820	CCDS1923.1	2	.	.	.	.	.	.	.	.	.	.	G	14.59	2.579835	0.46006	.	.	ENSG00000135631	ENST00000258098	T	0.47177	0.85	5.36	4.47	0.54385	.	0.089901	0.42964	D	0.000625	T	0.22475	0.0542	N	0.08118	0	0.27159	N	0.961217	P;P	0.49090	0.651;0.919	B;B	0.40256	0.057;0.324	T	0.07829	-1.0752	10	0.15952	T	0.53	-21.9048	8.2874	0.31937	0.088:0.1609:0.7511:0.0	.	274;274	Q9BXF6;Q2Z1P3	RFIP5_HUMAN;.	V	274	ENSP00000258098:L274V	ENSP00000258098:L274V	L	-	1	0	RAB11FIP5	73169563	0.992000	0.36948	1.000000	0.80357	0.806000	0.45545	1.582000	0.36568	2.688000	0.91661	0.561000	0.74099	CTC	-	NULL		0.692	RAB11FIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11FIP5	protein_coding	OTTHUMT00000251995.1	G	NM_015470	-		73316055	-1	no_errors	ENST00000258098	ensembl	human	known	74_37	missense	SNP	1.000	C
TREML4	285852	genome.wustl.edu	37	6	41197265	41197265	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr6:41197265C>G	ENST00000341495.2	+	3	505	c.401C>G	c.(400-402)aCc>aGc	p.T134S	TREML4_ENST00000448827.2_Missense_Mutation_p.T134S	NM_198153.2	NP_937796.1	Q6UXN2	TRML4_HUMAN	triggering receptor expressed on myeloid cells-like 4	134						extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(1)|lung(4)|skin(1)	8	Ovarian(28;0.0327)|Colorectal(47;0.196)					TTAGCCCCAACCACGTCTCCT	0.567																																																	0								ENSG00000188056						170.0	168.0	169.0					6																	41197265		2203	4300	6503	TREML4	SO:0001583	missense	0			-	HGNC	AF534826	CCDS34446.1	6p21.1	2013-01-11			ENSG00000188056	ENSG00000188056		"""Immunoglobulin superfamily / V-set domain containing"""	30807	protein-coding gene	gene with protein product	"""TREM like transcript 4"""	614664				12645956	Standard	NM_198153		Approved	TLT4	uc003oqc.3	Q6UXN2	OTTHUMG00000016408	ENST00000341495.2:c.401C>G	6.37:g.41197265C>G	ENSP00000342570:p.Thr134Ser	Somatic	0	209	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	196	21.91	B7ZL92	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.T134S	ENST00000341495.2	37	c.401	CCDS34446.1	6	.	.	.	.	.	.	.	.	.	.	.	3.441	-0.114147	0.06881	.	.	ENSG00000188056	ENST00000341495;ENST00000445267;ENST00000448827	T;T	0.04083	3.71;3.71	2.69	-0.277	0.12898	Immunoglobulin-like fold (1);	.	.	.	.	T	0.00496	0.0016	N	0.11560	0.145	0.09310	N	1	B	0.26483	0.15	B	0.19946	0.027	T	0.45629	-0.9248	9	0.02654	T	1	-1.0736	2.2698	0.04087	0.2451:0.4583:0.0:0.2966	.	134	Q6UXN2	TRML4_HUMAN	S	134	ENSP00000342570:T134S;ENSP00000418078:T134S	ENSP00000342570:T134S	T	+	2	0	TREML4	41305243	0.001000	0.12720	0.000000	0.03702	0.091000	0.18340	0.498000	0.22530	-0.091000	0.12440	0.467000	0.42956	ACC	-	NULL		0.567	TREML4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TREML4	protein_coding	OTTHUMT00000043873.2	C		-		41197265	+1	no_errors	ENST00000341495	ensembl	human	known	74_37	missense	SNP	0.000	G
ACTN4	81	genome.wustl.edu	37	19	39214715	39214715	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr19:39214715G>C	ENST00000252699.2	+	14	1766	c.1690G>C	c.(1690-1692)Gag>Cag	p.E564Q	ACTN4_ENST00000424234.2_Missense_Mutation_p.E174Q|ACTN4_ENST00000390009.3_Missense_Mutation_p.E345Q	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	564					actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.E564K(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CGAGGAGATTGAGGTTCGCAC	0.642																																					Colon(168;199 1940 10254 46213 46384)												1	Substitution - Missense(1)	endometrium(1)						ENSG00000130402						57.0	59.0	58.0					19																	39214715		2203	4300	6503	ACTN4	SO:0001583	missense	0			-	HGNC	D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.1690G>C	19.37:g.39214715G>C	ENSP00000252699:p.Glu564Gln	Somatic	0	168	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	95	187	33.69	A4K467|D6PXK4|O76048	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.E564Q	ENST00000252699.2	37	c.1690	CCDS12518.1	19	.	.	.	.	.	.	.	.	.	.	G	2.962	-0.214469	0.06101	.	.	ENSG00000130402	ENST00000252699;ENST00000424234;ENST00000390009	T;T;T	0.67865	-0.29;-0.29;-0.29	3.75	3.75	0.43078	.	0.070985	0.56097	D	0.000028	T	0.24005	0.0581	N	0.00121	-2.07	0.51482	D	0.999925	B	0.02656	0.0	B	0.06405	0.002	T	0.51411	-0.8709	10	0.02654	T	1	.	14.8549	0.70329	0.0:0.0:1.0:0.0	.	564	O43707	ACTN4_HUMAN	Q	564;174;345	ENSP00000252699:E564Q;ENSP00000411187:E174Q;ENSP00000439497:E345Q	ENSP00000252699:E564Q	E	+	1	0	ACTN4	43906555	1.000000	0.71417	0.998000	0.56505	0.649000	0.38597	3.658000	0.54482	2.106000	0.64143	0.561000	0.74099	GAG	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.642	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN4	protein_coding	OTTHUMT00000268091.1	G		-		39214715	+1	no_errors	ENST00000252699	ensembl	human	known	74_37	missense	SNP	1.000	C
SYCN	342898	genome.wustl.edu	37	19	39694754	39694754	+	Silent	SNP	G	G	A			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr19:39694754G>A	ENST00000318438.6	-	1	152	c.141C>T	c.(139-141)ccC>ccT	p.P47P		NM_001080468.2	NP_001073937.1	Q0VAF6	SYCN_HUMAN	syncollin	47					exocytosis (GO:0006887)	secretory granule membrane (GO:0030667)				endometrium(1)|kidney(1)	2	all_cancers(60;7.32e-07)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|all_epithelial(25;8.97e-07)|Ovarian(47;0.0454)		Epithelial(26;1.34e-25)|all cancers(26;9.31e-23)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			TCTCATAGTAGGGGTCGCTCT	0.687																																																	0								ENSG00000179751						21.0	25.0	24.0					19																	39694754		2000	4153	6153	SYCN	SO:0001819	synonymous_variant	0			-	HGNC	BC039541	CCDS46070.1	19q13.2	2008-02-05	2005-05-26			ENSG00000179751			18442	protein-coding gene	gene with protein product			"""insulin synthesis associated 1"""	INSSA1		11839820	Standard	NM_001080468		Approved	SYL, FLJ27441	uc002okr.2	Q0VAF6		ENST00000318438.6:c.141C>T	19.37:g.39694754G>A		Somatic	0	142	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	83	390	17.47		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P47	ENST00000318438.6	37	c.141	CCDS46070.1	19																																																																																			-	NULL		0.687	SYCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCN	protein_coding	OTTHUMT00000463830.1	G		-		39694754	-1	no_errors	ENST00000318438	ensembl	human	known	74_37	silent	SNP	1.000	A
FOXP3	50943	genome.wustl.edu	37	X	49114812	49114812	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chrX:49114812G>A	ENST00000376207.4	-	2	338	c.151C>T	c.(151-153)Cga>Tga	p.R51*	FOXP3_ENST00000376197.1_Nonsense_Mutation_p.R36*|FOXP3_ENST00000518685.1_Nonsense_Mutation_p.R51*|FOXP3_ENST00000455775.2_Nonsense_Mutation_p.R51*|FOXP3_ENST00000557224.1_Nonsense_Mutation_p.R51*|FOXP3_ENST00000376199.2_Nonsense_Mutation_p.R51*	NM_014009.3	NP_054728.2	Q9BZS1	FOXP3_HUMAN	forkhead box P3	51					B cell homeostasis (GO:0001782)|CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|chromatin remodeling (GO:0006338)|cytokine production (GO:0001816)|myeloid cell homeostasis (GO:0002262)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chronic inflammatory response (GO:0002677)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of cytokine biosynthetic process (GO:0042036)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of immune response (GO:0050777)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T cell cytokine production (GO:0002725)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0032831)|positive regulation of histone acetylation (GO:0035066)|positive regulation of immature T cell proliferation in thymus (GO:0033092)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of peripheral T cell tolerance induction (GO:0002851)|positive regulation of T cell anergy (GO:0002669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of isotype switching to IgG isotypes (GO:0048302)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell activation (GO:0042110)|T cell homeostasis (GO:0043029)|T cell mediated immunity (GO:0002456)|T cell receptor signaling pathway (GO:0050852)|tolerance induction to self antigen (GO:0002513)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|NFAT protein binding (GO:0051525)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)	10	Ovarian(276;0.236)					GCCCCGCCTCGAAGATCTCGG	0.697																																					GBM(182;1432 2112 16160 23073 31774)												0								ENSG00000049768						18.0	19.0	18.0					X																	49114812		2037	3946	5983	FOXP3	SO:0001587	stop_gained	0			-	HGNC		CCDS14323.1, CCDS48109.1	Xp11.23	2014-09-17		2002-09-20	ENSG00000049768	ENSG00000049768		"""Forkhead boxes"""	6106	protein-coding gene	gene with protein product		300292	"""immune dysregulation, polyendocrinopathy, enteropathy, X-linked"""	IPEX		10677306, 11138001	Standard	NM_014009		Approved	JM2, XPID, AIID, PIDX, DIETER, SCURFIN	uc004dnf.4	Q9BZS1	OTTHUMG00000024135	ENST00000376207.4:c.151C>T	X.37:g.49114812G>A	ENSP00000365380:p.Arg51*	Somatic	0	100	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	131	11.49	A5HJT1|B7ZLG0|B9UN80|O60827|Q14DD8|Q4ZH51	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.R51*	ENST00000376207.4	37	c.151	CCDS14323.1	X	.	.	.	.	.	.	.	.	.	.	G	13.62	2.290352	0.40494	.	.	ENSG00000049768	ENST00000376207;ENST00000376199;ENST00000557224;ENST00000518685;ENST00000376197;ENST00000455775	.	.	.	4.47	3.61	0.41365	.	0.196027	0.25164	N	0.032649	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.4213	0.27073	0.1209:0.0:0.8791:0.0	.	.	.	.	X	51;51;51;51;36;51	.	ENSP00000365369:R36X	R	-	1	2	FOXP3	49001756	0.995000	0.38212	0.717000	0.30585	0.042000	0.13812	1.838000	0.39211	1.005000	0.39183	0.513000	0.50165	CGA	-	NULL		0.697	FOXP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXP3	protein_coding	OTTHUMT00000060814.1	G	NM_014009	-		49114812	-1	no_errors	ENST00000376207	ensembl	human	known	74_37	nonsense	SNP	0.233	A
C16orf78	123970	genome.wustl.edu	37	16	49412407	49412407	+	Silent	SNP	C	C	T	rs143423404		TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr16:49412407C>T	ENST00000299191.3	+	3	414	c.297C>T	c.(295-297)gaC>gaT	p.D99D		NM_144602.2	NP_653203.1	Q8WTQ4	CP078_HUMAN	chromosome 16 open reading frame 78	99						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(1)	22						TCAGGAAGGACGCCGCCTCCT	0.572																																																	0								ENSG00000166152	C		0,4398		0,0,2199	42.0	37.0	39.0		297	-5.1	0.0	16	dbSNP_134	39	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	C16orf78	NM_144602.2		0,1,6498	TT,TC,CC		0.0116,0.0,0.0077		99/266	49412407	1,12997	2199	4300	6499	C16orf78	SO:0001819	synonymous_variant	0			-	HGNC	BC021181	CCDS10738.1	16q12.1	2008-02-05			ENSG00000166152	ENSG00000166152			28479	protein-coding gene	gene with protein product						12477932	Standard	NM_144602		Approved	MGC33367	uc002efr.3	Q8WTQ4	OTTHUMG00000133149	ENST00000299191.3:c.297C>T	16.37:g.49412407C>T		Somatic	0	130	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	145	15.20		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D99	ENST00000299191.3	37	c.297	CCDS10738.1	16																																																																																			-	NULL		0.572	C16orf78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf78	protein_coding	OTTHUMT00000256846.1	C	NM_144602	rs143423404		49412407	+1	no_errors	ENST00000299191	ensembl	human	known	74_37	silent	SNP	0.000	T
NCALD	83988	genome.wustl.edu	37	8	102698815	102698815	+	3'UTR	SNP	C	C	G			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr8:102698815C>G	ENST00000311028.3	-	0	3682				KB-1107E3.1_ENST00000518749.1_RNA|NCALD_ENST00000395923.1_3'UTR	NM_001040624.1|NM_001040626.1	NP_001035714.1|NP_001035716.1	P61601	NCALD_HUMAN	neurocalcin delta						calcium-mediated signaling (GO:0019722)|regulation of systemic arterial blood pressure (GO:0003073)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	clathrin coat of trans-Golgi network vesicle (GO:0030130)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|tubulin binding (GO:0015631)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)	8	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)			AAGAGCTACACAGTCAACTGA	0.423																																																	0								ENSG00000253629																																			KB-1107E3.1	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene	AF052142	CCDS6292.1	8q22.3	2014-08-12			ENSG00000104490	ENSG00000104490		"""EF-hand domain containing"""	7655	protein-coding gene	gene with protein product		606722				11267673	Standard	XM_006716672		Approved		uc003ykk.3	P61601	OTTHUMG00000164876	ENST00000311028.3:c.*2722G>C	8.37:g.102698815C>G		Somatic	0	48	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	48	20.00	P29554|Q8IYC3|Q9H0W2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000311028.3	37	NULL	CCDS6292.1	8																																																																																			-	-		0.423	NCALD-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000253629	protein_coding	OTTHUMT00000380732.2	C		-		102698815	+1	no_errors	ENST00000518749	ensembl	human	known	74_37	rna	SNP	0.006	G
TBCB	1155	genome.wustl.edu	37	19	36606379	36606380	+	5'UTR	INS	-	-	CAG	rs199646187|rs77581492|rs368856807	byFrequency	TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr19:36606379_36606380insCAG	ENST00000221855.3	+	0	492_493				TBCB_ENST00000586868.1_5'Flank|TBCB_ENST00000589996.1_5'Flank|TBCB_ENST00000585746.1_5'Flank|POLR2I_ENST00000221859.4_5'Flank	NM_001281.2	NP_001272.2	Q99426	TBCB_HUMAN	tubulin folding cofactor B						'de novo' posttranslational protein folding (GO:0051084)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GGCTGATAGCCCAGCAGCAGCA	0.733														586	0.117013	0.2534	0.0735	5008	,	,		11045	0.0		0.1342	False		,,,				2504	0.0665																0								ENSG00000105254																																			TBCB	SO:0001623	5_prime_UTR_variant	0				HGNC	AF013488	CCDS12488.1, CCDS74344.1	19q13.11-q13.12	2008-02-05	2006-11-22	2006-11-22	ENSG00000105254	ENSG00000105254			1989	protein-coding gene	gene with protein product		601303	"""cytoskeleton-associated protein 1"", ""cytoskeleton associated protein 1"""	CKAP1		8978778	Standard	NM_001281		Approved	CG22, CKAPI	uc002odg.1	Q99426	OTTHUMG00000048143	ENST00000221855.3:c.-83->CAG	19.37:g.36606386_36606388dupCAG		Somatic	0	16	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	32	20.00	O00111|O00674|O14728|Q6FGY5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000221855.3	37	NULL	CCDS12488.1	19																																																																																			-	-		0.733	TBCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCB	protein_coding	OTTHUMT00000156291.2	-	NM_001281			36606380	+1	no_errors	ENST00000593075	ensembl	human	putative	74_37	rna	INS	0.079:0.075	CAG
TEKT3	64518	genome.wustl.edu	37	17	15207230	15207230	+	3'UTR	SNP	C	C	T			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr17:15207230C>T	ENST00000395930.1	-	0	1682				TEKT3_ENST00000462175.1_5'UTR|TEKT3_ENST00000338696.2_3'UTR	NM_031898.2	NP_114104.1	Q9BXF9	TEKT3_HUMAN	tektin 3						cilium morphogenesis (GO:0060271)|regulation of fertilization (GO:0080154)|sperm motility (GO:0030317)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				endometrium(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	23				UCEC - Uterine corpus endometrioid carcinoma (92;0.0877)		TTAGGGGTATCAAAACCACAC	0.493																																																	0								ENSG00000125409						51.0	49.0	50.0					17																	15207230		2203	4300	6503	TEKT3	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF334676	CCDS11169.1	17p12	2011-05-23			ENSG00000125409	ENSG00000125409			14293	protein-coding gene	gene with protein product		612683				11381029, 14735490	Standard	NM_031898		Approved	FLJ32828	uc002gon.3	Q9BXF9	OTTHUMG00000058965	ENST00000395930.1:c.*23G>A	17.37:g.15207230C>T		Somatic	0	81	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	104	10.26	B2RAS7|D3DTT0|Q8N5R5|Q96M48	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000395930.1	37	NULL	CCDS11169.1	17																																																																																			-	-		0.493	TEKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT3	protein_coding	OTTHUMT00000130385.2	C	NM_031898	-		15207230	-1	no_errors	ENST00000462175	ensembl	human	putative	74_37	rna	SNP	0.000	T
HERC2	8924	genome.wustl.edu	37	15	28359945	28359945	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr15:28359945C>T	ENST00000261609.7	-	90	13834	c.13726G>A	c.(13726-13728)Gat>Aat	p.D4576N		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AAATCCTTATCAACCTTTTAA	0.507																																																	0								ENSG00000128731						73.0	68.0	70.0					15																	28359945		2203	4300	6503	HERC2	SO:0001583	missense	0			-	HGNC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.13726G>A	15.37:g.28359945C>T	ENSP00000261609:p.Asp4576Asn	Somatic	0	112	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	108	20.59		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.D4576N	ENST00000261609.7	37	c.13726	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	C	31	5.088526	0.94100	.	.	ENSG00000128731	ENST00000261609	T	0.66460	-0.21	5.17	5.17	0.71159	HECT (4);	0.000000	0.85682	D	0.000000	D	0.86928	0.6051	M	0.93638	3.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.90473	0.4454	10	0.87932	D	0	.	18.6672	0.91495	0.0:1.0:0.0:0.0	.	4576;265	O95714;Q8ND39	HERC2_HUMAN;.	N	4576	ENSP00000261609:D4576N	ENSP00000261609:D4576N	D	-	1	0	HERC2	26033540	1.000000	0.71417	0.919000	0.36401	0.750000	0.42670	7.787000	0.85759	2.407000	0.81776	0.655000	0.94253	GAT	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT		0.507	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	protein_coding	OTTHUMT00000251358.2	C	NM_004667	-		28359945	-1	no_errors	ENST00000261609	ensembl	human	known	74_37	missense	SNP	1.000	T
FGD4	121512	genome.wustl.edu	37	12	32751500	32751500	+	Nonsense_Mutation	SNP	C	C	T	rs118203972		TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr12:32751500C>T	ENST00000427716.2	+	5	1094	c.670C>T	c.(670-672)Cga>Tga	p.R224*	FGD4_ENST00000531134.1_Nonsense_Mutation_p.R309*|FGD4_ENST00000534526.2_Nonsense_Mutation_p.R361*|FGD4_ENST00000546442.1_Nonsense_Mutation_p.R131*|FGD4_ENST00000266482.3_5'UTR|FGD4_ENST00000525053.1_Nonsense_Mutation_p.R336*|FGD4_ENST00000381025.3_5'UTR	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	224	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.R224*(1)		breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					TTATGTCAACCGACTTGACCT	0.299																																																	1	Substitution - Nonsense(1)	ovary(1)	GRCh37	CM073065	FGD4	M	rs118203972	ENSG00000139132						87.0	86.0	86.0					12																	32751500		2203	4299	6502	FGD4	SO:0001587	stop_gained	0			-	HGNC	AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.670C>T	12.37:g.32751500C>T	ENSP00000394487:p.Arg224*	Somatic	0	48	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	34	22.73	Q6ULS2|Q8TCP6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.R224*	ENST00000427716.2	37	c.670	CCDS8727.1	12	.	.	.	.	.	.	.	.	.	.	C	29.8	5.037646	0.93630	.	.	ENSG00000139132	ENST00000534526;ENST00000531134;ENST00000427716;ENST00000546442;ENST00000525053	.	.	.	4.91	3.95	0.45737	.	0.000000	0.43110	D	0.000613	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.1136	13.1135	0.59288	0.2701:0.7299:0.0:0.0	.	.	.	.	X	361;309;224;131;336	.	ENSP00000379089:R224X	R	+	1	2	FGD4	32642767	0.997000	0.39634	0.999000	0.59377	0.763000	0.43281	2.023000	0.41040	2.426000	0.82243	0.655000	0.94253	CGA	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.299	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD4	protein_coding	OTTHUMT00000268017.1	C	NM_139241	rs118203972		32751500	+1	no_errors	ENST00000427716	ensembl	human	known	74_37	nonsense	SNP	0.988	T
MAP3K15	389840	genome.wustl.edu	37	X	19398277	19398277	+	Silent	SNP	C	C	T			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chrX:19398277C>T	ENST00000338883.4	-	19	2549	c.2550G>A	c.(2548-2550)ccG>ccA	p.P850P	MAP3K15_ENST00000359173.3_Silent_p.P285P|MAP3K15_ENST00000469203.2_Silent_p.P682P|MAP3K15_ENST00000518578.1_5'UTR	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	850	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					GCTCATGGAACGGAGGCTTGC	0.532																																																	0								ENSG00000180815						59.0	48.0	52.0					X																	19398277		2203	4300	6503	MAP3K15	SO:0001819	synonymous_variant	0			-	HGNC	AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.2550G>A	X.37:g.19398277C>T		Somatic	0	74	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	107	12.30	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P850	ENST00000338883.4	37	c.2550		X																																																																																			-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.532	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	MAP3K15	protein_coding		C	NM_001001671	-		19398277	-1	no_errors	ENST00000338883	ensembl	human	known	74_37	silent	SNP	0.241	T
CIDEA	1149	genome.wustl.edu	37	18	12254562	12254563	+	Intron	INS	-	-	CCGCGCACACACCCAT	rs71369912	byFrequency	TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr18:12254562_12254563insCCGCGCACACACCCAT	ENST00000320477.9	+	1	103					NM_001279.3	NP_001270.1	O60543	CIDEA_HUMAN	cell death-inducing DFFA-like effector a						apoptotic process (GO:0006915)|cell death (GO:0008219)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of sequestering of triglyceride (GO:0010890)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|response to stilbenoid (GO:0035634)|temperature homeostasis (GO:0001659)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|mitochondrial envelope (GO:0005740)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)	13						GCTCCGCGACCCCGCGCACACA	0.703														1926	0.384585	0.1082	0.3228	5008	,	,		14723	0.6359		0.4672	False		,,,				2504	0.4581																0								ENSG00000176194																																			CIDEA	SO:0001627	intron_variant	0				HGNC	AF041378	CCDS11856.1	18p11.21	2008-08-01			ENSG00000176194	ENSG00000176194			1976	protein-coding gene	gene with protein product		604440				9564035, 18509062	Standard	NM_001279		Approved	CIDE-A	uc002kqt.4	O60543	OTTHUMG00000131691	ENST00000320477.9:c.38+142->CCGCGCACACACCCAT	18.37:g.12254562_12254563insCCGCGCACACACCCAT		Somatic	NA	NA	NA		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B0YIY7|Q6UPR7	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.H64fs	ENST00000320477.9	37	c.180_181	CCDS11856.1	18																																																																																			-	NULL		0.703	CIDEA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CIDEA	protein_coding	OTTHUMT00000254599.2	-	NM_001279			12254563	+1	no_errors	ENST00000522713	ensembl	human	known	74_37	frame_shift_ins	INS	0.077:0.122	CCGCGCACACACCCAT
NOP14	8602	genome.wustl.edu	37	4	2958424	2958424	+	Missense_Mutation	SNP	C	C	T	rs149998901		TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr4:2958424C>T	ENST00000314262.6	-	3	493	c.445G>A	c.(445-447)Gat>Aat	p.D149N	NOP14_ENST00000416614.2_Missense_Mutation_p.D149N|NOP14_ENST00000398071.4_Missense_Mutation_p.D149N|NOP14_ENST00000502735.1_Missense_Mutation_p.D149N|NOP14-AS1_ENST00000503709.1_RNA	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein	149					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						TCCTCAGCATCGCTGTCACTG	0.488																																																	0								ENSG00000087269	C	ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	190.0	158.0	169.0		445	5.4	0.9	4	dbSNP_134	169	0,8600		0,0,4300	no	missense	NOP14	NM_003703.1	23	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	149/858	2958424	1,13005	2203	4300	6503	NOP14	SO:0001583	missense	0			-	HGNC	AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.445G>A	4.37:g.2958424C>T	ENSP00000315674:p.Asp149Asn	Somatic	0	49	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	55	12.70	D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nop14	p.D149N	ENST00000314262.6	37	c.445	CCDS33945.1	4	.	.	.	.	.	.	.	.	.	.	C	23.1	4.372488	0.82573	2.27E-4	0.0	ENSG00000087269	ENST00000416614;ENST00000314262;ENST00000502735;ENST00000398071;ENST00000546137	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.41	5.41	0.78517	.	0.050570	0.85682	D	0.000000	T	0.60612	0.2282	M	0.80982	2.52	0.80722	D	1	D;D	0.89917	0.995;1.0	P;D	0.83275	0.874;0.996	T	0.65360	-0.6187	10	0.87932	D	0	-39.7512	18.8106	0.92056	0.0:1.0:0.0:0.0	.	149;149	E9PFK5;P78316	.;NOP14_HUMAN	N	149;149;149;149;48	ENSP00000405068:D149N;ENSP00000315674:D149N;ENSP00000427415:D149N;ENSP00000381146:D149N	ENSP00000315674:D149N	D	-	1	0	NOP14	2928222	1.000000	0.71417	0.948000	0.38648	0.164000	0.22412	7.598000	0.82745	2.535000	0.85469	0.655000	0.94253	GAT	-	pfam_Nop14		0.488	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	NOP14	protein_coding	OTTHUMT00000358135.2	C	NM_003703	rs149998901		2958424	-1	no_errors	ENST00000416614	ensembl	human	known	74_37	missense	SNP	1.000	T
XKR7	343702	genome.wustl.edu	37	20	30584994	30584994	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr20:30584994C>T	ENST00000562532.2	+	3	1648	c.1474C>T	c.(1474-1476)Cgt>Tgt	p.R492C		NM_001011718.1	NP_001011718.1	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related family, member 7	492						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			GGCGGGAGAGCGTGCAGGGAC	0.697																																																	0								ENSG00000260903						28.0	32.0	30.0					20																	30584994		2203	4299	6502	XKR7	SO:0001583	missense	0			-	HGNC	AY534245	CCDS33459.1	20q11.21	2014-07-16	2006-01-12		ENSG00000260903	ENSG00000260903			23062	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 7"", ""chromosome 20 open reading frame 159"""	C20orf159			Standard	NM_001011718		Approved	dJ310O13.4	uc002wxe.3	Q5GH72	OTTHUMG00000032198	ENST00000562532.2:c.1474C>T	20.37:g.30584994C>T	ENSP00000477059:p.Arg492Cys	Somatic	0	72	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	71	19.78	Q9NUG5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transport_prot_XK	p.R492C	ENST00000562532.2	37	c.1474	CCDS33459.1	20	.	.	.	.	.	.	.	.	.	.	C	12.74	2.028545	0.35797	.	.	ENSG00000101321	ENST00000217299	.	.	.	4.85	4.85	0.62838	.	0.442859	0.23598	N	0.046479	T	0.50531	0.1621	N	0.08118	0	0.53005	D	0.999969	D	0.89917	1.0	P	0.59221	0.854	T	0.61973	-0.6952	9	0.72032	D	0.01	-15.4125	17.137	0.86743	0.0:1.0:0.0:0.0	.	492	Q5GH72	XKR7_HUMAN	C	492	.	ENSP00000217299:R492C	R	+	1	0	XKR7	30048655	0.889000	0.30405	0.976000	0.42696	0.176000	0.22953	0.575000	0.23729	2.518000	0.84900	0.561000	0.74099	CGT	-	NULL		0.697	XKR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR7	protein_coding	OTTHUMT00000078597.3	C	NM_001011718	-		30584994	+1	no_errors	ENST00000562532	ensembl	human	known	74_37	missense	SNP	0.996	T
DOCK8	81704	genome.wustl.edu	37	9	371546	371546	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr9:371546G>A	ENST00000453981.1	+	17	2099	c.1987G>A	c.(1987-1989)Gaa>Aaa	p.E663K	DOCK8_ENST00000382331.1_Intron|DOCK8_ENST00000382329.1_Missense_Mutation_p.E130K|DOCK8_ENST00000432829.2_Missense_Mutation_p.E595K|DOCK8_ENST00000469391.1_Missense_Mutation_p.E595K			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	663	DHR-1.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		AGCCTCCGTGGAAACTCTCCT	0.483																																																	0								ENSG00000107099						81.0	73.0	76.0					9																	371546		2203	4300	6503	DOCK8	SO:0001583	missense	0			-	HGNC	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.1987G>A	9.37:g.371546G>A	ENSP00000408464:p.Glu663Lys	Somatic	0	70	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	55	26.67	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_DOCK_C/D_N,superfamily_ARM-type_fold	p.E663K	ENST00000453981.1	37	c.1987	CCDS6440.2	9	.	.	.	.	.	.	.	.	.	.	G	34	5.345148	0.95807	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.20881	2.27;2.26;2.3;2.04	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.48370	0.1496	M	0.72576	2.205	0.80722	D	1	D;D;D	0.60160	0.975;0.987;0.987	D;D;D	0.69654	0.934;0.965;0.965	T	0.42120	-0.9470	10	0.66056	D	0.02	.	19.8831	0.96905	0.0:0.0:1.0:0.0	.	595;130;663	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	K	663;663;595;595;130	ENSP00000408464:E663K;ENSP00000394888:E595K;ENSP00000419438:E595K;ENSP00000371766:E130K	ENSP00000287364:E663K	E	+	1	0	DOCK8	361546	1.000000	0.71417	0.913000	0.36048	0.955000	0.61496	9.756000	0.98918	2.705000	0.92388	0.655000	0.94253	GAA	-	NULL		0.483	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	protein_coding	OTTHUMT00000171792.5	G	XM_036307	-		371546	+1	no_errors	ENST00000453981	ensembl	human	known	74_37	missense	SNP	1.000	A
MCF2L2	23101	genome.wustl.edu	37	3	182937682	182937682	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr3:182937682T>A	ENST00000328913.3	-	21	2629	c.2332A>T	c.(2332-2334)Atg>Ttg	p.M778L	MCF2L2_ENST00000473233.1_Missense_Mutation_p.M778L	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	778	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			TCTATCTCCATATCTTCAGGA	0.358																																																	0								ENSG00000053524						87.0	87.0	87.0					3																	182937682		2203	4300	6503	MCF2L2	SO:0001583	missense	0			-	HGNC	AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.2332A>T	3.37:g.182937682T>A	ENSP00000328118:p.Met778Leu	Somatic	0	55	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	51	16.39	O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.M778L	ENST00000328913.3	37	c.2332	CCDS3243.1	3	.	.	.	.	.	.	.	.	.	.	T	0.005	-2.221151	0.00286	.	.	ENSG00000053524	ENST00000328913;ENST00000473233	T;T	0.01584	4.75;4.76	4.05	0.465	0.16711	Dbl homology (DH) domain (4);	0.621206	0.13482	N	0.384646	T	0.00724	0.0024	N	0.03194	-0.395	0.53688	D	0.999973	B	0.02656	0.0	B	0.01281	0.0	T	0.48375	-0.9041	10	0.10902	T	0.67	.	0.9716	0.01416	0.4804:0.2263:0.115:0.1783	.	778	Q86YR7	MF2L2_HUMAN	L	778	ENSP00000328118:M778L;ENSP00000420070:M778L	ENSP00000328118:M778L	M	-	1	0	MCF2L2	184420376	0.476000	0.25901	0.575000	0.28536	0.179000	0.23085	0.175000	0.16762	0.073000	0.16731	-1.273000	0.01405	ATG	-	superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.358	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCF2L2	protein_coding	OTTHUMT00000350868.1	T	NM_015078	-		182937682	-1	no_errors	ENST00000328913	ensembl	human	known	74_37	missense	SNP	0.638	A
HAUS6	54801	genome.wustl.edu	37	9	19087122	19087122	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr9:19087122G>C	ENST00000380502.3	-	6	1084	c.617C>G	c.(616-618)tCt>tGt	p.S206C	HAUS6_ENST00000380496.1_Missense_Mutation_p.S70C|Y_RNA_ENST00000364248.1_RNA	NM_001270890.1|NM_017645.4	NP_001257819.1|NP_060115.3	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6	206					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TATACATTCAGATCTCAAGTT	0.338																																																	0								ENSG00000147874						150.0	142.0	145.0					9																	19087122		2203	4300	6503	HAUS6	SO:0001583	missense	0			-	HGNC	AL832495	CCDS6489.1	9p22.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000147874	ENSG00000147874		"""HAUS augmin-like complex subunits"""	25948	protein-coding gene	gene with protein product		613433	"""family with sequence similarity 29, member A"""	FAM29A		10997877, 19427217	Standard	NM_001270890		Approved	FLJ20060, KIAA1574, dgt6	uc003znk.4	Q7Z4H7	OTTHUMG00000019622	ENST00000380502.3:c.617C>G	9.37:g.19087122G>C	ENSP00000369871:p.Ser206Cys	Somatic	0	120	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	106	16.54	B3KPK4|B4DX82|Q05CG1|Q14CB6|Q14CD9|Q2TA91|Q6IQ10|Q6NZX5|Q8IZQ4|Q96FN0|Q9H950|Q9H998|Q9HCJ8|Q9NXT8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S206C	ENST00000380502.3	37	c.617	CCDS6489.1	9	.	.	.	.	.	.	.	.	.	.	G	13.39	2.222212	0.39300	.	.	ENSG00000147874	ENST00000380502;ENST00000380496	T;T	0.23147	1.92;1.92	5.18	4.25	0.50352	.	0.349077	0.30676	N	0.009111	T	0.45256	0.1333	M	0.76002	2.32	0.38271	D	0.94215	D;D	0.76494	0.986;0.999	P;D	0.63192	0.789;0.912	T	0.52697	-0.8541	10	0.87932	D	0	-2.4227	9.3077	0.37885	0.1063:0.0:0.8937:0.0	.	70;206	Q5VY60;Q7Z4H7	.;HAUS6_HUMAN	C	206;70	ENSP00000369871:S206C;ENSP00000369865:S70C	ENSP00000369865:S70C	S	-	2	0	HAUS6	19077122	1.000000	0.71417	0.987000	0.45799	0.084000	0.17831	3.352000	0.52239	1.239000	0.43787	0.591000	0.81541	TCT	-	NULL		0.338	HAUS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAUS6	protein_coding	OTTHUMT00000051825.1	G	NM_017645	-		19087122	-1	no_errors	ENST00000380502	ensembl	human	known	74_37	missense	SNP	0.993	C
CPNE1	8904	genome.wustl.edu	37	20	34220147	34220147	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr20:34220147G>A	ENST00000317619.3	-	7	788	c.394C>T	c.(394-396)Cag>Tag	p.Q132*	CPNE1_ENST00000397443.1_Nonsense_Mutation_p.Q132*|CPNE1_ENST00000397446.1_Nonsense_Mutation_p.Q132*|CPNE1_ENST00000397442.1_Nonsense_Mutation_p.Q132*|CPNE1_ENST00000397445.1_Nonsense_Mutation_p.Q132*|CPNE1_ENST00000352393.4_Nonsense_Mutation_p.Q132*|CPNE1_ENST00000317677.5_Nonsense_Mutation_p.Q137*			Q99829	CPNE1_HUMAN	copine I	132					lipid metabolic process (GO:0006629)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)	calcium-dependent phospholipid binding (GO:0005544)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			TTTAATTCCTGAGCTGAGACC	0.483																																																	0								ENSG00000214078						139.0	123.0	128.0					20																	34220147		2203	4300	6503	CPNE1	SO:0001587	stop_gained	0			-	HGNC	U83246	CCDS13260.1, CCDS46595.1	20q11.22	2009-06-01			ENSG00000214078	ENSG00000214078			2314	protein-coding gene	gene with protein product		604205				9430674	Standard	NM_152925		Approved	CPN1	uc002xdm.3	Q99829	OTTHUMG00000032356	ENST00000317619.3:c.394C>T	20.37:g.34220147G>A	ENSP00000326126:p.Gln132*	Somatic	0	132	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	133	16.77	E1P5Q4|Q6IBL3|Q9H243|Q9NTZ7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom	p.Q137*	ENST00000317619.3	37	c.409	CCDS13260.1	20	.	.	.	.	.	.	.	.	.	.	g	17.93	3.508457	0.64410	.	.	ENSG00000214078	ENST00000352393;ENST00000317677;ENST00000317619;ENST00000397446;ENST00000397445;ENST00000397443;ENST00000397442;ENST00000437340;ENST00000414664;ENST00000439806;ENST00000420363;ENST00000434795;ENST00000440240;ENST00000437100;ENST00000414711	.	.	.	5.09	5.09	0.68999	.	0.066034	0.64402	U	0.000019	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-4.0126	11.7208	0.51680	0.0:0.1778:0.8222:0.0	.	.	.	.	X	132;137;132;132;132;132;132;132;132;132;132;132;132;132;132	.	ENSP00000326126:Q132X	Q	-	1	0	CPNE1	33683561	1.000000	0.71417	0.994000	0.49952	0.868000	0.49771	6.092000	0.71414	2.659000	0.90383	0.552000	0.68991	CAG	-	superfamily_C2_dom		0.483	CPNE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE1	protein_coding	OTTHUMT00000078909.3	G	NM_152930	-		34220147	-1	no_errors	ENST00000317677	ensembl	human	known	74_37	nonsense	SNP	1.000	A
LRBA	987	genome.wustl.edu	37	4	151502697	151502698	+	Intron	INS	-	-	A	rs57457692|rs35940180|rs558262000	byFrequency	TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr4:151502697_151502698insA	ENST00000357115.3	-	41	6607				LRBA_ENST00000503716.1_5'UTR|LRBA_ENST00000510413.1_Intron|RP11-1336O20.2_ENST00000507934.1_RNA|MAB21L2_ENST00000317605.4_5'Flank|LRBA_ENST00000507224.1_Intron|LRBA_ENST00000535741.1_Intron	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing							cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TAGAATCATTTAAAAAAAAAAA	0.391																																																	0								ENSG00000198589																																			LRBA	SO:0001627	intron_variant	0				HGNC	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.6363+6501->T	4.37:g.151502708_151502708dupA		Somatic	0	26	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000357115.3	37	NULL	CCDS3773.1	4																																																																																			-	-		0.391	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	protein_coding	OTTHUMT00000364939.1	-				151502698	-1	no_errors	ENST00000503716	ensembl	human	known	74_37	rna	INS	0.000:0.000	A
ZBED9	114821	genome.wustl.edu	37	6	28543143	28543143	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr6:28543143C>G	ENST00000452236.2	-	3	1956	c.1339G>C	c.(1339-1341)Gtc>Ctc	p.V447L	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						AGTTCACTGACAACCTGGCTT	0.433																																																	0								ENSG00000232040						59.0	60.0	59.0					6																	28543143		2203	4300	6503	SCAND3	SO:0001583	missense	0			-	HGNC																												ENST00000452236.2:c.1339G>C	6.37:g.28543143C>G	ENSP00000395259:p.Val447Leu	Somatic	0	80	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	67	8.22		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tscrpt_reg_SCAN,pfam_Integrase_cat-core,pfam_HATC_dom_C,superfamily_Retrov_capsid_C,superfamily_RNaseH-like_dom,smart_Tscrpt_reg_SCAN,pfscan_Integrase_cat-core,pfscan_Tscrpt_reg_SCAN	p.V447L	ENST00000452236.2	37	c.1339	CCDS34355.1	6	.	.	.	.	.	.	.	.	.	.	C	16.34	3.097164	0.56075	.	.	ENSG00000232040	ENST00000452236	T	0.39787	1.06	2.95	2.95	0.34219	Integrase, catalytic core (2);Ribonuclease H-like (1);	.	.	.	.	T	0.38348	0.1037	L	0.39085	1.19	0.26983	N	0.965318	D	0.58970	0.984	D	0.65443	0.935	T	0.12218	-1.0556	9	0.72032	D	0.01	.	11.7317	0.51741	0.0:1.0:0.0:0.0	.	447	Q6R2W3	SCND3_HUMAN	L	447	ENSP00000395259:V447L	ENSP00000395259:V447L	V	-	1	0	SCAND3	28651122	0.001000	0.12720	0.978000	0.43139	0.977000	0.68977	0.113000	0.15499	1.668000	0.50843	0.563000	0.77884	GTC	-	pfam_Integrase_cat-core,superfamily_RNaseH-like_dom,pfscan_Integrase_cat-core		0.433	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SCAND3	protein_coding	OTTHUMT00000043551.3	C		-		28543143	-1	no_errors	ENST00000452236	ensembl	human	known	74_37	missense	SNP	0.999	G
PCLO	27445	genome.wustl.edu	37	7	82585951	82585951	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A6BK-01A-11D-A307-09	TCGA-DX-A6BK-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f9880e9-9009-4ed4-848d-e09740417390	aa4de766-b1c9-4fc1-8163-69c7643ff109	g.chr7:82585951C>A	ENST00000333891.9	-	5	4655	c.4318G>T	c.(4318-4320)Gaa>Taa	p.E1440*	PCLO_ENST00000423517.2_Nonsense_Mutation_p.E1440*	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.E1440K(2)|p.E1371K(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GGAGAAACTTCATGGGGTTGT	0.378																																																	3	Substitution - Missense(3)	lung(3)						ENSG00000186472						130.0	120.0	123.0					7																	82585951		1823	4075	5898	PCLO	SO:0001587	stop_gained	0			-	HGNC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.4318G>T	7.37:g.82585951C>A	ENSP00000334319:p.Glu1440*	Somatic	0	200	0.00		0.4370706985534812	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	197	8.37		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.E1440*	ENST00000333891.9	37	c.4318	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	C	44	10.951791	0.99494	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	.	.	.	5.62	3.38	0.38709	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	9.58	0.39481	0.0:0.737:0.0:0.263	.	.	.	.	X	1371;1440;1440	.	ENSP00000334319:E1440X	E	-	1	0	PCLO	82423887	0.004000	0.15560	0.001000	0.08648	0.566000	0.35808	1.898000	0.39809	1.018000	0.39521	0.655000	0.94253	GAA	-	NULL		0.378	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	protein_coding	OTTHUMT00000337368.5	C	NM_014510	-		82585951	-1	no_errors	ENST00000333891	ensembl	human	known	74_37	nonsense	SNP	0.000	A
