#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PTPN21	11099	genome.wustl.edu	37	14	88946616	88946616	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr14:88946616C>T	ENST00000556564.1	-	13	1443	c.1159G>A	c.(1159-1161)Ggt>Agt	p.G387S	PTPN21_ENST00000328736.3_Missense_Mutation_p.G387S	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	387					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						CGGATCCGACCGTTGAGGTCA	0.488																																																	0								ENSG00000070778						89.0	75.0	80.0					14																	88946616		2203	4300	6503	PTPN21	SO:0001583	missense	0			-	HGNC	X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.1159G>A	14.37:g.88946616C>T	ENSP00000452414:p.Gly387Ser	Somatic	0	29	0.00		0.6257302807660841	12	7.69	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	27	18.18		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,superfamily_FERM_central,smart_Band_41_domain,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-14/21,pfscan_FERM_domain,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam	p.G387S	ENST00000556564.1	37	c.1159	CCDS9884.1	14	.	.	.	.	.	.	.	.	.	.	C	22.0	4.237374	0.79800	.	.	ENSG00000070778	ENST00000328736;ENST00000556564	T;T	0.79033	-1.23;-1.23	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.88280	0.6394	M	0.78637	2.42	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.86136	0.1578	10	0.31617	T	0.26	.	19.3874	0.94563	0.0:1.0:0.0:0.0	.	387	Q16825	PTN21_HUMAN	S	387	ENSP00000330276:G387S;ENSP00000452414:G387S	ENSP00000330276:G387S	G	-	1	0	PTPN21	88016369	1.000000	0.71417	0.710000	0.30468	0.487000	0.33371	6.066000	0.71185	2.590000	0.87494	0.561000	0.74099	GGT	-	pirsf_Tyr_Pase_non-rcpt_typ-14/21		0.488	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN21	protein_coding	OTTHUMT00000410303.1	C		-		88946616	-1	no_errors	ENST00000328736	ensembl	human	known	74_37	missense	SNP	1.000	T
PPCS	79717	genome.wustl.edu	37	1	42925276	42925276	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr1:42925276A>G	ENST00000372561.3	+	3	622	c.615A>G	c.(613-615)atA>atG	p.I205M	PPCS_ENST00000472013.1_3'UTR|PPCS_ENST00000372562.1_Missense_Mutation_p.I32M|PPCS_ENST00000372556.3_Silent_p.*57*|PPCS_ENST00000455780.1_Missense_Mutation_p.I32M	NM_024664.2	NP_078940.2	Q9HAB8	PPCS_HUMAN	phosphopantothenoylcysteine synthetase	205					coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	phosphopantothenate--cysteine ligase activity (GO:0004632)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|skin(3)	12	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CAATACAGATAACAATGAAGA	0.373																																																	0								ENSG00000127125						53.0	53.0	53.0					1																	42925276		1835	4079	5914	PPCS	SO:0001583	missense	0			-	HGNC	AK021900	CCDS41311.1, CCDS41312.1	1p34.2	2008-02-05			ENSG00000127125	ENSG00000127125	6.3.2.5		25686	protein-coding gene	gene with protein product		609853				11923312	Standard	NM_024664		Approved	FLJ11838	uc001chl.3	Q9HAB8	OTTHUMG00000007332	ENST00000372561.3:c.615A>G	1.37:g.42925276A>G	ENSP00000361642:p.Ile205Met	Somatic	0	25	0.00		0.6257302807660841	27	62.50	45	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	26	59.38	Q3KQT2|Q5VVM0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA/pantothenate-metab_flavo_C,superfamily_DNA/pantothenate-metab_flavo_C	p.I205M	ENST00000372561.3	37	c.615	CCDS41311.1	1	.	.	.	.	.	.	.	.	.	.	A	17.02	3.282870	0.59867	.	.	ENSG00000127125	ENST00000372562;ENST00000455780;ENST00000372561	.	.	.	6.02	6.02	0.97574	DNA/pantothenate metabolism flavoprotein, C-terminal (3);	0.040889	0.85682	D	0.000000	T	0.70448	0.3225	M	0.69248	2.105	0.53688	D	0.999971	D	0.62365	0.991	D	0.67382	0.951	T	0.72014	-0.4418	9	0.49607	T	0.09	-11.8342	9.74	0.40413	0.8459:0.0:0.0:0.154	.	205	Q9HAB8	PPCS_HUMAN	M	32;32;205	.	ENSP00000361642:I205M	I	+	3	3	PPCS	42697863	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.545000	0.36169	2.311000	0.77944	0.533000	0.62120	ATA	-	pfam_DNA/pantothenate-metab_flavo_C,superfamily_DNA/pantothenate-metab_flavo_C		0.373	PPCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPCS	protein_coding	OTTHUMT00000019166.1	A	NM_024664	-		42925276	+1	no_errors	ENST00000372561	ensembl	human	known	74_37	missense	SNP	1.000	G
ASTE1	28990	genome.wustl.edu	37	3	130733046	130733047	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr3:130733046_130733047insT	ENST00000264992.3	-	6	2335_2336	c.1894_1895insA	c.(1894-1896)aggfs	p.R632fs	ASTE1_ENST00000514044.1_Frame_Shift_Ins_p.R657fs|ATP2C1_ENST00000328560.8_Intron|ATP2C1_ENST00000513801.1_Intron|ATP2C1_ENST00000393221.4_Intron|ATP2C1_ENST00000359644.3_Intron|ATP2C1_ENST00000507488.2_Intron|ATP2C1_ENST00000504381.1_Intron|ATP2C1_ENST00000422190.2_Intron|ATP2C1_ENST00000533801.2_Intron	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	632					DNA repair (GO:0006281)		nuclease activity (GO:0004518)	p.R632fs*33(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						TTTCTTCTGCCTTTTTTTTTTT	0.406																																																	2	Deletion - Frameshift(2)	ovary(2)						ENSG00000034533																																			ASTE1	SO:0001589	frameshift_variant	0				HGNC	AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.1895dupA	3.37:g.130733057_130733057dupT	ENSP00000264992:p.Arg632fs	Somatic	0	22	0.00		0.6257302807660841	25	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	9	30.77	B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_XPG_DNA_repair_N	p.R632fs	ENST00000264992.3	37	c.1895_1894	CCDS3068.1	3																																																																																			-	NULL		0.406	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASTE1	protein_coding	OTTHUMT00000356659.1	-	NM_014065			130733047	-1	no_errors	ENST00000264992	ensembl	human	known	74_37	frame_shift_ins	INS	0.003:0.014	T
NXNL2	158046	genome.wustl.edu	37	9	91150536	91150536	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr9:91150536G>A	ENST00000375854.3	+	1	521	c.187G>A	c.(187-189)Gcg>Acg	p.A63T	NXNL2_ENST00000375855.3_Missense_Mutation_p.A63T|NXNL2_ENST00000487646.2_3'UTR	NM_001161625.1	NP_001155097.1	Q5VZ03	NXNL2_HUMAN	nucleoredoxin-like 2	63	Thioredoxin.				photoreceptor cell maintenance (GO:0045494)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)					lung(3)	3						GCGGCGGCCCGCGCCCTTCGA	0.706																																																	0								ENSG00000130045						14.0	20.0	18.0					9																	91150536		2180	4275	6455	NXNL2	SO:0001583	missense	0			-	HGNC	BC022521	CCDS6679.1, CCDS55325.1	9q22.2	2008-02-05	2007-08-16	2007-08-16	ENSG00000130045	ENSG00000130045			30482	protein-coding gene	gene with protein product		615299	"""chromosome 9 open reading frame 121"""	C9orf121		12477932	Standard	NM_001161625		Approved		uc011ltj.2	Q5VZ03	OTTHUMG00000020170	ENST00000375854.3:c.187G>A	9.37:g.91150536G>A	ENSP00000365014:p.Ala63Thr	Somatic	0	11	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	8	33.33	B1AMD0|Q8TBG6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Thioredoxin-like_fold	p.A63T	ENST00000375854.3	37	c.187	CCDS55325.1	9	.	.	.	.	.	.	.	.	.	.	G	21.4	4.138513	0.77775	.	.	ENSG00000130045	ENST00000375854;ENST00000375855	T;T	0.80480	-1.38;-1.38	3.95	3.95	0.45737	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	D	0.86669	0.5988	M	0.62088	1.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.939	D	0.84003	0.0344	10	0.18710	T	0.47	-15.7778	16.176	0.81851	0.0:0.0:1.0:0.0	.	63;63	Q5VZ03;Q5VZ03-3	NXNL2_HUMAN;.	T	63	ENSP00000365014:A63T;ENSP00000365015:A63T	ENSP00000365014:A63T	A	+	1	0	NXNL2	90340356	1.000000	0.71417	0.938000	0.37757	0.125000	0.20455	8.384000	0.90160	2.040000	0.60383	0.491000	0.48974	GCG	-	superfamily_Thioredoxin-like_fold		0.706	NXNL2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	NXNL2	protein_coding		G	NM_145283	-		91150536	+1	no_errors	ENST00000375854	ensembl	human	known	74_37	missense	SNP	0.997	A
FOLH1	2346	genome.wustl.edu	37	11	49207240	49207240	+	Silent	SNP	T	T	G			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr11:49207240T>G	ENST00000256999.2	-	6	1067	c.807A>C	c.(805-807)acA>acC	p.T269T	FOLH1_ENST00000340334.7_Silent_p.T254T|FOLH1_ENST00000356696.3_Silent_p.T269T|FOLH1_ENST00000343844.4_Intron|FOLH1_ENST00000533034.1_Silent_p.T254T	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	269					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GGTAACCTGGTGTGAGAGGGT	0.428																																																	0								ENSG00000086205						55.0	56.0	56.0					11																	49207240		2201	4298	6499	FOLH1	SO:0001819	synonymous_variant	0			-	HGNC	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.807A>C	11.37:g.49207240T>G		Somatic	0	91	0.00		0.6257302807660841	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	72	28.71	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.T269	ENST00000256999.2	37	c.807	CCDS7946.1	11																																																																																			-	NULL		0.428	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	protein_coding	OTTHUMT00000390896.1	T	NM_004476	-		49207240	-1	no_errors	ENST00000256999	ensembl	human	known	74_37	silent	SNP	1.000	G
TTYH1	57348	genome.wustl.edu	37	19	54942232	54942232	+	Intron	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr19:54942232G>A	ENST00000376530.3	+	10	1135				TTYH1_ENST00000376531.3_Intron|TTYH1_ENST00000301194.4_Intron|TTYH1_ENST00000391739.3_Intron|AC008746.3_ENST00000457113.1_RNA|TTYH1_ENST00000489425.1_Intron	NM_001201461.1|NM_020659.3	NP_001188390.1|NP_065710.1	Q9H313	TTYH1_HUMAN	tweety family member 1						cell-substrate adhesion (GO:0031589)|chloride transport (GO:0006821)|filopodium assembly (GO:0046847)|ion transmembrane transport (GO:0034220)|iron ion transmembrane transport (GO:0034755)|iron ion transport (GO:0006826)|mitotic nuclear division (GO:0007067)|regulation of anion transport (GO:0044070)|single organismal cell-cell adhesion (GO:0016337)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|filopodium membrane (GO:0031527)|filopodium tip (GO:0032433)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum membrane (GO:0030868)	calcium ion binding (GO:0005509)|iron ion transmembrane transporter activity (GO:0005381)|volume-sensitive chloride channel activity (GO:0072320)			endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		ggcgatgggcgggCCTGAAGA	0.667																																																	0								ENSG00000227407						41.0	44.0	43.0					19																	54942232		2203	4300	6503	AC008746.3	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AF177909	CCDS12893.1, CCDS33106.1, CCDS56102.1	19q13.4	2013-09-02	2013-09-02		ENSG00000167614	ENSG00000167614			13476	protein-coding gene	gene with protein product		605784	"""tweety (Drosophila) homolog 1"", ""tweety homolog 1 (Drosophila)"""			10950931	Standard	NM_020659		Approved		uc002qfr.3	Q9H313	OTTHUMG00000065544	ENST00000376530.3:c.1033-45G>A	19.37:g.54942232G>A		Somatic	0	61	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	90	18.92	B0VJY3|B0VJY4|B0VJY5|B2VAL9|Q5U682|Q68A17|Q6L750|Q6ZTE5|Q8WUU2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376530.3	37	NULL	CCDS12893.1	19																																																																																			-	-		0.667	TTYH1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000227407	protein_coding	OTTHUMT00000140498.1	G		-		54942232	-1	no_errors	ENST00000457113	ensembl	human	known	74_37	rna	SNP	0.000	A
ZNF451	26036	genome.wustl.edu	37	6	57015419	57015419	+	Intron	SNP	A	A	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr6:57015419A>T	ENST00000370706.4	+	11	2852				ZNF451_ENST00000491832.2_Intron|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000586466.1_RNA|ZNF451_ENST00000357489.3_Intron|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			CAAGGTTAGTATTTTTGCATA	0.294																																																	0								ENSG00000226803																																			RP11-203B9.4	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.2609-98A>T	6.37:g.57015419A>T		Somatic	0	30	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	14	71.43	Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370706.4	37	NULL	CCDS43477.1	6																																																																																			-	-		0.294	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927211	protein_coding	OTTHUMT00000041035.2	A	NM_015555	-		57015419	-1	no_errors	ENST00000589263	ensembl	human	known	74_37	rna	SNP	0.000	T
CLDN8	9073	genome.wustl.edu	37	21	31588020	31588020	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr21:31588020G>A	ENST00000399899.1	-	1	371	c.224C>T	c.(223-225)cCg>cTg	p.P75L	CLDN8_ENST00000286809.1_Missense_Mutation_p.P75L	NM_199328.2	NP_955360.1	P56748	CLD8_HUMAN	claudin 8	75					calcium-independent cell-cell adhesion (GO:0016338)	basolateral plasma membrane (GO:0016323)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			NS(1)|endometrium(2)|large_intestine(6)|lung(6)	15						CTGTAGGTCCGGAGAAAGAGC	0.507																																																	0								ENSG00000156284						89.0	80.0	83.0					21																	31588020		2203	4300	6503	CLDN8	SO:0001583	missense	0			-	HGNC	AJ250711	CCDS13587.1	21q22.1	2008-07-31			ENSG00000156284	ENSG00000156284		"""Claudins"""	2050	protein-coding gene	gene with protein product		611231				9892664	Standard	NM_199328		Approved		uc002ynu.2	P56748	OTTHUMG00000081872	ENST00000399899.1:c.224C>T	21.37:g.31588020G>A	ENSP00000382783:p.Pro75Leu	Somatic	0	62	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	30	48.28	D3DSE3|Q53EX7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin8,prints_Claudin14	p.P75L	ENST00000399899.1	37	c.224	CCDS13587.1	21	.	.	.	.	.	.	.	.	.	.	G	17.30	3.354496	0.61293	.	.	ENSG00000156284	ENST00000399899;ENST00000286809;ENST00000536721	D;D	0.88431	-2.38;-2.38	5.05	4.15	0.48705	.	0.057668	0.64402	D	0.000001	D	0.94512	0.8233	M	0.86651	2.83	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.94468	0.7682	10	0.42905	T	0.14	.	14.7066	0.69194	0.0:0.0:0.8537:0.1463	.	75	P56748	CLD8_HUMAN	L	75	ENSP00000382783:P75L;ENSP00000286809:P75L	ENSP00000286809:P75L	P	-	2	0	CLDN8	30509891	0.985000	0.35326	0.331000	0.25455	0.819000	0.46315	2.030000	0.41108	1.453000	0.47775	0.650000	0.86243	CCG	-	pfam_PMP22/EMP/MP20/Claudin		0.507	CLDN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN8	protein_coding	OTTHUMT00000182260.1	G	NM_199328	-		31588020	-1	no_errors	ENST00000286809	ensembl	human	known	74_37	missense	SNP	0.789	A
HOXD11	3237	genome.wustl.edu	37	2	176973387	176973388	+	Intron	INS	-	-	TGTGTG	rs56323681		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr2:176973387_176973388insTGTGTG	ENST00000249504.5	+	2	851				AC009336.1_ENST00000401374.2_RNA|HOXD11_ENST00000498438.1_Intron	NM_021192.2	NP_067015.2	P31277	HXD11_HUMAN	homeobox D11						anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|developmental growth (GO:0048589)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of cell development (GO:0010720)|positive regulation of chondrocyte differentiation (GO:0032332)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|single fertilization (GO:0007338)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)							OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		GTGCCAGGCTCtgtgtgtgtgt	0.609			T	NUP98	AML																																			Dom	yes		2	2q31-q32	3237	homeo box D11		L	0								ENSG00000216193																																			AC009336.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene		CCDS2265.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128713	ENSG00000128713		"""Homeoboxes / ANTP class : HOXL subclass"""	5134	protein-coding gene	gene with protein product		142986	"""homeo box D11"""	HOX4, HOX4F		1973146, 1358459	Standard	NM_021192		Approved		uc002uki.3	P31277	OTTHUMG00000132510	ENST00000249504.5:c.782-247->TGTGTG	2.37:g.176973388_176973393dupTGTGTG		Somatic	NA	NA	NA		0.6257302807660841	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NIS4|Q9NS02	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000249504.5	37	NULL	CCDS2265.1	2																																																																																			-	-		0.609	HOXD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216193	protein_coding	OTTHUMT00000359250.2	-				176973388	+1	no_errors	ENST00000401374	ensembl	human	novel	74_37	rna	INS	0.011:0.248	TGTGTG
BCL7B	9275	genome.wustl.edu	37	7	72951686	72951686	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr7:72951686G>A	ENST00000223368.2	-	6	974	c.551C>T	c.(550-552)cCc>cTc	p.P184L	BCL7B_ENST00000482231.1_5'UTR|BCL7B_ENST00000411832.1_Missense_Mutation_p.P127L	NM_001707.3	NP_001698.2	Q9BQE9	BCL7B_HUMAN	B-cell CLL/lymphoma 7B	184							actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	9		Lung NSC(55;0.0659)|all_lung(88;0.152)				GCGCTTCAGGGGCGGGGCACC	0.632																																																	0								ENSG00000106635						66.0	69.0	68.0					7																	72951686		2203	4300	6503	BCL7B	SO:0001583	missense	0			-	HGNC	X89985	CCDS5550.1, CCDS56489.1, CCDS75613.1	7q11.23	2008-07-18			ENSG00000106635	ENSG00000106635			1005	protein-coding gene	gene with protein product		605846				8605326, 9806765	Standard	NM_001707		Approved		uc003tyf.2	Q9BQE9	OTTHUMG00000023412	ENST00000223368.2:c.551C>T	7.37:g.72951686G>A	ENSP00000223368:p.Pro184Leu	Somatic	0	55	0.00		0.6257302807660841	58	31.76	27	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	32	28.89	A8K226|C9JWD3|D3DXF0|O43769|Q13845|Q6ZW75	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BCL7	p.P184L	ENST00000223368.2	37	c.551	CCDS5550.1	7	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622985	0.46840	.	.	ENSG00000106635	ENST00000223368;ENST00000411832	T	0.51817	0.69	5.13	4.25	0.50352	.	0.054468	0.64402	D	0.000001	T	0.38108	0.1028	L	0.41492	1.28	0.53005	D	0.999967	B;B	0.17852	0.012;0.024	B;B	0.12837	0.006;0.008	T	0.31392	-0.9945	10	0.87932	D	0	.	9.656	0.39925	0.0939:0.0:0.9061:0.0	.	127;184	C9JWD3;Q9BQE9	.;BCL7B_HUMAN	L	184;127	ENSP00000223368:P184L	ENSP00000223368:P184L	P	-	2	0	BCL7B	72589622	1.000000	0.71417	0.948000	0.38648	0.959000	0.62525	3.935000	0.56560	1.398000	0.46701	-0.272000	0.10252	CCC	-	NULL		0.632	BCL7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL7B	protein_coding	OTTHUMT00000252194.1	G	NM_001707	-		72951686	-1	no_errors	ENST00000223368	ensembl	human	known	74_37	missense	SNP	0.954	A
MAGEC1	9947	genome.wustl.edu	37	X	140996581	140996581	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chrX:140996581A>G	ENST00000285879.4	+	4	3677	c.3391A>G	c.(3391-3393)Agc>Ggc	p.S1131G	MAGEC1_ENST00000406005.2_Missense_Mutation_p.S198G	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	1131										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					AGAAAGTGCAAGCTCCAGTGT	0.498										HNSCC(15;0.026)																																							0								ENSG00000155495						88.0	75.0	79.0					X																	140996581		2203	4300	6503	MAGEC1	SO:0001583	missense	0			-	HGNC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.3391A>G	X.37:g.140996581A>G	ENSP00000285879:p.Ser1131Gly	Somatic	0	41	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	8	85.71	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfscan_MAGE	p.S1131G	ENST00000285879.4	37	c.3391	CCDS35417.1	X	.	.	.	.	.	.	.	.	.	.	a	0.962	-0.702996	0.03255	.	.	ENSG00000155495	ENST00000285879;ENST00000406005	T;T	0.05139	4.4;3.49	1.06	1.06	0.20224	.	.	.	.	.	T	0.08088	0.0202	L	0.51422	1.61	0.09310	N	1	P	0.43392	0.805	P	0.45506	0.483	T	0.26815	-1.0092	9	0.54805	T	0.06	.	4.0185	0.09655	1.0:0.0:0.0:0.0	.	1131	O60732	MAGC1_HUMAN	G	1131;198	ENSP00000285879:S1131G;ENSP00000385500:S198G	ENSP00000285879:S1131G	S	+	1	0	MAGEC1	140824247	0.006000	0.16342	0.009000	0.14445	0.028000	0.11728	1.347000	0.33975	0.667000	0.31107	0.231000	0.17811	AGC	-	NULL		0.498	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	protein_coding	OTTHUMT00000058604.1	A	NM_005462	-		140996581	+1	no_errors	ENST00000285879	ensembl	human	known	74_37	missense	SNP	0.009	G
CP	1356	genome.wustl.edu	37	3	148924108	148924108	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr3:148924108delA	ENST00000264613.6	-	6	1317	c.1055delT	c.(1054-1056)ttcfs	p.F352fs		NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	352	F5/8 type A 1.|Plastocyanin-like 2.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	CTGGACCTGGAAAAAGGCTTG	0.428																																																	0								ENSG00000047457						111.0	110.0	110.0					3																	148924108		2203	4300	6503	CP	SO:0001589	frameshift_variant	0				HGNC	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.1055delT	3.37:g.148924108delA	ENSP00000264613:p.Phe352fs	Somatic	0	28	0.00		0.6257302807660841	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	Q14063|Q2PP18|Q9UKS4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Cu-oxidase_2,pfam_Cu-oxidase_3,pfam_Cu-oxidase,superfamily_Cupredoxin	p.F352fs	ENST00000264613.6	37	c.1055	CCDS3141.1	3																																																																																			-	pfam_Cu-oxidase_2,pfam_Cu-oxidase,superfamily_Cupredoxin		0.428	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CP	protein_coding	OTTHUMT00000317498.1	A	NM_000096			148924108	-1	no_errors	ENST00000264613	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
KLF11	8462	genome.wustl.edu	37	2	10194736	10194736	+	3'UTR	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr2:10194736C>T	ENST00000305883.1	+	0	3803				RP11-254F7.3_ENST00000607181.1_RNA|KLF11_ENST00000535335.1_3'UTR|KLF11_ENST00000540845.1_3'UTR	NM_003597.4	NP_003588.1	O14901	KLF11_HUMAN	Kruppel-like factor 11						apoptotic process (GO:0006915)|cellular response to peptide (GO:1901653)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		CCTCAGCTGGCGGCTCTGGGT	0.498																																					Melanoma(56;431 1507 23687 50789)												0								ENSG00000271787																																			RP11-254F7.3	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene	AF028008	CCDS1668.1, CCDS54333.1	2p25	2013-01-08	2004-11-29	2004-12-01	ENSG00000172059	ENSG00000172059		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11811	protein-coding gene	gene with protein product		603301	"""TGFB inducible early growth response 2"""	TIEG2		9748269, 11087666	Standard	NM_001177716		Approved	Tieg3, MODY7	uc002raf.1	O14901	OTTHUMG00000119004	ENST00000305883.1:c.*2102C>T	2.37:g.10194736C>T		Somatic	0	128	0.00		0.6257302807660841	40	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	B4DZE7|Q9EPF4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000305883.1	37	NULL	CCDS1668.1	2																																																																																			-	-		0.498	KLF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000271787	protein_coding	OTTHUMT00000239202.3	C	NM_003597	-		10194736	-1	no_errors	ENST00000607181	ensembl	human	known	74_37	rna	SNP	0.000	T
LPHN1	22859	genome.wustl.edu	37	19	14288464	14288464	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr19:14288464C>T	ENST00000340736.6	-	3	460	c.163G>A	c.(163-165)Gtc>Atc	p.V55I	LPHN1_ENST00000361434.3_Missense_Mutation_p.V55I	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	55	SUEL-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00260}.				calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						ACCATGATGACGTCGCTGCCG	0.657																																																	0								ENSG00000072071						118.0	94.0	102.0					19																	14288464		2203	4300	6503	LPHN1	SO:0001583	missense	0			-	HGNC	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.163G>A	19.37:g.14288464C>T	ENSP00000340688:p.Val55Ile	Somatic	0	42	0.00		0.6257302807660841	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	38	17.39	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like	p.V55I	ENST00000340736.6	37	c.163	CCDS32928.1	19	.	.	.	.	.	.	.	.	.	.	C	35	5.449484	0.96205	.	.	ENSG00000072071	ENST00000340736;ENST00000361434	T;T	0.16597	2.33;2.33	5.15	5.15	0.70609	D-galactoside/L-rhamnose binding SUEL lectin domain (2);	0.000000	0.64402	D	0.000001	T	0.44244	0.1284	M	0.78049	2.395	0.58432	D	0.999998	D;D	0.76494	0.999;0.999	D;D	0.91635	0.997;0.999	T	0.40270	-0.9572	10	0.56958	D	0.05	.	16.11	0.81255	0.0:1.0:0.0:0.0	.	55;55	O94910-2;O94910	.;LPHN1_HUMAN	I	55	ENSP00000340688:V55I;ENSP00000355328:V55I	ENSP00000340688:V55I	V	-	1	0	LPHN1	14149464	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.607000	0.82883	2.412000	0.81896	0.591000	0.81541	GTC	-	pfam_Lectin_gal-bd_dom,pfscan_Lectin_gal-bd_dom		0.657	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	LPHN1	protein_coding	OTTHUMT00000459696.1	C	NM_014921	-		14288464	-1	no_errors	ENST00000340736	ensembl	human	known	74_37	missense	SNP	1.000	T
KIR3DL2	3812	genome.wustl.edu	37	19	55363537	55363537	+	Missense_Mutation	SNP	G	G	A	rs549922142		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr19:55363537G>A	ENST00000326321.3	+	3	188	c.155G>A	c.(154-156)cGt>cAt	p.R52H	KIR3DL1_ENST00000402254.2_Intron|KIR3DL2_ENST00000270442.5_Missense_Mutation_p.R52H	NM_006737.3	NP_006728.2	P43630	KI3L2_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2	52	Ig-like C2-type 1.				cellular defense response (GO:0006968)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	23				GBM - Glioblastoma multiforme(193;0.0192)		TGTCACTATCGTCGTGGGTTT	0.552													.|||	1	0.000199681	0.0	0.0014	5008	,	,		10951	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000240403						9.0	8.0	9.0					19																	55363537		2023	3972	5995	KIR3DL2	SO:0001583	missense	0			-	HGNC	L41270	CCDS12906.1, CCDS58677.1	19q13.4	2014-05-22			ENSG00000240403	ENSG00000240403		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6339	protein-coding gene	gene with protein product		604947				7716543, 8662091	Standard	NM_006737		Approved	cl-5, nkat4, nkat4a, nkat4b, CD158K	uc002qho.4	P43630	OTTHUMG00000065935	ENST00000326321.3:c.155G>A	19.37:g.55363537G>A	ENSP00000325525:p.Arg52His	Somatic	0	31	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	20	37.50	Q13238|Q14947|Q14948|Q92684|Q95366|Q95367|Q95368	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Immunoglobulin,smart_Ig_sub	p.R52H	ENST00000326321.3	37	c.155	CCDS12906.1	19	.	.	.	.	.	.	.	.	.	.	g	0.330	-0.956797	0.02267	.	.	ENSG00000240403	ENST00000326321;ENST00000270442	T;T	0.12147	2.71;2.71	1.62	-3.23	0.05109	Immunoglobulin subtype (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.06872	0.0175	N	0.21448	0.665	0.09310	N	1	B;B	0.14438	0.01;0.007	B;B	0.12837	0.004;0.008	T	0.26643	-1.0097	9	0.42905	T	0.14	.	0.6215	0.00778	0.2527:0.3501:0.1559:0.2413	.	52;52	Q95366;P43630	.;KI3L2_HUMAN	H	52	ENSP00000325525:R52H;ENSP00000270442:R52H	ENSP00000270442:R52H	R	+	2	0	KIR3DL2	60055349	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.463000	0.02361	-3.254000	0.00203	-1.109000	0.02080	CGT	-	pfam_Immunoglobulin,smart_Ig_sub		0.552	KIR3DL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIR3DL2	protein_coding	OTTHUMT00000141241.1	G		-		55363537	+1	no_errors	ENST00000326321	ensembl	human	known	74_37	missense	SNP	0.000	A
OTOG	340990	genome.wustl.edu	37	11	17653668	17653668	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr11:17653668C>T	ENST00000399391.2	+	41	7003	c.7003C>T	c.(7003-7005)Cgg>Tgg	p.R2335W	OTOG_ENST00000399397.1_Missense_Mutation_p.R2262W|OTOG_ENST00000342528.2_Missense_Mutation_p.R1341W	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	2335					adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						GCTGTGGATCCGGGACACCAA	0.587																																																	0								ENSG00000188162																																			OTOG	SO:0001583	missense	0			-	HGNC	AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.7003C>T	11.37:g.17653668C>T	ENSP00000382323:p.Arg2335Trp	Somatic	0	57	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	59	23.08	A8MTX6|A8MUJ0|B7WPC4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.R2335W	ENST00000399391.2	37	c.7003	CCDS59225.1	11	.	.	.	.	.	.	.	.	.	.	C	19.58	3.854260	0.71719	.	.	ENSG00000188162	ENST00000399391;ENST00000399397;ENST00000342528	D;D;D	0.81821	-1.54;-1.54;-1.54	5.81	4.83	0.62350	.	0.195714	0.31976	N	0.006762	D	0.85952	0.5817	L	0.49126	1.545	0.38901	D	0.957329	D	0.89917	1.0	D	0.80764	0.994	D	0.85247	0.1042	10	0.38643	T	0.18	.	14.861	0.70382	0.1531:0.8469:0.0:0.0	.	1341	Q6ZRI0-2	.	W	2335;2262;1341	ENSP00000382323:R2335W;ENSP00000382329:R2262W;ENSP00000341666:R1341W	ENSP00000341666:R1341W	R	+	1	2	OTOG	17610244	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.675000	0.37555	2.746000	0.94184	0.591000	0.81541	CGG	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich		0.587	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	protein_coding		C		-		17653668	+1	no_errors	ENST00000399391	ensembl	human	known	74_37	missense	SNP	0.999	T
MOGAT2	80168	genome.wustl.edu	37	11	75440005	75440005	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr11:75440005T>A	ENST00000198801.5	+	5	891	c.821T>A	c.(820-822)aTa>aAa	p.I274K	MOGAT2_ENST00000526712.1_Missense_Mutation_p.I192K	NM_025098.2	NP_079374.2	Q3SYC2	MOGT2_HUMAN	monoacylglycerol O-acyltransferase 2	274					diacylglycerol biosynthetic process (GO:0006651)|glycerol metabolic process (GO:0006071)|intestinal absorption (GO:0050892)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|acetyltransferase activity (GO:0016407)			NS(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	20	Ovarian(111;0.103)					TTTGGTTTAATACCCTACCGC	0.562																																																	0								ENSG00000166391						145.0	123.0	130.0					11																	75440005		2200	4293	6493	MOGAT2	SO:0001583	missense	0			-	HGNC	AY157608	CCDS8240.1	11q13.5	2008-02-05			ENSG00000166391	ENSG00000166391			23248	protein-coding gene	gene with protein product		610270				14970677	Standard	NM_025098		Approved	MGAT2, DGAT2L5, FLJ22644	uc010rru.2	Q3SYC2	OTTHUMG00000165341	ENST00000198801.5:c.821T>A	11.37:g.75440005T>A	ENSP00000198801:p.Ile274Lys	Somatic	0	26	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	29	17.14	A8K7I3|Q3SYC1|Q6ZQZ2|Q86UH6|Q9H630	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DAGAT	p.I274K	ENST00000198801.5	37	c.821	CCDS8240.1	11	.	.	.	.	.	.	.	.	.	.	T	18.97	3.735557	0.69189	.	.	ENSG00000166391	ENST00000198801;ENST00000526712	T;T	0.15372	2.43;2.43	6.03	6.03	0.97812	.	0.797994	0.12254	N	0.485419	T	0.44787	0.1310	M	0.86502	2.82	0.26071	N	0.981229	P	0.46064	0.872	P	0.54590	0.756	T	0.44574	-0.9319	10	0.87932	D	0	-9.8809	15.3932	0.74767	0.0:0.0:0.0:1.0	.	274	Q3SYC2	MOGT2_HUMAN	K	274;192	ENSP00000198801:I274K;ENSP00000436283:I192K	ENSP00000198801:I274K	I	+	2	0	MOGAT2	75117653	0.971000	0.33674	0.033000	0.17914	0.901000	0.52897	7.654000	0.83653	2.308000	0.77769	0.533000	0.62120	ATA	-	pfam_DAGAT		0.562	MOGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOGAT2	protein_coding	OTTHUMT00000383520.1	T	NM_025098	-		75440005	+1	no_errors	ENST00000198801	ensembl	human	known	74_37	missense	SNP	0.099	A
SIAE	54414	genome.wustl.edu	37	11	124543597	124543597	+	Missense_Mutation	SNP	G	G	A	rs144571829	byFrequency	TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr11:124543597G>A	ENST00000263593.3	-	1	180	c.8C>T	c.(7-9)gCg>gTg	p.A3V	SPA17_ENST00000532692.1_5'Flank|SIAE_ENST00000545756.1_5'UTR|SIAE_ENST00000525730.1_Intron|SPA17_ENST00000227135.2_5'Flank			Q9HAT2	SIAE_HUMAN	sialic acid acetylesterase	3			A -> G (rare variant found in a patient with Crohn disease; probably not involved in disease susceptibility; the mutant enzyme has normal activity and is normally secreted). {ECO:0000269|PubMed:20555325}.		carbohydrate metabolic process (GO:0005975)|regulation of immune system process (GO:0002682)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	sialate O-acetylesterase activity (GO:0001681)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	15	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0243)		AAGCCCCGGCGCGACCATGCT	0.697																																																	0								ENSG00000110013						24.0	27.0	26.0					11																	124543597		2198	4297	6495	SIAE	SO:0001583	missense	0			-	HGNC	AF300796	CCDS8449.1, CCDS55795.1	11q24	2005-12-15	2005-12-15	2005-12-15		ENSG00000110013			18187	protein-coding gene	gene with protein product	"""sialic acid-specific acetylesterase II"""	610079	"""Ysg2 homolog (mouse)"""	YSG2		10464298	Standard	NM_001199922		Approved	CSE-C, MGC87009, LSE	uc001qan.3	Q9HAT2		ENST00000263593.3:c.8C>T	11.37:g.124543597G>A	ENSP00000263593:p.Ala3Val	Somatic	0	232	0.00		0.6257302807660841	6	14.29	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	100	31.03	B3KPB0|Q8IUT9|Q9HAU7|Q9NT71	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF303_acetylest	p.A3V	ENST00000263593.3	37	c.8	CCDS8449.1	11	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663305	0.47572	.	.	ENSG00000110013	ENST00000263593	D	0.84070	-1.8	5.21	2.24	0.28232	.	1.004470	0.08013	N	0.990638	T	0.72930	0.3522	L	0.36672	1.1	0.20926	N	0.999821	B	0.11235	0.004	B	0.06405	0.002	T	0.55692	-0.8101	10	0.29301	T	0.29	-20.1632	4.7094	0.12865	0.1832:0.0:0.6444:0.1724	.	3	Q9HAT2	SIAE_HUMAN	V	3	ENSP00000263593:A3V	ENSP00000263593:A3V	A	-	2	0	SIAE	124048807	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.429000	0.21412	0.260000	0.21731	0.467000	0.42956	GCG	-	NULL		0.697	SIAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIAE	protein_coding	OTTHUMT00000387070.1	G	NM_170601	-		124543597	-1	no_errors	ENST00000263593	ensembl	human	known	74_37	missense	SNP	0.000	A
ZZZ3	26009	genome.wustl.edu	37	1	78030139	78030139	+	IGR	DEL	A	A	-			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr1:78030139delA	ENST00000370801.3	-	0	4328				ZZZ3_ENST00000476275.1_5'Flank	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3						chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						TAACACTGGTAAAAAAAAAAA	0.279																																																	0								ENSG00000036549																																			ZZZ3	SO:0001628	intergenic_variant	0				HGNC	AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652		1.37:g.78030139delA		Somatic	0	24	0.00		0.6257302807660841	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	17	26.09	B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370801.3	37	NULL	CCDS677.1	1																																																																																			-	-		0.279	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZZ3	protein_coding	OTTHUMT00000026615.1	A	NM_015534			78030139	-1	no_errors	ENST00000481346	ensembl	human	known	74_37	rna	DEL	0.000	-
ILVBL	10994	genome.wustl.edu	37	19	15234361	15234361	+	Silent	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr19:15234361G>A	ENST00000263383.3	-	3	301	c.162C>T	c.(160-162)ggC>ggT	p.G54G	AC003956.1_ENST00000598450.1_RNA|ILVBL_ENST00000531635.1_5'UTR|ILVBL_ENST00000534378.1_5'UTR	NM_006844.3	NP_006835.2	A1L0T0	ILVBL_HUMAN	ilvB (bacterial acetolactate synthase)-like	54						integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|thiamine pyrophosphate binding (GO:0030976)|transferase activity (GO:0016740)	p.G54G(1)		NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)	26						CGTTCTCTCCGCCATGCCGGA	0.627																																																	1	Substitution - coding silent(1)	endometrium(1)						ENSG00000105135						74.0	64.0	67.0					19																	15234361		2203	4300	6503	ILVBL	SO:0001819	synonymous_variant	0			-	HGNC	U61263	CCDS12325.1	19p13.1	2008-07-16			ENSG00000105135	ENSG00000105135			6041	protein-coding gene	gene with protein product	"""acetolactate synthase homolog"""	605770				8954801	Standard	NM_006844		Approved	209L8, AHAS, ILV2H, MGC1269, FLJ39061, MGC19535	uc002nam.3	A1L0T0	OTTHUMG00000165630	ENST00000263383.3:c.162C>T	19.37:g.15234361G>A		Somatic	0	36	0.00		0.6257302807660841	58	23.68	18	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	21	25.00	O43341|Q96F08|Q99651|Q9BWN5|Q9UEB2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Thiamin_PyroP_enz_TPP-bd_dom,pfam_TPP_enzyme-bd_C,pfam_Thiamin_PyroP_enz_cen_dom	p.G54	ENST00000263383.3	37	c.162	CCDS12325.1	19																																																																																			-	pfam_Thiamin_PyroP_enz_TPP-bd_dom		0.627	ILVBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILVBL	protein_coding	OTTHUMT00000385439.1	G	NM_006844	-		15234361	-1	no_errors	ENST00000263383	ensembl	human	known	74_37	silent	SNP	0.470	A
RTEL1	51750	genome.wustl.edu	37	20	62292822	62292824	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr20:62292822_62292824delGCT	ENST00000360203.5	+	3	599_601	c.274_276delGCT	c.(274-276)gctdel	p.A96del	RTEL1-TNFRSF6B_ENST00000482936.1_In_Frame_Del_p.A96del|RTEL1_ENST00000318100.4_In_Frame_Del_p.A96del|RTEL1_ENST00000508582.2_In_Frame_Del_p.A96del|RTEL1_ENST00000488316.1_3'UTR|RTEL1_ENST00000370018.3_In_Frame_Del_p.A96del					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			CTGGGGCAACGCTGCTGCTGCTG	0.645																																																	0								ENSG00000258366																																			RTEL1	SO:0001651	inframe_deletion	0				HGNC	AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.274_276delGCT	20.37:g.62292831_62292833delGCT	ENSP00000353332:p.Ala96del	Somatic	0	14	0.00		0.6257302807660841	11	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	15	11.76		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DEAD_2,superfamily_P-loop_NTPase,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.A95in_frame_del	ENST00000360203.5	37	c.274_276		20																																																																																			-	superfamily_P-loop_NTPase,smart_Helicase-like_DEXD_c2,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3		0.645	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	RTEL1	protein_coding	OTTHUMT00000289781.1	GCT	NM_032957			62292824	+1	no_errors	ENST00000318100	ensembl	human	known	74_37	in_frame_del	DEL	0.006:0.021:0.035	-
CENPO	79172	genome.wustl.edu	37	2	25016757	25016757	+	5'UTR	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr2:25016757C>T	ENST00000380834.2	+	0	394				PTRHD1_ENST00000328379.5_5'Flank|PTRHD1_ENST00000487316.1_5'Flank|CENPO_ENST00000260662.1_5'UTR|CENPO_ENST00000473706.1_Intron			Q9BU64	CENPO_HUMAN	centromere protein O						CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GTTGCCTAGACAACTTCATGG	0.522																																																	0								ENSG00000138092						108.0	102.0	104.0					2																	25016757		2203	4300	6503	CENPO	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AK027859	CCDS1714.1, CCDS56113.1	2p23.3	2013-11-05			ENSG00000138092	ENSG00000138092			28152	protein-coding gene	gene with protein product		611504				16622420, 16622419	Standard	NM_024322		Approved	MGC11266, CENP-O	uc002rfp.2	Q9BU64	OTTHUMG00000125525	ENST00000380834.2:c.-32C>T	2.37:g.25016757C>T		Somatic	0	67	0.00		0.6257302807660841	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	29	14.71	B2RDC0|D6W536|Q53T55|Q96JV3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000380834.2	37	NULL	CCDS1714.1	2																																																																																			-	-		0.522	CENPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPO	protein_coding	OTTHUMT00000246856.2	C	NM_024322	-		25016757	+1	no_errors	ENST00000473476	ensembl	human	putative	74_37	rna	SNP	0.001	T
GJA8	2703	genome.wustl.edu	37	1	147380140	147380140	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr1:147380140G>A	ENST00000369235.1	+	1	58	c.58G>A	c.(58-60)Gtc>Atc	p.V20I	GJA8_ENST00000240986.4_Missense_Mutation_p.V20I			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	20					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					GCACTCCACCGTCATCGGCAG	0.562																																					Melanoma(76;1255 1795 8195 52096)												0								ENSG00000121634						112.0	107.0	109.0					1																	147380140		2203	4300	6503	GJA8	SO:0001583	missense	0			-	HGNC	U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.58G>A	1.37:g.147380140G>A	ENSP00000358238:p.Val20Ile	Somatic	0	35	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	17	67.92	A7L5M5|Q5VVN9|Q9NP25	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Connexin_N,pfam_Connexin50,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin50	p.V20I	ENST00000369235.1	37	c.58	CCDS30834.1	1	.	.	.	.	.	.	.	.	.	.	g	19.76	3.887106	0.72410	.	.	ENSG00000121634	ENST00000240986;ENST00000369235	D;D	0.99105	-5.43;-5.43	5.03	4.12	0.48240	Connexin, N-terminal (1);	0.063532	0.64402	N	0.000008	D	0.98356	0.9454	L	0.58925	1.835	0.47819	D	0.99952	D	0.67145	0.996	P	0.60886	0.88	D	0.97715	1.0193	10	0.36615	T	0.2	.	13.6813	0.62487	0.0756:0.0:0.9244:0.0	.	20	P48165	CXA8_HUMAN	I	20	ENSP00000240986:V20I;ENSP00000358238:V20I	ENSP00000240986:V20I	V	+	1	0	GJA8	145846764	1.000000	0.71417	0.791000	0.31998	0.961000	0.63080	7.955000	0.87856	1.112000	0.41740	-0.194000	0.12790	GTC	-	pfam_Connexin_N		0.562	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJA8	protein_coding	OTTHUMT00000060647.1	G	NM_005267	-		147380140	+1	no_errors	ENST00000240986	ensembl	human	known	74_37	missense	SNP	0.995	A
VSIG10L	147645	genome.wustl.edu	37	19	51844468	51844468	+	Silent	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr19:51844468C>T	ENST00000335624.4	-	2	833	c.834G>A	c.(832-834)acG>acA	p.T278T	CTD-2616J11.16_ENST00000601148.1_RNA|CTD-2616J11.16_ENST00000594311.1_RNA	NM_001163922.1	NP_001157394.1	Q86VR7	VS10L_HUMAN	V-set and immunoglobulin domain containing 10 like	278						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)	4						TGACCTCAGCCGTGTAGACCC	0.672																																																	0								ENSG00000186806						17.0	25.0	23.0					19																	51844468		691	1590	2281	VSIG10L	SO:0001819	synonymous_variant	0			-	HGNC		CCDS54300.1	19q13.41	2013-01-11				ENSG00000186806		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27111	protein-coding gene	gene with protein product						12477932	Standard	NM_001163922		Approved		uc002pwf.3	Q86VR7		ENST00000335624.4:c.834G>A	19.37:g.51844468C>T		Somatic	0	72	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	82	18.00		Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T278	ENST00000335624.4	37	c.834	CCDS54300.1	19																																																																																			-	smart_Ig_sub		0.672	VSIG10L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VSIG10L	protein_coding	OTTHUMT00000464535.1	C	NM_001163922	-		51844468	-1	no_errors	ENST00000335624	ensembl	human	novel	74_37	silent	SNP	0.015	T
CHRNA7	1139	genome.wustl.edu	37	15	32460274	32460274	+	Missense_Mutation	SNP	C	C	T	rs374714000		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr15:32460274C>T	ENST00000306901.3	+	10	1221	c.1124C>T	c.(1123-1125)gCg>gTg	p.A375V	CHRNA7_ENST00000455693.2_Missense_Mutation_p.A194V|CHRNA7_ENST00000454250.3_Missense_Mutation_p.A404V	NM_000746.5	NP_000737.1	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7 (neuronal)	375				A -> G (in Ref. 1; CAA49778). {ECO:0000305}.	activation of MAPK activity (GO:0000187)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to ethanol (GO:0048149)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular calcium ion homeostasis (GO:0006874)|cognition (GO:0050890)|dopamine biosynthetic process (GO:0042416)|endocytosis (GO:0006897)|generation of ovulation cycle rhythm (GO:0060112)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|memory (GO:0007613)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of tumor necrosis factor production (GO:0032720)|neuronal action potential (GO:0019228)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate involved in baroreceptor response to decreased systemic arterial blood pressure (GO:0001988)|regulation of norepinephrine secretion (GO:0014061)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to food (GO:0032094)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|T cell activation (GO:0042110)	acetylcholine-gated channel complex (GO:0005892)|apical plasma membrane (GO:0016324)|asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|external side of plasma membrane (GO:0009897)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|acetylcholine-gated cation channel activity (GO:0022848)|beta-amyloid binding (GO:0001540)|chloride channel regulator activity (GO:0017081)|drug binding (GO:0008144)|protein homodimerization activity (GO:0042803)|toxic substance binding (GO:0015643)			endometrium(3)|large_intestine(1)|lung(6)|ovary(2)	12		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	AGCGCCGTGGCGCCGCCGCCC	0.701																																					Esophageal Squamous(193;529 2900 40232 43193)												0								ENSG00000175344	C	VAL/ALA,VAL/ALA	0,4390		0,0,2195	33.0	42.0	39.0		1124,1211	2.9	0.0	15		39	1,8591	1.2+/-3.3	0,1,4295	no	missense,missense	CHRNA7	NM_000746.4,NM_001190455.1	64,64	0,1,6490	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	375/503,404/532	32460274	1,12981	2195	4296	6491	CHRNA7	SO:0001583	missense	0			-	HGNC	Z23141	CCDS10027.1, CCDS53924.1	15q13.3	2012-02-11	2012-02-07		ENSG00000175344	ENSG00000175344		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1960	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 7 (neuronal)"""	118511	"""cholinergic receptor, nicotinic, alpha polypeptide 7"""			8188270	Standard	NM_001190455		Approved		uc021sic.2	P36544	OTTHUMG00000129285	ENST00000306901.3:c.1124C>T	15.37:g.32460274C>T	ENSP00000303727:p.Ala375Val	Somatic	0	108	0.00		0.6257302807660841	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	103	15.57	A8K7Q4|B4DFS0|Q15826|Q8IUZ4|Q96RH2|Q99555|Q9BXH0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.A404V	ENST00000306901.3	37	c.1211	CCDS10027.1	15	.	.	.	.	.	.	.	.	.	.	c	7.505	0.653377	0.14580	0.0	1.16E-4	ENSG00000175344	ENST00000437966;ENST00000454250;ENST00000306901;ENST00000455693	T;T;T	0.23348	1.91;1.91;1.91	3.84	2.87	0.33458	Neurotransmitter-gated ion-channel transmembrane domain (2);	1.080770	0.07165	N	0.851430	T	0.15435	0.0372	N	0.16266	0.395	0.09310	N	1	B;B	0.27316	0.0;0.175	B;B	0.29862	0.002;0.108	T	0.34700	-0.9818	10	0.22109	T	0.4	.	4.5623	0.12166	0.0:0.6413:0.2256:0.1331	.	404;375	B4DFS0;P36544	.;ACHA7_HUMAN	V	285;404;375;194	ENSP00000407546:A404V;ENSP00000303727:A375V;ENSP00000405989:A194V	ENSP00000303727:A375V	A	+	2	0	CHRNA7	30247566	0.948000	0.32251	0.004000	0.12327	0.198000	0.23893	2.960000	0.49161	1.115000	0.41800	0.650000	0.86243	GCG	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel		0.701	CHRNA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHRNA7	protein_coding	OTTHUMT00000251410.2	C		-		32460274	+1	no_errors	ENST00000454250	ensembl	human	known	74_37	missense	SNP	0.031	T
FAT1	2195	genome.wustl.edu	37	4	187539627	187539627	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr4:187539627C>A	ENST00000441802.2	-	10	8322	c.8113G>T	c.(8113-8115)Gaa>Taa	p.E2705*		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2705	Cadherin 25. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TAGAAAGGTTCTGAAAATTTT	0.418										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												0								ENSG00000083857						123.0	124.0	124.0					4																	187539627		1849	4087	5936	FAT1	SO:0001587	stop_gained	0			-	HGNC	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.8113G>T	4.37:g.187539627C>A	ENSP00000406229:p.Glu2705*	Somatic	0	31	0.00		0.6257302807660841	1	75.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	7	75.00		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.E2705*	ENST00000441802.2	37	c.8113	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	C	49	15.460513	0.99834	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	.	.	.	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	18.8402	0.92180	0.0:1.0:0.0:0.0	.	.	.	.	X	2705;2707	.	ENSP00000260147:E2707X	E	-	1	0	FAT1	187776621	1.000000	0.71417	0.988000	0.46212	0.433000	0.31745	7.651000	0.83577	2.757000	0.94681	0.655000	0.94253	GAA	-	superfamily_Cadherin-like,pfscan_Cadherin		0.418	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	protein_coding	OTTHUMT00000360209.3	C	NM_005245	-		187539627	-1	no_errors	ENST00000441802	ensembl	human	known	74_37	nonsense	SNP	1.000	A
SCN8A	6334	genome.wustl.edu	37	12	52159701	52159701	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr12:52159701C>T	ENST00000354534.6	+	16	2969	c.2791C>T	c.(2791-2793)Cga>Tga	p.R931*	SCN8A_ENST00000545061.1_Nonsense_Mutation_p.R931*|SCN8A_ENST00000550891.1_Nonsense_Mutation_p.R931*	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	931					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CATTGTCTTTCGAGTGTTGTG	0.493																																																	0								ENSG00000196876						225.0	228.0	227.0					12																	52159701		2202	4300	6502	SCN8A	SO:0001587	stop_gained	0			-	HGNC	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.2791C>T	12.37:g.52159701C>T	ENSP00000346534:p.Arg931*	Somatic	0	69	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	53	30.26	B9VWG8|O95788|Q9NYX2|Q9UPB2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.R931*	ENST00000354534.6	37	c.2791	CCDS44891.1	12	.	.	.	.	.	.	.	.	.	.	C	39	7.541727	0.98348	.	.	ENSG00000196876	ENST00000550891;ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961	.	.	.	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.6486	0.91421	0.0:1.0:0.0:0.0	.	.	.	.	X	931;931;931;931;844	.	ENSP00000346534:R931X	R	+	1	2	SCN8A	50445968	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.977000	0.40589	2.817000	0.96982	0.563000	0.77884	CGA	-	pfam_Ion_trans_dom		0.493	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	protein_coding	OTTHUMT00000404372.3	C	NM_014191	-		52159701	+1	no_errors	ENST00000354534	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ITGB7	3695	genome.wustl.edu	37	12	53585695	53585695	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr12:53585695C>T	ENST00000267082.5	-	15	2495	c.2264G>A	c.(2263-2265)cGc>cAc	p.R755H	ITGB7_ENST00000422257.3_Missense_Mutation_p.R755H|ITGB7_ENST00000550743.2_Missense_Mutation_p.R607H|ITGB7_ENST00000338737.4_Missense_Mutation_p.R607H	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	755					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GTATTCCCGGCGGTCATAGAT	0.597																																																	0								ENSG00000139626						58.0	59.0	59.0					12																	53585695		2203	4300	6503	ITGB7	SO:0001583	missense	0			-	HGNC		CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.2264G>A	12.37:g.53585695C>T	ENSP00000267082:p.Arg755His	Somatic	0	91	0.00		0.6257302807660841	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	68	20.00	Q9UCP7|Q9UCS7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt_dom,pfam_EGF_extracell,superfamily_Plexin-like_fold,superfamily_Integrin_bsu_tail,smart_Plexin-like_fold,smart_Integrin_bsu_N,prints_Integrin_bsu	p.R755H	ENST00000267082.5	37	c.2264	CCDS8849.1	12	.	.	.	.	.	.	.	.	.	.	C	26.3	4.722224	0.89298	.	.	ENSG00000139626	ENST00000422257;ENST00000267082;ENST00000338737	D;D;D	0.91124	-2.79;-2.79;-2.79	4.86	3.9	0.45041	Integrin beta subunit, cytoplasmic (2);	0.000000	0.43110	D	0.000619	D	0.94889	0.8348	M	0.83603	2.65	0.27666	N	0.946922	D	0.89917	1.0	D	0.77004	0.989	D	0.89123	0.3504	10	0.72032	D	0.01	.	13.1591	0.59535	0.1603:0.8397:0.0:0.0	.	755	P26010	ITB7_HUMAN	H	755;755;607	ENSP00000408741:R755H;ENSP00000267082:R755H;ENSP00000345501:R607H	ENSP00000267082:R755H	R	-	2	0	ITGB7	51871962	0.998000	0.40836	0.977000	0.42913	0.984000	0.73092	3.640000	0.54350	2.431000	0.82371	0.655000	0.94253	CGC	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_cyt_dom,prints_Integrin_bsu		0.597	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB7	protein_coding	OTTHUMT00000405821.2	C		-		53585695	-1	no_errors	ENST00000267082	ensembl	human	known	74_37	missense	SNP	0.996	T
SLC7A3	84889	genome.wustl.edu	37	X	70147136	70147136	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chrX:70147136G>A	ENST00000374299.3	-	8	1426	c.1282C>T	c.(1282-1284)Ctc>Ttc	p.L428F	SLC7A3_ENST00000298085.4_Missense_Mutation_p.L428F			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	428					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	TCTCACCTGAGGATGAGAACA	0.448																																																	0								ENSG00000165349						112.0	90.0	97.0					X																	70147136		2203	4300	6503	SLC7A3	SO:0001583	missense	0			-	HGNC	AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.1282C>T	X.37:g.70147136G>A	ENSP00000363417:p.Leu428Phe	Somatic	0	25	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	21	48.78	D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease	p.L428F	ENST00000374299.3	37	c.1282	CCDS14404.1	X	.	.	.	.	.	.	.	.	.	.	G	18.63	3.665709	0.67700	.	.	ENSG00000165349	ENST00000374299;ENST00000298085	T;T	0.57752	0.38;0.38	4.93	4.06	0.47325	Amino acid permease domain (1);	0.120078	0.56097	D	0.000022	T	0.76004	0.3927	M	0.93106	3.38	0.58432	D	0.999997	P	0.43909	0.821	P	0.60012	0.867	T	0.80672	-0.1278	10	0.87932	D	0	.	12.463	0.55743	0.0:0.0:0.8315:0.1685	.	428	Q8WY07	CTR3_HUMAN	F	428	ENSP00000363417:L428F;ENSP00000298085:L428F	ENSP00000298085:L428F	L	-	1	0	SLC7A3	70063861	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.492000	0.97957	1.058000	0.40530	0.529000	0.55759	CTC	-	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease		0.448	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A3	protein_coding	OTTHUMT00000057080.1	G	NM_032803	-		70147136	-1	no_errors	ENST00000298085	ensembl	human	known	74_37	missense	SNP	1.000	A
MYO1G	64005	genome.wustl.edu	37	7	45005706	45005706	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr7:45005706C>T	ENST00000258787.7	-	16	2259	c.2123G>A	c.(2122-2124)cGc>cAc	p.R708H		NM_033054.2	NP_149043.2	B0I1T2	MYO1G_HUMAN	myosin IG	708						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|skin(4)	28						GGGGATGAGGCGGGCTCGGCT	0.632																																																	0								ENSG00000136286						67.0	64.0	65.0					7																	45005706		2203	4300	6503	MYO1G	SO:0001583	missense	0			-	HGNC	AF380932	CCDS34629.1	7p13-p11.2	2011-09-27			ENSG00000136286	ENSG00000136286		"""Myosins / Myosin superfamily : Class I"""	13880	protein-coding gene	gene with protein product	"""minor histocompatibility antigen HA-2"""	600642					Standard	NM_033054		Approved	HA-2	uc003tmh.2	B0I1T2	OTTHUMG00000155821	ENST00000258787.7:c.2123G>A	7.37:g.45005706C>T	ENSP00000258787:p.Arg708His	Somatic	0	32	0.00		0.6257302807660841	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	9	43.75	Q8TEI9|Q8TES2|Q96BE2|Q96RI5|Q96RI6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.R708H	ENST00000258787.7	37	c.2123	CCDS34629.1	7	.	.	.	.	.	.	.	.	.	.	C	11.49	1.655067	0.29425	.	.	ENSG00000136286	ENST00000258787	T	0.73575	-0.76	4.69	0.588	0.17445	Myosin head, motor domain (1);	0.374933	0.19492	N	0.112963	T	0.62708	0.2450	L	0.43152	1.355	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.52881	-0.8516	10	0.48119	T	0.1	.	8.789	0.34839	0.0:0.469:0.0:0.531	.	708	B0I1T2	MYO1G_HUMAN	H	708	ENSP00000258787:R708H	ENSP00000258787:R708H	R	-	2	0	MYO1G	44972231	0.000000	0.05858	0.015000	0.15790	0.982000	0.71751	0.058000	0.14301	-0.124000	0.11724	-0.254000	0.11334	CGC	-	superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.632	MYO1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1G	protein_coding	OTTHUMT00000341832.2	C		-		45005706	-1	no_errors	ENST00000258787	ensembl	human	known	74_37	missense	SNP	0.001	T
PIM3	415116	genome.wustl.edu	37	22	50355434	50355434	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr22:50355434G>T	ENST00000360612.4	+	4	1026	c.591G>T	c.(589-591)aaG>aaT	p.K197N		NM_001001852.3	NP_001001852.2	Q86V86	PIM3_HUMAN	Pim-3 proto-oncogene, serine/threonine kinase	197	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|histone phosphorylation (GO:0016572)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)						all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.196)|LUAD - Lung adenocarcinoma(64;0.247)		CGCTGCTCAAGGACACGGTCT	0.662																																																	0								ENSG00000198355						28.0	26.0	27.0					22																	50355434		2203	4300	6503	PIM3	SO:0001583	missense	0			-	HGNC	BC052239	CCDS33678.1	22q13	2014-06-25	2014-06-25		ENSG00000198355	ENSG00000198355			19310	protein-coding gene	gene with protein product		610580	"""pim-3 oncogene"""			12477932	Standard	NM_001001852		Approved		uc003bjb.3	Q86V86	OTTHUMG00000150290	ENST00000360612.4:c.591G>T	22.37:g.50355434G>T	ENSP00000353824:p.Lys197Asn	Somatic	0	58	0.00		0.6257302807660841	45	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A5D8X8|A8K7J0|B1B0P0|Q68BM2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K197N	ENST00000360612.4	37	c.591	CCDS33678.1	22	.	.	.	.	.	.	.	.	.	.	g	11.21	1.570848	0.28003	.	.	ENSG00000198355	ENST00000360612	T	0.18657	2.2	3.23	-2.24	0.06909	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	U	0.000000	T	0.17619	0.0423	L	0.28400	0.85	0.53005	D	0.999965	D	0.58970	0.984	P	0.54924	0.764	T	0.19614	-1.0300	10	0.87932	D	0	.	2.1105	0.03702	0.1864:0.1511:0.5072:0.1552	.	197	Q86V86	PIM3_HUMAN	N	197	ENSP00000353824:K197N	ENSP00000353824:K197N	K	+	3	2	PIM3	48741438	1.000000	0.71417	0.231000	0.23993	0.001000	0.01503	3.328000	0.52052	-0.634000	0.05538	-1.074000	0.02243	AAG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.662	PIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIM3	protein_coding	OTTHUMT00000317406.1	G	NM_001001852	-		50355434	+1	no_errors	ENST00000360612	ensembl	human	known	74_37	missense	SNP	1.000	T
DSC1	1823	genome.wustl.edu	37	18	28711868	28711868	+	Intron	DEL	T	T	-			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr18:28711868delT	ENST00000257198.5	-	15	2500				DSC1_ENST00000257197.3_Intron|RP11-408H20.2_ENST00000581836.1_RNA|RP11-408H20.3_ENST00000582307.1_RNA	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1						homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			TTCATTTTCATTTTTTTTCac	0.348																																																	0								ENSG00000263698																																			RP11-408H20.3	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.2239-63A>-	18.37:g.28711868delT		Somatic	0	28	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	Q9HB01	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000257198.5	37	NULL	CCDS11894.1	18																																																																																			-	-		0.348	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000263698	protein_coding	OTTHUMT00000254946.1	T	NM_004948, NM_024421			28711868	+1	no_errors	ENST00000582307	ensembl	human	known	74_37	rna	DEL	0.072	-
KIAA0355	9710	genome.wustl.edu	37	19	34838875	34838875	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr19:34838875A>T	ENST00000299505.6	+	11	3488	c.2615A>T	c.(2614-2616)aAc>aTc	p.N872I	AC010504.2_ENST00000591311.1_RNA	NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	872										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					CGGCCAGGCAACCCCCGGGGC	0.637																																																	0								ENSG00000166398						40.0	41.0	41.0					19																	34838875		2203	4300	6503	KIAA0355	SO:0001583	missense	0			-	HGNC		CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.2615A>T	19.37:g.34838875A>T	ENSP00000299505:p.Asn872Ile	Somatic	0	39	0.00		0.6257302807660841	25	7.14	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	30	26.19	Q2M3W4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.N872I	ENST00000299505.6	37	c.2615	CCDS12436.1	19	.	.	.	.	.	.	.	.	.	.	A	27.3	4.818388	0.90790	.	.	ENSG00000166398	ENST00000299505	.	.	.	6.06	6.06	0.98353	.	0.149689	0.64402	D	0.000016	T	0.33089	0.0851	L	0.27053	0.805	0.53688	D	0.999973	P	0.42203	0.773	B	0.37304	0.246	T	0.28364	-1.0046	9	0.87932	D	0	-40.8057	8.6722	0.34156	0.8022:0.1306:0.0672:0.0	.	872	O15063	K0355_HUMAN	I	872	.	ENSP00000299505:N872I	N	+	2	0	KIAA0355	39530715	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.700000	0.61803	2.324000	0.78689	0.533000	0.62120	AAC	-	NULL		0.637	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0355	protein_coding	OTTHUMT00000451678.4	A	NM_014686	-		34838875	+1	no_errors	ENST00000299505	ensembl	human	known	74_37	missense	SNP	1.000	T
RGS3	5998	genome.wustl.edu	37	9	116359104	116359104	+	Silent	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr9:116359104G>A	ENST00000374140.2	+	26	3677	c.3468G>A	c.(3466-3468)acG>acA	p.T1156T	RGS3_ENST00000350696.5_Silent_p.T1156T|RGS3_ENST00000343817.5_Silent_p.T875T|RGS3_ENST00000342620.5_Silent_p.T126T|RGS3_ENST00000394646.3_Silent_p.T549T|RGS3_ENST00000374134.3_Silent_p.T477T|RGS3_ENST00000462403.1_Silent_p.T269T|RGS3_ENST00000462143.1_Silent_p.T477T	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3	1156	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						AGAGCGTCACGCGGGGCTGCT	0.607																																																	0								ENSG00000138835						136.0	106.0	116.0					9																	116359104		2203	4300	6503	RGS3	SO:0001819	synonymous_variant	0			-	HGNC	AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.3468G>A	9.37:g.116359104G>A		Somatic	0	72	0.00		0.6257302807660841	232	1.28	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	77	17.20	A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RGS_dom,pfam_C2_dom,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_C2_dom,superfamily_PDZ,smart_C2_dom,smart_PDZ,smart_Regulat_G_prot_signal_superfam,pfscan_C2_dom,pfscan_PDZ,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.T1156	ENST00000374140.2	37	c.3468	CCDS43869.1	9																																																																																			-	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam		0.607	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS3	protein_coding	OTTHUMT00000055561.3	G	NM_017790	-		116359104	+1	no_errors	ENST00000350696	ensembl	human	known	74_37	silent	SNP	0.345	A
AQP12B	653437	genome.wustl.edu	37	2	241622006	241622006	+	Silent	SNP	G	G	A	rs373980987		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr2:241622006G>A	ENST00000407834.3	-	1	311	c.249C>T	c.(247-249)caC>caT	p.H83H		NM_001102467.1	NP_001095937.1	A6NM10	AQ12B_HUMAN	aquaporin 12B	71						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|lung(8)|ovary(1)	13		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		AGGTGACCCCGTGCGCCAGGA	0.677																																																	0								ENSG00000185176			0,4406		0,0,2203	50.0	51.0	51.0		249	0.1	0.6	2		51	1,8599		0,1,4299	no	coding-synonymous	AQP12B	NM_001102467.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		83/308	241622006	1,13005	2203	4300	6503	AQP12B	SO:0001819	synonymous_variant	0			-	HGNC	BC041460	CCDS46560.1	2q37.3	2007-12-14	2005-05-26	2005-05-26	ENSG00000185176	ENSG00000185176		"""Ion channels / Aquaporins"""	6096	protein-coding gene	gene with protein product			"""insulin synthesis associated 3"""	INSSA3			Standard	NM_001102467		Approved		uc010fzj.3	A6NM10	OTTHUMG00000152263	ENST00000407834.3:c.249C>T	2.37:g.241622006G>A		Somatic	0	127	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	88	22.12	A4QPB9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MIP,superfamily_Aquaporin-like,pirsf_Aquaporin_11/12,prints_Aquaporin_12,prints_MIP	p.H83	ENST00000407834.3	37	c.249	CCDS46560.1	2																																																																																			-	pfam_MIP,superfamily_Aquaporin-like,pirsf_Aquaporin_11/12,prints_MIP		0.677	AQP12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP12B	protein_coding	OTTHUMT00000325625.1	G		-		241622006	-1	no_errors	ENST00000407834	ensembl	human	known	74_37	silent	SNP	0.972	A
HAPLN1	1404	genome.wustl.edu	37	5	82940427	82940427	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr5:82940427G>A	ENST00000274341.4	-	4	1380	c.530C>T	c.(529-531)gCg>gTg	p.A177V		NM_001884.3	NP_001875.1	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	177	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|liver(1)|lung(15)|ovary(1)|prostate(1)|skin(1)	34		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)	Hyaluronan(DB08818)	CGCCTGCTGCGCCTCGTGAAA	0.582																																																	0								ENSG00000145681						38.0	36.0	37.0					5																	82940427		2203	4300	6503	HAPLN1	SO:0001583	missense	0			-	HGNC		CCDS4061.1	5q14.3	2013-01-11	2004-03-16	2004-03-17	ENSG00000145681	ENSG00000145681		"""Immunoglobulin superfamily / V-set domain containing"""	2380	protein-coding gene	gene with protein product	"""Cartilage link protein"", ""hyaluronan and proteoglycan link protein 1"""	115435	"""cartilage linking protein 1"""	CRTL1		2286376, 2320422	Standard	NM_001884		Approved		uc003kin.3	P10915	OTTHUMG00000119045	ENST00000274341.4:c.530C>T	5.37:g.82940427G>A	ENSP00000274341:p.Ala177Val	Somatic	0	41	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	38	29.63	B2R9A9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Link,pfam_Ig_V-set,superfamily_C-type_lectin_fold,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,pfscan_Link,pfscan_Ig-like_dom,prints_Link	p.A177V	ENST00000274341.4	37	c.530	CCDS4061.1	5	.	.	.	.	.	.	.	.	.	.	G	33	5.268298	0.95429	.	.	ENSG00000145681	ENST00000274341;ENST00000510978;ENST00000508307;ENST00000503117	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	5.8	5.8	0.92144	C-type lectin fold (1);Link (4);C-type lectin-like (1);	0.000000	0.85682	D	0.000000	T	0.82024	0.4947	H	0.97918	4.105	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88221	0.2897	10	0.87932	D	0	.	20.0608	0.97674	0.0:0.0:1.0:0.0	.	177	P10915	HPLN1_HUMAN	V	177;177;177;176	ENSP00000274341:A177V;ENSP00000422592:A177V;ENSP00000421341:A177V;ENSP00000426610:A176V	ENSP00000274341:A177V	A	-	2	0	HAPLN1	82976183	1.000000	0.71417	0.968000	0.41197	0.636000	0.38137	9.476000	0.97823	2.733000	0.93635	0.650000	0.86243	GCG	-	pfam_Link,superfamily_C-type_lectin_fold,smart_Link,pfscan_Link,prints_Link		0.582	HAPLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAPLN1	protein_coding	OTTHUMT00000239256.2	G	NM_001884	-		82940427	-1	no_errors	ENST00000274341	ensembl	human	known	74_37	missense	SNP	1.000	A
FAM86B3P	286042	genome.wustl.edu	37	8	8092059	8092059	+	IGR	SNP	A	A	G			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr8:8092059A>G								FAM85B (7923 upstream) : ALG1L13P (3136 downstream)																							GCTGGCGGAGACCCTGATGGC	0.592																																																	0								ENSG00000173295																																			FAM86B3P	SO:0001628	intergenic_variant	0			-	HGNC																													8.37:g.8092059A>G		Somatic	0	216	0.00		0.6257302807660841	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	199	16.32		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		8																																																																																			-	-	0	0.592					FAM86B3P			A		-		8092059	+1	no_errors	ENST00000522601	ensembl	human	known	74_37	rna	SNP	0.354	G
ABCA12	26154	genome.wustl.edu	37	2	215940283	215940284	+	Intron	INS	-	-	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr2:215940283_215940284insA	ENST00000272895.7	-	3	383				ABCA12_ENST00000412081.1_Frame_Shift_Ins_p.S74fs	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12						cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		atttatGCAGGAAAAAAAAAAA	0.376																																					Ovarian(66;664 1488 5121 34295)												0								ENSG00000144452																																			ABCA12	SO:0001627	intron_variant	0				HGNC	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.164-11341->T	2.37:g.215940294_215940294dupA		Somatic	0	36	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	29	9.38	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.S74fs	ENST00000272895.7	37	c.221_220	CCDS33372.1	2																																																																																			-	NULL		0.376	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	protein_coding	OTTHUMT00000337111.1	-	NM_173076			215940284	-1	no_errors	ENST00000412081	ensembl	human	novel	74_37	frame_shift_ins	INS	0.094:0.082	A
ITPR2	3709	genome.wustl.edu	37	12	26592165	26592165	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr12:26592165C>A	ENST00000381340.3	-	47	6954	c.6538G>T	c.(6538-6540)Gtg>Ttg	p.V2180L		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2180					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	GTATTGAACACACGGCACTTG	0.383																																																	0								ENSG00000123104						164.0	151.0	155.0					12																	26592165		1867	4114	5981	ITPR2	SO:0001583	missense	0			-	HGNC	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.6538G>T	12.37:g.26592165C>A	ENSP00000370744:p.Val2180Leu	Somatic	0	57	0.00		0.6257302807660841	6	14.29	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	26	42.22	O94773	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.V2180L	ENST00000381340.3	37	c.6538	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	C	15.73	2.920640	0.52653	.	.	ENSG00000123104	ENST00000381340	D	0.91740	-2.9	5.52	4.61	0.57282	.	0.000000	0.85682	D	0.000000	D	0.89476	0.6726	M	0.72894	2.215	0.80722	D	1	B	0.15473	0.013	B	0.20184	0.028	T	0.82436	-0.0458	10	0.15066	T	0.55	.	11.0159	0.47689	0.0:0.8586:0.0:0.1414	.	2180	Q14571	ITPR2_HUMAN	L	2180	ENSP00000370744:V2180L	ENSP00000370744:V2180L	V	-	1	0	ITPR2	26483432	1.000000	0.71417	0.966000	0.40874	0.952000	0.60782	4.814000	0.62627	2.873000	0.98535	0.563000	0.77884	GTG	-	NULL		0.383	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	protein_coding	OTTHUMT00000402732.1	C	NM_002223	-		26592165	-1	no_errors	ENST00000381340	ensembl	human	known	74_37	missense	SNP	0.996	A
UTP3	57050	genome.wustl.edu	37	4	71554691	71554693	+	In_Frame_Del	DEL	GGA	GGA	-	rs146575538|rs61104402	byFrequency	TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	GGA	GGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr4:71554691_71554693delGGA	ENST00000254803.2	+	1	496_498	c.297_299delGGA	c.(295-300)ggggag>ggg	p.E105del		NM_020368.2	NP_065101.1	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)	105	Glu-rich.				brain development (GO:0007420)|chromatin modification (GO:0016568)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(4)	18			Lung(101;0.235)			ggaatgcgggggaggaggaggag	0.576														35	0.00698882	0.0197	0.0043	5008	,	,		23033	0.002		0.001	False		,,,				2504	0.0031																0								ENSG00000132467			0,251,4015		0,0,0,0,251,1882						-0.6	0.0		dbSNP_134	50	1,543,7710		0,0,1,6,531,3589	no	codingComplex	UTP3	NM_020368.2		0,0,1,6,782,5471	A1A1,A1A2,A1R,A2A2,A2R,RR		6.5907,5.8837,6.3498				1,794,11725				UTP3	SO:0001651	inframe_deletion	0				HGNC	AL136590	CCDS3546.1	4q13.3	2008-02-05			ENSG00000132467	ENSG00000132467			24477	protein-coding gene	gene with protein product	"""disrupter of silencing 10"""	611614				12477932	Standard	NM_020368		Approved	FLJ23256, DKFZp761F222, SAS10, CRLZ1	uc003hfo.3	Q9NQZ2	OTTHUMG00000129911	ENST00000254803.2:c.297_299delGGA	4.37:g.71554700_71554702delGGA	ENSP00000254803:p.Glu105del	Somatic	0	38	0.00		0.6257302807660841	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	Q6FI82	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Sas10_C_dom,pfam_Sas10/Utp3/C1D	p.E103in_frame_del	ENST00000254803.2	37	c.297_299	CCDS3546.1	4																																																																																			-	NULL		0.576	UTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP3	protein_coding	OTTHUMT00000252163.2	GGA	NM_020368			71554693	+1	no_errors	ENST00000254803	ensembl	human	known	74_37	in_frame_del	DEL	0.002:0.002:0.002	-
KCNH2	3757	genome.wustl.edu	37	7	150642533	150642533	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr7:150642533G>A	ENST00000262186.5	-	15	3801	c.3400C>T	c.(3400-3402)Cga>Tga	p.R1134*	KCNH2_ENST00000392968.2_Nonsense_Mutation_p.R1038*|KCNH2_ENST00000330883.4_Nonsense_Mutation_p.R794*	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	1134					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	GAGAGGCGTCGTGTGGGGCCT	0.677																																					GBM(137;110 1844 13671 20123 45161)												0			GRCh37	CD057243	KCNH2	D		ENSG00000055118						9.0	10.0	10.0					7																	150642533		2161	4248	6409	KCNH2	SO:0001587	stop_gained	0			-	HGNC	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.3400C>T	7.37:g.150642533G>A	ENSP00000262186:p.Arg1134*	Somatic	0	40	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	32	50.00	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_cNMP-bd_dom,pfam_PAS_fold,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.R1134*	ENST00000262186.5	37	c.3400	CCDS5910.1	7	.	.	.	.	.	.	.	.	.	.	G	43	10.163859	0.99350	.	.	ENSG00000055118	ENST00000330883;ENST00000392968;ENST00000262186	.	.	.	5.09	4.2	0.49525	.	0.000000	0.52532	D	0.000072	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.807	0.46524	0.0:0.0:0.8105:0.1895	.	.	.	.	X	794;1038;1134	.	ENSP00000262186:R1134X	R	-	1	2	KCNH2	150273466	0.930000	0.31532	0.989000	0.46669	0.430000	0.31655	2.525000	0.45598	1.111000	0.41721	0.557000	0.71058	CGA	-	NULL		0.677	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH2	protein_coding	OTTHUMT00000350741.2	G	NM_000238	-		150642533	-1	no_errors	ENST00000262186	ensembl	human	known	74_37	nonsense	SNP	0.996	A
AASDHPPT	60496	genome.wustl.edu	37	11	105967630	105967630	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr11:105967630C>T	ENST00000278618.4	+	6	1148	c.926C>T	c.(925-927)tCa>tTa	p.S309L	RP11-677I18.3_ENST00000532422.1_RNA|RP11-677I18.3_ENST00000527594.1_RNA	NM_015423.2	NP_056238.2	Q9NRN7	ADPPT_HUMAN	aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase	309				TKS -> YKVMMIP (in Ref. 4; AAG49439). {ECO:0000305}.	macromolecule biosynthetic process (GO:0009059)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	holo-[acyl-carrier-protein] synthase activity (GO:0008897)|magnesium ion binding (GO:0000287)			endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)	17		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.78e-05)|Epithelial(105;0.00622)|all cancers(92;0.041)		GGTACAAAGTCATGATGATTC	0.353																																																	0								ENSG00000149313						59.0	51.0	54.0					11																	105967630		2200	4298	6498	AASDHPPT	SO:0001583	missense	0			-	HGNC	AF302110	CCDS31664.1	11q22	2010-12-09			ENSG00000149313	ENSG00000149313	1.2.1.31		14235	protein-coding gene	gene with protein product		607756				12815048, 11286508	Standard	NM_015423		Approved	LYS5, CGI-80, AASD-PPT	uc001pjc.1	Q9NRN7	OTTHUMG00000166253	ENST00000278618.4:c.926C>T	11.37:g.105967630C>T	ENSP00000278618:p.Ser309Leu	Somatic	0	25	0.00		0.6257302807660841	15	28.57	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	11	38.89	B2R6D1|B4DDW7|Q9C068|Q9P0Q3|Q9UG80|Q9Y389	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_4-PPantetheinyl_Trfase_SF,superfamily_4-PPantetheinyl_Trfase_SF	p.S309L	ENST00000278618.4	37	c.926	CCDS31664.1	11	.	.	.	.	.	.	.	.	.	.	C	16.10	3.026666	0.54683	.	.	ENSG00000149313	ENST00000278618	.	.	.	5.71	3.83	0.44106	.	0.520959	0.20445	N	0.092219	T	0.29321	0.0730	N	0.24115	0.695	0.26347	N	0.977262	B	0.09022	0.002	B	0.04013	0.001	T	0.27606	-1.0069	9	0.87932	D	0	.	10.7831	0.46390	0.0:0.8485:0.0:0.1515	.	309	Q9NRN7	ADPPT_HUMAN	L	309	.	ENSP00000278618:S309L	S	+	2	0	AASDHPPT	105472840	1.000000	0.71417	1.000000	0.80357	0.211000	0.24417	1.974000	0.40559	1.419000	0.47118	0.650000	0.86243	TCA	-	NULL		0.353	AASDHPPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AASDHPPT	protein_coding	OTTHUMT00000388734.1	C	NM_015423	-		105967630	+1	no_errors	ENST00000278618	ensembl	human	known	74_37	missense	SNP	1.000	T
MEGF9	1955	genome.wustl.edu	37	9	123476543	123476548	+	In_Frame_Del	DEL	CGGCGG	CGGCGG	-	rs200946879|rs369989873	byFrequency	TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	CGGCGG	CGGCGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr9:123476543_123476548delCGGCGG	ENST00000373930.3	-	1	200_205	c.89_94delCCGCCG	c.(88-96)gccgccgtc>gtc	p.AA30del	MEGF9_ENST00000426959.1_In_Frame_Del_p.AA22del	NM_001080497.2	NP_001073966.2	Q9H1U4	MEGF9_HUMAN	multiple EGF-like-domains 9	30	Ala-rich.					integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	16						gctgaggcgacggcggcggcggcggc	0.782														3349	0.66873	0.6044	0.7637	5008	,	,		7106	0.5853		0.7058	False		,,,				2504	0.7362																0								ENSG00000106780			26,6		13,0,3						2.8	0.2		dbSNP_119	1	80,32		39,2,15	no	coding	MEGF9	NM_001080497.2		52,2,18	A1A1,A1R,RR		28.5714,18.75,26.3889				106,38				MEGF9	SO:0001651	inframe_deletion	0				HGNC	AB011542	CCDS48010.1, CCDS48010.2	9q32-q33.3	2008-07-21	2006-03-31	2006-03-31	ENSG00000106780	ENSG00000106780			3234	protein-coding gene	gene with protein product		604268	"""EGF-like-domain, multiple 5"""	EGFL5		9693030	Standard	NM_001080497		Approved		uc022bms.1	Q9H1U4	OTTHUMG00000021039	ENST00000373930.3:c.89_94delCCGCCG	9.37:g.123476549_123476554delCGGCGG	ENSP00000363040:p.Ala30_Ala31del	Somatic	NA	NA	NA		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B7Z315|O75098	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,smart_EGF_laminin,smart_EG-like_dom,pfscan_EGF_laminin	p.AA22in_frame_del	ENST00000373930.3	37	c.70_65	CCDS48010.2	9																																																																																			-	NULL		0.782	MEGF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF9	protein_coding	OTTHUMT00000055513.1	CGGCGG	NM_001080497			123476548	-1	no_errors	ENST00000426959	ensembl	human	known	74_37	in_frame_del	DEL	0.255:0.243:0.247:0.263:0.993:0.998	-
ANKRD30BP2	149992	genome.wustl.edu	37	21	14410709	14410709	+	RNA	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr21:14410709C>T	ENST00000507941.1	+	0	59									ankyrin repeat domain 30B pseudogene 2																		ATGAAGAAGACGACAATGGAC	0.572																																																	0								ENSG00000224309																																			ANKRD30BP2			0			-	HGNC	AF427490		21q11.2	2010-06-14	2010-06-14	2010-06-14	ENSG00000224309	ENSG00000224309			16620	pseudogene	pseudogene	"""cancer/testis antigen 85"""		"""chromosome 21 open reading frame 99"""	C21orf99		12036297, 17114284	Standard	NR_026916		Approved	CT85, CTSP-1	uc002yja.4		OTTHUMG00000074164		21.37:g.14410709C>T		Somatic	0	127	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	93	16.22		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000507941.1	37	NULL		21																																																																																			-	-		0.572	ANKRD30BP2-004	KNOWN	basic	processed_transcript	ANKRD30BP2	pseudogene	OTTHUMT00000372094.1	C	NR_026916	-		14410709	+1	no_errors	ENST00000507941	ensembl	human	known	74_37	rna	SNP	0.000	T
TAF7L	54457	genome.wustl.edu	37	X	100531414	100531419	+	In_Frame_Del	DEL	TCATCC	TCATCC	-	rs377399072|rs199759165		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	TCATCC	TCATCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chrX:100531414_100531419delTCATCC	ENST00000372907.3	-	10	1058_1063	c.1047_1052delGGATGA	c.(1045-1053)gaggatgaa>gaa	p.349_351EDE>E	TAF7L_ENST00000324762.6_Intron|TAF7L_ENST00000356784.1_In_Frame_Del_p.263_265EDE>E|TAF7L_ENST00000372905.2_Intron	NM_024885.3	NP_079161.3	Q5H9L4	TAF7L_HUMAN	TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa	349	Glu-rich.		Missing. {ECO:0000269|PubMed:11279525, ECO:0000269|PubMed:16597641, ECO:0000269|PubMed:17714218}.		cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIID complex (GO:0005669)				NS(1)|breast(4)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						GTCTtcatcttcatcctcatcctcat	0.422														459	0.121589	0.084	0.0893	3775	,	,		14668	0.0317		0.1759	False		,,,				2504	0.0787				Ovarian(104;431 1530 3210 15406 18594)												0								ENSG00000102387																																			TAF7L	SO:0001651	inframe_deletion	0				HGNC	AF285595	CCDS35347.1, CCDS55466.1	Xq22.1	2009-03-25	2002-08-29	2001-12-07	ENSG00000102387	ENSG00000102387			11548	protein-coding gene	gene with protein product	"""cancer/testis antigen 40"""	300314	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, Q"""	TAF2Q		11279525	Standard	NM_024885		Approved	CT40	uc004ehb.3	Q5H9L4	OTTHUMG00000022021	ENST00000372907.3:c.1047_1052delGGATGA	X.37:g.100531420_100531425delTCATCC	ENSP00000361998:p.Glu353_Asp354del	Somatic	NA	NA	NA		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5H9L6|Q86XI4|Q9BXU5|Q9H5R0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_TAFII55_prot_cons_reg	p.ED353in_frame_del	ENST00000372907.3	37	c.1052_1047	CCDS35347.1	X																																																																																			-	NULL		0.422	TAF7L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TAF7L	protein_coding	OTTHUMT00000057526.2	TCATCC				100531419	-1	no_errors	ENST00000372907	ensembl	human	known	74_37	in_frame_del	DEL	0.002:0.004:0.000:0.078:0.088:0.000	-
SHANK1	50944	genome.wustl.edu	37	19	51201120	51201120	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr19:51201120C>T	ENST00000293441.1	-	12	1859	c.1841G>A	c.(1840-1842)cGc>cAc	p.R614H	SHANK1_ENST00000359082.3_Missense_Mutation_p.R614H|SHANK1_ENST00000391814.1_Missense_Mutation_p.R614H	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	614					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		CTCCTGAGAGCGATTCGCCAC	0.572																																																	0								ENSG00000161681						84.0	73.0	77.0					19																	51201120		2203	4300	6503	SHANK1	SO:0001583	missense	0			-	HGNC	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.1841G>A	19.37:g.51201120C>T	ENSP00000293441:p.Arg614His	Somatic	0	78	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	78	24.27	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SH3_2,pfam_SAM_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SH3_domain,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.R614H	ENST00000293441.1	37	c.1841	CCDS12799.1	19	.	.	.	.	.	.	.	.	.	.	C	10.45	1.352798	0.24512	.	.	ENSG00000161681	ENST00000293441;ENST00000359082;ENST00000391814	T;T;T	0.13901	2.55;2.55;2.55	3.27	3.27	0.37495	Src homology-3 domain (1);	0.351137	0.21186	U	0.078724	T	0.19046	0.0457	L	0.42245	1.32	0.09310	N	0.999998	D	0.71674	0.998	P	0.57009	0.811	T	0.03922	-1.0992	10	0.87932	D	0	-24.5534	5.2959	0.15752	0.0:0.7553:0.0:0.2447	.	614	Q9Y566	SHAN1_HUMAN	H	614	ENSP00000293441:R614H;ENSP00000351984:R614H;ENSP00000375690:R614H	ENSP00000293441:R614H	R	-	2	0	SHANK1	55892932	0.708000	0.27876	0.998000	0.56505	0.696000	0.40369	1.102000	0.31050	1.836000	0.53414	0.457000	0.33378	CGC	-	superfamily_SH3_domain		0.572	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHANK1	protein_coding	OTTHUMT00000268071.1	C	NM_016148	-		51201120	-1	no_errors	ENST00000391814	ensembl	human	known	74_37	missense	SNP	0.109	T
TOX2	84969	genome.wustl.edu	37	20	42635240	42635240	+	Silent	SNP	A	A	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr20:42635240A>T	ENST00000358131.5	+	3	454	c.246A>T	c.(244-246)acA>acT	p.T82T	TOX2_ENST00000423191.2_Silent_p.T31T|RN7SL443P_ENST00000464331.2_RNA|TOX2_ENST00000372999.1_Silent_p.T31T|TOX2_ENST00000341197.4_Silent_p.T73T	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	82	Required for transcriptional activation. {ECO:0000250}.				female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			CCCCGATAACACCTCCCAACC	0.592																																																	0								ENSG00000124191						176.0	141.0	153.0					20																	42635240		2203	4300	6503	TOX2	SO:0001819	synonymous_variant	0			-	HGNC	BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.246A>T	20.37:g.42635240A>T		Somatic	0	58	0.00		0.6257302807660841	4	42.86	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	31	36.73	A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.T73	ENST00000358131.5	37	c.219	CCDS42875.1	20																																																																																			-	NULL		0.592	TOX2-001	KNOWN	basic|CCDS	protein_coding	TOX2	protein_coding	OTTHUMT00000079329.2	A		-		42635240	+1	no_errors	ENST00000341197	ensembl	human	known	74_37	silent	SNP	0.963	T
OR2V2	285659	genome.wustl.edu	37	5	180582017	180582017	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr5:180582017C>A	ENST00000328275.1	+	1	75	c.75C>A	c.(73-75)gaC>gaA	p.D25E		NM_206880.1	NP_996763.1	Q96R30	OR2V2_HUMAN	olfactory receptor, family 2, subfamily V, member 2	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTACTGCTGACCTTGTCCTCT	0.547																																																	0								ENSG00000182613						275.0	222.0	240.0					5																	180582017		2203	4300	6503	OR2V2	SO:0001583	missense	0			-	HGNC	AL161615	CCDS4461.1	5q35.3	2012-08-09			ENSG00000182613	ENSG00000182613		"""GPCR / Class A : Olfactory receptors"""	15341	protein-coding gene	gene with protein product				OR2V3			Standard	NM_206880		Approved	OST713	uc011dhj.2	Q96R30	OTTHUMG00000130933	ENST00000328275.1:c.75C>A	5.37:g.180582017C>A	ENSP00000332185:p.Asp25Glu	Somatic	0	76	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	62	29.55	Q6IFL6|Q8NGV1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D25E	ENST00000328275.1	37	c.75	CCDS4461.1	5	.	.	.	.	.	.	.	.	.	.	.	9.244	1.039021	0.19669	.	.	ENSG00000182613	ENST00000328275	T	0.00424	7.45	3.38	-6.75	0.01738	.	0.000000	0.38778	N	0.001580	T	0.00241	0.0007	N	0.02142	-0.665	0.09310	N	1	D	0.64830	0.994	D	0.72625	0.978	T	0.46484	-0.9188	10	0.05833	T	0.94	.	13.4866	0.61369	0.0:0.1345:0.0:0.8655	.	25	Q96R30	OR2V2_HUMAN	E	25	ENSP00000332185:D25E	ENSP00000332185:D25E	D	+	3	2	OR2V2	180514623	0.000000	0.05858	0.003000	0.11579	0.386000	0.30323	-2.033000	0.01425	-1.823000	0.01210	0.305000	0.20034	GAC	-	NULL		0.547	OR2V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2V2	protein_coding	OTTHUMT00000253529.1	C		-		180582017	+1	no_errors	ENST00000328275	ensembl	human	known	74_37	missense	SNP	0.000	A
DRAM2	128338	genome.wustl.edu	37	1	111674157	111674157	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr1:111674157C>A	ENST00000286692.4	-	3	637	c.20G>T	c.(19-21)gGc>gTc	p.G7V	DRAM2_ENST00000539140.1_Missense_Mutation_p.G7V|DRAM2_ENST00000484310.1_5'UTR			Q6UX65	DRAM2_HUMAN	DNA-damage regulated autophagy modulator 2	7					apoptotic process (GO:0006915)|regulation of autophagy (GO:0010506)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|microtubule cytoskeleton (GO:0015630)				endometrium(1)|large_intestine(5)|lung(3)	9						GAAACTGAGGCCTTGCTGAAA	0.388																																																	0								ENSG00000156171						122.0	121.0	122.0					1																	111674157		2203	4300	6503	DRAM2	SO:0001583	missense	0			-	HGNC	AY336747	CCDS30801.1	1p13.3	2010-07-08	2009-06-12	2009-06-12	ENSG00000156171	ENSG00000156171			28769	protein-coding gene	gene with protein product		613360	"""transmembrane protein 77"""	TMEM77		12975309	Standard	NM_178454		Approved	MGC54289, PRO180, WWFQ154, RP5-1180E21.1	uc001ead.4	Q6UX65	OTTHUMG00000011911	ENST00000286692.4:c.20G>T	1.37:g.111674157C>A	ENSP00000286692:p.Gly7Val	Somatic	0	58	0.00		0.6257302807660841	67	1.45	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B3SUG9|Q4VWF6|Q86VD3|Q8NBQ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Frag1/DRAM/Sfk1	p.G7V	ENST00000286692.4	37	c.20	CCDS30801.1	1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.362328	0.82353	.	.	ENSG00000156171	ENST00000286692;ENST00000539140	.	.	.	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.77260	0.4104	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79203	-0.1900	9	0.87932	D	0	-2.3378	16.0793	0.80989	0.0:1.0:0.0:0.0	.	7	Q6UX65	DRAM2_HUMAN	V	7	.	ENSP00000286692:G7V	G	-	2	0	DRAM2	111475680	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.925000	0.70062	2.873000	0.98535	0.561000	0.74099	GGC	-	NULL		0.388	DRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRAM2	protein_coding	OTTHUMT00000032930.3	C	NM_178454	-		111674157	-1	no_errors	ENST00000286692	ensembl	human	known	74_37	missense	SNP	1.000	A
SEPT11	55752	genome.wustl.edu	37	4	77952007	77952007	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr4:77952007G>T	ENST00000264893.6	+	9	1359	c.1158G>T	c.(1156-1158)aaG>aaT	p.K386N	SEPT11_ENST00000505788.1_Missense_Mutation_p.K386N|SEPT11_ENST00000541121.1_Missense_Mutation_p.K396N|SEPT11_ENST00000512575.1_3'UTR|SEPT11_ENST00000502584.1_Missense_Mutation_p.K386N|SEPT11_ENST00000510515.1_Missense_Mutation_p.K396N	NM_018243.2	NP_060713.1	Q9NVA2	SEP11_HUMAN	septin 11	386					cell cycle (GO:0007049)|cell division (GO:0051301)|protein heterooligomerization (GO:0051291)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|septin complex (GO:0031105)|stress fiber (GO:0001725)|synapse (GO:0045202)	GTP binding (GO:0005525)			endometrium(2)|kidney(3)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	11						ACAAGAAGAAGGAGCTTGAGG	0.483																																																	0								ENSG00000138758						102.0	105.0	104.0					4																	77952007		2203	4300	6503	SEPT11	SO:0001583	missense	0			-	HGNC	AK001711	CCDS34018.1	4q21.1	2013-01-21			ENSG00000138758	ENSG00000138758		"""Septins"""	25589	protein-coding gene	gene with protein product		612887				14999297, 15140406	Standard	NM_018243		Approved	FLJ10849	uc003hkj.3	Q9NVA2	OTTHUMG00000160854	ENST00000264893.6:c.1158G>T	4.37:g.77952007G>T	ENSP00000264893:p.Lys386Asn	Somatic	0	42	0.00		0.6257302807660841	84	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B7Z7Z6|E9KL32|Q4W5G1|Q7L4N1|Q96SP1|Q9UFY9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	p.K396N	ENST00000264893.6	37	c.1188	CCDS34018.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.61|16.61	3.170031|3.170031	0.57584|0.57584	.|.	.|.	ENSG00000138758|ENSG00000138758	ENST00000264893;ENST00000502584;ENST00000505788;ENST00000510515;ENST00000541121;ENST00000502401|ENST00000506731	D;D;D;D;D|.	0.84516|.	-1.86;-1.86;-1.86;-1.86;-1.86|.	5.93|5.93	5.09|5.09	0.68999|0.68999	.|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|T	0.61640|0.61640	0.2363|0.2363	L|L	0.56199|0.56199	1.76|1.76	0.43385|0.43385	D|D	0.995497|0.995497	P;P|.	0.40731|.	0.728;0.608|.	P;B|.	0.44359|.	0.447;0.137|.	T|T	0.60120|0.60120	-0.7325|-0.7325	10|5	0.66056|.	D|.	0.02|.	.|.	10.9497|10.9497	0.47321|0.47321	0.1415:0.0:0.8585:0.0|0.1415:0.0:0.8585:0.0	.|.	396;386|.	Q9NVA2-2;Q9NVA2|.	.;SEP11_HUMAN|.	N|M	386;386;386;396;396;39|115	ENSP00000264893:K386N;ENSP00000426344:K386N;ENSP00000424925:K386N;ENSP00000422896:K396N;ENSP00000443701:K396N|.	ENSP00000264893:K386N|.	K|R	+|+	3|2	2|0	SEPT11|SEPT11	78171031|78171031	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.000000|3.000000	0.49481|0.49481	1.513000|1.513000	0.48852|0.48852	0.655000|0.655000	0.94253|0.94253	AAG|AGG	-	pirsf_Septin		0.483	SEPT11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEPT11	protein_coding	OTTHUMT00000362676.1	G	NM_018243	-		77952007	+1	no_errors	ENST00000541121	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF467	168544	genome.wustl.edu	37	7	149462898	149462898	+	Silent	SNP	C	C	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr7:149462898C>A	ENST00000302017.3	-	5	1106	c.693G>T	c.(691-693)ctG>ctT	p.L231L	ZNF467_ENST00000484747.1_Intron	NM_207336.1	NP_997219.1	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	231					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|urinary_tract(1)	13	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GGTGGCGGGTCAGATGGGCCT	0.682																																																	0								ENSG00000181444						18.0	16.0	17.0					7																	149462898		2201	4297	6498	ZNF467	SO:0001819	synonymous_variant	0			-	HGNC	BC029296	CCDS5899.1	7q36.1	2013-01-08			ENSG00000181444	ENSG00000181444		"""Zinc fingers, C2H2-type"""	23154	protein-coding gene	gene with protein product		614040				12426389	Standard	NM_207336		Approved	EZI, Zfp467	uc003wgd.2	Q7Z7K2	OTTHUMG00000157883	ENST00000302017.3:c.693G>T	7.37:g.149462898C>A		Somatic	0	34	0.00		0.6257302807660841	11	8.33	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	39	20.41		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L231	ENST00000302017.3	37	c.693	CCDS5899.1	7																																																																																			-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.682	ZNF467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF467	protein_coding	OTTHUMT00000349833.1	C	NM_207336	-		149462898	-1	no_errors	ENST00000302017	ensembl	human	known	74_37	silent	SNP	1.000	A
STAB2	55576	genome.wustl.edu	37	12	103981330	103981330	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr12:103981330G>T	ENST00000388887.2	+	1	280	c.76G>T	c.(76-78)Ggg>Tgg	p.G26W		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TGAAACCACAGGGCAGGTAAG	0.363																																																	0								ENSG00000136011						105.0	99.0	101.0					12																	103981330		2203	4300	6503	STAB2	SO:0001583	missense	0			-	HGNC	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.76G>T	12.37:g.103981330G>T	ENSP00000373539:p.Gly26Trp	Somatic	0	44	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	41	18.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_FAS1_domain,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.G26W	ENST00000388887.2	37	c.76	CCDS31888.1	12	.	.	.	.	.	.	.	.	.	.	G	16.24	3.066556	0.55539	.	.	ENSG00000136011	ENST00000388887	T	0.42900	0.96	5.77	2.76	0.32466	.	1.251780	0.05734	N	0.600164	T	0.41604	0.1166	L	0.47190	1.495	0.09310	N	1	P	0.52463	0.953	P	0.46975	0.533	T	0.21008	-1.0258	10	0.37606	T	0.19	.	5.6284	0.17495	0.1663:0.3123:0.5214:0.0	.	26	Q8WWQ8	STAB2_HUMAN	W	26	ENSP00000373539:G26W	ENSP00000373539:G26W	G	+	1	0	STAB2	102505460	0.002000	0.14202	0.001000	0.08648	0.476000	0.33039	0.971000	0.29396	0.749000	0.32854	0.655000	0.94253	GGG	-	NULL		0.363	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	protein_coding	OTTHUMT00000407089.1	G		-		103981330	+1	no_errors	ENST00000388887	ensembl	human	known	74_37	missense	SNP	0.000	T
PMS2P1	5379	genome.wustl.edu	37	7	99928403	99928403	+	RNA	SNP	T	T	C			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr7:99928403T>C	ENST00000365043.1	-	0	97																											TTTTTCCTTATgctagtcaag	0.323																																																	0								ENSG00000201913																																			Y_RNA			0			-	RFAM																													7.37:g.99928403T>C		Somatic	0	35	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	37	11.90		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000365043.1	37	NULL		7																																																																																			-	-		0.323	Y_RNA.337-201	NOVEL	basic	misc_RNA	ENSG00000201913	misc_RNA		T		-		99928403	-1	no_errors	ENST00000365043	ensembl	human	novel	74_37	rna	SNP	0.023	C
MYADM	91663	genome.wustl.edu	37	19	54379104	54379104	+	3'UTR	DEL	A	A	-	rs75209913|rs369211393		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr19:54379104delA	ENST00000391769.2	+	0	2601				MYADM_ENST00000391770.4_3'UTR|AC008440.5_ENST00000413496.2_RNA|MYADM_ENST00000336967.3_3'UTR|MYADM_ENST00000391771.1_3'UTR	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker						establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		actccatctcaaaaaaaaaaa	0.498																																																	0								ENSG00000232220																																			AC008440.5	SO:0001624	3_prime_UTR_variant	0				Clone_based_vega_gene	AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.*1352A>-	19.37:g.54379104delA		Somatic	0	27	0.00		0.6257302807660841	164	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	36	18.18	B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000391769.2	37	NULL	CCDS12866.1	19																																																																																			-	-		0.498	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232220	protein_coding	OTTHUMT00000134337.1	A	NM_138373			54379104	-1	no_errors	ENST00000413496	ensembl	human	known	74_37	rna	DEL	0.000	-
LILRA1	11024	genome.wustl.edu	37	19	55107308	55107308	+	Missense_Mutation	SNP	G	G	A	rs35534776	byFrequency	TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr19:55107308G>A	ENST00000251372.3	+	6	1048	c.866G>A	c.(865-867)cGc>cAc	p.R289H	LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000418536.2_Intron|LILRA1_ENST00000453777.1_Intron|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000396321.2_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	289	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		CCTGTGAGCCGCTCCTACGGG	0.647																																																	0								ENSG00000104974						43.0	58.0	53.0					19																	55107308		2203	4300	6503	LILRA1	SO:0001583	missense	0			-	HGNC	AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.866G>A	19.37:g.55107308G>A	ENSP00000251372:p.Arg289His	Somatic	0	185	0.00		0.6257302807660841	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	148	21.58	O75018|Q3MJA6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like_dom	p.R289H	ENST00000251372.3	37	c.866	CCDS12901.1	19	.	.	.	.	.	.	.	.	.	.	G	3.545	-0.092935	0.07053	.	.	ENSG00000104974	ENST00000251372	T	0.12569	2.67	1.58	-3.16	0.05217	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	3.535700	0.01092	N	0.005193	T	0.07548	0.0190	N	0.25144	0.715	0.09310	N	1	B	0.22851	0.076	B	0.21546	0.035	T	0.19451	-1.0305	10	0.11485	T	0.65	.	1.3079	0.02092	0.1666:0.3949:0.2401:0.1984	.	289	O75019	LIRA1_HUMAN	H	289	ENSP00000251372:R289H	ENSP00000251372:R289H	R	+	2	0	LILRA1	59799120	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-1.648000	0.01995	-1.418000	0.02014	-1.052000	0.02337	CGC	-	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt		0.647	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA1	protein_coding	OTTHUMT00000140807.2	G	NM_006863	-		55107308	+1	no_errors	ENST00000251372	ensembl	human	known	74_37	missense	SNP	0.000	A
HPSE2	60495	genome.wustl.edu	37	10	100503735	100503735	+	Missense_Mutation	SNP	C	C	T	rs373235110		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr10:100503735C>T	ENST00000370552.3	-	4	748	c.689G>A	c.(688-690)cGt>cAt	p.R230H	HPSE2_ENST00000404542.1_Intron|HPSE2_ENST00000370549.1_Intron|HPSE2_ENST00000370546.1_Missense_Mutation_p.R230H	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	230					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		ATTGGGATTACGACGCAGTGC	0.453																																																	0								ENSG00000172987						121.0	115.0	117.0					10																	100503735		2203	4300	6503	HPSE2	SO:0001583	missense	0			-	HGNC	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.689G>A	10.37:g.100503735C>T	ENSP00000359583:p.Arg230His	Somatic	0	56	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	28	30.00	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_79,superfamily_Glycoside_hydrolase_SF	p.R230H	ENST00000370552.3	37	c.689	CCDS7477.1	10	.	.	.	.	.	.	.	.	.	.	C	33	5.206756	0.95033	.	.	ENSG00000172987	ENST00000370552;ENST00000370546	T;T	0.29397	1.57;1.57	5.68	5.68	0.88126	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.59101	0.2169	M	0.75615	2.305	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.994;0.997	T	0.56823	-0.7915	10	0.51188	T	0.08	-5.3324	20.1554	0.98111	0.0:1.0:0.0:0.0	.	230;230	Q8WWQ2-2;Q8WWQ2	.;HPSE2_HUMAN	H	230	ENSP00000359583:R230H;ENSP00000359577:R230H	ENSP00000359577:R230H	R	-	2	0	HPSE2	100493725	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.376000	0.79658	2.838000	0.97847	0.591000	0.81541	CGT	-	pfam_Glyco_hydro_79,superfamily_Glycoside_hydrolase_SF		0.453	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HPSE2	protein_coding	OTTHUMT00000049789.1	C	NM_021828	-		100503735	-1	no_errors	ENST00000370552	ensembl	human	known	74_37	missense	SNP	1.000	T
MYO18B	84700	genome.wustl.edu	37	22	26247469	26247469	+	Missense_Mutation	SNP	C	C	T	rs371063606		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr22:26247469C>T	ENST00000407587.2	+	21	3980	c.3811C>T	c.(3811-3813)Cgc>Tgc	p.R1271C	MYO18B_ENST00000536101.1_Missense_Mutation_p.R1270C|MYO18B_ENST00000335473.7_Missense_Mutation_p.R1270C			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1270	Myosin motor.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CACTCGCTTCCGCCGGCAATT	0.577																																																	0								ENSG00000133454	C	CYS/ARG	1,4331		0,1,2165	32.0	32.0	32.0		3808	4.7	1.0	22		32	0,8506		0,0,4253	no	missense	MYO18B	NM_032608.5	180	0,1,6418	TT,TC,CC		0.0,0.0231,0.0078	probably-damaging	1270/2568	26247469	1,12837	2166	4253	6419	MYO18B	SO:0001583	missense	0			-	HGNC	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.3811C>T	22.37:g.26247469C>T	ENSP00000386096:p.Arg1271Cys	Somatic	0	53	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	72	29.41	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1270C	ENST00000407587.2	37	c.3808		22	.	.	.	.	.	.	.	.	.	.	C	19.53	3.845414	0.71603	2.31E-4	0.0	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	T;T;T	0.72505	-0.66;-0.66;-0.66	4.72	4.72	0.59763	Myosin head, motor domain (2);	0.129079	0.51477	D	0.000099	D	0.85741	0.5767	M	0.87180	2.865	0.50813	D	0.999893	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.995;0.999	D	0.88512	0.3090	10	0.87932	D	0	.	15.5835	0.76465	0.0:1.0:0.0:0.0	.	783;1270;1271;1270	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	C	1270;1270;1271	ENSP00000441229:R1270C;ENSP00000334563:R1270C;ENSP00000386096:R1271C	ENSP00000334563:R1270C	R	+	1	0	MYO18B	24577469	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.598000	0.46223	2.356000	0.79943	0.561000	0.74099	CGC	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.577	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	protein_coding	OTTHUMT00000400691.1	C	NM_032608	-		26247469	+1	no_errors	ENST00000335473	ensembl	human	known	74_37	missense	SNP	1.000	T
SSPO	23145	genome.wustl.edu	37	7	149480380	149480380	+	RNA	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr7:149480380C>T	ENST00000378016.2	+	0	2262							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCCACGCCTTCGCAGAGGCGG	0.642																																																	0								ENSG00000197558						44.0	49.0	47.0					7																	149480380		2108	4215	6323	SSPO			0			-	HGNC	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149480380C>T		Somatic	0	30	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	57	13.64	Q76B61	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			-	-		0.642	SSPO-202	KNOWN	basic	processed_transcript	SSPO	processed_transcript		C		-		149480380	+1	no_errors	ENST00000262089	ensembl	human	known	74_37	rna	SNP	0.000	T
RPS27L	51065	genome.wustl.edu	37	15	63447932	63447933	+	Splice_Site	INS	-	-	A	rs368882344|rs547223571		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr15:63447932_63447933insA	ENST00000455271.1	-	3	604		c.e3-2		RPS27L_ENST00000559763.1_5'Flank|RPS27L_ENST00000439025.1_Splice_Site|RPS27L_ENST00000411926.1_Splice_Site|RPS27L_ENST00000462430.1_Splice_Site|RPS27L_ENST00000330964.5_Splice_Site					ribosomal protein S27-like											large_intestine(1)	1						TGTAGCAACCTAAAAAAAAAAA	0.396																																																	0								ENSG00000185088																																			RPS27L	SO:0001630	splice_region_variant	0				HGNC	BC003667	CCDS42048.1	15q21.3	2008-07-18			ENSG00000185088	ENSG00000185088		"""S ribosomal proteins"""	18476	protein-coding gene	gene with protein product		612055				11042152	Standard	NM_015920		Approved		uc002aly.3	Q71UM5	OTTHUMG00000155301	ENST00000455271.1:c.20-2->T	15.37:g.63447943_63447943dupA		Somatic	0	32	0.00		0.6257302807660841	36	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63		Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e3-2	ENST00000455271.1	37	c.116-3_116-2		15																																																																																			-	-		0.396	RPS27L-003	PUTATIVE	basic|exp_conf	protein_coding	RPS27L	protein_coding	OTTHUMT00000339349.2	-	NM_015920		Intron	63447933	-1	no_errors	ENST00000330964	ensembl	human	known	74_37	splice_site_ins	INS	1.000:0.554	A
GPR50	9248	genome.wustl.edu	37	X	150345294	150345294	+	Missense_Mutation	SNP	C	C	T	rs372712912		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chrX:150345294C>T	ENST00000218316.3	+	1	170	c.101C>T	c.(100-102)gCg>gTg	p.A34V	GPR50-AS1_ENST00000454196.1_RNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	34					cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)			breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					ATGTTCTGCGCGATGGTTATC	0.522																																																	0								ENSG00000102195						128.0	124.0	125.0					X																	150345294		1899	4106	6005	GPR50	SO:0001583	missense	0			-	HGNC	U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.101C>T	X.37:g.150345294C>T	ENSP00000218316:p.Ala34Val	Somatic	0	71	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	62	36.08	Q0VGG3|Q3ZAR0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Mel_rcpt_1X,prints_GPCR_Rhodpsn,prints_Melatonin_rcpt,prints_NPY_rcpt	p.A34V	ENST00000218316.3	37	c.101	CCDS44012.1	X	.	.	.	.	.	.	.	.	.	.	C	7.795	0.712382	0.15306	.	.	ENSG00000102195	ENST00000218316	T	0.33438	1.41	3.88	1.91	0.25777	.	0.704021	0.13056	N	0.417277	T	0.13927	0.0337	N	0.08118	0	0.20873	N	0.999835	B	0.09022	0.002	B	0.08055	0.003	T	0.23190	-1.0195	10	0.35671	T	0.21	0.0044	5.3749	0.16160	0.0:0.6867:0.0:0.3133	.	34	Q13585	MTR1L_HUMAN	V	34	ENSP00000218316:A34V	ENSP00000218316:A34V	A	+	2	0	GPR50	150095952	0.611000	0.26992	0.233000	0.24025	0.442000	0.32017	0.030000	0.13688	0.199000	0.20427	0.292000	0.19580	GCG	-	prints_GPCR_Rhodpsn		0.522	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR50	protein_coding	OTTHUMT00000060874.1	C	NM_004224	-		150345294	+1	no_errors	ENST00000218316	ensembl	human	known	74_37	missense	SNP	0.649	T
DTHD1	401124	genome.wustl.edu	37	4	36295187	36295187	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr4:36295187T>G	ENST00000456874.2	+	3	941	c.883T>G	c.(883-885)Ttt>Gtt	p.F295V	DTHD1_ENST00000357504.3_Missense_Mutation_p.F130V|DTHD1_ENST00000507598.1_Missense_Mutation_p.F335V	NM_001170700.2	NP_001164171.1	Q6ZMT9	DTHD1_HUMAN	death domain containing 1	295					signal transduction (GO:0007165)					breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|stomach(1)	8						ATTGGGTATCTTTTCTGTTGT	0.348																																																	0								ENSG00000197057						115.0	98.0	103.0					4																	36295187		692	1591	2283	DTHD1	SO:0001583	missense	0			-	HGNC	AK094684	CCDS54754.1	4p14	2009-10-02			ENSG00000197057	ENSG00000197057			37261	protein-coding gene	gene with protein product							Standard	NM_001170700		Approved	FLJ16686	uc021xne.2	Q6ZMT9	OTTHUMG00000160371	ENST00000456874.2:c.883T>G	4.37:g.36295187T>G	ENSP00000401597:p.Phe295Val	Somatic	0	67	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	70	20.45	B2RXK4|B4E2N7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Death_domain,superfamily_DEATH-like_dom,pfscan_Death_domain	p.F295V	ENST00000456874.2	37	c.883	CCDS54754.1	4	.	.	.	.	.	.	.	.	.	.	T	20.9	4.068497	0.76301	.	.	ENSG00000197057	ENST00000357504;ENST00000507598;ENST00000456874	T;T;T	0.49432	0.78;1.16;1.15	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.60314	0.2259	M	0.70275	2.135	0.48975	D	0.999738	P	0.51537	0.946	P	0.53313	0.723	T	0.63148	-0.6702	10	0.48119	T	0.1	-23.5576	15.302	0.73958	0.0:0.0:0.0:1.0	.	130	Q6ZMT9-2	.	V	130;335;295	ENSP00000350103:F130V;ENSP00000424426:F335V;ENSP00000401597:F295V	ENSP00000350103:F130V	F	+	1	0	DTHD1	35971582	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	6.086000	0.71352	2.191000	0.70037	0.533000	0.62120	TTT	-	NULL		0.348	DTHD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DTHD1	protein_coding		T	NM_001136536	-		36295187	+1	no_errors	ENST00000456874	ensembl	human	known	74_37	missense	SNP	1.000	G
TPR	7175	genome.wustl.edu	37	1	186313635	186313635	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr1:186313635G>T	ENST00000367478.4	-	25	3585	c.3289C>A	c.(3289-3291)Caa>Aaa	p.Q1097K		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1097					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TTCGCAGCTTGTAGAGCTTCA	0.408			T	NTRK1	papillary thyroid																																			Dom	yes		1	1q25	7175	translocated promoter region		E	0								ENSG00000047410						194.0	175.0	181.0					1																	186313635		1934	4159	6093	TPR	SO:0001583	missense	0			-	HGNC	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.3289C>A	1.37:g.186313635G>T	ENSP00000356448:p.Gln1097Lys	Somatic	0	50	0.00		0.6257302807660841	27	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TPR_MLP1_2,superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.Q1097K	ENST00000367478.4	37	c.3289	CCDS41446.1	1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.978122	0.92982	.	.	ENSG00000047410	ENST00000367478	T	0.27104	1.69	5.42	5.42	0.78866	Tetratricopeptide, MLP1/MLP2-like (1);	0.000000	0.85682	D	0.000000	T	0.54565	0.1866	M	0.81112	2.525	0.80722	D	1	D	0.69078	0.997	D	0.76071	0.987	T	0.51601	-0.8685	10	0.32370	T	0.25	.	19.2133	0.93766	0.0:0.0:1.0:0.0	.	1097	P12270	TPR_HUMAN	K	1097	ENSP00000356448:Q1097K	ENSP00000356448:Q1097K	Q	-	1	0	TPR	184580258	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	9.434000	0.97515	2.553000	0.86117	0.555000	0.69702	CAA	-	pfam_TPR_MLP1_2		0.408	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPR	protein_coding	OTTHUMT00000086353.2	G	NM_003292	-		186313635	-1	no_errors	ENST00000367478	ensembl	human	known	74_37	missense	SNP	1.000	T
FRG2B	441581	genome.wustl.edu	37	10	135439015	135439015	+	Missense_Mutation	SNP	T	T	C	rs75470891		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr10:135439015T>C	ENST00000425520.1	-	4	477	c.425A>G	c.(424-426)gAt>gGt	p.D142G	FRG2B_ENST00000443774.1_Missense_Mutation_p.D143G	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	142						nucleus (GO:0005634)		p.D143G(1)|p.D142G(1)		endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		ATGGTGGGCATCACAGGTCTC	0.517																																																	2	Substitution - Missense(2)	prostate(2)						ENSG00000225899						94.0	106.0	102.0					10																	135439015		2200	4298	6498	FRG2B	SO:0001583	missense	0			-	HGNC	AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.425A>G	10.37:g.135439015T>C	ENSP00000401310:p.Asp142Gly	Somatic	0	79	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	12	29.41	Q5VSQ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D142G	ENST00000425520.1	37	c.425	CCDS44502.1	10	.	.	.	.	.	.	.	.	.	.	.	7.820	0.717602	0.15372	.	.	ENSG00000225899	ENST00000443774;ENST00000425520	T;T	0.46063	0.88;0.88	.	.	.	.	2.387620	0.01707	N	0.027493	T	0.45115	0.1326	N	0.19112	0.55	0.80722	P	0.0	D	0.61697	0.99	D	0.66351	0.943	T	0.44967	-0.9293	7	0.25751	T	0.34	-0.0211	.	.	.	.	142	Q96QU4	FRG2B_HUMAN	G	143;142	ENSP00000408343:D143G;ENSP00000401310:D142G	ENSP00000401310:D142G	D	-	2	0	FRG2B	135289005	0.038000	0.19896	0.258000	0.24420	0.260000	0.26232	0.264000	0.18497	0.103000	0.17682	0.102000	0.15555	GAT	-	NULL		0.517	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FRG2B	protein_coding	OTTHUMT00000467780.1	T	NM_001080998	rs75470891		135439015	-1	no_errors	ENST00000425520	ensembl	human	known	74_37	missense	SNP	0.272	C
MAATS1	89876	genome.wustl.edu	37	3	119462955	119462955	+	Missense_Mutation	SNP	G	G	A	rs201045322		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr3:119462955G>A	ENST00000273390.5	+	14	1891	c.1814G>A	c.(1813-1815)cGc>cAc	p.R605H	RP11-169N13.4_ENST00000489428.2_RNA	NM_033364.3	NP_203528	Q7Z4T9	MAAT1_HUMAN	MYCBP-associated, testis expressed 1	441						mitochondrion (GO:0005739)											CTGGCTGAGCGCCAGCGGCGG	0.582																																																	0								ENSG00000183833						81.0	74.0	76.0					3																	119462955		2203	4300	6503	MAATS1	SO:0001583	missense	0			GMAF=0.0005	HGNC	AB063296	CCDS2994.1	3q12-q13.3	2014-07-31	2012-12-07	2012-09-26	ENSG00000183833	ENSG00000183833			24010	protein-coding gene	gene with protein product	"""AMY-1-associating protein expressed in testis 1"", ""MYCBP-binding protein"", ""spermatogenesis associated 26"""	609910	"""chromosome 3 open reading frame 15"", ""MYCBP/AMY-1-associated, testis expressed 1"""	C3orf15		12223483, 14551891, 17967944	Standard	NM_033364		Approved	AAT1, AAT1alpha, SPATA26, CaM-IP2	uc003ede.4	Q7Z4T9	OTTHUMG00000159422	ENST00000273390.5:c.1814G>A	3.37:g.119462955G>A	ENSP00000273390:p.Arg605His	Somatic	0	21	0.00		0.6257302807660841	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	16	33.33	A0AVK2|A8K1J9|B3KP23|B4DG52|B4DZ14|C9JUG4|Q68DX2|Q8TD41|Q96A45|Q96JE8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_S-AdoMet_deCO2ase_core	p.R605H	ENST00000273390.5	37	c.1814	CCDS2994.1	3	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	35	5.575518	0.96553	.	.	ENSG00000183833	ENST00000273390	T	0.29655	1.56	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.63129	0.2485	M	0.85197	2.74	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	T	0.67608	-0.5627	10	0.72032	D	0.01	-12.6434	19.7305	0.96180	0.0:0.0:1.0:0.0	.	441;543;605	Q7Z4T9;Q7Z4T9-3;Q7Z4T9-7	AAT1_HUMAN;.;.	H	605	ENSP00000273390:R605H	ENSP00000273390:R605H	R	+	2	0	C3orf15	120945645	1.000000	0.71417	0.847000	0.33407	0.948000	0.59901	9.184000	0.94893	2.663000	0.90544	0.484000	0.47621	CGC	-	NULL		0.582	MAATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAATS1	protein_coding	OTTHUMT00000355222.1	G	NM_033364	rs201045322		119462955	+1	no_errors	ENST00000273390	ensembl	human	known	74_37	missense	SNP	0.994	A
GOT1L1	137362	genome.wustl.edu	37	8	37791833	37791834	+	Frame_Shift_Ins	INS	-	-	T	rs370114090	byFrequency	TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr8:37791833_37791834insT	ENST00000307599.4	-	9	1342_1343	c.1243_1244insA	c.(1243-1245)acafs	p.T415fs		NM_152413.2	NP_689626.2	Q8NHS2	AATC2_HUMAN	glutamic-oxaloacetic transaminase 1-like 1	415					biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)	cytoplasm (GO:0005737)	pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)			central_nervous_system(1)|endometrium(3)|lung(8)|ovary(1)|prostate(1)	14	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;1.37e-11)			TCCAATCAGTGTTTTTTTTTCC	0.371													?|TTTTTTTTT|TTTTTTTTTT|unsure	7	0.00139776	0.0	0.0	5008	,	,		21654	0.0069		0.0	False		,,,				2504	0.0																0								ENSG00000169154																																			GOT1L1	SO:0001589	frameshift_variant	0				HGNC	BC029504	CCDS47839.1	8p12	2005-09-22			ENSG00000169154	ENSG00000169154			28487	protein-coding gene	gene with protein product						12477932	Standard	NM_152413		Approved	MGC33309	uc011lbj.1	Q8NHS2	OTTHUMG00000164027	ENST00000307599.4:c.1244dupA	8.37:g.37791842_37791842dupT	ENSP00000303077:p.Thr415fs	Somatic	0	30	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A8MWL4	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase,prints_Asp_trans	p.T415fs	ENST00000307599.4	37	c.1244_1243	CCDS47839.1	8																																																																																			-	NULL		0.371	GOT1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOT1L1	protein_coding	OTTHUMT00000376823.1	-	NM_152413			37791834	-1	no_errors	ENST00000307599	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.000	T
HCN2	610	genome.wustl.edu	37	19	603785	603785	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr19:603785G>A	ENST00000251287.2	+	2	927	c.874G>A	c.(874-876)Gtg>Atg	p.V292M		NM_001194.3	NP_001185.3	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 2	292					cell-cell signaling (GO:0007267)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	cAMP binding (GO:0030552)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			endometrium(5)|lung(4)	9		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACGTGGTTCGTGGTGGACTT	0.562																																					Melanoma(145;1175 2427 8056 36306)												0								ENSG00000099822						181.0	140.0	154.0					19																	603785		2198	4298	6496	HCN2	SO:0001583	missense	0			-	HGNC	AF064877	CCDS12035.1	19p13	2011-07-05				ENSG00000099822		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4846	protein-coding gene	gene with protein product		602781		BCNG2		9405696, 9630217, 16382102	Standard	NM_001194		Approved	BCNG-2, HAC-1	uc002lpe.3	Q9UL51		ENST00000251287.2:c.874G>A	19.37:g.603785G>A	ENSP00000251287:p.Val292Met	Somatic	0	71	0.00		0.6257302807660841	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	56	17.65	O60742|O60743|O75267|Q9UBS2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.V292M	ENST00000251287.2	37	c.874	CCDS12035.1	19	.	.	.	.	.	.	.	.	.	.	.	15.26	2.779739	0.49891	.	.	ENSG00000099822	ENST00000251287	D	0.98550	-4.99	3.05	3.05	0.35203	Ion transport (1);	.	.	.	.	D	0.97445	0.9164	M	0.87827	2.91	0.42380	D	0.992486	P	0.48911	0.917	B	0.40477	0.33	D	0.97485	1.0050	9	0.48119	T	0.1	.	13.6304	0.62191	0.0:0.0:1.0:0.0	.	292	Q9UL51	HCN2_HUMAN	M	292	ENSP00000251287:V292M	ENSP00000251287:V292M	V	+	1	0	HCN2	554785	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.411000	0.59781	1.749000	0.51849	0.299000	0.19835	GTG	-	pfam_Ion_trans_dom		0.562	HCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN2	protein_coding	OTTHUMT00000452100.1	G	NM_001194	-		603785	+1	no_errors	ENST00000251287	ensembl	human	known	74_37	missense	SNP	1.000	A
RSAD1	55316	genome.wustl.edu	37	17	48562112	48562112	+	Missense_Mutation	SNP	C	C	T	rs375677855		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr17:48562112C>T	ENST00000258955.2	+	9	1304	c.1219C>T	c.(1219-1221)Cgg>Tgg	p.R407W		NM_018346.1	NP_060816.1	Q9HA92	RSAD1_HUMAN	radical S-adenosyl methionine domain containing 1	407					porphyrin-containing compound biosynthetic process (GO:0006779)	mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|coproporphyrinogen oxidase activity (GO:0004109)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			CAGGGGTCTTCGGTGTTCCTG	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		17114	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000136444	C	TRP/ARG	0,4406		0,0,2203	80.0	69.0	73.0		1219	4.7	1.0	17		73	1,8599	1.2+/-3.3	0,1,4299	no	missense	RSAD1	NM_018346.1	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	407/443	48562112	1,13005	2203	4300	6503	RSAD1	SO:0001583	missense	0			-	HGNC	AK002026	CCDS11569.1	17q21.33	2004-11-08			ENSG00000136444	ENSG00000136444			25634	protein-coding gene	gene with protein product						12477932	Standard	NM_018346		Approved	FLJ11164	uc002iqw.1	Q9HA92	OTTHUMG00000162126	ENST00000258955.2:c.1219C>T	17.37:g.48562112C>T	ENSP00000258955:p.Arg407Trp	Somatic	0	79	0.00		0.6257302807660841	40	31.03	18	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	51	32.89	B4DMW0|Q53HV8|Q86VC4|Q9BRY7|Q9NUS7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HemN_C_dom,pfam_rSAM,smart_Elp3/MiaB/NifB,tigrfam_Coprogen_oxidase_HemN-rel	p.R407W	ENST00000258955.2	37	c.1219	CCDS11569.1	17	.	.	.	.	.	.	.	.	.	.	C	23.6	4.434114	0.83776	0.0	1.16E-4	ENSG00000136444	ENST00000258955	T	0.55588	0.51	5.76	4.74	0.60224	HemN, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.52869	0.1761	N	0.08118	0	0.52501	D	0.999952	D	0.89917	1.0	D	0.97110	1.0	T	0.62177	-0.6909	10	0.87932	D	0	-38.2165	14.0583	0.64784	0.2485:0.7515:0.0:0.0	.	407	Q9HA92	RSAD1_HUMAN	W	407	ENSP00000258955:R407W	ENSP00000258955:R407W	R	+	1	2	RSAD1	45917111	0.949000	0.32298	1.000000	0.80357	0.997000	0.91878	1.702000	0.37836	2.709000	0.92574	0.655000	0.94253	CGG	-	pfam_HemN_C_dom		0.607	RSAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSAD1	protein_coding	OTTHUMT00000367413.1	C	NM_018346	-		48562112	+1	no_errors	ENST00000258955	ensembl	human	known	74_37	missense	SNP	1.000	T
UHRF1	29128	genome.wustl.edu	37	19	4960773	4960773	+	RNA	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr19:4960773G>A	ENST00000592666.1	+	0	2916							Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains 1						cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|histone monoubiquitination (GO:0010390)|histone ubiquitination (GO:0016574)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autoubiquitination (GO:0051865)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|replication fork (GO:0005657)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|hemi-methylated DNA-binding (GO:0044729)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(2)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		TCTGCAGACCGTCCTCAACCA	0.612																																																	0								ENSG00000034063						11.0	13.0	13.0					19																	4960773		1849	4048	5897	UHRF1			0			-	HGNC	AF129507	CCDS74262.1, CCDS74263.1	19p13.3	2012-04-20	2008-08-14		ENSG00000034063	ENSG00000276043		"""RING-type (C3HC4) zinc fingers"""	12556	protein-coding gene	gene with protein product		607990				10646863	Standard	NM_001048201		Approved	ICBP90, Np95, FLJ21925, RNF106	uc002mbo.3	Q96T88			19.37:g.4960773G>A		Somatic	0	33	0.00		0.6257302807660841	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	49	22.22	A0JBR2|A8K024|B2RBA9|Q2HIX7|Q8J022|Q9H6S6|Q9P115|Q9P1U7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000592666.1	37	NULL		19	.	.	.	.	.	.	.	.	.	.	G	1.015	-0.686587	0.03328	.	.	ENSG00000034063	ENST00000262952;ENST00000396708;ENST00000455180;ENST00000543616;ENST00000398240	.	.	.	4.43	-2.58	0.06228	Zinc finger, RING/FYVE/PHD-type (1);	0.437398	0.22834	N	0.055076	T	0.14227	0.0344	.	.	.	0.23834	N	0.996716	B;B	0.10296	0.003;0.0	B;B	0.04013	0.001;0.001	T	0.41610	-0.9499	7	0.02654	T	1	-37.4898	6.9817	0.24706	0.5298:0.2106:0.2597:0.0	.	794;781	Q2HIX7;Q96T88	.;UHRF1_HUMAN	I	780;395;780;780;793	.	ENSP00000262952:V780I	V	+	1	0	UHRF1	4911773	0.000000	0.05858	0.024000	0.17045	0.537000	0.34900	-0.174000	0.09839	-0.195000	0.10382	-0.367000	0.07326	GTC	-	-		0.612	UHRF1-006	KNOWN	sequence_error|basic	processed_transcript	UHRF1	processed_transcript	OTTHUMT00000450444.1	G	NM_001048201	-		4960773	+1	no_errors	ENST00000262952	ensembl	human	known	74_37	rna	SNP	0.027	A
CERKL	375298	genome.wustl.edu	37	2	182403828	182403828	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr2:182403828A>G	ENST00000339098.5	-	13	1606	c.1607T>C	c.(1606-1608)gTc>gCc	p.V536A	CERKL_ENST00000410087.3_Missense_Mutation_p.V510A|CERKL_ENST00000374970.2_Missense_Mutation_p.V441A|CERKL_ENST00000374969.2_Missense_Mutation_p.V397A|CERKL_ENST00000409440.3_Missense_Mutation_p.V492A			Q49MI3	CERKL_HUMAN	ceramide kinase-like	536					negative regulation of apoptotic process (GO:0043066)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(13)|ovary(3)|skin(3)	32			OV - Ovarian serous cystadenocarcinoma(117;0.088)			CCTAATATGGACCTCTGATGC	0.378																																																	0								ENSG00000188452						138.0	132.0	134.0					2																	182403828		2203	4300	6503	CERKL	SO:0001583	missense	0			-	HGNC	BC020465	CCDS33340.1, CCDS33341.1, CCDS42789.1, CCDS46466.1, CCDS54425.1	2q31.3	2005-01-04			ENSG00000188452	ENSG00000188452			21699	protein-coding gene	gene with protein product			"""retinitis pigmentosa 26 (autosomal recessive)"""	RP26		14681825	Standard	NR_027689		Approved		uc002uny.3	Q49MI3	OTTHUMG00000154315	ENST00000339098.5:c.1607T>C	2.37:g.182403828A>G	ENSP00000341159:p.Val536Ala	Somatic	0	161	0.00		0.6257302807660841	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	88	28	75.86	B2RPL2|B4DEY1|Q49MH9|Q49MI0|Q49MI1|Q49MI2|Q5DVJ2|Q5DVJ4|Q5DVJ5|Q6UZF6|Q6ZP59	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Diacylglycerol_kinase_cat_dom	p.V536A	ENST00000339098.5	37	c.1607	CCDS42789.1	2	.	.	.	.	.	.	.	.	.	.	A	22.7	4.323832	0.81580	.	.	ENSG00000188452	ENST00000410087;ENST00000409440;ENST00000374969;ENST00000339098;ENST00000374970	T;T;T;T;T	0.16073	2.37;2.37;2.37;2.37;2.37	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.42291	0.1196	M	0.76838	2.35	0.41341	D	0.9873	D;D;D;D;D	0.71674	0.998;0.995;0.997;0.992;0.997	P;P;D;P;P	0.63957	0.888;0.869;0.92;0.874;0.849	T	0.43686	-0.9376	10	0.87932	D	0	.	15.8884	0.79273	1.0:0.0:0.0:0.0	.	492;397;441;510;536	B4DEY1;Q49MI3-4;Q49MI3-3;Q49MI3-2;Q49MI3	.;.;.;.;CERKL_HUMAN	A	510;492;397;536;441	ENSP00000386725:V510A;ENSP00000387080:V492A;ENSP00000364108:V397A;ENSP00000341159:V536A;ENSP00000364109:V441A	ENSP00000341159:V536A	V	-	2	0	CERKL	182112073	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	5.642000	0.67888	2.209000	0.71365	0.533000	0.62120	GTC	-	NULL		0.378	CERKL-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CERKL	protein_coding	OTTHUMT00000334811.1	A		-		182403828	-1	no_errors	ENST00000339098	ensembl	human	known	74_37	missense	SNP	1.000	G
RP11-435B5.5	0	genome.wustl.edu	37	1	143378850	143378850	+	lincRNA	SNP	G	G	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr1:143378850G>T	ENST00000428624.1	+	0	1570				RP11-435B5.3_ENST00000430699.1_lincRNA|RP11-435B5.4_ENST00000423249.1_lincRNA																							AGAAGCTAATGAACGAATGTG	0.313																																																	0								ENSG00000238261																																			RP11-435B5.5			0			-	Clone_based_vega_gene																													1.37:g.143378850G>T		Somatic	0	160	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	196	10.91		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			-	-		0.313	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	lincRNA	OTTHUMT00000037971.1	G		-		143378850	+1	no_errors	ENST00000423394	ensembl	human	known	74_37	rna	SNP	0.000	T
ZNF665	79788	genome.wustl.edu	37	19	53668216	53668216	+	Silent	SNP	A	A	G			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr19:53668216A>G	ENST00000600412.1	-	2	1447	c.1332T>C	c.(1330-1332)acT>acC	p.T444T	CTD-2245F17.2_ENST00000600257.1_RNA|ZNF665_ENST00000396424.3_Silent_p.T509T			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	444					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		GTTTTTCTCCAGTATGAACTC	0.393																																																	0								ENSG00000197497						120.0	127.0	125.0					19																	53668216		2203	4300	6503	ZNF665	SO:0001819	synonymous_variant	0			-	HGNC		CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.1332T>C	19.37:g.53668216A>G		Somatic	0	55	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	90	20.35	A8K5T8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T509	ENST00000600412.1	37	c.1527		19																																																																																			-	pfscan_Znf_C2H2		0.393	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	ZNF665	protein_coding	OTTHUMT00000464179.1	A	NM_024733	-		53668216	-1	no_errors	ENST00000396424	ensembl	human	known	74_37	silent	SNP	0.405	G
TRPV5	56302	genome.wustl.edu	37	7	142627168	142627168	+	Missense_Mutation	SNP	A	A	G	rs367563090		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr7:142627168A>G	ENST00000265310.1	-	3	682	c.334T>C	c.(334-336)Tgt>Cgt	p.C112R	TRPV5_ENST00000442623.1_Missense_Mutation_p.C112R	NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	112					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					AAAGCCTCACATGTGGTGGGC	0.547																																																	0								ENSG00000127412	A	ARG/CYS	1,4405	2.1+/-5.4	0,1,2202	99.0	96.0	97.0		334	3.1	0.3	7		97	0,8600		0,0,4300	no	missense	TRPV5	NM_019841.4	180	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	possibly-damaging	112/730	142627168	1,13005	2203	4300	6503	TRPV5	SO:0001583	missense	0			-	HGNC	AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.334T>C	7.37:g.142627168A>G	ENSP00000265310:p.Cys112Arg	Somatic	0	32	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	19	32.14	A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV5/TRPV6,prints_TRPV5,prints_Ankyrin_rpt,tigrfam_TRP_channel	p.C112R	ENST00000265310.1	37	c.334	CCDS5875.1	7	.	.	.	.	.	.	.	.	.	.	A	10.36	1.328983	0.24167	2.27E-4	0.0	ENSG00000127412	ENST00000265310;ENST00000439304;ENST00000442623	T;T;T	0.52057	0.68;0.68;0.68	4.32	3.11	0.35812	Ankyrin repeat-containing domain (3);	0.228496	0.47093	D	0.000260	T	0.36826	0.0981	N	0.10707	0.03	0.51482	D	0.999922	P;P	0.41080	0.605;0.737	P;B	0.50708	0.648;0.381	T	0.21552	-1.0242	10	0.41790	T	0.15	-15.3499	9.9603	0.41693	0.8287:0.1713:0.0:0.0	.	112;112	E9PBZ6;Q9NQA5	.;TRPV5_HUMAN	R	112;106;112	ENSP00000265310:C112R;ENSP00000406361:C106R;ENSP00000406572:C112R	ENSP00000265310:C112R	C	-	1	0	TRPV5	142337290	0.993000	0.37304	0.291000	0.24904	0.008000	0.06430	3.138000	0.50570	0.757000	0.33036	0.379000	0.24179	TGT	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV5/TRPV6,tigrfam_TRP_channel		0.547	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV5	protein_coding	OTTHUMT00000347660.1	A	NM_019841	-		142627168	-1	no_errors	ENST00000265310	ensembl	human	known	74_37	missense	SNP	0.779	G
CNTNAP2	26047	genome.wustl.edu	37	7	148080943	148080943	+	Silent	SNP	C	C	T	rs201219937	byFrequency	TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr7:148080943C>T	ENST00000361727.3	+	22	4194	c.3678C>T	c.(3676-3678)tcC>tcT	p.S1226S	CNTNAP2_ENST00000463592.2_3'UTR|CNTNAP2_ENST00000538075.1_Silent_p.S285S	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	1226					adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CCATGTCGTCCGCCACCGACC	0.597										HNSCC(39;0.1)																																							0								ENSG00000174469						22.0	23.0	23.0					7																	148080943		2203	4300	6503	CNTNAP2	SO:0001819	synonymous_variant	0			-	HGNC	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.3678C>T	7.37:g.148080943C>T		Somatic	0	42	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	66	18.52	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,pfam_EG-like_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.S1226	ENST00000361727.3	37	c.3678	CCDS5889.1	7																																																																																			-	NULL		0.597	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	protein_coding	OTTHUMT00000327668.1	C		-		148080943	+1	no_errors	ENST00000361727	ensembl	human	known	74_37	silent	SNP	0.004	T
PCDHA6	56142	genome.wustl.edu	37	5	140208762	140208762	+	Silent	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr5:140208762C>T	ENST00000529310.1	+	1	1200	c.1086C>T	c.(1084-1086)gaC>gaT	p.D362D	PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Silent_p.D362D|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	362	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACGTGAAGACGCTCAATTTG	0.498																																																	0								ENSG00000081842						116.0	112.0	113.0					5																	140208762		2203	4297	6500	PCDHA6	SO:0001819	synonymous_variant	0			-	HGNC	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1086C>T	5.37:g.140208762C>T		Somatic	0	70	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	40	23.08	O75283|Q9NRT8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D362	ENST00000529310.1	37	c.1086	CCDS47281.1	5																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.498	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA6	protein_coding	OTTHUMT00000372829.3	C	NM_018909	-		140208762	+1	no_errors	ENST00000529310	ensembl	human	known	74_37	silent	SNP	0.935	T
C10orf54	64115	genome.wustl.edu	37	10	73521633	73521633	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr10:73521633C>T	ENST00000394957.3	-	2	291	c.233G>A	c.(232-234)gGc>gAc	p.G78D	C10orf54_ENST00000481568.2_5'UTR|CDH23_ENST00000224721.6_Intron	NM_022153.1	NP_071436.1	Q9H7M9	GI24_HUMAN	chromosome 10 open reading frame 54	78	Ig-like.				BMP signaling pathway (GO:0030509)|negative regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000562)|negative regulation of T cell cytokine production (GO:0002725)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of stem cell differentiation (GO:2000738)|stem cell differentiation (GO:0048863)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|endometrium(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	9						CTGCACCTCGCCCCTCGAGCT	0.647																																																	0								ENSG00000107738						104.0	91.0	95.0					10																	73521633		2203	4300	6503	C10orf54	SO:0001583	missense	0			-	HGNC	AF193048	CCDS31218.1	10q22.1	2013-11-28			ENSG00000107738	ENSG00000107738		"""Immunoglobulin superfamily / V-set domain containing"""	30085	protein-coding gene	gene with protein product	"""stress induced secreted protein 1"""	615608				12975309	Standard	NM_022153		Approved	SISP1, GI24, B7-H5, B7H5	uc001jsd.3	Q9H7M9	OTTHUMG00000018426	ENST00000394957.3:c.233G>A	10.37:g.73521633C>T	ENSP00000378409:p.Gly78Asp	Somatic	0	24	0.00		0.6257302807660841	71	12.35	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	17	43.33	A1L0X9|A4ZYV1|A8MVH5|Q6UXF3|Q8WUG3|Q8WYZ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.G78D	ENST00000394957.3	37	c.233	CCDS31218.1	10	.	.	.	.	.	.	.	.	.	.	C	15.58	2.876501	0.51801	.	.	ENSG00000107738	ENST00000394957;ENST00000263569	T	0.02863	4.13	4.46	4.46	0.54185	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.573727	0.21247	N	0.077720	T	0.10766	0.0263	M	0.65975	2.015	0.09310	N	0.999999	D;D	0.69078	0.997;0.983	D;P	0.63283	0.913;0.709	T	0.04781	-1.0927	10	0.36615	T	0.2	-7.9643	13.1341	0.59399	0.0:0.8388:0.1612:0.0	.	74;78	Q2TA85;Q9H7M9	.;GI24_HUMAN	D	78;74	ENSP00000378409:G78D	ENSP00000263569:G74D	G	-	2	0	C10orf54	73191639	0.034000	0.19679	0.114000	0.21550	0.949000	0.60115	3.268000	0.51585	2.767000	0.95098	0.655000	0.94253	GGC	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom		0.647	C10orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf54	protein_coding	OTTHUMT00000048548.1	C	NM_022153	-		73521633	-1	no_errors	ENST00000394957	ensembl	human	known	74_37	missense	SNP	0.018	T
KIR3DX1	90011	genome.wustl.edu	37	19	55048149	55048149	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr19:55048149A>C	ENST00000335056.3	+	5	754	c.716A>C	c.(715-717)aAg>aCg	p.K239T	KIR3DX1_ENST00000482404.1_3'UTR			Q9H7L2	KI3X1_HUMAN	killer cell immunoglobulin-like receptor, three domains, X1	239	Ig-like C2-type 2.					extracellular region (GO:0005576)				endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|pancreas(1)|skin(1)	24				GBM - Glioblastoma multiforme(193;0.099)		CTGGGAGAGAAGTTGACCCTC	0.507											OREG0003665	type=REGULATORY REGION|Gene=BC033195|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									Colon(183;529 2002 28270 32358 35845)|Esophageal Squamous(50;443 1006 2278 10294 37938)												0								ENSG00000104970						68.0	69.0	68.0					19																	55048149		1918	4138	6056	KIR3DX1	SO:0001583	missense	0			-	HGNC	BC033195		19q13.42	2013-03-26	2006-09-12	2006-09-12	ENSG00000104970	ENSG00000104970		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	25043	other	unknown			"""leukocyte receptor cluster (LRC) member 12"""	LENG12		11441184	Standard	NR_026716		Approved	FLJ00060	uc010erm.2	Q9H7L2	OTTHUMG00000065696	ENST00000335056.3:c.716A>C	19.37:g.55048149A>C	ENSP00000335388:p.Lys239Thr	Somatic	0	47	0.00	1004	0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	30	25.00	B7WNL0|Q8N0S4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom	p.K239T	ENST00000335056.3	37	c.716		19	.	.	.	.	.	.	.	.	.	.	A	9.046	0.990847	0.18966	.	.	ENSG00000104970	ENST00000335056	T	0.00664	5.92	1.9	0.79	0.18613	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00815	0.0027	.	.	.	0.09310	N	1	B	0.22276	0.067	B	0.27380	0.079	T	0.47355	-0.9124	8	0.87932	D	0	.	4.6775	0.12719	0.6643:0.3357:0.0:0.0	.	239	Q9H7L2	KI3X1_HUMAN	T	239	ENSP00000335388:K239T	ENSP00000221567:K239T	K	+	2	0	KIR3DX1	59739961	0.013000	0.17824	0.059000	0.19551	0.009000	0.06853	0.478000	0.22212	0.175000	0.19841	0.528000	0.53228	AAG	-	smart_Ig_sub,pfscan_Ig-like_dom		0.507	KIR3DX1-002	KNOWN	basic|appris_principal	protein_coding	KIR3DX1	protein_coding	OTTHUMT00000140800.2	A	NR_026716	-		55048149	+1	no_errors	ENST00000335056	ensembl	human	known	74_37	missense	SNP	0.063	C
ANK3	288	genome.wustl.edu	37	10	61834026	61834026	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr10:61834026G>T	ENST00000280772.2	-	37	6804	c.6613C>A	c.(6613-6615)Cca>Aca	p.P2205T	ANK3_ENST00000355288.2_Intron|ANK3_ENST00000503366.1_Intron|ANK3_ENST00000373827.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2205					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GTGGGCTTTGGTTCCAATTCC	0.443																																																	0								ENSG00000151150						138.0	136.0	137.0					10																	61834026		2203	4300	6503	ANK3	SO:0001583	missense	0			-	HGNC	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.6613C>A	10.37:g.61834026G>T	ENSP00000280772:p.Pro2205Thr	Somatic	0	34	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	16	30.43	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.P2205T	ENST00000280772.2	37	c.6613	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	G	11.17	1.560586	0.27827	.	.	ENSG00000151150	ENST00000280772	T	0.62364	0.03	6.05	4.06	0.47325	.	0.000000	0.41605	D	0.000847	T	0.52468	0.1736	L	0.48642	1.525	0.80722	D	1	B	0.27625	0.183	B	0.22386	0.039	T	0.52682	-0.8543	10	0.42905	T	0.14	.	12.0451	0.53475	0.0662:0.1208:0.813:0.0	.	2205	Q12955	ANK3_HUMAN	T	2205	ENSP00000280772:P2205T	ENSP00000280772:P2205T	P	-	1	0	ANK3	61504032	0.995000	0.38212	0.994000	0.49952	0.657000	0.38888	2.402000	0.44521	2.875000	0.98604	0.643000	0.83706	CCA	-	NULL		0.443	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	protein_coding	OTTHUMT00000048201.4	G	NM_020987	-		61834026	-1	no_errors	ENST00000280772	ensembl	human	known	74_37	missense	SNP	0.998	T
HPSE2	60495	genome.wustl.edu	37	10	100242511	100242511	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr10:100242511G>T	ENST00000370552.3	-	11	1554	c.1495C>A	c.(1495-1497)Ctt>Att	p.L499I	HPSE2_ENST00000404542.1_Missense_Mutation_p.L387I|HPSE2_ENST00000370549.1_Missense_Mutation_p.L441I|HPSE2_ENST00000370546.1_Missense_Mutation_p.L499I	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	499					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		ATGATAAAAAGTGTAATGGAC	0.433																																																	0								ENSG00000172987						109.0	96.0	100.0					10																	100242511		2203	4300	6503	HPSE2	SO:0001583	missense	0			-	HGNC	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.1495C>A	10.37:g.100242511G>T	ENSP00000359583:p.Leu499Ile	Somatic	0	45	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	34	24.44	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_79,superfamily_Glycoside_hydrolase_SF	p.L499I	ENST00000370552.3	37	c.1495	CCDS7477.1	10	.	.	.	.	.	.	.	.	.	.	G	13.53	2.264929	0.40095	.	.	ENSG00000172987	ENST00000370552;ENST00000370549;ENST00000370546;ENST00000404542	T;T;T;T	0.49720	0.77;0.82;1.06;0.79	5.34	5.34	0.76211	.	0.073806	0.52532	D	0.000080	T	0.34395	0.0896	N	0.20845	0.615	0.48288	D	0.99962	B;B;B;B	0.20052	0.041;0.021;0.037;0.002	B;B;B;B	0.21151	0.033;0.022;0.028;0.008	T	0.08994	-1.0695	10	0.33141	T	0.24	-6.9312	14.6935	0.69103	0.0716:0.0:0.9284:0.0	.	387;499;441;499	Q8WWQ2-4;Q8WWQ2-2;Q8WWQ2-3;Q8WWQ2	.;.;.;HPSE2_HUMAN	I	499;441;499;387	ENSP00000359583:L499I;ENSP00000359580:L441I;ENSP00000359577:L499I;ENSP00000384384:L387I	ENSP00000359577:L499I	L	-	1	0	HPSE2	100232501	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	4.381000	0.59587	2.677000	0.91161	0.655000	0.94253	CTT	-	NULL		0.433	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HPSE2	protein_coding	OTTHUMT00000049789.1	G	NM_021828	-		100242511	-1	no_errors	ENST00000370552	ensembl	human	known	74_37	missense	SNP	1.000	T
LRP2	4036	genome.wustl.edu	37	2	170062573	170062573	+	Missense_Mutation	SNP	C	C	T	rs199918722		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr2:170062573C>T	ENST00000263816.3	-	40	7801	c.7516G>A	c.(7516-7518)Gtt>Att	p.V2506I		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2506					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GGTTTTGGAACGCGGGCTATC	0.423																																																	0								ENSG00000081479	C	ILE/VAL	0,4406		0,0,2203	153.0	148.0	150.0		7516	3.4	0.0	2		150	1,8599	1.2+/-3.3	0,1,4299	no	missense	LRP2	NM_004525.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	2506/4656	170062573	1,13005	2203	4300	6503	LRP2	SO:0001583	missense	0			-	HGNC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.7516G>A	2.37:g.170062573C>T	ENSP00000263816:p.Val2506Ile	Somatic	0	18	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	2	88.89	O00711|Q16215	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.V2506I	ENST00000263816.3	37	c.7516	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	15.33	2.800845	0.50315	0.0	1.16E-4	ENSG00000081479	ENST00000263816	D	0.93488	-3.23	6.17	3.37	0.38596	Six-bladed beta-propeller, TolB-like (1);	0.108694	0.64402	N	0.000007	D	0.84534	0.5493	N	0.16307	0.4	0.80722	D	1	B	0.31054	0.306	B	0.19391	0.025	T	0.78168	-0.2309	10	0.36615	T	0.2	.	10.2735	0.43497	0.2446:0.6928:0.0:0.0625	.	2506	P98164	LRP2_HUMAN	I	2506	ENSP00000263816:V2506I	ENSP00000263816:V2506I	V	-	1	0	LRP2	169770819	1.000000	0.71417	0.002000	0.10522	0.810000	0.45777	6.093000	0.71422	0.454000	0.26884	0.655000	0.94253	GTT	-	smart_LDLR_classB_rpt		0.423	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	protein_coding	OTTHUMT00000255231.2	C	NM_004525	rs199918722		170062573	-1	no_errors	ENST00000263816	ensembl	human	known	74_37	missense	SNP	0.815	T
ZNF37A	7587	genome.wustl.edu	37	10	38406967	38406967	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr10:38406967delA	ENST00000361085.5	+	7	1233	c.888delA	c.(886-888)ggafs	p.G296fs	ZNF37A_ENST00000351773.3_Frame_Shift_Del_p.G296fs	NM_001178101.1|NM_003421.2	NP_001171572.1|NP_003412.1	P17032	ZN37A_HUMAN	zinc finger protein 37A	296					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|prostate(1)	28						ACACAGGGGGAAAACCCTATG	0.413																																																	0								ENSG00000075407						68.0	71.0	70.0					10																	38406967		2203	4298	6501	ZNF37A	SO:0001589	frameshift_variant	0				HGNC	X69115	CCDS31183.1	10p11.2	2013-01-08	2006-05-11		ENSG00000075407	ENSG00000075407		"""Zinc fingers, C2H2-type"", ""-"""	13102	protein-coding gene	gene with protein product			"""zinc finger protein 37a (KOX 21)"""			2014798, 8464732	Standard	NM_001178101		Approved	KOX21, ZNF37	uc001izl.3	P17032	OTTHUMG00000017990	ENST00000361085.5:c.888delA	10.37:g.38406967delA	ENSP00000354377:p.Gly296fs	Somatic	0	53	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	19	9.52	B3KRQ3|D3DRZ3|Q96B88	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K297fs	ENST00000361085.5	37	c.888	CCDS31183.1	10																																																																																			-	pfscan_Znf_C2H2		0.413	ZNF37A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF37A	protein_coding	OTTHUMT00000047624.2	A	NM_003421			38406967	+1	no_errors	ENST00000351773	ensembl	human	known	74_37	frame_shift_del	DEL	0.714	-
SNORD3B-1	26851	genome.wustl.edu	37	17	18967389	18967390	+	lincRNA	INS	-	-	ACGTTCAGAGAA	rs201644392		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr17:18967389_18967390insACGTTCAGAGAA	ENST00000363359.1	+	0	432				SNORD3B-2_ENST00000364880.1_lincRNA					small nucleolar RNA, C/D box 3B-1																		cggtgctctacacgttcagaga	0.505																																																	0								ENSG00000262074																																			SNORD3B-2			0				HGNC	AF020534, AF020533, AF020532		17p11.2	2013-09-05	2006-11-28	2006-11-28	ENSG00000200229	ENSG00000265185			10168	non-coding RNA	RNA, small nucleolar			"""RNA, U3A1 small nucleolar, RNA, U3A1 small nucleolar"""	RNU3A1		9365252	Standard	NR_003271		Approved	U3a, U3b1, U3b2					17.37:g.18967389_18967390insACGTTCAGAGAA		Somatic	NA	NA	NA		0.6257302807660841	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000363359.1	37	NULL		17																																																																																			-	-		0.505	SNORD3B-1-201	KNOWN	basic	snoRNA	SNORD3B-2	lincRNA		-	NR_003271			18967390	-1	no_errors	ENST00000364880	ensembl	human	known	74_37	rna	INS	0.247:0.254	ACGTTCAGAGAA
KB-7G2.8	0	genome.wustl.edu	37	22	17160294	17160294	+	lincRNA	DEL	T	T	-	rs532871216|rs143230585|rs201117403		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr22:17160294delT	ENST00000423580.2	-	0	547				ANKRD62P1-PARP4P3_ENST00000338526.6_RNA																							GAAATTTTACTTTTAAGTCGT	0.318																																																	0								ENSG00000189295																																			ANKRD62P1-PARP4P3			0				HGNC																													22.37:g.17160294delT		Somatic	0	22	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	12	36.84		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000423580.2	37	NULL		22																																																																																			-	-		0.318	KB-7G2.8-001	KNOWN	basic|readthrough_transcript	processed_transcript	ANKRD62P1-PARP4P3	lincRNA	OTTHUMT00000418976.1	T				17160294	-1	no_errors	ENST00000338526	ensembl	human	known	74_37	rna	DEL	0.185	-
FAM208B	54906	genome.wustl.edu	37	10	5756021	5756022	+	Intron	INS	-	-	AAA	rs538801926|rs114548935|rs201086813|rs34237123|rs199937653|rs3834899	byFrequency	TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr10:5756021_5756022insAAA	ENST00000328090.5	+	2	434				RP11-336A10.2_ENST00000411512.2_RNA|RP11-336A10.2_ENST00000596567.1_RNA|FAM208B_ENST00000463468.1_Intron	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B																		aaaataaaaTTAAAAAAAAAAA	0.356																																																	0								ENSG00000226647																																			RP11-336A10.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.-192+1140->AAA	10.37:g.5756028_5756030dupAAA		Somatic	0	42	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000328090.5	37	NULL	CCDS41485.1	10																																																																																			-	-		0.356	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000226647	protein_coding	OTTHUMT00000046571.2	-	NM_017782			5756022	-1	no_errors	ENST00000596567	ensembl	human	known	74_37	rna	INS	0.007:0.000	AAA
MMRN2	79812	genome.wustl.edu	37	10	88717176	88717176	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr10:88717176C>T	ENST00000372027.5	-	1	444	c.123G>A	c.(121-123)tgG>tgA	p.W41*	SNCG_ENST00000348795.4_5'Flank|SNCG_ENST00000372017.3_5'Flank	NM_024756.2	NP_079032.2	Q9H8L6	MMRN2_HUMAN	multimerin 2	41					angiogenesis (GO:0001525)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|stomach(1)	19						CCTCTGCCTTCCAGACCCCAG	0.652																																																	0								ENSG00000173269						99.0	99.0	99.0					10																	88717176		2203	4300	6503	MMRN2	SO:0001587	stop_gained	0			-	HGNC	AK023527	CCDS7379.1	10q23.31	2004-03-10	2004-03-02	2004-03-02	ENSG00000173269	ENSG00000173269		"""EMI domain containing"""	19888	protein-coding gene	gene with protein product		608925	"""elastin microfibril interfacer 3"""	EMILIN3		11559704	Standard	NM_024756		Approved	EndoGlyx-1, FLJ13465	uc001kea.3	Q9H8L6	OTTHUMG00000018663	ENST00000372027.5:c.123G>A	10.37:g.88717176C>T	ENSP00000361097:p.Trp41*	Somatic	0	68	0.00		0.6257302807660841	34	2.86	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	13	53.57	Q504V7|Q6P2N2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C1q,pfam_EMI_domain,superfamily_Tumour_necrosis_fac-like_dom,superfamily_tRNA-bd_arm,smart_C1q,prints_C1q,pfscan_C1q,pfscan_EMI_domain	p.W41*	ENST00000372027.5	37	c.123	CCDS7379.1	10	.	.	.	.	.	.	.	.	.	.	C	20.7	4.029177	0.75504	.	.	ENSG00000173269	ENST00000372027;ENST00000443699	.	.	.	3.99	1.08	0.20341	.	0.566996	0.16172	N	0.226231	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-3.8335	3.4482	0.07488	0.2002:0.5839:0.0:0.2159	.	.	.	.	X	41	.	ENSP00000361097:W41X	W	-	3	0	MMRN2	88707156	0.222000	0.23652	0.002000	0.10522	0.090000	0.18270	1.169000	0.31871	0.240000	0.21263	0.462000	0.41574	TGG	-	NULL		0.652	MMRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMRN2	protein_coding	OTTHUMT00000049179.2	C	NM_024756	-		88717176	-1	no_errors	ENST00000372027	ensembl	human	known	74_37	nonsense	SNP	0.002	T
GALNT18	374378	genome.wustl.edu	37	11	11454275	11454275	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr11:11454275A>T	ENST00000227756.4	-	3	899	c.488T>A	c.(487-489)gTc>gAc	p.V163D		NM_198516.2	NP_940918.2	Q6P9A2	GLT18_HUMAN	polypeptide N-acetylgalactosaminyltransferase 18	163	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										CGCTTCATTGACGAAGATGAA	0.542																																																	0								ENSG00000110328						101.0	85.0	90.0					11																	11454275		2201	4294	6495	GALNT18	SO:0001583	missense	0			-	HGNC	AK055111	CCDS7807.1	11p15	2014-03-13	2014-03-13	2013-01-25	ENSG00000110328	ENSG00000110328	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	30488	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 18"""	615136	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18"""	GALNTL4		22186971	Standard	NM_198516		Approved	MGC71806, GALNT15, GalNAc-T18	uc001mjo.2	Q6P9A2	OTTHUMG00000165707	ENST00000227756.4:c.488T>A	11.37:g.11454275A>T	ENSP00000227756:p.Val163Asp	Somatic	0	39	0.00		0.6257302807660841	31	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	O95903|Q8NDY9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.V163D	ENST00000227756.4	37	c.488	CCDS7807.1	11	.	.	.	.	.	.	.	.	.	.	A	14.28	2.486934	0.44249	.	.	ENSG00000110328	ENST00000227756	T	0.61510	0.1	5.78	4.65	0.58169	Glycosyl transferase, family 2 (1);	0.000000	0.64402	D	0.000002	T	0.67401	0.2889	M	0.83012	2.62	0.80722	D	1	P	0.38250	0.624	P	0.46885	0.53	T	0.67133	-0.5747	10	0.42905	T	0.14	.	10.6771	0.45792	0.9247:0.0:0.0753:0.0	.	163	Q6P9A2	GLTL4_HUMAN	D	163	ENSP00000227756:V163D	ENSP00000227756:V163D	V	-	2	0	GALNTL4	11410851	1.000000	0.71417	0.981000	0.43875	0.085000	0.17905	7.327000	0.79147	1.020000	0.39573	-0.250000	0.11733	GTC	-	pfam_Glyco_trans_2		0.542	GALNT18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT18	protein_coding	OTTHUMT00000385848.1	A	NM_198516	-		11454275	-1	no_errors	ENST00000227756	ensembl	human	known	74_37	missense	SNP	1.000	T
TSPAN18	90139	genome.wustl.edu	37	11	44925357	44925357	+	Intron	SNP	G	G	A	rs200807307		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr11:44925357G>A	ENST00000520358.2	+	4	405				TSPAN18_ENST00000340160.3_Intron			Q96SJ8	TSN18_HUMAN	tetraspanin 18							integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(6)|lung(3)	10						Aagctggattgcctgggttcc	0.502																																																	0								ENSG00000175274																																			TP53I11	SO:0001627	intron_variant	0			-	HGNC	AY358087	CCDS7910.1	11p11.2	2013-02-14				ENSG00000157570		"""Tetraspanins"""	20660	protein-coding gene	gene with protein product						11756464	Standard	NM_130783		Approved	TSPAN	uc001mye.4	Q96SJ8		ENST00000520358.2:c.-10-2601G>A	11.37:g.44925357G>A		Somatic	0	60	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	64	13.51	Q6UY44|Q8NBI9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A140V	ENST00000520358.2	37	c.419	CCDS7910.1	11																																																																																			-	NULL		0.502	TSPAN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53I11	protein_coding	OTTHUMT00000376197.3	G	NM_130783	-		44925357	-1	no_errors	ENST00000354556	ensembl	human	known	74_37	missense	SNP	0.001	A
CDH12	1010	genome.wustl.edu	37	5	22142560	22142560	+	Intron	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr5:22142560C>T	ENST00000382254.1	-	5	901				CDH12_ENST00000504376.2_Intron|RP11-855C21.1_ENST00000524042.1_RNA|CDH12_ENST00000522262.1_Intron|PMCHL1_ENST00000418902.1_RNA	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						AAAACCTTATCTTGCACTAGA	0.383										HNSCC(59;0.17)																																							0								ENSG00000168967																																			PMCHL1	SO:0001627	intron_variant	0			-	HGNC	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.186-63589G>A	5.37:g.22142560C>T		Somatic	0	86	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	110	14.73	B2RBT1|B7Z2U6|Q86UD2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000382254.1	37	NULL	CCDS3890.1	5																																																																																			-	-		0.383	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMCHL1	protein_coding	OTTHUMT00000207139.1	C	NM_004061	-		22142560	+1	no_errors	ENST00000418902	ensembl	human	known	74_37	rna	SNP	0.975	T
FTMT	94033	genome.wustl.edu	37	5	121187750	121187750	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr5:121187750G>A	ENST00000321339.1	+	1	101	c.92G>A	c.(91-93)cGt>cAt	p.R31H		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	31					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		CTCCCGCTGCGTTGGGCCCCG	0.771																																																	0								ENSG00000181867						10.0	11.0	11.0					5																	121187750		2179	4259	6438	FTMT	SO:0001583	missense	0			-	HGNC	BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.92G>A	5.37:g.121187750G>A	ENSP00000313691:p.Arg31His	Somatic	0	24	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	14	30.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ferritin_DPS_dom,superfamily_Ferritin-like_SF,pfscan_Ferritin-like_diiron	p.R31H	ENST00000321339.1	37	c.92	CCDS4128.1	5	.	.	.	.	.	.	.	.	.	.	G	11.72	1.724205	0.30593	.	.	ENSG00000181867	ENST00000321339	T	0.65549	-0.16	3.06	2.16	0.27623	.	.	.	.	.	T	0.49201	0.1543	N	0.19112	0.55	0.09310	N	1	D	0.69078	0.997	P	0.47603	0.551	T	0.32188	-0.9916	9	0.31617	T	0.26	.	9.5278	0.39175	0.0:0.0:0.7879:0.212	.	31	Q8N4E7	FTMT_HUMAN	H	31	ENSP00000313691:R31H	ENSP00000313691:R31H	R	+	2	0	FTMT	121215649	0.001000	0.12720	0.135000	0.22099	0.006000	0.05464	0.447000	0.21710	0.813000	0.34350	0.650000	0.86243	CGT	-	NULL		0.771	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTMT	protein_coding	OTTHUMT00000250884.1	G	NM_177478	-		121187750	+1	no_errors	ENST00000321339	ensembl	human	known	74_37	missense	SNP	0.371	A
GUCY2F	2986	genome.wustl.edu	37	X	108708524	108708524	+	Silent	SNP	G	G	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chrX:108708524G>T	ENST00000218006.2	-	3	1170	c.879C>A	c.(877-879)acC>acA	p.T293T		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	293					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						CCCGGTAGGGGGTGTGCTTAT	0.468																																																	0								ENSG00000101890						151.0	123.0	132.0					X																	108708524		2203	4300	6503	GUCY2F	SO:0001819	synonymous_variant	0			-	HGNC	L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.879C>A	X.37:g.108708524G>T		Somatic	0	36	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	42	37.31	Q9UJF1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Haem_no_assoc-bd,superfamily_Peripla_BP_I,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase	p.T293	ENST00000218006.2	37	c.879	CCDS14545.1	X																																																																																			-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I		0.468	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2F	protein_coding	OTTHUMT00000057884.1	G	NM_001522	-		108708524	-1	no_errors	ENST00000218006	ensembl	human	known	74_37	silent	SNP	0.978	T
TFDP1	7027	genome.wustl.edu	37	13	114294576	114294576	+	Silent	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr13:114294576C>T	ENST00000375370.5	+	12	1439	c.1227C>T	c.(1225-1227)gaC>gaT	p.D409D	TFDP1_ENST00000544902.1_Silent_p.D380D|TFDP1_ENST00000538138.1_Silent_p.D310D	NM_007111.4	NP_009042.1	Q14186	TFDP1_HUMAN	transcription factor Dp-1	409	Asp/Glu-rich (acidic; NCB domain).				anoikis (GO:0043276)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|epidermis development (GO:0008544)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA biosynthetic process (GO:2000278)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)			atgacgaggacgactgacgTC	0.512										TSP Lung(29;0.18)																																							0								ENSG00000198176						38.0	33.0	35.0					13																	114294576		2203	4300	6503	TFDP1	SO:0001819	synonymous_variant	0			-	HGNC	BC011685	CCDS9538.1	13q34	2008-07-18			ENSG00000198176	ENSG00000198176			11749	protein-coding gene	gene with protein product		189902				8413592, 9027491	Standard	NM_007111		Approved	Dp-1, DRTF1, DP1	uc001vtw.3	Q14186	OTTHUMG00000017388	ENST00000375370.5:c.1227C>T	13.37:g.114294576C>T		Somatic	0	65	0.00		0.6257302807660841	179	31.42	82	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	69	43.44	B4DLQ9|Q5JSB4|Q8IZL5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Transc_factor_DP_C,pfam_E2F_TDP,pirsf_Transcrpt_fac_DP	p.D409	ENST00000375370.5	37	c.1227	CCDS9538.1	13																																																																																			-	NULL		0.512	TFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFDP1	protein_coding	OTTHUMT00000045918.3	C	NM_007111	-		114294576	+1	no_errors	ENST00000375370	ensembl	human	known	74_37	silent	SNP	0.006	T
KCNMA1	3778	genome.wustl.edu	37	10	79397243	79397243	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr10:79397243G>A	ENST00000286628.8	-	1	157	c.158C>T	c.(157-159)tCc>tTc	p.S53F	KCNMA1_ENST00000372443.1_Missense_Mutation_p.S53F|KCNMA1_ENST00000354353.5_Missense_Mutation_p.S53F|KCNMA1_ENST00000404771.3_Missense_Mutation_p.S53F|KCNMA1_ENST00000406533.3_Missense_Mutation_p.S53F|KCNMA1_ENST00000404857.1_Missense_Mutation_p.S53F|KCNMA1_ENST00000480683.1_Missense_Mutation_p.S53F|KCNMA1_ENST00000372440.1_Missense_Mutation_p.S53F|KCNMA1_ENST00000286627.5_Missense_Mutation_p.S53F|KCNMA1_ENST00000481070.1_Missense_Mutation_p.S53F	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	53	Poly-Ser.				blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	ggaagaggaggaggaagaaga	0.592																																																	0								ENSG00000156113						30.0	26.0	28.0					10																	79397243		2203	4300	6503	KCNMA1	SO:0001583	missense	0			-	HGNC	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.158C>T	10.37:g.79397243G>A	ENSP00000286628:p.Ser53Phe	Somatic	0	27	0.00		0.6257302807660841	7	30.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	42	23.64	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_RCK_N,prints_K_chnl_Ca-activ_BK_asu,prints_K_chnl	p.S53F	ENST00000286628.8	37	c.158		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.69|12.69	2.015079|2.015079	0.35511|0.35511	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372403|ENST00000372440;ENST00000457953;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857	.|T;T;T;T;D;T;T;T	.|0.85013	.|0.88;0.88;0.88;0.88;-1.93;0.88;0.88;0.88	3.33|3.33	1.41|1.41	0.22369|0.22369	.|.	.|0.806035	.|0.10124	.|U	.|0.712982	T|T	0.70561|0.70561	0.3238|0.3238	N|N	0.08118|0.08118	0|0	0.22292|0.22292	N|N	0.999229|0.999229	.|P;P;B;B;P;B;B	.|0.44090	.|0.712;0.81;0.006;0.028;0.826;0.011;0.006	.|B;B;B;B;B;B;B	.|0.43536	.|0.19;0.423;0.003;0.008;0.188;0.008;0.003	T|T	0.62115|0.62115	-0.6922|-0.6922	5|10	.|0.49607	.|T	.|0.09	0.0109|0.0109	4.7693|4.7693	0.13148|0.13148	0.2977:0.0:0.7023:0.0|0.2977:0.0:0.7023:0.0	.|.	.|53;53;53;53;53;53;53	.|D5MRH1;Q12791-6;B7ZMF5;Q12791-2;Q12791;Q12791-5;Q5SVJ7	.|.;.;.;.;KCMA1_HUMAN;.;.	S|F	4|53;27;53;53;27;53;53;53	.|ENSP00000361517:S53F;ENSP00000396608:S27F;ENSP00000361520:S53F;ENSP00000286627:S53F;ENSP00000286628:S27F;ENSP00000385552:S53F;ENSP00000346321:S53F;ENSP00000385806:S53F	.|ENSP00000286627:S53F	P|S	-|-	1|2	0|0	KCNMA1|KCNMA1	79067249|79067249	.|.	.|.	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	.|.	.|.	0.673000|0.673000	0.31224|0.31224	0.455000|0.455000	0.32223|0.32223	CCT|TCC	-	NULL		0.592	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	KCNMA1	protein_coding	OTTHUMT00000048885.3	G	NM_002247	-		79397243	-1	no_errors	ENST00000406533	ensembl	human	known	74_37	missense	SNP	0.999	A
MROH7	374977	genome.wustl.edu	37	1	55151962	55151962	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr1:55151962T>G	ENST00000421030.2	+	15	2837	c.2552T>G	c.(2551-2553)gTc>gGc	p.V851G	MROH7_ENST00000395690.2_Missense_Mutation_p.V851G|MROH7_ENST00000339553.5_Missense_Mutation_p.V851G|MROH7_ENST00000409996.1_Missense_Mutation_p.V419G|MROH7_ENST00000454855.2_Missense_Mutation_p.V369G|MROH7-TTC4_ENST00000414150.2_Missense_Mutation_p.V851G|MROH7_ENST00000545244.1_Missense_Mutation_p.V419G	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	851						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											CTCCTGTCCGTCAACAGCTGC	0.657																																																	0								ENSG00000271723						45.0	52.0	50.0					1																	55151962		2122	4236	6358	MROH7-TTC4	SO:0001583	missense	0			-	HGNC	AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.2552T>G	1.37:g.55151962T>G	ENSP00000396622:p.Val851Gly	Somatic	0	31	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	16	62.79	A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.V851G	ENST00000421030.2	37	c.2552	CCDS41342.2	1	.	.	.	.	.	.	.	.	.	.	T	13.06	2.124789	0.37533	.	.	ENSG00000184313	ENST00000421030;ENST00000545244;ENST00000414867;ENST00000339553;ENST00000409996;ENST00000454855;ENST00000395690	T;T;T;T;T;T	0.33438	1.5;3.47;1.41;1.5;1.5;1.41	4.97	4.97	0.65823	Armadillo-type fold (1);	0.299432	0.23902	N	0.043436	T	0.43411	0.1246	L	0.39147	1.195	0.43540	D	0.995839	D;B;P;D	0.76494	0.999;0.234;0.48;0.999	D;B;B;D	0.79108	0.992;0.14;0.118;0.992	T	0.18524	-1.0334	10	0.37606	T	0.19	-12.9887	10.9524	0.47336	0.0:0.0:0.0:1.0	.	851;851;419;851	F8W8P2;Q68CQ1;F5H7R4;Q68CQ1-9	.;HEAT8_HUMAN;.;.	G	851;419;880;851;419;369;851	ENSP00000396622:V851G;ENSP00000442333:V419G;ENSP00000343211:V851G;ENSP00000387048:V419G;ENSP00000401130:V369G;ENSP00000379044:V851G	ENSP00000343211:V851G	V	+	2	0	HEATR8	54924550	0.967000	0.33354	0.993000	0.49108	0.814000	0.46013	3.776000	0.55356	2.072000	0.62099	0.533000	0.62120	GTC	-	superfamily_ARM-type_fold		0.657	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH7-TTC4	protein_coding	OTTHUMT00000346978.1	T	NM_198547	-		55151962	+1	no_errors	ENST00000414150	ensembl	human	known	74_37	missense	SNP	0.997	G
HCAR2	338442	genome.wustl.edu	37	12	123187043	123187043	+	Missense_Mutation	SNP	G	G	A	rs201581105		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr12:123187043G>A	ENST00000328880.5	-	1	847	c.788C>T	c.(787-789)aCg>aTg	p.T263M	HCAR1_ENST00000356987.2_Intron|RP11-324E6.6_ENST00000543611.1_lincRNA	NM_177551.3	NP_808219.1	Q8TDS4	HCAR2_HUMAN	hydroxycarboxylic acid receptor 2	263					negative regulation of lipid catabolic process (GO:0050995)|neutrophil apoptotic process (GO:0001781)|positive regulation of adiponectin secretion (GO:0070165)|positive regulation of neutrophil apoptotic process (GO:0033031)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nicotinic acid receptor activity (GO:0070553)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	15					Niacin(DB00627)	ACAATTCTGCGTGCCCGAAGT	0.542																																																	0								ENSG00000182782	G	MET/THR	0,4406		0,0,2203	97.0	81.0	87.0		788	2.4	0.0	12		87	1,8599	1.2+/-3.3	0,1,4299	no	missense	HCAR2	NM_177551.3	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	263/364	123187043	1,13005	2203	4300	6503	HCAR2	SO:0001583	missense	0			-	HGNC	AY148884	CCDS9235.1	12q24.31	2012-08-08	2011-05-30	2011-05-30	ENSG00000182782	ENSG00000182782		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	24827	protein-coding gene	gene with protein product	"""niacin receptor 1"""	609163	"""G protein-coupled receptor 109A"""	GPR109A		21167710, 12522134, 12646212, 19141678, 18983141, 21454438	Standard	NM_177551		Approved	HCA2, HM74A, PUMAG, Puma-g, NIACR1	uc001ucx.1	Q8TDS4	OTTHUMG00000162722	ENST00000328880.5:c.788C>T	12.37:g.123187043G>A	ENSP00000375066:p.Thr263Met	Somatic	0	59	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	47	17.54	A0PJL5|A7LGG3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.T263M	ENST00000328880.5	37	c.788	CCDS9235.1	12	.	.	.	.	.	.	.	.	.	.	G	1.042	-0.678588	0.03378	0.0	1.16E-4	ENSG00000182782	ENST00000328880;ENST00000536970	T	0.72835	-0.69	4.41	2.44	0.29823	GPCR, rhodopsin-like superfamily (1);	0.606355	0.15248	N	0.272514	T	0.59059	0.2166	L	0.46157	1.445	0.09310	N	1	B	0.25235	0.121	B	0.29942	0.109	T	0.49293	-0.8955	10	0.34782	T	0.22	-4.49	3.4892	0.07632	0.2622:0.2125:0.5253:0.0	.	263	Q8TDS4	HCAR2_HUMAN	M	263	ENSP00000375066:T263M	ENSP00000375066:T263M	T	-	2	0	HCAR2	121752996	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-0.607000	0.05648	0.695000	0.31675	0.557000	0.71058	ACG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.542	HCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCAR2	protein_coding	OTTHUMT00000370202.1	G	NM_177551	-		123187043	-1	no_errors	ENST00000328880	ensembl	human	known	74_37	missense	SNP	0.001	A
MATK	4145	genome.wustl.edu	37	19	3778349	3778349	+	Silent	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr19:3778349G>A	ENST00000310132.6	-	14	1754	c.1356C>T	c.(1354-1356)ccC>ccT	p.P452P	MATK_ENST00000395045.2_Silent_p.P453P|MATK_ENST00000585778.1_Silent_p.P451P|MATK_ENST00000395040.2_Silent_p.P411P	NM_139355.2	NP_647612.1	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase	452	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	26		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		GGACGTGCACGGGGCCTGGAC	0.692																																																	0								ENSG00000007264						28.0	33.0	31.0					19																	3778349		2203	4294	6497	MATK	SO:0001819	synonymous_variant	0			-	HGNC	L18974	CCDS12113.1, CCDS12114.1, CCDS42468.1	19p13.3	2013-02-14						"""SH2 domain containing"""	6906	protein-coding gene	gene with protein product	"""Csk-homologous kinase"", ""tyrosine-protein kinase CTK"", ""protein kinase HYL"", ""hematopoietic consensus tyrosine-lacking kinase"", ""tyrosylprotein kinase"", ""hydroxyaryl-protein kinase"", ""Csk-type protein tyrosine kinase"", ""HYL tyrosine kinase"", ""tyrosine kinase MATK"", ""leukocyte carboxyl-terminal src kinase related"""	600038				8288563, 7530249	Standard	NM_139355		Approved	HYLTK, CTK, HYL, Lsk, CHK, HHYLTK, DKFZp434N1212, MGC1708, MGC2101	uc002lyt.3	P42679		ENST00000310132.6:c.1356C>T	19.37:g.3778349G>A		Somatic	0	79	0.00		0.6257302807660841	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	63	11	85.14	B3KNZ9|Q9NST8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.P453	ENST00000310132.6	37	c.1359	CCDS12114.1	19																																																																																			-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.692	MATK-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	MATK	protein_coding	OTTHUMT00000453639.1	G	NM_139355	-		3778349	-1	no_errors	ENST00000395045	ensembl	human	known	74_37	silent	SNP	0.000	A
KLK15	55554	genome.wustl.edu	37	19	51330315	51330315	+	Silent	SNP	C	C	T	rs559995592		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr19:51330315C>T	ENST00000598239.1	-	3	330	c.300G>A	c.(298-300)gcG>gcA	p.A100A	KLK15_ENST00000326856.4_Silent_p.A99A|KLK15_ENST00000416184.1_Silent_p.A100A|KLK15_ENST00000596931.1_Silent_p.A99A|KLK15_ENST00000301421.2_Silent_p.A100A	NM_017509.2	NP_059979.2	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15	100	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		GGTGGCTGCGCGCTTCGTAGC	0.672																																					Pancreas(140;10 2513 7143 9246)												0								ENSG00000174562						63.0	57.0	59.0					19																	51330315		2203	4298	6501	KLK15	SO:0001819	synonymous_variant	0			-	HGNC	AF242195	CCDS12805.1, CCDS12806.1, CCDS12806.2, CCDS62766.1	19q13.4	2008-02-05	2006-10-27			ENSG00000174562		"""Kallikreins"""	20453	protein-coding gene	gene with protein product		610601	"""kallikrein 15"""			11010966, 12439720, 16800724, 16800723	Standard	NM_017509		Approved	HSRNASPH, ACO, prostinogen	uc002ptl.3	Q9H2R5		ENST00000598239.1:c.300G>A	19.37:g.51330315C>T		Somatic	0	45	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	37	22.92	A0AUY8|Q15358|Q6ISI0|Q9H2R3|Q9H2R4|Q9H2R6|Q9HBG9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.A100	ENST00000598239.1	37	c.300	CCDS12805.1	19																																																																																			-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.672	KLK15-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK15	protein_coding	OTTHUMT00000465160.1	C	NM_017509	-		51330315	-1	no_errors	ENST00000598239	ensembl	human	known	74_37	silent	SNP	0.000	T
SEZ6L	23544	genome.wustl.edu	37	22	26688611	26688611	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr22:26688611G>A	ENST00000248933.6	+	2	429	c.334G>A	c.(334-336)Gcc>Acc	p.A112T	SEZ6L_ENST00000343706.4_Missense_Mutation_p.A112T|SEZ6L_ENST00000402979.1_5'UTR|SEZ6L_ENST00000360929.3_Missense_Mutation_p.A112T|SEZ6L_ENST00000529632.2_Missense_Mutation_p.A112T|SEZ6L_ENST00000403121.1_5'UTR|SEZ6L_ENST00000404234.3_Missense_Mutation_p.A112T			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	112					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						CCCCAAGCACGCCTTGCCCCC	0.647																																																	0								ENSG00000100095						43.0	36.0	39.0					22																	26688611		2203	4300	6503	SEZ6L	SO:0001583	missense	0			-	HGNC	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.334G>A	22.37:g.26688611G>A	ENSP00000248933:p.Ala112Thr	Somatic	0	128	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	224	11.02	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.A112T	ENST00000248933.6	37	c.334	CCDS13833.1	22	.	.	.	.	.	.	.	.	.	.	G	1.111	-0.658295	0.03454	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706	T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55	4.15	-7.7	0.01259	.	1.340970	0.05467	N	0.552354	T	0.10380	0.0254	N	0.08118	0	0.09310	N	0.999995	B;B;B;B;B;B	0.23891	0.001;0.001;0.009;0.093;0.001;0.001	B;B;B;B;B;B	0.12837	0.001;0.001;0.005;0.008;0.001;0.001	T	0.20009	-1.0288	10	0.13108	T	0.6	.	3.7933	0.08730	0.5686:0.1179:0.2071:0.1064	.	112;112;112;112;112;112	B7ZLJ8;B7ZLJ6;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;SE6L1_HUMAN	T	112	ENSP00000384772:A112T;ENSP00000437037:A112T;ENSP00000354185:A112T;ENSP00000248933:A112T;ENSP00000342661:A112T	ENSP00000248933:A112T	A	+	1	0	SEZ6L	25018611	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.512000	0.06313	-1.455000	0.01923	-0.300000	0.09419	GCC	-	NULL		0.647	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L	protein_coding	OTTHUMT00000320359.3	G		-		26688611	+1	no_errors	ENST00000248933	ensembl	human	known	74_37	missense	SNP	0.000	A
LHX5	64211	genome.wustl.edu	37	12	113906052	113906052	+	Silent	SNP	G	G	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr12:113906052G>T	ENST00000261731.3	-	3	1128	c.555C>A	c.(553-555)acC>acA	p.T185T		NM_022363.2	NP_071758.1	Q9H2C1	LHX5_HUMAN	LIM homeobox 5	185					cell proliferation in forebrain (GO:0021846)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|forebrain neuron differentiation (GO:0021879)|hippocampus development (GO:0021766)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	10						CCTTGATGGTGGTGCGGGGGC	0.677																																																	0								ENSG00000089116						103.0	89.0	94.0					12																	113906052		2203	4300	6503	LHX5	SO:0001819	synonymous_variant	0			-	HGNC	AF291181	CCDS9171.1	12q24.13	2014-01-15			ENSG00000089116	ENSG00000089116		"""Homeoboxes / LIM class"""	14216	protein-coding gene	gene with protein product		605992					Standard	NM_022363		Approved		uc001tvj.1	Q9H2C1	OTTHUMG00000169552	ENST00000261731.3:c.555C>A	12.37:g.113906052G>T		Somatic	0	41	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	16	30.43	Q32MA4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.T185	ENST00000261731.3	37	c.555	CCDS9171.1	12																																																																																			-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.677	LHX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHX5	protein_coding	OTTHUMT00000404788.3	G	NM_022363	-		113906052	-1	no_errors	ENST00000261731	ensembl	human	known	74_37	silent	SNP	1.000	T
PKHD1	5314	genome.wustl.edu	37	6	51747956	51747956	+	Missense_Mutation	SNP	C	C	T	rs148284341		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr6:51747956C>T	ENST00000371117.3	-	46	7560	c.7285G>A	c.(7285-7287)Gtc>Atc	p.V2429I	PKHD1_ENST00000340994.4_Missense_Mutation_p.V2429I	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2429					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CTTTCCAAGACGTCAATTCCA	0.368																																																	0								ENSG00000170927	C	ILE/VAL,ILE/VAL	0,4406		0,0,2203	92.0	79.0	83.0		7285,7285	3.1	1.0	6	dbSNP_134	83	2,8598	1.2+/-3.3	0,2,4298	no	missense,missense	PKHD1	NM_138694.3,NM_170724.2	29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign	2429/4075,2429/3397	51747956	2,13004	2203	4300	6503	PKHD1	SO:0001583	missense	0			-	HGNC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.7285G>A	6.37:g.51747956C>T	ENSP00000360158:p.Val2429Ile	Somatic	0	65	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	74	18.68	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.V2429I	ENST00000371117.3	37	c.7285	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	C	3.089	-0.187402	0.06299	0.0	2.33E-4	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	T;T	0.79033	-1.23;-1.23	5.6	3.13	0.36017	Pectin lyase fold/virulence factor (1);Pectin lyase fold (1);	0.208186	0.42053	N	0.000775	T	0.15998	0.0385	N	0.00621	-1.32	0.18873	N	0.999984	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.44112	-0.9349	10	0.02654	T	1	.	7.6221	0.28191	0.0:0.1854:0.0:0.8146	.	2429;2429;2429	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	I	2429	ENSP00000360158:V2429I;ENSP00000341097:V2429I	ENSP00000341097:V2429I	V	-	1	0	PKHD1	51855915	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	0.936000	0.28938	0.371000	0.24564	-0.383000	0.06682	GTC	-	superfamily_Pectin_lyase_fold/virulence,smart_PbH1		0.368	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	protein_coding	OTTHUMT00000040893.1	C	NM_138694	rs148284341		51747956	-1	no_errors	ENST00000371117	ensembl	human	known	74_37	missense	SNP	1.000	T
COL22A1	169044	genome.wustl.edu	37	8	139606332	139606332	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr8:139606332C>T	ENST00000303045.6	-	63	4989	c.4543G>A	c.(4543-4545)Ggc>Agc	p.G1515S	COL22A1_ENST00000435777.1_Missense_Mutation_p.G1495S|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1515	Collagen-like 15.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.G1515C(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCCATGGGGCCGGCCCGGCCT	0.652										HNSCC(7;0.00092)																																							1	Substitution - Missense(1)	lung(1)						ENSG00000169436						28.0	32.0	30.0					8																	139606332		2203	4300	6503	COL22A1	SO:0001583	missense	0			-	HGNC	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.4543G>A	8.37:g.139606332C>T	ENSP00000303153:p.Gly1515Ser	Somatic	0	90	0.00		0.6257302807660841	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	39	30.36	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.G1515S	ENST00000303045.6	37	c.4543	CCDS6376.1	8	.	.	.	.	.	.	.	.	.	.	C	25.5	4.648643	0.87958	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.99527	-6.09;-6.09	5.92	5.92	0.95590	.	0.000000	0.50627	D	0.000102	D	0.99680	0.9880	M	0.93763	3.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97924	1.0316	10	0.87932	D	0	.	19.3539	0.94402	0.0:1.0:0.0:0.0	.	1495;1515	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	S	1515;1495;1208	ENSP00000303153:G1515S;ENSP00000387655:G1495S	ENSP00000303153:G1515S	G	-	1	0	COL22A1	139675514	1.000000	0.71417	0.995000	0.50966	0.858000	0.48976	7.453000	0.80700	2.820000	0.97059	0.650000	0.86243	GGC	-	pfam_Collagen		0.652	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	protein_coding	OTTHUMT00000315905.2	C	XM_291257	-		139606332	-1	no_errors	ENST00000303045	ensembl	human	known	74_37	missense	SNP	1.000	T
CCDC144A	9720	genome.wustl.edu	37	17	16706243	16706243	+	3'UTR	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr17:16706243G>A	ENST00000443444.2	+	0	7388				USP32P1_ENST00000393005.2_RNA|RP11-219A15.4_ENST00000602730.1_RNA|RP11-219A15.1_ENST00000448331.3_3'UTR|RP11-219A15.2_ENST00000582895.1_lincRNA			A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A																		TGATTCTTACGGCATGGGCGA	0.353																																																	0								ENSG00000188933																																			USP32P1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000443444.2:c.*2964G>A	17.37:g.16706243G>A		Somatic	0	67	0.00		0.6257302807660841	71	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	94	17.54	O60311|Q6ZU57	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000443444.2	37	NULL	CCDS45621.1	17																																																																																			-	-		0.353	CCDC144A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP32P1	protein_coding		G		-		16706243	+1	no_errors	ENST00000341745	ensembl	human	known	74_37	rna	SNP	0.061	A
MYO5B	4645	genome.wustl.edu	37	18	47431168	47431168	+	Silent	SNP	C	C	T	rs372848572		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr18:47431168C>T	ENST00000285039.7	-	20	2744	c.2445G>A	c.(2443-2445)gcG>gcA	p.A815A	MYO5B_ENST00000324581.6_5'Flank	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	815	Arg-rich.|IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)	p.A815A(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		GCACCACAGCCGCTCTGATCC	0.622																																																	1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000167306	C		0,4006		0,0,2003	35.0	40.0	39.0		2445	-10.7	0.0	18		39	1,8321		0,1,4160	no	coding-synonymous	MYO5B	NM_001080467.2		0,1,6163	TT,TC,CC		0.012,0.0,0.0081		815/1849	47431168	1,12327	2003	4161	6164	MYO5B	SO:0001819	synonymous_variant	0			-	HGNC	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.2445G>A	18.37:g.47431168C>T		Somatic	0	110	0.00		0.6257302807660841	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	67	21.18	B0I1R3|Q0P656|Q9H6Y6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A815	ENST00000285039.7	37	c.2445	CCDS42436.1	18																																																																																			-	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS		0.622	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	protein_coding	OTTHUMT00000448515.2	C		-		47431168	-1	no_errors	ENST00000285039	ensembl	human	known	74_37	silent	SNP	0.001	T
GNPTAB	79158	genome.wustl.edu	37	12	102142886	102142886	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr12:102142886G>A	ENST00000299314.7	-	20	3948	c.3686C>T	c.(3685-3687)gCt>gTt	p.A1229V		NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	1229					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						TACCTGCTCAGCAAAAAATGA	0.318																																																	0								ENSG00000111670						99.0	100.0	100.0					12																	102142886		2203	4300	6503	GNPTAB	SO:0001583	missense	0			-	HGNC	AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.3686C>T	12.37:g.102142886G>A	ENSP00000299314:p.Ala1229Val	Somatic	0	34	0.00		0.6257302807660841	26	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DMAP1-bd,pfam_Notch_dom,pfam_DUF3184,superfamily_Notch_dom,smart_Notch_dom,pfscan_EF_hand_dom,pfscan_Notch_dom	p.A1229V	ENST00000299314.7	37	c.3686	CCDS9088.1	12	.	.	.	.	.	.	.	.	.	.	G	25.0	4.596982	0.87055	.	.	ENSG00000111670	ENST00000299314	D	0.96459	-4.02	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.96658	0.8909	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94613	0.7806	10	0.17369	T	0.5	-20.0654	20.0349	0.97554	0.0:0.0:1.0:0.0	.	1229	Q3T906	GNPTA_HUMAN	V	1229	ENSP00000299314:A1229V	ENSP00000299314:A1229V	A	-	2	0	GNPTAB	100667017	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.444000	0.97578	2.744000	0.94065	0.650000	0.86243	GCT	-	NULL		0.318	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTAB	protein_coding	OTTHUMT00000409182.1	G		-		102142886	-1	no_errors	ENST00000299314	ensembl	human	known	74_37	missense	SNP	1.000	A
KLF2	10365	genome.wustl.edu	37	19	16437824	16437824	+	Silent	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr19:16437824C>T	ENST00000248071.5	+	3	1157	c.1050C>T	c.(1048-1050)caC>caT	p.H350H	KLF2_ENST00000592003.1_Missense_Mutation_p.T78I|CTD-2562J15.6_ENST00000588799.1_RNA	NM_016270.2	NP_057354.1	Q9Y5W3	KLF2_HUMAN	Kruppel-like factor 2	350					cell morphogenesis (GO:0000902)|cellular response to cycloheximide (GO:0071409)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to peptide (GO:1901653)|cellular response to tumor necrosis factor (GO:0071356)|erythrocyte maturation (GO:0043249)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of interleukin-6 production (GO:0032715)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(3)|lung(1)|skin(1)	5						TGGCGCTGCACATGAAACGGC	0.697																																																	0								ENSG00000127528						33.0	24.0	27.0					19																	16437824		2202	4299	6501	KLF2	SO:0001819	synonymous_variant	0			-	HGNC	AF123344	CCDS12343.1	19p13.11	2013-10-15	2013-10-15		ENSG00000127528	ENSG00000127528		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6347	protein-coding gene	gene with protein product		602016	"""Kruppel-like factor 2 (lung)"""			10217429, 10458913	Standard	NM_016270		Approved	LKLF	uc002ndw.3	Q9Y5W3	OTTHUMG00000182330	ENST00000248071.5:c.1050C>T	19.37:g.16437824C>T		Somatic	0	55	0.00		0.6257302807660841	198	14.89	35	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	74	17.78	Q6IPC4|Q9UJS5|Q9UKR6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T78I	ENST00000248071.5	37	c.233	CCDS12343.1	19																																																																																			-	NULL		0.697	KLF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF2	protein_coding	OTTHUMT00000460562.1	C		-		16437824	+1	no_errors	ENST00000592003	ensembl	human	putative	74_37	missense	SNP	1.000	T
TBC1D7	51256	genome.wustl.edu	37	6	13307950	13307950	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr6:13307950G>T	ENST00000379300.3	-	6	790	c.547C>A	c.(547-549)Ctg>Atg	p.L183M	TBC1D7_ENST00000379307.2_Missense_Mutation_p.L156M|TBC1D7_ENST00000607532.1_5'UTR|TBC1D7_ENST00000343141.4_Missense_Mutation_p.L137M|TBC1D7_ENST00000607658.1_Missense_Mutation_p.L156M|TBC1D7_ENST00000356436.4_Missense_Mutation_p.L183M	NM_001143964.2|NM_016495.4	NP_001137436.1|NP_057579.1	Q9P0N9	TBCD7_HUMAN	TBC1 domain family, member 7	183	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				activation of Rho GTPase activity (GO:0032862)|negative regulation of cilium assembly (GO:1902018)|negative regulation of TOR signaling (GO:0032007)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of Rab GTPase activity (GO:0032851)|response to growth factor (GO:0070848)	ciliary basal body (GO:0036064)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)	22	Breast(50;0.0296)|Ovarian(93;0.0339)	all_hematologic(90;0.135)	Epithelial(50;0.0784)|BRCA - Breast invasive adenocarcinoma(129;0.13)|all cancers(50;0.21)			CCATCTTCCAGATTCAAGTAT	0.423																																																	0								ENSG00000145979						85.0	80.0	82.0					6																	13307950		2203	4300	6503	TBC1D7	SO:0001583	missense	0			-	HGNC	AF151073	CCDS4523.1, CCDS47376.1, CCDS58995.1	6p23	2013-07-10			ENSG00000145979	ENSG00000145979			21066	protein-coding gene	gene with protein product		612655				11042152, 17646400	Standard	XM_005249163		Approved	dJ257A7.3, FLJ32666	uc003nan.3	Q9P0N9	OTTHUMG00000014272	ENST00000379300.3:c.547C>A	6.37:g.13307950G>T	ENSP00000368602:p.Leu183Met	Somatic	0	39	0.00		0.6257302807660841	28	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	E7EV96|Q2TU37|Q53F44|Q5SZL7|Q86VM8|Q96MB8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.L183M	ENST00000379300.3	37	c.547	CCDS4523.1	6	.	.	.	.	.	.	.	.	.	.	G	19.10	3.762114	0.69763	.	.	ENSG00000145979	ENST00000334971;ENST00000356436;ENST00000379300;ENST00000379307;ENST00000343141;ENST00000452989;ENST00000450347;ENST00000422136;ENST00000446018;ENST00000420456	T;T;T;T;T;T;T;T;T	0.30981	2.71;2.71;2.71;1.92;2.71;2.71;2.71;2.71;1.51	6.17	5.31	0.75309	Rab-GAP/TBC domain (3);	0.130049	0.53938	D	0.000053	T	0.35941	0.0949	M	0.63428	1.95	0.41661	D	0.989183	P;D;P;B	0.54772	0.809;0.968;0.946;0.419	P;P;P;P	0.58331	0.575;0.837;0.672;0.475	T	0.11397	-1.0589	10	0.34782	T	0.22	-13.5968	14.5747	0.68238	0.0:0.0:0.7205:0.2795	.	137;156;156;183	Q2TU37;Q5SZL5;Q9P0N9-2;Q9P0N9	.;.;.;TBCD7_HUMAN	M	124;183;183;156;137;156;156;183;156;156	ENSP00000348813:L183M;ENSP00000368602:L183M;ENSP00000368609:L156M;ENSP00000343100:L137M;ENSP00000414292:L156M;ENSP00000404680:L156M;ENSP00000394425:L183M;ENSP00000417005:L156M;ENSP00000412102:L156M	ENSP00000334212:L124M	L	-	1	2	TBC1D7	13415929	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.355000	0.44107	1.643000	0.50594	-0.122000	0.15005	CTG	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom		0.423	TBC1D7-009	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D7	protein_coding	OTTHUMT00000039896.2	G	NM_016495	-		13307950	-1	no_errors	ENST00000356436	ensembl	human	known	74_37	missense	SNP	1.000	T
VASN	114990	genome.wustl.edu	37	16	4431389	4431391	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	CTG	CTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr16:4431389_4431391delCTG	ENST00000304735.3	+	2	666_668	c.511_513delCTG	c.(511-513)ctgdel	p.L174del	CORO7_ENST00000251166.4_Intron|CORO7_ENST00000539968.1_Intron|CORO7_ENST00000537233.2_Intron|CORO7-PAM16_ENST00000572467.1_Intron|CORO7_ENST00000574025.1_Intron|CORO7_ENST00000423908.2_Intron	NM_138440.2	NP_612449.2	Q6EMK4	VASN_HUMAN	vasorin	174					cellular response to hypoxia (GO:0071456)|cellular response to redox state (GO:0071461)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	transforming growth factor beta binding (GO:0050431)			breast(1)|lung(3)|prostate(1)|skin(1)	6						CCTGCCCCGCCTGCTGCTGCTGG	0.704																																																	0								ENSG00000168140		,,,,	13,3925		1,11,1957					,,,,	4.8	1.0			8	53,7679		3,47,3816	no	coding,intron,intron,intron,intron	CORO7,VASN,CORO7-PAM16	NM_138440.2,NM_024535.4,NM_001201479.1,NM_001201473.1,NM_001201472.1	,,,,	4,58,5773	A1A1,A1R,RR		0.6855,0.3301,0.5656	,,,,	,,,,		66,11604				VASN	SO:0001651	inframe_deletion	0				HGNC	AY358299	CCDS10514.1	16p13.3	2008-02-05	2006-03-30	2006-03-30	ENSG00000168140	ENSG00000168140			18517	protein-coding gene	gene with protein product		608843	"""slit-like 2 (Drosophila)"""	SLITL2		15247411	Standard	NM_138440		Approved		uc002cwj.1	Q6EMK4	OTTHUMG00000129469	ENST00000304735.3:c.511_513delCTG	16.37:g.4431398_4431400delCTG	ENSP00000306864:p.Leu174del	Somatic	0	24	0.00		0.6257302807660841	227	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	Q6UXL4|Q6UXL5|Q96CX1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.L174in_frame_del	ENST00000304735.3	37	c.511_513	CCDS10514.1	16																																																																																			-	smart_Leu-rich_rpt_typical-subtyp		0.704	VASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VASN	protein_coding	OTTHUMT00000251632.1	CTG	NM_138440			4431391	+1	no_errors	ENST00000304735	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
ARAP2	116984	genome.wustl.edu	37	4	36212335	36212335	+	Silent	SNP	G	G	A	rs538850005		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr4:36212335G>A	ENST00000303965.4	-	6	1653	c.1164C>T	c.(1162-1164)agC>agT	p.S388S		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	388					regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						CCTTGTCCTCGCTTATTTTCT	0.338													G|||	1	0.000199681	0.0	0.0	5008	,	,		18462	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000047365						118.0	125.0	123.0					4																	36212335		2202	4300	6502	ARAP2	SO:0001819	synonymous_variant	0			-	HGNC	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.1164C>T	4.37:g.36212335G>A		Somatic	0	21	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	13	48.00	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_SAM_2,pfam_Ras-assoc,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.S388	ENST00000303965.4	37	c.1164	CCDS3441.1	4																																																																																			-	NULL		0.338	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP2	protein_coding	OTTHUMT00000215074.2	G	NM_015230	-		36212335	-1	no_errors	ENST00000303965	ensembl	human	known	74_37	silent	SNP	0.810	A
CLEC3A	10143	genome.wustl.edu	37	16	78064763	78064763	+	3'UTR	SNP	G	G	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr16:78064763G>T	ENST00000575655.1	+	0	700				CLEC3A_ENST00000299642.4_3'UTR|RP11-281J9.2_ENST00000563114.1_RNA|CLEC3A_ENST00000565808.1_3'UTR	NM_005752.4	NP_005743.4	O75596	CLC3A_HUMAN	C-type lectin domain family 3, member A						skeletal system development (GO:0001501)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(2)|large_intestine(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	18						TGTCCTCCAAGCAAGATTCAT	0.388																																																	0								ENSG00000166509						47.0	49.0	48.0					16																	78064763		2187	4292	6479	CLEC3A	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF077345	CCDS10927.1, CCDS10927.2	16q23	2008-02-05	2005-02-09	2005-02-11	ENSG00000166509	ENSG00000166509		"""C-type lectin domain containing"""	2052	protein-coding gene	gene with protein product		613588	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 1 (cartilage-derived)"""	CLECSF1		10524194	Standard	NM_001244755		Approved		uc002ffh.5	O75596	OTTHUMG00000137620	ENST00000575655.1:c.*25G>T	16.37:g.78064763G>T		Somatic	0	47	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	30	38.78	B2R8C4|Q3SX91|Q6UXF5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000575655.1	37	NULL		16																																																																																			-	-		0.388	CLEC3A-201	KNOWN	basic|appris_principal	protein_coding	CLEC3A	protein_coding		G	NM_005752	-		78064763	+1	no_errors	ENST00000565808	ensembl	human	putative	74_37	rna	SNP	0.578	T
MYBPC3	4607	genome.wustl.edu	37	11	47372888	47372888	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr11:47372888G>A	ENST00000545968.1	-	2	248	c.194C>T	c.(193-195)aCg>aTg	p.T65M	MYBPC3_ENST00000399249.2_Missense_Mutation_p.T65M|MYBPC3_ENST00000256993.4_Missense_Mutation_p.T65M	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	65					cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		CACTGTCAGCGTATGCCGTGT	0.622																																																	0								ENSG00000134571																																			MYBPC3	SO:0001583	missense	0			-	HGNC	X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.194C>T	11.37:g.47372888G>A	ENSP00000442795:p.Thr65Met	Somatic	0	39	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.T65M	ENST00000545968.1	37	c.194	CCDS53621.1	11	.	.	.	.	.	.	.	.	.	.	G	14.45	2.540415	0.45176	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	T;T;T	0.70986	-0.53;-0.53;-0.53	4.27	3.35	0.38373	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.78635	0.4314	L	0.55481	1.735	0.42114	D	0.991398	D	0.76494	0.999	D	0.69307	0.963	T	0.80269	-0.1453	9	0.87932	D	0	.	12.034	0.53415	0.0848:0.0:0.9152:0.0	.	65	Q14896	MYPC3_HUMAN	M	65	ENSP00000442795:T65M;ENSP00000382193:T65M;ENSP00000256993:T65M	ENSP00000256993:T65M	T	-	2	0	MYBPC3	47329464	1.000000	0.71417	0.967000	0.41034	0.014000	0.08584	6.242000	0.72376	1.011000	0.39340	0.467000	0.42956	ACG	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2		0.622	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYBPC3	protein_coding	OTTHUMT00000392271.3	G		-		47372888	-1	no_errors	ENST00000399249	ensembl	human	known	74_37	missense	SNP	0.997	A
ERVV-2	100271846	genome.wustl.edu	37	19	53553299	53553299	+	Silent	SNP	G	G	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr19:53553299G>T	ENST00000601417.1	+	2	1401	c.795G>T	c.(793-795)ctG>ctT	p.L265L		NM_001191055.1	NP_001177984.1	B6SEH9	ERVV2_HUMAN	endogenous retrovirus group V, member 2	265						integral component of membrane (GO:0016021)											AAAATAAACTGCCCTTTGATG	0.478																																																	0								ENSG00000268964																																			ERVV-2	SO:0001819	synonymous_variant	0			-	HGNC	AI434519, CA417098, DA863698	CCDS59420.1	19q13.41	2014-05-02			ENSG00000268964	ENSG00000268964			39051	other	endogenous retrovirus						18826608, 21542922	Standard	NM_001191055		Approved		uc021uzd.1	B6SEH9	OTTHUMG00000182943	ENST00000601417.1:c.795G>T	19.37:g.53553299G>T		Somatic	0	100	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	113	11.72		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TLV/ENV_coat_polyprotein	p.L265	ENST00000601417.1	37	c.795	CCDS59420.1	19																																																																																			-	NULL		0.478	ERVV-2-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ERVV-2	protein_coding	OTTHUMT00000464404.1	G	NM_001191055	-		53553299	+1	no_errors	ENST00000601417	ensembl	human	known	74_37	silent	SNP	0.010	T
ING2	3622	genome.wustl.edu	37	4	184431445	184431445	+	Silent	SNP	G	G	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr4:184431445G>A	ENST00000302327.3	+	2	385	c.183G>A	c.(181-183)aaG>aaA	p.K61K	ING2_ENST00000434682.2_Silent_p.K21K	NM_001564.2	NP_001555.1	Q9H160	ING2_HUMAN	inhibitor of growth family, member 2	61					chromatin modification (GO:0016568)|male germ-line stem cell asymmetric division (GO:0048133)|male meiosis I (GO:0007141)|negative regulation of cell proliferation (GO:0008285)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cellular senescence (GO:2000772)|regulation of growth (GO:0040008)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|seminiferous tubule development (GO:0072520)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleus (GO:0005634)|Sin3 complex (GO:0016580)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)	7		all_lung(41;5.16e-14)|Lung NSC(41;1.33e-13)|Colorectal(36;0.00139)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|all_hematologic(60;0.0207)|Prostate(90;0.0235)|all_neural(102;0.202)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		AAACGTTAAAGGAAATTGATG	0.308																																																	0								ENSG00000168556						69.0	81.0	77.0					4																	184431445		2160	4276	6436	ING2	SO:0001819	synonymous_variant	0			-	HGNC	AB012853	CCDS3833.1	4q35.1	2013-01-28	2005-02-10	2005-02-11	ENSG00000168556	ENSG00000168556		"""Zinc fingers, PHD-type"""	6063	protein-coding gene	gene with protein product		604215	"""inhibitor of growth family, member 1-like"""	ING1L		10072587	Standard	XM_005262982		Approved	p33ING2	uc003ivs.1	Q9H160	OTTHUMG00000150502	ENST00000302327.3:c.183G>A	4.37:g.184431445G>A		Somatic	0	36	0.00		0.6257302807660841	12	25.00	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	19	52.38	B6ZDS1|O95698	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.K61	ENST00000302327.3	37	c.183	CCDS3833.1	4																																																																																			-	NULL		0.308	ING2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ING2	protein_coding	OTTHUMT00000318652.1	G	NM_001564	-		184431445	+1	no_errors	ENST00000302327	ensembl	human	known	74_37	silent	SNP	1.000	A
KCNG4	93107	genome.wustl.edu	37	16	84270517	84270517	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr16:84270517C>T	ENST00000308251.4	-	2	643	c.575G>A	c.(574-576)cGc>cAc	p.R192H	KCNG4_ENST00000568181.1_Missense_Mutation_p.R192H	NM_172347.2	NP_758857.1	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G, member 4	192					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	31						CGAGGCGGGGCGGCGGGTCTC	0.682																																																	0								ENSG00000168418						24.0	24.0	24.0					16																	84270517		2199	4296	6495	KCNG4	SO:0001583	missense	0			-	HGNC	AF348984	CCDS10945.1	16q24.1	2011-07-05			ENSG00000168418	ENSG00000168418		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19697	protein-coding gene	gene with protein product		607603				12060745, 16382104	Standard	NM_172347		Approved	Kv6.4	uc010voc.2	Q8TDN1	OTTHUMG00000137638	ENST00000308251.4:c.575G>A	16.37:g.84270517C>T	ENSP00000312129:p.Arg192His	Somatic	0	89	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	23	41.86	Q96H24	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.R192H	ENST00000308251.4	37	c.575	CCDS10945.1	16	.	.	.	.	.	.	.	.	.	.	C	4.549	0.101955	0.08731	.	.	ENSG00000168418	ENST00000308251	D	0.96651	-4.08	5.11	1.96	0.26148	.	1.220070	0.05980	N	0.644022	D	0.91492	0.7314	N	0.25647	0.755	0.09310	N	1	B;B	0.13594	0.007;0.008	B;B	0.09377	0.004;0.003	T	0.79754	-0.1670	10	0.13108	T	0.6	.	7.577	0.27942	0.2933:0.6275:0.0:0.0792	.	192;192	Q8TDN1;Q8TDN1-2	KCNG4_HUMAN;.	H	192	ENSP00000312129:R192H	ENSP00000312129:R192H	R	-	2	0	KCNG4	82828018	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.329000	0.19698	0.134000	0.18681	-0.332000	0.08345	CGC	-	NULL		0.682	KCNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNG4	protein_coding	OTTHUMT00000269079.2	C	NM_172347	-		84270517	-1	no_errors	ENST00000308251	ensembl	human	known	74_37	missense	SNP	0.000	T
SF1	7536	genome.wustl.edu	37	11	64532898	64532898	+	3'UTR	SNP	C	C	T	rs539758407		TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr11:64532898C>T	ENST00000377390.3	-	0	2649				SF1_ENST00000489544.1_5'Flank|SF1_ENST00000377394.3_Missense_Mutation_p.R560H|SF1_ENST00000227503.9_3'UTR|SF1_ENST00000422298.2_3'UTR|SF1_ENST00000334944.5_Missense_Mutation_p.R627H|SF1_ENST00000377387.1_3'UTR	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1						Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						CCACCAGGGGCGTTGCTGAGG	0.567																																																	0								ENSG00000168066						114.0	124.0	120.0					11																	64532898		2201	4297	6498	SF1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.*392G>A	11.37:g.64532898C>T		Somatic	0	55	0.00		0.6257302807660841	222	28.43	89	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	45	22.41	B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KH_dom_type_1,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_KH_dom,smart_Znf_CCHC,pfscan_Znf_CCHC,pfscan_KH_dom_type_1	p.R627H	ENST00000377390.3	37	c.1880	CCDS31599.1	11	.	.	.	.	.	.	.	.	.	.	C	13.22	2.170675	0.38315	.	.	ENSG00000168066	ENST00000377394;ENST00000334944	T;T	0.60920	0.15;0.71	5.36	4.45	0.53987	.	.	.	.	.	T	0.64461	0.2600	.	.	.	0.80722	D	1	D;D	0.59767	0.986;0.986	P;P	0.53006	0.715;0.715	T	0.68138	-0.5488	8	0.87932	D	0	.	10.2964	0.43627	0.0:0.9088:0.0:0.0912	.	560;627	Q15637-6;Q15637-2	.;.	H	560;627	ENSP00000366611:R560H;ENSP00000334414:R627H	ENSP00000334414:R627H	R	-	2	0	SF1	64289474	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.136000	0.31467	1.268000	0.44264	-0.369000	0.07265	CGC	-	NULL		0.567	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SF1	protein_coding	OTTHUMT00000143242.1	C	NM_004630	-		64532898	-1	no_errors	ENST00000334944	ensembl	human	known	74_37	missense	SNP	1.000	T
VRTN	55237	genome.wustl.edu	37	14	74823735	74823735	+	Silent	SNP	C	C	A			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr14:74823735C>A	ENST00000256362.4	+	2	490	c.249C>A	c.(247-249)ggC>ggA	p.G83G		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	83					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						AGGGGGAGGGCAGCCTGCTGT	0.667																																																	0								ENSG00000133980						53.0	48.0	49.0					14																	74823735		2203	4300	6503	VRTN	SO:0001819	synonymous_variant	0			-	HGNC	AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.249C>A	14.37:g.74823735C>A		Somatic	0	15	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	16	34.62	Q9NVC7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Transposase_8	p.G83	ENST00000256362.4	37	c.249	CCDS9830.1	14																																																																																			-	NULL		0.667	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VRTN	protein_coding	OTTHUMT00000412339.1	C	NM_018228	-		74823735	+1	no_errors	ENST00000256362	ensembl	human	known	74_37	silent	SNP	0.967	A
OR4C5	79346	genome.wustl.edu	37	11	48387926	48387926	+	Missense_Mutation	SNP	G	G	A	rs561798212	byFrequency	TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr11:48387926G>A	ENST00000319813.3	-	1	91	c.92C>T	c.(91-93)aCg>aTg	p.T31M				Q8NGB2	OR4C5_HUMAN	olfactory receptor, family 4, subfamily C, member 5	31						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										GATGAATTCCGTTATGTTGTT	0.388													g|||	2	0.000399361	0.0008	0.0	5008	,	,		21461	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000176540																																			OR4C5	SO:0001583	missense	0			-	HGNC			11p11.2	2013-03-27	2004-03-04	2004-03-05	ENSG00000176540	ENSG00000176540		"""GPCR / Class A : Olfactory receptors"""	14702	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 5 pseudogene"""	OR4C5P			Standard	NG_002247		Approved	OR4C5Q		Q8NGB2	OTTHUMG00000169462	ENST00000319813.3:c.92C>T	11.37:g.48387926G>A	ENSP00000321338:p.Thr31Met	Somatic	0	68	0.00		0.6257302807660841	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	57	19.72	Q6IFB2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T31M	ENST00000319813.3	37	c.92		11	.	.	.	.	.	.	.	.	.	.	G	14.19	2.462895	0.43736	.	.	ENSG00000176540	ENST00000319813	T	0.02216	4.39	5.03	5.03	0.67393	.	0.000000	0.64402	D	0.000014	T	0.06690	0.0171	.	.	.	0.29987	N	0.817246	.	.	.	.	.	.	T	0.00341	-1.1804	7	0.87932	D	0	.	14.3679	0.66817	0.0:0.0:1.0:0.0	.	.	.	.	M	31	ENSP00000321338:T31M	ENSP00000321338:T31M	T	-	2	0	OR4C5	48344502	0.000000	0.05858	0.663000	0.29738	0.074000	0.17049	0.525000	0.22956	2.518000	0.84900	0.465000	0.42564	ACG	-	NULL		0.388	OR4C5-001	KNOWN	basic|appris_principal	protein_coding	OR4C5	protein_coding	OTTHUMT00000404174.1	G	NG_002247	-		48387926	-1	no_errors	ENST00000319813	ensembl	human	known	74_37	missense	SNP	0.963	A
KCNMA1	3778	genome.wustl.edu	37	10	79397225	79397225	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YR-01A-33D-A351-09	TCGA-DX-A6YR-10B-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0851f971-c95c-4c39-8390-f62598885c5a	f97fc91e-8830-4217-9c02-02531bdffc59	g.chr10:79397225G>T	ENST00000286628.8	-	1	175	c.176C>A	c.(175-177)tCc>tAc	p.S59Y	KCNMA1_ENST00000372443.1_Missense_Mutation_p.S59Y|KCNMA1_ENST00000354353.5_Missense_Mutation_p.S59Y|KCNMA1_ENST00000404771.3_Missense_Mutation_p.S59Y|KCNMA1_ENST00000406533.3_Missense_Mutation_p.S59Y|KCNMA1_ENST00000404857.1_Missense_Mutation_p.S59Y|KCNMA1_ENST00000480683.1_Missense_Mutation_p.S59Y|KCNMA1_ENST00000372440.1_Missense_Mutation_p.S59Y|KCNMA1_ENST00000286627.5_Missense_Mutation_p.S59Y|KCNMA1_ENST00000481070.1_Missense_Mutation_p.S59Y	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	59	Poly-Ser.				blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	GTGGACCgaggacgaggagga	0.607																																																	0								ENSG00000156113						38.0	33.0	35.0					10																	79397225		2203	4300	6503	KCNMA1	SO:0001583	missense	0			-	HGNC	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.176C>A	10.37:g.79397225G>T	ENSP00000286628:p.Ser59Tyr	Somatic	0	37	0.00		0.6257302807660841	14	30.00	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	47	24.19	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_RCK_N,prints_K_chnl_Ca-activ_BK_asu,prints_K_chnl	p.S59Y	ENST00000286628.8	37	c.176		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.6|21.6	4.167038|4.167038	0.78339|0.78339	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372403|ENST00000372440;ENST00000457953;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857	.|T;T;T;T;T;T;T	.|0.43294	.|0.95;0.95;0.95;0.95;0.95;0.95;0.95	3.6|3.6	3.6|3.6	0.41247|0.41247	.|.	.|0.269330	.|0.25964	.|U	.|0.027180	T|T	0.45875|0.45875	0.1364|0.1364	N|N	0.14661|0.14661	0.345|0.345	0.37372|0.37372	D|D	0.911673|0.911673	.|D;D;D;D;P;D;D	.|0.89917	.|0.998;1.0;0.972;0.994;0.956;0.984;0.972	.|D;D;D;D;D;D;D	.|0.85130	.|0.99;0.997;0.962;0.983;0.923;0.983;0.962	T|T	0.58188|0.58188	-0.7680|-0.7680	5|10	.|0.72032	.|D	.|0.01	-4.0831|-4.0831	12.9702|12.9702	0.58508|0.58508	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|59;59;59;59;59;59;59	.|D5MRH1;Q12791-6;B7ZMF5;Q12791-2;Q12791;Q12791-5;Q5SVJ7	.|.;.;.;.;KCMA1_HUMAN;.;.	T|Y	10|59;33;59;59;33;59;59;59	.|ENSP00000361517:S59Y;ENSP00000396608:S33Y;ENSP00000361520:S59Y;ENSP00000286627:S59Y;ENSP00000385552:S59Y;ENSP00000346321:S59Y;ENSP00000385806:S59Y	.|ENSP00000286627:S59Y	P|S	-|-	1|2	0|0	KCNMA1|KCNMA1	79067231|79067231	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	4.327000|4.327000	0.59247|0.59247	1.940000|1.940000	0.56252|0.56252	0.455000|0.455000	0.32223|0.32223	CCT|TCC	-	NULL		0.607	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	KCNMA1	protein_coding	OTTHUMT00000048885.3	G	NM_002247	-		79397225	-1	no_errors	ENST00000406533	ensembl	human	known	74_37	missense	SNP	1.000	T
