#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
DSCAM	1826	genome.wustl.edu	37	21	41416026	41416026	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr21:41416026C>T	ENST00000400454.1	-	31	5839	c.5362G>A	c.(5362-5364)Gtc>Atc	p.V1788I		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1788					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GAGGGGCTGACGCTGTAACTG	0.637																																					Melanoma(134;970 1778 1785 21664 32388)												0								ENSG00000171587						109.0	117.0	114.0					21																	41416026		2186	4294	6480	DSCAM	SO:0001583	missense	0			-	HGNC	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.5362G>A	21.37:g.41416026C>T	ENSP00000383303:p.Val1788Ile	Somatic	0	25	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	17	48.48	O60468	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V1788I	ENST00000400454.1	37	c.5362	CCDS42929.1	21	.	.	.	.	.	.	.	.	.	.	c	20.3	3.961060	0.74016	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.60040	0.22;0.32	5.53	5.53	0.82687	.	0.060719	0.64402	D	0.000003	T	0.66167	0.2762	L	0.27053	0.805	0.37713	D	0.924639	D	0.76494	0.999	D	0.71184	0.972	T	0.68723	-0.5333	10	0.42905	T	0.14	.	19.4936	0.95062	0.0:1.0:0.0:0.0	.	1788	O60469	DSCAM_HUMAN	I	1788;1540	ENSP00000383303:V1788I;ENSP00000385342:V1540I	ENSP00000383303:V1788I	V	-	1	0	DSCAM	40337896	1.000000	0.71417	1.000000	0.80357	0.582000	0.36321	6.003000	0.70701	2.605000	0.88082	0.655000	0.94253	GTC	-	NULL		0.637	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	protein_coding	OTTHUMT00000195029.1	C	NM_001389	-		41416026	-1	no_errors	ENST00000400454	ensembl	human	known	74_37	missense	SNP	1.000	T
ASMT	438	genome.wustl.edu	37	X	1743283	1743283	+	Silent	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:1743283C>T	ENST00000381229.4	+	3	402	c.366C>T	c.(364-366)gaC>gaT	p.D122D	ASMT_ENST00000381241.3_Silent_p.D122D|ASMT_ENST00000381233.3_Silent_p.D122D			P46597	ASMT_HUMAN	acetylserotonin O-methyltransferase	122					cellular nitrogen compound metabolic process (GO:0034641)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|negative regulation of male gonad development (GO:2000019)|small molecule metabolic process (GO:0044281)|translation (GO:0006412)	cytosol (GO:0005829)	acetylserotonin O-methyltransferase activity (GO:0017096)|identical protein binding (GO:0042802)|O-methyltransferase activity (GO:0008171)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Melatonin(DB01065)	ACCTGGCAGACGCCGTGAGGT	0.672													c|||	2	0.000399361	0.0015	0.0	5008	,	,		18650	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000196433		,,	3,4403		0,3,2200	82.0	75.0	77.0		366,366,366	-1.5	0.0	X	dbSNP_134	77	1,8591		0,1,4295	no	coding-synonymous,coding-synonymous,coding-synonymous	ASMT	NM_001171038.1,NM_001171039.1,NM_004043.2	,,	0,4,6495	TT,TC,CC		0.0116,0.0681,0.0308	,,	122/374,122/299,122/374	1743283	4,12994	2203	4296	6499	ASMT	SO:0001819	synonymous_variant	0			-	HGNC	M83779	CCDS14117.1, CCDS55364.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000196433	ENSG00000196433	2.1.1.4	"""Pseudoautosomal regions / PAR1"""	750	protein-coding gene	gene with protein product		300015, 402500				8397829, 7989373	Standard	NM_004043		Approved	HIOMT, ASMTY, HIOMTY	uc010ncy.3	P46597	OTTHUMG00000021065	ENST00000381229.4:c.366C>T	X.37:g.1743283C>T		Somatic	0	78	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	57	13	80.28	B2RC33|Q16598|Q5JQ72|Q5JQ73	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_O_MeTrfase_2,pirsf_COMT	p.D122	ENST00000381229.4	37	c.366		X																																																																																			-	pfam_O_MeTrfase_2,pirsf_COMT		0.672	ASMT-002	KNOWN	basic|appris_principal	protein_coding	ASMT	protein_coding	OTTHUMT00000055612.1	C	NM_004043	-		1743283	+1	no_errors	ENST00000381241	ensembl	human	known	74_37	silent	SNP	0.452	T
MAP1A	4130	genome.wustl.edu	37	15	43815018	43815018	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr15:43815018G>T	ENST00000300231.5	+	4	1797	c.1347G>T	c.(1345-1347)agG>agT	p.R449S	MAP1A_ENST00000382031.1_Missense_Mutation_p.R687S|MAP1A_ENST00000399453.1_Missense_Mutation_p.R449S			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	449	9 X 3 AA repeats of K-K-[DE].|Lys-rich (basic).				microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	aggagaagaggaaAGATACCA	0.453																																																	0								ENSG00000166963						36.0	36.0	36.0					15																	43815018		1916	4125	6041	MAP1A	SO:0001583	missense	0			-	HGNC	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.1347G>T	15.37:g.43815018G>T	ENSP00000300231:p.Arg449Ser	Somatic	0	35	0.00		0.6159915499159303	20	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R449S	ENST00000300231.5	37	c.1347	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	G	10.37	1.332015	0.24167	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231;ENST00000442025	T;T;T	0.19669	2.13;2.13;2.13	5.5	4.57	0.56435	.	0.000000	0.37857	N	0.001901	T	0.25158	0.0611	M	0.65975	2.015	0.35541	D	0.803047	P	0.35272	0.493	B	0.34242	0.178	T	0.30909	-0.9962	10	0.45353	T	0.12	-9.0091	14.8374	0.70194	0.0697:0.0:0.9303:0.0	.	449	P78559	MAP1A_HUMAN	S	687;449;449;449	ENSP00000371462:R687S;ENSP00000382380:R449S;ENSP00000300231:R449S	ENSP00000300231:R449S	R	+	3	2	MAP1A	41602310	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.986000	0.56937	2.880000	0.98712	0.650000	0.86243	AGG	-	NULL		0.453	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	protein_coding	OTTHUMT00000132894.5	G	NM_002373	-		43815018	+1	no_errors	ENST00000399453	ensembl	human	known	74_37	missense	SNP	1.000	T
DCHS1	8642	genome.wustl.edu	37	11	6662109	6662109	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr11:6662109G>T	ENST00000299441.3	-	2	1147	c.736C>A	c.(736-738)Ctg>Atg	p.L246M		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	246	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTGATGTCCAGCAGTGTCACG	0.607																																																	0								ENSG00000166341						105.0	105.0	105.0					11																	6662109		2201	4296	6497	DCHS1	SO:0001583	missense	0			-	HGNC	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.736C>A	11.37:g.6662109G>T	ENSP00000299441:p.Leu246Met	Somatic	0	42	0.00		0.6159915499159303	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	15.38	O15098	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L246M	ENST00000299441.3	37	c.736	CCDS7771.1	11	.	.	.	.	.	.	.	.	.	.	G	14.25	2.479284	0.44044	.	.	ENSG00000166341	ENST00000299441	T	0.43688	0.94	4.71	3.73	0.42828	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.218597	0.23340	N	0.049245	T	0.67287	0.2877	M	0.87381	2.88	0.28461	N	0.915875	D	0.76494	0.999	D	0.87578	0.998	T	0.63559	-0.6610	10	0.45353	T	0.12	.	14.5287	0.67909	0.0:0.1468:0.8532:0.0	.	246	Q96JQ0	PCD16_HUMAN	M	246	ENSP00000299441:L246M	ENSP00000299441:L246M	L	-	1	2	DCHS1	6618685	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.325000	0.52030	2.312000	0.78011	0.544000	0.68410	CTG	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.607	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	protein_coding	OTTHUMT00000257258.1	G	NM_003737	-		6662109	-1	no_errors	ENST00000299441	ensembl	human	known	74_37	missense	SNP	0.997	T
TMEM131	23505	genome.wustl.edu	37	2	98428883	98428883	+	Splice_Site	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:98428883C>A	ENST00000186436.5	-	17	2092		c.e17+1			NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131							integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						AGTTTACTTACCGATGATTGA	0.338																																																	0								ENSG00000075568						90.0	84.0	86.0					2																	98428883		1841	4091	5932	TMEM131	SO:0001630	splice_region_variant	0			-	HGNC	AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.1863+1G>T	2.37:g.98428883C>A		Somatic	0	48	0.00		0.6159915499159303	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	66	39	62.86		Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e17+1	ENST00000186436.5	37	c.1863+1	CCDS46368.1	2	.	.	.	.	.	.	.	.	.	.	C	21.1	4.093046	0.76756	.	.	ENSG00000075568	ENST00000186436	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3239	0.87242	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMEM131	97795315	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	6.072000	0.71238	2.832000	0.97577	0.655000	0.94253	.	-	-		0.338	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM131	protein_coding	OTTHUMT00000329285.2	C	XM_371542	-	Intron	98428883	-1	no_errors	ENST00000186436	ensembl	human	known	74_37	splice_site	SNP	1.000	A
FAM230B	642633	genome.wustl.edu	37	22	21537771	21537771	+	RNA	SNP	G	G	C	rs63749487		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:21537771G>C	ENST00000451257.1	+	0	757									family with sequence similarity 230, member B (non-protein coding)																		ACGCCGCCCAGGGCATCGCCA	0.716																																																	0								ENSG00000215498																																			FAM230B			0			-	HGNC	BC039313, AK128837		22q11.21	2014-01-24	2014-01-06		ENSG00000215498	ENSG00000215498			32943	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 230, member B"""				Standard	NR_108107		Approved	FLJ46366			OTTHUMG00000150782		22.37:g.21537771G>C		Somatic	0	37	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000451257.1	37	NULL		22																																																																																			-	-		0.716	FAM230B-002	KNOWN	basic	lincRNA	FAM230B	processed_transcript	OTTHUMT00000320063.1	G	NR_108107	rs63749487		21537771	+1	no_errors	ENST00000451257	ensembl	human	known	74_37	rna	SNP	0.022	C
CCDC9	26093	genome.wustl.edu	37	19	47774588	47774588	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:47774588G>T	ENST00000221922.6	+	12	1471	c.1249G>T	c.(1249-1251)Gag>Tag	p.E417*		NM_015603.2	NP_056418.1	Q9Y3X0	CCDC9_HUMAN	coiled-coil domain containing 9	417	Glu-rich.						poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|urinary_tract(1)	12		all_cancers(25;0.0432)|all_epithelial(76;0.00812)|Medulloblastoma(540;0.0208)|all_neural(266;0.0416)|Hepatocellular(1079;0.114)		OV - Ovarian serous cystadenocarcinoma(262;8.51e-95)|Epithelial(262;1.15e-92)|all cancers(93;7.67e-84)|GBM - Glioblastoma multiforme(486;0.024)|STAD - Stomach adenocarcinoma(1328;0.183)		ggaagagaatgagggggaaga	0.582																																																	0								ENSG00000105321						80.0	70.0	74.0					19																	47774588		2203	4299	6502	CCDC9	SO:0001587	stop_gained	0			-	HGNC	AL050284	CCDS12698.1	19q13.33	2008-02-05				ENSG00000105321			24560	protein-coding gene	gene with protein product						11230166	Standard	NM_015603		Approved	DKFZP586M1019	uc010xym.2	Q9Y3X0		ENST00000221922.6:c.1249G>T	19.37:g.47774588G>T	ENSP00000221922:p.Glu417*	Somatic	0	34	0.00		0.6159915499159303	125	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E417*	ENST00000221922.6	37	c.1249	CCDS12698.1	19	.	.	.	.	.	.	.	.	.	.	.	25.4	4.632823	0.87660	.	.	ENSG00000105321	ENST00000221922;ENST00000504556	.	.	.	3.85	3.85	0.44370	.	0.946005	0.08747	N	0.899607	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	11.1029	0.48186	0.0:0.0:1.0:0.0	.	.	.	.	X	417;399	.	ENSP00000221922:E417X	E	+	1	0	CCDC9	52466428	0.006000	0.16342	0.071000	0.20095	0.254000	0.26022	0.139000	0.16036	1.955000	0.56771	0.305000	0.20034	GAG	-	NULL		0.582	CCDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC9	protein_coding	OTTHUMT00000466917.1	G	NM_015603	-		47774588	+1	no_errors	ENST00000221922	ensembl	human	known	74_37	nonsense	SNP	0.612	T
ERVH48-1	90625	genome.wustl.edu	37	21	44339204	44339207	+	lincRNA	DEL	CAGA	CAGA	-			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	CAGA	CAGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr21:44339204_44339207delCAGA	ENST00000447535.1	-	0	495_498							M5A8F1	SUPYN_HUMAN	endogenous retrovirus group 48, member 1						syncytium formation (GO:0006949)	extracellular space (GO:0005615)											GAAATTGGCCCAGACAAACACTTA	0.456																																																	0								ENSG00000233056																																			ERVH48-1			0				HGNC	BC005107, CR591419		21q22.3	2011-06-16	2011-05-05	2011-05-05	ENSG00000233056	ENSG00000233056			17216	other	endogenous retrovirus			"""chromosome 21 open reading frame 105"", ""NDUFV3 antisense RNA 1 (non-protein coding)"""	C21orf105, NDUFV3-AS1		21542922	Standard			Approved			M5A8F1	OTTHUMG00000086835		21.37:g.44339204_44339207delCAGA		Somatic	0	25	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	8	38.46		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000447535.1	37	NULL		21																																																																																			-	-		0.456	ERVH48-1-001	KNOWN	basic	lincRNA	ERVH48-1	lincRNA	OTTHUMT00000195540.1	CAGA				44339207	-1	no_errors	ENST00000447535	ensembl	human	known	74_37	rna	DEL	0.012:0.014:0.015:0.016	-
FSTL4	23105	genome.wustl.edu	37	5	132902896	132902896	+	Silent	SNP	A	A	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr5:132902896A>G	ENST00000265342.7	-	3	390	c.141T>C	c.(139-141)ttT>ttC	p.F47F		NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	47						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTGTGACTTCAAAGCTTCTGG	0.348																																																	0								ENSG00000053108						99.0	102.0	101.0					5																	132902896		2203	4300	6503	FSTL4	SO:0001819	synonymous_variant	0			-	HGNC	AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.141T>C	5.37:g.132902896A>G		Somatic	0	56	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	58	17.14	Q8TBU0|Q9UPU1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Kazal_dom,smart_Kazal_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_EF_hand_dom,pfscan_Ig-like_dom	p.F47	ENST00000265342.7	37	c.141	CCDS34238.1	5																																																																																			-	NULL		0.348	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSTL4	protein_coding	OTTHUMT00000370212.1	A	XM_048786	-		132902896	-1	no_errors	ENST00000265342	ensembl	human	known	74_37	silent	SNP	1.000	G
ZNF80	7634	genome.wustl.edu	37	3	113955795	113955795	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr3:113955795C>T	ENST00000482457.2	-	1	630	c.127G>A	c.(127-129)Gtt>Att	p.V43I	RP11-553L6.2_ENST00000481773.1_RNA|RP11-553L6.2_ENST00000493033.1_RNA	NM_007136.3	NP_009067.2	P51504	ZNF80_HUMAN	zinc finger protein 80	43					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|urinary_tract(2)	32		Lung NSC(201;0.0233)|all_neural(597;0.0837)				CCCTCACGAACCAAAGTGTCT	0.498																																					GBM(23;986 1114 21716)												0								ENSG00000174255						119.0	109.0	113.0					3																	113955795		2203	4300	6503	ZNF80	SO:0001583	missense	0			-	HGNC	X65233	CCDS2979.1	3q13.31	2013-01-08	2006-05-12		ENSG00000174255	ENSG00000174255		"""Zinc fingers, C2H2-type"""	13155	protein-coding gene	gene with protein product		194553	"""zinc finger protein 80 (pT17)"""			8478004	Standard	NM_007136		Approved	pT17	uc010hqo.3	P51504	OTTHUMG00000159332	ENST00000482457.2:c.127G>A	3.37:g.113955795C>T	ENSP00000417192:p.Val43Ile	Somatic	0	52	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	71	17.44	Q6NSW4|Q6NT14	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V43I	ENST00000482457.2	37	c.127	CCDS2979.1	3	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.468697	0.01053	.	.	ENSG00000174255	ENST00000482457	T	0.05717	3.4	2.45	0.25	0.15535	.	.	.	.	.	T	0.01940	0.0061	N	0.02721	-0.515	0.09310	N	1	B	0.15719	0.014	B	0.19666	0.026	T	0.46275	-0.9203	9	0.02654	T	1	.	2.8499	0.05554	0.0:0.3751:0.2407:0.3841	.	43	P51504	ZNF80_HUMAN	I	43	ENSP00000417192:V43I	ENSP00000309812:V43I	V	-	1	0	ZNF80	115438485	0.000000	0.05858	0.002000	0.10522	0.011000	0.07611	0.022000	0.13511	0.040000	0.15660	-0.150000	0.13652	GTT	-	NULL		0.498	ZNF80-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF80	protein_coding	OTTHUMT00000354696.2	C	NM_007136	-		113955795	-1	no_errors	ENST00000308095	ensembl	human	known	74_37	missense	SNP	0.002	T
IGSF1	3547	genome.wustl.edu	37	X	130408685	130408685	+	Silent	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:130408685G>A	ENST00000361420.3	-	18	3718	c.3639C>T	c.(3637-3639)atC>atT	p.I1213I	IGSF1_ENST00000370903.3_Silent_p.I1218I|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370910.1_Silent_p.I1204I|IGSF1_ENST00000370904.1_Silent_p.I1204I			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1213	Ig-like C2-type 12.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						CTACGTTGTTGATGACAAAGT	0.522																																																	0								ENSG00000147255						229.0	211.0	217.0					X																	130408685		2203	4300	6503	IGSF1	SO:0001819	synonymous_variant	0			-	HGNC	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3639C>T	X.37:g.130408685G>A		Somatic	0	42	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	80	11.11	B5MEG2|H9KV64|O15070|Q9NTC8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.I1218	ENST00000361420.3	37	c.3654	CCDS14629.1	X																																																																																			-	smart_Ig_sub,smart_Ig_sub2		0.522	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	protein_coding	OTTHUMT00000058288.1	G		-		130408685	-1	no_errors	ENST00000370903	ensembl	human	known	74_37	silent	SNP	0.983	A
TIPARP	25976	genome.wustl.edu	37	3	156396247	156396247	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr3:156396247G>T	ENST00000461166.1	+	2	1349	c.761G>T	c.(760-762)gGc>gTc	p.G254V	TIPARP_ENST00000486483.1_Missense_Mutation_p.G254V|TIPARP_ENST00000542783.1_Missense_Mutation_p.G254V|TIPARP_ENST00000295924.7_Missense_Mutation_p.G254V	NM_001184717.1	NP_001171646.1	Q7Z3E1	PARPT_HUMAN	TCDD-inducible poly(ADP-ribose) polymerase	254					androgen metabolic process (GO:0008209)|cellular response to organic cyclic compound (GO:0071407)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|multicellular organismal metabolic process (GO:0044236)|negative regulation of gene expression (GO:0010629)|nitrogen compound metabolic process (GO:0006807)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of protein catabolic process (GO:0045732)|post-embryonic development (GO:0009791)|protein ADP-ribosylation (GO:0006471)|skeletal system morphogenesis (GO:0048705)|smooth muscle tissue development (GO:0048745)|vasculogenesis (GO:0001570)	nucleus (GO:0005634)	enhancer binding (GO:0035326)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TGTATTTATGGCAGGGATTGT	0.443																																					Ovarian(171;276 1987 3319 6837 11197)												0								ENSG00000163659						144.0	150.0	148.0					3																	156396247		2203	4300	6503	TIPARP	SO:0001583	missense	0			-	HGNC	BX537965	CCDS3177.1	3q25.31	2011-06-22			ENSG00000163659	ENSG00000163659		"""Poly (ADP-ribose) polymerases"""	23696	protein-coding gene	gene with protein product		612480				12851707	Standard	NM_001184717		Approved	DKFZP434J214, DKFZp686N0351, DDF1, PARP7, PARP-7, PARP-1, pART14, RM1	uc021xgg.1	Q7Z3E1	OTTHUMG00000158646	ENST00000461166.1:c.761G>T	3.37:g.156396247G>T	ENSP00000420612:p.Gly254Val	Somatic	0	42	0.00		0.6159915499159303	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	11.54	D3DNK6|Q68CY9|Q86VP4|Q9Y4P7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.G254V	ENST00000461166.1	37	c.761	CCDS3177.1	3	.	.	.	.	.	.	.	.	.	.	G	21.2	4.120195	0.77323	.	.	ENSG00000163659	ENST00000486483;ENST00000295924;ENST00000461166;ENST00000473702;ENST00000481853;ENST00000542783	T;T;T;T;T;T	0.59906	0.23;0.23;0.23;0.23;0.23;0.23	5.33	5.33	0.75918	Zinc finger, CCCH-type (1);	0.000000	0.85682	D	0.000000	T	0.73713	0.3622	M	0.68952	2.095	0.80722	D	1	D	0.62365	0.991	D	0.63283	0.913	T	0.76369	-0.2984	10	0.72032	D	0.01	.	18.6261	0.91340	0.0:0.0:1.0:0.0	.	254	Q7Z3E1	PARPT_HUMAN	V	254	ENSP00000418757:G254V;ENSP00000295924:G254V;ENSP00000420612:G254V;ENSP00000419982:G254V;ENSP00000418829:G254V;ENSP00000438345:G254V	ENSP00000295924:G254V	G	+	2	0	TIPARP	157878941	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.338000	0.96553	2.498000	0.84270	0.563000	0.77884	GGC	-	NULL		0.443	TIPARP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TIPARP	protein_coding	OTTHUMT00000351618.1	G	NM_015508	-		156396247	+1	no_errors	ENST00000295924	ensembl	human	known	74_37	missense	SNP	1.000	T
KIAA2022	340533	genome.wustl.edu	37	X	73961451	73961451	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:73961451C>A	ENST00000055682.6	-	3	3552	c.2941G>T	c.(2941-2943)Ggg>Tgg	p.G981W		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	981					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TTGACTGGCCCCTGCTGGAAA	0.448																																																	0								ENSG00000050030						87.0	76.0	79.0					X																	73961451		2203	4300	6503	KIAA2022	SO:0001583	missense	0			-	HGNC		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.2941G>T	X.37:g.73961451C>A	ENSP00000055682:p.Gly981Trp	Somatic	0	53	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G981W	ENST00000055682.6	37	c.2941	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	C	16.31	3.087612	0.55968	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.37411	1.2;1.2	5.58	3.83	0.44106	.	0.453697	0.26871	N	0.022063	T	0.49321	0.1550	L	0.47716	1.5	0.51482	D	0.999922	D	0.69078	0.997	D	0.65874	0.939	T	0.45963	-0.9225	10	0.87932	D	0	-0.2484	11.4435	0.50110	0.0:0.8511:0.0:0.1489	.	981	Q5QGS0	K2022_HUMAN	W	981	ENSP00000362567:G981W;ENSP00000055682:G981W	ENSP00000055682:G981W	G	-	1	0	KIAA2022	73878176	1.000000	0.71417	0.953000	0.39169	0.792000	0.44763	1.946000	0.40283	0.551000	0.29008	0.600000	0.82982	GGG	-	NULL		0.448	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	protein_coding	OTTHUMT00000057270.2	C	NM_001008537	-		73961451	-1	no_errors	ENST00000055682	ensembl	human	known	74_37	missense	SNP	1.000	A
PTPRT	11122	genome.wustl.edu	37	20	41419840	41419840	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr20:41419840A>G	ENST00000373187.1	-	3	480	c.481T>C	c.(481-483)Tat>Cat	p.Y161H	PTPRT_ENST00000373184.1_Missense_Mutation_p.Y161H|PTPRT_ENST00000373190.1_Missense_Mutation_p.Y161H|PTPRT_ENST00000373198.4_Missense_Mutation_p.Y161H|PTPRT_ENST00000373193.3_Missense_Mutation_p.Y161H|PTPRT_ENST00000373201.1_Missense_Mutation_p.Y161H|PTPRT_ENST00000356100.2_Missense_Mutation_p.Y161H			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	161	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CATACCTGATAGAAATGTGGC	0.478																																																	0								ENSG00000196090						96.0	100.0	99.0					20																	41419840		1967	4171	6138	PTPRT	SO:0001583	missense	0			-	HGNC	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.481T>C	20.37:g.41419840A>G	ENSP00000362283:p.Tyr161His	Somatic	0	76	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	84	22.94	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.Y161H	ENST00000373187.1	37	c.481	CCDS42874.1	20	.	.	.	.	.	.	.	.	.	.	A	24.8	4.567167	0.86439	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.02498	4.27;4.27;4.27;4.27;4.27;4.27;4.27	5.67	5.67	0.87782	Concanavalin A-like lectin/glucanase (1);MAM domain (4);	0.000000	0.85682	D	0.000000	T	0.19087	0.0458	M	0.87758	2.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.00611	-1.1645	10	0.87932	D	0	.	15.9059	0.79430	1.0:0.0:0.0:0.0	.	161;161	O14522-1;O14522	.;PTPRT_HUMAN	H	161	ENSP00000362286:Y161H;ENSP00000362283:Y161H;ENSP00000362289:Y161H;ENSP00000348408:Y161H;ENSP00000362294:Y161H;ENSP00000362280:Y161H;ENSP00000362297:Y161H	ENSP00000348408:Y161H	Y	-	1	0	PTPRT	40853254	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.339000	0.96797	2.161000	0.67846	0.459000	0.35465	TAT	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom,prints_MAM_dom		0.478	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRT	protein_coding	OTTHUMT00000080315.1	A		-		41419840	-1	no_errors	ENST00000373198	ensembl	human	known	74_37	missense	SNP	1.000	G
MTHFD2L	441024	genome.wustl.edu	37	4	75041117	75041117	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr4:75041117C>T	ENST00000395759.2	+	3	475	c.448C>T	c.(448-450)Cca>Tca	p.P150S	MTHFD2L_ENST00000433372.1_Missense_Mutation_p.P15S|MTHFD2L_ENST00000325278.6_Missense_Mutation_p.P92S|MTHFD2L_ENST00000331145.6_Missense_Mutation_p.P92S	NM_001144978.1	NP_001138450.1	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like	150					folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|tetrahydrofolate interconversion (GO:0035999)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)			central_nervous_system(1)|endometrium(1)|lung(4)|ovary(2)	8			all cancers(17;0.0101)|Lung(101;0.196)			GTTACCACTACCAGGTACATA	0.333																																																	0								ENSG00000163738						129.0	129.0	129.0					4																	75041117		2203	4300	6503	MTHFD2L	SO:0001583	missense	0			-	HGNC	BC065771	CCDS47075.1	4q13.3	2011-08-03			ENSG00000163738	ENSG00000163738			31865	protein-coding gene	gene with protein product		614047				21163947	Standard	NM_001144978		Approved	MGC72244	uc011cbk.2	Q9H903	OTTHUMG00000157135	ENST00000395759.2:c.448C>T	4.37:g.75041117C>T	ENSP00000379108:p.Pro150Ser	Somatic	0	74	0.00		0.6159915499159303	9	18.18	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	134	21.18	Q6P079|Q8N560	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	p.P150S	ENST00000395759.2	37	c.448	CCDS47075.1	4	.	.	.	.	.	.	.	.	.	.	C	24.4	4.530470	0.85706	.	.	ENSG00000163738	ENST00000433372;ENST00000395759;ENST00000331145;ENST00000359107;ENST00000325278	T;T;T;T;T	0.38560	1.13;1.55;1.22;1.23;1.62	5.36	5.36	0.76844	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.76637	0.4015	H	0.97103	3.94	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.989;0.999	D	0.84323	0.0517	10	0.87932	D	0	-22.9907	16.6388	0.85066	0.0:1.0:0.0:0.0	.	150;92	Q9H903;Q9H903-3	MTD2L_HUMAN;.	S	15;150;92;92;92	ENSP00000405692:P15S;ENSP00000379108:P150S;ENSP00000330982:P92S;ENSP00000352012:P92S;ENSP00000321984:P92S	ENSP00000321984:P92S	P	+	1	0	MTHFD2L	75259981	1.000000	0.71417	0.998000	0.56505	0.924000	0.55760	7.098000	0.76974	2.803000	0.96430	0.643000	0.83706	CCA	-	pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase		0.333	MTHFD2L-202	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFD2L	protein_coding		C	NM_001004346	-		75041117	+1	no_errors	ENST00000395759	ensembl	human	known	74_37	missense	SNP	1.000	T
CCDC117	150275	genome.wustl.edu	37	22	29169758	29169758	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:29169758G>C	ENST00000249064.4	+	2	407	c.231G>C	c.(229-231)gaG>gaC	p.E77D	CCDC117_ENST00000443309.2_5'UTR|CCDC117_ENST00000448492.2_Intron|CCDC117_ENST00000421503.2_Missense_Mutation_p.E77D	NM_001284263.1|NM_001284265.1|NM_173510.2	NP_001271192.1|NP_001271194.1|NP_775781.1	Q8IWD4	CC117_HUMAN	coiled-coil domain containing 117	77								p.E77D(1)		breast(1)|kidney(1)|large_intestine(4)|upper_aerodigestive_tract(1)	7						AGGAGGAGGAGGATGATGAGT	0.368																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000159873						301.0	264.0	277.0					22																	29169758		2203	4300	6503	CCDC117	SO:0001583	missense	0			-	HGNC	AK091133	CCDS13846.1, CCDS63435.1, CCDS63436.1	22q12.1	2006-06-27			ENSG00000159873	ENSG00000159873			26599	protein-coding gene	gene with protein product						12477932	Standard	NM_001284263		Approved	FLJ33814	uc003aeb.3	Q8IWD4	OTTHUMG00000151091	ENST00000249064.4:c.231G>C	22.37:g.29169758G>C	ENSP00000249064:p.Glu77Asp	Somatic	0	65	0.00		0.6159915499159303	8	59.09	13	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	35	36.36	A8K0F1|B7Z2V1|B7Z860|Q6ICA7|Q8N278	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E77D	ENST00000249064.4	37	c.231	CCDS13846.1	22	.	.	.	.	.	.	.	.	.	.	G	13.46	2.245039	0.39697	.	.	ENSG00000159873	ENST00000249064;ENST00000421503	T;T	0.15256	2.44;2.46	5.03	-3.0	0.05480	.	0.305004	0.29616	N	0.011657	T	0.04634	0.0126	N	0.08118	0	0.80722	D	1	B;B	0.10296	0.002;0.003	B;B	0.14578	0.011;0.011	T	0.44236	-0.9341	10	0.02654	T	1	.	3.5404	0.07809	0.3397:0.0:0.3715:0.2888	.	77;77	B7Z2V1;Q8IWD4	.;CC117_HUMAN	D	77	ENSP00000249064:E77D;ENSP00000387827:E77D	ENSP00000249064:E77D	E	+	3	2	CCDC117	27499758	0.988000	0.35896	0.656000	0.29637	0.955000	0.61496	-0.014000	0.12656	-0.666000	0.05310	-0.367000	0.07326	GAG	-	NULL		0.368	CCDC117-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC117	protein_coding	OTTHUMT00000321258.1	G	NM_173510	-		29169758	+1	no_errors	ENST00000249064	ensembl	human	known	74_37	missense	SNP	0.860	C
PGLYRP3	114771	genome.wustl.edu	37	1	153271624	153271624	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:153271624A>G	ENST00000290722.1	-	6	864	c.812T>C	c.(811-813)aTt>aCt	p.I271T		NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3	271					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TCCTAGGGCAATATCGTTGAA	0.532																																																	0								ENSG00000159527						114.0	96.0	102.0					1																	153271624		2203	4300	6503	PGLYRP3	SO:0001583	missense	0			-	HGNC	AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.812T>C	1.37:g.153271624A>G	ENSP00000290722:p.Ile271Thr	Somatic	0	53	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	41	28.07	A1A4U8|Q5SY65	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	p.I271T	ENST00000290722.1	37	c.812	CCDS1035.1	1	.	.	.	.	.	.	.	.	.	.	A	12.67	2.007623	0.35415	.	.	ENSG00000159527	ENST00000290722	T	0.12672	2.66	4.59	4.59	0.56863	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (4);	0.096973	0.43416	D	0.000566	T	0.13329	0.0323	M	0.79805	2.47	0.34518	D	0.707825	P	0.51537	0.946	P	0.50617	0.646	T	0.12785	-1.0534	10	0.17832	T	0.49	-33.1972	10.3569	0.43969	1.0:0.0:0.0:0.0	.	271	Q96LB9	PGRP3_HUMAN	T	271	ENSP00000290722:I271T	ENSP00000290722:I271T	I	-	2	0	PGLYRP3	151538248	0.719000	0.27986	0.995000	0.50966	0.782000	0.44232	4.643000	0.61390	1.700000	0.51204	0.260000	0.18958	ATT	-	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain		0.532	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGLYRP3	protein_coding	OTTHUMT00000039488.1	A	NM_052891	-		153271624	-1	no_errors	ENST00000290722	ensembl	human	known	74_37	missense	SNP	0.995	G
DMTF1	9988	genome.wustl.edu	37	7	86811368	86811368	+	Intron	SNP	A	A	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:86811368A>G	ENST00000394703.5	+	12	1273				DMTF1_ENST00000432937.2_Intron|DMTF1_ENST00000411766.2_Missense_Mutation_p.H208R|DMTF1_ENST00000413276.2_Intron|DMTF1_ENST00000331242.7_Intron|DMTF1_ENST00000394702.3_Missense_Mutation_p.H249R|DMTF1_ENST00000414194.2_Intron	NM_021145.3	NP_066968.3	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1						cell cycle (GO:0007049)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)	16	Esophageal squamous(14;0.0058)					TTTTTCACCCACAGACAACTG	0.418																																																	0								ENSG00000135164																																			DMTF1	SO:0001627	intron_variant	0			-	HGNC	AF084530	CCDS5601.1, CCDS47633.1	7q21	2014-06-25			ENSG00000135164	ENSG00000135164			14603	protein-coding gene	gene with protein product	"""cyclin D-binding Myb-like protein"""	608491				10095122, 24958102	Standard	NR_024549		Approved	DMP1, DMTF, hDMP1, MRUL	uc003uih.3	Q9Y222	OTTHUMG00000154135	ENST00000394703.5:c.711-176A>G	7.37:g.86811368A>G		Somatic	0	69	0.00		0.6159915499159303	3	62.50	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	36	38.98	B2RBE1|B4DJS5|Q05C48|Q59G79|Q6IS13|Q969T2|Q9H2Z2|Q9H2Z3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.H249R	ENST00000394703.5	37	c.746	CCDS5601.1	7	.	.	.	.	.	.	.	.	.	.	A	17.97	3.518135	0.64634	.	.	ENSG00000135164	ENST00000394702;ENST00000447863;ENST00000425406;ENST00000411766	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	T	0.72946	0.3524	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.76323	-0.3001	5	0.87932	D	0	.	12.3173	0.54964	1.0:0.0:0.0:0.0	.	.	.	.	R	249;249;208;208	.	ENSP00000378192:H249R	H	+	2	0	DMTF1	86649304	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.194000	0.58393	2.222000	0.72286	0.528000	0.53228	CAC	-	NULL		0.418	DMTF1-002	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	DMTF1	protein_coding	OTTHUMT00000334025.5	A	NM_021145	-		86811368	+1	no_errors	ENST00000394702	ensembl	human	known	74_37	missense	SNP	1.000	G
TRIM21	6737	genome.wustl.edu	37	11	4407544	4407544	+	Intron	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr11:4407544C>T	ENST00000254436.7	-	6	871				TRIM21_ENST00000543625.1_Missense_Mutation_p.V249M	NM_003141.3	NP_003132.2	P19474	RO52_HUMAN	tripartite motif containing 21						cell cycle (GO:0007049)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein deubiquitination (GO:0090086)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral entry into host cell (GO:0046598)|protein autoubiquitination (GO:0051865)|protein destabilization (GO:0031648)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)	16		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;2.08e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0851)|LUSC - Lung squamous cell carcinoma(625;0.194)		AACCCTAACACTATAACCTCC	0.468																																																	0								ENSG00000132109																																			TRIM21	SO:0001627	intron_variant	0			-	HGNC	AF391283	CCDS44525.1	11p15.5-p15.3	2014-02-14	2011-01-25	2004-11-26		ENSG00000132109		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	11312	protein-coding gene	gene with protein product		109092	"""Sjogren syndrome antigen A1 (52kDa, ribonucleoprotein autoantigen SS-A/Ro)"", ""tripartite motif-containing 21"""	SSA1		8094596	Standard	NM_003141		Approved	RNF81, RO52, Ro/SSA	uc001lyy.1	P19474		ENST00000254436.7:c.759-57G>A	11.37:g.4407544C>T		Somatic	0	23	0.00		0.6159915499159303	1	75.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	8	65.38	Q5XPV5|Q96RF8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Ubox_domain,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin,prints_Znf_B-box_chordata	p.V249M	ENST00000254436.7	37	c.745	CCDS44525.1	11	.	.	.	.	.	.	.	.	.	.	C	7.155	0.584486	0.13749	.	.	ENSG00000132109	ENST00000543625	T	0.04862	3.54	3.84	0.742	0.18341	.	2.042700	0.02175	N	0.060054	T	0.07548	0.0190	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.33033	-0.9884	7	0.51188	T	0.08	.	4.6814	0.12736	0.3652:0.5265:0.0:0.1083	.	.	.	.	M	249	ENSP00000444045:V249M	ENSP00000444045:V249M	V	-	1	0	TRIM21	4364120	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.197000	0.17197	0.167000	0.19631	0.655000	0.94253	GTG	-	NULL		0.468	TRIM21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM21	protein_coding	OTTHUMT00000385842.1	C	NM_003141	-		4407544	-1	no_errors	ENST00000543625	ensembl	human	known	74_37	missense	SNP	0.000	T
ZNF300	91975	genome.wustl.edu	37	5	150282891	150282891	+	Intron	SNP	A	A	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr5:150282891A>G	ENST00000274599.5	-	3	394				ZNF300_ENST00000427179.1_Intron|ZNF300_ENST00000394226.2_Intron|ZNF300_ENST00000446148.2_Splice_Site_p.S7S|ZNF300_ENST00000418587.2_Intron	NM_052860.2	NP_443092.1	Q96RE9	ZN300_HUMAN	zinc finger protein 300						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)	27		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGAGCCTTACAGAAGTCTCAG	0.418																																																	0								ENSG00000145908																																			ZNF300	SO:0001627	intron_variant	0			-	HGNC	AF395541	CCDS4311.2, CCDS54939.1, CCDS54940.1	5q33.1	2013-01-08			ENSG00000145908	ENSG00000145908		"""Zinc fingers, C2H2-type"", ""-"""	13091	protein-coding gene	gene with protein product		612429				14746915	Standard	NM_052860		Approved		uc021yfx.1	Q96RE9	OTTHUMG00000130076	ENST00000274599.5:c.27-147T>C	5.37:g.150282891A>G		Somatic	0	61	0.00		0.6159915499159303	3	50.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	94	18.97	A8MY91|B3KU35|B4DU78|F5GWS1|Q06DQ3|Q17RP3|Q5H9N5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S7	ENST00000274599.5	37	c.21	CCDS4311.2	5																																																																																			-	NULL		0.418	ZNF300-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF300	protein_coding		A	NM_052860	-		150282891	-1	no_errors	ENST00000446148	ensembl	human	known	74_37	silent	SNP	0.001	G
ITGA7	3679	genome.wustl.edu	37	12	56088249	56088249	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr12:56088249C>A	ENST00000555728.1	-	18	2495	c.2467G>T	c.(2467-2469)Gag>Tag	p.E823*	ITGA7_ENST00000257879.6_Nonsense_Mutation_p.E779*|ITGA7_ENST00000452168.2_Nonsense_Mutation_p.E686*|ITGA7_ENST00000394230.2_Nonsense_Mutation_p.E783*|ITGA7_ENST00000553804.1_Nonsense_Mutation_p.E783*|ITGA7_ENST00000394229.2_Nonsense_Mutation_p.E779*|ITGA7_ENST00000257880.7_Nonsense_Mutation_p.E823*|ITGA7_ENST00000347027.6_Nonsense_Mutation_p.E773*			Q13683	ITA7_HUMAN	integrin, alpha 7	823					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						AGCTCTACCTCCAGTTCCGTG	0.582																																																	0								ENSG00000135424						74.0	65.0	68.0					12																	56088249		2203	4300	6503	ITGA7	SO:0001587	stop_gained	0			-	HGNC		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.2467G>T	12.37:g.56088249C>A	ENSP00000452387:p.Glu823*	Somatic	0	42	0.00		0.6159915499159303	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.E823*	ENST00000555728.1	37	c.2467		12	.	.	.	.	.	.	.	.	.	.	C	38	7.144508	0.98092	.	.	ENSG00000135424	ENST00000553804;ENST00000257879;ENST00000347027;ENST00000452168;ENST00000257880;ENST00000394230;ENST00000394229;ENST00000353687;ENST00000555728	.	.	.	4.56	3.65	0.41850	.	0.382752	0.26119	N	0.026234	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	11.0515	0.47893	0.0:0.9067:0.0:0.0933	.	.	.	.	X	783;779;773;686;823;783;779;652;823	.	ENSP00000257879:E779X	E	-	1	0	ITGA7	54374516	0.036000	0.19791	1.000000	0.80357	0.963000	0.63663	1.546000	0.36179	1.255000	0.44051	0.555000	0.69702	GAG	-	pfam_Integrin_alpha-2		0.582	ITGA7-014	KNOWN	basic	protein_coding	ITGA7	protein_coding	OTTHUMT00000410138.1	C	NM_002206	-		56088249	-1	no_errors	ENST00000555728	ensembl	human	known	74_37	nonsense	SNP	1.000	A
POTEJ	653781	genome.wustl.edu	37	2	131369279	131369279	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:131369279G>T	ENST00000409602.1	+	1	226	c.174G>T	c.(172-174)agG>agT	p.R58S		NM_001277083.1	NP_001264012.1	P0CG39	POTEJ_HUMAN	POTE ankyrin domain family, member J	58					retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				lung(5)	5						AGACACTCAGGAGCAAGATGG	0.632																																																	0								ENSG00000222038																																			POTEJ	SO:0001583	missense	0			-	HGNC		CCDS59432.1	2q21.1	2013-01-10			ENSG00000222038	ENSG00000222038		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37094	protein-coding gene	gene with protein product						16364570	Standard	NM_001277083		Approved	POTE2beta	uc021vor.2	P0CG39	OTTHUMG00000154050	ENST00000409602.1:c.174G>T	2.37:g.131369279G>T	ENSP00000387176:p.Arg58Ser	Somatic	0	37	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	10	16.67		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Actin-related,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-related,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-related	p.R58S	ENST00000409602.1	37	c.174	CCDS59432.1	2	.	.	.	.	.	.	.	.	.	.	.	4.701	0.130310	0.08981	.	.	ENSG00000222038	ENST00000409602	D	0.83837	-1.77	0.418	-0.836	0.10770	.	.	.	.	.	T	0.80276	0.4593	L	0.58101	1.795	0.09310	N	1	.	.	.	.	.	.	T	0.70992	-0.4721	6	0.87932	D	0	.	.	.	.	.	.	.	.	S	58	ENSP00000387176:R58S	ENSP00000387176:R58S	R	+	3	2	POTEJ	131085749	0.234000	0.23783	0.009000	0.14445	0.040000	0.13550	-0.132000	0.10467	-0.507000	0.06549	-1.207000	0.01640	AGG	-	NULL		0.632	POTEJ-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEJ	protein_coding	OTTHUMT00000333665.1	G	XM_929706	-		131369279	+1	no_errors	ENST00000409602	ensembl	human	novel	74_37	missense	SNP	0.012	T
ESX1	80712	genome.wustl.edu	37	X	103494923	103494923	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:103494923A>T	ENST00000372588.4	-	4	1290	c.1207T>A	c.(1207-1209)Tgt>Agt	p.C403S		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	403					labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						AAAAAGGGACATGCATAATAA	0.473																																					Pancreas(200;1705 2227 25194 28471 45274)												0								ENSG00000123576						61.0	60.0	60.0					X																	103494923		2203	4300	6503	ESX1	SO:0001583	missense	0			-	HGNC	AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.1207T>A	X.37:g.103494923A>T	ENSP00000361669:p.Cys403Ser	Somatic	0	133	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	103	24.26	B0QYU3|Q7Z6K7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_POU	p.C403S	ENST00000372588.4	37	c.1207	CCDS14516.1	X	.	.	.	.	.	.	.	.	.	.	A	2.710	-0.268932	0.05716	.	.	ENSG00000123576	ENST00000372588	T	0.52754	0.65	4.09	1.42	0.22433	.	.	.	.	.	T	0.21427	0.0516	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19353	-1.0308	9	0.20519	T	0.43	-0.0475	2.7571	0.05296	0.1774:0.3816:0.3384:0.1025	.	403	Q8N693	ESX1_HUMAN	S	403	ENSP00000361669:C403S	ENSP00000361669:C403S	C	-	1	0	ESX1	103381579	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.154000	0.10130	0.167000	0.19631	-0.819000	0.03115	TGT	-	NULL		0.473	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESX1	protein_coding	OTTHUMT00000057763.2	A	NM_153448	-		103494923	-1	no_errors	ENST00000372588	ensembl	human	known	74_37	missense	SNP	0.000	T
NEFH	4744	genome.wustl.edu	37	22	29885939	29885939	+	Silent	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:29885939G>A	ENST00000310624.6	+	4	2343	c.2310G>A	c.(2308-2310)gcG>gcA	p.A770A		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	776	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGACTCCAGCGAAGGAGGAAG	0.542																																																	0								ENSG00000100285						76.0	76.0	76.0					22																	29885939		2203	4300	6503	NEFH	SO:0001819	synonymous_variant	0			-	HGNC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2310G>A	22.37:g.29885939G>A		Somatic	0	89	0.00		0.6159915499159303	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	51	23.88	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,pfam_DUF1388	p.A770	ENST00000310624.6	37	c.2310	CCDS13858.1	22																																																																																			-	NULL		0.542	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEFH	protein_coding	OTTHUMT00000321553.2	G	NM_021076	-		29885939	+1	no_errors	ENST00000310624	ensembl	human	known	74_37	silent	SNP	0.004	A
THBS1	7057	genome.wustl.edu	37	15	39874116	39874116	+	Missense_Mutation	SNP	C	C	A	rs201203521		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr15:39874116C>A	ENST00000260356.5	+	2	223	c.58C>A	c.(58-60)Cgc>Agc	p.R20S		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	20					activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		TGGCACCAACCGCATTCCAGG	0.607											OREG0023050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000137801						130.0	107.0	115.0					15																	39874116		2200	4297	6497	THBS1	SO:0001583	missense	0			-	HGNC		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.58C>A	15.37:g.39874116C>A	ENSP00000260356:p.Arg20Ser	Somatic	0	22	0.00	889	0.6159915499159303	66	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_C,pfam_Thrombospondin_1_rpt,pfam_VWF_C,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Thrombospondin_1_rpt,smart_Laminin_G,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.R20S	ENST00000260356.5	37	c.58	CCDS32194.1	15	.	.	.	.	.	.	.	.	.	.	C	15.58	2.875501	0.51695	.	.	ENSG00000137801	ENST00000260356;ENST00000397591	T;T	0.77098	-1.07;0.8	4.94	2.84	0.33178	.	0.464939	0.16116	N	0.228869	T	0.65354	0.2683	L	0.36672	1.1	0.31878	N	0.618894	B	0.31625	0.332	B	0.26693	0.072	T	0.69359	-0.5166	10	0.51188	T	0.08	-14.3285	9.3684	0.38239	0.4152:0.5848:0.0:0.0	.	20	P07996	TSP1_HUMAN	S	20	ENSP00000260356:R20S;ENSP00000380720:R20S	ENSP00000260356:R20S	R	+	1	0	THBS1	37661408	0.996000	0.38824	1.000000	0.80357	0.996000	0.88848	0.304000	0.19228	1.251000	0.43983	0.591000	0.81541	CGC	-	NULL		0.607	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS1	protein_coding	OTTHUMT00000257831.2	C	NM_003246	-		39874116	+1	no_errors	ENST00000260356	ensembl	human	known	74_37	missense	SNP	1.000	A
FASTKD1	79675	genome.wustl.edu	37	2	170417232	170417232	+	Silent	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:170417232C>A	ENST00000453153.2	-	5	982	c.636G>T	c.(634-636)ctG>ctT	p.L212L	FASTKD1_ENST00000453929.2_Silent_p.L212L	NM_024622.3	NP_078898.3	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	212					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(5)|large_intestine(10)|lung(9)|ovary(4)|prostate(3)	37						TTTTGTTCACCAGTTGTTGTT	0.328																																																	0								ENSG00000138399						39.0	39.0	39.0					2																	170417232		2202	4299	6501	FASTKD1	SO:0001819	synonymous_variant	0			-	HGNC	AL832058	CCDS33318.1, CCDS63051.1	2q31.1	2008-02-05			ENSG00000138399	ENSG00000138399			26150	protein-coding gene	gene with protein product						11347906	Standard	NM_024622		Approved	FLJ21901	uc002uev.4	Q53R41	OTTHUMG00000154953	ENST00000453153.2:c.636G>T	2.37:g.170417232C>A		Somatic	0	41	0.00		0.6159915499159303	39	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q8N583|Q8TEA9|Q96JM5|Q96N71|Q9H6T4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_FAST_2,pfam_FAST_Leu-rich,pfam_RAP,smart_RAP	p.L212	ENST00000453153.2	37	c.636	CCDS33318.1	2																																																																																			-	NULL		0.328	FASTKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FASTKD1	protein_coding	OTTHUMT00000337788.2	C	NM_024622	-		170417232	-1	no_errors	ENST00000453153	ensembl	human	known	74_37	silent	SNP	0.935	A
ZNF727	442319	genome.wustl.edu	37	7	63538202	63538202	+	Missense_Mutation	SNP	G	G	A	rs192720590		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:63538202G>A	ENST00000550760.3	+	4	954	c.775G>A	c.(775-777)Gaa>Aaa	p.E259K	RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727	259					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						CTACAAATGCGAAGAATGTCA	0.393													g|||	1	0.000199681	0.0008	0.0	5008	,	,		19999	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000257482						62.0	65.0	64.0					7																	63538202		692	1591	2283	ZNF727	SO:0001583	missense	0			GMAF=0.0005	HGNC			7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536	ENST00000550760.3:c.775G>A	7.37:g.63538202G>A	ENSP00000447987:p.Glu259Lys	Somatic	0	44	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	34	56.41		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E259K	ENST00000550760.3	37	c.775	CCDS55113.1	7	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	12.07	1.827161	0.32329	.	.	ENSG00000257482	ENST00000550760	T	0.16597	2.33	1.02	-0.714	0.11219	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08088	0.0202	N	0.25485	0.75	0.09310	N	1	P	0.46457	0.878	B	0.36959	0.237	T	0.25257	-1.0137	8	.	.	.	.	2.2746	0.04099	0.2834:0.3349:0.3816:0.0	.	259	A8MUV8	ZN727_HUMAN	K	259	ENSP00000447987:E259K	.	E	+	1	0	ZNF727	63175637	0.000000	0.05858	0.126000	0.21872	0.111000	0.19643	-2.222000	0.01215	0.436000	0.26393	0.436000	0.28706	GAA	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.393	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF727	protein_coding		G	NM_001159522	rs192720590		63538202	+1	no_errors	ENST00000550760	ensembl	human	known	74_37	missense	SNP	0.400	A
NUMB	8650	genome.wustl.edu	37	14	73743865	73743865	+	Silent	SNP	T	T	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr14:73743865T>C	ENST00000355058.3	-	13	1655	c.1377A>G	c.(1375-1377)tcA>tcG	p.S459S	NUMB_ENST00000555738.2_Silent_p.S302S|NUMB_ENST00000555394.1_Silent_p.S411S|NUMB_ENST00000554546.1_Silent_p.S400S|NUMB_ENST00000560335.1_Silent_p.S313S|NUMB_ENST00000356296.4_Silent_p.S411S|NUMB_ENST00000554521.2_Silent_p.S253S|NUMB_ENST00000454166.4_Silent_p.S313S|NUMB_ENST00000544991.3_Silent_p.S264S|NUMB_ENST00000557597.1_Silent_p.S448S|NUMB_ENST00000556772.1_Silent_p.S315S|NUMB_ENST00000555238.1_Silent_p.S459S|NUMB_ENST00000359560.3_Silent_p.S448S|NUMB_ENST00000559312.1_Silent_p.S264S|NUMB_ENST00000535282.1_Silent_p.S448S			P49757	NUMB_HUMAN	numb homolog (Drosophila)	459					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|lateral ventricle development (GO:0021670)|lung epithelial cell differentiation (GO:0060487)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein localization to plasma membrane (GO:1903077)|neuroblast division in subventricular zone (GO:0021849)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration (GO:0030335)|positive regulation of neurogenesis (GO:0050769)|positive regulation of polarized epithelial cell differentiation (GO:0030862)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		GAGGAGCAGCTGAGGCCTGGG	0.607																																																	0								ENSG00000133961						47.0	45.0	46.0					14																	73743865		2203	4300	6503	NUMB	SO:0001819	synonymous_variant	0			-	HGNC	L40393	CCDS9814.1, CCDS32115.1, CCDS32116.1, CCDS55927.1	14q24.3	2011-11-25	2001-11-28			ENSG00000133961			8060	protein-coding gene	gene with protein product		603728	"""numb (Drosophila) homolog"", ""chromosome 14 open reading frame 41"""	C14orf41			Standard	NM_003744		Approved		uc001xny.1	P49757		ENST00000355058.3:c.1377A>G	14.37:g.73743865T>C		Somatic	0	31	0.00		0.6159915499159303	104	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B1P2N5|B1P2N6|B1P2N7|B1P2N8|B1P2N9|B4E2B1|Q6NUQ7|Q86SY1|Q8WW73|Q9UBG1|Q9UEQ4|Q9UKE8|Q9UKE9|Q9UKF0|Q9UQJ4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Numb_domain,pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pirsf_Numb/numb-like,pfscan_PTB/PI_dom	p.S459	ENST00000355058.3	37	c.1377	CCDS32116.1	14																																																																																			-	pirsf_Numb/numb-like		0.607	NUMB-201	KNOWN	basic|CCDS	protein_coding	NUMB	protein_coding	OTTHUMT00000414416.1	T		-		73743865	-1	no_errors	ENST00000355058	ensembl	human	known	74_37	silent	SNP	0.908	C
ANKRD10	55608	genome.wustl.edu	37	13	111555879	111555879	+	Intron	SNP	G	G	T	rs147774607		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr13:111555879G>T	ENST00000267339.2	-	3	590				ANKRD10_ENST00000375758.5_Intron|ANKRD10_ENST00000489973.2_Intron|ANKRD10_ENST00000310847.4_Intron	NM_017664.2	NP_060134.2	Q9NXR5	ANR10_HUMAN	ankyrin repeat domain 10											central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)	9	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		all cancers(43;0.0882)|BRCA - Breast invasive adenocarcinoma(86;0.188)|Lung(89;0.208)			TTATCTTACAGATGCAACCTA	0.333																																																	0								ENSG00000088448																																			ANKRD10	SO:0001627	intron_variant	0			-	HGNC	AK000100	CCDS9520.1, CCDS66580.1	13q33.3	2013-01-10			ENSG00000088448	ENSG00000088448		"""Ankyrin repeat domain containing"""	20265	protein-coding gene	gene with protein product							Standard	NM_017664		Approved	FLJ20093	uc001vrn.3	Q9NXR5	OTTHUMG00000017349	ENST00000267339.2:c.455+2500C>A	13.37:g.111555879G>T		Somatic	0	53	0.00		0.6159915499159303	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q5VW12|Q9BV12	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000267339.2	37	NULL	CCDS9520.1	13																																																																																			-	-		0.333	ANKRD10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD10	protein_coding	OTTHUMT00000045783.1	G		-		111555879	-1	no_errors	ENST00000464579	ensembl	human	known	74_37	rna	SNP	0.090	T
INTS7	25896	genome.wustl.edu	37	1	212148708	212148708	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:212148708G>T	ENST00000366994.3	-	13	1719	c.1615C>A	c.(1615-1617)Cat>Aat	p.H539N	INTS7_ENST00000440600.2_Missense_Mutation_p.H490N|INTS7_ENST00000469606.1_5'UTR|INTS7_ENST00000366992.3_Missense_Mutation_p.H539N|INTS7_ENST00000366993.3_Missense_Mutation_p.H539N	NM_001199811.1|NM_001199812.1|NM_015434.3	NP_001186740.1|NP_001186741.1|NP_056249.1	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	539					cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|snRNA processing (GO:0016180)	chromosome (GO:0005694)|integrator complex (GO:0032039)				NS(1)|breast(1)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		GCCATGTCATGATTACCCTAA	0.378																																																	0								ENSG00000143493						78.0	85.0	83.0					1																	212148708		2203	4300	6503	INTS7	SO:0001583	missense	0			-	HGNC	AK022509	CCDS1501.1, CCDS55684.1, CCDS55683.1, CCDS55685.1	1q32.3	2008-02-05	2006-03-15	2006-03-15	ENSG00000143493	ENSG00000143493			24484	protein-coding gene	gene with protein product		611350	"""chromosome 1 open reading frame 73"""	C1orf73		16239144	Standard	NM_015434		Approved	DKFZP434B168, INT7	uc001hiw.2	Q9NVH2	OTTHUMG00000037119	ENST00000366994.3:c.1615C>A	1.37:g.212148708G>T	ENSP00000355961:p.His539Asn	Somatic	0	39	0.00		0.6159915499159303	37	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B4DLZ6|B7WNP6|B7WPB6|Q8N4K7|Q8WUH5|Q9H9V3|Q9NVU5|Q9UFC6|Q9UFM3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.H490N	ENST00000366994.3	37	c.1468	CCDS1501.1	1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.703229	0.88924	.	.	ENSG00000143493	ENST00000366994;ENST00000366993;ENST00000366992;ENST00000440600	T;T;T;T	0.29655	1.56;1.56;1.56;1.56	6.06	6.06	0.98353	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.57740	0.2074	M	0.73217	2.22	0.80722	D	1	D;D;D;D	0.61080	0.989;0.989;0.989;0.989	D;D;D;D	0.72982	0.979;0.979;0.979;0.979	T	0.49579	-0.8925	10	0.41790	T	0.15	-26.5119	20.6208	0.99490	0.0:0.0:1.0:0.0	.	490;539;539;539	B4DLZ6;Q9NVH2-3;Q9NVH2-2;Q9NVH2	.;.;.;INT7_HUMAN	N	539;539;539;490	ENSP00000355961:H539N;ENSP00000355960:H539N;ENSP00000355959:H539N;ENSP00000388908:H490N	ENSP00000355959:H539N	H	-	1	0	INTS7	210215331	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.507000	0.97996	2.882000	0.98803	0.655000	0.94253	CAT	-	NULL		0.378	INTS7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	INTS7	protein_coding	OTTHUMT00000090142.1	G	NM_015434	-		212148708	-1	no_errors	ENST00000440600	ensembl	human	known	74_37	missense	SNP	1.000	T
ZCRB1	85437	genome.wustl.edu	37	12	42706971	42706971	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr12:42706971delT	ENST00000266529.3	-	8	735	c.552delA	c.(550-552)aaafs	p.K184fs	ZCRB1_ENST00000552673.1_Frame_Shift_Del_p.K143fs|PPHLN1_ENST00000549190.1_Intron	NM_033114.3	NP_149105.3	Q8TBF4	ZCRB1_HUMAN	zinc finger CCHC-type and RNA binding motif 1	184					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|skin(2)	8	all_cancers(12;0.000348)|Breast(8;0.221)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0689)		TGGGTTTCCATTTTTTTTGTT	0.328																																																	0								ENSG00000139168						123.0	112.0	116.0					12																	42706971		2203	4300	6503	ZCRB1	SO:0001589	frameshift_variant	0				HGNC	BC022543	CCDS8740.1	12q12	2013-02-12				ENSG00000139168		"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	29620	protein-coding gene	gene with protein product	"""U11/U12 snRNP 31K"""	610750				15146077, 16959469	Standard	NM_033114		Approved	MADP-1, MADP1, RBM36, ZCCHC19, SNRNP31	uc001rmz.3	Q8TBF4	OTTHUMG00000169382	ENST00000266529.3:c.552delA	12.37:g.42706971delT	ENSP00000266529:p.Lys184fs	Somatic	0	54	0.00		0.6159915499159303	260	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	Q6PJX0|Q96TA6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_RRM_dom_euk,smart_RRM_dom,smart_Znf_CCHC,pfscan_Znf_CCHC,pfscan_RRM_dom	p.K184fs	ENST00000266529.3	37	c.552	CCDS8740.1	12																																																																																			-	NULL		0.328	ZCRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCRB1	protein_coding	OTTHUMT00000403813.1	T	NM_033114			42706971	-1	no_errors	ENST00000266529	ensembl	human	known	74_37	frame_shift_del	DEL	0.732	-
STRIP2	57464	genome.wustl.edu	37	7	129103922	129103922	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:129103922C>A	ENST00000249344.2	+	15	1629	c.1589C>A	c.(1588-1590)aCc>aAc	p.T530N	STRIP2_ENST00000435494.2_Missense_Mutation_p.T530N	NM_020704.2	NP_065755.1	Q9ULQ0	STRP2_HUMAN	striatin interacting protein 2	530					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)											GCAGCTCCCACCTCTAAGGCT	0.478																																																	0								ENSG00000128578						113.0	100.0	104.0					7																	129103922		2203	4300	6503	STRIP2	SO:0001583	missense	0			-	HGNC	AB032996	CCDS34752.1, CCDS47709.1	7q32.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000128578	ENSG00000128578			22209	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog B (yeast)"""		"""family with sequence similarity 40, member B"""	FAM40B		22782902, 22298706, 18782753	Standard	NM_020704		Approved	KIAA1170, FAR11B	uc011koy.2	Q9ULQ0	OTTHUMG00000157695	ENST00000249344.2:c.1589C>A	7.37:g.129103922C>A	ENSP00000249344:p.Thr530Asn	Somatic	0	30	0.00		0.6159915499159303	32	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q8WUZ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3402,pfam_N1221	p.T530N	ENST00000249344.2	37	c.1589	CCDS34752.1	7	.	.	.	.	.	.	.	.	.	.	C	27.8	4.864004	0.91511	.	.	ENSG00000128578	ENST00000249344;ENST00000435494	T;T	0.51325	0.72;0.71	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.72112	0.3420	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.997;0.996	T	0.70963	-0.4729	10	0.38643	T	0.18	-25.8567	18.5982	0.91236	0.0:1.0:0.0:0.0	.	530;530	Q9ULQ0;Q9ULQ0-2	FA40B_HUMAN;.	N	530	ENSP00000249344:T530N;ENSP00000392393:T530N	ENSP00000249344:T530N	T	+	2	0	FAM40B	128891158	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.767000	0.85331	2.746000	0.94184	0.643000	0.83706	ACC	-	pfam_DUF3402		0.478	STRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRIP2	protein_coding	OTTHUMT00000349418.1	C	NM_001134336	-		129103922	+1	no_errors	ENST00000249344	ensembl	human	known	74_37	missense	SNP	1.000	A
TRPM5	29850	genome.wustl.edu	37	11	2437219	2437219	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr11:2437219G>T	ENST00000155858.6	-	8	1053	c.1045C>A	c.(1045-1047)Ctg>Atg	p.L349M	TRPM5_ENST00000452833.1_Missense_Mutation_p.L351M|TRPM5_ENST00000528453.1_Missense_Mutation_p.L349M|TRPM5_ENST00000533060.1_Missense_Mutation_p.L349M	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		AGCTCATCCAGATAGTCCTGA	0.647																																					NSCLC(1;49 61 17205 18850 43201)												0								ENSG00000070985						80.0	53.0	62.0					11																	2437219		2187	4293	6480	TRPM5	SO:0001583	missense	0			-	HGNC	AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.1045C>A	11.37:g.2437219G>T	ENSP00000155858:p.Leu349Met	Somatic	0	30	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Ankyrin_rpt-contain_dom	p.L351M	ENST00000155858.6	37	c.1051	CCDS31340.1	11	.	.	.	.	.	.	.	.	.	.	G	17.52	3.410813	0.62399	.	.	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453;ENST00000437542	T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;-0.37	3.93	3.0	0.34707	.	0.000000	0.56097	D	0.000022	T	0.76926	0.4056	M	0.68317	2.08	0.42835	D	0.994035	D;D;D	0.89917	1.0;1.0;0.983	D;D;P	0.78314	0.991;0.991;0.885	T	0.77046	-0.2733	10	0.44086	T	0.13	-6.5666	11.454	0.50169	0.0963:0.0:0.9037:0.0	.	349;351;349	E9PRW0;Q9NZQ8-2;Q9NZQ8	.;.;TRPM5_HUMAN	M	343;349;351;349;349;349	ENSP00000434383:L343M;ENSP00000155858:L349M;ENSP00000387965:L351M;ENSP00000434121:L349M;ENSP00000436809:L349M	ENSP00000155858:L349M	L	-	1	2	TRPM5	2393795	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	3.621000	0.54210	2.219000	0.72066	0.491000	0.48974	CTG	-	superfamily_Ankyrin_rpt-contain_dom		0.647	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPM5	protein_coding	OTTHUMT00000027378.1	G	NM_014555	-		2437219	-1	no_errors	ENST00000452833	ensembl	human	known	74_37	missense	SNP	1.000	T
CSF2RB	1439	genome.wustl.edu	37	22	37334065	37334065	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:37334065G>C	ENST00000403662.3	+	14	2437	c.2215G>C	c.(2215-2217)Gac>Cac	p.D739H	CSF2RB_ENST00000262825.5_Missense_Mutation_p.D745H|CSF2RB_ENST00000406230.1_Missense_Mutation_p.D745H|CSF2RB_ENST00000536485.1_Missense_Mutation_p.D686H			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	739					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	CCTCCCCTCAGACCAGACCCC	0.612																																																	0								ENSG00000100368						57.0	64.0	61.0					22																	37334065		2203	4300	6503	CSF2RB	SO:0001583	missense	0			-	HGNC	M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.2215G>C	22.37:g.37334065G>C	ENSP00000384053:p.Asp739His	Somatic	0	30	0.00		0.6159915499159303	16	5.88	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	102	32	75.56	Q5JZI1|Q6ICE0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_IL3_rcpt_beta,pfam_Fibronectin_type3,pfam_IL-6_rcpt_alpha-bd,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.D745H	ENST00000403662.3	37	c.2233	CCDS13936.1	22	.	.	.	.	.	.	.	.	.	.	G	10.05	1.243148	0.22796	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000536485	D;D;D;D	0.92099	-2.46;-2.97;-2.97;-2.97	5.16	2.98	0.34508	.	0.841308	0.10137	N	0.711347	D	0.90212	0.6940	M	0.63428	1.95	0.09310	N	1	B;B	0.29508	0.246;0.159	B;B	0.29663	0.105;0.028	T	0.79417	-0.1812	10	0.39692	T	0.17	-7.7796	11.5954	0.50970	0.0:0.4018:0.5982:0.0	.	745;739	P32927-2;P32927	.;IL3RB_HUMAN	H	739;739;745;745;686	ENSP00000384053:D739H;ENSP00000262825:D745H;ENSP00000385271:D745H;ENSP00000440003:D686H	ENSP00000262825:D745H	D	+	1	0	CSF2RB	35664011	0.096000	0.21769	0.001000	0.08648	0.190000	0.23558	1.810000	0.38932	0.513000	0.28278	0.555000	0.69702	GAC	-	pirsf_IL3_rcpt_beta		0.612	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF2RB	protein_coding	OTTHUMT00000318854.1	G	NM_000395	-		37334065	+1	no_errors	ENST00000262825	ensembl	human	known	74_37	missense	SNP	0.001	C
ARHGAP27	201176	genome.wustl.edu	37	17	43472839	43472839	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr17:43472839T>G	ENST00000428638.1	-	17	2652	c.2653A>C	c.(2653-2655)Atc>Ctc	p.I885L	ARHGAP27_ENST00000582826.1_5'Flank|ARHGAP27_ENST00000532038.1_Missense_Mutation_p.I663L|ARHGAP27_ENST00000376922.2_Missense_Mutation_p.I544L|CTB-39G8.3_ENST00000592389.1_RNA|ARHGAP27_ENST00000532891.2_Missense_Mutation_p.I863L|ARHGAP27_ENST00000442348.1_Missense_Mutation_p.I858L|ARHGAP27_ENST00000528384.1_Missense_Mutation_p.I517L|ARHGAP27_ENST00000455881.1_Missense_Mutation_p.I544L			Q6ZUM4	RHG27_HUMAN	Rho GTPase activating protein 27	885	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of Rac GTPase activity (GO:0032855)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|SH3 domain binding (GO:0017124)			endometrium(4)|large_intestine(9)|lung(3)|skin(1)	17	Renal(3;0.0405)					GGCGGGAAGATGTCCGCGCAC	0.687											OREG0024481	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000159314						23.0	19.0	21.0					17																	43472839		2184	4267	6451	ARHGAP27	SO:0001583	missense	0			-	HGNC	AK125535	CCDS11498.1, CCDS74082.1	17q21.31	2013-01-10			ENSG00000159314	ENSG00000159314		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	31813	protein-coding gene	gene with protein product		610591	"""SH3 domain containing 20"""	SH3D20		15147912	Standard	NM_199282		Approved	CAMGAP1, FLJ43547, SH3P20	uc002iix.3	Q6ZUM4	OTTHUMG00000166982	ENST00000428638.1:c.2653A>C	17.37:g.43472839T>G	ENSP00000403323:p.Ile885Leu	Somatic	0	29	0.00	916	0.6159915499159303	16	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	18	45.71	A4FU35|A8K3N5|C9JTF3|Q494U0|Q6NWZ8|Q8WY58	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_WW_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_WW_dom,smart_WW_dom,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_WW_dom,pfscan_RhoGAP_dom	p.I885L	ENST00000428638.1	37	c.2653		17	.	.	.	.	.	.	.	.	.	.	T	13.33	2.204940	0.38905	.	.	ENSG00000159314	ENST00000532038;ENST00000376922;ENST00000528384;ENST00000532891;ENST00000428638;ENST00000442348;ENST00000455881	T;T;T;T;T;T;T	0.11604	2.76;2.76;2.76;2.76;2.76;2.76;2.76	4.45	3.35	0.38373	Rho GTPase-activating protein domain (2);Rho GTPase activation protein (1);	0.225301	0.36778	N	0.002415	T	0.23249	0.0562	L	0.53249	1.67	0.80722	D	1	B;P	0.47962	0.069;0.903	B;D	0.72075	0.167;0.976	T	0.01212	-1.1417	10	0.28530	T	0.3	.	8.3321	0.32193	0.0:0.0965:0.0:0.9035	.	858;885	F8WBX1;Q6ZUM4	.;RHG27_HUMAN	L	663;544;517;863;885;858;544	ENSP00000432762:I663L;ENSP00000366121:I544L;ENSP00000431591:I517L;ENSP00000433942:I863L;ENSP00000403323:I885L;ENSP00000409330:I858L;ENSP00000408235:I544L	ENSP00000366121:I544L	I	-	1	0	ARHGAP27	40828622	1.000000	0.71417	0.997000	0.53966	0.300000	0.27592	1.299000	0.33424	0.729000	0.32403	0.443000	0.29094	ATC	-	superfamily_Rho_GTPase_activation_prot,pfscan_RhoGAP_dom		0.687	ARHGAP27-202	KNOWN	basic	protein_coding	ARHGAP27	protein_coding		T	NM_199282	-		43472839	-1	no_errors	ENST00000428638	ensembl	human	known	74_37	missense	SNP	1.000	G
TMEM169	92691	genome.wustl.edu	37	2	216965176	216965176	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:216965176A>T	ENST00000295658.4	+	3	1012	c.805A>T	c.(805-807)Agc>Tgc	p.S269C	TMEM169_ENST00000454545.1_Missense_Mutation_p.S269C|TMEM169_ENST00000406027.2_Missense_Mutation_p.S269C|TMEM169_ENST00000437356.2_Missense_Mutation_p.S269C	NM_001142311.1|NM_001142312.1|NM_138390.3	NP_001135783.1|NP_001135784.1|NP_612399.1	Q96HH4	TM169_HUMAN	transmembrane protein 169	269						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)	13		Renal(323;0.0651)		Epithelial(149;6.44e-06)|all cancers(144;0.000398)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTCTCCCTACAGCATTGTGGA	0.537																																																	0								ENSG00000163449						116.0	110.0	112.0					2																	216965176		2203	4300	6503	TMEM169	SO:0001583	missense	0			-	HGNC	AK091582	CCDS2401.1	2q35	2008-02-05			ENSG00000163449	ENSG00000163449			25130	protein-coding gene	gene with protein product						12477932	Standard	NM_001142310		Approved	FLJ34263	uc002vfv.4	Q96HH4	OTTHUMG00000133053	ENST00000295658.4:c.805A>T	2.37:g.216965176A>T	ENSP00000295658:p.Ser269Cys	Somatic	0	31	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	10	52.38	B2R8W6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S269C	ENST00000295658.4	37	c.805	CCDS2401.1	2	.	.	.	.	.	.	.	.	.	.	A	23.7	4.442766	0.83993	.	.	ENSG00000163449	ENST00000454545;ENST00000437356;ENST00000295658;ENST00000406027	.	.	.	4.99	4.99	0.66335	.	0.038528	0.85682	D	0.000000	T	0.75496	0.3857	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75819	-0.3183	8	.	.	.	-19.0687	13.9978	0.64414	1.0:0.0:0.0:0.0	.	269	Q96HH4	TM169_HUMAN	C	269	.	.	S	+	1	0	TMEM169	216673421	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.115000	0.94336	2.078000	0.62432	0.533000	0.62120	AGC	-	NULL		0.537	TMEM169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM169	protein_coding	OTTHUMT00000256666.2	A	NM_138390	-		216965176	+1	no_errors	ENST00000295658	ensembl	human	known	74_37	missense	SNP	1.000	T
CCDC167	154467	genome.wustl.edu	37	6	37451009	37451009	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr6:37451009C>A	ENST00000373408.3	-	4	305	c.247G>T	c.(247-249)Gcc>Tcc	p.A83S		NM_138493.2	NP_612502.1	Q9P0B6	CC167_HUMAN	coiled-coil domain containing 167	83						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(2)|skin(1)	6						ATAAAGATGGCCACAGAGAGC	0.542																																																	0								ENSG00000198937						243.0	204.0	217.0					6																	37451009		2203	4300	6503	CCDC167	SO:0001583	missense	0			-	HGNC		CCDS34441.1	6p21.2	2011-07-04	2011-07-04	2011-07-04	ENSG00000198937	ENSG00000198937			21239	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 129"""	C6orf129			Standard	NM_138493		Approved	dJ153P14.2	uc003ont.3	Q9P0B6	OTTHUMG00000014625	ENST00000373408.3:c.247G>T	6.37:g.37451009C>A	ENSP00000362507:p.Ala83Ser	Somatic	0	32	0.00		0.6159915499159303	157	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q5T7F7|Q9BTQ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A83S	ENST00000373408.3	37	c.247	CCDS34441.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.2|20.2	3.954335|3.954335	0.73902|0.73902	.|.	.|.	ENSG00000198937|ENSG00000198937	ENST00000373408|ENST00000373405;ENST00000411755	.|.	.|.	.|.	5.25|5.25	5.25|5.25	0.73442|0.73442	.|.	.|1.106660	.|0.06595	.|N	.|0.752702	T|T	0.66752|0.66752	0.2821|0.2821	.|.	.|.	.|.	0.53005|0.53005	D|D	0.999967|0.999967	D|.	0.76494|.	0.999|.	D|.	0.83275|.	0.996|.	T|T	0.59085|0.59085	-0.7520|-0.7520	7|6	0.66056|0.51188	D|T	0.02|0.08	-7.5774|-7.5774	15.6895|15.6895	0.77439|0.77439	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	83|.	Q9P0B6|.	CC167_HUMAN|.	S|V	83|65	.|.	ENSP00000362507:A83S|ENSP00000362504:G65V	A|G	-|-	1|2	0|0	CCDC167|CCDC167	37558987|37558987	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	2.983000|2.983000	0.49345|0.49345	2.744000|2.744000	0.94065|0.94065	0.561000|0.561000	0.74099|0.74099	GCC|GGC	-	NULL		0.542	CCDC167-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC167	protein_coding	OTTHUMT00000040417.1	C	NM_138493	-		37451009	-1	no_errors	ENST00000373408	ensembl	human	known	74_37	missense	SNP	1.000	A
SNRPD2	6633	genome.wustl.edu	37	19	46190817	46190817	+	Silent	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:46190817G>T	ENST00000342669.3	-	3	795	c.351C>A	c.(349-351)ggC>ggA	p.G117G	SNRPD2_ENST00000588301.1_Silent_p.G117G|SNRPD2_ENST00000585392.1_Silent_p.G53G|SNRPD2_ENST00000590212.1_3'UTR|SNRPD2_ENST00000587367.1_Silent_p.G107G|SNRPD2_ENST00000588599.1_Silent_p.G107G|SNRPD2_ENST00000391932.3_Silent_p.G107G	NM_004597.5	NP_004588.1	P62316	SMD2_HUMAN	small nuclear ribonucleoprotein D2 polypeptide 16.5kDa	117					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|spliceosomal snRNP assembly (GO:0000387)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(1)|lung(2)	4		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00546)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.194)		GCCCCTACTTGCCGGCGATGA	0.522																																																	0								ENSG00000125743						66.0	61.0	63.0					19																	46190817		2203	4300	6503	SNRPD2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS33053.1, CCDS54281.1	19q13.2-q13.3	2011-10-11	2002-08-29		ENSG00000125743	ENSG00000125743			11159	protein-coding gene	gene with protein product	"""snRNP core protein D2"""	601061	"""small nuclear ribonucleoprotein D2 polypeptide (16.5kD)"""	SNRPD1		7527560, 1701240	Standard	NM_004597		Approved	Sm-D2	uc002pcw.3	P62316		ENST00000342669.3:c.351C>A	19.37:g.46190817G>T		Somatic	0	43	0.00		0.6159915499159303	1039	0.19	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.51	A8K797|J3KPM5|P43330	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	p.G117	ENST00000342669.3	37	c.351	CCDS33053.1	19																																																																																			-	superfamily_LSM_dom		0.522	SNRPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRPD2	protein_coding	OTTHUMT00000459648.1	G	NM_004597	-		46190817	-1	no_errors	ENST00000342669	ensembl	human	known	74_37	silent	SNP	1.000	T
LCT	3938	genome.wustl.edu	37	2	136570168	136570168	+	Missense_Mutation	SNP	C	C	T	rs146706415	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:136570168C>T	ENST00000264162.2	-	7	2076	c.2066G>A	c.(2065-2067)cGc>cAc	p.R689H	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	689	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GCTGATGAGGCGGGAGGTGTA	0.557													C|||	2	0.000399361	0.0015	0.0	5008	,	,		20285	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000115850	C	HIS/ARG	4,4402	6.2+/-15.9	0,4,2199	98.0	90.0	93.0		2066	2.5	1.0	2	dbSNP_134	93	0,8600		0,0,4300	yes	missense	LCT	NM_002299.2	29	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	possibly-damaging	689/1928	136570168	4,13002	2203	4300	6503	LCT	SO:0001583	missense	0			GMAF=0.0005	HGNC	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.2066G>A	2.37:g.136570168C>T	ENSP00000264162:p.Arg689His	Somatic	0	33	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	9	64.29	Q4ZG58	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.R689H	ENST00000264162.2	37	c.2066	CCDS2178.1	2	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	16.51	3.144457	0.57044	9.08E-4	0.0	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.34072	1.38	5.49	2.55	0.30701	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.316283	0.34725	N	0.003738	T	0.29882	0.0747	L	0.45698	1.435	0.44816	D	0.997826	P	0.45715	0.865	B	0.43194	0.411	T	0.02713	-1.1120	10	0.37606	T	0.19	-14.8521	7.055	0.25093	0.2448:0.6204:0.0:0.1348	.	689	P09848	LPH_HUMAN	H	689;121	ENSP00000264162:R689H	ENSP00000264162:R689H	R	-	2	0	LCT	136286638	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.562000	0.36353	0.683000	0.31428	0.655000	0.94253	CGC	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1		0.557	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	protein_coding	OTTHUMT00000254657.1	C	NM_002299	rs146706415		136570168	-1	no_errors	ENST00000264162	ensembl	human	known	74_37	missense	SNP	1.000	T
CEP97	79598	genome.wustl.edu	37	3	101481976	101481976	+	Intron	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr3:101481976C>T	ENST00000341893.3	+	10	2645				CEP97_ENST00000494050.1_Intron|CEP97_ENST00000327230.4_Silent_p.P639P			Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa						cell projection organization (GO:0030030)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)				cervix(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29						ccatattgcccaggccggtct	0.378																																																	0								ENSG00000182504																																			CEP97	SO:0001627	intron_variant	0			-	HGNC	AL833269	CCDS2944.1	3q12.3	2014-02-20	2008-01-08	2008-01-08	ENSG00000182504	ENSG00000182504			26244	protein-coding gene	gene with protein product		615864	"""leucine-rich repeats and IQ motif containing 2"""	LRRIQ2		17719545, 18068367	Standard	NM_024548		Approved	FLJ23047	uc003dvk.1	Q8IW35	OTTHUMG00000159162	ENST00000341893.3:c.1893+572C>T	3.37:g.101481976C>T		Somatic	0	74	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	48	35.14	B5MDY8|Q8NA71|Q9H5T9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,pfscan_IQ_motif_EF-hand-BS	p.P639	ENST00000341893.3	37	c.1917	CCDS2944.1	3																																																																																			-	NULL		0.378	CEP97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP97	protein_coding	OTTHUMT00000353597.2	C	NM_024548	-		101481976	+1	no_errors	ENST00000327230	ensembl	human	known	74_37	silent	SNP	0.008	T
UNC93B6	255620	genome.wustl.edu	37	11	71314423	71314423	+	Intron	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr11:71314423G>A	ENST00000343767.3	-	3	2876				KRTAP5-11_ENST00000526239.1_5'Flank|UNC93B6_ENST00000525262.2_RNA																							TGCCACGCCCGGTGCCCCTCG	0.662																																																	0								ENSG00000255562																																			UNC93B6	SO:0001627	intron_variant	0			-	HGNC																												ENST00000343767.3:c.436-12C>T	11.37:g.71314423G>A		Somatic	0	115	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	60	61	49.59		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000343767.3	37	NULL		11																																																																																			-	-		0.662	AP000867.1-201	KNOWN	basic|appris_principal	protein_coding	UNC93B6	protein_coding		G		-		71314423	+1	no_errors	ENST00000525262	ensembl	human	known	74_37	rna	SNP	0.996	A
RIMS2	9699	genome.wustl.edu	37	8	105235954	105235954	+	Silent	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:105235954G>T	ENST00000339750.2	+	1	75	c.75G>T	c.(73-75)ctG>ctT	p.L25L	RIMS2_ENST00000262231.10_Intron|RIMS2_ENST00000406091.3_Intron|RIMS2_ENST00000436393.2_Intron|RIMS2_ENST00000507740.1_Intron			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	0					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GGAGTAGCCTGTCTGCCTCCT	0.662										HNSCC(12;0.0054)																																							0								ENSG00000176406						18.0	18.0	18.0					8																	105235954		875	1991	2866	RIMS2	SO:0001819	synonymous_variant	0			-	HGNC	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000339750.2:c.75G>T	8.37:g.105235954G>T		Somatic	0	71	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	33	35.29	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.L25	ENST00000339750.2	37	c.75		8																																																																																			-	NULL		0.662	RIMS2-201	KNOWN	basic	protein_coding	RIMS2	protein_coding		G	NM_001100117	-		105235954	+1	no_errors	ENST00000339750	ensembl	human	known	74_37	silent	SNP	0.970	T
ZNF225	7768	genome.wustl.edu	37	19	44622637	44622637	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:44622637C>T	ENST00000262894.6	+	4	425	c.145C>T	c.(145-147)Cat>Tat	p.H49Y	ZNF225_ENST00000592780.1_Missense_Mutation_p.H49Y|ZNF225_ENST00000590612.1_Missense_Mutation_p.H49Y	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	49	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				GTTCACAGGGCATCAATCACT	0.378																																																	0								ENSG00000256294						87.0	84.0	85.0					19																	44622637		2203	4300	6503	ZNF225	SO:0001583	missense	0			-	HGNC	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.145C>T	19.37:g.44622637C>T	ENSP00000262894:p.His49Tyr	Somatic	0	90	0.00		0.6159915499159303	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	44	21.43	A8K8S2|Q53F12|Q9NS46|Q9UID8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H49Y	ENST00000262894.6	37	c.145	CCDS46100.1	19	.	.	.	.	.	.	.	.	.	.	C	9.249	1.040230	0.19669	.	.	ENSG00000256294	ENST00000262894;ENST00000544184	T	0.00724	5.78	1.77	0.707	0.18139	Krueppel-associated box (3);	.	.	.	.	T	0.00468	0.0015	N	0.10945	0.07	0.09310	N	1	P	0.50528	0.936	B	0.43889	0.435	T	0.23119	-1.0197	9	0.02654	T	1	.	4.0899	0.09965	0.0:0.779:0.0:0.221	.	49	Q9UK10	ZN225_HUMAN	Y	49;13	ENSP00000262894:H49Y	ENSP00000262894:H49Y	H	+	1	0	ZNF225	49314477	0.000000	0.05858	0.001000	0.08648	0.039000	0.13416	-0.089000	0.11180	0.294000	0.22547	0.555000	0.69702	CAT	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.378	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF225	protein_coding	OTTHUMT00000460581.1	C		-		44622637	+1	no_errors	ENST00000262894	ensembl	human	known	74_37	missense	SNP	0.002	T
CAPRIN1	4076	genome.wustl.edu	37	11	34111815	34111815	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr11:34111815G>T	ENST00000341394.4	+	13	1572	c.1383G>T	c.(1381-1383)aaG>aaT	p.K461N	CAPRIN1_ENST00000529307.1_Missense_Mutation_p.K380N|CAPRIN1_ENST00000530820.1_Missense_Mutation_p.K461N|CAPRIN1_ENST00000533657.1_3'UTR|CAPRIN1_ENST00000532820.1_Missense_Mutation_p.K461N|CAPRIN1_ENST00000389645.3_Missense_Mutation_p.K461N	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	461					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				GACCACAGAAGGAACCAATTG	0.428																																																	0								ENSG00000135387						131.0	112.0	118.0					11																	34111815		2202	4298	6500	CAPRIN1	SO:0001583	missense	0			-	HGNC	BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.1383G>T	11.37:g.34111815G>T	ENSP00000340329:p.Lys461Asn	Somatic	0	64	0.00		0.6159915499159303	344	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Caprin-1_C	p.K461N	ENST00000341394.4	37	c.1383	CCDS31453.1	11	.	.	.	.	.	.	.	.	.	.	G	12.07	1.826814	0.32329	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000532820;ENST00000530820;ENST00000529307	T;T;T;T;T	0.22539	1.95;1.95;1.95;1.95;1.95	5.72	0.695	0.18070	.	0.205046	0.50627	D	0.000110	T	0.13670	0.0331	L	0.36672	1.1	0.49915	D	0.999839	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.002	T	0.13818	-1.0495	10	0.17369	T	0.5	.	9.8784	0.41218	0.5196:0.0:0.4804:0.0	.	461;461	Q14444;Q14444-2	CAPR1_HUMAN;.	N	461;461;461;461;380	ENSP00000340329:K461N;ENSP00000374296:K461N;ENSP00000434150:K461N;ENSP00000434204:K461N;ENSP00000431581:K380N	ENSP00000340329:K461N	K	+	3	2	CAPRIN1	34068391	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.000000	0.29770	0.357000	0.24183	0.650000	0.86243	AAG	-	pfam_Caprin-1_C		0.428	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	CAPRIN1	protein_coding	OTTHUMT00000388680.2	G	NM_005898	-		34111815	+1	no_errors	ENST00000341394	ensembl	human	known	74_37	missense	SNP	0.997	T
IGSF1	3547	genome.wustl.edu	37	X	130408744	130408744	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:130408744G>C	ENST00000361420.3	-	18	3659	c.3580C>G	c.(3580-3582)Cta>Gta	p.L1194V	IGSF1_ENST00000370903.3_Missense_Mutation_p.L1199V|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370910.1_Missense_Mutation_p.L1185V|IGSF1_ENST00000370904.1_Missense_Mutation_p.L1185V			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1194	Ig-like C2-type 12.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						TCATGTTCTAGGACAAATTCA	0.502																																																	0								ENSG00000147255						168.0	165.0	166.0					X																	130408744		2203	4300	6503	IGSF1	SO:0001583	missense	0			-	HGNC	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3580C>G	X.37:g.130408744G>C	ENSP00000355010:p.Leu1194Val	Somatic	0	81	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	93	10.58	B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L1199V	ENST00000361420.3	37	c.3595	CCDS14629.1	X	.	.	.	.	.	.	.	.	.	.	G	14.63	2.594177	0.46214	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.17528	2.27;2.27;2.27;2.27	5.35	3.59	0.41128	Immunoglobulin-like fold (1);	0.168825	0.28296	N	0.015878	T	0.44350	0.1289	M	0.89968	3.075	0.29624	N	0.845943	D;D;D	0.69078	0.979;0.997;0.992	D;D;D	0.76071	0.92;0.976;0.987	T	0.48896	-0.8994	10	0.87932	D	0	.	7.462	0.27300	0.2039:0.0:0.7961:0.0	.	1185;638;1194	Q8N6C5-2;C9JP68;Q8N6C5	.;.;IGSF1_HUMAN	V	1185;1194;1185;1199	ENSP00000359947:L1185V;ENSP00000355010:L1194V;ENSP00000359941:L1185V;ENSP00000359940:L1199V	ENSP00000355010:L1194V	L	-	1	2	IGSF1	130236425	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	1.370000	0.34238	0.566000	0.29273	0.594000	0.82650	CTA	-	smart_Ig_sub,smart_Ig_sub2		0.502	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	protein_coding	OTTHUMT00000058288.1	G		-		130408744	-1	no_errors	ENST00000370903	ensembl	human	known	74_37	missense	SNP	0.994	C
EMID1	129080	genome.wustl.edu	37	22	29629378	29629378	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:29629378G>T	ENST00000404820.3	+	9	961	c.834G>T	c.(832-834)ttG>ttT	p.L278F	EMID1_ENST00000334018.6_Missense_Mutation_p.L278F|EMID1_ENST00000484039.1_3'UTR|EMID1_ENST00000404755.3_Missense_Mutation_p.L278F			Q96A84	EMID1_HUMAN	EMI domain containing 1	276	Collagen-like.					collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(2)|skin(3)	12						GAGACCCATTGCTGTCCAACA	0.592																																																	0								ENSG00000186998						196.0	202.0	200.0					22																	29629378		2203	4300	6503	EMID1	SO:0001583	missense	0			-	HGNC	AJ416090	CCDS33630.1	22q12.2	2009-08-04			ENSG00000186998	ENSG00000186998		"""EMI domain containing"""	18036	protein-coding gene	gene with protein product	"""emilin and multimerin-domain containing protein 1"", ""putative emu1"""	608926				12221002	Standard	NM_001267895		Approved	EMU1, hEmu1, EMI5	uc003aem.4	Q96A84	OTTHUMG00000151013	ENST00000404820.3:c.834G>T	22.37:g.29629378G>T	ENSP00000384452:p.Leu278Phe	Somatic	0	54	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B0QYK6|Q6ICG1|Q86SS7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_EMI_domain,pfscan_EMI_domain	p.L278F	ENST00000404820.3	37	c.834		22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.013|0.013	-1.640826|-1.640826	0.00799|0.00799	.|.	.|.	ENSG00000186998|ENSG00000186998	ENST00000433143|ENST00000334018;ENST00000429226;ENST00000404755;ENST00000404820	.|D;T;D;D	.|0.90504	.|-2.68;0.84;-2.46;-2.63	5.24|5.24	-3.87|-3.87	0.04218|0.04218	.|.	.|1.630380	.|0.04769	.|N	.|0.427673	T|T	0.80670|0.80670	0.4667|0.4667	N|N	0.17564|0.17564	0.495|0.495	0.18873|0.18873	N|N	0.999988|0.999988	.|B;B;B;B	.|0.15930	.|0.009;0.001;0.009;0.015	.|B;B;B;B	.|0.14578	.|0.005;0.002;0.005;0.011	T|T	0.66040|0.66040	-0.6022|-0.6022	5|10	.|0.40728	.|T	.|0.16	0.2213|0.2213	5.649|5.649	0.17606|0.17606	0.4149:0.0:0.431:0.1541|0.4149:0.0:0.431:0.1541	.|.	.|278;278;276;278	.|B0QYK4;B0QYK5;Q96A84;Q96A84-3	.|.;.;EMID1_HUMAN;.	F|F	141|278;199;278;278	.|ENSP00000335481:L278F;ENSP00000403816:L199F;ENSP00000385414:L278F;ENSP00000384452:L278F	.|ENSP00000335481:L278F	C|L	+|+	2|3	0|2	EMID1|EMID1	27959378|27959378	0.499000|0.499000	0.26083|0.26083	0.021000|0.021000	0.16686|0.16686	0.085000|0.085000	0.17905|0.17905	-0.437000|-0.437000	0.06914|0.06914	-0.689000|-0.689000	0.05149|0.05149	-0.982000|-0.982000	0.02568|0.02568	TGC|TTG	-	NULL		0.592	EMID1-002	NOVEL	basic|appris_principal	protein_coding	EMID1	protein_coding	OTTHUMT00000321075.1	G	NM_133455	-		29629378	+1	no_errors	ENST00000334018	ensembl	human	known	74_37	missense	SNP	0.043	T
DCX	1641	genome.wustl.edu	37	X	110653472	110653472	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:110653472G>T	ENST00000338081.3	-	2	569	c.398C>A	c.(397-399)gCc>gAc	p.A133D	DCX_ENST00000356220.3_Missense_Mutation_p.A52D|DCX_ENST00000488120.1_Missense_Mutation_p.A52D|DCX_ENST00000496551.1_5'UTR|DCX_ENST00000371993.2_Missense_Mutation_p.A52D|DCX_ENST00000356915.2_Missense_Mutation_p.A52D	NM_000555.3	NP_000546.2	O43602	DCX_HUMAN	doublecortin	133					axon extension (GO:0048675)|axon guidance (GO:0007411)|brain development (GO:0007420)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neuron migration (GO:0001764)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuron projection (GO:0043005)	microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|skin(6)|upper_aerodigestive_tract(1)	41						TACCTTCTTGGCTTTCTTCTC	0.552																																																	0								ENSG00000077279						289.0	215.0	240.0					X																	110653472		2203	4300	6503	DCX	SO:0001583	missense	0			-	HGNC	AF040254	CCDS14556.1, CCDS14557.1, CCDS14558.1	Xq22.3-q23	2008-08-01	2008-08-01		ENSG00000077279	ENSG00000077279			2714	protein-coding gene	gene with protein product	"""doublecortex"""	300121	"""doublecortex; lissencephaly, X-linked (doublecortin)"""			9489699, 9489700	Standard	NM_178151		Approved	SCLH, DC, LISX, DBCN, XLIS	uc004epd.3	O43602	OTTHUMG00000022204	ENST00000338081.3:c.398C>A	X.37:g.110653472G>T	ENSP00000337697:p.Ala133Asp	Somatic	0	75	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	54	25.00	A6NFY6|A9Z1V8|D3DUY8|D3DUY9|D3DUZ0|O43911|Q5JYZ5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Doublecortin_dom,smart_Doublecortin_dom,pirsf_Doublecortin_chordata,pfscan_Doublecortin_dom	p.A133D	ENST00000338081.3	37	c.398	CCDS14556.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.2|23.2	4.389603|4.389603	0.82902|0.82902	.|.	.|.	ENSG00000077279|ENSG00000077279	ENST00000356915;ENST00000371993;ENST00000338081;ENST00000356220;ENST00000488120;ENST00000468911|ENST00000358070	D;D;D;D;D;D|.	0.94576|.	-2.4;-2.4;-2.4;-2.4;-2.4;-3.46|.	5.37|5.37	4.51|4.51	0.55191|0.55191	Doublecortin domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.58206|0.58206	0.2106|0.2106	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	D;D|.	0.63880|.	0.993;0.993|.	D;D|.	0.70016|.	0.967;0.956|.	T|T	0.54735|0.54735	-0.8249|-0.8249	10|5	0.87932|.	D|.	0|.	.|.	13.0652|13.0652	0.59030|0.59030	0.0785:0.0:0.9214:0.0|0.0785:0.0:0.9214:0.0	.|.	121;133|.	B4DM53;O43602|.	.;DCX_HUMAN|.	D|T	52;52;133;52;52;52|125	ENSP00000349385:A52D;ENSP00000361061:A52D;ENSP00000337697:A133D;ENSP00000348553:A52D;ENSP00000419861:A52D;ENSP00000418811:A52D|.	ENSP00000337697:A133D|.	A|P	-|-	2|1	0|0	DCX|DCX	110540128|110540128	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.657000|9.657000	0.98554|0.98554	1.238000|1.238000	0.43771|0.43771	0.513000|0.513000	0.50165|0.50165	GCC|CCA	-	smart_Doublecortin_dom,pirsf_Doublecortin_chordata		0.552	DCX-006	KNOWN	basic|CCDS	protein_coding	DCX	protein_coding	OTTHUMT00000357058.1	G	NM_178153	-		110653472	-1	no_errors	ENST00000338081	ensembl	human	known	74_37	missense	SNP	1.000	T
ATRAID	51374	genome.wustl.edu	37	2	27435287	27435287	+	Silent	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:27435287C>A	ENST00000606999.1	+	1	109	c.51C>A	c.(49-51)gcC>gcA	p.A17A	ATRAID_ENST00000405489.3_5'UTR|SLC5A6_ENST00000408041.1_5'Flank|SLC5A6_ENST00000310574.3_5'Flank|ATRAID_ENST00000380171.3_Silent_p.A72A	NM_001170795.1	NP_001164266.1	Q6UW56	ARAID_HUMAN	all-trans retinoic acid-induced differentiation factor	17					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)											CCTGGGCTGCCGCCCTGCTCC	0.692																																																	0								ENSG00000138085						12.0	14.0	13.0					2																	27435287		2160	4239	6399	ATRAID	SO:0001819	synonymous_variant	0			-	HGNC	BC021237	CCDS1741.1, CCDS46243.1, CCDS62877.1	2p23.3	2012-08-01	2012-07-30	2012-07-30	ENSG00000138085	ENSG00000138085			24090	protein-coding gene	gene with protein product	"""apoptosis-related protein 3"""		"""chromosome 2 open reading frame 28"""	C2orf28		17524364, 21723284	Standard	NM_016085		Approved	HSPC013, p18, APR3	uc002rjf.3	Q6UW56	OTTHUMG00000128405	ENST00000606999.1:c.51C>A	2.37:g.27435287C>A		Somatic	0	52	0.00		0.6159915499159303	360	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	38	11.63	A8C1S2|A8K779|Q96FF6|Q96RT2|Q9Y2R7|Q9Y5L7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfscan_EG-like_dom	p.A72	ENST00000606999.1	37	c.216		2																																																																																			-	NULL		0.692	ATRAID-007	NOVEL	basic|appris_principal	protein_coding	ATRAID	protein_coding	OTTHUMT00000470709.1	C	NM_016085	-		27435287	+1	no_errors	ENST00000380171	ensembl	human	known	74_37	silent	SNP	0.000	A
ZFYVE19	84936	genome.wustl.edu	37	15	41099899	41099900	+	In_Frame_Ins	INS	-	-	GGGGCGGGGCGGGGC	rs371684343|rs200042011|rs142730574|rs369585041	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr15:41099899_41099900insGGGGCGGGGCGGGGC	ENST00000355341.4	+	1	613_614	c.112_113insGGGGCGGGGCGGGGC	c.(112-114)tgg>tGGGGCGGGGCGGGGCgg	p.38_39insGGAGR	DNAJC17_ENST00000220496.4_5'Flank|ZFYVE19_ENST00000563530.1_3'UTR|ZFYVE19_ENST00000299173.10_In_Frame_Ins_p.38_39insGGAGR|ZFYVE19_ENST00000570108.1_Intron|ZFYVE19_ENST00000336455.5_Intron|ZFYVE19_ENST00000564258.1_Intron	NM_001077268.1	NP_001070736.1	Q96K21	ANCHR_HUMAN	zinc finger, FYVE domain containing 19	38					abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis checkpoint (GO:0031565)|negative regulation of cytokinesis (GO:0032466)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|midbody (GO:0030496)	phosphatidylinositol-3-phosphate binding (GO:0032266)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		AGTGGGCGTGTGgggcggggca	0.718																																																	0								ENSG00000166140																																			ZFYVE19	SO:0001652	inframe_insertion	0				HGNC	AK027746	CCDS42025.1, CCDS58353.1, CCDS58354.1, CCDS58355.1	15q14	2008-05-02				ENSG00000166140		"""Zinc fingers, FYVE domain containing"""	20758	protein-coding gene	gene with protein product							Standard	NM_001077268		Approved	FLJ14840	uc031qrk.1	Q96K21		Exception_encountered	15.37:g.41099899_41099900insGGGGCGGGGCGGGGC	ENSP00000347498:p.Trp38_Gly39insGlyGlyAlaGlyArg	Somatic	NA	NA	NA		0.6159915499159303	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KVB2|C9JNF4|H3BUF9|Q86WC2|Q8WU96	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.42in_frame_insGRGGA	ENST00000355341.4	37	c.112_113	CCDS42025.1	15																																																																																			-	NULL		0.718	ZFYVE19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFYVE19	protein_coding	OTTHUMT00000418996.1	-	NM_032850			41099900	+1	no_errors	ENST00000355341	ensembl	human	known	74_37	in_frame_ins	INS	0.028:0.002	GGGGCGGGGCGGGGC
MAZ	4150	genome.wustl.edu	37	16	29819035	29819035	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr16:29819035C>T	ENST00000322945.6	+	2	1094	c.929C>T	c.(928-930)cCg>cTg	p.P310L	AC009133.14_ENST00000563806.1_RNA|MAZ_ENST00000569978.1_5'Flank|MAZ_ENST00000563402.1_Intron|MAZ_ENST00000219782.6_Missense_Mutation_p.P310L|MAZ_ENST00000568544.1_5'Flank|MAZ_ENST00000545521.1_Missense_Mutation_p.P287L|AC009133.20_ENST00000569039.1_RNA|MAZ_ENST00000568282.1_5'Flank|AC009133.14_ENST00000569981.1_RNA|MAZ_ENST00000562337.1_Intron|MAZ_ENST00000566906.2_Intron|AC009133.15_ENST00000566537.1_RNA	NM_002383.2	NP_002374.2	P56270	MAZ_HUMAN	MYC-associated zinc finger protein (purine-binding transcription factor)	310					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|termination of RNA polymerase II transcription (GO:0006369)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						TACCAGTGCCCGGTGTGCCAG	0.617																																					Colon(72;875 1167 15364 30899 37091)												0								ENSG00000103495						60.0	65.0	63.0					16																	29819035		2132	4250	6382	MAZ	SO:0001583	missense	0			-	HGNC	M93339	CCDS42143.1, CCDS42144.1, CCDS61902.1, CCDS61903.1	16p11.2	2013-01-08			ENSG00000103495	ENSG00000103495		"""Zinc fingers, C2H2-type"""	6914	protein-coding gene	gene with protein product		600999				1567856, 1502157	Standard	NM_001276275		Approved	ZF87, Pur-1, Zif87, ZNF801	uc002dtx.4	P56270	OTTHUMG00000132119	ENST00000322945.6:c.929C>T	16.37:g.29819035C>T	ENSP00000313362:p.Pro310Leu	Somatic	0	44	0.00		0.6159915499159303	494	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A8QJL9|C6G496|G5E927|H3BQD6|Q15703|Q8NFN7|Q99443	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P310L	ENST00000322945.6	37	c.929	CCDS42143.1	16	.	.	.	.	.	.	.	.	.	.	C	13.69	2.313221	0.40895	.	.	ENSG00000103495	ENST00000545521;ENST00000322945;ENST00000219782;ENST00000544343	T;T;T	0.27256	3.22;3.22;1.68	3.12	3.12	0.35913	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.065681	0.64402	D	0.000009	T	0.33059	0.0850	L	0.33137	0.985	0.80722	D	1	D;D;P;D	0.89917	1.0;1.0;0.886;1.0	D;D;P;D	0.70935	0.971;0.971;0.595;0.951	T	0.03503	-1.1030	10	0.41790	T	0.15	-6.8825	7.8686	0.29552	0.247:0.753:0.0:0.0	.	287;75;310;310	C6G496;Q59GP8;P56270;G5E927	.;.;MAZ_HUMAN;.	L	287;310;310;86	ENSP00000443956:P287L;ENSP00000313362:P310L;ENSP00000219782:P310L	ENSP00000219782:P310L	P	+	2	0	MAZ	29726536	0.892000	0.30473	0.995000	0.50966	0.014000	0.08584	1.851000	0.39338	1.464000	0.47987	0.442000	0.29010	CCG	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.617	MAZ-001	KNOWN	basic|CCDS	protein_coding	MAZ	protein_coding	OTTHUMT00000435536.1	C	NM_002383	-		29819035	+1	no_errors	ENST00000219782	ensembl	human	known	74_37	missense	SNP	1.000	T
TANC1	85461	genome.wustl.edu	37	2	160035450	160035450	+	Silent	SNP	C	C	A	rs201404392		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:160035450C>A	ENST00000263635.6	+	14	2523	c.2286C>A	c.(2284-2286)ctC>ctA	p.L762L	TANC1_ENST00000454300.1_Silent_p.L656L	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	762					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						ACGTGGCCCTCGCATCCCTCC	0.547																																																	0								ENSG00000115183						169.0	172.0	171.0					2																	160035450		2007	4157	6164	TANC1	SO:0001819	synonymous_variant	0			-	HGNC	AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.2286C>A	2.37:g.160035450C>A		Somatic	0	40	0.00		0.6159915499159303	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	C9JD88|Q49AI8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,smart_TPR_repeat,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.L762	ENST00000263635.6	37	c.2286	CCDS42766.1	2																																																																																			-	NULL		0.547	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANC1	protein_coding	OTTHUMT00000333135.1	C		-		160035450	+1	no_errors	ENST00000263635	ensembl	human	known	74_37	silent	SNP	0.448	A
PTPRA	5786	genome.wustl.edu	37	20	2945566	2945566	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr20:2945566G>T	ENST00000216877.6	+	5	533	c.133G>T	c.(133-135)Gaa>Taa	p.E45*	PTPRA_ENST00000380393.3_Nonsense_Mutation_p.E45*|PTPRA_ENST00000425918.2_Nonsense_Mutation_p.E56*|PTPRA_ENST00000358719.4_5'UTR|PTPRA_ENST00000399903.2_Nonsense_Mutation_p.E45*|PTPRA_ENST00000318266.5_Nonsense_Mutation_p.E45*|PTPRA_ENST00000356147.3_Nonsense_Mutation_p.E45*	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	45					axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						ACCAGTTAAAGAAGAGGCCAA	0.388																																																	0								ENSG00000132670						103.0	96.0	98.0					20																	2945566		2203	4300	6503	PTPRA	SO:0001587	stop_gained	0			-	HGNC		CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.133G>T	20.37:g.2945566G>T	ENSP00000216877:p.Glu45*	Somatic	0	34	0.00		0.6159915499159303	190	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_Pase_rcpt_a/e-type,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.E56*	ENST00000216877.6	37	c.166	CCDS13039.1	20	.	.	.	.	.	.	.	.	.	.	G	19.98	3.926972	0.73327	.	.	ENSG00000132670	ENST00000380393;ENST00000455631;ENST00000216877;ENST00000399903;ENST00000431048;ENST00000418580;ENST00000425918;ENST00000318266;ENST00000430705;ENST00000356147	.	.	.	4.54	2.54	0.30619	.	0.939771	0.08904	U	0.876794	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	7.7489	0.28886	0.201:0.0:0.799:0.0	.	.	.	.	X	45;45;45;45;45;45;56;45;45;45	.	ENSP00000216877:E45X	E	+	1	0	PTPRA	2893566	1.000000	0.71417	0.997000	0.53966	0.865000	0.49528	1.849000	0.39318	0.448000	0.26722	0.650000	0.86243	GAA	-	pirsf_Tyr_Pase_rcpt_a/e-type		0.388	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTPRA	protein_coding	OTTHUMT00000077682.3	G		-		2945566	+1	no_errors	ENST00000425918	ensembl	human	known	74_37	nonsense	SNP	0.998	T
CLPP	8192	genome.wustl.edu	37	19	6362546	6362546	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:6362546C>A	ENST00000245816.4	+	3	483	c.360C>A	c.(358-360)aaC>aaA	p.N120K	CTB-180A7.3_ENST00000595644.1_RNA|CLPP_ENST00000596605.1_Missense_Mutation_p.N33K|CLPP_ENST00000596149.1_Missense_Mutation_p.N33K	NM_006012.2	NP_006003.1	Q16740	CLPP_HUMAN	caseinolytic mitochondrial matrix peptidase proteolytic subunit	120					protein homooligomerization (GO:0051260)|proteolysis involved in cellular protein catabolic process (GO:0051603)	endopeptidase Clp complex (GO:0009368)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(2)|ovary(2)	6						TGTACATCAACAGCCCTGGTG	0.582																																																	0								ENSG00000125656						135.0	103.0	114.0					19																	6362546		2203	4300	6503	CLPP	SO:0001583	missense	0			-	HGNC	Z50853	CCDS12162.1	19p13.3	2013-09-12	2013-09-12		ENSG00000125656	ENSG00000125656		"""ATPases / AAA-type"""	2084	protein-coding gene	gene with protein product	"""ATP-dependent protease ClpAP (E. coli), proteolytic subunit, human"""	601119	"""ClpP (caseinolytic protease, ATP-dependent, proteolytic subunit, E. coli) homolog"", ""ClpP caseinolytic protease, ATP-dependent, proteolytic subunit homolog (E. coli)"", ""ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli)"""			8543061, 23360988	Standard	NM_006012		Approved		uc002mem.1	Q16740	OTTHUMG00000180779	ENST00000245816.4:c.360C>A	19.37:g.6362546C>A	ENSP00000245816:p.Asn120Lys	Somatic	0	37	0.00		0.6159915499159303	336	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B2R4W5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ClpP/TepA,prints_ClpP	p.N120K	ENST00000245816.4	37	c.360	CCDS12162.1	19	.	.	.	.	.	.	.	.	.	.	C	22.3	4.273317	0.80580	.	.	ENSG00000125656	ENST00000245816	.	.	.	4.69	-0.125	0.13519	.	0.000000	0.85682	D	0.000000	D	0.86887	0.6041	H	0.99225	4.475	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86389	0.1734	9	0.87932	D	0	-53.6226	9.2258	0.37405	0.0:0.5934:0.0:0.4066	.	120	Q16740	CLPP_HUMAN	K	120	.	ENSP00000245816:N120K	N	+	3	2	CLPP	6313546	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.235000	0.43044	0.144000	0.18951	0.563000	0.77884	AAC	-	pfam_ClpP/TepA,prints_ClpP		0.582	CLPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPP	protein_coding	OTTHUMT00000452984.1	C	NM_006012	-		6362546	+1	no_errors	ENST00000245816	ensembl	human	known	74_37	missense	SNP	1.000	A
YEATS2	55689	genome.wustl.edu	37	3	183520323	183520324	+	Intron	INS	-	-	TATATATATACACGTGTA	rs11276625|rs74710373	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr3:183520323_183520324insTATATATATACACGTGTA	ENST00000305135.5	+	26	3697				AC131160.1_ENST00000401347.1_RNA	NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2						chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			atatacacgtgtatatacacac	0.332																																																	0								ENSG00000216166																																			AC131160.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.3503-720->TATATATATACACGTGTA	3.37:g.183520323_183520324insTATATATATACACGTGTA		Somatic	NA	NA	NA		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7E2B9|D3DNS9|Q641P6|Q9NW96	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000305135.5	37	NULL	CCDS43175.1	3																																																																																			-	-		0.332	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216166	protein_coding	OTTHUMT00000346507.2	-	NM_018023			183520324	-1	no_errors	ENST00000401347	ensembl	human	novel	74_37	rna	INS	0.000:0.000	TATATATATACACGTGTA
ZNF578	147660	genome.wustl.edu	37	19	52954520	52954520	+	5'Flank	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:52954520G>A	ENST00000421239.2	+	0	0				ZNF534_ENST00000432303.2_Missense_Mutation_p.G75S|ZNF534_ENST00000301085.4_Missense_Mutation_p.G118S	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		GGAGCCAACCGGCCCAAACTT	0.577																																																	0								ENSG00000198633						4.0	3.0	3.0					19																	52954520		831	1865	2696	ZNF534	SO:0001631	upstream_gene_variant	0			-	HGNC	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468		19.37:g.52954520G>A	Exception_encountered	Somatic	0	73	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	94	16.81	B4DR51|I3L1Y6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.G118S	ENST00000421239.2	37	c.352	CCDS54310.1	19	.	.	.	.	.	.	.	.	.	.	G	6.998	0.554316	0.13374	.	.	ENSG00000198633	ENST00000301085;ENST00000432303	T;T	0.01495	5.59;4.83	0.85	-1.7	0.08159	.	.	.	.	.	T	0.00936	0.0031	.	.	.	0.09310	N	1	P;B	0.45986	0.87;0.0	B;B	0.26310	0.068;0.0	T	0.49485	-0.8935	8	0.35671	T	0.21	.	4.6297	0.12495	0.4461:0.0:0.5539:0.0	.	75;118	Q1T7F6;Q1T7F5	.;.	S	118;75	ENSP00000301085:G118S;ENSP00000409421:G75S	ENSP00000301085:G118S	G	+	1	0	ZNF534	57646332	0.004000	0.15560	0.001000	0.08648	0.006000	0.05464	-1.603000	0.02077	-1.167000	0.02779	-1.328000	0.01277	GGC	-	NULL		0.577	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF534	protein_coding	OTTHUMT00000344298.3	G	NM_152472	-		52954520	+1	no_errors	ENST00000301085	ensembl	human	putative	74_37	missense	SNP	0.001	A
SFTPB	6439	genome.wustl.edu	37	2	85895264	85895266	+	In_Frame_Del	DEL	GCA	GCA	-	rs147057701		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	GCA	GCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:85895264_85895266delGCA	ENST00000519937.2	-	1	60_62	c.41_43delTGC	c.(40-45)ctgccc>ccc	p.L14del	SFTPB_ENST00000393822.3_In_Frame_Del_p.L26del|SFTPB_ENST00000409383.1_In_Frame_Del_p.L26del|SFTPB_ENST00000342375.3_In_Frame_Del_p.L14del			P07988	PSPB_HUMAN	surfactant protein B	14					organ morphogenesis (GO:0009887)|respiratory gaseous exchange (GO:0007585)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)	16						CAGAGCGTGGGCAGCAGCAGCAG	0.64																																																	0								ENSG00000168878		,	56,3532		3,50,1741					,	3.5	0.8		dbSNP_134	24	135,6753		12,111,3321	no	coding,coding	SFTPB	NM_198843.2,NM_000542.3	,	15,161,5062	A1A1,A1R,RR		1.9599,1.5608,1.8232	,	,		191,10285				SFTPB	SO:0001651	inframe_deletion	0				HGNC	J02761	CCDS1983.1, CCDS1983.2	2p12-p11.2	2008-08-26	2008-08-26		ENSG00000168878	ENSG00000168878			10801	protein-coding gene	gene with protein product		178640	"""surfactant, pulmonary-associated protein B"""	SFTP3		2924687, 1346779	Standard	NM_198843		Approved	SP-B	uc002sqh.3	P07988	OTTHUMG00000130181	ENST00000519937.2:c.41_43delTGC	2.37:g.85895273_85895275delGCA	ENSP00000428719:p.Leu14del	Somatic	0	18	0.00		0.6159915499159303	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	15	11.76	Q96R04	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SapB_2,pfam_SapA,pfam_SapB_1,superfamily_Saposin-like,smart_SapA,smart_SaposinB,pfscan_SapA,pfscan_SaposinB,prints_Saposin	p.L26in_frame_del	ENST00000519937.2	37	c.79_77		2																																																																																			-	NULL		0.640	SFTPB-001	KNOWN	alternative_3_UTR|basic|appris_principal	protein_coding	SFTPB	protein_coding	OTTHUMT00000252499.3	GCA	NM_198843			85895266	-1	no_errors	ENST00000393822	ensembl	human	known	74_37	in_frame_del	DEL	0.966:0.981:0.990	-
LAMC1	3915	genome.wustl.edu	37	1	183094418	183094419	+	Intron	INS	-	-	C	rs5779155|rs386368938	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:183094418_183094419insC	ENST00000258341.4	+	15	2904				LAMC1_ENST00000466964.1_3'UTR	NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						gccacatgtgacagcagctacc	0.416													CC|C|CC|deletion	2662	0.53155	0.3313	0.6254	5008	,	,		18182	0.628		0.5636	False		,,,				2504	0.6033																0								ENSG00000135862																																			LAMC1	SO:0001627	intron_variant	0				HGNC	J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.2648-113->C	1.37:g.183094419_183094419dupC		Somatic	0	10	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	9	40.00	Q5VYE7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000258341.4	37	NULL	CCDS1351.1	1																																																																																			-	-		0.416	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	protein_coding	OTTHUMT00000085954.2	-	NM_002293			183094419	+1	no_errors	ENST00000466964	ensembl	human	known	74_37	rna	INS	0.000:0.000	C
ASPDH	554235	genome.wustl.edu	37	19	51017057	51017057	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:51017057C>A	ENST00000389208.4	-	1	85	c.24G>T	c.(22-24)agG>agT	p.R8S	ASPDH_ENST00000597030.1_Intron|JOSD2_ENST00000598418.1_5'Flank|ASPDH_ENST00000376916.3_Intron|JOSD2_ENST00000391815.3_5'Flank|JOSD2_ENST00000601423.1_5'Flank|JOSD2_ENST00000595669.1_5'Flank	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	8					NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CCACGCCCACCCTCCACGGGC	0.692																																																	0								ENSG00000204653						36.0	45.0	42.0					19																	51017057		692	1591	2283	ASPDH	SO:0001583	missense	0			-	HGNC		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.24G>T	19.37:g.51017057C>A	ENSP00000373860:p.Arg8Ser	Somatic	0	85	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	105	15.32	Q6NZ37	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Asp_DH,pfam_Asp/hSer_DH_NAD-bd	p.R8S	ENST00000389208.4	37	c.24	CCDS46153.1	19	.	.	.	.	.	.	.	.	.	.	C	13.90	2.374864	0.42105	.	.	ENSG00000204653	ENST00000389208	T	0.56611	0.45	3.76	1.57	0.23409	NAD(P)-binding domain (1);	0.260151	0.29501	U	0.011964	T	0.41834	0.1176	L	0.52011	1.625	0.31346	N	0.683123	B	0.23377	0.084	B	0.21360	0.034	T	0.44467	-0.9326	10	0.87932	D	0	.	6.1416	0.20263	0.0:0.7513:0.0:0.2487	.	8	A6ND91	ASPD_HUMAN	S	8	ENSP00000373860:R8S	ENSP00000373860:R8S	R	-	3	2	ASPDH	55708869	0.171000	0.23029	0.940000	0.37924	0.739000	0.42172	0.013000	0.13310	0.215000	0.20761	0.462000	0.41574	AGG	-	NULL		0.692	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPDH	protein_coding	OTTHUMT00000464861.1	C	NM_001024656	-		51017057	-1	no_errors	ENST00000389208	ensembl	human	known	74_37	missense	SNP	0.806	A
DLC1	10395	genome.wustl.edu	37	8	12952388	12952388	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:12952388C>A	ENST00000276297.4	-	12	3815	c.3406G>T	c.(3406-3408)Gtc>Ttc	p.V1136F	DLC1_ENST00000512044.2_Missense_Mutation_p.V733F|DLC1_ENST00000510318.1_5'UTR|DLC1_ENST00000520226.1_Missense_Mutation_p.V625F|DLC1_ENST00000358919.2_Missense_Mutation_p.V699F	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1136	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						TCGTAGTTGACACAGTCTATG	0.498																																																	0								ENSG00000164741						82.0	78.0	79.0					8																	12952388		2203	4300	6503	DLC1	SO:0001583	missense	0			-	HGNC	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.3406G>T	8.37:g.12952388C>A	ENSP00000276297:p.Val1136Phe	Somatic	0	50	0.00		0.6159915499159303	166	0.60	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_START_lipid-bd_dom,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom,pfscan_RhoGAP_dom	p.V1136F	ENST00000276297.4	37	c.3406	CCDS5989.1	8	.	.	.	.	.	.	.	.	.	.	C	18.45	3.626096	0.66901	.	.	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000510318;ENST00000512044;ENST00000520226	T;T;T;T	0.19938	2.11;2.11;2.11;2.11	4.97	4.1	0.47936	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.194223	0.44688	D	0.000435	T	0.38188	0.1031	L	0.57536	1.79	0.80722	D	1	B;D;P	0.71674	0.325;0.998;0.508	B;D;B	0.72982	0.153;0.979;0.099	T	0.16837	-1.0389	10	0.87932	D	0	.	8.732	0.34505	0.1497:0.7741:0.0:0.0762	.	1136;733;699	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	F	1136;699;75;733;625	ENSP00000276297:V1136F;ENSP00000351797:V699F;ENSP00000422595:V733F;ENSP00000428028:V625F	ENSP00000276297:V1136F	V	-	1	0	DLC1	12996759	0.992000	0.36948	0.954000	0.39281	0.967000	0.64934	2.999000	0.49473	1.466000	0.48025	0.650000	0.86243	GTC	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.498	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	protein_coding	OTTHUMT00000207632.2	C	NM_182643, NM_006094	-		12952388	-1	no_errors	ENST00000276297	ensembl	human	known	74_37	missense	SNP	1.000	A
RAPGEF2	9693	genome.wustl.edu	37	4	160216908	160216908	+	Intron	SNP	C	C	T	rs66478721|rs373967945|rs4690935|rs113715111|rs60091174		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr4:160216908C>T	ENST00000264431.4	+	2	479				RAPGEF2_ENST00000504604.1_Intron|AC105316.1_ENST00000401270.1_RNA	NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2						adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		tgtgtgtgtgcgcgcgcgcgc	0.423																																																	0								ENSG00000216089																																			AC105316.1	SO:0001627	intron_variant	0			-	Clone_based_ensembl_gene	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.61-8586C>T	4.37:g.160216908C>T		Somatic	0	16	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	18	33.33	D3DP27	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000264431.4	37	NULL	CCDS43277.1	4																																																																																			-	-		0.423	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216089	protein_coding	OTTHUMT00000364980.2	C	NM_014247	rs4690935		160216908	+1	no_errors	ENST00000401270	ensembl	human	novel	74_37	rna	SNP	0.000	T
BCAS1	8537	genome.wustl.edu	37	20	52644921	52644921	+	Intron	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr20:52644921G>T	ENST00000395961.3	-	4	890				BCAS1_ENST00000371440.3_Intron|BCAS1_ENST00000411563.1_Missense_Mutation_p.P148T|BCAS1_ENST00000371435.2_Intron	NM_003657.2	NP_003648.2	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(23)|ovary(2)|skin(2)|stomach(1)|urinary_tract(1)	37	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			ATACACCTTGGCACACTTACC	0.552																																																	0								ENSG00000064787						262.0	221.0	235.0					20																	52644921		2203	4300	6503	BCAS1	SO:0001627	intron_variant	0			-	HGNC	AF041260	CCDS13444.1	20q13.2	2006-11-10			ENSG00000064787	ENSG00000064787			974	protein-coding gene	gene with protein product		602968				9671742	Standard	NM_003657		Approved	NABC1, AIBC1	uc002xws.2	O75363	OTTHUMG00000032772	ENST00000395961.3:c.723+9C>A	20.37:g.52644921G>T		Somatic	0	41	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A0AVG5|Q68CZ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P148T	ENST00000395961.3	37	c.442	CCDS13444.1	20	.	.	.	.	.	.	.	.	.	.	G	15.93	2.977459	0.53720	.	.	ENSG00000064787	ENST00000411563	T	0.50277	0.75	4.65	-7.6	0.01303	.	.	.	.	.	T	0.23094	0.0558	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.14035	-1.0487	8	0.34782	T	0.22	.	1.4726	0.02419	0.2567:0.1806:0.3924:0.1703	.	148	B4E2C4	.	T	148	ENSP00000397442:P148T	ENSP00000397442:P148T	P	-	1	0	BCAS1	52078328	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	-0.830000	0.04410	-1.883000	0.01120	0.563000	0.77884	CCA	-	NULL		0.552	BCAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAS1	protein_coding	OTTHUMT00000079766.2	G	NM_003657	-		52644921	-1	no_errors	ENST00000411563	ensembl	human	known	74_37	missense	SNP	0.000	T
BCR	613	genome.wustl.edu	37	22	23523835	23523835	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:23523835C>A	ENST00000305877.8	+	1	1439	c.688C>A	c.(688-690)Cct>Act	p.P230T	BCR_ENST00000398512.5_Missense_Mutation_p.P230T|BCR_ENST00000359540.3_Missense_Mutation_p.P230T	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	230	Binding to ABL SH2-domain.|Kinase.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	ATCCAGGCCCCCTTACCGGGG	0.677			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																			Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0								ENSG00000186716						28.0	30.0	29.0					22																	23523835		2184	4268	6452	BCR	SO:0001583	missense	0			-	HGNC		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.688C>A	22.37:g.23523835C>A	ENSP00000303507:p.Pro230Thr	Somatic	0	37	0.00		0.6159915499159303	19	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.11	P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_Bcr-Abl_oncoprot_oligo,pfam_DH-domain,pfam_C2_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_DH-domain,superfamily_Bcr-Abl_oncoprot_oligo,superfamily_C2_dom,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_dom,smart_RhoGAP_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom,pfscan_DH-domain	p.P230T	ENST00000305877.8	37	c.688	CCDS13806.1	22	.	.	.	.	.	.	.	.	.	.	C	0.670	-0.802250	0.02841	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000398512;ENST00000290956;ENST00000292697;ENST00000420248	T;T;T	0.40756	1.84;1.84;1.02	4.15	-3.16	0.05217	.	1.311420	0.05240	N	0.511983	T	0.14356	0.0347	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.14727	-1.0462	10	0.07644	T	0.81	.	1.9737	0.03412	0.1264:0.1647:0.3778:0.331	.	230;230	P11274-2;P11274	.;BCR_HUMAN	T	230	ENSP00000303507:P230T;ENSP00000352535:P230T;ENSP00000381524:P230T	ENSP00000290956:P230T	P	+	1	0	BCR	21853835	0.418000	0.25440	0.000000	0.03702	0.002000	0.02628	0.414000	0.21164	-0.619000	0.05648	-1.109000	0.02080	CCT	-	NULL		0.677	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	protein_coding	OTTHUMT00000075819.1	C	NM_004327	-		23523835	+1	no_errors	ENST00000305877	ensembl	human	known	74_37	missense	SNP	0.000	A
ZNF223	7766	genome.wustl.edu	37	19	44571365	44571365	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:44571365G>T	ENST00000434772.3	+	5	1639	c.1384G>T	c.(1384-1386)Ggg>Tgg	p.G462W	ZNF223_ENST00000591793.1_Missense_Mutation_p.G572W	NM_013361.4	NP_037493.3	Q9UK11	ZN223_HUMAN	zinc finger protein 223	462					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18		Prostate(69;0.0352)				TGAAGACTGTGGGAAGCGCTA	0.368																																																	0								ENSG00000267022						53.0	55.0	54.0					19																	44571365		2203	4300	6503	ZNF223	SO:0001583	missense	0			-	Uniprot_gn	AF187989	CCDS12635.1	19q13.2	2013-01-08				ENSG00000178386		"""Zinc fingers, C2H2-type"", ""-"""	13016	protein-coding gene	gene with protein product							Standard	XM_006723365		Approved		uc002oyf.1	Q9UK11		ENST00000434772.3:c.1384G>T	19.37:g.44571365G>T	ENSP00000401947:p.Gly462Trp	Somatic	0	49	0.00		0.6159915499159303	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q15736|Q8TBJ3|Q9HCA9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G572W	ENST00000434772.3	37	c.1714	CCDS12635.1	19	.	.	.	.	.	.	.	.	.	.	G	17.02	3.281976	0.59867	.	.	ENSG00000178386	ENST00000434772	T	0.23754	1.89	2.46	1.34	0.21922	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.49779	0.1577	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.51911	-0.8645	9	0.87932	D	0	.	10.1702	0.42904	0.0:0.2054:0.7946:0.0	.	462	Q9UK11	ZN223_HUMAN	W	462	ENSP00000401947:G462W	ENSP00000401947:G462W	G	+	1	0	ZNF223	49263205	1.000000	0.71417	0.014000	0.15608	0.654000	0.38779	1.947000	0.40293	0.319000	0.23209	0.313000	0.20887	GGG	-	NULL		0.368	ZNF223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF223	protein_coding	OTTHUMT00000460469.2	G		-		44571365	+1	no_errors	ENST00000591793	ensembl	human	known	74_37	missense	SNP	0.996	T
FOSB	2354	genome.wustl.edu	37	19	45974168	45974168	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:45974168delC	ENST00000353609.3	+	2	1000	c.408delC	c.(406-408)cgcfs	p.R136fs	FOSB_ENST00000417353.2_Frame_Shift_Del_p.R136fs|ERCC1_ENST00000423698.2_Intron|FOSB_ENST00000592436.1_Frame_Shift_Del_p.R136fs|FOSB_ENST00000590335.1_Frame_Shift_Del_p.R136fs|FOSB_ENST00000586615.1_Frame_Shift_Del_p.R87fs|FOSB_ENST00000585836.1_Frame_Shift_Del_p.R97fs|FOSB_ENST00000591858.1_Frame_Shift_Del_p.R97fs|FOSB_ENST00000443841.2_Intron|FOSB_ENST00000592811.1_Frame_Shift_Del_p.R87fs	NM_006732.2	NP_006723.2	P53539	FOSB_HUMAN	FBJ murine osteosarcoma viral oncogene homolog B	136					cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	13		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00814)|Epithelial(262;0.18)|GBM - Glioblastoma multiforme(486;0.242)		GGCCTGCCCGCCCAGCCCGAG	0.647																																																	0								ENSG00000125740						35.0	42.0	40.0					19																	45974168		2203	4298	6501	FOSB	SO:0001589	frameshift_variant	0				HGNC		CCDS12664.1, CCDS46113.1	19q13.3	2013-01-10						"""basic leucine zipper proteins"""	3797	protein-coding gene	gene with protein product	"""oncogene FOS-B"", ""activator protein 1"""	164772				1301997	Standard	NM_006732		Approved	G0S3, GOSB, GOS3, AP-1, MGC42291, DKFZp686C0818	uc002pbx.4	P53539		ENST00000353609.3:c.408delC	19.37:g.45974168delC	ENSP00000245919:p.Arg136fs	Somatic	0	12	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	15	28.57	A8K9K5|A8VJE1|A8VJE6|A8VJF0|A8VJF3|A8VJF7|A8VJG1|A8VJG5|A8VJG9|E7EPR6|E9PHJ3|K7EMJ6|Q49AD7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.P137fs	ENST00000353609.3	37	c.408	CCDS12664.1	19																																																																																			-	NULL		0.647	FOSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOSB	protein_coding	OTTHUMT00000459561.1	C	NM_006732			45974168	+1	no_errors	ENST00000353609	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
POTEG	404785	genome.wustl.edu	37	14	19559063	19559063	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr14:19559063G>C	ENST00000409832.3	+	3	761	c.709G>C	c.(709-711)Gag>Cag	p.E237Q		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	237										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						TATTCCAGATGAGTATGGAAA	0.393																																																	0								ENSG00000222036						47.0	51.0	50.0					14																	19559063		1266	2814	4080	POTEG	SO:0001583	missense	0			-	HGNC		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.709G>C	14.37:g.19559063G>C	ENSP00000386971:p.Glu237Gln	Somatic	0	258	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	241	12.68	A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E237Q	ENST00000409832.3	37	c.709	CCDS32018.1	14	.	.	.	.	.	.	.	.	.	.	g	10.34	1.323315	0.24080	.	.	ENSG00000222036	ENST00000409832	T	0.53640	0.61	1.87	-2.81	0.05805	Ankyrin repeat-containing domain (3);	3.877450	0.00775	N	0.001236	T	0.54647	0.1871	L	0.48260	1.515	0.09310	N	1	D	0.55800	0.973	P	0.58266	0.836	T	0.50224	-0.8853	10	0.44086	T	0.13	.	6.539	0.22370	0.6634:0.0:0.3366:0.0	.	237	Q6S5H5	POTEG_HUMAN	Q	237	ENSP00000386971:E237Q	ENSP00000386971:E237Q	E	+	1	0	POTEG	18629063	0.000000	0.05858	0.000000	0.03702	0.116000	0.19942	-2.861000	0.00726	-0.873000	0.04032	0.184000	0.17185	GAG	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom		0.393	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEG	protein_coding	OTTHUMT00000408579.1	G	NM_001005356	-		19559063	+1	no_errors	ENST00000409832	ensembl	human	known	74_37	missense	SNP	0.000	C
SGSM1	129049	genome.wustl.edu	37	22	25270488	25270488	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:25270488G>T	ENST00000400359.4	+	13	1405	c.1398G>T	c.(1396-1398)tgG>tgT	p.W466C	SGSM1_ENST00000400358.4_Intron	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	466						Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						GGAGTCAGTGGGAGCCAGCCA	0.657																																																	0								ENSG00000167037						38.0	40.0	39.0					22																	25270488		2058	4206	6264	SGSM1	SO:0001583	missense	0			-	HGNC	AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.1398G>T	22.37:g.25270488G>T	ENSP00000383212:p.Trp466Cys	Somatic	0	47	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Run,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Run,smart_Rab-GTPase-TBC_dom,pfscan_Run,pfscan_Rab-GTPase-TBC_dom	p.W466C	ENST00000400359.4	37	c.1398	CCDS46674.1	22	.	.	.	.	.	.	.	.	.	.	G	4.495	0.091759	0.08632	.	.	ENSG00000167037	ENST00000400359	T	0.06608	3.28	4.63	3.53	0.40419	.	.	.	.	.	T	0.06600	0.0169	N	0.22421	0.69	0.42463	D	0.992796	D	0.55172	0.97	P	0.47206	0.541	T	0.27331	-1.0077	9	0.56958	D	0.05	-3.3271	10.1853	0.42993	0.0:0.2022:0.7978:0.0	.	466	Q2NKQ1	SGSM1_HUMAN	C	466	ENSP00000383212:W466C	ENSP00000383212:W466C	W	+	3	0	SGSM1	23600488	1.000000	0.71417	0.992000	0.48379	0.069000	0.16628	2.329000	0.43876	2.563000	0.86464	0.563000	0.77884	TGG	-	NULL		0.657	SGSM1-004	KNOWN	basic|CCDS	protein_coding	SGSM1	protein_coding	OTTHUMT00000320282.1	G	XM_059318	-		25270488	+1	no_errors	ENST00000400359	ensembl	human	known	74_37	missense	SNP	0.932	T
GRK1	6011	genome.wustl.edu	37	13	114321791	114321791	+	Silent	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr13:114321791C>A	ENST00000335678.6	+	1	322	c.90C>A	c.(88-90)tcC>tcA	p.S30S		NM_002929.2	NP_002920.1	Q15835	RK_HUMAN	G protein-coupled receptor kinase 1	30	N-terminal.				negative regulation of apoptotic process (GO:0043066)|photoreceptor cell morphogenesis (GO:0008594)|phototransduction, visible light (GO:0007603)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)|rhodopsin kinase activity (GO:0050254)			ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.234)			CCCAACCCTCCCGGGACAAGA	0.622																																																	0								ENSG00000185974						28.0	34.0	32.0					13																	114321791		2078	4207	6285	GRK1	SO:0001819	synonymous_variant	0			-	HGNC			13q34	2013-09-02	2004-03-23	2004-03-24	ENSG00000185974	ENSG00000185974	2.7.11.14		10013	protein-coding gene	gene with protein product		180381	"""rhodopsin kinase"""	RHOK		8812493, 15057823	Standard	NM_002929		Approved	GPRK1, RK	uc010tkf.2	Q15835	OTTHUMG00000185528	ENST00000335678.6:c.90C>A	13.37:g.114321791C>A		Somatic	0	59	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q53X14	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RGS_dom,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Regulat_G_prot_signal_superfam,pfscan_Prot_kinase_dom,prints_GPCR_kinase	p.S30	ENST00000335678.6	37	c.90		13																																																																																			-	NULL		0.622	GRK1-001	KNOWN	basic|appris_principal	protein_coding	GRK1	protein_coding	OTTHUMT00000470655.1	C	NM_002929	-		114321791	+1	no_errors	ENST00000335678	ensembl	human	known	74_37	silent	SNP	0.993	A
SNRPB	6628	genome.wustl.edu	37	20	2442576	2442576	+	Intron	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr20:2442576C>T	ENST00000438552.2	-	7	848				SNRPB_ENST00000381342.2_Silent_p.*232*|SNORD119_ENST00000515997.1_RNA	NM_198216.1	NP_937859.1	P14678	RSMB_HUMAN	small nuclear ribonucleoprotein polypeptides B and B1						gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	histone pre-mRNA DCP binding (GO:0071208)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	10						GGCCAAGGGTCAAAGAAGGCC	0.532																																																	0								ENSG00000125835						87.0	71.0	76.0					20																	2442576		2203	4300	6503	SNRPB	SO:0001627	intron_variant	0			-	HGNC		CCDS13026.1, CCDS13027.1	20p13	2011-10-11			ENSG00000125835	ENSG00000125835			11153	protein-coding gene	gene with protein product		182282		SNRPB1		1376292	Standard	NM_003091		Approved	COD, SmB/SmB', Sm-B/B', snRNP-B	uc002wfz.1	P14678	OTTHUMG00000031694	ENST00000438552.2:c.686-137G>A	20.37:g.2442576C>T		Somatic	0	67	0.00		0.6159915499159303	447	13.54	70	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	81	20.59	Q15490|Q6IB35|Q9UIS5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc,pirsf_snRNP-assoc_SmB/SmN	p.*232	ENST00000438552.2	37	c.695	CCDS13026.1	20	.	.	.	.	.	.	.	.	.	.	C	8.291	0.817791	0.16607	.	.	ENSG00000125835	ENST00000303103	.	.	.	4.9	3.88	0.44766	.	0.204155	0.32987	N	0.005417	T	0.66489	0.2794	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69135	-0.5225	6	0.87932	D	0	.	10.6392	0.45584	0.0:0.806:0.194:0.0	.	.	.	.	N	232	.	ENSP00000303591:D232N	D	-	1	0	SNRPB	2390576	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.975000	0.40569	2.717000	0.92951	0.655000	0.94253	GAC	-	NULL		0.532	SNRPB-002	KNOWN	basic|CCDS	protein_coding	SNRPB	protein_coding	OTTHUMT00000077585.2	C		-		2442576	-1	no_errors	ENST00000381342	ensembl	human	known	74_37	silent	SNP	1.000	T
FAM98A	25940	genome.wustl.edu	37	2	33812310	33812310	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:33812310G>T	ENST00000238823.8	-	5	740	c.600C>A	c.(598-600)caC>caA	p.H200Q	FAM98A_ENST00000403368.1_Missense_Mutation_p.H200Q|FAM98A_ENST00000498340.1_5'UTR|FAM98A_ENST00000441530.2_Missense_Mutation_p.H5Q			Q8NCA5	FA98A_HUMAN	family with sequence similarity 98, member A	201							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(1)	24	all_hematologic(175;0.115)					TACTCACCCAGTGGGCTGGTC	0.328																																																	0								ENSG00000119812						112.0	113.0	113.0					2																	33812310		2203	4300	6503	FAM98A	SO:0001583	missense	0			-	HGNC		CCDS33179.1	2p22.3	2006-11-29		2005-11-20	ENSG00000119812	ENSG00000119812			24520	protein-coding gene	gene with protein product						12477932	Standard	NM_015475		Approved	DKFZP564F0522	uc002rpa.1	Q8NCA5	OTTHUMG00000152152	ENST00000238823.8:c.600C>A	2.37:g.33812310G>T	ENSP00000238823:p.His200Gln	Somatic	0	48	0.00		0.6159915499159303	71	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B2RNA2|Q9Y3Y6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Uncharacterised_FAM98	p.H200Q	ENST00000238823.8	37	c.600	CCDS33179.1	2	.	.	.	.	.	.	.	.	.	.	G	4.672	0.124901	0.08931	.	.	ENSG00000119812	ENST00000238823;ENST00000395190;ENST00000403368;ENST00000441530	T;T;T	0.34859	1.34;1.34;1.34	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.22820	0.0551	N	0.00746	-1.225	0.58432	D	0.999995	D;B;D;D	0.76494	0.982;0.046;0.997;0.999	D;B;D;D	0.85130	0.934;0.137;0.991;0.997	T	0.42189	-0.9466	10	0.02654	T	1	-10.7087	10.6341	0.45554	0.1423:0.0:0.8577:0.0	.	201;31;200;77	Q8NCA5;B4DY25;Q8NCA5-2;B3KTW4	FA98A_HUMAN;.;.;.	Q	200;201;200;5	ENSP00000238823:H200Q;ENSP00000384711:H200Q;ENSP00000408716:H5Q	ENSP00000238823:H200Q	H	-	3	2	FAM98A	33665814	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.299000	0.59073	2.861000	0.98227	0.655000	0.94253	CAC	-	pfam_Uncharacterised_FAM98		0.328	FAM98A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM98A	protein_coding	OTTHUMT00000325457.2	G	NM_015475	-		33812310	-1	no_errors	ENST00000238823	ensembl	human	known	74_37	missense	SNP	1.000	T
PKD2L2	27039	genome.wustl.edu	37	5	137226243	137226243	+	Nonsense_Mutation	SNP	C	C	A	rs537075402		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr5:137226243C>A	ENST00000508883.1	+	2	131	c.105C>A	c.(103-105)taC>taA	p.Y35*	PKD2L2_ENST00000502810.1_Nonsense_Mutation_p.Y35*|RP11-381K20.2_ENST00000508281.2_RNA|PKD2L2_ENST00000290431.5_Nonsense_Mutation_p.Y35*|RP11-381K20.2_ENST00000514616.1_RNA|PKD2L2_ENST00000350250.4_Intron|PKD2L2_ENST00000508638.1_Nonsense_Mutation_p.Y35*			Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	35					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)	integral component of membrane (GO:0016021)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			breast(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	28			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TGTTACTCTACTTTATTTTTT	0.289																																																	0								ENSG00000078795						75.0	77.0	76.0					5																	137226243		1790	4060	5850	PKD2L2	SO:0001587	stop_gained	0			-	HGNC	AF118125	CCDS43367.1, CCDS58971.1, CCDS58972.1	5q31	2011-12-16			ENSG00000078795	ENSG00000078795		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9012	protein-coding gene	gene with protein product		604669				10602361	Standard	NM_014386		Approved	TRPP5	uc003lbw.1	Q9NZM6	OTTHUMG00000163306	ENST00000508883.1:c.105C>A	5.37:g.137226243C>A	ENSP00000424725:p.Tyr35*	Somatic	1	103	0.95		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	122	25.61	A6NK98|B4DXD2|E9PC91|E9PDG4|Q86YB4|Q9UNJ0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PKD1_2_channel,pfam_Ion_trans_dom,prints_PKD_2	p.Y35*	ENST00000508883.1	37	c.105		5	.	.	.	.	.	.	.	.	.	.	C	24.3	4.515739	0.85495	.	.	ENSG00000078795	ENST00000508638;ENST00000502810;ENST00000508883;ENST00000290431	.	.	.	5.8	4.0	0.46444	.	0.000000	0.56097	D	0.000021	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.8203	8.8458	0.35170	0.0:0.7685:0.0:0.2315	.	.	.	.	X	35	.	ENSP00000290431:Y35X	Y	+	3	2	PKD2L2	137254142	0.967000	0.33354	1.000000	0.80357	0.990000	0.78478	0.916000	0.28651	1.430000	0.47334	0.460000	0.39030	TAC	-	NULL		0.289	PKD2L2-001	KNOWN	basic|appris_principal	protein_coding	PKD2L2	protein_coding	OTTHUMT00000372521.1	C	NM_014386	-		137226243	+1	no_errors	ENST00000508883	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ITGB4	3691	genome.wustl.edu	37	17	73750863	73750863	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr17:73750863G>T	ENST00000200181.3	+	34	4712	c.4525G>T	c.(4525-4527)Gac>Tac	p.D1509Y	ITGB4_ENST00000449880.2_Missense_Mutation_p.D1439Y|ITGB4_ENST00000579662.1_Missense_Mutation_p.D1439Y|ITGB4_ENST00000339591.3_Missense_Mutation_p.D1439Y|ITGB4_ENST00000450894.3_Missense_Mutation_p.D1439Y|GALK1_ENST00000225614.2_Intron	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	1509					amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			ACTGCCCAGGGACTACTCCAC	0.617																																																	0								ENSG00000132470						310.0	189.0	230.0					17																	73750863		2203	4300	6503	ITGB4	SO:0001583	missense	0			-	HGNC		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.4525G>T	17.37:g.73750863G>T	ENSP00000200181:p.Asp1509Tyr	Somatic	0	28	0.00		0.6159915499159303	9	52.63	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	28	48.15	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Integrin_bsu-4,pfam_Integrin_bsu_N,pfam_Fibronectin_type3,pfam_Calx_beta,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Fibronectin_type3,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,smart_Calx_beta,smart_Fibronectin_type3,prints_Integrin_bsu,pfscan_Fibronectin_type3	p.D1509Y	ENST00000200181.3	37	c.4525	CCDS11727.1	17	.	.	.	.	.	.	.	.	.	.	G	14.66	2.601438	0.46423	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	T;T;T	0.75704	-0.96;-0.89;-0.89	5.39	5.39	0.77823	.	0.300274	0.26855	N	0.022156	T	0.80486	0.4632	L	0.32530	0.975	0.80722	D	1	B;D;B	0.89917	0.004;1.0;0.02	B;D;B	0.85130	0.008;0.997;0.017	T	0.82424	-0.0464	10	0.87932	D	0	.	15.8645	0.79055	0.0:0.0:1.0:0.0	.	1439;1439;1509	P16144-3;A0AVL6;P16144	.;.;ITB4_HUMAN	Y	1509;1439;1439	ENSP00000200181:D1509Y;ENSP00000344079:D1439Y;ENSP00000400217:D1439Y	ENSP00000200181:D1509Y	D	+	1	0	ITGB4	71262458	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.020000	0.64066	2.517000	0.84864	0.561000	0.74099	GAC	-	pirsf_Integrin_bsu-4		0.617	ITGB4-001	KNOWN	basic|CCDS	protein_coding	ITGB4	protein_coding	OTTHUMT00000448334.1	G		-		73750863	+1	no_errors	ENST00000200181	ensembl	human	known	74_37	missense	SNP	1.000	T
NEDD4L	23327	genome.wustl.edu	37	18	55992284	55992286	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	TCC	TCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr18:55992284_55992286delTCC	ENST00000400345.3	+	9	853_855	c.570_572delTCC	c.(568-573)cttcct>ctt	p.P194del	NEDD4L_ENST00000435432.2_In_Frame_Del_p.P73del|NEDD4L_ENST00000456986.1_In_Frame_Del_p.P73del|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000382850.4_In_Frame_Del_p.P194del|NEDD4L_ENST00000586263.1_In_Frame_Del_p.P186del|NEDD4L_ENST00000256830.9_In_Frame_Del_p.P194del|NEDD4L_ENST00000431212.2_In_Frame_Del_p.P73del|NEDD4L_ENST00000256832.7_In_Frame_Del_p.P73del|NEDD4L_ENST00000456173.2_In_Frame_Del_p.P73del|NEDD4L_ENST00000357895.5_In_Frame_Del_p.P186del|NEDD4L_ENST00000356462.6_In_Frame_Del_p.P194del	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	194	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						AAGAGGAACTTCCTCCTCCTCCT	0.498																																																	0								ENSG00000049759																																			NEDD4L	SO:0001651	inframe_deletion	0				HGNC	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.570_572delTCC	18.37:g.55992293_55992295delTCC	ENSP00000383199:p.Pro194del	Somatic	0	38	0.00		0.6159915499159303	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_C2_dom,superfamily_WW_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom,prints_C2_dom	p.P194in_frame_del	ENST00000400345.3	37	c.570_572	CCDS45872.1	18																																																																																			-	superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom		0.498	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEDD4L	protein_coding	OTTHUMT00000448749.1	TCC				55992286	+1	no_errors	ENST00000400345	ensembl	human	known	74_37	in_frame_del	DEL	0.796:0.984:0.981	-
FAM155A	728215	genome.wustl.edu	37	13	107822972	107822972	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr13:107822972A>T	ENST00000375915.2	-	3	1388	c.1250T>A	c.(1249-1251)cTc>cAc	p.L417H		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	417						integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						ACACAGCTTGAGTCTGCTGTT	0.502																																																	0								ENSG00000204442						263.0	182.0	210.0					13																	107822972		2203	4300	6503	FAM155A	SO:0001583	missense	0			-	HGNC	L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.1250T>A	13.37:g.107822972A>T	ENSP00000365080:p.Leu417His	Somatic	0	57	0.00		0.6159915499159303	4	20.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	29	21.62	B2RUV1|B7Z334	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L417H	ENST00000375915.2	37	c.1250	CCDS32006.1	13	.	.	.	.	.	.	.	.	.	.	A	26.0	4.695882	0.88830	.	.	ENSG00000204442	ENST00000375915	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.70605	0.3243	L	0.46157	1.445	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73353	-0.4009	9	0.87932	D	0	.	15.2977	0.73922	1.0:0.0:0.0:0.0	.	417	B1AL88	F155A_HUMAN	H	417	.	ENSP00000365080:L417H	L	-	2	0	FAM155A	106620973	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.533000	0.90617	2.199000	0.70637	0.519000	0.50382	CTC	-	NULL		0.502	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155A	protein_coding	OTTHUMT00000045736.2	A	NM_001080396	-		107822972	-1	no_errors	ENST00000375915	ensembl	human	known	74_37	missense	SNP	1.000	T
DHX36	170506	genome.wustl.edu	37	3	154018909	154018909	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr3:154018909G>T	ENST00000496811.1	-	10	1305	c.1225C>A	c.(1225-1227)Cca>Aca	p.P409T	DHX36_ENST00000544526.1_Missense_Mutation_p.P409T|DHX36_ENST00000329463.5_Missense_Mutation_p.P409T|DHX36_ENST00000308361.6_Missense_Mutation_p.P409T	NM_020865.2	NP_065916.2	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	409					ATP catabolic process (GO:0006200)|innate immune response (GO:0045087)|ossification (GO:0001503)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|core promoter binding (GO:0001047)|DNA-dependent ATPase activity (GO:0008094)|double-stranded RNA binding (GO:0003725)|G-quadruplex DNA binding (GO:0051880)|G-quadruplex RNA binding (GO:0002151)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)	p.P409A(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	35			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TTTTGTTCTGGAACATACCTA	0.294																																																	1	Substitution - Missense(1)	urinary_tract(1)						ENSG00000174953						66.0	68.0	67.0					3																	154018909		2203	4298	6501	DHX36	SO:0001583	missense	0			-	HGNC	AF217190	CCDS3171.1, CCDS54657.1	3q25.2	2012-09-20	2003-06-13	2003-06-20	ENSG00000174953	ENSG00000174953		"""DEAH-boxes"""	14410	protein-coding gene	gene with protein product		612767	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 36"""	DDX36			Standard	NM_020865		Approved	MLEL1, KIAA1488	uc003ezy.4	Q9H2U1	OTTHUMG00000159109	ENST00000496811.1:c.1225C>A	3.37:g.154018909G>T	ENSP00000417078:p.Pro409Thr	Somatic	0	25	0.00		0.6159915499159303	84	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39	B2RB00|Q70JU3|Q8IYE5|Q9P240	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P409T	ENST00000496811.1	37	c.1225	CCDS3171.1	3	.	.	.	.	.	.	.	.	.	.	G	15.74	2.923339	0.52653	.	.	ENSG00000174953	ENST00000496811;ENST00000308361;ENST00000544526;ENST00000329463;ENST00000481941	T;T;T;T;T	0.13307	2.6;2.6;2.6;2.6;2.6	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.23094	0.0558	M	0.74546	2.27	0.58432	D	0.999999	B;B;B	0.26002	0.064;0.139;0.038	B;B;B	0.30251	0.054;0.113;0.053	T	0.04307	-1.0961	10	0.22109	T	0.4	.	20.2527	0.98410	0.0:0.0:1.0:0.0	.	409;409;409	Q9H2U1-2;Q9H2U1-3;Q9H2U1	.;.;DHX36_HUMAN	T	409;409;409;409;323	ENSP00000417078:P409T;ENSP00000309296:P409T;ENSP00000444247:P409T;ENSP00000330113:P409T;ENSP00000419862:P323T	ENSP00000309296:P409T	P	-	1	0	DHX36	155501603	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.965000	0.87945	2.788000	0.95919	0.557000	0.71058	CCA	-	superfamily_P-loop_NTPase		0.294	DHX36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX36	protein_coding	OTTHUMT00000353349.1	G	NM_020865	-		154018909	-1	no_errors	ENST00000496811	ensembl	human	known	74_37	missense	SNP	1.000	T
GLRX2	51022	genome.wustl.edu	37	1	193074824	193074824	+	5'Flank	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:193074824G>T	ENST00000367439.3	-	0	0				GLRX2_ENST00000367440.3_5'UTR|GLRX2_ENST00000472197.1_5'UTR	NM_197962.2	NP_932066.1	Q9NS18	GLRX2_HUMAN	glutaredoxin 2						apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|DNA protection (GO:0042262)|glutathione metabolic process (GO:0006749)|protein folding (GO:0006457)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|response to hydrogen peroxide (GO:0042542)|response to organic substance (GO:0010033)|response to redox state (GO:0051775)|response to temperature stimulus (GO:0009266)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	2 iron, 2 sulfur cluster binding (GO:0051537)|arsenate reductase (glutaredoxin) activity (GO:0008794)|electron carrier activity (GO:0009055)|glutathione disulfide oxidoreductase activity (GO:0015038)|metal ion binding (GO:0046872)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|large_intestine(1)|lung(3)	5					Glutathione(DB00143)	AGGCTCCCAGGCACTTGGAAG	0.517																																																	0								ENSG00000023572																																			GLRX2	SO:0001631	upstream_gene_variant	0			-	HGNC	AF132495	CCDS1380.1, CCDS1381.1	1q31.2	2012-09-20			ENSG00000023572	ENSG00000023572			16065	protein-coding gene	gene with protein product	"""bA101E13.1 (GRX2 glutaredoxin (thioltransferase) 2)"""	606820				11297543	Standard	NM_016066		Approved	GRX2, bA101E13.1	uc001gsz.2	Q9NS18	OTTHUMG00000035677		1.37:g.193074824G>T	Exception_encountered	Somatic	0	35	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q3LR69|Q7L1N7|Q96JC0|Q9Y3D4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000367439.3	37	NULL	CCDS1381.1	1																																																																																			-	-		0.517	GLRX2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GLRX2	protein_coding	OTTHUMT00000086699.1	G	NM_016066	-		193074824	-1	no_errors	ENST00000472197	ensembl	human	known	74_37	rna	SNP	0.000	T
PAMR1	25891	genome.wustl.edu	37	11	35454312	35454312	+	Silent	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr11:35454312C>T	ENST00000378880.2	-	11	2200	c.1755G>A	c.(1753-1755)cgG>cgA	p.R585R	PAMR1_ENST00000378878.3_Silent_p.R474R|PAMR1_ENST00000278360.3_Silent_p.R602R|PAMR1_ENST00000532848.1_Silent_p.R545R	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	585	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						TGCTGAGATCCCGACTGGCAG	0.592																																																	0								ENSG00000149090						75.0	67.0	69.0					11																	35454312		2202	4298	6500	PAMR1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.1755G>A	11.37:g.35454312C>T		Somatic	0	49	0.00		0.6159915499159303	74	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_CUB_dom,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_EG-like_dom,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_Sushi_SCR_CCP,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1	p.R602	ENST00000378880.2	37	c.1806	CCDS31460.1	11																																																																																			-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.592	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAMR1	protein_coding	OTTHUMT00000389177.1	C	NM_015430	-		35454312	-1	no_errors	ENST00000278360	ensembl	human	known	74_37	silent	SNP	0.991	T
ADCY2	108	genome.wustl.edu	37	5	7626396	7626396	+	Silent	SNP	G	G	T	rs149422716	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr5:7626396G>T	ENST00000338316.4	+	4	776	c.687G>T	c.(685-687)tcG>tcT	p.S229S		NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	229					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						GCATCAAGTCGCGGATCAAGT	0.393																																																	0								ENSG00000078295						120.0	115.0	117.0					5																	7626396		2203	4300	6503	ADCY2	SO:0001819	synonymous_variant	0			-	HGNC	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.687G>T	5.37:g.7626396G>T		Somatic	0	52	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	43	10.42	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.S229	ENST00000338316.4	37	c.687	CCDS3872.2	5																																																																																			-	NULL		0.393	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	protein_coding	OTTHUMT00000206930.2	G	NM_020546	-		7626396	+1	no_errors	ENST00000338316	ensembl	human	known	74_37	silent	SNP	1.000	T
TSPEAR	54084	genome.wustl.edu	37	21	45947272	45947272	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr21:45947272G>T	ENST00000323084.4	-	7	1117	c.1052C>A	c.(1051-1053)tCc>tAc	p.S351Y	TSPEAR_ENST00000397916.1_Missense_Mutation_p.S283Y	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	351					sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)		p.S351Y(1)		breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						GTAGACGGCGGATGTGGCTTT	0.552																																																	1	Substitution - Missense(1)	endometrium(1)						ENSG00000175894						260.0	236.0	244.0					21																	45947272		2203	4300	6503	TSPEAR	SO:0001583	missense	0			-	HGNC	AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.1052C>A	21.37:g.45947272G>T	ENSP00000321987:p.Ser351Tyr	Somatic	0	38	0.00		0.6159915499159303	17	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	57	8.06		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EPTP,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_EAR	p.S351Y	ENST00000323084.4	37	c.1052	CCDS13712.1	21	.	.	.	.	.	.	.	.	.	.	G	15.57	2.872392	0.51695	.	.	ENSG00000175894	ENST00000323084;ENST00000397918;ENST00000397916;ENST00000341581	T;T	0.20200	2.09;2.1	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.49677	0.1571	M	0.78049	2.395	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.55412	-0.8145	10	0.87932	D	0	-15.3549	18.4735	0.90783	0.0:0.0:1.0:0.0	.	351	Q8WU66	TSEAR_HUMAN	Y	351;204;283;352	ENSP00000321987:S351Y;ENSP00000381012:S283Y	ENSP00000321987:S351Y	S	-	2	0	TSPEAR	44771700	1.000000	0.71417	0.088000	0.20740	0.010000	0.07245	8.983000	0.93477	2.355000	0.79922	0.563000	0.77884	TCC	-	pfscan_EAR		0.552	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPEAR	protein_coding	OTTHUMT00000098761.1	G	NM_144991	-		45947272	-1	no_errors	ENST00000323084	ensembl	human	known	74_37	missense	SNP	0.992	T
NBR2	10230	genome.wustl.edu	37	17	41297099	41297099	+	RNA	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr17:41297099G>T	ENST00000460115.1	+	0	1313					NR_003108.1		O15453	NBR2_HUMAN	neighbor of BRCA1 gene 2 (non-protein coding)																		AGCAGCGAAGGATAAATTTTC	0.468																																																	0								ENSG00000198496																																			NBR2			0			-	HGNC	U88573		17q21	2012-10-16	2009-08-21		ENSG00000198496	ENSG00000198496		"""Long non-coding RNAs"""	20691	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 192"""		"""neighbor of BRCA1 gene 2"""			9215675, 15777733	Standard	NR_003108		Approved	NCRNA00192	uc002idf.3	O15453	OTTHUMG00000140395		17.37:g.41297099G>T		Somatic	0	59	0.00		0.6159915499159303	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q3LRJ7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000460115.1	37	NULL		17																																																																																			-	-		0.468	NBR2-001	KNOWN	basic	processed_transcript	NBR2	pseudogene	OTTHUMT00000277175.1	G	NR_003108	-		41297099	+1	no_errors	ENST00000460115	ensembl	human	known	74_37	rna	SNP	0.866	T
PRICKLE3	4007	genome.wustl.edu	37	X	49040116	49040117	+	Intron	DEL	GT	GT	-			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:49040116_49040117delGT	ENST00000376317.3	-	3	407				PRICKLE3_ENST00000538114.1_Frame_Shift_Del_p.T128fs|PRICKLE3_ENST00000376310.3_Intron|PRICKLE3_ENST00000536904.1_Frame_Shift_Del_p.T60fs|PRICKLE3_ENST00000540849.1_Intron	NM_006150.3	NP_006141.2	O43900	PRIC3_HUMAN	prickle homolog 3 (Drosophila)								zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|skin(2)	22						TCCCACCTGAGTGTGTGTGTGT	0.604																																																	0								ENSG00000012211																																			PRICKLE3	SO:0001627	intron_variant	0				HGNC	BC016856	CCDS14320.1	Xp11.23	2008-02-05	2007-09-18	2007-09-18	ENSG00000012211	ENSG00000012211			6645	protein-coding gene	gene with protein product		300111	"""LIM domain only 6"""	LMO6		9344658	Standard	XM_005272605		Approved		uc004dmy.1	O43900	OTTHUMG00000024134	ENST00000376317.3:c.312+69AC>-	X.37:g.49040126_49040127delGT		Somatic	0	35	0.00		0.6159915499159303	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B7Z8F2|O76007|Q53XR5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_LIM,pfam_PET_domain,smart_Znf_LIM,pfscan_Znf_LIM	p.T60fs	ENST00000376317.3	37	c.179_178	CCDS14320.1	X																																																																																			-	NULL		0.604	PRICKLE3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRICKLE3	protein_coding	OTTHUMT00000060811.1	GT	NM_006150			49040117	-1	no_errors	ENST00000536904	ensembl	human	known	74_37	frame_shift_del	DEL	0.149:0.119	-
ANO7	50636	genome.wustl.edu	37	2	242149951	242149951	+	Missense_Mutation	SNP	C	C	G	rs189738174		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:242149951C>G	ENST00000274979.8	+	15	1792	c.1689C>G	c.(1687-1689)atC>atG	p.I563M	ANO7_ENST00000402430.3_Missense_Mutation_p.I562M	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	563					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						TCTCCAAGATCTATGTATCCC	0.642																																																	0								ENSG00000146205						108.0	91.0	97.0					2																	242149951		2203	4300	6503	ANO7	SO:0001583	missense	0			-	HGNC	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.1689C>G	2.37:g.242149951C>G	ENSP00000274979:p.Ile563Met	Somatic	0	20	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	10	52.38	Q6IWH6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Anoctamin	p.I563M	ENST00000274979.8	37	c.1689	CCDS33423.1	2	.	.	.	.	.	.	.	.	.	.	C	11.72	1.721326	0.30503	.	.	ENSG00000146205	ENST00000274979;ENST00000402430	T;T	0.66280	-0.2;-0.2	3.34	2.34	0.29019	.	2.468800	0.02314	U	0.072346	T	0.71558	0.3354	M	0.64170	1.965	0.30702	N	0.750212	P	0.44690	0.841	P	0.50617	0.646	T	0.61347	-0.7081	10	0.44086	T	0.13	.	10.9405	0.47270	0.0:0.8076:0.1923:0.0	.	563	Q6IWH7	ANO7_HUMAN	M	563;562	ENSP00000274979:I563M;ENSP00000385418:I562M	ENSP00000274979:I563M	I	+	3	3	ANO7	241798624	0.233000	0.23772	0.064000	0.19789	0.297000	0.27493	-0.167000	0.09940	1.576000	0.49790	0.313000	0.20887	ATC	-	pfam_Anoctamin		0.642	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO7	protein_coding	OTTHUMT00000323509.1	C	NM_001001891	-		242149951	+1	no_errors	ENST00000274979	ensembl	human	known	74_37	missense	SNP	0.998	G
PCK2	5106	genome.wustl.edu	37	14	24564007	24564007	+	Intron	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr14:24564007C>A	ENST00000216780.4	+	1	297				PCK2_ENST00000559250.1_Intron|PCK2_ENST00000561286.1_5'UTR|NRL_ENST00000561028.1_Intron|PCK2_ENST00000396973.4_Intron|PCK2_ENST00000545054.2_5'UTR|PCK2_ENST00000560657.1_Intron|NRL_ENST00000396997.1_Intron|PCK2_ENST00000558096.1_5'UTR	NM_004563.2	NP_004554.2	Q16822	PCKGM_HUMAN	phosphoenolpyruvate carboxykinase 2 (mitochondrial)						carbohydrate metabolic process (GO:0005975)|cellular response to glucose stimulus (GO:0071333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|NADH oxidation (GO:0006116)|oxaloacetate metabolic process (GO:0006107)|positive regulation of insulin secretion (GO:0032024)|pyruvate metabolic process (GO:0006090)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)|phosphoenolpyruvate carboxykinase activity (GO:0004611)			breast(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(265;0.0184)		GGGCTCTCAGCCAGCGCCCCA	0.612																																																	0								ENSG00000100889																																			PCK2	SO:0001627	intron_variant	0			-	HGNC	AK129934	CCDS9609.1, CCDS41928.1	14q12	2006-06-09			ENSG00000100889	ENSG00000100889	4.1.1.32		8725	protein-coding gene	gene with protein product		614095				8645161, 9657976	Standard	XM_005267726		Approved	PEPCK, PEPCK2	uc001wlt.3	Q16822	OTTHUMG00000028791	ENST00000216780.4:c.29+364C>A	14.37:g.24564007C>A		Somatic	0	55	0.00		0.6159915499159303	21	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.70	O43253|Q86U01|Q9BV62	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A21D	ENST00000216780.4	37	c.62	CCDS9609.1	14																																																																																			-	NULL		0.612	PCK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCK2	protein_coding	OTTHUMT00000071900.3	C	NM_001018073	-		24564007	+1	no_errors	ENST00000559584	ensembl	human	known	74_37	missense	SNP	0.000	A
PNISR	25957	genome.wustl.edu	37	6	99873377	99873377	+	5'Flank	DEL	T	T	-			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr6:99873377delT	ENST00000369239.5	-	0	0				RP11-98I9.4_ENST00000418945.1_RNA|PNISR_ENST00000466057.1_5'Flank|PNISR_ENST00000438806.1_5'Flank	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein							cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						TGCACGTTACTTTTTAACGTA	0.458																																																	0								ENSG00000228506																																			RP11-98I9.4	SO:0001631	upstream_gene_variant	0				Clone_based_vega_gene	AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262		6.37:g.99873377delT	Exception_encountered	Somatic	0	14	0.00		0.6159915499159303	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	26	21.21	A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369239.5	37	NULL	CCDS5043.1	6																																																																																			-	-		0.458	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000228506	protein_coding	OTTHUMT00000041598.1	T	NM_032870			99873377	+1	no_errors	ENST00000418945	ensembl	human	known	74_37	rna	DEL	0.000	-
GBF1	8729	genome.wustl.edu	37	10	104121645	104121645	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr10:104121645G>C	ENST00000369983.3	+	14	1919	c.1659G>C	c.(1657-1659)gaG>gaC	p.E553D		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	553					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		ACCTCTTTGAGGAACTCACAA	0.473																																																	0								ENSG00000107862						102.0	89.0	93.0					10																	104121645		2203	4300	6503	GBF1	SO:0001583	missense	0			-	HGNC	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.1659G>C	10.37:g.104121645G>C	ENSP00000359000:p.Glu553Asp	Somatic	0	18	0.00		0.6159915499159303	35	47.76	32	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	9	65.38	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sec7_dom,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.E553D	ENST00000369983.3	37	c.1659	CCDS7533.1	10	.	.	.	.	.	.	.	.	.	.	G	15.78	2.933518	0.52866	.	.	ENSG00000107862	ENST00000369983	T	0.68903	-0.36	6.17	-1.5	0.08691	.	0.000000	0.85682	D	0.000000	T	0.61413	0.2345	M	0.63843	1.955	0.58432	D	0.999991	B;B;B	0.27594	0.182;0.146;0.012	B;B;B	0.29176	0.099;0.04;0.007	T	0.61342	-0.7082	10	0.62326	D	0.03	-17.6937	13.8793	0.63674	0.7309:0.0:0.2691:0.0	.	553;553;553	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	D	553	ENSP00000359000:E553D	ENSP00000359000:E553D	E	+	3	2	GBF1	104111635	0.995000	0.38212	0.994000	0.49952	0.985000	0.73830	0.465000	0.22004	-0.151000	0.11176	-0.136000	0.14681	GAG	-	superfamily_ARM-type_fold		0.473	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBF1	protein_coding	OTTHUMT00000050051.1	G		-		104121645	+1	no_errors	ENST00000369983	ensembl	human	known	74_37	missense	SNP	0.984	C
RANGAP1	5905	genome.wustl.edu	37	22	41642614	41642614	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:41642614T>C	ENST00000455915.2	-	15	3226	c.1757A>G	c.(1756-1758)aAg>aGg	p.K586R	RANGAP1_ENST00000405486.1_Missense_Mutation_p.K586R|RANGAP1_ENST00000356244.3_Missense_Mutation_p.K586R|RANGAP1_ENST00000407260.4_Missense_Mutation_p.K531R			P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	586					mitotic cell cycle (GO:0000278)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of Ran GTPase activity (GO:0032853)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear pore (GO:0005643)|perinuclear region of cytoplasm (GO:0048471)	Ran GTPase activator activity (GO:0005098)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AGTCTAGACCTTGTACAGCGT	0.627																																																	0								ENSG00000100401						58.0	45.0	49.0					22																	41642614		2192	4292	6484	RANGAP1	SO:0001583	missense	0			-	HGNC	X82260	CCDS14012.1	22q13	2013-01-17			ENSG00000100401	ENSG00000100401			9854	protein-coding gene	gene with protein product		602362	"""segregation distorter homolog (Drosophila)"""	SD		7878053	Standard	NM_002883		Approved	Fug1, KIAA1835	uc003azu.3	P46060	OTTHUMG00000150940	ENST00000455915.2:c.1757A>G	22.37:g.41642614T>C	ENSP00000401470:p.Lys586Arg	Somatic	0	55	0.00		0.6159915499159303	408	13.71	65	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	39	23.53	Q96JJ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ran_GTPase_activating_1_C,superfamily_Ran_GTPase_activating_1_C,smart_Leu-rich_rpt_RNase_inh_sub-typ	p.K586R	ENST00000455915.2	37	c.1757	CCDS14012.1	22	.	.	.	.	.	.	.	.	.	.	T	14.57	2.574360	0.45902	.	.	ENSG00000100401	ENST00000405486;ENST00000356244;ENST00000405383;ENST00000455915;ENST00000407260	T;T;T;T	0.44881	0.91;0.91;0.91;1.37	5.68	4.63	0.57726	Ran-GTPase activating protein 1, C-terminal (3);	0.647288	0.16499	N	0.211758	T	0.31949	0.0813	L	0.33485	1.01	0.21445	N	0.99969	B;B	0.06786	0.0;0.001	B;B	0.10450	0.005;0.005	T	0.18085	-1.0348	10	0.30854	T	0.27	-17.066	10.4868	0.44726	0.0:0.1362:0.0:0.8638	.	531;586	F8W7I9;P46060	.;RAGP1_HUMAN	R	586;586;586;586;531	ENSP00000385866:K586R;ENSP00000348577:K586R;ENSP00000401470:K586R;ENSP00000385354:K531R	ENSP00000348577:K586R	K	-	2	0	RANGAP1	39972560	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	3.330000	0.52068	0.951000	0.37770	0.383000	0.25322	AAG	-	pfam_Ran_GTPase_activating_1_C,superfamily_Ran_GTPase_activating_1_C		0.627	RANGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RANGAP1	protein_coding	OTTHUMT00000320606.1	T	NM_002883	-		41642614	-1	no_errors	ENST00000356244	ensembl	human	known	74_37	missense	SNP	0.721	C
PBRM1	55193	genome.wustl.edu	37	3	52598199	52598199	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr3:52598199C>A	ENST00000296302.7	-	23	3743	c.3742G>T	c.(3742-3744)Gaa>Taa	p.E1248*	PBRM1_ENST00000409057.1_Nonsense_Mutation_p.E1248*|PBRM1_ENST00000337303.4_Nonsense_Mutation_p.E1248*|PBRM1_ENST00000409114.3_Nonsense_Mutation_p.E1263*|PBRM1_ENST00000356770.4_Nonsense_Mutation_p.E1216*|PBRM1_ENST00000394830.3_Nonsense_Mutation_p.E1223*|PBRM1_ENST00000410007.1_Nonsense_Mutation_p.E1223*|SMIM4_ENST00000476842.1_Intron|PBRM1_ENST00000409767.1_Nonsense_Mutation_p.E1263*			Q86U86	PB1_HUMAN	polybromo 1	1248	BAH 2. {ECO:0000255|PROSITE- ProRule:PRU00370}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCTGGTATTTCAGTTGGCCTG	0.408			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0								ENSG00000163939						96.0	95.0	95.0					3																	52598199		2203	4300	6503	PBRM1	SO:0001587	stop_gained	0			-	HGNC	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.3742G>T	3.37:g.52598199C>A	ENSP00000296302:p.Glu1248*	Somatic	0	57	0.00		0.6159915499159303	47	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Bromodomain,pfam_BAH_dom,pfam_HMG_box_dom,superfamily_Bromodomain,superfamily_HMG_box_dom,smart_Bromodomain,smart_BAH_dom,smart_HMG_box_dom,pfscan_BAH_dom,pfscan_HMG_box_dom,pfscan_Bromodomain,prints_Bromodomain	p.E1248*	ENST00000296302.7	37	c.3742		3	.	.	.	.	.	.	.	.	.	.	C	42	9.757182	0.99256	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-15.4527	19.2735	0.94021	0.0:1.0:0.0:0.0	.	.	.	.	X	1216;1223;1248;1248;1248;1223;1263;1263;1247	.	ENSP00000296302:E1248X	E	-	1	0	PBRM1	52573239	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.920000	0.70017	2.549000	0.85964	0.655000	0.94253	GAA	-	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom		0.408	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	PBRM1	protein_coding	OTTHUMT00000327232.1	C	NM_018165	-		52598199	-1	no_errors	ENST00000296302	ensembl	human	known	74_37	nonsense	SNP	1.000	A
STC1	6781	genome.wustl.edu	37	8	23702549	23702549	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:23702549A>T	ENST00000290271.2	-	4	761	c.478T>A	c.(478-480)Tat>Aat	p.Y160N	STC1_ENST00000524323.1_Missense_Mutation_p.Y91N	NM_003155.2	NP_003146.1	P52823	STC1_HUMAN	stanniocalcin 1	160					bone development (GO:0060348)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cAMP (GO:0071320)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hypoxia (GO:0071456)|chondrocyte proliferation (GO:0035988)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endothelial cell morphogenesis (GO:0001886)|growth plate cartilage axis specification (GO:0003421)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of renal phosphate excretion (GO:1903403)|ossification (GO:0001503)|positive regulation of calcium ion import (GO:0090280)|regulation of anion transport (GO:0044070)|regulation of cardiac muscle cell contraction (GO:0086004)|response to vitamin D (GO:0033280)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26		Prostate(55;0.055)|Breast(100;0.116)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		AGTCTGTTATAGTATCTGCAT	0.522																																																	0								ENSG00000159167						103.0	96.0	98.0					8																	23702549		2203	4300	6503	STC1	SO:0001583	missense	0			-	HGNC		CCDS6043.1	8p22-p12	2008-06-23			ENSG00000159167	ENSG00000159167			11373	protein-coding gene	gene with protein product		601185		STC		9480753	Standard	NM_003155		Approved		uc003xdw.1	P52823	OTTHUMG00000097853	ENST00000290271.2:c.478T>A	8.37:g.23702549A>T	ENSP00000290271:p.Tyr160Asn	Somatic	0	31	0.00		0.6159915499159303	117	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	8	55.56	B4DN22|Q71UE5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Stanniocalcin	p.Y160N	ENST00000290271.2	37	c.478	CCDS6043.1	8	.	.	.	.	.	.	.	.	.	.	A	26.5	4.747530	0.89663	.	.	ENSG00000159167	ENST00000290271;ENST00000540277;ENST00000524323	.	.	.	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.78039	0.4221	M	0.68952	2.095	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.79933	-0.1594	9	0.87932	D	0	-9.0847	15.6301	0.76899	1.0:0.0:0.0:0.0	.	160	P52823	STC1_HUMAN	N	160;91;91	.	ENSP00000290271:Y160N	Y	-	1	0	STC1	23758494	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	8.790000	0.91844	2.367000	0.80283	0.528000	0.53228	TAT	-	pfam_Stanniocalcin		0.522	STC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STC1	protein_coding	OTTHUMT00000215143.1	A		-		23702549	-1	no_errors	ENST00000290271	ensembl	human	known	74_37	missense	SNP	1.000	T
KRTAP24-1	643803	genome.wustl.edu	37	21	31654526	31654526	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr21:31654526C>T	ENST00000340345.4	-	1	750	c.725G>A	c.(724-726)aGg>aAg	p.R242K		NM_001085455.1	NP_001078924.1	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	242	6 X 10 AA repeats of Y-[ILR]-[SVPC]- [NRTS]-[SNTG]-X-[QHRP]-[PSY]-[QSL]-[SRK].					keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|large_intestine(3)|lung(7)|urinary_tract(3)	14						GCACAAATACCTCAGAGGTGG	0.448																																																	0								ENSG00000188694						92.0	88.0	89.0					21																	31654526		1842	4092	5934	KRTAP24-1	SO:0001583	missense	0			-	HGNC	AB096935	CCDS42915.1	21q22.11	2007-11-23			ENSG00000188694	ENSG00000188694		"""Keratin associated proteins"""	33902	protein-coding gene	gene with protein product							Standard	NM_001085455		Approved	KAP24.1	uc002ynv.3	Q3LI83	OTTHUMG00000125483	ENST00000340345.4:c.725G>A	21.37:g.31654526C>T	ENSP00000339238:p.Arg242Lys	Somatic	0	45	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	33	15.38	Q1XDX0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KRTAP_PMG	p.R242K	ENST00000340345.4	37	c.725	CCDS42915.1	21	.	.	.	.	.	.	.	.	.	.	C	21.1	4.091357	0.76756	.	.	ENSG00000188694	ENST00000340345	T	0.32023	1.47	3.75	3.75	0.43078	.	0.460512	0.20990	N	0.082057	T	0.35189	0.0923	L	0.29908	0.895	0.32911	D	0.514527	D	0.76494	0.999	D	0.73708	0.981	T	0.06734	-1.0810	10	0.07030	T	0.85	-10.9873	11.3491	0.49577	0.0:1.0:0.0:0.0	.	242	Q3LI83	KR241_HUMAN	K	242	ENSP00000339238:R242K	ENSP00000339238:R242K	R	-	2	0	KRTAP24-1	30576397	0.995000	0.38212	1.000000	0.80357	0.969000	0.65631	1.628000	0.37060	2.382000	0.81193	0.557000	0.71058	AGG	-	NULL		0.448	KRTAP24-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP24-1	protein_coding	OTTHUMT00000246806.2	C	NM_001085455	-		31654526	-1	no_errors	ENST00000340345	ensembl	human	known	74_37	missense	SNP	1.000	T
FREM1	158326	genome.wustl.edu	37	9	14746430	14746430	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr9:14746430G>T	ENST00000380880.3	-	35	6958	c.6175C>A	c.(6175-6177)Cag>Aag	p.Q2059K	FREM1_ENST00000422223.2_Missense_Mutation_p.Q2059K|FREM1_ENST00000380894.1_Missense_Mutation_p.Q595K|FREM1_ENST00000380881.4_Missense_Mutation_p.Q2060K			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	2059					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		CCTGAGTGCTGGTGCCACCCG	0.488																																																	0								ENSG00000164946						135.0	138.0	137.0					9																	14746430		1992	4158	6150	FREM1	SO:0001583	missense	0			-	HGNC	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.6175C>A	9.37:g.14746430G>T	ENSP00000370262:p.Gln2059Lys	Somatic	0	46	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,superfamily_Cadherin-like,smart_C-type_lectin,pfscan_C-type_lectin	p.Q2060K	ENST00000380880.3	37	c.6178	CCDS47952.1	9	.	.	.	.	.	.	.	.	.	.	G	14.16	2.453029	0.43531	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380894;ENST00000380880	T;T;T;T	0.17054	2.3;2.3;2.3;2.3	6.03	4.19	0.49359	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (1);	0.521176	0.22413	N	0.060381	T	0.08447	0.0210	N	0.08118	0	0.20873	N	0.999834	B;B	0.06786	0.0;0.001	B;B	0.01281	0.0;0.0	T	0.26815	-1.0092	10	0.29301	T	0.29	-1.5149	9.3906	0.38370	0.2686:0.0:0.7314:0.0	.	2059;595	Q5H8C1;B7ZBX4	FREM1_HUMAN;.	K	2060;2059;595;2059	ENSP00000370263:Q2060K;ENSP00000412940:Q2059K;ENSP00000370278:Q595K;ENSP00000370262:Q2059K	ENSP00000370262:Q2059K	Q	-	1	0	FREM1	14736430	0.999000	0.42202	0.988000	0.46212	0.972000	0.66771	2.786000	0.47790	1.553000	0.49476	0.557000	0.71058	CAG	-	superfamily_C-type_lectin_fold,smart_C-type_lectin		0.488	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	protein_coding	OTTHUMT00000339474.2	G	NM_144966	-		14746430	-1	no_errors	ENST00000380881	ensembl	human	known	74_37	missense	SNP	0.977	T
CD209	30835	genome.wustl.edu	37	19	7808042	7808042	+	Silent	SNP	G	G	A	rs553008652	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:7808042G>A	ENST00000315599.7	-	7	1120	c.1098C>T	c.(1096-1098)gaC>gaT	p.D366D	CD209_ENST00000593821.1_Silent_p.D230D|CD209_ENST00000301357.8_Silent_p.D230D|CD209_ENST00000394173.4_Silent_p.D205D|CD209_ENST00000593660.1_Silent_p.D296D|CD209_ENST00000601951.1_Silent_p.D342D|CD209_ENST00000354397.6_Silent_p.D360D|CD209_ENST00000602261.1_Silent_p.D274D|CD209_ENST00000394161.5_Silent_p.D130D|CD209_ENST00000204801.8_Silent_p.D322D|CD209_ENST00000315591.8_Silent_p.D342D	NM_001144895.1|NM_001144897.1|NM_021155.3	NP_001138367.1|NP_001138369.1|NP_066978.1	Q9NNX6	CD209_HUMAN	CD209 molecule	366	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|heterophilic cell-cell adhesion (GO:0007157)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of T cell proliferation (GO:0042129)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|virion binding (GO:0046790)			endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						TACATTTGTCGTCGTTCCAGC	0.522													a|||	2	0.000399361	0.0	0.0	5008	,	,		17546	0.0		0.0	False		,,,				2504	0.002																0								ENSG00000090659						234.0	219.0	224.0					19																	7808042		2203	4300	6503	CD209	SO:0001819	synonymous_variant	0			-	HGNC	M98457	CCDS12186.1, CCDS45949.1, CCDS45950.1, CCDS45951.1, CCDS45952.1, CCDS59344.1, CCDS59345.1	19p13	2011-08-30	2006-03-28			ENSG00000090659		"""C-type lectin domain containing"", ""CD molecules"""	1641	protein-coding gene	gene with protein product		604672	"""CD209 antigen"""			1518869	Standard	NM_021155		Approved	DC-SIGN, CDSIGN, DC-SIGN1, CLEC4L	uc002mht.2	Q9NNX6		ENST00000315599.7:c.1098C>T	19.37:g.7808042G>A		Somatic	0	85	0.00		0.6159915499159303	69	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	44	51.11	A8KAM4|A8MVQ9|G5E9C4|Q2TB19|Q96QP7|Q96QP8|Q96QP9|Q96QQ0|Q96QQ1|Q96QQ2|Q96QQ3|Q96QQ4|Q96QQ5|Q96QQ6|Q96QQ7|Q96QQ8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.D366	ENST00000315599.7	37	c.1098	CCDS12186.1	19																																																																																			-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII		0.522	CD209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD209	protein_coding	OTTHUMT00000462241.1	G	NM_021155	-		7808042	-1	no_errors	ENST00000315599	ensembl	human	known	74_37	silent	SNP	0.003	A
FAM90A27P	646508	genome.wustl.edu	37	19	53786084	53786084	+	RNA	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:53786084G>T	ENST00000599085.1	+	0	60					NR_046365.1		A6NNH2	F90AR_HUMAN	family with sequence similarity 90, member A27, pseudogene								nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)										GCAGAGCGAAGCTCCGACGCA	0.557																																																	0								ENSG00000189348																																			FAM90A27P			0			-	HGNC			19q13.42	2014-03-18			ENSG00000189348	ENSG00000189348			43617	pseudogene	pseudogene							Standard	NR_046365		Approved		uc031rmv.1	A6NNH2	OTTHUMG00000182909		19.37:g.53786084G>T		Somatic	0	84	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	82	21.90		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000599085.1	37	NULL		19	.	.	.	.	.	.	.	.	.	.	G	7.667	0.686245	0.14973	.	.	ENSG00000189348	ENST00000338885	.	.	.	2.16	-4.32	0.03688	.	0.481200	0.15557	N	0.256120	T	0.28962	0.0719	.	.	.	0.23406	N	0.99774	.	.	.	.	.	.	T	0.27502	-1.0072	5	0.52906	T	0.07	.	0.8762	0.01224	0.2474:0.2446:0.3491:0.159	.	.	.	.	S	117	.	ENSP00000341223:A117S	A	+	1	0	AC092070.1	58477896	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.082000	0.03400	-1.447000	0.01943	-0.302000	0.09304	GCT	-	-		0.557	FAM90A27P-002	KNOWN	basic	processed_transcript	FAM90A27P	pseudogene	OTTHUMT00000464290.1	G	NR_046365	-		53786084	+1	no_errors	ENST00000599085	ensembl	human	known	74_37	rna	SNP	0.000	T
MYH13	8735	genome.wustl.edu	37	17	10248638	10248638	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr17:10248638G>C	ENST00000418404.3	-	14	1628	c.1465C>G	c.(1465-1467)Cag>Gag	p.Q489E	MYH13_ENST00000252172.4_Missense_Mutation_p.Q489E			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	489	Myosin motor.				cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TTGAAAAACTGTTGCAGTTTC	0.463																																																	0								ENSG00000006788						154.0	138.0	144.0					17																	10248638		2203	4297	6500	MYH13	SO:0001583	missense	0			-	HGNC	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.1465C>G	17.37:g.10248638G>C	ENSP00000404570:p.Gln489Glu	Somatic	0	154	0.00		0.6159915499159303	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	287	10.87	O95252|Q9P0U8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q489E	ENST00000418404.3	37	c.1465	CCDS45613.1	17	.	.	.	.	.	.	.	.	.	.	G	26.0	4.698000	0.88830	.	.	ENSG00000006788	ENST00000252172;ENST00000418404	D;D	0.89196	-2.48;-2.14	4.46	4.46	0.54185	Myosin head, motor domain (2);	.	.	.	.	D	0.96611	0.8894	H	0.95950	3.745	0.49582	D	0.999803	P	0.35481	0.504	P	0.60117	0.869	D	0.97357	0.9967	9	0.87932	D	0	.	17.6701	0.88214	0.0:0.0:1.0:0.0	.	489	Q9UKX3	MYH13_HUMAN	E	489;164	ENSP00000252172:Q489E;ENSP00000404570:Q164E	ENSP00000252172:Q489E	Q	-	1	0	MYH13	10189363	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.450000	0.97607	2.471000	0.83476	0.655000	0.94253	CAG	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.463	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	protein_coding	OTTHUMT00000442255.1	G	NM_003802	-		10248638	-1	no_errors	ENST00000252172	ensembl	human	known	74_37	missense	SNP	1.000	C
PKD1	5310	genome.wustl.edu	37	16	2153897	2153897	+	Splice_Site	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr16:2153897C>A	ENST00000262304.4	-	23	8370		c.e23-1		PKD1_ENST00000423118.1_Splice_Site|PKD1_ENST00000561991.1_Splice_Site	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)						anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						ATGAGGTCTCCTGCAGACATG	0.662																																																	0								ENSG00000008710						10.0	9.0	10.0					16																	2153897		2139	4244	6383	PKD1	SO:0001630	splice_region_variant	0			-	HGNC	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.8162-1G>T	16.37:g.2153897C>A		Somatic	0	41	0.00		0.6159915499159303	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	Q15140|Q15141	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e23-1	ENST00000262304.4	37	c.8162-1	CCDS32369.1	16	.	.	.	.	.	.	.	.	.	.	.	12.57	1.977743	0.34848	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101;ENST00000382481	.	.	.	4.29	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9217	0.86166	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PKD1	2093898	1.000000	0.71417	0.495000	0.27527	0.117000	0.20001	4.137000	0.58010	2.207000	0.71202	0.484000	0.47621	.	-	-		0.662	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKD1	protein_coding	OTTHUMT00000341688.1	C		-	Intron	2153897	-1	no_errors	ENST00000262304	ensembl	human	known	74_37	splice_site	SNP	0.998	A
METTL21C	196541	genome.wustl.edu	37	13	103339326	103339326	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr13:103339326C>A	ENST00000267273.6	-	3	369	c.364G>T	c.(364-366)Gga>Tga	p.G122*		NM_001010977.1	NP_001010977.1	Q5VZV1	MT21C_HUMAN	methyltransferase like 21C	122	S-adenosyl-L-methionine binding. {ECO:0000269|Ref.5}.				peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)			breast(1)|large_intestine(3)|lung(2)|skin(1)	7						AGGCCTGGTCCGGCACCAATT	0.373																																																	0								ENSG00000139780						77.0	69.0	71.0					13																	103339326		2203	4300	6503	METTL21C	SO:0001587	stop_gained	0			-	HGNC		CCDS32003.1	13q33.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000139780	ENSG00000139780			33717	protein-coding gene	gene with protein product		615259	"""chromosome 13 open reading frame 39"""	C13orf39			Standard	NM_001010977		Approved	LOC196541	uc001vpj.4	Q5VZV1	OTTHUMG00000017304	ENST00000267273.6:c.364G>T	13.37:g.103339326C>A	ENSP00000267273:p.Gly122*	Somatic	0	57	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nicotinamide_N-MeTfrase-like	p.G122*	ENST00000267273.6	37	c.364	CCDS32003.1	13	.	.	.	.	.	.	.	.	.	.	C	33	5.262163	0.95368	.	.	ENSG00000139780	ENST00000267273	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-0.3638	20.4192	0.99033	0.0:1.0:0.0:0.0	.	.	.	.	X	122	.	ENSP00000267273:G122X	G	-	1	0	METTL21C	102137327	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.138000	0.77305	2.831000	0.97527	0.650000	0.86243	GGA	-	pfam_Nicotinamide_N-MeTfrase-like		0.373	METTL21C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL21C	protein_coding	OTTHUMT00000045682.2	C	NM_001010977	-		103339326	-1	no_errors	ENST00000267273	ensembl	human	known	74_37	nonsense	SNP	1.000	A
HKDC1	80201	genome.wustl.edu	37	10	70980216	70980216	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr10:70980216T>C	ENST00000354624.5	+	1	158	c.25T>C	c.(25-27)Ttt>Ctt	p.F9L	HKDC1_ENST00000395086.2_Missense_Mutation_p.F9L|RP11-227H15.4_ENST00000450995.1_RNA	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	9					carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						CTTGATGGCATTTTACTTCAG	0.498																																																	0								ENSG00000156510						90.0	81.0	84.0					10																	70980216		2203	4300	6503	HKDC1	SO:0001583	missense	0			-	HGNC		CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.25T>C	10.37:g.70980216T>C	ENSP00000346643:p.Phe9Leu	Somatic	0	58	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	15	66.67	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.F9L	ENST00000354624.5	37	c.25	CCDS7288.1	10	.	.	.	.	.	.	.	.	.	.	T	20.2	3.955926	0.73902	.	.	ENSG00000156510	ENST00000354624;ENST00000395087;ENST00000395086	D;D	0.98889	-5.21;-5.21	5.44	5.44	0.79542	.	0.121431	0.56097	D	0.000030	D	0.96824	0.8963	L	0.44542	1.39	0.49687	D	0.99981	B	0.02656	0.0	B	0.04013	0.001	D	0.94924	0.8076	10	0.41790	T	0.15	-4.6952	15.5123	0.75793	0.0:0.0:0.0:1.0	.	9	Q2TB90	HKDC1_HUMAN	L	9	ENSP00000346643:F9L;ENSP00000378521:F9L	ENSP00000346643:F9L	F	+	1	0	HKDC1	70650222	1.000000	0.71417	0.980000	0.43619	0.963000	0.63663	7.546000	0.82137	2.065000	0.61736	0.533000	0.62120	TTT	-	NULL		0.498	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HKDC1	protein_coding	OTTHUMT00000048389.1	T	NM_025130	-		70980216	+1	no_errors	ENST00000354624	ensembl	human	known	74_37	missense	SNP	0.997	C
DUSP19	142679	genome.wustl.edu	37	2	183960369	183960369	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:183960369C>T	ENST00000354221.4	+	4	812	c.637C>T	c.(637-639)Cag>Tag	p.Q213*	AC064871.3_ENST00000444562.1_RNA|DUSP19_ENST00000469344.1_3'UTR|DUSP19_ENST00000342619.6_Nonsense_Mutation_p.Q162*|AC064871.3_ENST00000413954.1_RNA	NM_080876.3	NP_543152.1	Q8WTR2	DUS19_HUMAN	dual specificity phosphatase 19	213					inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase activity (GO:0045860)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	JUN kinase phosphatase activity (GO:0008579)|MAP-kinase scaffold activity (GO:0005078)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase activator activity (GO:0030295)|protein kinase inhibitor activity (GO:0004860)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/threonine phosphatase activity (GO:0008330)			breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(4)|pancreas(1)	17						TGACAGAATACAGGAGAACAG	0.403																																																	0								ENSG00000162999						93.0	90.0	91.0					2																	183960369		2203	4300	6503	DUSP19	SO:0001587	stop_gained	0			-	HGNC	AB038770	CCDS2289.1, CCDS46469.1	2q32.1	2011-06-09			ENSG00000162999	ENSG00000162999		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	18894	protein-coding gene	gene with protein product		611437					Standard	NM_080876		Approved	SKRP1, DUSP17	uc002upd.3	Q8WTR2	OTTHUMG00000132622	ENST00000354221.4:c.637C>T	2.37:g.183960369C>T	ENSP00000346160:p.Gln213*	Somatic	0	45	0.00		0.6159915499159303	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B2RA79|Q547H4|Q8WYN4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP	p.Q213*	ENST00000354221.4	37	c.637	CCDS2289.1	2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.351086	0.82132	.	.	ENSG00000162999	ENST00000342619;ENST00000354221	.	.	.	5.56	0.453	0.16639	.	2.446060	0.01435	N	0.014884	.	.	.	.	.	.	0.20307	N	0.999912	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	.	5.1541	0.15025	0.4328:0.3084:0.1959:0.063	.	.	.	.	X	162;213	.	ENSP00000343905:Q162X	Q	+	1	0	DUSP19	183668614	0.255000	0.24002	0.000000	0.03702	0.141000	0.21300	0.434000	0.21494	-0.121000	0.11787	-0.924000	0.02725	CAG	-	NULL		0.403	DUSP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP19	protein_coding	OTTHUMT00000255866.1	C		-		183960369	+1	no_errors	ENST00000354221	ensembl	human	known	74_37	nonsense	SNP	0.000	T
DGAT1	8694	genome.wustl.edu	37	8	145541664	145541664	+	Silent	SNP	G	G	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:145541664G>C	ENST00000332324.4	-	9	1041	c.768C>G	c.(766-768)ctC>ctG	p.L256L	DGAT1_ENST00000531896.1_Missense_Mutation_p.L287V|GS1-393G12.12_ENST00000525023.1_RNA|DGAT1_ENST00000527438.1_5'Flank	NM_012079.4	NP_036211.2	O75907	DGAT1_HUMAN	diacylglycerol O-acyltransferase 1	256					acylglycerol acyl-chain remodeling (GO:0036155)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|lipid storage (GO:0019915)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	diacylglycerol O-acyltransferase activity (GO:0004144)|retinol O-fatty-acyltransferase activity (GO:0050252)|transferase activity, transferring acyl groups (GO:0016746)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	9	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;7.67e-40)|all cancers(56;7.88e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			TGGGGGCGAAGAGGAAGTAGT	0.617																																																	0								ENSG00000185000						36.0	42.0	40.0					8																	145541664		2203	4295	6498	DGAT1	SO:0001819	synonymous_variant	0			-	HGNC	AF059202	CCDS6420.1	8q24.3	2014-05-06	2010-06-24	2001-11-09	ENSG00000185000	ENSG00000185000	2.3.1.20		2843	protein-coding gene	gene with protein product		604900	"""diacylglycerol O-acyltransferase homolog 1 (mouse)"""			9756920	Standard	NM_012079		Approved	ARGP1, DGAT	uc003zbv.3	O75907	OTTHUMG00000174606	ENST00000332324.4:c.768C>G	8.37:g.145541664G>C		Somatic	0	19	0.00		0.6159915499159303	55	33.73	28	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	11	31.25	B2RWQ2|D3DWL6|Q96BB8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_PEP-util_enz_mobile_dom	p.L287V	ENST00000332324.4	37	c.859	CCDS6420.1	8	.	.	.	.	.	.	.	.	.	.	G	10.67	1.415904	0.25552	.	.	ENSG00000185000	ENST00000531896	.	.	.	4.68	-2.85	0.05734	.	0.639724	0.15908	N	0.238735	T	0.31888	0.0811	.	.	.	0.20074	N	0.999938	.	.	.	.	.	.	T	0.30534	-0.9975	6	0.66056	D	0.02	-23.293	2.8497	0.05554	0.144:0.3315:0.4075:0.117	.	.	.	.	V	287	.	ENSP00000432795:L287V	L	-	1	0	DGAT1	145512472	0.882000	0.30256	0.994000	0.49952	0.950000	0.60333	-0.045000	0.12003	-0.171000	0.10797	0.484000	0.47621	CTT	-	NULL		0.617	DGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGAT1	protein_coding	OTTHUMT00000382059.3	G	NM_012079	-		145541664	-1	no_errors	ENST00000531896	ensembl	human	putative	74_37	missense	SNP	0.929	C
TFCP2L1	29842	genome.wustl.edu	37	2	121992844	121992844	+	Silent	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:121992844G>T	ENST00000263707.5	-	11	1144	c.1047C>A	c.(1045-1047)atC>atA	p.I349I		NM_014553.2	NP_055368.1	Q9NZI6	TF2L1_HUMAN	transcription factor CP2-like 1	349					cell morphogenesis (GO:0000902)|cytoplasm organization (GO:0007028)|determination of adult lifespan (GO:0008340)|epithelial cell maturation (GO:0002070)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of growth (GO:0045927)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|salivary gland development (GO:0007431)|steroid biosynthetic process (GO:0006694)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)|pancreas(2)|skin(1)|stomach(1)	22	Renal(3;0.01)					CGGGACCACAGATCTGGACCA	0.552																																																	0								ENSG00000115112						106.0	101.0	103.0					2																	121992844		2203	4300	6503	TFCP2L1	SO:0001819	synonymous_variant	0			-	HGNC	AF198488	CCDS2134.1	2q14	2008-02-05			ENSG00000115112	ENSG00000115112			17925	protein-coding gene	gene with protein product		609785				10644752, 11073954	Standard	NM_014553		Approved	LBP-9, CRTR1	uc002tmx.3	Q9NZI6	OTTHUMG00000131443	ENST00000263707.5:c.1047C>A	2.37:g.121992844G>T		Somatic	0	41	0.00		0.6159915499159303	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q4ZG43	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CP2,superfamily_SAM/pointed	p.I349	ENST00000263707.5	37	c.1047	CCDS2134.1	2																																																																																			-	superfamily_SAM/pointed		0.552	TFCP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFCP2L1	protein_coding	OTTHUMT00000338539.1	G	NM_014553	-		121992844	-1	no_errors	ENST00000263707	ensembl	human	known	74_37	silent	SNP	1.000	T
ITIH3	3699	genome.wustl.edu	37	3	52831124	52831124	+	Silent	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr3:52831124C>A	ENST00000449956.2	+	5	396	c.390C>A	c.(388-390)gcC>gcA	p.A130A	ITIH3_ENST00000416872.2_Silent_p.A130A	NM_002217.3	NP_002208.3	Q06033	ITIH3_HUMAN	inter-alpha-trypsin inhibitor heavy chain 3	130	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(6)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		TGGTCAGGGCCTCTGGGAGGA	0.617																																																	0								ENSG00000162267						32.0	36.0	35.0					3																	52831124		2076	4209	6285	ITIH3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS46845.1	3p21.1	2011-10-26	2011-10-26		ENSG00000162267	ENSG00000162267			6168	protein-coding gene	gene with protein product	"""pre-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha-trypsin inhibitor heavy chain H3"""	146650	"""inter-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha (globulin) inhibitor H3"""			2465147, 10100603	Standard	NM_002217		Approved	H3P	uc003dfv.2	Q06033	OTTHUMG00000158956	ENST00000449956.2:c.390C>A	3.37:g.52831124C>A		Somatic	0	41	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q3B7H5|Q53F06|Q6LAM2|Q99085	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.A130	ENST00000449956.2	37	c.390	CCDS46845.1	3																																																																																			-	pfam_VIT,smart_VIT		0.617	ITIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH3	protein_coding	OTTHUMT00000352668.2	C	NM_002217	-		52831124	+1	no_errors	ENST00000449956	ensembl	human	known	74_37	silent	SNP	1.000	A
ROBO1	6091	genome.wustl.edu	37	3	78766516	78766516	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr3:78766516C>A	ENST00000464233.1	-	7	939	c.826G>T	c.(826-828)Gat>Tat	p.D276Y	ROBO1_ENST00000495273.1_Missense_Mutation_p.D237Y|ROBO1_ENST00000436010.2_Missense_Mutation_p.D237Y|ROBO1_ENST00000467549.1_Missense_Mutation_p.D237Y	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	276	Ig-like C2-type 3.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		GCACTGTCATCCACAGTTACT	0.418																																																	0								ENSG00000169855						194.0	183.0	187.0					3																	78766516		1886	4113	5999	ROBO1	SO:0001583	missense	0			-	HGNC	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.826G>T	3.37:g.78766516C>A	ENSP00000420321:p.Asp276Tyr	Somatic	0	50	0.00		0.6159915499159303	27	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.D276Y	ENST00000464233.1	37	c.826	CCDS54611.1	3	.	.	.	.	.	.	.	.	.	.	C	26.3	4.729330	0.89390	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	5.54	5.54	0.83059	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.043683	0.85682	D	0.000000	T	0.77896	0.4199	L	0.45581	1.43	0.80722	D	1	D;D;D;D	0.76494	0.999;0.996;0.998;0.999	D;D;D;D	0.75484	0.986;0.969;0.98;0.975	T	0.74999	-0.3472	9	.	.	.	.	19.4858	0.95028	0.0:1.0:0.0:0.0	.	276;237;237;237	Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	ROBO1_HUMAN;.;.;.	Y	237;237;276;237;237;276	ENSP00000406043:D237Y;ENSP00000420321:D276Y;ENSP00000420637:D237Y;ENSP00000417992:D237Y	.	D	-	1	0	ROBO1	78849206	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.294000	0.78760	2.607000	0.88179	0.462000	0.41574	GAT	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.418	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO1	protein_coding	OTTHUMT00000352610.1	C	NM_002941	-		78766516	-1	no_errors	ENST00000464233	ensembl	human	known	74_37	missense	SNP	1.000	A
USP17L2	377630	genome.wustl.edu	37	8	11995398	11995398	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:11995398A>G	ENST00000333796.3	-	1	1188	c.872T>C	c.(871-873)cTt>cCt	p.L291P	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	291	USP.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						ATTCTTGGCAAGTTTGTTGCC	0.502																																																	0								ENSG00000223443						22.0	26.0	25.0					8																	11995398		1355	3008	4363	USP17L2	SO:0001583	missense	0			-	HGNC	BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.872T>C	8.37:g.11995398A>G	ENSP00000333329:p.Leu291Pro	Somatic	0	98	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	83	25.89		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfam_HABP4_PAIRBP1-bd,pfscan_Peptidase_C19/C67	p.L291P	ENST00000333796.3	37	c.872	CCDS43713.1	8	.	.	.	.	.	.	.	.	.	.	A	9.055	0.993040	0.19043	.	.	ENSG00000223443	ENST00000333796	T	0.07216	3.21	0.745	0.745	0.18359	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.555420	0.14724	N	0.302170	T	0.23133	0.0559	M	0.86805	2.84	0.21355	N	0.999716	P	0.39748	0.686	P	0.55455	0.776	T	0.09143	-1.0688	10	0.87932	D	0	.	3.6197	0.08090	0.5857:0.4142:0.0:1.0E-4	.	291	Q6R6M4	U17L2_HUMAN	P	291	ENSP00000333329:L291P	ENSP00000333329:L291P	L	-	2	0	USP17L2	12032807	0.009000	0.17119	0.002000	0.10522	0.003000	0.03518	1.678000	0.37586	0.611000	0.30052	0.386000	0.25728	CTT	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.502	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP17L2	protein_coding	OTTHUMT00000383303.2	A	NM_201402	-		11995398	-1	no_errors	ENST00000333796	ensembl	human	known	74_37	missense	SNP	0.001	G
NSUN5	55695	genome.wustl.edu	37	7	72717521	72717521	+	3'UTR	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:72717521G>A	ENST00000252594.6	-	0	1377				NSUN5_ENST00000428206.1_3'UTR|NSUN5_ENST00000438747.2_Missense_Mutation_p.A431V|NSUN5_ENST00000310326.8_Splice_Site_p.S429S			Q96P11	NSUN5_HUMAN	NOP2/Sun domain family, member 5						rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	8		Lung NSC(55;0.163)				GGCCTGTGAGGCTGAGCTAGA	0.587																																																	0								ENSG00000130305						122.0	107.0	112.0					7																	72717521		2203	4300	6503	NSUN5	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF420249	CCDS5546.1, CCDS5547.1, CCDS55118.1, CCDS55119.1	7q11.23	2010-04-08	2009-11-23	2005-01-14	ENSG00000130305	ENSG00000130305		"""NOP2/Sun domain containing"""	16385	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 5A"""	615732	"""Williams Beuren syndrome chromosome region 20A"", ""NOL1/NOP2/Sun domain family, member 5"""	WBSCR20, WBSCR20A		11978965, 12073013	Standard	NM_148956		Approved	NOL1R, p120, (NOL1), FLJ10267, NSUN5A, Ynl022cL	uc011kev.2	Q96P11	OTTHUMG00000129869	ENST00000252594.6:c.*72C>T	7.37:g.72717521G>A		Somatic	0	90	0.00		0.6159915499159303	103	22.56	30	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	77	14.44	B3KX04|B4DP79|G3V0G9|Q6ZUI8|Q96HT9|Q9NW70	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fmu/NOL1/Nop2p,prints_RCMT	p.A431V	ENST00000252594.6	37	c.1292	CCDS5547.1	7	.	.	.	.	.	.	.	.	.	.	.	10.24	1.295606	0.23564	.	.	ENSG00000130305	ENST00000438747	T	0.12147	2.71	4.28	-2.69	0.06022	.	1.499030	0.03680	N	0.245433	T	0.08044	0.0201	.	.	.	0.23542	N	0.997452	B	0.02656	0.0	B	0.08055	0.003	T	0.34179	-0.9839	9	0.27082	T	0.32	.	5.5804	0.17247	0.1586:0.2598:0.5816:0.0	.	431	Q96P11-2	.	V	431	ENSP00000388464:A431V	ENSP00000388464:A431V	A	-	2	0	NSUN5	72355457	0.000000	0.05858	0.008000	0.14137	0.320000	0.28249	-0.249000	0.08842	-0.323000	0.08602	0.289000	0.19496	GCC	-	NULL		0.587	NSUN5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	NSUN5	protein_coding	OTTHUMT00000252113.1	G	NM_148956	-		72717521	-1	no_errors	ENST00000438747	ensembl	human	known	74_37	missense	SNP	0.027	A
PTPRB	5787	genome.wustl.edu	37	12	70988365	70988365	+	Silent	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr12:70988365C>A	ENST00000261266.5	-	4	773	c.744G>T	c.(742-744)gtG>gtT	p.V248V	PTPRB_ENST00000551525.1_Silent_p.V465V|PTPRB_ENST00000451516.2_Silent_p.V248V|PTPRB_ENST00000334414.6_Silent_p.V466V|PTPRB_ENST00000550358.1_Silent_p.V466V|PTPRB_ENST00000538174.2_5'UTR|PTPRB_ENST00000550857.1_Silent_p.V248V|PTPRB_ENST00000538708.1_Silent_p.V248V	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	248	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CATGTTTGTCCACAACACCGC	0.502																																																	0								ENSG00000127329						160.0	162.0	161.0					12																	70988365		2019	4204	6223	PTPRB	SO:0001819	synonymous_variant	0			-	HGNC	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.744G>T	12.37:g.70988365C>A		Somatic	0	69	0.00		0.6159915499159303	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Ricin_B_lectin,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.V466	ENST00000261266.5	37	c.1398	CCDS44944.1	12																																																																																			-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.502	PTPRB-007	KNOWN	basic|CCDS	protein_coding	PTPRB	protein_coding	OTTHUMT00000404439.1	C		-		70988365	-1	no_errors	ENST00000334414	ensembl	human	known	74_37	silent	SNP	0.968	A
GLDN	342035	genome.wustl.edu	37	15	51696485	51696485	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr15:51696485G>T	ENST00000335449.6	+	10	1246	c.1190G>T	c.(1189-1191)gGc>gTc	p.G397V	GLDN_ENST00000396399.2_Missense_Mutation_p.G273V	NM_181789.2	NP_861454.2	Q6ZMI3	GLDN_HUMAN	gliomedin	397	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|microvillus organization (GO:0032528)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19				all cancers(107;0.00194)|GBM - Glioblastoma multiforme(94;0.00942)		TTTGAATTTGGCCAGGAAACA	0.353																																																	0								ENSG00000186417						131.0	141.0	137.0					15																	51696485		2196	4293	6489	GLDN	SO:0001583	missense	0			-	HGNC	AY358144	CCDS10140.2	15q15.3	2008-02-05	2005-10-06	2005-10-06	ENSG00000186417	ENSG00000186417			29514	protein-coding gene	gene with protein product		608603	"""collomin"""	COLM		16039564, 12642876	Standard	XM_005254338		Approved	CRG-L2, CLOM, colmedin, UNC-112	uc002aba.3	Q6ZMI3	OTTHUMG00000131746	ENST00000335449.6:c.1190G>T	15.37:g.51696485G>T	ENSP00000335196:p.Gly397Val	Somatic	0	61	0.00		0.6159915499159303	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q6UXZ7|Q7Z359	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Olfac-like,pfam_Collagen,smart_Olfac-like,pfscan_Olfac-like	p.G397V	ENST00000335449.6	37	c.1190	CCDS10140.2	15	.	.	.	.	.	.	.	.	.	.	G	11.45	1.643705	0.29246	.	.	ENSG00000186417	ENST00000335449;ENST00000396399;ENST00000537339	D;D	0.90324	-2.65;-2.65	5.71	2.65	0.31530	Olfactomedin-like (3);	0.167970	0.28262	N	0.015987	T	0.82075	0.4958	L	0.29908	0.895	0.53688	D	0.999977	P	0.40360	0.714	B	0.40782	0.34	T	0.76661	-0.2877	10	0.31617	T	0.26	.	4.2602	0.10737	0.3127:0.3334:0.354:0.0	.	397	Q6ZMI3	GLDN_HUMAN	V	397;273;273	ENSP00000335196:G397V;ENSP00000379681:G273V	ENSP00000335196:G397V	G	+	2	0	GLDN	49483777	0.067000	0.21026	1.000000	0.80357	0.776000	0.43924	0.518000	0.22847	1.423000	0.47198	0.563000	0.77884	GGC	-	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like		0.353	GLDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLDN	protein_coding	OTTHUMT00000254667.2	G	NM_181789	-		51696485	+1	no_errors	ENST00000335449	ensembl	human	known	74_37	missense	SNP	0.925	T
NLGN4X	57502	genome.wustl.edu	37	X	5811526	5811526	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:5811526G>T	ENST00000381095.3	-	6	2410	c.1783C>A	c.(1783-1785)Cct>Act	p.P595T	NLGN4X_ENST00000275857.6_Missense_Mutation_p.P595T|NLGN4X_ENST00000538097.1_Missense_Mutation_p.P595T|NLGN4X_ENST00000381093.2_Missense_Mutation_p.P615T|NLGN4X_ENST00000381092.1_Missense_Mutation_p.P595T	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	595					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)	p.P595S(1)		breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						TGCAAATGAGGAACGAGTTCC	0.468																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000146938						173.0	161.0	165.0					X																	5811526		2170	4258	6428	NLGN4X	SO:0001583	missense	0			-	HGNC	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.1783C>A	X.37:g.5811526G>T	ENSP00000370485:p.Pro595Thr	Somatic	0	29	0.00		0.6159915499159303	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	Q6UX10|Q9ULG0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.P615T	ENST00000381095.3	37	c.1843	CCDS14126.1	X	.	.	.	.	.	.	.	.	.	.	G	16.66	3.185732	0.57909	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2	4.1	4.1	0.47936	.	0.000000	0.36628	N	0.002493	T	0.75700	0.3885	M	0.79123	2.44	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.998;0.981;0.995	T	0.80289	-0.1445	10	0.87932	D	0	.	14.7802	0.69760	0.0:0.0:1.0:0.0	.	652;595;615	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	T	595;615;595;595;595	ENSP00000370485:P595T;ENSP00000370483:P615T;ENSP00000275857:P595T;ENSP00000370482:P595T;ENSP00000439203:P595T	ENSP00000275857:P595T	P	-	1	0	NLGN4X	5821526	1.000000	0.71417	0.011000	0.14972	0.724000	0.41520	8.442000	0.90317	1.654000	0.50703	0.513000	0.50165	CCT	-	NULL		0.468	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	NLGN4X	protein_coding	OTTHUMT00000055673.1	G	NM_020742	-		5811526	-1	no_errors	ENST00000381093	ensembl	human	known	74_37	missense	SNP	0.992	T
ZMAT1	84460	genome.wustl.edu	37	X	101159271	101159271	+	Missense_Mutation	SNP	G	G	T	rs367645895		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:101159271G>T	ENST00000372782.3	-	3	201	c.154C>A	c.(154-156)Ctt>Att	p.L52I	ZMAT1_ENST00000458570.1_5'UTR|ZMAT1_ENST00000540921.1_Missense_Mutation_p.L52I	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	52						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						TCTGTAAAAAGTTCAGCCTTT	0.318																																																	0								ENSG00000166432						106.0	97.0	100.0					X																	101159271		2201	4300	6501	ZMAT1	SO:0001583	missense	0			-	HGNC	Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.154C>A	X.37:g.101159271G>T	ENSP00000361868:p.Leu52Ile	Somatic	0	48	0.00		0.6159915499159303	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	51	29.17	Q8NDS3|Q96JN6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Asn/Gln_tRNA_amidoTrfrase-rel,smart_Znf_U1,smart_Znf_C2H2-like	p.L52I	ENST00000372782.3	37	c.154	CCDS35348.1	X	.	.	.	.	.	.	.	.	.	.	G	15.98	2.992989	0.54041	.	.	ENSG00000166432	ENST00000372782;ENST00000540921	T;T	0.15718	2.4;2.4	4.75	0.981	0.19756	.	2.946150	0.01654	N	0.024720	T	0.08447	0.0210	N	0.05383	-0.06	0.09310	N	0.999999	P	0.42827	0.791	B	0.29785	0.107	T	0.29058	-1.0024	10	0.52906	T	0.07	2.3531	7.6487	0.28336	0.3934:0.0:0.6066:0.0	.	52	Q5H9K5	ZMAT1_HUMAN	I	52	ENSP00000361868:L52I;ENSP00000437529:L52I	ENSP00000361868:L52I	L	-	1	0	ZMAT1	101045927	0.805000	0.28982	0.004000	0.12327	0.981000	0.71138	0.744000	0.26245	-0.035000	0.13691	0.590000	0.80494	CTT	-	NULL		0.318	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMAT1	protein_coding	OTTHUMT00000057598.1	G		-		101159271	-1	no_errors	ENST00000372782	ensembl	human	known	74_37	missense	SNP	0.052	T
LCT	3938	genome.wustl.edu	37	2	136548305	136548305	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:136548305G>T	ENST00000264162.2	-	15	5268	c.5258C>A	c.(5257-5259)tCc>tAc	p.S1753Y		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1753	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TTCCCGCTGGGACACTCCATT	0.507																																																	0								ENSG00000115850						157.0	131.0	140.0					2																	136548305		2203	4300	6503	LCT	SO:0001583	missense	0			-	HGNC	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.5258C>A	2.37:g.136548305G>T	ENSP00000264162:p.Ser1753Tyr	Somatic	0	55	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q4ZG58	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.S1753Y	ENST00000264162.2	37	c.5258	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	G	20.9	4.073172	0.76415	.	.	ENSG00000115850	ENST00000264162	T	0.35605	1.3	6.06	6.06	0.98353	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.67757	0.2927	M	0.87900	2.915	0.80722	D	1	D	0.56968	0.978	D	0.69142	0.962	T	0.70905	-0.4745	10	0.87932	D	0	-36.3897	20.6208	0.99490	0.0:0.0:1.0:0.0	.	1753	P09848	LPH_HUMAN	Y	1753	ENSP00000264162:S1753Y	ENSP00000264162:S1753Y	S	-	2	0	LCT	136264775	1.000000	0.71417	0.862000	0.33874	0.347000	0.29111	9.869000	0.99810	2.882000	0.98803	0.655000	0.94253	TCC	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF		0.507	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	protein_coding	OTTHUMT00000254657.1	G	NM_002299	-		136548305	-1	no_errors	ENST00000264162	ensembl	human	known	74_37	missense	SNP	1.000	T
SRPK2	6733	genome.wustl.edu	37	7	104758460	104758460	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:104758460C>T	ENST00000393651.3	-	16	2012	c.1925G>A	c.(1924-1926)cGa>cAa	p.R642Q	SRPK2_ENST00000489828.1_Missense_Mutation_p.R631Q|SRPK2_ENST00000357311.3_Missense_Mutation_p.R631Q|SRPK2_ENST00000493638.1_5'Flank	NM_182692.1	NP_872634.1			SRSF protein kinase 2											NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(11)|large_intestine(6)|lung(4)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	35						GGTGATGTGTCGCAGTTCTCC	0.483																																																	0								ENSG00000135250						70.0	60.0	64.0					7																	104758460		2203	4300	6503	SRPK2	SO:0001583	missense	0			-	HGNC	U88666	CCDS5735.1, CCDS34724.1	7q22-q31.1	2010-06-23	2010-06-23		ENSG00000135250	ENSG00000135250			11306	protein-coding gene	gene with protein product	"""SR protein kinase 2"", ""serine/arginine-rich splicing factor kinase 2"""	602980	"""SFRS protein kinase 2"""			8208298, 9472028	Standard	NM_182692		Approved	SFRSK2	uc003vcv.4	P78362	OTTHUMG00000157405	ENST00000393651.3:c.1925G>A	7.37:g.104758460C>T	ENSP00000377262:p.Arg642Gln	Somatic	0	28	0.00		0.6159915499159303	85	50.87	88	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	39	32.76		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R642Q	ENST00000393651.3	37	c.1925	CCDS34724.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.2|22.2	4.258986|4.258986	0.80246|0.80246	.|.	.|.	ENSG00000135250|ENSG00000135250	ENST00000474770|ENST00000393651;ENST00000357311;ENST00000489828	.|T;T;T	.|0.20332	.|2.08;2.08;2.08	5.76|5.76	5.76|5.76	0.90799|0.90799	.|Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.38983|0.38983	0.1061|0.1061	L|L	0.46819|0.46819	1.47|1.47	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.999	.|P;P	.|0.59012	.|0.85;0.8	T|T	0.02320|0.02320	-1.1177|-1.1177	5|10	.|0.59425	.|D	.|0.04	-19.5337|-19.5337	20.3242|20.3242	0.98691|0.98691	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|642;631	.|P78362-2;P78362	.|.;SRPK2_HUMAN	N|Q	147|642;631;631	.|ENSP00000377262:R642Q;ENSP00000349863:R631Q;ENSP00000419791:R631Q	.|ENSP00000349863:R631Q	D|R	-|-	1|2	0|0	SRPK2|SRPK2	104545696|104545696	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.920000|0.920000	0.55202|0.55202	6.030000|6.030000	0.70903|0.70903	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	GAC|CGA	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom		0.483	SRPK2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRPK2	protein_coding	OTTHUMT00000348723.1	C	NM_182691	-		104758460	-1	no_errors	ENST00000393651	ensembl	human	known	74_37	missense	SNP	1.000	T
ELMSAN1	91748	genome.wustl.edu	37	14	74205954	74205956	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	TGC	TGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr14:74205954_74205956delTGC	ENST00000286523.5	-	2	1538_1540	c.756_758delGCA	c.(754-759)cagcaa>caa	p.252_253QQ>Q	ELMSAN1_ENST00000486739.1_5'Flank|ELMSAN1_ENST00000394071.2_In_Frame_Del_p.252_253QQ>Q	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	252	Gln-rich.|Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										ctgctgtggttgctgctgctgct	0.645																																																	0								ENSG00000156030																																			ELMSAN1	SO:0001651	inframe_deletion	0				HGNC	BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.756_758delGCA	14.37:g.74205963_74205965delTGC	ENSP00000286523:p.Gln253del	Somatic	0	39	0.00		0.6159915499159303	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	Q6PK13|Q6PK59|Q6ZS23	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.Q253in_frame_del	ENST00000286523.5	37	c.758_756	CCDS9819.1	14																																																																																			-	NULL		0.645	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMSAN1	protein_coding	OTTHUMT00000317793.1	TGC	NM_194278			74205956	-1	no_errors	ENST00000286523	ensembl	human	known	74_37	in_frame_del	DEL	0.074:0.180:0.001	-
VPS4A	27183	genome.wustl.edu	37	16	69353364	69353364	+	Missense_Mutation	SNP	G	G	A	rs573192094		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr16:69353364G>A	ENST00000254950.11	+	6	694	c.538G>A	c.(538-540)Gtg>Atg	p.V180M	COG8_ENST00000564419.1_5'Flank|RP11-343C2.11_ENST00000570054.2_Missense_Mutation_p.V204M	NM_013245.2	NP_037377.1			vacuolar protein sorting 4 homolog A (S. cerevisiae)											NS(1)|central_nervous_system(1)|large_intestine(2)|lung(3)	7		Ovarian(137;0.101)				GGCCAAAGCCGTGGCAACAGA	0.582																																																	0								ENSG00000132612						55.0	60.0	59.0					16																	69353364		2019	4178	6197	VPS4A	SO:0001583	missense	0			-	HGNC	AF112215	CCDS45517.1	16q23.1	2010-04-21	2006-04-04		ENSG00000132612	ENSG00000132612		"""ATPases / AAA-type"""	13488	protein-coding gene	gene with protein product		609982	"""vacuolar protein sorting 4A (yeast homolog)"", ""vacuolar protein sorting 4A (yeast)"""			10637304, 11563910	Standard	NM_013245		Approved	VPS4, VPS4-1, FLJ22197, SKD2, SKD1, SKD1A	uc002eww.3	Q9UN37		ENST00000254950.11:c.538G>A	16.37:g.69353364G>A	ENSP00000254950:p.Val180Met	Somatic	0	65	0.00		0.6159915499159303	143	45.00	117	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	22	40.54		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_MIT,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_MIT,smart_AAA+_ATPase	p.V180M	ENST00000254950.11	37	c.538	CCDS45517.1	16	.	.	.	.	.	.	.	.	.	.	G	33	5.208627	0.95069	.	.	ENSG00000132612	ENST00000254950	D	0.95307	-3.67	6.06	6.06	0.98353	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.97349	0.9133	M	0.77712	2.385	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.97286	0.9921	10	0.87932	D	0	-29.0773	20.2159	0.98296	0.0:0.0:1.0:0.0	.	180	Q9UN37	VPS4A_HUMAN	M	180	ENSP00000254950:V180M	ENSP00000254950:V180M	V	+	1	0	VPS4A	67910865	1.000000	0.71417	0.983000	0.44433	0.874000	0.50279	9.858000	0.99539	2.882000	0.98803	0.655000	0.94253	GTG	-	pfam_ATPase_AAA_core,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.582	VPS4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS4A	protein_coding	OTTHUMT00000430563.3	G	NM_013245	-		69353364	+1	no_errors	ENST00000254950	ensembl	human	known	74_37	missense	SNP	1.000	A
RAD51AP2	729475	genome.wustl.edu	37	2	17699541	17699541	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:17699541C>A	ENST00000399080.2	-	1	165	c.142G>T	c.(142-144)Ggc>Tgc	p.G48C		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	48										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					AGTCGCCAGCCCGCCTTAAAG	0.557																																																	0								ENSG00000214842						72.0	76.0	74.0					2																	17699541		1905	4119	6024	RAD51AP2	SO:0001583	missense	0			-	HGNC	AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.142G>T	2.37:g.17699541C>A	ENSP00000382030:p.Gly48Cys	Somatic	0	41	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G48C	ENST00000399080.2	37	c.142	CCDS42656.1	2	.	.	.	.	.	.	.	.	.	.	C	10.38	1.334049	0.24253	.	.	ENSG00000214842	ENST00000399080	T	0.33865	1.39	3.72	1.61	0.23674	.	.	.	.	.	T	0.35364	0.0929	N	0.24115	0.695	0.09310	N	1	D	0.69078	0.997	P	0.60345	0.873	T	0.11991	-1.0565	9	0.66056	D	0.02	2.3002	4.1663	0.10308	0.0:0.6159:0.2292:0.1549	.	48	Q09MP3	R51A2_HUMAN	C	48	ENSP00000382030:G48C	ENSP00000382030:G48C	G	-	1	0	RAD51AP2	17563022	0.000000	0.05858	0.070000	0.20053	0.020000	0.10135	-0.035000	0.12205	0.405000	0.25532	0.591000	0.81541	GGC	-	NULL		0.557	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD51AP2	protein_coding	OTTHUMT00000323801.3	C	NM_001099218	-		17699541	-1	no_errors	ENST00000399080	ensembl	human	known	74_37	missense	SNP	0.070	A
ST20	400410	genome.wustl.edu	37	15	80215134	80215134	+	Intron	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr15:80215134G>T	ENST00000485386.1	-	1	251				C15ORF37_ENST00000542003.1_5'Flank|ST20-MTHFS_ENST00000479961.1_Intron|ST20-MTHFS_ENST00000494999.1_Intron|C15orf37_ENST00000560255.1_Nonsense_Mutation_p.E7*			Q9HBF5	ST20_HUMAN	suppressor of tumorigenicity 20						extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)	mitochondrial outer membrane (GO:0005741)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4						ACCAGCATCCGAAAGCTGGTC	0.557																																																	0								ENSG00000259642						52.0	57.0	56.0					15																	80215134		1935	4139	6074	C15orf37	SO:0001627	intron_variant	0			-	HGNC	AF249277	CCDS42067.1	15q25.1	2007-07-16				ENSG00000180953			33520	protein-coding gene	gene with protein product							Standard	NM_001100879		Approved	HCCS-1		Q9HBF5		ENST00000485386.1:c.10+659C>A	15.37:g.80215134G>T		Somatic	0	41	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E7*	ENST00000485386.1	37	c.19	CCDS42067.1	15																																																																																			-	NULL		0.557	ST20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf37	protein_coding	OTTHUMT00000416729.1	G		-		80215134	+1	no_errors	ENST00000560255	ensembl	human	known	74_37	nonsense	SNP	0.052	T
MLH1	4292	genome.wustl.edu	37	3	37070375	37070375	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr3:37070375A>T	ENST00000231790.2	+	13	1726	c.1510A>T	c.(1510-1512)Act>Tct	p.T504S	MLH1_ENST00000455445.2_Missense_Mutation_p.T263S|MLH1_ENST00000435176.1_Missense_Mutation_p.T406S|MLH1_ENST00000539477.1_Missense_Mutation_p.T263S|MLH1_ENST00000458205.2_Missense_Mutation_p.T263S|MLH1_ENST00000536378.1_Missense_Mutation_p.T263S	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	504	Interaction with EXO1.				ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.0?(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						CATTAACCTCACTAGTGTTTT	0.493		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	1	Whole gene deletion(1)	ovary(1)						ENSG00000076242						225.0	227.0	227.0					3																	37070375		2203	4300	6503	MLH1	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	-	HGNC	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.1510A>T	3.37:g.37070375A>T	ENSP00000231790:p.Thr504Ser	Somatic	0	108	0.00		0.6159915499159303	19	84.96	113	WXS	Illumina HiSeq 2500	Phase_IV	tier1	59	29	67.05	B4DI13|B4DQ11|E9PCU2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA_mismatch_repair_C,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,tigrfam_DNA_mismatch_repair_N	p.T504S	ENST00000231790.2	37	c.1510	CCDS2663.1	3	.	.	.	.	.	.	.	.	.	.	A	19.91	3.914731	0.72983	.	.	ENSG00000076242	ENST00000231790;ENST00000383761;ENST00000421440;ENST00000396438;ENST00000458205;ENST00000539477;ENST00000455445;ENST00000435176;ENST00000536378;ENST00000450420;ENST00000413740	D;D;D;D;D;D;D;D	0.89617	-2.54;-2.54;-2.54;-2.54;-2.54;-2.54;-2.54;-2.54	5.9	5.9	0.94986	.	0.094616	0.64402	D	0.000001	D	0.93187	0.7830	M	0.62088	1.915	0.58432	D	0.999999	B;B;B;D;B;B;B	0.89917	0.419;0.283;0.419;1.0;0.283;0.263;0.007	B;B;B;D;B;B;B	0.91635	0.083;0.201;0.201;0.999;0.249;0.074;0.014	D	0.91951	0.5571	10	0.31617	T	0.26	-23.6381	16.3245	0.82970	1.0:0.0:0.0:0.0	.	406;406;263;47;263;504;504	E9PCU2;B4DQ11;B7Z821;E9PE33;B4DI13;Q53GX1;P40692	.;.;.;.;.;.;MLH1_HUMAN	S	504;368;47;47;263;263;263;406;263;45;45	ENSP00000231790:T504S;ENSP00000402667:T263S;ENSP00000443665:T263S;ENSP00000398272:T263S;ENSP00000402564:T406S;ENSP00000444286:T263S;ENSP00000393006:T45S;ENSP00000416476:T45S	ENSP00000231790:T504S	T	+	1	0	MLH1	37045379	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.856000	0.75450	2.254000	0.74563	0.460000	0.39030	ACT	-	NULL		0.493	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLH1	protein_coding	OTTHUMT00000253337.2	A	NM_000249	-		37070375	+1	no_errors	ENST00000231790	ensembl	human	known	74_37	missense	SNP	1.000	T
GRIK4	2900	genome.wustl.edu	37	11	120833172	120833172	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr11:120833172G>T	ENST00000527524.2	+	18	2335	c.2048G>T	c.(2047-2049)cGc>cTc	p.R683L	GRIK4_ENST00000438375.2_Missense_Mutation_p.R683L	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	683					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.R683H(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		CAGAATTCCCGCTACCAGACC	0.483																																																	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)						ENSG00000149403						59.0	54.0	56.0					11																	120833172		2203	4299	6502	GRIK4	SO:0001583	missense	0			-	HGNC	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.2048G>T	11.37:g.120833172G>T	ENSP00000435648:p.Arg683Leu	Somatic	0	60	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	A8K9L1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R683L	ENST00000527524.2	37	c.2048	CCDS8433.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.410260	0.96072	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	T;T	0.10099	2.91;2.91	5.69	5.69	0.88448	Ionotropic glutamate receptor (2);	0.083443	0.85682	D	0.000000	T	0.32734	0.0839	L	0.60845	1.875	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00834	-1.1547	10	0.87932	D	0	.	19.3996	0.94623	0.0:0.0:1.0:0.0	.	683;683	A6H8K8;Q16099	.;GRIK4_HUMAN	L	683	ENSP00000435648:R683L;ENSP00000404063:R683L	ENSP00000404063:R683L	R	+	2	0	GRIK4	120338382	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.030000	0.88816	2.676000	0.91093	0.655000	0.94253	CGC	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt		0.483	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK4	protein_coding	OTTHUMT00000109760.4	G	NM_014619	-		120833172	+1	no_errors	ENST00000527524	ensembl	human	known	74_37	missense	SNP	1.000	T
SRGAP3	9901	genome.wustl.edu	37	3	9034675	9034675	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr3:9034675G>T	ENST00000383836.3	-	20	2900	c.2473C>A	c.(2473-2475)Ctg>Atg	p.L825M	SRGAP3_ENST00000360413.3_Missense_Mutation_p.L801M	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	825					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		TTGTCATCCAGCAATGGCCCA	0.587			T	RAF1	pilocytic astrocytoma																																			Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	0								ENSG00000196220						80.0	68.0	72.0					3																	9034675		2203	4300	6503	SRGAP3	SO:0001583	missense	0			-	HGNC	AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.2473C>A	3.37:g.9034675G>T	ENSP00000373347:p.Leu825Met	Somatic	0	38	0.00		0.6159915499159303	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	39	15.22	Q8IX13|Q8IZV8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_FCH_dom,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.L825M	ENST00000383836.3	37	c.2473	CCDS2572.1	3	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203102	0.58234	.	.	ENSG00000196220	ENST00000383836;ENST00000360413	T;T	0.26810	1.71;2.12	5.41	3.28	0.37604	Src homology-3 domain (1);	0.000000	0.64402	D	0.000002	T	0.38241	0.1033	L	0.40543	1.245	0.52099	D	0.999948	D;D	0.69078	0.997;0.995	D;D	0.75484	0.986;0.969	T	0.06463	-1.0825	10	0.31617	T	0.26	.	12.607	0.56529	0.1614:0.0:0.8386:0.0	.	801;825	O43295-2;O43295	.;SRGP2_HUMAN	M	825;801	ENSP00000373347:L825M;ENSP00000353587:L801M	ENSP00000353587:L801M	L	-	1	2	SRGAP3	9009675	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	2.160000	0.42348	1.281000	0.44480	-0.218000	0.12543	CTG	-	superfamily_SH3_domain		0.587	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRGAP3	protein_coding	OTTHUMT00000207137.3	G		-		9034675	-1	no_errors	ENST00000383836	ensembl	human	known	74_37	missense	SNP	1.000	T
CNTNAP4	85445	genome.wustl.edu	37	16	76513331	76513331	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr16:76513331C>T	ENST00000476707.1	+	11	1926	c.1787C>T	c.(1786-1788)tCa>tTa	p.S596L	CNTNAP4_ENST00000377504.4_Missense_Mutation_p.S544L|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.S592L|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.S520L			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	593	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TATGAGCAGTCATGTGAAGCC	0.333																																																	0								ENSG00000152910						107.0	115.0	112.0					16																	76513331		2198	4298	6496	CNTNAP4	SO:0001583	missense	0			-	HGNC	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1787C>T	16.37:g.76513331C>T	ENSP00000417628:p.Ser596Leu	Somatic	0	60	0.00		0.6159915499159303	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	41	32.79	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.S592L	ENST00000476707.1	37	c.1775		16	.	.	.	.	.	.	.	.	.	.	C	32	5.158952	0.94686	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.35048	1.33;1.33;1.33;1.33	5.57	5.57	0.84162	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (3);	0.000000	0.33916	N	0.004437	T	0.64182	0.2575	.	.	.	0.80722	D	1	D;P;D;D	0.89917	1.0;0.947;1.0;1.0	D;D;D;D	0.91635	0.999;0.913;0.999;0.999	T	0.65985	-0.6035	9	0.87932	D	0	.	19.3573	0.94420	0.0:1.0:0.0:0.0	.	520;596;568;593	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	L	592;544;520;596	ENSP00000306893:S592L;ENSP00000439733:S544L;ENSP00000418741:S520L;ENSP00000417628:S596L	ENSP00000306893:S592L	S	+	2	0	CNTNAP4	75070832	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.589000	0.82641	2.902000	0.99343	0.650000	0.86243	TCA	-	superfamily_Fibrinogen_a/b/g_C_dom		0.333	CNTNAP4-005	PUTATIVE	basic	protein_coding	CNTNAP4	protein_coding	OTTHUMT00000348216.1	C	NM_033401	-		76513331	+1	no_errors	ENST00000307431	ensembl	human	known	74_37	missense	SNP	1.000	T
TBC1D3P3	653017	genome.wustl.edu	37	17	20451293	20451293	+	lincRNA	SNP	A	A	G	rs374159131		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr17:20451293A>G	ENST00000591705.1	+	0	2610																											GAAGGAAGGAAAGAAGGAAGG	0.542																																																	0								ENSG00000267075																																			RP11-434D2.3			0			-	Clone_based_vega_gene																													17.37:g.20451293A>G		Somatic	0	17	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	33	29.17		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000591705.1	37	NULL		17																																																																																			-	-		0.542	RP11-434D2.3-001	KNOWN	basic	lincRNA	ENSG00000267075	lincRNA	OTTHUMT00000441761.2	A		-		20451293	+1	no_errors	ENST00000591705	ensembl	human	known	74_37	rna	SNP	0.033	G
FAM208B	54906	genome.wustl.edu	37	10	5788391	5788391	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr10:5788391G>T	ENST00000328090.5	+	15	3632	c.3007G>T	c.(3007-3009)Gtg>Ttg	p.V1003L	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1003																	TGAAAACAAAGTGGATATTCT	0.473																																																	0								ENSG00000108021						98.0	94.0	95.0					10																	5788391		1986	4166	6152	FAM208B	SO:0001583	missense	0			-	HGNC	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.3007G>T	10.37:g.5788391G>T	ENSP00000328426:p.Val1003Leu	Somatic	0	63	0.00		0.6159915499159303	59	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3715,pfam_DUF3699	p.V1003L	ENST00000328090.5	37	c.3007	CCDS41485.1	10	.	.	.	.	.	.	.	.	.	.	G	12.48	1.952136	0.34471	.	.	ENSG00000108021	ENST00000328090	T	0.45276	0.9	5.3	4.39	0.52855	.	0.746895	0.11802	N	0.528049	T	0.36690	0.0976	L	0.52573	1.65	0.09310	N	1	B	0.23442	0.085	B	0.22152	0.038	T	0.12889	-1.0530	10	0.37606	T	0.19	.	8.8891	0.35423	0.0998:0.0:0.9002:0.0	.	1003	Q5VWN6	F208B_HUMAN	L	1003	ENSP00000328426:V1003L	ENSP00000328426:V1003L	V	+	1	0	C10orf18	5828397	0.064000	0.20934	0.092000	0.20876	0.057000	0.15508	1.404000	0.34623	2.450000	0.82876	0.655000	0.94253	GTG	-	pfam_DUF3715		0.473	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM208B	protein_coding	OTTHUMT00000046571.2	G	NM_017782	-		5788391	+1	no_errors	ENST00000328090	ensembl	human	known	74_37	missense	SNP	0.050	T
PTAFR	5724	genome.wustl.edu	37	1	28503185	28503185	+	Splice_Site	SNP	C	C	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:28503185C>G	ENST00000539896.1	-	2	215		c.e2-1		PTAFR_ENST00000373857.3_5'UTR|PTAFR_ENST00000305392.3_Intron	NM_001164721.1|NM_001164722.2|NM_001164723.2	NP_001158193.1|NP_001158194.1|NP_001158195.1	P25105	PTAFR_HUMAN	platelet-activating factor receptor						chemotaxis (GO:0006935)|cytokine production (GO:0001816)|cytokine-mediated signaling pathway (GO:0019221)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|inositol trisphosphate biosynthetic process (GO:0032959)|interferon-gamma-mediated signaling pathway (GO:0060333)|phosphatidylinositol-mediated signaling (GO:0048015)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|phospholipid binding (GO:0005543)|platelet activating factor receptor activity (GO:0004992)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|stomach(1)	15		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00715)|all_lung(284;0.00732)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.215)|OV - Ovarian serous cystadenocarcinoma(117;6e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|STAD - Stomach adenocarcinoma(196;0.00678)|READ - Rectum adenocarcinoma(331;0.0649)		TCTATGCTGTCTGGCAATTGC	0.587																																																	0								ENSG00000169403																																			PTAFR	SO:0001630	splice_region_variant	0			-	HGNC	BC063000	CCDS318.1	1p35-p34.3	2012-08-20			ENSG00000169403	ENSG00000169403		"""GPCR / Class A : Platelet-activating factor receptors"""	9582	protein-coding gene	gene with protein product		173393				1322356	Standard	NM_001164721		Approved		uc001bpl.3	P25105	OTTHUMG00000003953	ENST00000539896.1:c.120-1G>C	1.37:g.28503185C>G		Somatic	0	42	0.00		0.6159915499159303	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	53	28.38	A3KMC8|A8K2H5	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e1-1	ENST00000539896.1	37	c.1-1	CCDS318.1	1																																																																																			-	-		0.587	PTAFR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PTAFR	protein_coding		C	NM_000952	-	Intron	28503185	-1	no_errors	ENST00000539896	ensembl	human	known	74_37	splice_site	SNP	0.930	G
FAM83B	222584	genome.wustl.edu	37	6	54805724	54805724	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr6:54805724A>G	ENST00000306858.7	+	5	2071	c.1955A>G	c.(1954-1956)aAg>aGg	p.K652R	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	652										autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					GAAAATCTAAAGAATCAACAG	0.333																																																	0								ENSG00000168143						54.0	57.0	56.0					6																	54805724		2200	4300	6500	FAM83B	SO:0001583	missense	0			-	HGNC	AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.1955A>G	6.37:g.54805724A>G	ENSP00000304078:p.Lys652Arg	Somatic	0	61	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	51	23.88	Q2M1P3|Q96DQ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1669	p.K652R	ENST00000306858.7	37	c.1955	CCDS34479.1	6	.	.	.	.	.	.	.	.	.	.	A	11.05	1.523887	0.27299	.	.	ENSG00000168143	ENST00000306858	T	0.36878	1.23	5.55	4.39	0.52855	.	0.826156	0.11030	N	0.607374	T	0.16171	0.0389	L	0.59436	1.845	0.09310	N	1	B	0.18310	0.027	B	0.12837	0.008	T	0.25984	-1.0116	10	0.49607	T	0.09	-17.8201	6.6484	0.22949	0.7914:0.0:0.0721:0.1365	.	652	Q5T0W9	FA83B_HUMAN	R	652	ENSP00000304078:K652R	ENSP00000304078:K652R	K	+	2	0	FAM83B	54913683	0.993000	0.37304	0.022000	0.16811	0.965000	0.64279	3.634000	0.54302	1.050000	0.40346	0.533000	0.62120	AAG	-	NULL		0.333	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83B	protein_coding	OTTHUMT00000040994.1	A	XM_294139	-		54805724	+1	no_errors	ENST00000306858	ensembl	human	known	74_37	missense	SNP	0.089	G
CTCFL	140690	genome.wustl.edu	37	20	56090832	56090832	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr20:56090832C>A	ENST00000608263.1	-	5	1779	c.1118G>T	c.(1117-1119)tGc>tTc	p.C373F	CTCFL_ENST00000429804.3_Missense_Mutation_p.C373F|CTCFL_ENST00000608858.1_5'UTR|CTCFL_ENST00000243914.3_Missense_Mutation_p.C373F|CTCFL_ENST00000423479.3_Missense_Mutation_p.C373F|CTCFL_ENST00000539382.1_Missense_Mutation_p.C168F|CTCFL_ENST00000371196.2_Missense_Mutation_p.C373F|CTCFL_ENST00000608425.1_Missense_Mutation_p.C373F|CTCFL_ENST00000433949.3_Missense_Mutation_p.C168F|CTCFL_ENST00000609232.1_Missense_Mutation_p.C373F|CTCFL_ENST00000608903.1_Missense_Mutation_p.C111F|CTCFL_ENST00000432255.2_Intron|CTCFL_ENST00000502686.2_Missense_Mutation_p.C111F|CTCFL_ENST00000422869.2_Missense_Mutation_p.C373F|CTCFL_ENST00000608440.1_Missense_Mutation_p.C373F	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	373					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			GCTGCACTGGCAACACTGAAA	0.483																																																	0								ENSG00000124092						174.0	165.0	168.0					20																	56090832		2203	4300	6503	CTCFL	SO:0001583	missense	0			-	HGNC		CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.1118G>T	20.37:g.56090832C>A	ENSP00000476783:p.Cys373Phe	Somatic	0	64	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	55	35.29	A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C373F	ENST00000608263.1	37	c.1118	CCDS13459.1	20	.	.	.	.	.	.	.	.	.	.	C	6.200	0.405064	0.11754	.	.	ENSG00000124092	ENST00000423479;ENST00000243914;ENST00000371196;ENST00000429804;ENST00000433949;ENST00000502686;ENST00000422109;ENST00000426658;ENST00000539382;ENST00000422869	T;T;T;T;T;T;T;T;T;T	0.17691	2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26	5.24	-6.88	0.01665	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.445910	0.04419	N	0.367221	T	0.06735	0.0172	N	0.04746	-0.17	0.09310	N	1	B;P;B;P;P	0.41450	0.244;0.512;0.295;0.75;0.512	B;B;B;B;B	0.42062	0.281;0.173;0.374;0.226;0.171	T	0.14476	-1.0471	10	0.29301	T	0.29	1.9081	1.1248	0.01732	0.1895:0.2307:0.3226:0.2571	.	373;373;373;373;373	A6XGM9;A6XGM2;E7EUE3;A6XGL8;Q8NI51	.;.;.;.;CTCFL_HUMAN	F	373;373;373;373;373;111;373;373;168;373	ENSP00000415579:C373F;ENSP00000243914:C373F;ENSP00000360239:C373F;ENSP00000415329:C373F;ENSP00000392034:C373F;ENSP00000437999:C111F;ENSP00000413713:C373F;ENSP00000403369:C373F;ENSP00000439998:C168F;ENSP00000399061:C373F	ENSP00000243914:C373F	C	-	2	0	CTCFL	55524238	0.000000	0.05858	0.000000	0.03702	0.702000	0.40608	-0.214000	0.09292	-1.536000	0.01738	-0.172000	0.13284	TGC	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.483	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	CTCFL	protein_coding	OTTHUMT00000472040.1	C	NM_080618	-		56090832	-1	no_errors	ENST00000423479	ensembl	human	known	74_37	missense	SNP	0.001	A
RPL30	6156	genome.wustl.edu	37	8	99054503	99054504	+	Intron	INS	-	-	T	rs534352583|rs367741409	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:99054503_99054504insT	ENST00000521291.1	-	3	445				SNORA72_ENST00000384339.1_RNA|RPL30_ENST00000518164.1_Intron|RPL30_ENST00000287038.3_Intron|RPL30_ENST00000396070.2_Intron|KB-1208A12.3_ENST00000501016.2_RNA|RPL30_ENST00000523172.1_Intron			P62888	RL30_HUMAN	ribosomal protein L30						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(2)|lung(4)|skin(1)	7	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.192)			TTTTTTGGCACTTTTTTTTTTC	0.312																																																	0								ENSG00000245970																																			KB-1208A12.3	SO:0001627	intron_variant	0				Clone_based_vega_gene		CCDS34928.1	8q22	2013-05-09			ENSG00000156482	ENSG00000156482		"""L ribosomal proteins"""	10333	protein-coding gene	gene with protein product		180467				1577483	Standard	NM_000989		Approved	L30	uc003yif.3	P62888	OTTHUMG00000164796	ENST00000521291.1:c.298+368->A	8.37:g.99054513_99054513dupT		Somatic	0	27	0.00		0.6159915499159303	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	B2R591|P04645|Q502Z6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000521291.1	37	NULL	CCDS34928.1	8																																																																																			-	-		0.312	RPL30-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNORA72	protein_coding	OTTHUMT00000380450.1	-				99054504	+1	no_errors	ENST00000501016	ensembl	human	known	74_37	rna	INS	0.000:0.001	T
AZIN1	51582	genome.wustl.edu	37	8	103870327	103870327	+	De_novo_Start_OutOfFrame	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:103870327G>T	ENST00000337198.5	-	0	982				AZIN1_ENST00000347770.4_De_novo_Start_OutOfFrame|AZIN1_ENST00000522311.1_5'Flank|KB-1254G8.1_ENST00000519337.1_lincRNA	NM_148174.2	NP_680479.1	O14977	AZIN1_HUMAN	antizyme inhibitor 1						cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of catalytic activity (GO:0043086)|negative regulation of protein catabolic process (GO:0042177)|polyamine biosynthetic process (GO:0006596)|positive regulation of polyamine transmembrane transport (GO:1902269)|regulation of cellular amino acid metabolic process (GO:0006521)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|enzyme inhibitor activity (GO:0004857)|ornithine decarboxylase activator activity (GO:0042978)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|stomach(1)	9	Lung NSC(17;0.000143)|all_lung(17;0.000294)		OV - Ovarian serous cystadenocarcinoma(57;0.000196)|STAD - Stomach adenocarcinoma(118;0.0414)			TCTCTATACAGCACTTCTCCT	0.443																																																	0								ENSG00000155096																																			AZIN1			0			-	HGNC	AAC25391	CCDS6295.1	8p22-q21.3	2005-03-21	2005-03-21	2005-03-21		ENSG00000155096			16432	protein-coding gene	gene with protein product	"""ornithine decarboxylase 1-like"""	607909	"""ornithine decarboxylase antizyme inhibitor"""	OAZIN		9349715, 9110174	Standard	XM_005250969		Approved	OAZI, ODC1L	uc003yky.3	O14977		ENST00000337198.5:c.-182C>A	8.37:g.103870327G>T		Somatic	0	55	0.00		0.6159915499159303	111	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A6NCD5|Q6IBQ7|Q96D20	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000337198.5	37	NULL	CCDS6295.1	8																																																																																			-	-		0.443	AZIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZIN1	protein_coding	OTTHUMT00000380133.1	G		-		103870327	-1	no_errors	ENST00000517581	ensembl	human	known	74_37	rna	SNP	1.000	T
GABRR1	2569	genome.wustl.edu	37	6	89907776	89907776	+	Missense_Mutation	SNP	G	G	A	rs201013212		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr6:89907776G>A	ENST00000454853.2	-	5	645	c.535C>T	c.(535-537)Cgg>Tgg	p.R179W	GABRR1_ENST00000369451.3_Missense_Mutation_p.R92W|GABRR1_ENST00000435811.1_Missense_Mutation_p.R162W	NM_001256704.1|NM_002042.4	NP_001243633.1|NP_002033.2	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 1	179					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(7)|lung(16)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	35		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	GGCTGGACCCGCAACATGACG	0.483																																																	0								ENSG00000146276						198.0	172.0	181.0					6																	89907776		2203	4300	6503	GABRR1	SO:0001583	missense	0			-	HGNC		CCDS5019.2, CCDS59028.1, CCDS59029.1	6q15	2012-06-22	2012-02-03		ENSG00000146276	ENSG00000146276		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4090	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 1"""	137161	"""gamma-aminobutyric acid (GABA) receptor, rho 1"""			1849271, 1315307	Standard	NM_002042		Approved		uc003pna.2	P24046	OTTHUMG00000015195	ENST00000454853.2:c.535C>T	6.37:g.89907776G>A	ENSP00000412673:p.Arg179Trp	Somatic	0	65	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	64	31	67.37	A1L401|B4DJK8|B4DQT5|B7ZBQ7|Q9BX06	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAa_rho1_rcpt,prints_Neur_channel,prints_GABAAa_rho_rcpt,tigrfam_Neur_channel	p.R179W	ENST00000454853.2	37	c.535	CCDS5019.2	6	.	.	.	.	.	.	.	.	.	.	G	20.9	4.072444	0.76415	.	.	ENSG00000146276	ENST00000454853;ENST00000435811;ENST00000369451;ENST00000436331	T;T;T	0.79247	-1.25;-1.25;-1.25	5.83	4.94	0.65067	Neurotransmitter-gated ion-channel ligand-binding (3);	0.079850	0.64402	D	0.000002	D	0.83848	0.5343	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.988;0.999	D	0.84811	0.0790	9	.	.	.	-26.7525	16.0638	0.80859	0.0:0.0:0.8649:0.1351	.	162;179	P24046-2;P24046	.;GBRR1_HUMAN	W	179;162;92;92	ENSP00000412673:R179W;ENSP00000394687:R162W;ENSP00000358463:R92W	.	R	-	1	2	GABRR1	89964495	1.000000	0.71417	0.992000	0.48379	0.722000	0.41435	3.490000	0.53245	1.405000	0.46838	0.561000	0.74099	CGG	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.483	GABRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRR1	protein_coding	OTTHUMT00000041479.2	G		rs201013212		89907776	-1	no_errors	ENST00000454853	ensembl	human	known	74_37	missense	SNP	1.000	A
KCNJ16	3773	genome.wustl.edu	37	17	68128480	68128480	+	Silent	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr17:68128480G>A	ENST00000589377.1	+	2	415	c.252G>A	c.(250-252)tcG>tcA	p.S84S	KCNJ16_ENST00000392671.1_Silent_p.S84S|KCNJ16_ENST00000283936.1_Silent_p.S84S|KCNJ16_ENST00000392670.1_Silent_p.S84S|KCNJ16_ENST00000586462.1_Silent_p.S123S|KCNJ16_ENST00000585558.1_Silent_p.S119S	NM_001270422.1	NP_001257351.1	Q9NPI9	KCJ16_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 16	84					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	32	Breast(10;2.96e-09)					ATATTCTCTCGTGGTTGATAT	0.413																																																	0								ENSG00000153822						236.0	207.0	217.0					17																	68128480		2203	4300	6503	KCNJ16	SO:0001819	synonymous_variant	0			-	HGNC	AF153815	CCDS11687.1, CCDS74141.1	17q24.3	2011-07-05				ENSG00000153822		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6262	protein-coding gene	gene with protein product		605722				11240146, 16382105	Standard	NM_018658		Approved	Kir5.1, BIR9	uc002jio.4	Q9NPI9		ENST00000589377.1:c.252G>A	17.37:g.68128480G>A		Somatic	0	60	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	12	70.00		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir5,prints_K_chnl_inward-rec_Kir	p.S84	ENST00000589377.1	37	c.252	CCDS11687.1	17																																																																																			-	pfam_K_chnl_inward-rec_Kir,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir		0.413	KCNJ16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ16	protein_coding	OTTHUMT00000450880.1	G	NM_018658	-		68128480	+1	no_errors	ENST00000283936	ensembl	human	known	74_37	silent	SNP	0.794	A
EPHX1	2052	genome.wustl.edu	37	1	226030114	226030114	+	Nonsense_Mutation	SNP	G	G	T	rs531109510		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:226030114G>T	ENST00000366837.4	+	7	1175	c.979G>T	c.(979-981)Gag>Tag	p.E327*	RP11-285F7.2_ENST00000424332.1_RNA|EPHX1_ENST00000272167.5_Nonsense_Mutation_p.E327*	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	327					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					CTATATTCTAGAGAAGTTTTC	0.587																																																	0								ENSG00000143819						125.0	135.0	131.0					1																	226030114		2203	4300	6503	EPHX1	SO:0001587	stop_gained	0			-	HGNC	J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.979G>T	1.37:g.226030114G>T	ENSP00000355802:p.Glu327*	Somatic	0	53	0.00		0.6159915499159303	139	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Epoxide_hydro_N,pfam_AB_hydrolase_1,pirsf_Epoxide_hydrolase,prints_Epox_hydrolase-like	p.E327*	ENST00000366837.4	37	c.979	CCDS1547.1	1	.	.	.	.	.	.	.	.	.	.	G	39	7.570794	0.98365	.	.	ENSG00000143819	ENST00000272167;ENST00000366837	.	.	.	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-15.5744	19.084	0.93194	0.0:0.0:1.0:0.0	.	.	.	.	X	327	.	ENSP00000272167:E327X	E	+	1	0	EPHX1	224096737	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	9.707000	0.98725	2.575000	0.86900	0.561000	0.74099	GAG	-	pfam_AB_hydrolase_1,pirsf_Epoxide_hydrolase		0.587	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHX1	protein_coding	OTTHUMT00000092064.1	G	NM_000120	-		226030114	+1	no_errors	ENST00000272167	ensembl	human	known	74_37	nonsense	SNP	1.000	T
IGSF1	3547	genome.wustl.edu	37	X	130408805	130408805	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:130408805G>T	ENST00000361420.3	-	18	3598	c.3519C>A	c.(3517-3519)ttC>ttA	p.F1173L	IGSF1_ENST00000370903.3_Missense_Mutation_p.F1178L|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370910.1_Missense_Mutation_p.F1164L|IGSF1_ENST00000370904.1_Missense_Mutation_p.F1164L			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1173	Ig-like C2-type 12.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						TCCCTAACTTGAACATGGTGC	0.488																																																	0								ENSG00000147255						111.0	116.0	114.0					X																	130408805		2203	4300	6503	IGSF1	SO:0001583	missense	0			-	HGNC	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3519C>A	X.37:g.130408805G>T	ENSP00000355010:p.Phe1173Leu	Somatic	0	90	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	132	10.20	B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.F1178L	ENST00000361420.3	37	c.3534	CCDS14629.1	X	.	.	.	.	.	.	.	.	.	.	G	2.470	-0.322222	0.05350	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.08896	3.04;3.04;3.04;3.04	5.03	4.1	0.47936	Immunoglobulin-like fold (1);	0.133656	0.35040	N	0.003494	T	0.10465	0.0256	N	0.05177	-0.1	0.33563	D	0.597671	D;B;D	0.59357	0.979;0.169;0.985	P;B;D	0.72338	0.889;0.262;0.977	T	0.23013	-1.0200	10	0.45353	T	0.12	.	9.7945	0.40726	0.0:0.2043:0.7957:0.0	.	1164;617;1173	Q8N6C5-2;C9JP68;Q8N6C5	.;.;IGSF1_HUMAN	L	1164;1173;1164;1178	ENSP00000359947:F1164L;ENSP00000355010:F1173L;ENSP00000359941:F1164L;ENSP00000359940:F1178L	ENSP00000355010:F1173L	F	-	3	2	IGSF1	130236486	0.958000	0.32768	1.000000	0.80357	0.408000	0.30992	0.668000	0.25127	2.225000	0.72522	0.594000	0.82650	TTC	-	smart_Ig_sub		0.488	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	protein_coding	OTTHUMT00000058288.1	G		-		130408805	-1	no_errors	ENST00000370903	ensembl	human	known	74_37	missense	SNP	1.000	T
PRSS1	5644	genome.wustl.edu	37	7	142459862	142459862	+	Silent	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:142459862C>T	ENST00000311737.7	+	3	444	c.438C>T	c.(436-438)aaC>aaT	p.N146N	PRSS1_ENST00000486171.1_Silent_p.N160N	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	146	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	GCTGGGGCAACACTGCGAGCT	0.572																																																	0								ENSG00000204983						70.0	71.0	71.0					7																	142459862		2203	4300	6503	PRSS1	SO:0001819	synonymous_variant	0			-	HGNC	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.438C>T	7.37:g.142459862C>T		Somatic	0	31	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	21	56.25	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.N146	ENST00000311737.7	37	c.438	CCDS5872.1	7																																																																																			-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.572	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS1	protein_coding	OTTHUMT00000352538.2	C		-		142459862	+1	no_errors	ENST00000311737	ensembl	human	known	74_37	silent	SNP	1.000	T
SUPT7L	9913	genome.wustl.edu	37	2	27880347	27880347	+	Silent	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:27880347C>A	ENST00000337768.5	-	4	1178	c.609G>T	c.(607-609)cgG>cgT	p.R203R	SUPT7L_ENST00000464789.2_Silent_p.R201R|SUPT7L_ENST00000405491.1_Silent_p.R201R|SUPT7L_ENST00000406540.1_Silent_p.R201R|SUPT7L_ENST00000404798.2_Silent_p.R68R	NM_001282729.1|NM_014860.1	NP_001269658.1|NP_055675.1	O94864	ST65G_HUMAN	suppressor of Ty 7 (S. cerevisiae)-like	203					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|maintenance of protein location in nucleus (GO:0051457)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)					GCCGGGCCTCCCGGTCCACAG	0.522																																																	0								ENSG00000119760						74.0	79.0	77.0					2																	27880347		2012	4167	6179	SUPT7L	SO:0001819	synonymous_variant	0			-	HGNC	AF197954	CCDS42667.1, CCDS62885.1, CCDS62886.1	2p23.3	2008-02-05			ENSG00000119760	ENSG00000119760			30632	protein-coding gene	gene with protein product		612762				9872452, 11564863	Standard	NM_001282732		Approved	STAF65, gamma, KIAA0764, SPT7L	uc002rli.1	O94864	OTTHUMG00000151947	ENST00000337768.5:c.609G>T	2.37:g.27880347C>A		Somatic	0	53	0.00		0.6159915499159303	117	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B4E3W3|Q6IB21|Q9H2T6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BTP,smart_BTP	p.R203	ENST00000337768.5	37	c.609	CCDS42667.1	2																																																																																			-	pfam_BTP,smart_BTP		0.522	SUPT7L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT7L	protein_coding	OTTHUMT00000324568.1	C	NM_014860	-		27880347	-1	no_errors	ENST00000337768	ensembl	human	known	74_37	silent	SNP	0.990	A
ARHGAP27	201176	genome.wustl.edu	37	17	43472842	43472842	+	Frame_Shift_Del	DEL	C	C	-	rs547059220	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr17:43472842delC	ENST00000428638.1	-	17	2649	c.2650delG	c.(2650-2652)gacfs	p.D884fs	ARHGAP27_ENST00000582826.1_5'Flank|ARHGAP27_ENST00000532038.1_Frame_Shift_Del_p.D662fs|ARHGAP27_ENST00000376922.2_Frame_Shift_Del_p.D543fs|CTB-39G8.3_ENST00000592389.1_RNA|ARHGAP27_ENST00000532891.2_Frame_Shift_Del_p.D862fs|ARHGAP27_ENST00000442348.1_Frame_Shift_Del_p.D857fs|ARHGAP27_ENST00000528384.1_Frame_Shift_Del_p.D516fs|ARHGAP27_ENST00000455881.1_Frame_Shift_Del_p.D543fs			Q6ZUM4	RHG27_HUMAN	Rho GTPase activating protein 27	884	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of Rac GTPase activity (GO:0032855)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|SH3 domain binding (GO:0017124)			endometrium(4)|large_intestine(9)|lung(3)|skin(1)	17	Renal(3;0.0405)					GGGAAGATGTCCGCGCACTGC	0.692											OREG0024481	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000159314						25.0	20.0	22.0					17																	43472842		2183	4272	6455	ARHGAP27	SO:0001589	frameshift_variant	0				HGNC	AK125535	CCDS11498.1, CCDS74082.1	17q21.31	2013-01-10			ENSG00000159314	ENSG00000159314		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	31813	protein-coding gene	gene with protein product		610591	"""SH3 domain containing 20"""	SH3D20		15147912	Standard	NM_199282		Approved	CAMGAP1, FLJ43547, SH3P20	uc002iix.3	Q6ZUM4	OTTHUMG00000166982	ENST00000428638.1:c.2650delG	17.37:g.43472842delC	ENSP00000403323:p.Asp884fs	Somatic	0	30	0.00	916	0.6159915499159303	17	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	20	45.95	A4FU35|A8K3N5|C9JTF3|Q494U0|Q6NWZ8|Q8WY58	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_WW_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_WW_dom,smart_WW_dom,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_WW_dom,pfscan_RhoGAP_dom	p.D884fs	ENST00000428638.1	37	c.2650		17																																																																																			-	superfamily_Rho_GTPase_activation_prot,pfscan_RhoGAP_dom		0.692	ARHGAP27-202	KNOWN	basic	protein_coding	ARHGAP27	protein_coding		C	NM_199282			43472842	-1	no_errors	ENST00000428638	ensembl	human	known	74_37	frame_shift_del	DEL	0.234	-
SMARCA5	8467	genome.wustl.edu	37	4	144442729	144442731	+	In_Frame_Del	DEL	AAC	AAC	-			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	AAC	AAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr4:144442729_144442731delAAC	ENST00000283131.3	+	3	862_864	c.400_402delAAC	c.(400-402)aacdel	p.N134del		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	134					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					TGAGAAGCAGAACTTACTATCCG	0.374																																																	0								ENSG00000153147																																			SMARCA5	SO:0001651	inframe_deletion	0				HGNC	AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.400_402delAAC	4.37:g.144442729_144442731delAAC	ENSP00000283131:p.Asn134del	Somatic	0	85	0.00		0.6159915499159303	121	39.50	79	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	92	29.23		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_SLIDE,pfam_ISWI_HAND-dom,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_HDA_complex_subunit-2/3,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,superfamily_ISWI_HAND-dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_SANT/Myb,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.N134in_frame_del	ENST00000283131.3	37	c.400_402	CCDS3761.1	4																																																																																			-	superfamily_P-loop_NTPase		0.374	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCA5	protein_coding	OTTHUMT00000365077.3	AAC				144442731	+1	no_errors	ENST00000283131	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
CCDC150	284992	genome.wustl.edu	37	2	197584489	197584490	+	Intron	INS	-	-	A	rs546010406|rs368182383	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:197584489_197584490insA	ENST00000389175.4	+	19	2300				CCDC150_ENST00000272831.7_Intron|CCDC150_ENST00000409270.1_Intron|CCDC150_ENST00000487663.1_Intron	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150											breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						GCTTCCTTTACAAAAAAAAAAA	0.297																																																	0								ENSG00000144395																																			CCDC150	SO:0001627	intron_variant	0				HGNC		CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.2165+99->A	2.37:g.197584500_197584500dupA		Somatic	0	27	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	Q6P5U6|Q6P663|Q8N8V5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000389175.4	37	NULL	CCDS46478.1	2																																																																																			-	-		0.297	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	CCDC150	protein_coding	OTTHUMT00000335377.2	-	NM_001080539			197584490	+1	no_errors	ENST00000461825	ensembl	human	putative	74_37	rna	INS	0.000:0.000	A
GABRD	2563	genome.wustl.edu	37	1	1959608	1959608	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:1959608G>A	ENST00000378585.4	+	6	651	c.568G>A	c.(568-570)Gag>Aag	p.E190K		NM_000815.4	NP_000806.2	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta	190					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			central_nervous_system(2)|endometrium(3)|kidney(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TTACTCATCGGAGGACATCGT	0.642																																																	0								ENSG00000187730						70.0	58.0	62.0					1																	1959608		2202	4300	6502	GABRD	SO:0001583	missense	0			-	HGNC	BC033801	CCDS36.1	1p36.3	2012-06-22			ENSG00000187730	ENSG00000187730		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4084	protein-coding gene	gene with protein product	"""GABA(A) receptor, delta"""	137163				2176788, 10965146	Standard	NM_000815		Approved		uc001aip.2	O14764	OTTHUMG00000041064	ENST00000378585.4:c.568G>A	1.37:g.1959608G>A	ENSP00000367848:p.Glu190Lys	Somatic	0	33	0.00		0.6159915499159303	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	21	40.00	Q8N4N9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAd_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.E190K	ENST00000378585.4	37	c.568	CCDS36.1	1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.346990	0.61183	.	.	ENSG00000187730	ENST00000378585	T	0.79247	-1.25	3.58	3.58	0.41010	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.79335	0.4428	N	0.20530	0.585	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.82686	-0.0334	10	0.66056	D	0.02	-16.402	14.7342	0.69404	0.0:0.0:1.0:0.0	.	190	O14764	GBRD_HUMAN	K	190	ENSP00000367848:E190K	ENSP00000367848:E190K	E	+	1	0	GABRD	1949468	1.000000	0.71417	0.870000	0.34147	0.027000	0.11550	9.275000	0.95738	2.031000	0.59945	0.561000	0.74099	GAG	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.642	GABRD-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	GABRD	protein_coding	OTTHUMT00000098493.1	G	NM_000815	-		1959608	+1	no_errors	ENST00000378585	ensembl	human	known	74_37	missense	SNP	1.000	A
APBB1IP	54518	genome.wustl.edu	37	10	26849132	26849132	+	Splice_Site	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr10:26849132G>T	ENST00000376236.4	+	12	1709	c.1254G>T	c.(1252-1254)aaG>aaT	p.K418N		NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein	418	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						GGATAGCCAAGGTGAGAGAGC	0.522																																																	0								ENSG00000077420						117.0	102.0	107.0					10																	26849132		2203	4300	6503	APBB1IP	SO:0001630	splice_region_variant	0			-	HGNC	AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.1254+1G>T	10.37:g.26849132G>T		Somatic	0	47	0.00		0.6159915499159303	55	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q8IWS8|Q8IYL7|Q8IZZ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Ras-assoc	p.K418N	ENST00000376236.4	37	c.1254	CCDS31167.1	10	.	.	.	.	.	.	.	.	.	.	G	26.2	4.712747	0.89112	.	.	ENSG00000077420	ENST00000445780;ENST00000376236	T	0.18338	2.22	5.36	5.36	0.76844	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.47746	0.1462	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.51521	-0.8695	10	0.87932	D	0	.	18.0722	0.89413	0.0:0.0:1.0:0.0	.	418	Q7Z5R6	AB1IP_HUMAN	N	418	ENSP00000365411:K418N	ENSP00000365411:K418N	K	+	3	2	APBB1IP	26889138	1.000000	0.71417	1.000000	0.80357	0.707000	0.40811	7.670000	0.83925	2.671000	0.90904	0.644000	0.83932	AAG	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.522	APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	APBB1IP	protein_coding	OTTHUMT00000047270.1	G	NM_019043	-	Missense_Mutation	26849132	+1	no_errors	ENST00000376236	ensembl	human	known	74_37	missense	SNP	1.000	T
RGR	5995	genome.wustl.edu	37	10	86017696	86017696	+	Silent	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr10:86017696C>A	ENST00000359452.4	+	6	728	c.690C>A	c.(688-690)ccC>ccA	p.P230P	RGR_ENST00000479725.1_3'UTR|RGR_ENST00000358110.5_Intron	NM_001012720.1|NM_002921.3	NP_001012738.1|NP_002912.2	P47804	RGR_HUMAN	retinal G protein coupled receptor	226					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	17						GCTGGGGCCCCTATGCCATCC	0.547																																					NSCLC(15;204 545 5889 6385 32445)												0								ENSG00000148604						89.0	79.0	82.0					10																	86017696		2203	4300	6503	RGR	SO:0001819	synonymous_variant	0			-	HGNC	BC011349	CCDS7374.1, CCDS41543.1	10q23	2013-02-14			ENSG00000148604	ENSG00000148604		"""GPCR / Class A : Opsin receptors"""	9990	protein-coding gene	gene with protein product	"""RGR-opsin"""	600342				8641686	Standard	NM_002921		Approved	RP44	uc001kdd.1	P47804	OTTHUMG00000018636	ENST00000359452.4:c.690C>A	10.37:g.86017696C>A		Somatic	0	34	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	A6NKK7|Q96FC5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_RPE_GPCR,prints_GPCR_Rhodpsn	p.P230	ENST00000359452.4	37	c.690	CCDS7374.1	10																																																																																			-	pfscan_GPCR_Rhodpsn_7TM		0.547	RGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGR	protein_coding	OTTHUMT00000049116.1	C	NM_002921	-		86017696	+1	no_errors	ENST00000359452	ensembl	human	known	74_37	silent	SNP	0.997	A
MTMR4	9110	genome.wustl.edu	37	17	56572454	56572454	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr17:56572454G>T	ENST00000323456.5	-	16	3173	c.3049C>A	c.(3049-3051)Ccc>Acc	p.P1017T	MTMR4_ENST00000579925.1_Missense_Mutation_p.P960T	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	1017					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ACATCCGTGGGAAAGGGGAGT	0.527																																																	0								ENSG00000108389						206.0	177.0	186.0					17																	56572454		2203	4300	6503	MTMR4	SO:0001583	missense	0			-	HGNC	AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.3049C>A	17.37:g.56572454G>T	ENSP00000325285:p.Pro1017Thr	Somatic	0	51	0.00		0.6159915499159303	49	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myotubularin-like_Pase_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Tyr/Dual-sp_Pase	p.P1017T	ENST00000323456.5	37	c.3049	CCDS11608.1	17	.	.	.	.	.	.	.	.	.	.	G	14.31	2.498055	0.44455	.	.	ENSG00000108389	ENST00000323456	D	0.93247	-3.19	5.58	5.58	0.84498	.	0.050137	0.85682	D	0.000000	D	0.94971	0.8373	L	0.50333	1.59	0.40193	D	0.977429	D	0.76494	0.999	D	0.65684	0.937	D	0.92981	0.6406	10	0.19590	T	0.45	.	18.5537	0.91075	0.0:0.0:1.0:0.0	.	1017	Q9NYA4	MTMR4_HUMAN	T	1017	ENSP00000325285:P1017T	ENSP00000325285:P1017T	P	-	1	0	MTMR4	53927453	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.795000	0.69074	2.627000	0.88993	0.555000	0.69702	CCC	-	NULL		0.527	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR4	protein_coding	OTTHUMT00000444721.1	G	NM_004687	-		56572454	-1	no_errors	ENST00000323456	ensembl	human	known	74_37	missense	SNP	1.000	T
NACA	4666	genome.wustl.edu	37	12	57110121	57110121	+	Silent	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr12:57110121G>T	ENST00000454682.1	-	3	5474	c.5193C>A	c.(5191-5193)tcC>tcA	p.S1731S	NACA_ENST00000552540.1_Intron|NACA_ENST00000356769.3_Intron|NACA_ENST00000548563.1_Intron|NACA_ENST00000546392.1_Intron|NACA_ENST00000393891.4_Intron|NACA_ENST00000551793.1_Intron|NACA_ENST00000550952.1_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	1731	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						GAGCCACTGTGGAAAGGGGTC	0.512			T	BCL6	NHL																																			Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	0								ENSG00000196531						227.0	210.0	215.0					12																	57110121		1568	3582	5150	NACA	SO:0001819	synonymous_variant	0			-	HGNC	X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.5193C>A	12.37:g.57110121G>T		Somatic	0	41	0.00		0.6159915499159303	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Nas_poly-pep-assoc_cplx_dom,superfamily_UBA-like,pfscan_Nas_poly-pep-assoc_cplx_dom	p.S1731	ENST00000454682.1	37	c.5193		12																																																																																			-	NULL		0.512	NACA-201	KNOWN	basic	protein_coding	NACA	protein_coding		G	NM_005594	-		57110121	-1	no_errors	ENST00000454682	ensembl	human	known	74_37	silent	SNP	0.000	T
MYOM2	9172	genome.wustl.edu	37	8	2024315	2024315	+	Silent	SNP	G	G	A	rs563008335		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:2024315G>A	ENST00000262113.4	+	11	1356	c.1215G>A	c.(1213-1215)ccG>ccA	p.P405P	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	405	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		CCTGGAAGCCGCCCAACACCA	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		14476	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000036448						50.0	47.0	48.0					8																	2024315		2203	4300	6503	MYOM2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.1215G>A	8.37:g.2024315G>A		Somatic	0	71	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	79	28.18	Q7Z3Y2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P405	ENST00000262113.4	37	c.1215	CCDS5957.1	8																																																																																			-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.622	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	protein_coding	OTTHUMT00000251249.1	G	NM_003970	-		2024315	+1	no_errors	ENST00000262113	ensembl	human	known	74_37	silent	SNP	0.015	A
DNAH7	56171	genome.wustl.edu	37	2	196729289	196729289	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:196729289G>T	ENST00000312428.6	-	41	7190	c.7090C>A	c.(7090-7092)Caa>Aaa	p.Q2364K		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2364	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						ATTTCAACTTGGAAAACTGAA	0.473																																																	0								ENSG00000118997						86.0	85.0	85.0					2																	196729289		1914	4129	6043	DNAH7	SO:0001583	missense	0			-	HGNC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.7090C>A	2.37:g.196729289G>T	ENSP00000311273:p.Gln2364Lys	Somatic	0	32	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_hand_dom	p.Q2364K	ENST00000312428.6	37	c.7090	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	G	12.29	1.893157	0.33442	.	.	ENSG00000118997	ENST00000312428	T	0.52057	0.68	5.07	5.07	0.68467	Dynein heavy chain, P-loop containing D4 domain (1);	0.061524	0.64402	D	0.000003	T	0.76593	0.4009	H	0.94771	3.58	0.80722	D	1	P	0.50710	0.938	P	0.61874	0.895	D	0.83578	0.0116	10	0.87932	D	0	.	18.2236	0.89910	0.0:0.0:1.0:0.0	.	2364	Q8WXX0	DYH7_HUMAN	K	2364	ENSP00000311273:Q2364K	ENSP00000311273:Q2364K	Q	-	1	0	DNAH7	196437534	1.000000	0.71417	0.983000	0.44433	0.015000	0.08874	6.477000	0.73591	2.636000	0.89361	0.557000	0.71058	CAA	-	superfamily_P-loop_NTPase		0.473	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	protein_coding	OTTHUMT00000335202.3	G	NM_018897	-		196729289	-1	no_errors	ENST00000312428	ensembl	human	known	74_37	missense	SNP	1.000	T
COL1A1	1277	genome.wustl.edu	37	17	48271370	48271370	+	Silent	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr17:48271370G>T	ENST00000225964.5	-	25	1819	c.1701C>A	c.(1699-1701)ccC>ccA	p.P567P		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	567	Triple-helical region.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	GTGGGCCTGGGGGTCCGGGGC	0.617			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																																	Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	0								ENSG00000108821						51.0	55.0	54.0					17																	48271370		2203	4300	6503	COL1A1	SO:0001819	synonymous_variant	0			-	HGNC	Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.1701C>A	17.37:g.48271370G>T		Somatic	0	39	0.00		0.6159915499159303	3491	0.09	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.P567	ENST00000225964.5	37	c.1701	CCDS11561.1	17																																																																																			-	NULL		0.617	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A1	protein_coding	OTTHUMT00000309036.2	G		-		48271370	-1	no_errors	ENST00000225964	ensembl	human	known	74_37	silent	SNP	0.977	T
ABCA4	24	genome.wustl.edu	37	1	94577077	94577077	+	Silent	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:94577077G>T	ENST00000370225.3	-	3	305	c.219C>A	c.(217-219)atC>atA	p.I73I	ABCA4_ENST00000535735.1_Silent_p.I73I	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	73					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CATTGCAGAAGATCCCCTGGA	0.483																																																	0								ENSG00000198691						75.0	73.0	74.0					1																	94577077		2203	4300	6503	ABCA4	SO:0001819	synonymous_variant	0			-	HGNC	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.219C>A	1.37:g.94577077G>T		Somatic	0	46	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Rim_ABC_transpt	p.I73	ENST00000370225.3	37	c.219	CCDS747.1	1																																																																																			-	tigrfam_Rim_ABC_transpt		0.483	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	protein_coding	OTTHUMT00000029320.1	G	NM_000350	-		94577077	-1	no_errors	ENST00000370225	ensembl	human	known	74_37	silent	SNP	1.000	T
ASPH	444	genome.wustl.edu	37	8	62438653	62438653	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:62438653T>C	ENST00000379454.4	-	22	1970	c.1783A>G	c.(1783-1785)Aag>Gag	p.K595E	ASPH_ENST00000541428.1_Missense_Mutation_p.K566E	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase	595					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	CGGATTAACTTCCAGTTTCTT	0.453																																																	0								ENSG00000198363						83.0	82.0	82.0					8																	62438653		2203	4300	6503	ASPH	SO:0001583	missense	0			-	HGNC	AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.1783A>G	8.37:g.62438653T>C	ENSP00000368767:p.Lys595Glu	Somatic	0	46	0.00		0.6159915499159303	184	27.17	69	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	51	17.74	A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Asp-B-hydro/Triadin_dom,pfam_Asp_Arg_b-Hydrxlase,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.K595E	ENST00000379454.4	37	c.1783	CCDS34898.1	8	.	.	.	.	.	.	.	.	.	.	T	15.05	2.718042	0.48622	.	.	ENSG00000198363	ENST00000541428;ENST00000379454	T;T	0.42513	0.97;0.97	5.68	5.68	0.88126	.	0.054845	0.64402	D	0.000001	T	0.28001	0.0690	N	0.12637	0.245	0.80722	D	1	B;B	0.30763	0.081;0.294	B;B	0.31495	0.017;0.131	T	0.10132	-1.0643	10	0.25106	T	0.35	-24.1086	15.9351	0.79698	0.0:0.0:0.0:1.0	.	566;595	F5H667;Q12797	.;ASPH_HUMAN	E	566;595	ENSP00000437864:K566E;ENSP00000368767:K595E	ENSP00000368767:K595E	K	-	1	0	ASPH	62601207	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.647000	0.67923	2.159000	0.67721	0.528000	0.53228	AAG	-	pfam_Asp_Arg_b-Hydrxlase		0.453	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPH	protein_coding	OTTHUMT00000378510.3	T	NM_004318	-		62438653	-1	no_errors	ENST00000379454	ensembl	human	known	74_37	missense	SNP	1.000	C
PSIP1	11168	genome.wustl.edu	37	9	15472611	15472612	+	Intron	INS	-	-	A	rs113876575|rs201263257		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr9:15472611_15472612insA	ENST00000380733.4	-	10	1321				PSIP1_ENST00000380715.1_Intron|PSIP1_ENST00000380738.4_Intron|PSIP1_ENST00000380716.4_Intron|PSIP1_ENST00000397519.2_Intron			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1						establishment of integrated proviral latency (GO:0075713)|mRNA 5'-splice site recognition (GO:0000395)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to heat (GO:0009408)|response to oxidative stress (GO:0006979)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription coactivator activity (GO:0001105)|supercoiled DNA binding (GO:0097100)			breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)		CCAAAATTTAGAAAAAAAAAAA	0.342																																																	0								ENSG00000164985																																			PSIP1	SO:0001627	intron_variant	0				HGNC	AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985			9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2		9822615, 9885563	Standard	NM_033222		Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.977+17->T	9.37:g.15472622_15472622dupA		Somatic	0	31	0.00		0.6159915499159303	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000380733.4	37	NULL	CCDS6479.1	9																																																																																			-	-		0.342	PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PSIP1	protein_coding	OTTHUMT00000055445.1	-	NM_033222			15472612	-1	no_errors	ENST00000495873	ensembl	human	known	74_37	rna	INS	0.001:0.001	A
E2F8	79733	genome.wustl.edu	37	11	19258889	19258889	+	Silent	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr11:19258889G>T	ENST00000527884.1	-	4	655	c.423C>A	c.(421-423)atC>atA	p.I141I	E2F8_ENST00000250024.4_Silent_p.I141I|RP11-428C19.4_ENST00000527978.1_RNA	NM_001256371.1|NM_001256372.1	NP_001243300.1|NP_001243301.1	A0AVK6	E2F8_HUMAN	E2F transcription factor 8	141					cell cycle comprising mitosis without cytokinesis (GO:0033301)|chorionic trophoblast cell differentiation (GO:0060718)|hepatocyte differentiation (GO:0070365)|negative regulation of cytokinesis (GO:0032466)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CGTCAAGGCAGATGTCATTAT	0.378																																																	0								ENSG00000129173						103.0	97.0	99.0					11																	19258889		2199	4293	6492	E2F8	SO:0001819	synonymous_variant	0			-	HGNC		CCDS7849.1	11p15	2008-02-05			ENSG00000129173	ENSG00000129173			24727	protein-coding gene	gene with protein product		612047				15722552	Standard	NM_024680		Approved	FLJ23311	uc001mpo.2	A0AVK6	OTTHUMG00000166102	ENST00000527884.1:c.423C>A	11.37:g.19258889G>T		Somatic	0	80	0.00		0.6159915499159303	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	69	9.21	A8K9H3|Q2VPJ3|Q3C1U6|Q5BKY4|Q8N340|Q9H5M0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_E2F_TDP	p.I141	ENST00000527884.1	37	c.423	CCDS7849.1	11																																																																																			-	pfam_E2F_TDP		0.378	E2F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F8	protein_coding	OTTHUMT00000387830.1	G	NM_024680	-		19258889	-1	no_errors	ENST00000250024	ensembl	human	known	74_37	silent	SNP	1.000	T
DOCK4	9732	genome.wustl.edu	37	7	111617310	111617310	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:111617310G>A	ENST00000437633.1	-	8	834	c.578C>T	c.(577-579)aCc>aTc	p.T193I	DOCK4_ENST00000476846.1_5'UTR|DOCK4_ENST00000428084.1_Missense_Mutation_p.T193I	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	193					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				CTGCACCGGGGTGTCTTTCTT	0.498																																																	0								ENSG00000128512						65.0	66.0	65.0					7																	111617310		1969	4164	6133	DOCK4	SO:0001583	missense	0			-	HGNC		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.578C>T	7.37:g.111617310G>A	ENSP00000404179:p.Thr193Ile	Somatic	0	56	0.00		0.6159915499159303	5	16.67	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	48	52.48	O14584|O94824|Q8NB45	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_SH3_domain,pfscan_SH3_domain	p.T193I	ENST00000437633.1	37	c.578	CCDS47688.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.39|17.39	3.378671|3.378671	0.61735|0.61735	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000445943|ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250	.|T;T	.|0.03301	.|3.98;3.98	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.07728|0.07728	0.0194|0.0194	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.26845	.|0.161;0.161;0.161;0.161	.|B;B;B;B	.|0.29598	.|0.067;0.104;0.104;0.104	T|T	0.16482|0.16482	-1.0401|-1.0401	5|10	.|0.46703	.|T	.|0.11	.|.	19.2437|19.2437	0.93893|0.93893	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|193;193;193;193	.|A4D0S8;Q149N6;Q149N5;Q8N1I0	.|.;.;.;DOCK4_HUMAN	S|I	181|181;193;193;181;192	.|ENSP00000410746:T193I;ENSP00000404179:T193I	.|ENSP00000345432:T181I	P|T	-|-	1|2	0|0	DOCK4|DOCK4	111404546|111404546	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.862000|0.862000	0.49288|0.49288	7.581000|7.581000	0.82535|0.82535	2.527000|2.527000	0.85204|0.85204	0.563000|0.563000	0.77884|0.77884	CCC|ACC	-	NULL		0.498	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK4	protein_coding	OTTHUMT00000338369.4	G	NM_014705	-		111617310	-1	no_errors	ENST00000428084	ensembl	human	known	74_37	missense	SNP	1.000	A
TKTL2	84076	genome.wustl.edu	37	4	164394869	164394869	+	Silent	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr4:164394869G>T	ENST00000280605.3	-	1	178	c.18C>A	c.(16-18)gcC>gcA	p.A6A		NM_032136.4	NP_115512.3	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	6						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(42)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	70	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				CGTCGGGCTTGGCGTCGTTGG	0.642																																																	0								ENSG00000151005						29.0	26.0	27.0					4																	164394869		2203	4300	6503	TKTL2	SO:0001819	synonymous_variant	0			-	HGNC	BC028707	CCDS3805.1	4q32.2	2009-10-06			ENSG00000151005	ENSG00000151005			25313	protein-coding gene	gene with protein product	"""similar to transketolase"""					11230166	Standard	NM_032136		Approved	FLJ32975, DKFZP434L1717	uc003iqp.4	Q9H0I9	OTTHUMG00000161527	ENST00000280605.3:c.18C>A	4.37:g.164394869G>T		Somatic	0	31	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A4FVB4|Q8NCT0|Q96M82	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Transketolase_N,pfam_Transketolase-like_Pyr-bd,pfam_Transketolase_C,pfam_DH_E1,superfamily_Transketo_C/Pyr-ferredox_oxred,smart_Transketolase-like_Pyr-bd	p.A6	ENST00000280605.3	37	c.18	CCDS3805.1	4																																																																																			-	NULL		0.642	TKTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TKTL2	protein_coding	OTTHUMT00000365207.1	G	NM_032136	-		164394869	-1	no_errors	ENST00000280605	ensembl	human	known	74_37	silent	SNP	0.001	T
RNASET2	8635	genome.wustl.edu	37	6	167369655	167369655	+	Missense_Mutation	SNP	G	G	T	rs11557915	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr6:167369655G>T	ENST00000508775.1	-	1	535	c.16C>A	c.(16-18)Ctg>Atg	p.L6M	RNASET2_ENST00000366855.6_De_novo_Start_OutOfFrame|RNASET2_ENST00000476238.2_Missense_Mutation_p.L6M|RP11-514O12.4_ENST00000507747.1_5'Flank	NM_003730.4	NP_003721.2	O00584	RNT2_HUMAN	ribonuclease T2	6					RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	ribonuclease activity (GO:0004540)|ribonuclease T2 activity (GO:0033897)|RNA binding (GO:0003723)			large_intestine(4)|lung(4)	8		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;1.53e-19)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00665)		GCCCCGCGCAGGGCTGCAGGG	0.687																																																	0								ENSG00000026297						9.0	9.0	9.0					6																	167369655		1980	3815	5795	RNASET2	SO:0001583	missense	0			-	HGNC	AJ419866	CCDS5295.1	6q27	2014-05-20			ENSG00000026297	ENSG00000026297			21686	protein-coding gene	gene with protein product		612944				9192857	Standard	NM_003730		Approved	RNASE6PL, FLJ10907, bA514O12.3	uc003qve.3	O00584	OTTHUMG00000016009	ENST00000508775.1:c.16C>A	6.37:g.167369655G>T	ENSP00000426455:p.Leu6Met	Somatic	0	39	0.00		0.6159915499159303	122	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	B2RDA7|E1P5C3|Q5T8Q0|Q8TCU2|Q9BZ46|Q9BZ47	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNase_T2-like,superfamily_RNase_T2-like	p.L6M	ENST00000508775.1	37	c.16	CCDS5295.1	6	.	.	.	.	.	.	.	.	.	.	G	11.78	1.739892	0.30865	.	.	ENSG00000026297	ENST00000508775;ENST00000428859;ENST00000476238;ENST00000478180;ENST00000310843;ENST00000425007	T;T;T	0.65364	-0.15;-0.15;-0.15	2.81	-5.07	0.02938	.	7.083910	0.00906	U	0.002418	T	0.16514	0.0397	N	0.14661	0.345	0.09310	N	1	B	0.31227	0.314	B	0.17979	0.02	T	0.03060	-1.1077	9	.	.	.	-8.0963	8.1328	0.31037	0.0:0.5807:0.262:0.1573	.	6	O00584	RNT2_HUMAN	M	6	ENSP00000426455:L6M;ENSP00000422846:L6M;ENSP00000426059:L6M	.	L	-	1	2	RNASET2	167289645	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-1.058000	0.03482	-1.220000	0.02594	0.313000	0.20887	CTG	-	NULL		0.687	RNASET2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASET2	protein_coding	OTTHUMT00000043089.2	G	NM_003730	-		167369655	-1	no_errors	ENST00000476238	ensembl	human	known	74_37	missense	SNP	0.000	T
TARS	6897	genome.wustl.edu	37	5	33467090	33467090	+	Splice_Site	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr5:33467090G>T	ENST00000265112.3	+	18	2334	c.2023G>T	c.(2023-2025)Gtt>Ttt	p.V675F	TARS_ENST00000502553.1_Splice_Site_p.V675F|TARS_ENST00000455217.2_Splice_Site_p.V708F|TARS_ENST00000414361.2_Splice_Site_p.V554F|TARS_ENST00000541634.1_Splice_Site_p.V571F	NM_152295.4	NP_689508.3	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	675					gene expression (GO:0010467)|threonyl-tRNA aminoacylation (GO:0006435)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|threonine-tRNA ligase activity (GO:0004829)			NS(1)|biliary_tract(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)	29					L-Threonine(DB00156)	CTTCATTTTAGGTAAGAATGG	0.353																																																	0								ENSG00000113407						54.0	52.0	53.0					5																	33467090		2203	4300	6503	TARS	SO:0001630	splice_region_variant	0			-	HGNC	AK095852	CCDS3899.1, CCDS58943.1	5p13.2	2012-10-02			ENSG00000113407	ENSG00000113407	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	11572	protein-coding gene	gene with protein product	"""threonine tRNA ligase 1, cytoplasmic"""	187790					Standard	NM_152295		Approved		uc011coc.3	P26639	OTTHUMG00000090683	ENST00000265112.3:c.2023+1G>T	5.37:g.33467090G>T		Somatic	0	33	0.00		0.6159915499159303	282	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A8K8I1|B4DEG8|Q96FP5|Q9BWA6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,prints_Thr-tRNA-ligase_IIa,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-ligase_IIa	p.V675F	ENST00000265112.3	37	c.2023	CCDS3899.1	5	.	.	.	.	.	.	.	.	.	.	g	31	5.067024	0.93898	.	.	ENSG00000113407	ENST00000502553;ENST00000265112;ENST00000541634;ENST00000455217;ENST00000414361	D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96	5.47	5.47	0.80525	Anticodon-binding (3);	0.000000	0.85682	D	0.000000	D	0.96030	0.8707	H	0.98754	4.32	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.952;1.0;1.0;1.0	D	0.97786	1.0235	10	0.87932	D	0	-27.8794	18.9331	0.92574	0.0:0.0:1.0:0.0	.	554;708;571;675	E7ERI3;B4DEG8;G3XAN9;P26639	.;.;.;SYTC_HUMAN	F	675;675;571;708;554	ENSP00000424387:V675F;ENSP00000265112:V675F;ENSP00000438469:V571F;ENSP00000387710:V708F;ENSP00000394291:V554F	ENSP00000265112:V675F	V	+	1	0	TARS	33502847	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	9.808000	0.99193	2.558000	0.86282	0.655000	0.94253	GTT	-	pfam_Anticodon-bd,superfamily_Anticodon-bd,tigrfam_Thr-tRNA-ligase_IIa		0.353	TARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARS	protein_coding	OTTHUMT00000207367.1	G	NM_152295	-	Missense_Mutation	33467090	+1	no_errors	ENST00000265112	ensembl	human	known	74_37	missense	SNP	1.000	T
PLXNA3	55558	genome.wustl.edu	37	X	153692617	153692617	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:153692617C>T	ENST00000369682.3	+	8	1964	c.1789C>T	c.(1789-1791)Ccc>Tcc	p.P597S		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	597					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGCCCCTCACCCTCCCTCCA	0.697																																																	0								ENSG00000130827						23.0	23.0	23.0					X																	153692617		2199	4293	6492	PLXNA3	SO:0001583	missense	0			-	HGNC	X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.1789C>T	X.37:g.153692617C>T	ENSP00000358696:p.Pro597Ser	Somatic	0	21	0.00		0.6159915499159303	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	17	19.05	Q5HY36	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.P597S	ENST00000369682.3	37	c.1789	CCDS14752.1	X	.	.	.	.	.	.	.	.	.	.	C	13.43	2.235506	0.39498	.	.	ENSG00000130827	ENST00000369682	T	0.01209	5.17	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.04092	0.0114	M	0.80616	2.505	0.80722	D	1	P	0.50819	0.939	P	0.46825	0.528	T	0.22556	-1.0213	10	0.87932	D	0	.	17.0691	0.86568	0.0:1.0:0.0:0.0	.	597	P51805	PLXA3_HUMAN	S	597	ENSP00000358696:P597S	ENSP00000358696:P597S	P	+	1	0	PLXNA3	153345811	0.141000	0.22595	0.200000	0.23457	0.036000	0.12997	1.286000	0.33273	2.295000	0.77249	0.597000	0.82753	CCC	-	NULL		0.697	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA3	protein_coding	OTTHUMT00000081634.1	C	NM_017514	-		153692617	+1	no_errors	ENST00000369682	ensembl	human	known	74_37	missense	SNP	0.999	T
PADI6	353238	genome.wustl.edu	37	1	17707595	17707595	+	RNA	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:17707595C>A	ENST00000434762.2	+	0	539							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	TTGTGAATTGCAACCCTGCTG	0.493																																																	0								ENSG00000256049						76.0	79.0	78.0					1																	17707595		1946	4144	6090	PADI6			0			-	HGNC	AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17707595C>A		Somatic	0	26	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	37	38.33	Q330K5|Q70SX3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000434762.2	37	NULL		1																																																																																			-	-		0.493	PADI6-001	KNOWN	basic	processed_transcript	PADI6	processed_transcript	OTTHUMT00000006804.4	C	NM_207421	-		17707595	+1	no_errors	ENST00000358481	ensembl	human	known	74_37	rna	SNP	0.017	A
GPR112	139378	genome.wustl.edu	37	X	135405422	135405422	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:135405422C>A	ENST00000394143.1	+	5	847	c.556C>A	c.(556-558)Caa>Aaa	p.Q186K	GPR112_ENST00000394141.1_Intron|GPR112_ENST00000287534.4_Missense_Mutation_p.Q123K|GPR112_ENST00000412101.1_Intron|GPR112_ENST00000370652.1_Missense_Mutation_p.Q186K	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	186					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					GTACTACTTTCAACTCTGGGA	0.443																																																	0								ENSG00000156920						171.0	150.0	157.0					X																	135405422		2203	4300	6503	GPR112	SO:0001583	missense	0			-	HGNC	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.556C>A	X.37:g.135405422C>A	ENSP00000377699:p.Gln186Lys	Somatic	0	44	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	83	20.95	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.Q186K	ENST00000394143.1	37	c.556	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	C	19.92	3.916273	0.73098	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000287534	T;T;T	0.62788	-0.0;-0.0;-0.0	5.62	5.62	0.85841	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	.	.	.	.	T	0.71324	0.3326	L	0.34521	1.04	0.23056	N	0.998361	D	0.69078	0.997	D	0.83275	0.996	T	0.64997	-0.6275	9	0.59425	D	0.04	.	15.2305	0.73383	0.0:1.0:0.0:0.0	.	186	Q8IZF6	GP112_HUMAN	K	186;186;123	ENSP00000377699:Q186K;ENSP00000359686:Q186K;ENSP00000287534:Q123K	ENSP00000287534:Q123K	Q	+	1	0	GPR112	135233088	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.991000	0.49409	2.349000	0.79799	0.513000	0.50165	CAA	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin		0.443	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	protein_coding	OTTHUMT00000286639.1	C		-		135405422	+1	no_errors	ENST00000370652	ensembl	human	known	74_37	missense	SNP	1.000	A
FAM83F	113828	genome.wustl.edu	37	22	40391373	40391373	+	Silent	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:40391373C>T	ENST00000333407.6	+	1	421	c.327C>T	c.(325-327)ccC>ccT	p.P109P	FAM83F_ENST00000488874.1_3'UTR	NM_138435.2	NP_612444.2	Q8NEG4	FA83F_HUMAN	family with sequence similarity 83, member F	109										breast(1)|endometrium(2)|large_intestine(1)|lung(4)|skin(4)|urinary_tract(2)	14						CCTACTGGCCCGACCGTTCCG	0.731																																																	0								ENSG00000133477						4.0	6.0	5.0					22																	40391373		1635	3605	5240	FAM83F	SO:0001819	synonymous_variant	0			-	HGNC		CCDS14000.2	22q13.1	2006-03-22			ENSG00000133477	ENSG00000133477			25148	protein-coding gene	gene with protein product						12477932	Standard	NM_138435		Approved		uc003ayk.1	Q8NEG4	OTTHUMG00000150688	ENST00000333407.6:c.327C>T	22.37:g.40391373C>T		Somatic	0	17	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	23	39.47	Q96FD6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1669	p.P109	ENST00000333407.6	37	c.327	CCDS14000.2	22																																																																																			-	pfam_DUF1669		0.731	FAM83F-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83F	protein_coding	OTTHUMT00000319624.3	C	NM_138435	-		40391373	+1	no_errors	ENST00000333407	ensembl	human	known	74_37	silent	SNP	0.983	T
OR13A1	79290	genome.wustl.edu	37	10	45799437	45799437	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr10:45799437C>A	ENST00000553795.1	-	4	742	c.434G>T	c.(433-435)tGc>tTc	p.C145F	OR13A1_ENST00000536058.1_Missense_Mutation_p.C145F|OR13A1_ENST00000374401.2_Missense_Mutation_p.C145F	NM_001004297.2	NP_001004297.2	Q8NGR1	O13A1_HUMAN	olfactory receptor, family 13, subfamily A, member 1	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)|urinary_tract(1)	19						CAGCGGGTGGCAGATGGCTGC	0.627																																																	0								ENSG00000256574						32.0	26.0	28.0					10																	45799437		2203	4300	6503	OR13A1	SO:0001583	missense	0			-	HGNC	AB065728	CCDS31188.1	10q11.21	2012-10-03			ENSG00000256574	ENSG00000256574		"""GPCR / Class A : Olfactory receptors"""	14772	protein-coding gene	gene with protein product							Standard	NM_001004297		Approved		uc001jcc.1	Q8NGR1	OTTHUMG00000018080	ENST00000553795.1:c.434G>T	10.37:g.45799437C>A	ENSP00000451950:p.Cys145Phe	Somatic	0	18	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	5	58.33	Q2M3M4|Q5VV57|Q6IFH5|Q6ZMN6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C145F	ENST00000553795.1	37	c.434	CCDS31188.1	10	.	.	.	.	.	.	.	.	.	.	c	22.0	4.223670	0.79576	.	.	ENSG00000256574	ENST00000553795;ENST00000536058;ENST00000374401	T;T;T	0.34472	1.36;1.36;1.36	5.78	5.78	0.91487	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000083	T	0.72526	0.3471	H	0.95260	3.645	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	T	0.80856	-0.1195	10	0.87932	D	0	-77.0753	17.5765	0.87950	0.0:1.0:0.0:0.0	.	145	Q8NGR1	O13A1_HUMAN	F	145	ENSP00000451950:C145F;ENSP00000438657:C145F;ENSP00000363522:C145F	ENSP00000311379:C145F	C	-	2	0	OR13A1	45119443	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	5.604000	0.67626	2.724000	0.93272	0.650000	0.86243	TGC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.627	OR13A1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OR13A1	protein_coding	OTTHUMT00000047779.2	C	NM_001004297	-		45799437	-1	no_errors	ENST00000374401	ensembl	human	known	74_37	missense	SNP	1.000	A
OPALIN	93377	genome.wustl.edu	37	10	98109509	98109509	+	Silent	SNP	T	T	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr10:98109509T>G	ENST00000371172.3	-	4	552	c.147A>C	c.(145-147)ctA>ctC	p.L49L	OPALIN_ENST00000393870.2_Silent_p.L38L|OPALIN_ENST00000393871.1_Silent_p.L26L|OPALIN_ENST00000419479.1_Silent_p.L39L|OPALIN_ENST00000536387.1_Silent_p.L39L	NM_001284326.1|NM_001284327.1|NM_033207.3	NP_001271255.1|NP_001271256.1|NP_149984.1	Q96PE5	OPALI_HUMAN	oligodendrocytic myelin paranodal and inner loop protein	49						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(5)|prostate(2)	9						TCAAAGTAAATAGTAAAGCCA	0.507																																																	0								ENSG00000197430						71.0	69.0	69.0					10																	98109509		2203	4300	6503	OPALIN	SO:0001819	synonymous_variant	0			-	HGNC	AF367761	CCDS7448.1, CCDS41556.1, CCDS44466.1, CCDS60602.1, CCDS73172.1, CCDS73173.1	10q23-q24	2010-11-23	2008-05-01	2008-05-01	ENSG00000197430	ENSG00000197430			20707	protein-coding gene	gene with protein product			"""transmembrane protein 10"""	TMEM10		11814680, 17442045	Standard	NM_001284324		Approved	TMP10, HTMP10	uc001kmj.3	Q96PE5	OTTHUMG00000018831	ENST00000371172.3:c.147A>C	10.37:g.98109509T>G		Somatic	0	36	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	13	58.06	A8MX69|A8MYG4|B4DK96|B4DKH0|Q5W102	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L49	ENST00000371172.3	37	c.147	CCDS7448.1	10																																																																																			-	NULL		0.507	OPALIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPALIN	protein_coding	OTTHUMT00000049606.1	T	NM_033207	-		98109509	-1	no_errors	ENST00000371172	ensembl	human	known	74_37	silent	SNP	0.000	G
GNL3	26354	genome.wustl.edu	37	3	52724985	52724985	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr3:52724985G>T	ENST00000418458.1	+	8	852	c.679G>T	c.(679-681)Gct>Tct	p.A227S	SNORD19B_ENST00000516978.1_RNA|GNL3_ENST00000394799.2_Missense_Mutation_p.A215S|SNORD69_ENST00000391150.1_RNA|SNORD19_ENST00000410413.1_RNA|SNORD19B_ENST00000459623.1_RNA|SNORD19_ENST00000391191.1_RNA	NM_014366.4|NM_206826.1	NP_055181.3|NP_996562.1	Q9BVP2	GNL3_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)	227	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				cell proliferation (GO:0008283)|GTP catabolic process (GO:0006184)|regulation of cell proliferation (GO:0042127)|ribosome biogenesis (GO:0042254)	extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|large_intestine(3)|lung(2)	12				BRCA - Breast invasive adenocarcinoma(193;6.75e-05)|Kidney(197;0.000611)|KIRC - Kidney renal clear cell carcinoma(197;0.000773)|OV - Ovarian serous cystadenocarcinoma(275;0.048)		GAAGAATGCTGCTCCATTCAG	0.423																																																	0								ENSG00000163938						105.0	108.0	107.0					3																	52724985		2203	4300	6503	GNL3	SO:0001583	missense	0			-	HGNC	AK027514	CCDS2861.1, CCDS43100.1	3p21.1	2005-01-10			ENSG00000163938	ENSG00000163938			29931	protein-coding gene	gene with protein product		608011				11085516, 12464630	Standard	NM_014366		Approved	C77032, E2IG3, MGC800, NS, nucleostemin	uc003dfd.3	Q9BVP2	OTTHUMG00000158752	ENST00000418458.1:c.679G>T	3.37:g.52724985G>T	ENSP00000395772:p.Ala227Ser	Somatic	0	48	0.00		0.6159915499159303	301	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B2RDC1|Q5PU80|Q96SV6|Q96SV7|Q9UJY0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Gnl3_N_dom,pfam_GTP_binding_domain,superfamily_P-loop_NTPase	p.A227S	ENST00000418458.1	37	c.679	CCDS2861.1	3	.	.	.	.	.	.	.	.	.	.	G	1.390	-0.581125	0.03854	.	.	ENSG00000163938	ENST00000418458;ENST00000394799	T;T	0.17691	2.26;2.26	6.03	2.17	0.27698	.	0.691492	0.15397	N	0.264520	T	0.07954	0.0199	N	0.21194	0.64	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.40175	-0.9577	10	0.09338	T	0.73	.	1.8038	0.03076	0.2357:0.1391:0.4818:0.1434	.	227	Q9BVP2	GNL3_HUMAN	S	227;215	ENSP00000395772:A227S;ENSP00000378278:A215S	ENSP00000378278:A215S	A	+	1	0	GNL3	52700025	0.007000	0.16637	0.025000	0.17156	0.441000	0.31987	0.727000	0.25999	0.109000	0.17891	0.655000	0.94253	GCT	-	superfamily_P-loop_NTPase		0.423	GNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL3	protein_coding	OTTHUMT00000352032.1	G	NM_014366	-		52724985	+1	no_errors	ENST00000418458	ensembl	human	known	74_37	missense	SNP	0.000	T
VPS4A	27183	genome.wustl.edu	37	16	69352829	69352829	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr16:69352829C>A	ENST00000254950.11	+	5	603	c.447C>A	c.(445-447)ttC>ttA	p.F149L	COG8_ENST00000564419.1_5'Flank|RP11-343C2.11_ENST00000570054.2_Missense_Mutation_p.F173L	NM_013245.2	NP_037377.1			vacuolar protein sorting 4 homolog A (S. cerevisiae)											NS(1)|central_nervous_system(1)|large_intestine(2)|lung(3)	7		Ovarian(137;0.101)				CAATCAAATTCCCACACTTGT	0.562																																																	0								ENSG00000132612						110.0	128.0	122.0					16																	69352829		2053	4222	6275	VPS4A	SO:0001583	missense	0			-	HGNC	AF112215	CCDS45517.1	16q23.1	2010-04-21	2006-04-04		ENSG00000132612	ENSG00000132612		"""ATPases / AAA-type"""	13488	protein-coding gene	gene with protein product		609982	"""vacuolar protein sorting 4A (yeast homolog)"", ""vacuolar protein sorting 4A (yeast)"""			10637304, 11563910	Standard	NM_013245		Approved	VPS4, VPS4-1, FLJ22197, SKD2, SKD1, SKD1A	uc002eww.3	Q9UN37		ENST00000254950.11:c.447C>A	16.37:g.69352829C>A	ENSP00000254950:p.Phe149Leu	Somatic	0	50	0.00		0.6159915499159303	265	0.75	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_MIT,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_MIT,smart_AAA+_ATPase	p.F149L	ENST00000254950.11	37	c.447	CCDS45517.1	16	.	.	.	.	.	.	.	.	.	.	C	17.55	3.418180	0.62622	.	.	ENSG00000132612	ENST00000254950	D	0.94862	-3.54	6.17	3.15	0.36227	.	0.000000	0.85682	D	0.000000	D	0.92208	0.7529	M	0.71920	2.185	0.80722	D	1	B	0.31705	0.336	B	0.26517	0.07	D	0.88903	0.3354	10	0.59425	D	0.04	-26.8316	11.2496	0.49017	0.0:0.7967:0.0:0.2033	.	149	Q9UN37	VPS4A_HUMAN	L	149	ENSP00000254950:F149L	ENSP00000254950:F149L	F	+	3	2	VPS4A	67910330	0.995000	0.38212	1.000000	0.80357	0.995000	0.86356	0.512000	0.22755	0.467000	0.27218	-0.150000	0.13652	TTC	-	superfamily_P-loop_NTPase		0.562	VPS4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS4A	protein_coding	OTTHUMT00000430563.3	C	NM_013245	-		69352829	+1	no_errors	ENST00000254950	ensembl	human	known	74_37	missense	SNP	1.000	A
MGAT2	4247	genome.wustl.edu	37	14	50089989	50089989	+	3'UTR	DEL	T	T	-	rs573436485	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr14:50089989delT	ENST00000305386.2	+	0	2501				RPL36AL_ENST00000298289.6_5'Flank|RP11-649E7.5_ENST00000555043.1_RNA	NM_002408.3	NP_002399.1	Q10469	MGAT2_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase						cellular protein metabolic process (GO:0044267)|oligosaccharide biosynthetic process (GO:0009312)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-1,6-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity (GO:0008455)|carbohydrate binding (GO:0030246)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)	11	all_epithelial(31;0.0021)|Breast(41;0.0124)					AGTGGTTTTGTTTTTTTTTTT	0.274																																																	0								ENSG00000258377																																			RP11-649E7.5	SO:0001624	3_prime_UTR_variant	0				Clone_based_vega_gene	U15128	CCDS9690.1	14q21	2013-02-25			ENSG00000168282	ENSG00000168282	2.4.1.143	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7045	protein-coding gene	gene with protein product		602616				7635144	Standard	NM_002408		Approved	GNT-II	uc001wwr.3	Q10469	OTTHUMG00000140271	ENST00000305386.2:c.*659T>-	14.37:g.50089989delT		Somatic	0	41	0.00		0.6159915499159303	97	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	27	15.62	B3KPC5|B3KQM0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000305386.2	37	NULL	CCDS9690.1	14																																																																																			-	-		0.274	MGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000258377	protein_coding	OTTHUMT00000276807.1	T	NM_002408			50089989	-1	no_errors	ENST00000555043	ensembl	human	known	74_37	rna	DEL	0.003	-
OR12D3	81797	genome.wustl.edu	37	6	29342525	29342525	+	Silent	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr6:29342525C>T	ENST00000396806.3	-	1	543	c.540G>A	c.(538-540)aaG>aaA	p.K180K	OR5V1_ENST00000377154.1_Intron	NM_030959.2	NP_112221.1	Q9UGF7	O12D3_HUMAN	olfactory receptor, family 12, subfamily D, member 3	180						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)	23						CTAAGAGCGGCTTGACATCGT	0.448																																																	0								ENSG00000112462						93.0	94.0	94.0					6																	29342525		1510	2708	4218	OR12D3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS4658.1	6p22.1	2013-09-24			ENSG00000112462	ENSG00000112462		"""GPCR / Class A : Olfactory receptors"""	13963	protein-coding gene	gene with protein product							Standard	NM_030959		Approved	hs6M1-27	uc003nme.3	Q9UGF7	OTTHUMG00000031051	ENST00000396806.3:c.540G>A	6.37:g.29342525C>T		Somatic	0	20	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	17	19.05	A2BDZ1|Q5SQI8|Q6IF23	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K180	ENST00000396806.3	37	c.540	CCDS4658.1	6																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.448	OR12D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR12D3	protein_coding	OTTHUMT00000076056.3	C		-		29342525	-1	no_errors	ENST00000396806	ensembl	human	known	74_37	silent	SNP	0.071	T
LMTK2	22853	genome.wustl.edu	37	7	97823854	97823854	+	Silent	SNP	C	C	T	rs560743982		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:97823854C>T	ENST00000297293.5	+	11	4370	c.4077C>T	c.(4075-4077)ttC>ttT	p.F1359F		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	1359					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					TCACGTTTTTCGATGATGTCA	0.483																																																	0								ENSG00000164715						94.0	77.0	83.0					7																	97823854		2203	4300	6503	LMTK2	SO:0001819	synonymous_variant	0			-	HGNC	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.4077C>T	7.37:g.97823854C>T		Somatic	0	34	0.00		0.6159915499159303	6	40.00	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	36	42.19	A4D272|Q75MG7|Q9UPS3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.F1359	ENST00000297293.5	37	c.4077	CCDS5654.1	7																																																																																			-	NULL		0.483	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMTK2	protein_coding	OTTHUMT00000334560.1	C	NM_014916	-		97823854	+1	no_errors	ENST00000297293	ensembl	human	known	74_37	silent	SNP	0.635	T
NTSR2	23620	genome.wustl.edu	37	2	11800227	11800227	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:11800227G>T	ENST00000306928.5	-	3	965	c.931C>A	c.(931-933)Ctg>Atg	p.L311M		NM_012344.3	NP_036476	O95665	NTR2_HUMAN	neurotensin receptor 2	311					cell surface receptor signaling pathway (GO:0007166)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of membrane potential (GO:0042391)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(7)|lung(7)|prostate(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	Levocabastine(DB01106)	TGGTACGGCAGCCAGCAGATG	0.567																																																	0								ENSG00000169006						99.0	85.0	89.0					2																	11800227		2203	4300	6503	NTSR2	SO:0001583	missense	0			-	HGNC	Y10148	CCDS1681.1	2p25.1	2012-08-08			ENSG00000169006	ENSG00000169006		"""GPCR / Class A : Neurotensin receptors"""	8040	protein-coding gene	gene with protein product		605538				8647296, 9851594	Standard	NM_012344		Approved	NTR2	uc002rbq.4	O95665	OTTHUMG00000119083	ENST00000306928.5:c.931C>A	2.37:g.11800227G>T	ENSP00000303686:p.Leu311Met	Somatic	0	19	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	Q53QQ5|Q57Z87|Q8IY58|Q8TBH6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_NT2_rcpt,prints_NT_rcpt,prints_GPCR_Rhodpsn	p.L311M	ENST00000306928.5	37	c.931	CCDS1681.1	2	.	.	.	.	.	.	.	.	.	.	G	15.16	2.752318	0.49362	.	.	ENSG00000169006	ENST00000306928	T	0.76060	-0.99	3.33	-1.29	0.09288	GPCR, rhodopsin-like superfamily (1);	0.719989	0.11770	N	0.531232	T	0.62171	0.2406	L	0.41961	1.31	0.30178	N	0.800642	B	0.31989	0.35	B	0.31614	0.133	T	0.53337	-0.8453	10	0.16896	T	0.51	-1.0449	11.6113	0.51062	0.0:0.0:0.4674:0.5326	.	311	O95665	NTR2_HUMAN	M	311	ENSP00000303686:L311M	ENSP00000303686:L311M	L	-	1	2	NTSR2	11717678	1.000000	0.71417	0.994000	0.49952	0.794000	0.44872	0.648000	0.24828	-0.271000	0.09272	0.650000	0.86243	CTG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.567	NTSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTSR2	protein_coding	OTTHUMT00000239297.1	G		-		11800227	-1	no_errors	ENST00000306928	ensembl	human	known	74_37	missense	SNP	1.000	T
UBE3C	9690	genome.wustl.edu	37	7	157041079	157041079	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:157041079G>T	ENST00000348165.5	+	19	2859	c.2499G>T	c.(2497-2499)atG>atT	p.M833I		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	833	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		ATGAGAACATGCTGGTGGAGC	0.473																																																	0								ENSG00000009335						96.0	96.0	96.0					7																	157041079		2203	4300	6503	UBE3C	SO:0001583	missense	0			-	HGNC	AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.2499G>T	7.37:g.157041079G>T	ENSP00000309198:p.Met833Ile	Somatic	0	42	0.00		0.6159915499159303	86	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HECT,superfamily_HECT,superfamily_DHFR-like_dom,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.M833I	ENST00000348165.5	37	c.2499	CCDS34789.1	7	.	.	.	.	.	.	.	.	.	.	G	16.12	3.032931	0.54790	.	.	ENSG00000009335	ENST00000348165	T	0.53206	0.63	5.74	5.74	0.90152	HECT (4);	0.000000	0.85682	D	0.000000	T	0.18257	0.0438	N	0.00566	-1.37	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.15484	0.008;0.013	T	0.41161	-0.9524	10	0.02654	T	1	-43.8002	19.9122	0.97029	0.0:0.0:1.0:0.0	.	833;686	Q15386;B4DHJ9	UBE3C_HUMAN;.	I	833	ENSP00000309198:M833I	ENSP00000309198:M833I	M	+	3	0	UBE3C	156733840	1.000000	0.71417	1.000000	0.80357	0.560000	0.35617	9.502000	0.97981	2.702000	0.92279	0.655000	0.94253	ATG	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT		0.473	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3C	protein_coding	OTTHUMT00000348108.1	G	NM_014671	-		157041079	+1	no_errors	ENST00000348165	ensembl	human	known	74_37	missense	SNP	1.000	T
OR7C1	26664	genome.wustl.edu	37	19	14910160	14910160	+	Silent	SNP	T	T	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:14910160T>C	ENST00000248073.2	-	1	863	c.789A>G	c.(787-789)gcA>gcG	p.A263A	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	263					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						ATGGTGTGGCTGCAGAACTGA	0.542																																																	0								ENSG00000127530						89.0	82.0	84.0					19																	14910160		2203	4300	6503	OR7C1	SO:0001819	synonymous_variant	0			-	HGNC	X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.789A>G	19.37:g.14910160T>C		Somatic	0	49	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	25	56.14	Q15621|Q6IFP2|Q96R94	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A263	ENST00000248073.2	37	c.789	CCDS12317.1	19																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.542	OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7C1	protein_coding	OTTHUMT00000466519.1	T		-		14910160	-1	no_errors	ENST00000248073	ensembl	human	known	74_37	silent	SNP	0.000	C
MYH4	4622	genome.wustl.edu	37	17	10351814	10351814	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr17:10351814G>T	ENST00000255381.2	-	33	4665	c.4555C>A	c.(4555-4557)Caa>Aaa	p.Q1519K	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1519					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TCTGCAATTTGCTCTGTCAGG	0.363																																																	0								ENSG00000264424						103.0	98.0	99.0					17																	10351814		2202	4300	6502	MYH4	SO:0001583	missense	0			-	HGNC		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.4555C>A	17.37:g.10351814G>T	ENSP00000255381:p.Gln1519Lys	Somatic	0	34	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	72	19.10		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q1519K	ENST00000255381.2	37	c.4555	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	G	25.5	4.645060	0.87859	.	.	ENSG00000141048	ENST00000255381	D	0.83163	-1.69	5.49	5.49	0.81192	Myosin tail (1);	0.224065	0.22179	U	0.063533	D	0.93736	0.7998	H	0.95712	3.71	0.54753	D	0.999983	D	0.63046	0.992	D	0.63113	0.911	D	0.95044	0.8181	10	0.87932	D	0	.	19.7383	0.96217	0.0:0.0:1.0:0.0	.	1519	Q9Y623	MYH4_HUMAN	K	1519	ENSP00000255381:Q1519K	ENSP00000255381:Q1519K	Q	-	1	0	MYH4	10292539	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.784000	0.99039	2.742000	0.94016	0.655000	0.94253	CAA	-	pfam_Myosin_tail,superfamily_tRNA-bd_arm		0.363	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	protein_coding	OTTHUMT00000252731.1	G	NM_017533	-		10351814	-1	no_errors	ENST00000255381	ensembl	human	known	74_37	missense	SNP	1.000	T
MC4R	4160	genome.wustl.edu	37	18	58038604	58038604	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr18:58038604C>A	ENST00000299766.3	-	1	1397	c.979G>T	c.(979-981)Gac>Tac	p.D327Y		NM_005912.2	NP_005903.2	P32245	MC4R_HUMAN	melanocortin 4 receptor	327					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|diet induced thermogenesis (GO:0002024)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|insulin secretion (GO:0030073)|negative regulation of feeding behavior (GO:2000252)|positive regulation of bone resorption (GO:0045780)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of grooming behavior (GO:2000821)|response to insulin (GO:0032868)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(73;0.0946)				CTAGACAAGTCACAAAGGCCT	0.418																																																	0								ENSG00000166603						119.0	117.0	118.0					18																	58038604		2203	4300	6503	MC4R	SO:0001583	missense	0			-	HGNC	AY236539	CCDS11976.1	18q22	2012-08-10			ENSG00000166603	ENSG00000166603		"""GPCR / Class A : Melanocortin receptors"""	6932	protein-coding gene	gene with protein product		155541				7949735, 9763669	Standard	NM_005912		Approved		uc002lie.1	P32245	OTTHUMG00000132766	ENST00000299766.3:c.979G>T	18.37:g.58038604C>A	ENSP00000299766:p.Asp327Tyr	Somatic	0	36	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	B2RAC3|Q16317|Q3MIJ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Melcrt_ACTH_rcpt,prints_Mcort_rcpt_4,prints_GPCR_Rhodpsn,prints_Melancort_rcpt,prints_Cnbnoid_rcpt	p.D327Y	ENST00000299766.3	37	c.979	CCDS11976.1	18	.	.	.	.	.	.	.	.	.	.	C	8.294	0.818456	0.16607	.	.	ENSG00000166603	ENST00000299766	T	0.58940	0.3	5.65	4.78	0.61160	.	0.355818	0.28198	N	0.016231	T	0.48241	0.1489	L	0.36672	1.1	0.39559	D	0.969103	B	0.23128	0.08	B	0.23150	0.044	T	0.51212	-0.8734	10	0.62326	D	0.03	.	12.3576	0.55184	0.0:0.9198:0.0:0.0802	.	327	P32245	MC4R_HUMAN	Y	327	ENSP00000299766:D327Y	ENSP00000299766:D327Y	D	-	1	0	MC4R	56189584	1.000000	0.71417	0.999000	0.59377	0.435000	0.31806	3.123000	0.50453	1.636000	0.50526	-0.136000	0.14681	GAC	-	prints_Mcort_rcpt_4		0.418	MC4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC4R	protein_coding	OTTHUMT00000256139.1	C	NM_005912	-		58038604	-1	no_errors	ENST00000299766	ensembl	human	known	74_37	missense	SNP	1.000	A
CALCR	799	genome.wustl.edu	37	7	93106949	93106949	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:93106949C>A	ENST00000394441.1	-	4	552	c.237G>T	c.(235-237)tgG>tgT	p.W79C	CALCR_ENST00000359558.2_Missense_Mutation_p.W97C|CALCR_ENST00000426151.1_Missense_Mutation_p.W79C|CALCR_ENST00000360249.4_Missense_Mutation_p.W79C|CALCR_ENST00000421592.1_Missense_Mutation_p.W79C	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	97					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	CCCAGCACAGCCATCCATCCC	0.423																																																	0								ENSG00000004948						93.0	78.0	83.0					7																	93106949		2203	4300	6503	CALCR	SO:0001583	missense	0			-	HGNC	L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.237G>T	7.37:g.93106949C>A	ENSP00000377959:p.Trp79Cys	Somatic	0	34	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	41	26.79	A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GCPR_2_calcitonin_rcpt_fam,prints_GPCR_2_secretin-like,prints_GPCR_2_calcitonin_rcpt	p.W97C	ENST00000394441.1	37	c.291	CCDS5631.1	7	.	.	.	.	.	.	.	.	.	.	C	19.98	3.927608	0.73327	.	.	ENSG00000004948	ENST00000359558;ENST00000360249;ENST00000421592;ENST00000535783;ENST00000394441;ENST00000426151	T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05	4.06	4.06	0.47325	.	.	.	.	.	D	0.84275	0.5436	H	0.94503	3.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.88882	0.3340	9	0.72032	D	0.01	.	16.1994	0.82060	0.0:1.0:0.0:0.0	.	97;79	F5H605;A4D1G6	.;.	C	97;79;79;79;79;79	ENSP00000352561:W97C;ENSP00000353385:W79C;ENSP00000399552:W79C;ENSP00000377959:W79C;ENSP00000389295:W79C	ENSP00000352561:W97C	W	-	3	0	CALCR	92944885	1.000000	0.71417	0.977000	0.42913	0.994000	0.84299	7.123000	0.77176	2.544000	0.85801	0.557000	0.71058	TGG	-	pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom		0.423	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	CALCR	protein_coding	OTTHUMT00000254661.2	C	NM_001742	-		93106949	-1	no_errors	ENST00000359558	ensembl	human	known	74_37	missense	SNP	1.000	A
UCP1	7350	genome.wustl.edu	37	4	141489848	141489848	+	Silent	SNP	G	G	T	rs555213120		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr4:141489848G>T	ENST00000262999.3	-	1	111	c.36C>A	c.(34-36)acC>acA	p.T12T		NM_021833.4	NP_068605.1	P25874	UCP1_HUMAN	uncoupling protein 1 (mitochondrial, proton carrier)	12					brown fat cell differentiation (GO:0050873)|cellular metabolic process (GO:0044237)|mitochondrial transport (GO:0006839)|proton transport (GO:0015992)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	oxidative phosphorylation uncoupler activity (GO:0017077)			NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|stomach(1)	16	all_hematologic(180;0.162)					GGACCCCCAGGGTCGGGTGTA	0.622													g|||	1	0.000199681	0.0008	0.0	5008	,	,		15945	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000109424						36.0	31.0	33.0					4																	141489848		2203	4300	6503	UCP1	SO:0001819	synonymous_variant	0			-	HGNC	X51955	CCDS3753.1	4q28-q31	2013-05-22			ENSG00000109424	ENSG00000109424		"""Solute carriers"""	12517	protein-coding gene	gene with protein product		113730		UCP		2380264	Standard	NM_021833		Approved	SLC25A7	uc011chj.2	P25874	OTTHUMG00000133415	ENST00000262999.3:c.36C>A	4.37:g.141489848G>T		Somatic	0	41	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	41	22.64	Q13218|Q4KMZ3|Q68G66	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_uncoupling	p.T12	ENST00000262999.3	37	c.36	CCDS3753.1	4																																																																																			-	superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier		0.622	UCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCP1	protein_coding	OTTHUMT00000257273.1	G		-		141489848	-1	no_errors	ENST00000262999	ensembl	human	known	74_37	silent	SNP	1.000	T
NSD1	64324	genome.wustl.edu	37	5	176721530	176721530	+	Silent	SNP	G	G	T	rs369778799		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr5:176721530G>T	ENST00000439151.2	+	23	7206	c.7161G>T	c.(7159-7161)ccG>ccT	p.P2387P	NSD1_ENST00000361032.4_Silent_p.P2284P|NSD1_ENST00000347982.4_Silent_p.P2118P|NSD1_ENST00000354179.4_Silent_p.P2118P	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2387	Pro-rich.				gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TGAGACTTCCGCCGCCAGACA	0.577			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																														Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0								ENSG00000165671						58.0	63.0	61.0					5																	176721530		2203	4300	6503	NSD1	SO:0001819	synonymous_variant	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	-	HGNC	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.7161G>T	5.37:g.176721530G>T		Somatic	0	42	0.00		0.6159915499159303	71	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q96PD8|Q96RN7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PWWP_dom,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.P2387	ENST00000439151.2	37	c.7161	CCDS4412.1	5																																																																																			-	NULL		0.577	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	protein_coding	OTTHUMT00000253412.2	G	NM_172349	-		176721530	+1	no_errors	ENST00000439151	ensembl	human	known	74_37	silent	SNP	0.000	T
ZFP62	643836	genome.wustl.edu	37	5	180275824	180275824	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr5:180275824G>T	ENST00000502412.1	-	2	2728	c.2671C>A	c.(2671-2673)Ctg>Atg	p.L891M	ZFP62_ENST00000359141.6_Missense_Mutation_p.L831M|ZFP62_ENST00000512132.1_Missense_Mutation_p.L858M|ZFP62_ENST00000506377.1_Intron	NM_001172638.1	NP_001166109.1	Q8NB50	ZFP62_HUMAN	ZFP62 zinc finger protein	891					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|endometrium(2)|pancreas(1)	4	all_cancers(89;4.01e-05)|all_epithelial(37;4.69e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00469)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCCCATCCAGGGCATTCCCT	0.453																																																	0								ENSG00000196670						81.0	69.0	72.0					5																	180275824		692	1591	2283	ZFP62	SO:0001583	missense	0			-	HGNC	AK002206	CCDS47357.1, CCDS47357.2, CCDS54955.1	5q35.3	2013-01-08	2012-11-27			ENSG00000196670		"""Zinc fingers, C2H2-type"""	23241	protein-coding gene	gene with protein product		610281	"""zinc finger protein 62 homolog (mouse)"", ""zinc finger protein 62"""			8808410	Standard	NM_152283		Approved	FLJ34231, ZET, ZNF755	uc011dhf.2	Q8NB50		ENST00000502412.1:c.2671C>A	5.37:g.180275824G>T	ENSP00000423820:p.Leu891Met	Somatic	0	41	0.00		0.6159915499159303	35	2.78	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.33	B4DIP6|B4E0N3|B5MDX6|B7ZVZ2|B9EIP6|E9PFT8|J3QTA9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L858M	ENST00000502412.1	37	c.2572	CCDS54955.1	5	.	.	.	.	.	.	.	.	.	.	G	10.58	1.390484	0.25118	.	.	ENSG00000196670	ENST00000512132;ENST00000359141;ENST00000502412;ENST00000405851	T;T;T	0.08370	3.12;3.15;3.1	4.38	2.61	0.31194	.	.	.	.	.	T	0.09949	0.0244	N	0.08118	0	0.22601	N	0.998943	D	0.76494	0.999	D	0.66196	0.942	T	0.24119	-1.0169	9	0.62326	D	0.03	.	6.1954	0.20548	0.3019:0.0:0.6981:0.0	.	891	Q8NB50	ZFP62_HUMAN	M	858;831;891;489	ENSP00000426193:L858M;ENSP00000352053:L831M;ENSP00000423820:L891M	ENSP00000352053:L831M	L	-	1	2	ZFP62	180208430	0.000000	0.05858	0.725000	0.30721	0.526000	0.34562	0.058000	0.14301	0.791000	0.33826	0.563000	0.77884	CTG	-	NULL		0.453	ZFP62-002	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ZFP62	protein_coding	OTTHUMT00000368386.2	G	NM_152283	-		180275824	-1	no_errors	ENST00000512132	ensembl	human	known	74_37	missense	SNP	0.724	T
ZNF264	9422	genome.wustl.edu	37	19	57723678	57723678	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:57723678G>T	ENST00000263095.6	+	4	1627	c.1213G>T	c.(1213-1215)Ggg>Tgg	p.G405W	ZNF264_ENST00000536056.1_Missense_Mutation_p.G405W	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264	405					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		CCTCGAGTGTGGGAAGGCTTT	0.542																																																	0								ENSG00000083844						62.0	59.0	60.0					19																	57723678		2203	4300	6503	ZNF264	SO:0001583	missense	0			-	HGNC	AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.1213G>T	19.37:g.57723678G>T	ENSP00000263095:p.Gly405Trp	Somatic	0	44	0.00		0.6159915499159303	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A8K8Y9|Q9P1V0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G405W	ENST00000263095.6	37	c.1213	CCDS33127.1	19	.	.	.	.	.	.	.	.	.	.	G	16.30	3.084081	0.55861	.	.	ENSG00000083844	ENST00000263095;ENST00000536056	T;T	0.23754	1.89;1.89	1.98	0.906	0.19314	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.54208	0.1844	M	0.93106	3.38	0.35927	D	0.832231	D	0.89917	1.0	D	0.87578	0.998	T	0.63902	-0.6532	9	0.87932	D	0	.	7.8243	0.29305	0.1445:0.0:0.8555:0.0	.	405	O43296	ZN264_HUMAN	W	405	ENSP00000263095:G405W;ENSP00000440376:G405W	ENSP00000263095:G405W	G	+	1	0	ZNF264	62415490	1.000000	0.71417	0.985000	0.45067	0.991000	0.79684	6.849000	0.75414	0.396000	0.25283	0.491000	0.48974	GGG	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.542	ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF264	protein_coding	OTTHUMT00000465080.1	G		-		57723678	+1	no_errors	ENST00000263095	ensembl	human	known	74_37	missense	SNP	1.000	T
MET	4233	genome.wustl.edu	37	7	116340033	116340033	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:116340033A>T	ENST00000318493.6	+	2	1082	c.895A>T	c.(895-897)Att>Ttt	p.I299F	MET_ENST00000436117.2_Missense_Mutation_p.I299F|MET_ENST00000397752.3_Missense_Mutation_p.I299F			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TCTGGAGTGTATTCTCACAGA	0.423			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																															Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	0								ENSG00000105976						76.0	72.0	73.0					7																	116340033		1840	4092	5932	MET	SO:0001583	missense	0	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	-	HGNC	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.895A>T	7.37:g.116340033A>T	ENSP00000317272:p.Ile299Phe	Somatic	0	31	0.00		0.6159915499159303	100	21.26	27	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	47	12.96	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Semap_dom,pfscan_Prot_kinase_dom	p.I299F	ENST00000318493.6	37	c.895	CCDS47689.1	7	.	.	.	.	.	.	.	.	.	.	A	13.60	2.285649	0.40394	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	T;T;T	0.11063	2.81;2.81;2.81	6.17	6.17	0.99709	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.047093	0.85682	D	0.000000	T	0.39145	0.1067	M	0.85542	2.76	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.997;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.952;1.0;0.995;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;0.999;0.999	T	0.21449	-1.0245	10	0.48119	T	0.1	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	299;299;299;299;299;299;299;299;299;299;299;299;299	B5A929;E7EQ94;B5A930;B5A934;B5A936;B5A937;B5A939;B5A941;B5A940;P08581-2;B5A942;P08581;A1L467	.;.;.;.;.;.;.;.;.;.;.;MET_HUMAN;.	F	299	ENSP00000380860:I299F;ENSP00000317272:I299F;ENSP00000410980:I299F	ENSP00000317272:I299F	I	+	1	0	MET	116127269	1.000000	0.71417	0.998000	0.56505	0.009000	0.06853	6.976000	0.76135	2.371000	0.80710	0.533000	0.62120	ATT	-	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.423	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MET	protein_coding	OTTHUMT00000059620.3	A		-		116340033	+1	no_errors	ENST00000318493	ensembl	human	known	74_37	missense	SNP	1.000	T
CNTNAP5	129684	genome.wustl.edu	37	2	125175087	125175087	+	Missense_Mutation	SNP	G	G	T	rs547539440		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:125175087G>T	ENST00000431078.1	+	4	813	c.449G>T	c.(448-450)cGa>cTa	p.R150L		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	150	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.R150Q(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GTGAGAGCCCGATTTGTTCGC	0.507																																																	1	Substitution - Missense(1)	skin(1)						ENSG00000155052						97.0	100.0	99.0					2																	125175087		1994	4172	6166	CNTNAP5	SO:0001583	missense	0			-	HGNC	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.449G>T	2.37:g.125175087G>T	ENSP00000399013:p.Arg150Leu	Somatic	0	61	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.R150L	ENST00000431078.1	37	c.449	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	G	27.2	4.808980	0.90707	.	.	ENSG00000155052	ENST00000431078	D	0.99194	-5.54	6.17	5.3	0.74995	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.142474	0.31989	N	0.006746	D	0.99438	0.9801	M	0.93898	3.47	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.98427	1.0580	10	0.87932	D	0	.	14.0828	0.64937	0.0719:0.0:0.9281:0.0	.	150	Q8WYK1	CNTP5_HUMAN	L	150	ENSP00000399013:R150L	ENSP00000399013:R150L	R	+	2	0	CNTNAP5	124891557	1.000000	0.71417	0.449000	0.26957	0.811000	0.45836	7.444000	0.80532	1.630000	0.50440	0.655000	0.94253	CGA	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom		0.507	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	protein_coding	OTTHUMT00000330864.3	G		-		125175087	+1	no_errors	ENST00000431078	ensembl	human	known	74_37	missense	SNP	0.998	T
PEX19	5824	genome.wustl.edu	37	1	160251926	160251926	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:160251926T>C	ENST00000368072.5	-	5	518	c.497A>G	c.(496-498)gAt>gGt	p.D166G	PEX19_ENST00000440949.3_Missense_Mutation_p.D76G|PEX19_ENST00000532508.1_5'UTR|DCAF8_ENST00000608310.1_Missense_Mutation_p.D19G|DCAF8_ENST00000556710.1_Missense_Mutation_p.D19G	NM_001193644.1|NM_002857.3	NP_001180573.1|NP_002848.1	P40855	PEX19_HUMAN	peroxisomal biogenesis factor 19	166					chaperone-mediated protein folding (GO:0061077)|chaperone-mediated protein transport (GO:0072321)|establishment of protein localization to peroxisome (GO:0072663)|negative regulation of lipid binding (GO:1900131)|peroxisome fission (GO:0016559)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	ATPase binding (GO:0051117)|peroxisome membrane class-1 targeting sequence binding (GO:0036105)|protein N-terminus binding (GO:0047485)			cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(2)	11	all_cancers(52;1.27e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CCCTTCCCCATCCCCTTCGTC	0.502																																																	0								ENSG00000132716						143.0	116.0	125.0					1																	160251926		2203	4300	6503	DCAF8	SO:0001583	missense	0			-	HGNC	Y09048	CCDS1201.1	1q22	2008-07-18	2004-03-17	2004-03-19	ENSG00000162735	ENSG00000162735			9713	protein-coding gene	gene with protein product	"""housekeeping gene, 33kD"""	600279	"""peroxisomal farnesylated protein"""	PXF		9339377, 10051604	Standard	NM_002857		Approved	HK33, D1S2223E, PMP1, PMPI, PXMP1		P40855	OTTHUMG00000033112	ENST00000368072.5:c.497A>G	1.37:g.160251926T>C	ENSP00000357051:p.Asp166Gly	Somatic	0	41	0.00		0.6159915499159303	95	1.02	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	D3DVE7|Q5QNY4|Q8NI97	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pex19,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D19G	ENST00000368072.5	37	c.56	CCDS1201.1	1	.	.	.	.	.	.	.	.	.	.	T	16.73	3.203753	0.58234	.	.	ENSG00000132716;ENSG00000258465;ENSG00000258465;ENSG00000162735;ENSG00000162735;ENSG00000162735;ENSG00000162735	ENST00000555195;ENST00000556710;ENST00000485079;ENST00000368072;ENST00000429425;ENST00000440949;ENST00000392220	T;T	0.63744	-0.06;-0.06	5.38	4.25	0.50352	.	0.223546	0.47455	N	0.000227	T	0.16171	0.0389	N	0.03948	-0.315	0.53005	D	0.999964	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.001	T	0.11131	-1.0600	10	0.11794	T	0.64	-9.4486	10.5264	0.44952	0.0:0.0777:0.0:0.9223	.	19;166	G3V3G9;P40855	.;PEX19_HUMAN	G	19;19;36;166;146;76;146	ENSP00000451989:D19G;ENSP00000451235:D19G	ENSP00000357051:D166G	D	-	2	0	RP11-574F21.3;PEX19;DCAF8	158518550	0.995000	0.38212	0.997000	0.53966	0.985000	0.73830	3.301000	0.51842	0.874000	0.35823	0.460000	0.39030	GAT	-	pfam_Pex19		0.502	PEX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8	protein_coding	OTTHUMT00000080642.2	T	NM_002857	-		160251926	-1	no_errors	ENST00000608310	ensembl	human	known	74_37	missense	SNP	0.994	C
TBP	6908	genome.wustl.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000230354.6_Silent_p.Q60Q|TBP_ENST00000540980.1_Silent_p.Q40Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																																	0								ENSG00000112592						43.0	45.0	44.0					6																	170871004		2203	4300	6503	TBP	SO:0001819	synonymous_variant	0			-	HGNC	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	6.37:g.170871004G>A		Somatic	0	43	0.00		0.6159915499159303	56	3.45	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	43	20.37	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TBP,prints_TBP	p.Q60	ENST00000392092.2	37	c.180	CCDS5315.1	6																																																																																			-	NULL		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	protein_coding	OTTHUMT00000043271.2	G	NM_003194	-		170871004	+1	no_errors	ENST00000230354	ensembl	human	known	74_37	silent	SNP	0.991	A
MACF1	23499	genome.wustl.edu	37	1	39924730	39924730	+	Intron	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:39924730C>A	ENST00000372915.3	+	90	20980				MACF1_ENST00000545844.1_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000317713.7_Intron			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1						ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ACCAGCTGTTCTAATCTTGTG	0.373																																																	0								ENSG00000127603						64.0	67.0	66.0					1																	39924730		2203	4300	6503	MACF1	SO:0001627	intron_variant	0			-	HGNC	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.20894-28C>A	1.37:g.39924730C>A		Somatic	0	35	0.00		0.6159915499159303	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372915.3	37	NULL		1																																																																																			-	-		0.373	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	protein_coding	OTTHUMT00000392096.1	C	NM_033044	-		39924730	+1	no_errors	ENST00000497964	ensembl	human	known	74_37	rna	SNP	0.229	A
TIAF1	9220	genome.wustl.edu	37	17	27401040	27401040	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr17:27401040G>T	ENST00000359450.6	-	1	4835	c.178C>A	c.(178-180)Cca>Aca	p.P60T	MYO18A_ENST00000354329.4_3'UTR|MYO18A_ENST00000527372.1_3'UTR|MYO18A_ENST00000533112.1_3'UTR|MYO18A_ENST00000529578.1_5'UTR|MYO18A_ENST00000531253.1_3'UTR|TIAF1_ENST00000408971.2_Missense_Mutation_p.P60T	NM_004740.3	NP_004731.2	O95411	TIAF1_HUMAN	TGFB1-induced anti-apoptotic factor 1	60					apoptotic process (GO:0006915)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of apoptotic process (GO:0043066)	nucleus (GO:0005634)				kidney(1)|lung(1)|urinary_tract(1)	3	Lung NSC(42;0.015)		Epithelial(11;1.19e-05)|all cancers(11;6.57e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000153)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			GTGGGGGCTGGAGGTGCGGAT	0.557																																																	0								ENSG00000221995						94.0	78.0	84.0					17																	27401040		2203	4300	6503	TIAF1	SO:0001583	missense	0			-	HGNC	AF105277	CCDS32599.1	17q11.2	2006-08-07				ENSG00000221995			11803	protein-coding gene	gene with protein product		609517				9918798	Standard	NM_004740		Approved		uc002hdv.1	O95411		ENST00000359450.6:c.178C>A	17.37:g.27401040G>T	ENSP00000352424:p.Pro60Thr	Somatic	0	47	0.00		0.6159915499159303	83	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	A2RRE2|Q6PEG2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P60T	ENST00000359450.6	37	c.178	CCDS32599.1	17	.	.	.	.	.	.	.	.	.	.	G	0.780	-0.762789	0.02996	.	.	ENSG00000221995	ENST00000408971;ENST00000511177	.	.	.	4.83	-7.46	0.01369	.	.	.	.	.	T	0.13543	0.0328	N	0.08118	0	0.09310	N	1	B	0.32829	0.386	B	0.28011	0.085	T	0.30208	-0.9986	8	0.87932	D	0	.	5.2903	0.15723	0.5599:0.0:0.2133:0.2268	.	60	O95411	TIAF1_HUMAN	T	60	.	ENSP00000386130:P60T	P	-	1	0	TIAF1	24425166	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.017000	0.12590	-0.990000	0.03481	-0.982000	0.02568	CCA	-	NULL		0.557	TIAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAF1	protein_coding	OTTHUMT00000372394.2	G	NM_004740	-		27401040	-1	no_errors	ENST00000359450	ensembl	human	known	74_37	missense	SNP	0.000	T
CAMTA1	23261	genome.wustl.edu	37	1	7796530	7796530	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:7796530G>A	ENST00000303635.7	+	13	3400	c.3193G>A	c.(3193-3195)Gga>Aga	p.G1065R	CAMTA1_ENST00000439411.2_Missense_Mutation_p.G1065R	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	1065					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		GACTTTCCGCGGAATGACCCT	0.592			T	WWTR1	epitheliod hemangioendothelioma																																			Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	0								ENSG00000171735						132.0	120.0	124.0					1																	7796530		2203	4300	6503	CAMTA1	SO:0001583	missense	0			-	HGNC	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.3193G>A	1.37:g.7796530G>A	ENSP00000306522:p.Gly1065Arg	Somatic	0	43	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	37	13.64	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CG-1_dom,pfam_IPT,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.G1065R	ENST00000303635.7	37	c.3193	CCDS30576.1	1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474081	0.84640	.	.	ENSG00000171735	ENST00000303635;ENST00000439411;ENST00000414738;ENST00000303646	T;T	0.49720	0.77;0.77	5.58	5.58	0.84498	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.72566	0.3476	M	0.81497	2.545	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.999	T	0.75789	-0.3194	10	0.87932	D	0	-13.6807	19.5825	0.95473	0.0:0.0:1.0:0.0	.	1065;152;21;1065	Q9Y6Y1-2;B4DXR3;Q7Z7P1;Q9Y6Y1	.;.;.;CMTA1_HUMAN	R	1065;1065;152;21	ENSP00000306522:G1065R;ENSP00000402561:G1065R	ENSP00000306522:G1065R	G	+	1	0	CAMTA1	7719117	1.000000	0.71417	0.341000	0.25589	0.535000	0.34838	9.793000	0.99091	2.624000	0.88883	0.655000	0.94253	GGA	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.592	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA1	protein_coding	OTTHUMT00000003588.3	G	NM_015215	-		7796530	+1	no_errors	ENST00000303635	ensembl	human	known	74_37	missense	SNP	1.000	A
OBSL1	23363	genome.wustl.edu	37	2	220424007	220424007	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:220424007C>T	ENST00000404537.1	-	9	3222	c.3166G>A	c.(3166-3168)Ggg>Agg	p.G1056R	OBSL1_ENST00000373876.1_Missense_Mutation_p.G1056R|OBSL1_ENST00000265318.4_Missense_Mutation_p.G1056R|OBSL1_ENST00000603926.1_Missense_Mutation_p.G1056R|OBSL1_ENST00000265317.5_Missense_Mutation_p.G47R|RP11-256I23.2_ENST00000597192.1_RNA	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	1056	Ig-like 8.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		AACTCGCCCCCGTCCTCGGGC	0.612																																																	0								ENSG00000124006																																			OBSL1	SO:0001583	missense	0			-	HGNC	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.3166G>A	2.37:g.220424007C>T	ENSP00000385636:p.Gly1056Arg	Somatic	0	20	0.00		0.6159915499159303	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	4	50.00	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G1056R	ENST00000404537.1	37	c.3166	CCDS46520.1	2	.	.	.	.	.	.	.	.	.	.	C	11.47	1.649218	0.29336	.	.	ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000265317	T;T;T;T	0.41065	2.63;2.63;2.63;1.01	4.34	4.34	0.51931	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.55909	0.1950	M	0.68593	2.085	0.09310	N	1	P;D;D;D	0.89917	0.937;1.0;1.0;1.0	P;D;D;D	0.97110	0.603;1.0;1.0;0.997	T	0.49943	-0.8885	9	0.41790	T	0.15	.	3.8349	0.08889	0.2368:0.6191:0.0:0.1441	.	47;1057;1056;47	B7Z5P5;A4KVA4;O75147;E7ER99	.;.;OBSL1_HUMAN;.	R	1056;1056;1056;47	ENSP00000265318:G1056R;ENSP00000385636:G1056R;ENSP00000362983:G1056R;ENSP00000265317:G47R	ENSP00000265317:G47R	G	-	1	0	OBSL1	220132251	0.000000	0.05858	0.945000	0.38365	0.088000	0.18126	-0.115000	0.10741	2.256000	0.74724	0.491000	0.48974	GGG	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.612	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	OBSL1	protein_coding	OTTHUMT00000322012.1	C		-		220424007	-1	no_errors	ENST00000404537	ensembl	human	known	74_37	missense	SNP	0.044	T
MYO5B	4645	genome.wustl.edu	37	18	47363917	47363917	+	Missense_Mutation	SNP	A	A	G	rs138128932	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr18:47363917A>G	ENST00000285039.7	-	37	5407	c.5108T>C	c.(5107-5109)gTc>gCc	p.V1703A	SCARNA17_ENST00000589499.1_RNA|RP11-886H22.1_ENST00000590532.2_Missense_Mutation_p.V26A|MYO5B_ENST00000592688.1_Missense_Mutation_p.V273A|MYO5B_ENST00000324581.6_Missense_Mutation_p.V818A	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	1703	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)	p.V1703A(5)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		CCAAGAGCAGACGTCCTTCCG	0.527																																																	5	Substitution - Missense(5)	endometrium(2)|kidney(2)|lung(1)						ENSG00000167306						70.0	68.0	69.0					18																	47363917		2027	4186	6213	MYO5B	SO:0001583	missense	0			-	HGNC	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.5108T>C	18.37:g.47363917A>G	ENSP00000285039:p.Val1703Ala	Somatic	0	43	0.00		0.6159915499159303	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	43	15.69	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.V1703A	ENST00000285039.7	37	c.5108	CCDS42436.1	18	.	.	.	.	.	.	.	.	.	.	A	14.46	2.542024	0.45280	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	D;T	0.86432	-2.12;2.51	4.77	0.996	0.19844	Dilute (1);Dil domain (1);	0.146358	0.45126	N	0.000396	T	0.78534	0.4298	L	0.40543	1.245	0.36910	D	0.890859	B;B	0.13145	0.001;0.007	B;B	0.21708	0.012;0.036	T	0.66284	-0.5962	10	0.19147	T	0.46	.	8.6034	0.33758	0.7815:0.0:0.2185:0.0	.	1703;818	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	A	1703;818	ENSP00000285039:V1703A;ENSP00000315531:V818A	ENSP00000285039:V1703A	V	-	2	0	MYO5B	45617915	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	4.310000	0.59141	0.082000	0.17018	0.482000	0.46254	GTC	-	pfam_Dil_domain,pfscan_Dilute		0.527	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	protein_coding	OTTHUMT00000448515.2	A		rs138128932		47363917	-1	no_errors	ENST00000285039	ensembl	human	known	74_37	missense	SNP	1.000	G
LIX1L	128077	genome.wustl.edu	37	1	145497479	145497479	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:145497479G>T	ENST00000369308.3	+	4	758	c.684G>T	c.(682-684)ttG>ttT	p.L228F	RP11-315I20.1_ENST00000421764.1_RNA|RP11-315I20.1_ENST00000600340.1_RNA|RP11-315I20.1_ENST00000598103.1_RNA|RP11-315I20.1_ENST00000601726.1_RNA|RP11-315I20.1_ENST00000599626.1_RNA|RP11-315I20.1_ENST00000412239.1_RNA|RP11-315I20.1_ENST00000595518.1_RNA|RP11-315I20.1_ENST00000599469.1_RNA|RP11-315I20.1_ENST00000597144.1_RNA|RP11-315I20.1_ENST00000595494.1_RNA|RP11-315I20.1_ENST00000598354.1_RNA|RP11-315I20.1_ENST00000437797.1_RNA|RP11-315I20.1_ENST00000599147.1_RNA|RP11-315I20.1_ENST00000448561.1_RNA	NM_153713.1	NP_714924.1	Q8IVB5	LIX1L_HUMAN	Lix1 homolog (chicken) like	228										large_intestine(4)|lung(6)|ovary(2)|skin(1)	13	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AATCAATGTTGGAGTTCCAGG	0.453																																																	0								ENSG00000152022						81.0	66.0	71.0					1																	145497479		2203	4300	6503	LIX1L	SO:0001583	missense	0			-	HGNC	AK128733	CCDS72873.1	1q21.1	2014-07-15	2014-07-15		ENSG00000152022	ENSG00000271601			28715	protein-coding gene	gene with protein product			"""Lix1 homolog (mouse) like"", ""Lix1 homolog (chicken)-like"""			12477932	Standard	NM_153713		Approved	MGC46719	uc001enr.3	Q8IVB5	OTTHUMG00000013741	ENST00000369308.3:c.684G>T	1.37:g.145497479G>T	ENSP00000358314:p.Leu228Phe	Somatic	0	40	0.00		0.6159915499159303	65	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q6AI36	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L228F	ENST00000369308.3	37	c.684	CCDS915.1	1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.000016	0.74818	.	.	ENSG00000152022	ENST00000369308;ENST00000449167	.	.	.	5.1	4.15	0.48705	.	0.000000	0.64402	D	0.000001	T	0.70657	0.3249	M	0.78049	2.395	0.53688	D	0.999977	D	0.89917	1.0	D	0.91635	0.999	T	0.75470	-0.3306	9	0.87932	D	0	-19.2704	10.0195	0.42035	0.1054:0.0:0.8946:0.0	.	228	Q8IVB5	LIX1L_HUMAN	F	228;175	.	ENSP00000358314:L228F	L	+	3	2	LIX1L	144208836	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.212000	0.58514	1.285000	0.44548	0.563000	0.77884	TTG	-	NULL		0.453	LIX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIX1L	protein_coding	OTTHUMT00000038513.1	G	NM_153713	-		145497479	+1	no_errors	ENST00000369308	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC2A6	11182	genome.wustl.edu	37	9	136343454	136343454	+	Silent	SNP	T	T	C	rs199947289	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr9:136343454T>C	ENST00000371899.4	-	2	254	c.177A>G	c.(175-177)acA>acG	p.T59T	SLC2A6_ENST00000371897.4_Silent_p.T59T|SLC2A6_ENST00000485978.1_5'UTR	NM_017585.3	NP_060055.2	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 6	59					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		TGACAGGGGATGTGTAGACCA	0.587													T|||	2	0.000399361	0.0	0.0	5008	,	,		18451	0.002		0.0	False		,,,				2504	0.0																0								ENSG00000160326						165.0	159.0	161.0					9																	136343454		2203	4300	6503	SLC2A6	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	AJ011372	CCDS6975.1, CCDS48052.1	9q34	2013-05-22			ENSG00000160326	ENSG00000160326		"""Solute carriers"""	11011	protein-coding gene	gene with protein product		606813				10970791	Standard	NM_001145099		Approved	GLUT9, GLUT6, HSA011372	uc004cee.3	Q9UGQ3	OTTHUMG00000020874	ENST00000371899.4:c.177A>G	9.37:g.136343454T>C		Somatic	0	97	0.00		0.6159915499159303	6	45.45	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	50	29.58	A6NNU6|Q5SXD7|Q8NCC2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt,tigrfam_Sugar/inositol_transpt	p.T59	ENST00000371899.4	37	c.177	CCDS6975.1	9																																																																																			-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt		0.587	SLC2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A6	protein_coding	OTTHUMT00000054909.1	T	NM_017585	rs199947289		136343454	-1	no_errors	ENST00000371899	ensembl	human	known	74_37	silent	SNP	0.323	C
ADSL	158	genome.wustl.edu	37	22	40762509	40762509	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:40762509G>A	ENST00000216194.7	+	13	1494	c.1438G>A	c.(1438-1440)Gca>Aca	p.A480T	ADSL_ENST00000342312.6_Missense_Mutation_p.A421T|ADSL_ENST00000454266.2_Missense_Mutation_p.A494T	NM_000026.2	NP_000017.1	P30566	PUR8_HUMAN	adenylosuccinate lyase	480					'de novo' AMP biosynthetic process (GO:0044208)|'de novo' IMP biosynthetic process (GO:0006189)|aerobic respiration (GO:0009060)|AMP biosynthetic process (GO:0006167)|metabolic process (GO:0008152)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity (GO:0070626)|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity (GO:0004018)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(2)|ovary(1)|prostate(1)	19						GAAGGTGAAAGCAGAATTATG	0.373																																					Colon(4;65 130 1097 1516)												0								ENSG00000239900						124.0	119.0	120.0					22																	40762509		2203	4300	6503	ADSL	SO:0001583	missense	0			-	HGNC	X65867	CCDS14001.1, CCDS46714.1	22q13.1	2011-02-17			ENSG00000239900	ENSG00000239900	4.3.2.2		291	protein-coding gene	gene with protein product		608222				8404037	Standard	NM_000026		Approved		uc003ayp.4	P30566	OTTHUMG00000166425	ENST00000216194.7:c.1438G>A	22.37:g.40762509G>A	ENSP00000216194:p.Ala480Thr	Somatic	0	74	0.00		0.6159915499159303	81	43.84	64	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	54	43.16	B0QY76|O75495|Q5TI34	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fumarate_lyase_N,pfam_AdenyloSucc_lyase_C,superfamily_L-Aspartase-like,prints_Fumarate_lyase_fam,tigrfam_Pur_lyase	p.A494T	ENST00000216194.7	37	c.1480	CCDS14001.1	22	.	.	.	.	.	.	.	.	.	.	G	18.07	3.540772	0.65085	.	.	ENSG00000239900	ENST00000216194;ENST00000454266;ENST00000537028;ENST00000342312	D;D;D	0.96104	-3.91;-3.91;-3.65	5.47	5.47	0.80525	.	0.159160	0.56097	D	0.000040	D	0.93409	0.7898	M	0.70595	2.14	0.31195	N	0.700425	B;B;B;B	0.23540	0.087;0.02;0.046;0.046	B;B;B;B	0.26094	0.066;0.034;0.031;0.031	D	0.88752	0.3251	9	.	.	.	-10.9115	8.1622	0.31204	0.1601:0.0:0.8399:0.0	.	494;421;480;480	E7ERF4;P30566-2;Q71UA4;P30566	.;.;.;PUR8_HUMAN	T	480;494;300;421	ENSP00000216194:A480T;ENSP00000390107:A494T;ENSP00000341429:A421T	.	A	+	1	0	ADSL	39092455	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.930000	0.56522	2.853000	0.98044	0.655000	0.94253	GCA	-	NULL		0.373	ADSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADSL	protein_coding	OTTHUMT00000321386.1	G	NM_000026	-		40762509	+1	no_errors	ENST00000454266	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF174	7727	genome.wustl.edu	37	16	3458702	3458702	+	Missense_Mutation	SNP	C	C	A	rs533699877		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr16:3458702C>A	ENST00000268655.4	+	3	1592	c.1007C>A	c.(1006-1008)aCg>aAg	p.T336K	ZNF174_ENST00000571936.1_Missense_Mutation_p.T336K	NM_003450.2	NP_003441.1	Q15697	ZN174_HUMAN	zinc finger protein 174	336					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|urinary_tract(2)	12						AAAAGCTTCACGTGGAATTCA	0.527																																																	0								ENSG00000103343						61.0	63.0	62.0					16																	3458702		2197	4300	6497	ZNF174	SO:0001583	missense	0			-	HGNC	U31248	CCDS10504.1, CCDS32380.1	16p13	2013-01-09			ENSG00000103343	ENSG00000103343		"""-"", ""Zinc fingers, C2H2-type"""	12963	protein-coding gene	gene with protein product		603900					Standard	NM_003450		Approved	ZSCAN8	uc002cvc.3	Q15697	OTTHUMG00000129358	ENST00000268655.4:c.1007C>A	16.37:g.3458702C>A	ENSP00000268655:p.Thr336Lys	Somatic	0	39	0.00		0.6159915499159303	34	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	Q53Y68|Q9BQ34	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.T336K	ENST00000268655.4	37	c.1007	CCDS10504.1	16	.	.	.	.	.	.	.	.	.	.	C	10.90	1.481838	0.26598	.	.	ENSG00000103343	ENST00000268655	T	0.00976	5.48	5.26	3.16	0.36331	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.137517	0.33980	N	0.004370	T	0.00580	0.0019	N	0.11845	0.185	0.09310	N	0.999996	B	0.34241	0.444	B	0.32805	0.153	T	0.51474	-0.8701	10	0.24483	T	0.36	.	3.7943	0.08733	0.1715:0.576:0.1651:0.0873	.	336	Q15697	ZN174_HUMAN	K	336	ENSP00000268655:T336K	ENSP00000268655:T336K	T	+	2	0	ZNF174	3398703	0.000000	0.05858	0.910000	0.35882	0.011000	0.07611	-0.405000	0.07196	1.576000	0.49790	-0.182000	0.12963	ACG	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.527	ZNF174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF174	protein_coding	OTTHUMT00000251510.1	C	NM_003450	-		3458702	+1	no_errors	ENST00000268655	ensembl	human	known	74_37	missense	SNP	0.036	A
STARD8	9754	genome.wustl.edu	37	X	67939184	67939184	+	Silent	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:67939184G>A	ENST00000252336.6	+	6	1965	c.1593G>A	c.(1591-1593)ctG>ctA	p.L531L	STARD8_ENST00000374597.3_Silent_p.L531L|STARD8_ENST00000374599.3_Silent_p.L611L	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	531					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						GCTCACTGCTGCGGCTTACCG	0.602																																																	0								ENSG00000130052						81.0	50.0	60.0					X																	67939184		2203	4300	6503	STARD8	SO:0001819	synonymous_variant	0			-	HGNC	D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.1593G>A	X.37:g.67939184G>A		Somatic	0	90	0.00		0.6159915499159303	10	9.09	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	29	64.63	A8K6T2|D3DVT9|Q5JST0|Q68DG7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_START_lipid-bd_dom,pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom,pfscan_RhoGAP_dom	p.L611	ENST00000252336.6	37	c.1833	CCDS14390.1	X																																																																																			-	NULL		0.602	STARD8-201	KNOWN	basic|CCDS	protein_coding	STARD8	protein_coding	OTTHUMT00000057026.2	G	NM_014725	-		67939184	+1	no_errors	ENST00000374599	ensembl	human	known	74_37	silent	SNP	0.998	A
ZDHHC16	84287	genome.wustl.edu	37	10	99212667	99212667	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr10:99212667G>T	ENST00000370854.3	+	5	732	c.543G>T	c.(541-543)atG>atT	p.M181I	ZDHHC16_ENST00000393760.1_Missense_Mutation_p.M181I|ZDHHC16_ENST00000345745.5_Missense_Mutation_p.M116I|ZDHHC16_ENST00000370842.2_Missense_Mutation_p.M181I|ZDHHC16_ENST00000370846.4_Missense_Mutation_p.M181I|ZDHHC16_ENST00000352634.4_Missense_Mutation_p.M181I|ZDHHC16_ENST00000353979.3_Intron|ZDHHC16_ENST00000495735.1_3'UTR	NM_032327.2	NP_115703.2	Q969W1	ZDH16_HUMAN	zinc finger, DHHC-type containing 16	181					apoptotic process (GO:0006915)|protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			kidney(4)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	14		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)		TGCTGAAGATGGATCACCACT	0.512																																																	0								ENSG00000171307						430.0	283.0	333.0					10																	99212667		2203	4300	6503	ZDHHC16	SO:0001583	missense	0			-	HGNC	AF258563	CCDS7460.1, CCDS7461.1, CCDS7462.1, CCDS7463.1, CCDS73176.1	10q24.1	2008-05-02			ENSG00000171307	ENSG00000171307		"""Zinc fingers, DHHC-type"""	20714	protein-coding gene	gene with protein product						12021275	Standard	NM_198043		Approved	APH2	uc001knk.3	Q969W1	OTTHUMG00000018847	ENST00000370854.3:c.543G>T	10.37:g.99212667G>T	ENSP00000359891:p.Met181Ile	Somatic	0	39	0.00		0.6159915499159303	72	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	D3DR52|D3DR53|D3DR54|Q5JTG7|Q5JTH0|Q8N4Z6|Q8WY84|Q9BSV3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.M181I	ENST00000370854.3	37	c.543	CCDS7460.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.6|23.6	4.440794|4.440794	0.83993|0.83993	.|.	.|.	ENSG00000171307|ENSG00000171307	ENST00000370854;ENST00000393760;ENST00000414567;ENST00000370846;ENST00000352634;ENST00000370842;ENST00000345745;ENST00000433086|ENST00000420089;ENST00000417044	T;T;T;T;T;T;T;T|.	0.26810|.	1.71;1.71;1.71;1.71;1.71;1.71;1.71;1.71|.	5.42|5.42	5.42|5.42	0.78866|0.78866	Zinc finger, DHHC-type, palmitoyltransferase (2);|.	0.038966|.	0.85682|.	D|.	0.000000|.	D|D	0.91009|0.91009	0.7172|0.7172	H|H	0.98295|0.98295	4.195|4.195	0.80722|0.80722	D|D	1|1	D;D;D;P;D;D;D|.	0.89917|.	0.975;1.0;0.999;0.826;0.999;0.997;0.999|.	P;D;D;B;D;D;D|.	0.91635|.	0.875;0.992;0.999;0.446;0.979;0.967;0.986|.	D|D	0.93976|0.93976	0.7254|0.7254	10|5	0.87932|.	D|.	0|.	-3.1828|-3.1828	19.3993|19.3993	0.94621|0.94621	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	181;116;181;156;116;181;181|.	B4DNL2;E9PCL9;B1AMU0;B1AMU1;Q969W1-4;Q969W1-2;Q969W1|.	.;.;.;.;.;.;ZDH16_HUMAN|.	I|L	181;181;181;181;181;181;116;116|157;123	ENSP00000359891:M181I;ENSP00000377357:M181I;ENSP00000400719:M181I;ENSP00000359883:M181I;ENSP00000345383:M181I;ENSP00000359879:M181I;ENSP00000304487:M116I;ENSP00000398532:M116I|.	ENSP00000304487:M116I|.	M|W	+|+	3|2	0|0	ZDHHC16|ZDHHC16	99202657|99202657	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	9.365000|9.365000	0.97139|0.97139	2.821000|2.821000	0.97095|0.97095	0.561000|0.561000	0.74099|0.74099	ATG|TGG	-	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase		0.512	ZDHHC16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZDHHC16	protein_coding	OTTHUMT00000049658.2	G	NM_032327	-		99212667	+1	no_errors	ENST00000370854	ensembl	human	known	74_37	missense	SNP	1.000	T
GJD2	57369	genome.wustl.edu	37	15	35045464	35045464	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr15:35045464C>A	ENST00000290374.4	-	2	657	c.181G>T	c.(181-183)Ggc>Tgc	p.G61C	RP11-814P5.1_ENST00000558707.1_RNA|RP11-814P5.1_ENST00000503496.1_RNA	NM_020660.2	NP_065711.1	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	61					action potential (GO:0001508)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	19		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		TGGTTACAGCCGGGCTGCAGG	0.547																																																	0								ENSG00000159248						92.0	82.0	85.0					15																	35045464		2201	4298	6499	GJD2	SO:0001583	missense	0			-	HGNC	AB037509	CCDS10040.1	15q13.1	2008-02-04	2007-11-06	2007-11-06	ENSG00000159248	ENSG00000159248		"""Ion channels / Gap junction proteins (connexins)"""	19154	protein-coding gene	gene with protein product	"""connexin 36"""	607058	"""gap junction protein, alpha 9, 36kDa"""	GJA9		10462698	Standard	NM_020660		Approved	CX36	uc001zis.2	Q9UKL4	OTTHUMG00000129674	ENST00000290374.4:c.181G>T	15.37:g.35045464C>A	ENSP00000290374:p.Gly61Cys	Somatic	0	44	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	16	38.46	Q2M241|Q9P2R0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin36	p.G61C	ENST00000290374.4	37	c.181	CCDS10040.1	15	.	.	.	.	.	.	.	.	.	.	C	19.42	3.823427	0.71143	.	.	ENSG00000159248	ENST00000290374	D	0.99814	-6.89	5.09	5.09	0.68999	Connexin, conserved site (1);Connexin, N-terminal (2);	0.000000	0.64402	D	0.000015	D	0.99837	0.9926	M	0.92317	3.295	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96897	0.9657	10	0.87932	D	0	.	18.6722	0.91516	0.0:1.0:0.0:0.0	.	61	Q9UKL4	CXD2_HUMAN	C	61	ENSP00000290374:G61C	ENSP00000290374:G61C	G	-	1	0	GJD2	32832756	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.651000	0.83577	2.648000	0.89879	0.555000	0.69702	GGC	-	pfam_Connexin_N,smart_Connexin_N,prints_Connexin		0.547	GJD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJD2	protein_coding	OTTHUMT00000251875.2	C		-		35045464	-1	no_errors	ENST00000290374	ensembl	human	known	74_37	missense	SNP	1.000	A
JAKMIP3	282973	genome.wustl.edu	37	10	133976760	133976760	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr10:133976760G>T	ENST00000298622.4	+	19	2400	c.2262G>T	c.(2260-2262)gaG>gaT	p.E754D	JAKMIP3_ENST00000477275.1_3'UTR	NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	754						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TGCAGCAGGAGGCCGGGGCTA	0.627																																																	0								ENSG00000188385						49.0	39.0	42.0					10																	133976760		2194	4290	6484	JAKMIP3	SO:0001583	missense	0			-	HGNC	AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.2262G>T	10.37:g.133976760G>T	ENSP00000298622:p.Glu754Asp	Somatic	0	45	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	12	76.92	A6PW00|Q69YM6|Q6ZT29	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E754D	ENST00000298622.4	37	c.2262	CCDS44494.1	10	.	.	.	.	.	.	.	.	.	.	G	12.24	1.878711	0.33162	.	.	ENSG00000188385	ENST00000298622	T	0.26957	1.7	3.97	-1.33	0.09172	.	.	.	.	.	T	0.15825	0.0381	L	0.31664	0.95	0.30296	N	0.789881	P;B	0.35507	0.506;0.02	B;B	0.36134	0.218;0.019	T	0.33650	-0.9860	9	0.17369	T	0.5	.	9.1058	0.36696	0.5803:0.0:0.4197:0.0	.	191;754	Q5VZ66-2;Q5VZ66	.;JKIP3_HUMAN	D	754	ENSP00000298622:E754D	ENSP00000298622:E754D	E	+	3	2	JAKMIP3	133826750	0.972000	0.33761	0.733000	0.30861	0.823000	0.46562	0.034000	0.13776	-0.124000	0.11724	-0.384000	0.06662	GAG	-	NULL		0.627	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	JAKMIP3	protein_coding	OTTHUMT00000051049.3	G	NM_194303	-		133976760	+1	no_errors	ENST00000298622	ensembl	human	known	74_37	missense	SNP	0.686	T
SUPT6H	6830	genome.wustl.edu	37	17	27002030	27002030	+	Missense_Mutation	SNP	G	G	T	rs376272646		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr17:27002030G>T	ENST00000314616.6	+	5	671	c.388G>T	c.(388-390)Gat>Tat	p.D130Y	SUPT6H_ENST00000347486.4_Missense_Mutation_p.D130Y|AC010761.13_ENST00000578819.1_RNA	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	130	Asp/Glu-rich.|Interaction with IWS1. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D130Y(1)		NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					TGACGAGGACGATGACGAGGA	0.498																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000109111						92.0	84.0	87.0					17																	27002030		2203	4300	6503	SUPT6H	SO:0001583	missense	0			-	HGNC	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.388G>T	17.37:g.27002030G>T	ENSP00000319104:p.Asp130Tyr	Somatic	0	68	0.00		0.6159915499159303	131	0.75	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_SH2,superfamily_NA-bd_OB-fold,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,smart_SH2,pirsf_TF_Spt6,pfscan_SH2,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.D130Y	ENST00000314616.6	37	c.388	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	G	16.57	3.161209	0.57368	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	.	.	.	5.41	5.41	0.78517	.	0.046129	0.85682	D	0.000000	T	0.74809	0.3765	M	0.65975	2.015	0.80722	D	1	D	0.60575	0.988	P	0.56088	0.791	T	0.77446	-0.2585	9	0.87932	D	0	-24.5167	19.558	0.95361	0.0:0.0:1.0:0.0	.	130	Q7KZ85	SPT6H_HUMAN	Y	130	.	ENSP00000319104:D130Y	D	+	1	0	SUPT6H	24026157	1.000000	0.71417	0.961000	0.40146	0.628000	0.37860	7.049000	0.76613	2.697000	0.92050	0.655000	0.94253	GAT	-	pirsf_TF_Spt6		0.498	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SUPT6H	protein_coding	OTTHUMT00000446422.2	G	NM_003170	-		27002030	+1	no_errors	ENST00000314616	ensembl	human	known	74_37	missense	SNP	1.000	T
MAP3K12	7786	genome.wustl.edu	37	12	53876539	53876539	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr12:53876539delG	ENST00000267079.2	-	12	2174	c.1949delC	c.(1948-1950)cctfs	p.P650fs	MAP3K12_ENST00000547488.1_Frame_Shift_Del_p.P683fs|MAP3K12_ENST00000547035.1_Frame_Shift_Del_p.P683fs	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	650					histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						GGTGGAGCCAGGGGCTGAGCC	0.687																																																	0								ENSG00000139625						37.0	44.0	42.0					12																	53876539		2201	4299	6500	MAP3K12	SO:0001589	frameshift_variant	0				HGNC	U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.1949delC	12.37:g.53876539delG	ENSP00000267079:p.Pro650fs	Somatic	0	30	0.00		0.6159915499159303	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	15	11.76	B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pirsf_MAP3K12_MAP3K13,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P650fs	ENST00000267079.2	37	c.1949	CCDS8860.1	12																																																																																			-	pirsf_MAP3K12_MAP3K13		0.687	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP3K12	protein_coding	OTTHUMT00000406267.1	G	NM_006301			53876539	-1	no_errors	ENST00000267079	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
ANKZF1	55139	genome.wustl.edu	37	2	220099841	220099841	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:220099841G>T	ENST00000323348.5	+	10	1672	c.1498G>T	c.(1498-1500)Gct>Tct	p.A500S	ANKZF1_ENST00000409849.1_Missense_Mutation_p.A290S|ANKZF1_ENST00000410034.3_Missense_Mutation_p.A500S|GLB1L_ENST00000497855.1_5'Flank	NM_018089.2	NP_060559.2	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing 1	500						membrane (GO:0016020)	metal ion binding (GO:0046872)	p.A500P(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	23		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGCACTGCTTGCTGCTTGCCG	0.607																																																	1	Substitution - Missense(1)	ovary(1)						ENSG00000163516						52.0	56.0	55.0					2																	220099841		2020	4180	6200	ANKZF1	SO:0001583	missense	0			-	HGNC	AF364318	CCDS42821.1, CCDS63129.1	2q35	2013-01-10			ENSG00000163516	ENSG00000163516		"""Zinc fingers, C2H2-type"", ""Ankyrin repeat domain containing"""	25527	protein-coding gene	gene with protein product						12477932	Standard	NM_018089		Approved	FLJ10415, ZNF744	uc002vkg.3	Q9H8Y5	OTTHUMG00000154533	ENST00000323348.5:c.1498G>T	2.37:g.220099841G>T	ENSP00000321617:p.Ala500Ser	Somatic	0	20	0.00		0.6159915499159303	39	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27	Q9NVZ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A500S	ENST00000323348.5	37	c.1498	CCDS42821.1	2	.	.	.	.	.	.	.	.	.	.	G	11.63	1.694669	0.30052	.	.	ENSG00000163516	ENST00000323348;ENST00000409849;ENST00000410034	T;T;T	0.53857	0.6;0.6;0.6	5.41	4.51	0.55191	Ankyrin repeat-containing domain (2);	0.050173	0.85682	D	0.000000	T	0.47229	0.1434	M	0.63428	1.95	0.32603	N	0.525645	P	0.48407	0.91	B	0.42462	0.388	T	0.58730	-0.7585	10	0.33141	T	0.24	-6.021	8.2297	0.31590	0.1588:0.0:0.8412:0.0	.	500	Q9H8Y5	ANKZ1_HUMAN	S	500;290;500	ENSP00000321617:A500S;ENSP00000386815:A290S;ENSP00000386337:A500S	ENSP00000321617:A500S	A	+	1	0	ANKZF1	219808085	0.278000	0.24230	0.957000	0.39632	0.623000	0.37688	1.952000	0.40343	2.814000	0.96858	0.591000	0.81541	GCT	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt		0.607	ANKZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKZF1	protein_coding	OTTHUMT00000335790.1	G	NM_018089	-		220099841	+1	no_errors	ENST00000323348	ensembl	human	known	74_37	missense	SNP	0.930	T
FGD3	89846	genome.wustl.edu	37	9	95796885	95796885	+	Silent	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr9:95796885C>T	ENST00000375482.3	+	17	2344	c.1848C>T	c.(1846-1848)agC>agT	p.S616S	FGD3_ENST00000538555.1_Silent_p.S219S|FGD3_ENST00000337352.6_Silent_p.S616S|FGD3_ENST00000416701.2_Silent_p.S615S	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	616	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						TGTCAGAGAGCGGTGAGACCT	0.672																																																	0								ENSG00000127084						40.0	48.0	45.0					9																	95796885		2013	4173	6186	FGD3	SO:0001819	synonymous_variant	0			-	HGNC	AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.1848C>T	9.37:g.95796885C>T		Somatic	0	40	0.00		0.6159915499159303	17	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	44	38.03	F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.S616	ENST00000375482.3	37	c.1848	CCDS43849.1	9																																																																																			-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.672	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FGD3	protein_coding	OTTHUMT00000055493.1	C	NM_033086	-		95796885	+1	no_errors	ENST00000337352	ensembl	human	known	74_37	silent	SNP	0.000	T
SGK223	157285	genome.wustl.edu	37	8	8234395	8234395	+	Silent	SNP	G	G	A	rs200101338		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:8234395G>A	ENST00000520004.1	-	3	1788	c.1524C>T	c.(1522-1524)tcC>tcT	p.S508S	SGK223_ENST00000330777.4_Silent_p.S508S			Q86YV5	SG223_HUMAN		510							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										CACCTACCTCGGAGTTCTGGC	0.652																																					GBM(34;731 755 10259 33573 33867)												0								ENSG00000182319	G		2,4184		0,2,2091	21.0	24.0	23.0		1524	-7.4	0.0	8		23	4,8426		0,4,4211	no	coding-synonymous	SGK223	NM_001080826.1		0,6,6302	AA,AG,GG		0.0474,0.0478,0.0476		508/1403	8234395	6,12610	2093	4215	6308	SGK223	SO:0001819	synonymous_variant	0			-	Uniprot_gn																												ENST00000520004.1:c.1524C>T	8.37:g.8234395G>A		Somatic	0	55	0.00		0.6159915499159303	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	57	18.57	Q8N3N5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.S508	ENST00000520004.1	37	c.1524	CCDS43706.1	8																																																																																			-	NULL		0.652	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK223	protein_coding	OTTHUMT00000374864.1	G		rs200101338		8234395	-1	no_errors	ENST00000330777	ensembl	human	known	74_37	silent	SNP	0.001	A
OR51E1	143503	genome.wustl.edu	37	11	4673847	4673847	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr11:4673847G>T	ENST00000530215.1	+	1	132	c.91G>T	c.(91-93)Gcc>Tcc	p.A31S	OR51E1_ENST00000396952.5_Missense_Mutation_p.A31S			Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E, member 1	30						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|skin(1)|stomach(2)	30		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTTCTGGTTGGCCTTCCCATT	0.478																																																	0								ENSG00000180785						281.0	205.0	231.0					11																	4673847		2201	4298	6499	OR51E1	SO:0001583	missense	0			-	HGNC	AY775731	CCDS31358.2	11p15.4	2012-08-22	2004-11-03	2004-11-06	ENSG00000180785	ENSG00000180785		"""GPCR / Class A : Olfactory receptors"""	15194	protein-coding gene	gene with protein product		611267	"""olfactory receptor, family 51, subfamily E, member 1 pseudogene"""	OR51E1P, OR52A3P, GPR164			Standard	NM_152430		Approved	GPR136	uc001lzi.4	Q8TCB6	OTTHUMG00000157024	ENST00000530215.1:c.91G>T	11.37:g.4673847G>T	ENSP00000431593:p.Ala31Ser	Somatic	0	55	0.00		0.6159915499159303	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	43	10.42	A8KAM6|Q5S4P5|Q66X57|Q6IF93	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A31S	ENST00000530215.1	37	c.91		11	.	.	.	.	.	.	.	.	.	.	G	19.66	3.868468	0.72065	.	.	ENSG00000180785	ENST00000396952;ENST00000530215	T;T	0.02974	4.09;8.08	4.87	4.87	0.63330	.	0.236139	0.29791	N	0.011187	T	0.02047	0.0064	N	0.12853	0.265	0.38311	D	0.943265	B	0.23490	0.086	B	0.24269	0.052	T	0.35773	-0.9775	10	0.02654	T	1	.	16.7377	0.85451	0.0:0.0:1.0:0.0	.	30	Q8TCB6	O51E1_HUMAN	S	31	ENSP00000380155:A31S;ENSP00000431593:A31S	ENSP00000380155:A31S	A	+	1	0	OR51E1	4630423	0.365000	0.25006	1.000000	0.80357	0.992000	0.81027	0.629000	0.24538	2.530000	0.85305	0.655000	0.94253	GCC	-	prints_GPCR_Rhodpsn		0.478	OR51E1-002	PUTATIVE	basic|exp_conf	protein_coding	OR51E1	protein_coding	OTTHUMT00000385957.1	G	NM_152430	-		4673847	+1	no_errors	ENST00000396952	ensembl	human	known	74_37	missense	SNP	1.000	T
FRMD1	79981	genome.wustl.edu	37	6	168465633	168465633	+	Missense_Mutation	SNP	G	G	T	rs568201228	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr6:168465633G>T	ENST00000283309.6	-	5	630	c.566C>A	c.(565-567)gCg>gAg	p.A189E	FRMD1_ENST00000432403.1_5'UTR|FRMD1_ENST00000440994.2_Missense_Mutation_p.A121E|FRMD1_ENST00000537786.1_5'UTR	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	189	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		AGCCTGCAGCGCGCAGGCAGC	0.657																																					GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)												0								ENSG00000153303						55.0	47.0	50.0					6																	168465633		2203	4300	6503	FRMD1	SO:0001583	missense	0			-	HGNC		CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.566C>A	6.37:g.168465633G>T	ENSP00000283309:p.Ala189Glu	Somatic	0	24	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.A189E	ENST00000283309.6	37	c.566	CCDS5306.1	6	.	.	.	.	.	.	.	.	.	.	G	12.71	2.019447	0.35606	.	.	ENSG00000153303	ENST00000283309;ENST00000440994	T;T	0.79141	-1.24;-1.24	2.75	1.85	0.25348	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.501681	0.17573	U	0.169414	T	0.82107	0.4965	M	0.77406	2.37	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.80764	0.993;0.994;0.981	T	0.82546	-0.0403	10	0.87932	D	0	.	10.465	0.44602	0.0:0.5921:0.4079:0.0	.	101;189;121	B7Z8G9;Q8N878;Q8N878-2	.;FRMD1_HUMAN;.	E	189;121	ENSP00000283309:A189E;ENSP00000414115:A121E	ENSP00000283309:A189E	A	-	2	0	FRMD1	168208482	0.632000	0.27172	0.194000	0.23346	0.015000	0.08874	1.398000	0.34554	0.333000	0.23563	0.313000	0.20887	GCG	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain		0.657	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD1	protein_coding	OTTHUMT00000362513.2	G	NM_024919	-		168465633	-1	no_errors	ENST00000283309	ensembl	human	known	74_37	missense	SNP	0.996	T
CPAMD8	27151	genome.wustl.edu	37	19	17040028	17040028	+	Silent	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:17040028G>A	ENST00000443236.1	-	24	3040	c.3009C>T	c.(3007-3009)ccC>ccT	p.P1003P		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	956						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CATACTTGTTGGGGGTGGAGA	0.572																																																	0								ENSG00000160111						51.0	57.0	55.0					19																	17040028		2072	4216	6288	CPAMD8	SO:0001819	synonymous_variant	0			-	HGNC	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3009C>T	19.37:g.17040028G>A		Somatic	0	63	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	47	22.95	Q8NC09|Q9ULD7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal_dom,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Kazal_dom	p.P1003	ENST00000443236.1	37	c.3009	CCDS42519.1	19	.	.	.	.	.	.	.	.	.	.	G	9.355	1.066460	0.20067	.	.	ENSG00000160111	ENST00000443236	T	0.35236	1.32	3.39	-1.86	0.07760	.	0.000000	0.64402	U	0.000011	T	0.34600	0.0903	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29671	-1.0004	7	0.87932	D	0	.	1.5758	0.02624	0.1761:0.334:0.3229:0.167	.	.	.	.	L	1014	ENSP00000402505:P1014L	ENSP00000402505:P1014L	P	-	2	0	CPAMD8	16901028	1.000000	0.71417	0.973000	0.42090	0.973000	0.67179	0.868000	0.27982	0.405000	0.25532	-0.182000	0.12963	CCA	-	NULL		0.572	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	protein_coding	OTTHUMT00000257531.2	G	NM_015692	-		17040028	-1	no_errors	ENST00000443236	ensembl	human	known	74_37	silent	SNP	0.999	A
TFPT	29844	genome.wustl.edu	37	19	54617940	54617940	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:54617940G>T	ENST00000391759.1	-	2	569	c.164C>A	c.(163-165)tCa>tAa	p.S55*	PRPF31_ENST00000321030.4_5'Flank|TFPT_ENST00000391758.1_Nonsense_Mutation_p.S46*|TFPT_ENST00000391757.1_Nonsense_Mutation_p.S55*|PRPF31_ENST00000419967.1_5'Flank	NM_013342.3	NP_037474.1	P0C1Z6	TFPT_HUMAN	TCF3 (E2A) fusion partner (in childhood Leukemia)	55					apoptotic signaling pathway (GO:0097190)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(2)|lung(2)	4	all_cancers(19;0.004)|all_epithelial(19;0.00195)|all_lung(19;0.0193)|Lung NSC(19;0.0358)|Breast(117;0.137)|Ovarian(34;0.19)					CCGGAGCCCTGAGCCGCCCAG	0.637			T	TCF3	pre-B ALL																																			Dom	yes		19	19q13	29844	TCF3 (E2A) fusion partner (in childhood Leukemia)		L	0								ENSG00000105619						99.0	110.0	107.0					19																	54617940		2203	4300	6503	TFPT	SO:0001587	stop_gained	0			-	HGNC	AF052052	CCDS12878.1	19q13	2011-07-06			ENSG00000105619	ENSG00000105619		"""INO80 complex subunits"""	13630	protein-coding gene	gene with protein product	"""amida, partner of the E2A"", ""INO80 complex subunit F"""	609519				10644725, 16230350	Standard	NM_013342		Approved	FB1, amida, INO80F	uc010yej.1	P0C1Z6	OTTHUMG00000065906	ENST00000391759.1:c.164C>A	19.37:g.54617940G>T	ENSP00000375639:p.Ser55*	Somatic	0	44	0.00		0.6159915499159303	137	0.71	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S55*	ENST00000391759.1	37	c.164	CCDS12878.1	19	.	.	.	.	.	.	.	.	.	.	G	39	7.582535	0.98371	.	.	ENSG00000105619	ENST00000391759;ENST00000391758;ENST00000391757	.	.	.	5.06	5.06	0.68205	.	0.702903	0.13090	N	0.414620	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.4201	14.3073	0.66393	0.0:0.0:1.0:0.0	.	.	.	.	X	55;46;55	.	ENSP00000375637:S55X	S	-	2	0	TFPT	59309752	0.978000	0.34361	0.523000	0.27875	0.663000	0.39108	5.464000	0.66719	2.516000	0.84829	0.563000	0.77884	TCA	-	NULL		0.637	TFPT-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TFPT	protein_coding	OTTHUMT00000141215.4	G	NM_013342	-		54617940	-1	no_errors	ENST00000391759	ensembl	human	known	74_37	nonsense	SNP	0.470	T
PCDHA4	56144	genome.wustl.edu	37	5	140187880	140187880	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr5:140187880G>A	ENST00000530339.1	+	1	1108	c.1108G>A	c.(1108-1110)Gcc>Acc	p.A370T	PCDHA4_ENST00000356878.4_Missense_Mutation_p.A370T|PCDHA4_ENST00000512229.2_Missense_Mutation_p.A370T|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	370	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A370S(2)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACAGTCATCGCCCTGATCAG	0.493																																																	2	Substitution - Missense(2)	lung(2)						ENSG00000204967						97.0	94.0	95.0					5																	140187880		2203	4300	6503	PCDHA4	SO:0001583	missense	0			-	HGNC	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1108G>A	5.37:g.140187880G>A	ENSP00000435300:p.Ala370Thr	Somatic	0	55	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	69	8.00	O75285|Q2M253	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A370T	ENST00000530339.1	37	c.1108	CCDS54916.1	5	.	.	.	.	.	.	.	.	.	.	g	14.66	2.600395	0.46423	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.52754	0.65;0.65;0.65	4.72	4.72	0.59763	Cadherin (3);Cadherin-like (1);	0.000000	0.40302	U	0.001121	T	0.59810	0.2221	M	0.64567	1.98	0.29498	N	0.855113	P;D;D	0.57257	0.853;0.963;0.979	B;P;P	0.53518	0.322;0.728;0.728	T	0.61787	-0.6991	10	0.59425	D	0.04	.	18.0295	0.89278	0.0:0.0:1.0:0.0	.	370;370;370	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	T	370	ENSP00000423470:A370T;ENSP00000349344:A370T;ENSP00000435300:A370T	ENSP00000349344:A370T	A	+	1	0	PCDHA4	140168064	1.000000	0.71417	0.553000	0.28255	0.264000	0.26372	4.379000	0.59575	2.341000	0.79615	0.591000	0.81541	GCC	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.493	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	protein_coding	OTTHUMT00000372864.2	G	NM_018907	-		140187880	+1	no_errors	ENST00000530339	ensembl	human	known	74_37	missense	SNP	0.882	A
SEC14L6	730005	genome.wustl.edu	37	22	30925097	30925097	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:30925097C>T	ENST00000402034.2	-	8	640	c.641G>A	c.(640-642)cGc>cAc	p.R214H		NM_001193336.2	NP_001180265.2	B5MCN3	S14L6_HUMAN	SEC14-like 6 (S. cerevisiae)	214	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			lung(3)	3						CACCTTCCTGCGTGTCTCTTC	0.567																																																	0								ENSG00000214491																																			SEC14L6	SO:0001583	missense	0			-	HGNC		CCDS54518.1	22q12.2	2011-05-06			ENSG00000214491	ENSG00000214491			40047	protein-coding gene	gene with protein product							Standard	NM_001193336		Approved		uc021wnu.1	B5MCN3	OTTHUMG00000151267	ENST00000402034.2:c.641G>A	22.37:g.30925097C>T	ENSP00000385695:p.Arg214His	Somatic	0	31	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	3	70.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_GOLD,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,prints_CRAL-bd_toc_tran	p.R214H	ENST00000402034.2	37	c.641	CCDS54518.1	22	.	.	.	.	.	.	.	.	.	.	.	19.72	3.879558	0.72294	.	.	ENSG00000214491	ENST00000402034	T	0.79352	-1.26	3.96	1.76	0.24704	.	.	.	.	.	D	0.83599	0.5289	M	0.85777	2.775	0.58432	D	0.999993	.	.	.	.	.	.	T	0.81391	-0.0954	7	0.66056	D	0.02	-7.7704	7.0451	0.25040	0.0:0.7284:0.1742:0.0974	.	.	.	.	H	214	ENSP00000385695:R214H	ENSP00000385695:R214H	R	-	2	0	SEC14L6	29255097	0.003000	0.15002	0.002000	0.10522	0.341000	0.28922	1.472000	0.35376	0.246000	0.21394	0.430000	0.28490	CGC	-	pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,prints_CRAL-bd_toc_tran		0.567	SEC14L6-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf|CCDS	protein_coding	SEC14L6	protein_coding	OTTHUMT00000322022.2	C		-		30925097	-1	no_errors	ENST00000402034	ensembl	human	novel	74_37	missense	SNP	0.571	T
MTMR11	10903	genome.wustl.edu	37	1	149908644	149908644	+	5'UTR	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:149908644G>T	ENST00000439741.2	-	0	147				MTMR11_ENST00000369140.3_5'Flank|MTMR11_ENST00000361405.6_5'UTR|MTMR11_ENST00000492824.1_5'UTR|MTMR11_ENST00000406732.3_5'UTR	NM_001145862.1	NP_001139334.1	A4FU01	MTMRB_HUMAN	myotubularin related protein 11								phosphatase activity (GO:0016791)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(13)|prostate(2)|stomach(1)|urinary_tract(4)	34	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			AGGGGTGTTAGGGAGAGGGGT	0.582																																																	0								ENSG00000014914																																			MTMR11	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AK097000	CCDS72901.1, CCDS72902.1	1q12-q21	2011-06-09			ENSG00000014914	ENSG00000014914		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	24307	protein-coding gene	gene with protein product	"""cisplatin resistance associated"""					12495846	Standard	NM_181873		Approved	CRA	uc001etl.4	A4FU01	OTTHUMG00000012207	ENST00000439741.2:c.-104C>A	1.37:g.149908644G>T		Somatic	0	31	0.00		0.6159915499159303	24	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	B3KUE4|B4DJI6|B4DQF5|B4E3Q6|Q3ZCP7|Q5SZ62|Q6P2Q8|Q99752|Q99753	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000439741.2	37	NULL	CCDS53360.1	1																																																																																			-	-		0.582	MTMR11-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTMR11	protein_coding		G	NM_181873	-		149908644	-1	no_errors	ENST00000466496	ensembl	human	known	74_37	rna	SNP	0.001	T
TGS1	96764	genome.wustl.edu	37	8	56698829	56698829	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:56698829A>G	ENST00000260129.5	+	4	849	c.372A>G	c.(370-372)atA>atG	p.I124M		NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	124					7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			AAGTTAAAATAAAAAAGAAAA	0.259																																					Esophageal Squamous(34;275 823 4842 34837 48447)												0								ENSG00000137574						14.0	14.0	14.0					8																	56698829		2141	4265	6406	TGS1	SO:0001583	missense	0			-	HGNC	AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.372A>G	8.37:g.56698829A>G	ENSP00000260129:p.Ile124Met	Somatic	0	36	0.00		0.6159915499159303	4	20.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	21	38.24	A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNA_cap_Gua-N2-MeTrfase,pfam_RNA_methylase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	p.I124M	ENST00000260129.5	37	c.372	CCDS34894.1	8	.	.	.	.	.	.	.	.	.	.	A	9.682	1.149508	0.21288	.	.	ENSG00000137574	ENST00000260129	T	0.17370	2.28	5.36	-6.02	0.02192	.	1.088660	0.07112	N	0.842302	T	0.09024	0.0223	L	0.35723	1.085	0.09310	N	1	B;P	0.45283	0.07;0.855	B;B	0.39027	0.01;0.288	T	0.22417	-1.0217	10	0.46703	T	0.11	0.0087	0.0728	0.00024	0.2689:0.1931:0.2305:0.3075	.	124;124	B2RBJ7;Q96RS0	.;TGS1_HUMAN	M	124	ENSP00000260129:I124M	ENSP00000260129:I124M	I	+	3	3	TGS1	56861383	0.000000	0.05858	0.052000	0.19188	0.532000	0.34746	-1.654000	0.01984	-0.598000	0.05806	-0.258000	0.10820	ATA	-	NULL		0.259	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGS1	protein_coding	OTTHUMT00000378152.1	A	NM_024831	-		56698829	+1	no_errors	ENST00000260129	ensembl	human	known	74_37	missense	SNP	0.006	G
HSF1	3297	genome.wustl.edu	37	8	145533178	145533178	+	Silent	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:145533178C>T	ENST00000528838.1	+	3	424	c.264C>T	c.(262-264)ggC>ggT	p.G88G	HSF1_ENST00000400780.4_Silent_p.G23G	NM_005526.2	NP_005517.1	Q00613	HSF1_HUMAN	heat shock transcription factor 1	88					cellular response to heat (GO:0034605)|defense response (GO:0006952)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|female meiotic division (GO:0007143)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)|response to lipopolysaccharide (GO:0032496)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pronucleus (GO:0045120)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)|urinary_tract(2)	11	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.12e-39)|all cancers(56;9.11e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0547)|Colorectal(110;0.055)			AGCAGGGCGGCCTGGTCAAGC	0.607																																																	0								ENSG00000185122						118.0	118.0	118.0					8																	145533178		2203	4296	6499	HSF1	SO:0001819	synonymous_variant	0			-	HGNC	M64673	CCDS6419.1	8q24.3	2014-04-10			ENSG00000185122	ENSG00000185122			5224	protein-coding gene	gene with protein product		140580				1871105	Standard	NM_005526		Approved	HSTF1	uc003zbt.4	Q00613	OTTHUMG00000174604	ENST00000528838.1:c.264C>T	8.37:g.145533178C>T		Somatic	0	67	0.00		0.6159915499159303	258	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A8K4L0|A8MW26|Q53XT4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Vert_HSTF_C,pfam_HSF_DNA-bd,smart_HSF_DNA-bd,prints_HSF_DNA-bd	p.G88	ENST00000528838.1	37	c.264	CCDS6419.1	8																																																																																			-	pfam_HSF_DNA-bd,smart_HSF_DNA-bd		0.607	HSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF1	protein_coding	OTTHUMT00000382053.1	C	NM_005526	-		145533178	+1	no_errors	ENST00000528838	ensembl	human	known	74_37	silent	SNP	1.000	T
KIAA1211	57482	genome.wustl.edu	37	4	57138564	57138564	+	5'UTR	SNP	C	C	A	rs368222551		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr4:57138564C>A	ENST00000264229.6	+	0	281				KIAA1211_ENST00000541073.1_5'Flank|KIAA1211_ENST00000504228.1_5'Flank	NM_020722.1	NP_065773.1	Q6ZU35	K1211_HUMAN	KIAA1211											endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					TTCGTTGTTCCGGGTGCCGTC	0.448																																																	0								ENSG00000109265																																			KIAA1211	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000264229.6:c.-111C>A	4.37:g.57138564C>A		Somatic	0	71	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q9NTE2|Q9NTP8|Q9ULK9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000264229.6	37	NULL	CCDS43230.1	4																																																																																			-	-		0.448	KIAA1211-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KIAA1211	protein_coding	OTTHUMT00000362142.1	C	NM_020722	-		57138564	+1	no_errors	ENST00000503618	ensembl	human	known	74_37	rna	SNP	0.043	A
HMCN1	83872	genome.wustl.edu	37	1	186151337	186151337	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:186151337T>G	ENST00000271588.4	+	105	16561	c.16332T>G	c.(16330-16332)caT>caG	p.H5444Q	HMCN1_ENST00000367492.2_Missense_Mutation_p.H5327Q	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5444	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CCTGCCAGCATGAGTGTAAGA	0.423																																																	0								ENSG00000143341						148.0	142.0	144.0					1																	186151337		2203	4300	6503	HMCN1	SO:0001583	missense	0			-	HGNC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.16332T>G	1.37:g.186151337T>G	ENSP00000271588:p.His5444Gln	Somatic	0	24	0.00		0.6159915499159303	11	42.11	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	30	40.00	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.H5444Q	ENST00000271588.4	37	c.16332	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	T	14.95	2.687510	0.48097	.	.	ENSG00000143341	ENST00000271588;ENST00000367492;ENST00000414277	D;D;D	0.86769	-2.17;-2.17;-2.17	5.53	1.86	0.25419	EGF-like calcium-binding, conserved site (1);Growth factor, receptor (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.86410	0.5926	N	0.25485	0.75	0.39772	D	0.972175	D	0.55800	0.973	D	0.66196	0.942	D	0.83659	0.0160	10	0.46703	T	0.11	.	9.5339	0.39211	0.0:0.2949:0.0:0.7051	.	5444	Q96RW7	HMCN1_HUMAN	Q	5444;5327;119	ENSP00000271588:H5444Q;ENSP00000356462:H5327Q;ENSP00000406205:H119Q	ENSP00000271588:H5444Q	H	+	3	2	HMCN1	184417960	0.599000	0.26891	0.999000	0.59377	0.992000	0.81027	-0.242000	0.08928	0.055000	0.16094	-0.371000	0.07208	CAT	-	pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.423	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	protein_coding	OTTHUMT00000131848.1	T	NM_031935	-		186151337	+1	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	SNP	0.999	G
TARS	6897	genome.wustl.edu	37	5	33463875	33463875	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr5:33463875C>T	ENST00000265112.3	+	17	2164	c.1853C>T	c.(1852-1854)cCt>cTt	p.P618L	TARS_ENST00000502553.1_Missense_Mutation_p.P618L|TARS_ENST00000455217.2_Missense_Mutation_p.P651L|TARS_ENST00000414361.2_Missense_Mutation_p.P497L|TARS_ENST00000541634.1_Missense_Mutation_p.P514L|TARS_ENST00000509410.1_3'UTR	NM_152295.4	NP_689508.3	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	618					gene expression (GO:0010467)|threonyl-tRNA aminoacylation (GO:0006435)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|threonine-tRNA ligase activity (GO:0004829)			NS(1)|biliary_tract(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)	29					L-Threonine(DB00156)	TGGCTGTCCCCTCGCCAGGTA	0.398																																																	0								ENSG00000113407						112.0	97.0	102.0					5																	33463875		2203	4300	6503	TARS	SO:0001583	missense	0			-	HGNC	AK095852	CCDS3899.1, CCDS58943.1	5p13.2	2012-10-02			ENSG00000113407	ENSG00000113407	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	11572	protein-coding gene	gene with protein product	"""threonine tRNA ligase 1, cytoplasmic"""	187790					Standard	NM_152295		Approved		uc011coc.3	P26639	OTTHUMG00000090683	ENST00000265112.3:c.1853C>T	5.37:g.33463875C>T	ENSP00000265112:p.Pro618Leu	Somatic	0	61	0.00		0.6159915499159303	27	89.82	247	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	15	58.97	A8K8I1|B4DEG8|Q96FP5|Q9BWA6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,prints_Thr-tRNA-ligase_IIa,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-ligase_IIa	p.P618L	ENST00000265112.3	37	c.1853	CCDS3899.1	5	.	.	.	.	.	.	.	.	.	.	C	33	5.194284	0.94960	.	.	ENSG00000113407	ENST00000502553;ENST00000265112;ENST00000541634;ENST00000455217;ENST00000414361	T;T;T	0.75260	-0.9;-0.9;-0.92	5.86	5.86	0.93980	Anticodon-binding (2);	0.000000	0.85682	D	0.000000	D	0.93268	0.7855	H	0.99746	4.745	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.99;0.999	D;D;D;D	0.72625	0.978;0.933;0.914;0.933	D	0.95818	0.8847	10	0.87932	D	0	-8.7674	20.2019	0.98263	0.0:1.0:0.0:0.0	.	497;651;514;618	E7ERI3;B4DEG8;G3XAN9;P26639	.;.;.;SYTC_HUMAN	L	618;618;514;651;497	ENSP00000424387:P618L;ENSP00000265112:P618L;ENSP00000387710:P651L	ENSP00000265112:P618L	P	+	2	0	TARS	33499632	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.568000	0.82369	2.776000	0.95493	0.655000	0.94253	CCT	-	superfamily_Anticodon-bd,prints_Thr-tRNA-ligase_IIa,tigrfam_Thr-tRNA-ligase_IIa		0.398	TARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARS	protein_coding	OTTHUMT00000207367.1	C	NM_152295	-		33463875	+1	no_errors	ENST00000265112	ensembl	human	known	74_37	missense	SNP	1.000	T
TLR9	54106	genome.wustl.edu	37	3	52255758	52255758	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr3:52255758delC	ENST00000360658.2	-	2	3207	c.2574delG	c.(2572-2574)gggfs	p.G858fs	TLR9_ENST00000494383.1_Frame_Shift_Del_p.A1013fs|TLR9_ENST00000597542.1_Frame_Shift_Del_p.G882fs	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	858					defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	CACTTTGCCGCCCCCGCCAGG	0.632																																																	0								ENSG00000239732						58.0	59.0	59.0					3																	52255758		2203	4300	6503	TLR9	SO:0001589	frameshift_variant	0				HGNC	AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.2574delG	3.37:g.52255758delC	ENSP00000353874:p.Gly858fs	Somatic	0	33	0.00		0.6159915499159303	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_TIR_dom,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_TIR_dom,pfscan_TIR_dom	p.R883fs	ENST00000360658.2	37	c.2646	CCDS2848.1	3																																																																																			-	NULL		0.632	TLR9-001	KNOWN	basic|CCDS	protein_coding	TLR9	protein_coding	OTTHUMT00000350203.1	C				52255758	-1	no_errors	ENST00000597542	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
ZNF225	7768	genome.wustl.edu	37	19	44622636	44622636	+	Splice_Site	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:44622636G>T	ENST00000262894.6	+	4	424	c.144G>T	c.(142-144)ggG>ggT	p.G48G	ZNF225_ENST00000592780.1_Splice_Site_p.G48G|ZNF225_ENST00000590612.1_Splice_Site_p.G48G	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	48	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				CGTTCACAGGGCATCAATCAC	0.383																																																	0								ENSG00000256294						86.0	83.0	84.0					19																	44622636		2203	4300	6503	ZNF225	SO:0001630	splice_region_variant	0			-	HGNC	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.143-1G>T	19.37:g.44622636G>T		Somatic	0	90	0.00		0.6159915499159303	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	44	21.43	A8K8S2|Q53F12|Q9NS46|Q9UID8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G48	ENST00000262894.6	37	c.144	CCDS46100.1	19																																																																																			-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.383	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF225	protein_coding	OTTHUMT00000460581.1	G		-	Silent	44622636	+1	no_errors	ENST00000262894	ensembl	human	known	74_37	silent	SNP	0.001	T
MUC2	4583	genome.wustl.edu	37	11	1104259	1104259	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr11:1104259G>T	ENST00000441003.2	+	49	8477	c.8450G>T	c.(8449-8451)gGg>gTg	p.G2817V		NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	5179					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CTGGGGAGCGGGTGAGCGGGG	0.672																																																	0								ENSG00000198788						33.0	37.0	36.0					11																	1104259		1863	4085	5948	MUC2	SO:0001583	missense	0			-	HGNC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.8450G>T	11.37:g.1104259G>T	ENSP00000415183:p.Gly2817Val	Somatic	0	33	0.00		0.6159915499159303	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	17	19.05	Q14878	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.G2817V	ENST00000441003.2	37	c.8450		11	.	.	.	.	.	.	.	.	.	.	G	0.267	-0.995808	0.02145	.	.	ENSG00000198788	ENST00000441003	T	0.12984	2.63	2.52	-5.03	0.02973	.	.	.	.	.	T	0.06872	0.0175	N	0.22421	0.69	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.29212	-1.0019	9	0.87932	D	0	.	1.0775	0.01635	0.3169:0.3367:0.1361:0.2103	.	2817	E7EUV1	.	V	2817	ENSP00000415183:G2817V	ENSP00000415183:G2817V	G	+	2	0	MUC2	1094259	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.293000	0.01145	-3.710000	0.00117	-1.310000	0.01310	GGG	-	NULL		0.672	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	protein_coding	OTTHUMT00000345894.2	G	NM_002457	-		1104259	+1	no_errors	ENST00000441003	ensembl	human	known	74_37	missense	SNP	0.000	T
FOXRED1	55572	genome.wustl.edu	37	11	126146398	126146398	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr11:126146398G>T	ENST00000263578.5	+	9	1155	c.1081G>T	c.(1081-1083)Ggt>Tgt	p.G361C	FOXRED1_ENST00000442061.2_Missense_Mutation_p.G191C|FOXRED1_ENST00000534011.1_3'UTR|FOXRED1_ENST00000532125.1_Missense_Mutation_p.G347C	NM_017547.3	NP_060017.1	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing 1	361						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)		CAACTACCTAGGTGGTCGTAG	0.552																																																	0								ENSG00000110074						93.0	89.0	90.0					11																	126146398		2201	4298	6499	FOXRED1	SO:0001583	missense	0			-	HGNC		CCDS8471.1	11q24.2	2006-02-03			ENSG00000110074	ENSG00000110074			26927	protein-coding gene	gene with protein product		613622				10497265	Standard	NM_017547		Approved	H17	uc001qdi.3	Q96CU9	OTTHUMG00000165827	ENST00000263578.5:c.1081G>T	11.37:g.126146398G>T	ENSP00000263578:p.Gly361Cys	Somatic	0	39	0.00		0.6159915499159303	36	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	B3KN84|B4DHU2|Q71MG0|Q9BU39|Q9UKY9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FAD-dep_OxRdtase	p.G361C	ENST00000263578.5	37	c.1081	CCDS8471.1	11	.	.	.	.	.	.	.	.	.	.	g	10.23	1.293679	0.23564	.	.	ENSG00000110074	ENST00000263578;ENST00000442061;ENST00000532125	D;D;D	0.86497	-2.13;-2.13;-2.13	5.52	5.52	0.82312	FAD dependent oxidoreductase (1);	0.198470	0.52532	D	0.000068	T	0.77226	0.4099	N	0.10629	0.01	0.32715	N	0.511072	B;B;B	0.22746	0.0;0.074;0.0	B;B;B	0.26770	0.002;0.073;0.004	T	0.72821	-0.4177	9	.	.	.	-7.4428	19.1206	0.93362	0.0:0.0:1.0:0.0	.	347;228;361	Q96CU9-3;B4DI59;Q96CU9	.;.;FXRD1_HUMAN	C	361;191;347	ENSP00000263578:G361C;ENSP00000404371:G191C;ENSP00000434178:G347C	.	G	+	1	0	FOXRED1	125651608	1.000000	0.71417	0.974000	0.42286	0.992000	0.81027	6.032000	0.70918	2.619000	0.88677	0.574000	0.79327	GGT	-	pfam_FAD-dep_OxRdtase		0.552	FOXRED1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXRED1	protein_coding	OTTHUMT00000386434.1	G	NM_017547	-		126146398	+1	no_errors	ENST00000263578	ensembl	human	known	74_37	missense	SNP	0.996	T
NLRP9	338321	genome.wustl.edu	37	19	56220321	56220321	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:56220321G>C	ENST00000332836.2	-	9	2960	c.2933C>G	c.(2932-2934)cCt>cGt	p.P978R	CTD-2611O12.6_ENST00000600582.1_RNA|CTD-2611O12.7_ENST00000597680.1_RNA|CTD-2611O12.8_ENST00000596293.1_RNA	NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	978						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		GTCAATCCAAGGTCCATGTGA	0.478																																																	0								ENSG00000185792						105.0	101.0	102.0					19																	56220321		2203	4300	6503	NLRP9	SO:0001583	missense	0			-	HGNC	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.2933C>G	19.37:g.56220321G>C	ENSP00000331857:p.Pro978Arg	Somatic	0	56	0.00		0.6159915499159303	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	62	23.46	B2RN12|Q86W27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.P978R	ENST00000332836.2	37	c.2933	CCDS12934.1	19	.	.	.	.	.	.	.	.	.	.	G	9.598	1.127819	0.20959	.	.	ENSG00000185792	ENST00000332836	T	0.72942	-0.7	2.65	-1.06	0.10002	.	.	.	.	.	T	0.56366	0.1980	L	0.29908	0.895	0.09310	N	0.999998	P	0.51351	0.944	P	0.44860	0.462	T	0.50065	-0.8871	9	0.52906	T	0.07	.	5.6222	0.17463	0.4372:0.0:0.5628:0.0	.	978	Q7RTR0	NALP9_HUMAN	R	978	ENSP00000331857:P978R	ENSP00000331857:P978R	P	-	2	0	NLRP9	60912133	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	0.298000	0.19120	-0.143000	0.11334	-0.150000	0.13652	CCT	-	NULL		0.478	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP9	protein_coding	OTTHUMT00000453653.1	G	NM_176820	-		56220321	-1	no_errors	ENST00000332836	ensembl	human	known	74_37	missense	SNP	0.000	C
IGSF1	3547	genome.wustl.edu	37	X	130409008	130409008	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:130409008G>T	ENST00000361420.3	-	17	3516	c.3437C>A	c.(3436-3438)tCa>tAa	p.S1146*	IGSF1_ENST00000370903.3_Nonsense_Mutation_p.S1151*|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370910.1_Nonsense_Mutation_p.S1137*|IGSF1_ENST00000370904.1_Nonsense_Mutation_p.S1137*			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1146	Ig-like C2-type 11.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						ACTGTGATTTGAAGCTGCAAA	0.468																																																	0								ENSG00000147255						166.0	160.0	162.0					X																	130409008		2203	4300	6503	IGSF1	SO:0001587	stop_gained	0			-	HGNC	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3437C>A	X.37:g.130409008G>T	ENSP00000355010:p.Ser1146*	Somatic	0	60	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	66	19.51	B5MEG2|H9KV64|O15070|Q9NTC8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S1151*	ENST00000361420.3	37	c.3452	CCDS14629.1	X	.	.	.	.	.	.	.	.	.	.	G	41	8.601538	0.98881	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	.	.	.	5.35	4.48	0.54585	.	2.260420	0.01731	N	0.028871	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.1551	0.31165	0.1092:0.0:0.8908:0.0	.	.	.	.	X	1137;1146;1137;1151	.	ENSP00000355010:S1146X	S	-	2	0	IGSF1	130236689	1.000000	0.71417	0.989000	0.46669	0.994000	0.84299	2.987000	0.49378	2.376000	0.81061	0.594000	0.82650	TCA	-	smart_Ig_sub		0.468	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	protein_coding	OTTHUMT00000058288.1	G		-		130409008	-1	no_errors	ENST00000370903	ensembl	human	known	74_37	nonsense	SNP	0.857	T
TYRO3	7301	genome.wustl.edu	37	15	41859686	41859686	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr15:41859686G>T	ENST00000263798.3	+	7	1136	c.912G>T	c.(910-912)ttG>ttT	p.L304F	TYRO3_ENST00000559066.1_Missense_Mutation_p.L259F	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	304	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CCAATGCCTTGGGGCCCTCTC	0.642																																																	0								ENSG00000092445						95.0	95.0	95.0					15																	41859686		2203	4300	6503	TYRO3	SO:0001583	missense	0			-	HGNC	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.912G>T	15.37:g.41859686G>T	ENSP00000263798:p.Leu304Phe	Somatic	0	39	0.00		0.6159915499159303	25	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	O14953|Q86VR3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L304F	ENST00000263798.3	37	c.912	CCDS10080.1	15	.	.	.	.	.	.	.	.	.	.	G	18.31	3.595799	0.66332	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	T	0.57273	0.41	4.64	3.7	0.42460	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.34338	N	0.004057	T	0.60470	0.2271	L	0.52573	1.65	0.43156	D	0.994931	D	0.62365	0.991	P	0.62382	0.901	T	0.60860	-0.7179	10	0.49607	T	0.09	-11.093	10.361	0.43994	0.0959:0.0:0.9041:0.0	.	304	Q06418	TYRO3_HUMAN	F	236;304	ENSP00000263798:L304F	ENSP00000263798:L304F	L	+	3	2	TYRO3	39646978	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.453000	0.52978	2.417000	0.82017	0.655000	0.94253	TTG	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.642	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRO3	protein_coding	OTTHUMT00000252693.2	G		-		41859686	+1	no_errors	ENST00000263798	ensembl	human	known	74_37	missense	SNP	1.000	T
NF2	4771	genome.wustl.edu	37	22	30032860	30032860	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:30032860A>T	ENST00000338641.4	+	2	676	c.235A>T	c.(235-237)Aag>Tag	p.K79*	NF2_ENST00000403999.3_Nonsense_Mutation_p.K79*|NF2_ENST00000413209.2_Nonsense_Mutation_p.K79*|NF2_ENST00000347330.5_Intron|NF2_ENST00000353887.4_Intron|NF2_ENST00000361676.4_Intron|NF2_ENST00000397789.3_Nonsense_Mutation_p.K79*|NF2_ENST00000361452.4_Nonsense_Mutation_p.K79*|NF2_ENST00000403435.1_Nonsense_Mutation_p.K79*|NF2_ENST00000334961.7_Intron|NF2_ENST00000361166.4_Nonsense_Mutation_p.K79*	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	79	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.		K -> E (in vestibular schwannoma). {ECO:0000269|PubMed:7951231}.		actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.M39_K80del(3)|p.?(3)|p.K79E(1)|p.K76fs*5(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						CAAAATGGACAAGAAGGTTGG	0.542			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																														yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	8	Unknown(3)|Deletion - In frame(3)|Substitution - Missense(1)|Deletion - Frameshift(1)	soft_tissue(4)|meninges(1)|stomach(1)|large_intestine(1)|lung(1)						ENSG00000186575						109.0	103.0	105.0					22																	30032860		2203	4300	6503	NF2	SO:0001587	stop_gained	0	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	-	HGNC	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.235A>T	22.37:g.30032860A>T	ENSP00000344666:p.Lys79*	Somatic	0	54	0.00		0.6159915499159303	4	55.56	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	11	73.33	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_ERM,pfam_ERM_C_dom,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin_tail,smart_Band_41_domain,pfscan_FERM_domain,prints_Ez/rad/moesin_like,prints_Band_41_fam,prints_Tropomyosin	p.K79*	ENST00000338641.4	37	c.235	CCDS13861.1	22	.	.	.	.	.	.	.	.	.	.	A	40	8.300822	0.98750	.	.	ENSG00000186575	ENST00000413209;ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000397789;ENST00000361166	.	.	.	6.02	6.02	0.97574	.	0.047341	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5446	0.84426	1.0:0.0:0.0:0.0	.	.	.	.	X	79	.	.	K	+	1	0	NF2	28362860	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.435000	0.80391	2.311000	0.77944	0.533000	0.62120	AAG	-	pirsf_ERM,pfam_FERM_N,smart_Band_41_domain,pfscan_FERM_domain		0.542	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NF2	protein_coding	OTTHUMT00000075615.3	A	NM_000268	-		30032860	+1	no_errors	ENST00000338641	ensembl	human	known	74_37	nonsense	SNP	1.000	T
IGSF1	3547	genome.wustl.edu	37	X	130408707	130408707	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:130408707G>C	ENST00000361420.3	-	18	3696	c.3617C>G	c.(3616-3618)tCa>tGa	p.S1206*	IGSF1_ENST00000370903.3_Nonsense_Mutation_p.S1211*|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370910.1_Nonsense_Mutation_p.S1197*|IGSF1_ENST00000370904.1_Nonsense_Mutation_p.S1197*			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1206	Ig-like C2-type 12.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						TCCATCCTCTGAAAACTGCTG	0.498																																																	0								ENSG00000147255						217.0	206.0	210.0					X																	130408707		2203	4300	6503	IGSF1	SO:0001587	stop_gained	0			-	HGNC	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3617C>G	X.37:g.130408707G>C	ENSP00000355010:p.Ser1206*	Somatic	0	45	0.00		0.6159915499159303	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	76	11.63	B5MEG2|H9KV64|O15070|Q9NTC8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S1211*	ENST00000361420.3	37	c.3632	CCDS14629.1	X	.	.	.	.	.	.	.	.	.	.	G	40	8.435862	0.98810	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	.	.	.	5.35	4.47	0.54385	.	0.931858	0.08884	N	0.879565	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	9.3694	0.38246	0.1063:0.0:0.8937:0.0	.	.	.	.	X	1197;1206;1197;1211	.	ENSP00000355010:S1206X	S	-	2	0	IGSF1	130236388	0.182000	0.23173	0.997000	0.53966	0.958000	0.62258	1.220000	0.32491	2.376000	0.81061	0.594000	0.82650	TCA	-	smart_Ig_sub,smart_Ig_sub2		0.498	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	protein_coding	OTTHUMT00000058288.1	G		-		130408707	-1	no_errors	ENST00000370903	ensembl	human	known	74_37	nonsense	SNP	0.957	C
