#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
COPS4	51138	genome.wustl.edu	37	4	83966800	83966800	+	Silent	SNP	A	A	G	rs555889521		TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr4:83966800A>G	ENST00000264389.2	+	2	231	c.96A>G	c.(94-96)aaA>aaG	p.K32K	COPS4_ENST00000511708.1_3'UTR|COPS4_ENST00000511653.1_Silent_p.K32K|COPS4_ENST00000503682.1_Silent_p.K32K|COPS4_ENST00000509093.1_Silent_p.K32K	NM_016129.2	NP_057213.2	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	32					cullin deneddylation (GO:0010388)|protein deneddylation (GO:0000338)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(2)	13		Hepatocellular(203;0.114)				TCCTGGAAAAAGCCATTCAGT	0.343																																																	0								ENSG00000138663						105.0	103.0	104.0					4																	83966800		2203	4300	6503	COPS4	SO:0001819	synonymous_variant	0			-	HGNC	AF100757	CCDS3600.1, CCDS58909.1	4q21.22	2013-03-14	2013-03-14		ENSG00000138663	ENSG00000138663			16702	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 4"", ""COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)"""			9707402	Standard	NM_016129		Approved	CSN4	uc003hoa.3	Q9BT78	OTTHUMG00000130298	ENST00000264389.2:c.96A>G	4.37:g.83966800A>G		Somatic	0	103	0.00		0.5720907680579784	67	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B3KN88|B3KST5|Q561W7|Q9NW31|Q9Y677	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K42R	ENST00000264389.2	37	c.125	CCDS3600.1	4																																																																																			-	NULL		0.343	COPS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS4	protein_coding	OTTHUMT00000252643.1	A		-		83966800	+1	no_errors	ENST00000507376	ensembl	human	known	74_37	missense	SNP	1.000	G
FUT11	170384	genome.wustl.edu	37	10	75535408	75535408	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr10:75535408C>A	ENST00000372841.3	+	3	1487	c.1444C>A	c.(1444-1446)Cta>Ata	p.L482I	RMRPP1_ENST00000517236.1_RNA	NM_173540.2	NP_775811.2	Q495W5	FUT11_HUMAN	fucosyltransferase 11 (alpha (1,3) fucosyltransferase)	482					protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	7	Prostate(51;0.0112)					TTGGGATTACCTACATGAAAT	0.458																																																	0								ENSG00000196968						115.0	102.0	107.0					10																	75535408		2203	4300	6503	FUT11	SO:0001583	missense	0			-	HGNC	BC036037	CCDS7333.1, CCDS60558.1	10q22.3	2014-01-02			ENSG00000196968	ENSG00000196968		"""Fucosyltransferases"""	19233	protein-coding gene	gene with protein product						11698403, 24318988	Standard	NM_173540		Approved	MGC33202	uc001jva.3	Q495W5	OTTHUMG00000018483	ENST00000372841.3:c.1444C>A	10.37:g.75535408C>A	ENSP00000361932:p.Leu482Ile	Somatic	0	41	0.00		0.5720907680579784	46	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	Q495W7|Q8IYE4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_10,pirsf_Alpha-1_3-FUT_met	p.L482I	ENST00000372841.3	37	c.1444	CCDS7333.1	10	.	.	.	.	.	.	.	.	.	.	C	7.639	0.680473	0.14907	.	.	ENSG00000196968	ENST00000372841	T	0.34072	1.38	5.8	0.932	0.19466	.	0.345569	0.32473	N	0.006054	T	0.12902	0.0313	N	0.10874	0.06	0.80722	D	1	B	0.11235	0.004	B	0.12837	0.008	T	0.10428	-1.0630	10	0.11182	T	0.66	-24.444	1.3286	0.02130	0.3121:0.3832:0.1054:0.1993	.	482	Q495W5	FUT11_HUMAN	I	482	ENSP00000361932:L482I	ENSP00000361932:L482I	L	+	1	2	FUT11	75205414	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	3.088000	0.50175	0.257000	0.21650	0.563000	0.77884	CTA	-	pirsf_Alpha-1_3-FUT_met		0.458	FUT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT11	protein_coding	OTTHUMT00000048689.1	C	NM_173540	-		75535408	+1	no_errors	ENST00000372841	ensembl	human	known	74_37	missense	SNP	1.000	A
PDE12	201626	genome.wustl.edu	37	3	57545573	57545573	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr3:57545573G>T	ENST00000311180.8	+	3	1775	c.1672G>T	c.(1672-1674)Gga>Tga	p.G558*	PDE12_ENST00000487257.1_3'UTR	NM_177966.5	NP_808881.3	Q6L8Q7	PDE12_HUMAN	phosphodiesterase 12	558					mRNA processing (GO:0006397)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(4)|lung(3)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20				KIRC - Kidney renal clear cell carcinoma(284;0.011)|Kidney(284;0.0127)		TGGCTTTCATGGATGTCTAGA	0.408																																					Colon(125;308 1634 19198 50622 50717)												0								ENSG00000174840						264.0	252.0	256.0					3																	57545573		2203	4300	6503	PDE12	SO:0001587	stop_gained	0			-	HGNC	AK074423	CCDS33772.1	3p14.3	2013-10-11			ENSG00000174840	ENSG00000174840			25386	protein-coding gene	gene with protein product	"""2'-phosphodiesterase"""					15231837	Standard	NM_177966		Approved	DKFZp667B1218, 2'-PDE	uc003diw.4	Q6L8Q7	OTTHUMG00000158599	ENST00000311180.8:c.1672G>T	3.37:g.57545573G>T	ENSP00000309142:p.Gly558*	Somatic	0	43	0.00		0.5720907680579784	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	B4DTU8|Q8IYU3|Q8NDU2|Q8TE78	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.G558*	ENST00000311180.8	37	c.1672	CCDS33772.1	3	.	.	.	.	.	.	.	.	.	.	G	38	7.041391	0.98021	.	.	ENSG00000174840	ENST00000311180	.	.	.	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.6179	20.1197	0.97955	0.0:0.0:1.0:0.0	.	.	.	.	X	558	.	ENSP00000309142:G558X	G	+	1	0	PDE12	57520613	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.123000	0.94387	2.755000	0.94549	0.557000	0.71058	GGA	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase		0.408	PDE12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE12	protein_coding	OTTHUMT00000351440.2	G	NM_177966	-		57545573	+1	no_errors	ENST00000311180	ensembl	human	known	74_37	nonsense	SNP	1.000	T
PDE10A	10846	genome.wustl.edu	37	6	165749697	165749697	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr6:165749697C>A	ENST00000366882.1	-	22	2306	c.2152G>T	c.(2152-2154)Ggg>Tgg	p.G718W	PDE10A_ENST00000539869.2_Missense_Mutation_p.G728W|PDE10A_ENST00000354448.4_Missense_Mutation_p.G718W			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	718					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	TTGTAGAACCCAAGCTGCCTC	0.458																																					Esophageal Squamous(22;308 615 5753 12038 40624)												0								ENSG00000112541						67.0	64.0	65.0					6																	165749697		2203	4300	6503	PDE10A	SO:0001583	missense	0			-	HGNC	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.2152G>T	6.37:g.165749697C>A	ENSP00000355847:p.Gly718Trp	Somatic	0	42	0.00		0.5720907680579784	30	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.G728W	ENST00000366882.1	37	c.2182		6	.	.	.	.	.	.	.	.	.	.	C	27.0	4.791401	0.90367	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	D;D	0.81659	-1.52;-1.52	5.4	5.4	0.78164	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.90903	0.7141	M	0.88377	2.95	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.91910	0.5539	10	0.87932	D	0	.	19.5373	0.95257	0.0:1.0:0.0:0.0	.	728;718	Q9ULW9;Q9Y233	.;PDE10_HUMAN	W	718;746;728;718;717	ENSP00000355847:G718W;ENSP00000346435:G718W	ENSP00000341187:G728W	G	-	1	0	PDE10A	165669687	1.000000	0.71417	0.294000	0.24946	0.916000	0.54674	7.075000	0.76798	2.681000	0.91329	0.655000	0.94253	GGG	-	pfam_PDEase_catalytic_dom		0.458	PDE10A-001	PUTATIVE	basic	protein_coding	PDE10A	protein_coding	OTTHUMT00000043031.1	C		-		165749697	-1	no_errors	ENST00000539869	ensembl	human	known	74_37	missense	SNP	0.253	A
FOXL2NB	401089	genome.wustl.edu	37	3	138668445	138668445	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr3:138668445C>A	ENST00000383165.3	+	2	315	c.184C>A	c.(184-186)Cac>Aac	p.H62N	FOXL2_ENST00000330315.3_5'Flank	NM_001040061.2	NP_001035150.1	Q6ZUU3	FOXNB_HUMAN		62										large_intestine(1)|lung(3)	4						GATGTGCCTTCACATGGCTGT	0.567																																																	0								ENSG00000206262						73.0	77.0	76.0					3																	138668445		1943	4155	6098	C3orf72	SO:0001583	missense	0			-	HGNC																												ENST00000383165.3:c.184C>A	3.37:g.138668445C>A	ENSP00000372651:p.His62Asn	Somatic	0	59	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A6NGX0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.H62N	ENST00000383165.3	37	c.184	CCDS43155.1	3	.	.	.	.	.	.	.	.	.	.	C	5.372	0.253939	0.10185	.	.	ENSG00000206262	ENST00000383165	.	.	.	2.75	-1.66	0.08265	.	.	.	.	.	T	0.16769	0.0403	N	0.14661	0.345	0.09310	N	1	B	0.13145	0.007	B	0.12156	0.007	T	0.24941	-1.0146	8	0.87932	D	0	.	0.3587	0.00361	0.2105:0.3315:0.1899:0.2681	.	62	Q6ZUU3	CC072_HUMAN	N	62	.	ENSP00000372651:H62N	H	+	1	0	C3orf72	140151135	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.722000	0.04958	-0.432000	0.07297	-0.226000	0.12346	CAC	-	NULL		0.567	C3orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf72	protein_coding	OTTHUMT00000357986.1	C		-		138668445	+1	no_errors	ENST00000383165	ensembl	human	known	74_37	missense	SNP	0.000	A
DSCAML1	57453	genome.wustl.edu	37	11	117351251	117351251	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr11:117351251C>A	ENST00000321322.6	-	14	2873	c.2872G>T	c.(2872-2874)Gtg>Ttg	p.V958L	DSCAML1_ENST00000527706.1_Missense_Mutation_p.V688L	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	898	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CGGGCCTTCACCTCCCGGATC	0.627																																																	0								ENSG00000177103						36.0	36.0	36.0					11																	117351251		2201	4292	6493	DSCAML1	SO:0001583	missense	0			-	HGNC		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2872G>T	11.37:g.117351251C>A	ENSP00000315465:p.Val958Leu	Somatic	0	68	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V958L	ENST00000321322.6	37	c.2872	CCDS8384.1	11	.	.	.	.	.	.	.	.	.	.	C	17.24	3.340208	0.60963	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.58940	0.3;0.3	4.12	4.12	0.48240	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.56558	0.1993	L	0.60957	1.885	0.58432	D	0.999999	B	0.19935	0.04	B	0.26969	0.075	T	0.57219	-0.7849	9	0.39692	T	0.17	.	16.1999	0.82063	0.0:1.0:0.0:0.0	.	898	Q8TD84	DSCL1_HUMAN	L	688;958;665	ENSP00000434335:V688L;ENSP00000315465:V958L	ENSP00000315465:V958L	V	-	1	0	DSCAML1	116856461	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.508000	0.81686	2.151000	0.67156	0.485000	0.47835	GTG	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.627	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	protein_coding	OTTHUMT00000392907.2	C	NM_020693	-		117351251	-1	no_errors	ENST00000321322	ensembl	human	known	74_37	missense	SNP	1.000	A
RNFT2	84900	genome.wustl.edu	37	12	117289549	117289549	+	3'UTR	DEL	A	A	-	rs373885060		TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr12:117289549delA	ENST00000257575.4	+	0	3864				RNFT2_ENST00000319176.7_Frame_Shift_Del_p.K260fs|RNFT2_ENST00000407967.3_Intron|RNFT2_ENST00000551251.1_Intron|RNFT2_ENST00000392549.2_Intron			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		gactctgtctaaaaaaaaaaa	0.502																																																	0								ENSG00000135119																																			RNFT2	SO:0001624	3_prime_UTR_variant	0				HGNC	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.*2296A>-	12.37:g.117289549delA		Somatic	0	21	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	5	37.50	E9PAM7|Q96SU5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.K259fs	ENST00000257575.4	37	c.766	CCDS44987.1	12																																																																																			-	NULL		0.502	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNFT2	protein_coding	OTTHUMT00000320417.1	A	NM_032814			117289549	+1	no_errors	ENST00000319176	ensembl	human	putative	74_37	frame_shift_del	DEL	0.003	-
SEZ6L	23544	genome.wustl.edu	37	22	26695005	26695005	+	Silent	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr22:26695005G>T	ENST00000248933.6	+	5	1313	c.1218G>T	c.(1216-1218)gtG>gtT	p.V406V	SEZ6L_ENST00000360929.3_Silent_p.V406V|SEZ6L_ENST00000403121.1_Silent_p.V179V|SEZ6L_ENST00000404234.3_Silent_p.V406V|SEZ6L_ENST00000343706.4_Silent_p.V406V|SEZ6L_ENST00000529632.2_Silent_p.V406V|SEZ6L_ENST00000402979.1_Silent_p.V179V			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	406	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						ATGTCACGGTGATGGACCTGC	0.592																																																	0								ENSG00000100095						63.0	53.0	57.0					22																	26695005		2203	4300	6503	SEZ6L	SO:0001819	synonymous_variant	0			-	HGNC	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.1218G>T	22.37:g.26695005G>T		Somatic	0	30	0.00		0.5720907680579784	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.V406	ENST00000248933.6	37	c.1218	CCDS13833.1	22																																																																																			-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.592	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L	protein_coding	OTTHUMT00000320359.3	G		-		26695005	+1	no_errors	ENST00000248933	ensembl	human	known	74_37	silent	SNP	1.000	T
ALG3	10195	genome.wustl.edu	37	3	183960417	183960417	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr3:183960417G>T	ENST00000397676.3	-	9	1232	c.1202C>A	c.(1201-1203)tCc>tAc	p.S401Y	ALG3_ENST00000455059.1_Missense_Mutation_p.S361Y|ALG3_ENST00000463495.1_5'Flank|ALG3_ENST00000418734.2_Missense_Mutation_p.S345Y|ALG3_ENST00000445626.2_Missense_Mutation_p.S353Y|MIR1224_ENST00000408193.1_RNA|EIF2B5_ENST00000444495.1_Intron	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase	401					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)			kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCAGGATGTGGAAGGGTATGT	0.587																																																	0								ENSG00000214160						61.0	65.0	64.0					3																	183960417		2065	4217	6282	ALG3	SO:0001583	missense	0			-	HGNC	BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823	ENST00000397676.3:c.1202C>A	3.37:g.183960417G>T	ENSP00000380793:p.Ser401Tyr	Somatic	0	45	0.00		0.5720907680579784	158	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	A8JZZ6|Q9BT71	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glycosyltransferase_ALG3	p.S401Y	ENST00000397676.3	37	c.1202	CCDS46968.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.5|23.5	4.426752|4.426752	0.83667|0.83667	.|.	.|.	ENSG00000214160|ENSG00000214160	ENST00000446569|ENST00000418734;ENST00000397676;ENST00000445626;ENST00000455059	.|D;D;D;D	.|0.89552	.|-2.53;-2.53;-2.53;-2.53	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	.|0.000000	.|0.85682	.|U	.|0.000000	D|D	0.96253|0.96253	0.8778|0.8778	H|H	0.94925|0.94925	3.6|3.6	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|0.999;1.0;1.0;0.999	.|D;D;D;D	.|0.79784	.|0.96;0.982;0.993;0.972	D|D	0.97059|0.97059	0.9769|0.9769	5|10	.|0.87932	.|D	.|0	-20.5003|-20.5003	18.6456|18.6456	0.91409|0.91409	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|353;345;361;401	.|A8JZZ6;B4DS50;C9J7S5;Q92685	.|.;.;.;ALG3_HUMAN	L|Y	304|345;401;353;361	.|ENSP00000402976:S345Y;ENSP00000380793:S401Y;ENSP00000402744:S353Y;ENSP00000397613:S361Y	.|ENSP00000380793:S401Y	F|S	-|-	3|2	2|0	ALG3|ALG3	185443111|185443111	1.000000|1.000000	0.71417|0.71417	0.981000|0.981000	0.43875|0.43875	0.954000|0.954000	0.61252|0.61252	9.824000|9.824000	0.99380|0.99380	2.645000|2.645000	0.89757|0.89757	0.462000|0.462000	0.41574|0.41574	TTC|TCC	-	pfam_Glycosyltransferase_ALG3		0.587	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG3	protein_coding	OTTHUMT00000346033.1	G	NM_005787	-		183960417	-1	no_errors	ENST00000397676	ensembl	human	known	74_37	missense	SNP	1.000	T
DCLK2	166614	genome.wustl.edu	37	4	151000434	151000434	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr4:151000434G>T	ENST00000296550.7	+	1	1009	c.255G>T	c.(253-255)aaG>aaT	p.K85N	DCLK2_ENST00000302176.8_Missense_Mutation_p.K85N|DCLK2_ENST00000506325.1_Missense_Mutation_p.K85N	NM_001040260.3	NP_001035350.2	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2	85	Doublecortin 1. {ECO:0000255|PROSITE- ProRule:PRU00072}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					GCTACTTCAAGGGCCTGGTGT	0.642																																					GBM(195;186 2215 13375 16801 37459)												0								ENSG00000170390						31.0	34.0	33.0					4																	151000434		2201	4300	6501	DCLK2	SO:0001583	missense	0			-	HGNC	BC032726	CCDS34076.1, CCDS47142.1, CCDS47142.2	4q31.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000170390	ENSG00000170390			19002	protein-coding gene	gene with protein product		613166	"""doublecortin and CaM kinase-like 2"""	DCAMKL2		12477932	Standard	NM_001040260		Approved	MGC45428, DCDC3, DCDC3B, DCK2	uc003ilo.4	Q8N568	OTTHUMG00000161444	ENST00000296550.7:c.255G>T	4.37:g.151000434G>T	ENSP00000296550:p.Lys85Asn	Somatic	0	60	0.00		0.5720907680579784	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	C9J5Q9|Q59GC8|Q8N399	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Doublecortin_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Doublecortin_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Doublecortin_dom,pfscan_Prot_kinase_dom	p.K85N	ENST00000296550.7	37	c.255	CCDS34076.1	4	.	.	.	.	.	.	.	.	.	.	G	15.11	2.735309	0.48939	.	.	ENSG00000170390	ENST00000296550;ENST00000506325;ENST00000302176	D;D;D	0.94000	-3.33;-3.33;-3.33	4.22	2.44	0.29823	Doublecortin domain (4);	0.164262	0.52532	N	0.000075	D	0.93000	0.7772	L	0.45470	1.425	0.54753	D	0.999985	B;B;D	0.53462	0.322;0.078;0.96	B;B;P	0.56916	0.297;0.087;0.809	D	0.90988	0.4833	10	0.49607	T	0.09	.	10.0333	0.42114	0.1484:0.0:0.8516:0.0	.	85;85;85	Q8N568-3;Q8N568-2;Q8N568	.;.;DCLK2_HUMAN	N	85	ENSP00000296550:K85N;ENSP00000427235:K85N;ENSP00000303887:K85N	ENSP00000296550:K85N	K	+	3	2	DCLK2	151219884	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.606000	0.36826	0.496000	0.27904	0.563000	0.77884	AAG	-	smart_Doublecortin_dom,pfscan_Doublecortin_dom		0.642	DCLK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCLK2	protein_coding	OTTHUMT00000364952.1	G	NM_001040260	-		151000434	+1	no_errors	ENST00000302176	ensembl	human	known	74_37	missense	SNP	1.000	T
PEX7	5191	genome.wustl.edu	37	6	137146370	137146370	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr6:137146370T>C	ENST00000318471.4	+	2	230	c.149T>C	c.(148-150)aTa>aCa	p.I50T	PEX7_ENST00000367756.4_Missense_Mutation_p.I50T|PEX7_ENST00000541292.1_Missense_Mutation_p.I50T	NM_000288.3	NP_000279.1	O00628	PEX7_HUMAN	peroxisomal biogenesis factor 7	50					endochondral ossification (GO:0001958)|ether lipid biosynthetic process (GO:0008611)|fatty acid beta-oxidation (GO:0006635)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	enzyme binding (GO:0019899)|peroxisome matrix targeting signal-2 binding (GO:0005053)|protein homodimerization activity (GO:0042803)			lung(7)|prostate(1)	8	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000257)|OV - Ovarian serous cystadenocarcinoma(155;0.00492)		ACCCTACTAATATTGGATCCA	0.368																																																	0								ENSG00000112357						129.0	126.0	127.0					6																	137146370		2203	4300	6503	PEX7	SO:0001583	missense	0			-	HGNC	AF180814	CCDS5180.1	6q21-q22.2	2013-01-10			ENSG00000112357	ENSG00000112357		"""WD repeat domain containing"""	8860	protein-coding gene	gene with protein product	"""Refsum disease"""	601757				9090381, 10673331	Standard	NM_000288		Approved	PTS2R, RD	uc003qhd.3	O00628	OTTHUMG00000015650	ENST00000318471.4:c.149T>C	6.37:g.137146370T>C	ENSP00000315680:p.Ile50Thr	Somatic	0	124	0.00		0.5720907680579784	13	35.00	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	58	30.95	C0H5X6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.I50T	ENST00000318471.4	37	c.149	CCDS5180.1	6	.	.	.	.	.	.	.	.	.	.	T	10.52	1.373956	0.24857	.	.	ENSG00000112357	ENST00000367756;ENST00000541292;ENST00000318471	D;T;D	0.93426	-3.22;-0.57;-1.75	5.59	5.59	0.84812	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.204720	0.50627	D	0.000120	D	0.88157	0.6361	M	0.68317	2.08	0.09310	N	1	B	0.21309	0.054	B	0.20767	0.031	D	0.83678	0.0170	10	0.72032	D	0.01	-17.4627	13.1423	0.59442	0.0:0.0:0.0:1.0	.	50	O00628	PEX7_HUMAN	T	50	ENSP00000356730:I50T;ENSP00000441004:I50T;ENSP00000315680:I50T	ENSP00000315680:I50T	I	+	2	0	PEX7	137188063	1.000000	0.71417	0.004000	0.12327	0.391000	0.30476	5.408000	0.66368	2.121000	0.65114	0.533000	0.62120	ATA	-	superfamily_WD40_repeat_dom		0.368	PEX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX7	protein_coding	OTTHUMT00000042387.2	T	NM_000288	-		137146370	+1	no_errors	ENST00000318471	ensembl	human	known	74_37	missense	SNP	0.015	C
UGDH	7358	genome.wustl.edu	37	4	39505572	39505584	+	Frame_Shift_Del	DEL	GCATTTTTTTATG	GCATTTTTTTATG	-	rs147122976		TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	GCATTTTTTTATG	GCATTTTTTTATG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr4:39505572_39505584delGCATTTTTTTATG	ENST00000316423.6	-	11	1627_1639	c.1285_1297delCATAAAAAAATGC	c.(1285-1299)cataaaaaaatgctafs	p.HKKML429fs	UGDH_ENST00000507089.1_Frame_Shift_Del_p.HKKML332fs|UGDH_ENST00000506179.1_Frame_Shift_Del_p.HKKML429fs|UGDH_ENST00000501493.2_Frame_Shift_Del_p.HKKML362fs	NM_001184701.1|NM_003359.3	NP_001171630.1|NP_003350.1	O60701	UGDH_HUMAN	UDP-glucose 6-dehydrogenase	429					cellular glucuronidation (GO:0052695)|gastrulation with mouth forming second (GO:0001702)|glycosaminoglycan biosynthetic process (GO:0006024)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|UDP-glucose 6-dehydrogenase activity (GO:0003979)			breast(1)|central_nervous_system(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(2)	27						GCTGGCTTTAGCATTTTTTTATGAATGCGTTCA	0.455																																																	0								ENSG00000109814																																			UGDH	SO:0001589	frameshift_variant	0				HGNC	AF061016	CCDS3455.1, CCDS54757.1, CCDS54758.1	4p14	2011-11-16	2010-04-28		ENSG00000109814	ENSG00000109814	1.1.1.22		12525	protein-coding gene	gene with protein product		603370	"""UDP-glucose dehydrogenase"""			9737970, 10575217	Standard	NM_003359		Approved		uc003guk.2	O60701	OTTHUMG00000099371	ENST00000316423.6:c.1285_1297delCATAAAAAAATGC	4.37:g.39505572_39505584delGCATTTTTTTATG	ENSP00000319501:p.His429fs	Somatic	NA	NA	NA		0.5720907680579784	217	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KUU2|B4DN25|O60589	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_UDP-Glc/GDP-Man_DH_N,pfam_UDP-Glc/GDP-Man_DH_C,pfam_UDP-Glc/GDP-Man_DH_dimer,superfamily_UDP-Glc/GDP-Man_DH_C,superfamily_6-PGluconate_DH_C-like,tigrfam_UDP-Glc/GDP-Man	p.H429fs	ENST00000316423.6	37	c.1297_1285	CCDS3455.1	4																																																																																			-	pfam_UDP-Glc/GDP-Man_DH_C,superfamily_UDP-Glc/GDP-Man_DH_C,tigrfam_UDP-Glc/GDP-Man		0.455	UGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGDH	protein_coding	OTTHUMT00000216818.3	GCATTTTTTTATG	NM_003359			39505584	-1	no_errors	ENST00000316423	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.999:1.000:1.000	-
FRMPD3	84443	genome.wustl.edu	37	X	106846478	106846480	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chrX:106846478_106846480delCAG	ENST00000276185.4	+	16	5308_5310	c.5308_5310delCAG	c.(5308-5310)cagdel	p.Q1776del				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	1776	Gln-rich.					cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						gcaacaacaacagcagcagcagc	0.586																																																	0								ENSG00000147234			51,2272		9,27,6,1017,211						0.5	0.8			2	74,3975		18,26,12,1566,817	no	coding	FRMPD3	XM_042978.7		27,53,18,2583,1028	A1A1,A1R,A1,RR,R		1.8276,2.1954,1.9617				125,6247				FRMPD3	SO:0001651	inframe_deletion	0				HGNC	AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.5308_5310delCAG	X.37:g.106846487_106846489delCAG	ENSP00000276185:p.Gln1776del	Somatic	0	78	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	Q96JK8	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.Q1773in_frame_del	ENST00000276185.4	37	c.5308_5310		X																																																																																			-	NULL		0.586	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	FRMPD3	protein_coding		CAG	XM_042978			106846480	+1	no_errors	ENST00000276185	ensembl	human	known	74_37	in_frame_del	DEL	0.517:0.515:0.516	-
NF1	4763	genome.wustl.edu	37	17	29663696	29663696	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr17:29663696C>A	ENST00000358273.4	+	42	6574	c.6191C>A	c.(6190-6192)tCt>tAt	p.S2064Y	NF1_ENST00000356175.3_Missense_Mutation_p.S2043Y|NF1_ENST00000417592.2_5'Flank|NF1_ENST00000444181.2_5'Flank	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2064					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ACATGCTTATCTCCAACTCCT	0.348			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)						ENSG00000196712						127.0	103.0	111.0					17																	29663696		2203	4300	6503	NF1	SO:0001583	missense	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	-	HGNC		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.6191C>A	17.37:g.29663696C>A	ENSP00000351015:p.Ser2064Tyr	Somatic	0	62	0.00		0.5720907680579784	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.S2064Y	ENST00000358273.4	37	c.6191	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	C	22.6	4.316500	0.81469	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	T;T;T	0.11169	2.96;3.11;2.8	5.63	5.63	0.86233	Armadillo-type fold (2);	0.000000	0.85682	D	0.000000	T	0.33818	0.0876	M	0.63428	1.95	0.80722	D	1	D;D	0.64830	0.994;0.989	D;P	0.77004	0.989;0.885	T	0.00909	-1.1518	10	0.87932	D	0	.	20.0345	0.97552	0.0:1.0:0.0:0.0	.	2043;2064	P21359-2;P21359	.;NF1_HUMAN	Y	2064;2043;1709	ENSP00000351015:S2064Y;ENSP00000348498:S2043Y;ENSP00000389907:S1709Y	ENSP00000348498:S2043Y	S	+	2	0	NF1	26687822	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.334000	0.79224	2.797000	0.96272	0.655000	0.94253	TCT	-	superfamily_ARM-type_fold		0.348	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	protein_coding	OTTHUMT00000256351.2	C	NM_000267	-		29663696	+1	no_errors	ENST00000358273	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF425	155054	genome.wustl.edu	37	7	148802643	148802643	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr7:148802643G>T	ENST00000378061.2	-	4	452	c.320C>A	c.(319-321)cCc>cAc	p.P107H		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	107					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			TTTTGTCCTGGGAGTTCCTTC	0.388																																																	0								ENSG00000204947						74.0	71.0	72.0					7																	148802643		2203	4300	6503	ZNF425	SO:0001583	missense	0			-	HGNC	AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.320C>A	7.37:g.148802643G>T	ENSP00000367300:p.Pro107His	Somatic	0	47	0.00		0.5720907680579784	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	B3KPM1|Q08AG3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.P107H	ENST00000378061.2	37	c.320	CCDS34773.1	7	.	.	.	.	.	.	.	.	.	.	G	4.823	0.153072	0.09185	.	.	ENSG00000204947	ENST00000378061;ENST00000483014	T;T	0.07114	3.22;4.94	2.45	-0.284	0.12870	.	.	.	.	.	T	0.03053	0.0090	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46992	-0.9151	9	0.13108	T	0.6	.	2.1889	0.03893	0.4848:0.0:0.2855:0.2298	.	107	Q6IV72	ZN425_HUMAN	H	107;129	ENSP00000367300:P107H;ENSP00000420379:P129H	ENSP00000367300:P107H	P	-	2	0	ZNF425	148433576	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.132000	0.15891	-0.197000	0.10350	-1.286000	0.01371	CCC	-	NULL		0.388	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF425	protein_coding	OTTHUMT00000352726.1	G	XM_088140	-		148802643	-1	no_errors	ENST00000378061	ensembl	human	known	74_37	missense	SNP	0.000	T
LRRN4CL	221091	genome.wustl.edu	37	11	62455864	62455864	+	Silent	SNP	C	C	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr11:62455864C>T	ENST00000317449.4	-	2	594	c.117G>A	c.(115-117)gcG>gcA	p.A39A		NM_203422.2	NP_981967.1	Q8ND94	LRN4L_HUMAN	LRRN4 C-terminal like	39						integral component of membrane (GO:0016021)				cervix(1)|kidney(1)	2						AAGGCGGCCACGCCGTCTCAG	0.647																																																	0								ENSG00000177363						19.0	20.0	20.0					11																	62455864		2200	4288	6488	LRRN4CL	SO:0001819	synonymous_variant	0			-	HGNC	AK291334	CCDS8030.1	11q12.3	2013-02-11				ENSG00000177363		"""Fibronectin type III domain containing"""	33724	protein-coding gene	gene with protein product							Standard	NM_203422		Approved		uc001nun.3	Q8ND94		ENST00000317449.4:c.117G>A	11.37:g.62455864C>T		Somatic	0	73	0.00		0.5720907680579784	29	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	A8K5L9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.A39	ENST00000317449.4	37	c.117	CCDS8030.1	11																																																																																			-	NULL		0.647	LRRN4CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRN4CL	protein_coding	OTTHUMT00000395168.1	C	NM_203422	-		62455864	-1	no_errors	ENST00000317449	ensembl	human	known	74_37	silent	SNP	0.000	T
WDR34	89891	genome.wustl.edu	37	9	131398646	131398646	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr9:131398646C>T	ENST00000372715.2	-	4	677	c.617G>A	c.(616-618)cGt>cAt	p.R206H	WDR34_ENST00000483181.1_5'Flank	NM_052844.3	NP_443076.2	Q96EX3	WDR34_HUMAN	WD repeat domain 34	206			R -> C (in dbSNP:rs148543026). {ECO:0000269|PubMed:24183451}.			axoneme (GO:0005930)|centriole (GO:0005814)|ciliary basal body (GO:0036064)				central_nervous_system(2)|lung(5)|skin(1)|urinary_tract(1)	9						CTGCTGGGGACGCAGGTCTCG	0.677																																																	0								ENSG00000119333						59.0	54.0	56.0					9																	131398646		2201	4298	6499	WDR34	SO:0001583	missense	0			-	HGNC	BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333		"""WD repeat domain containing"""	28296	protein-coding gene	gene with protein product		613363				19521662, 21953912, 24183451	Standard	NM_052844		Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.617G>A	9.37:g.131398646C>T	ENSP00000361800:p.Arg206His	Somatic	0	97	0.00		0.5720907680579784	139	29.80	59	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	55	21.43	Q5VXV4|Q9BV46	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.R206H	ENST00000372715.2	37	c.617	CCDS6906.2	9	.	.	.	.	.	.	.	.	.	.	c	11.03	1.519704	0.27211	.	.	ENSG00000119333	ENST00000372715;ENST00000451652	D;T	0.85702	-2.02;-0.21	5.75	-2.36	0.06663	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.699661	0.14782	N	0.298744	T	0.72787	0.3504	N	0.20986	0.625	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.56884	-0.7905	10	0.45353	T	0.12	-1.1348	11.4973	0.50415	0.0:0.3354:0.0:0.6646	.	197;89;206	A2A3F9;B4DXR8;Q96EX3	.;.;WDR34_HUMAN	H	206;197	ENSP00000361800:R206H;ENSP00000411370:R197H	ENSP00000361800:R206H	R	-	2	0	WDR34	130438467	0.883000	0.30277	0.342000	0.25602	0.044000	0.14063	1.190000	0.32126	-0.714000	0.04975	-1.163000	0.01768	CGT	-	superfamily_WD40_repeat_dom		0.677	WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR34	protein_coding	OTTHUMT00000054463.1	C	NM_052844	-		131398646	-1	no_errors	ENST00000372715	ensembl	human	known	74_37	missense	SNP	0.863	T
CHD7	55636	genome.wustl.edu	37	8	61769387	61769387	+	Silent	SNP	G	G	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr8:61769387G>A	ENST00000423902.2	+	34	8027	c.7548G>A	c.(7546-7548)agG>agA	p.R2516R	CHD7_ENST00000529472.1_3'UTR|CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2516					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GGGGAAGGAGGAAAAATGTGG	0.542																																																	0								ENSG00000171316						81.0	83.0	83.0					8																	61769387		2039	4196	6235	CHD7	SO:0001819	synonymous_variant	0			-	HGNC	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.7548G>A	8.37:g.61769387G>A		Somatic	0	19	0.00		0.5720907680579784	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	21	22.22	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R2516	ENST00000423902.2	37	c.7548	CCDS47865.1	8																																																																																			-	NULL		0.542	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	protein_coding	OTTHUMT00000383468.2	G	XM_098762	-		61769387	+1	no_errors	ENST00000423902	ensembl	human	known	74_37	silent	SNP	1.000	A
IGFN1	91156	genome.wustl.edu	37	1	201196039	201196039	+	Missense_Mutation	SNP	C	C	T	rs532414867		TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr1:201196039C>T	ENST00000335211.4	+	23	10946	c.10816C>T	c.(10816-10818)Cgg>Tgg	p.R3606W	IGFN1_ENST00000295591.8_3'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	1149						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						TCCGTGCTACCGGGAGCCCGA	0.667													C|||	1	0.000199681	0.0	0.0	5008	,	,		14729	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000163395						70.0	83.0	79.0					1																	201196039		2203	4293	6496	IGFN1	SO:0001583	missense	0			-	HGNC	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.10816C>T	1.37:g.201196039C>T	ENSP00000334714:p.Arg3606Trp	Somatic	0	51	0.00		0.5720907680579784	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	27	18.18	F8WAI1|Q9NT72	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R3606W	ENST00000335211.4	37	c.10816	CCDS53455.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.68|12.68	2.010590|2.010590	0.35511|0.35511	.|.	.|.	ENSG00000163395|ENSG00000163395	ENST00000412892|ENST00000335211	.|T	.|0.56103	.|0.48	5.05|5.05	0.152|0.152	0.14893|0.14893	.|.	.|0.486105	.|0.19668	.|N	.|0.108825	T|T	0.55986|0.55986	0.1955|0.1955	L|L	0.27053|0.27053	0.805|0.805	0.19300|0.19300	N|N	0.999979|0.999979	.|D	.|0.76494	.|0.999	.|D	.|0.71870	.|0.975	T|T	0.54997|0.54997	-0.8209|-0.8209	5|10	.|0.87932	.|D	.|0	.|.	12.7769|12.7769	0.57453|0.57453	0.7424:0.2576:0.0:0.0|0.7424:0.2576:0.0:0.0	.|.	.|3606	.|F8WAI1	.|.	L|W	1023|3606	.|ENSP00000334714:R3606W	.|ENSP00000334714:R3606W	P|R	+|+	2|1	0|2	IGFN1|IGFN1	199462662|199462662	0.091000|0.091000	0.21658|0.21658	0.014000|0.014000	0.15608|0.15608	0.221000|0.221000	0.24807|0.24807	1.315000|1.315000	0.33608|0.33608	0.119000|0.119000	0.18210|0.18210	-0.310000|-0.310000	0.09108|0.09108	CCG|CGG	-	NULL		0.667	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	protein_coding		C	NM_178275	-		201196039	+1	no_errors	ENST00000335211	ensembl	human	known	74_37	missense	SNP	0.019	T
FURIN	5045	genome.wustl.edu	37	15	91421487	91421489	+	In_Frame_Del	DEL	GGG	GGG	-			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	GGG	GGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr15:91421487_91421489delGGG	ENST00000268171.3	+	8	1072_1074	c.793_795delGGG	c.(793-795)gggdel	p.G265del		NM_002569.2	NP_002560.1	P09958	FURIN_HUMAN	furin (paired basic amino acid cleaving enzyme)	265	Peptidase S8.				cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of low-density lipoprotein particle receptor catabolic process (GO:0032804)|negative regulation of transforming growth factor beta1 production (GO:0032911)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-translational protein modification (GO:0043687)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)|regulation of protein catabolic process (GO:0042176)|secretion by cell (GO:0032940)|signal peptide processing (GO:0006465)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|nerve growth factor binding (GO:0048406)|peptidase activity (GO:0008233)|peptide binding (GO:0042277)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(4)|endometrium(4)|large_intestine(3)|liver(2)|lung(13)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	36	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			GACAGTGGATGGGCCAGCCCGCC	0.655																																																	0								ENSG00000140564																																			FURIN	SO:0001651	inframe_deletion	0				HGNC	X17094	CCDS10364.1	15q26.1	2007-01-24	2002-12-04	2002-12-06	ENSG00000140564	ENSG00000140564			8568	protein-coding gene	gene with protein product		136950	"""paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein)"""	PCSK3, FUR, PACE		2251280, 1741956	Standard	NM_002569		Approved	SPC1	uc002bpu.1	P09958	OTTHUMG00000149831	ENST00000268171.3:c.793_795delGGG	15.37:g.91421487_91421489delGGG	ENSP00000268171:p.Gly265del	Somatic	0	125	0.00		0.5720907680579784	63	18.18	14	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	42	14.29	Q14336|Q6LBS3|Q9UCZ5	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,prints_Peptidase_S8_subtilisin-rel	p.G265in_frame_del	ENST00000268171.3	37	c.793_795	CCDS10364.1	15																																																																																			-	pfam_Peptidase_S8/S53_dom,superfamily_Peptidase_S8/S53_dom		0.655	FURIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FURIN	protein_coding	OTTHUMT00000313492.1	GGG	NM_002569			91421489	+1	no_errors	ENST00000268171	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:0.996	-
PPP1R12C	54776	genome.wustl.edu	37	19	55610363	55610363	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr19:55610363G>C	ENST00000263433.3	-	5	847	c.832C>G	c.(832-834)Ctg>Gtg	p.L278V	PPP1R12C_ENST00000376393.2_Missense_Mutation_p.L278V|PPP1R12C_ENST00000435544.2_Missense_Mutation_p.L204V	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1			protein phosphatase 1, regulatory subunit 12C											central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		TCGGCCAGCAGGCGGCAGGCA	0.716																																																	0								ENSG00000125503						15.0	13.0	14.0					19																	55610363		2156	4258	6414	PPP1R12C	SO:0001583	missense	0			-	HGNC	AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3		11399775	Standard	NM_017607		Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.832C>G	19.37:g.55610363G>C	ENSP00000263433:p.Leu278Val	Somatic	0	65	0.00		0.5720907680579784	197	15.38	36	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	40	13.04		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Pase-1_reg_su_12A/B/C_euk,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L278V	ENST00000263433.3	37	c.832	CCDS12916.1	19	.	.	.	.	.	.	.	.	.	.	G	19.46	3.831113	0.71258	.	.	ENSG00000125503	ENST00000263433;ENST00000376393;ENST00000435544	T;T;T	0.69175	-0.38;-0.38;-0.38	4.6	1.08	0.20341	Ankyrin repeat-containing domain (4);	0.219175	0.29822	N	0.011105	T	0.64023	0.2561	L	0.47716	1.5	0.46725	D	0.999175	D;P;D	0.53745	0.962;0.865;0.962	P;B;P	0.53450	0.726;0.421;0.726	T	0.59867	-0.7373	10	0.51188	T	0.08	.	5.8197	0.18520	0.1757:0.0:0.6708:0.1536	.	204;278;278	B4DME2;Q9BZL4-3;Q9BZL4	.;.;PP12C_HUMAN	V	278;278;204	ENSP00000263433:L278V;ENSP00000365573:L278V;ENSP00000387833:L204V	ENSP00000263433:L278V	L	-	1	2	PPP1R12C	60302175	0.999000	0.42202	0.984000	0.44739	0.983000	0.72400	0.517000	0.22832	0.115000	0.18071	0.462000	0.41574	CTG	-	pirsf_Pase-1_reg_su_12A/B/C_euk,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.716	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R12C	protein_coding	OTTHUMT00000451814.2	G	NM_017607	-		55610363	-1	no_errors	ENST00000263433	ensembl	human	known	74_37	missense	SNP	0.997	C
RBM4B	83759	genome.wustl.edu	37	11	66436591	66436591	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr11:66436591delC	ENST00000525754.1	-	2	1252	c.584delG	c.(583-585)ggafs	p.G195fs	RP11-658F2.8_ENST00000550837.1_RNA|RBM4B_ENST00000310046.4_Frame_Shift_Del_p.G195fs|RP11-658F2.8_ENST00000548810.1_RNA|RBM4B_ENST00000524637.1_3'UTR|RBM4B_ENST00000529195.2_5'Flank|RBM4B_ENST00000531969.1_Intron			Q9BQ04	RBM4B_HUMAN	RNA binding motif protein 4B	195					circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|entrainment of circadian clock by photoperiod (GO:0043153)|mRNA processing (GO:0006397)|positive regulation of gene expression (GO:0010628)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(4)|lung(1)|urinary_tract(2)	10						TCGAACTGCTCCATATTGTTC	0.498																																																	0								ENSG00000173914						134.0	122.0	126.0					11																	66436591		2200	4295	6495	RBM4B	SO:0001589	frameshift_variant	0				HGNC	AK095158	CCDS8149.1, CCDS66144.1	11q13	2013-02-12	2006-01-25	2006-01-25				"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	28842	protein-coding gene	gene with protein product			"""RNA binding motif protein 30"""	RBM30		12477932	Standard	XR_247213		Approved	MGC10871, ZCCHC15, RBM4L, ZCRB3B, ZCCHC21B	uc001ojb.3	Q9BQ04		ENST00000525754.1:c.584delG	11.37:g.66436591delC	ENSP00000433071:p.Gly195fs	Somatic	0	43	0.00		0.5720907680579784	35	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29	B3KT83	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,pfam_Znf_CCHC,smart_RRM_dom,smart_Znf_CCHC,pfscan_Znf_CCHC,pfscan_RRM_dom	p.G195fs	ENST00000525754.1	37	c.584	CCDS8149.1	11																																																																																			-	NULL		0.498	RBM4B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RBM4B	protein_coding	OTTHUMT00000393851.1	C	NM_031492			66436591	-1	no_errors	ENST00000310046	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
PANX1	24145	genome.wustl.edu	37	11	93913360	93913360	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr11:93913360G>A	ENST00000227638.3	+	4	1523	c.1138G>A	c.(1138-1140)Ggc>Agc	p.G380S	PANX1_ENST00000436171.2_Missense_Mutation_p.G380S	NM_015368.3	NP_056183.2	Q96RD7	PANX1_HUMAN	pannexin 1	380					calcium ion transport (GO:0006816)|cation transport (GO:0006812)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|protein hexamerization (GO:0034214)|response to ATP (GO:0033198)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	bleb (GO:0032059)|endoplasmic reticulum (GO:0005783)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium channel activity (GO:0005262)|gap junction hemi-channel activity (GO:0055077)|leak channel activity (GO:0022840)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(2)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Probenecid(DB01032)	TGTTGTTGATGGCAAAACTCC	0.507																																																	0								ENSG00000110218						83.0	76.0	79.0					11																	93913360		2201	4298	6499	PANX1	SO:0001583	missense	0			-	HGNC	AF093239	CCDS8296.1	11q14-q21	2011-12-02			ENSG00000110218	ENSG00000110218		"""Ion channels / Pannexins"""	8599	protein-coding gene	gene with protein product	"""innexin"""	608420				14597722	Standard	NM_015368		Approved	MRS1, UNQ2529, PX1	uc001per.3	Q96RD7	OTTHUMG00000167757	ENST00000227638.3:c.1138G>A	11.37:g.93913360G>A	ENSP00000227638:p.Gly380Ser	Somatic	0	49	0.00		0.5720907680579784	22	33.33	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	19	26.92	O75968|Q543A0|Q6UW26|Q96AM9|Q96L77|Q96RS5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Innexin,pfscan_Innexin	p.G380S	ENST00000227638.3	37	c.1138	CCDS8296.1	11	.	.	.	.	.	.	.	.	.	.	G	23.2	4.383166	0.82792	.	.	ENSG00000110218	ENST00000227638;ENST00000436171	T;T	0.19806	2.13;2.12	5.42	5.42	0.78866	.	0.143817	0.64402	D	0.000006	T	0.43077	0.1231	M	0.66506	2.035	0.58432	D	0.999998	D;D	0.71674	0.997;0.998	P;D	0.65233	0.859;0.933	T	0.21965	-1.0230	10	0.52906	T	0.07	-31.4195	15.2581	0.73601	0.0:0.1406:0.8594:0.0	.	380;380	Q96RD7;Q96RD7-2	PANX1_HUMAN;.	S	380	ENSP00000227638:G380S;ENSP00000411461:G380S	ENSP00000227638:G380S	G	+	1	0	PANX1	93553008	1.000000	0.71417	0.358000	0.25811	0.107000	0.19398	3.766000	0.55280	2.542000	0.85734	0.655000	0.94253	GGC	-	pfscan_Innexin		0.507	PANX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PANX1	protein_coding	OTTHUMT00000396121.1	G	NM_015368	-		93913360	+1	no_errors	ENST00000227638	ensembl	human	known	74_37	missense	SNP	0.999	A
THNSL2	55258	genome.wustl.edu	37	2	88484878	88484878	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr2:88484878C>A	ENST00000324166.5	+	7	2800	c.1109C>A	c.(1108-1110)tCg>tAg	p.S370*	THNSL2_ENST00000377254.3_Intron|THNSL2_ENST00000496844.1_Intron|THNSL2_ENST00000449349.1_Intron|THNSL2_ENST00000358591.2_Nonsense_Mutation_p.S370*|THNSL2_ENST00000402102.1_Intron|THNSL2_ENST00000343544.4_Intron	NM_018271.4	NP_060741.3	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2 (S. cerevisiae)	370					2-oxobutyrate biosynthetic process (GO:0046360)|dephosphorylation (GO:0016311)|serine family amino acid catabolic process (GO:0009071)	extracellular space (GO:0005615)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|serine binding (GO:0070905)			breast(4)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	27						GTGTCAGTGTCGGATGAAGCC	0.572																																																	0								ENSG00000144115						40.0	46.0	44.0					2																	88484878		2180	4289	6469	THNSL2	SO:0001587	stop_gained	0			-	HGNC		CCDS2002.2, CCDS58718.1, CCDS74539.1	2p11.2	2007-06-20			ENSG00000144115	ENSG00000144115			25602	protein-coding gene	gene with protein product		611261				17034760	Standard	NM_018271		Approved	FLJ10916	uc021vkr.1	Q86YJ6	OTTHUMG00000130314	ENST00000324166.5:c.1109C>A	2.37:g.88484878C>A	ENSP00000327323:p.Ser370*	Somatic	0	41	0.00		0.5720907680579784	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	B3KTB1|B5MDX8|B7WPF8|D9ZZB8|Q6P2M7|Q6PI27|Q9NV54	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Trp_syn_b_sub_like_PLP_eny_SF,superfamily_Trp_syn_b_sub_like_PLP_eny_SF,tigrfam_Thr_synthase_like	p.S370*	ENST00000324166.5	37	c.1109	CCDS2002.2	2	.	.	.	.	.	.	.	.	.	.	C	48	14.431868	0.99795	.	.	ENSG00000144115	ENST00000358591;ENST00000324166	.	.	.	5.81	3.97	0.46021	.	0.530317	0.20118	N	0.098866	.	.	.	.	.	.	0.22796	N	0.998729	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.589	0.45298	0.0:0.7949:0.1336:0.0715	.	.	.	.	X	370	.	ENSP00000327323:S370X	S	+	2	0	THNSL2	88265993	0.964000	0.33143	0.042000	0.18584	0.005000	0.04900	2.336000	0.43938	0.758000	0.33059	0.655000	0.94253	TCG	-	pfam_Trp_syn_b_sub_like_PLP_eny_SF,superfamily_Trp_syn_b_sub_like_PLP_eny_SF,tigrfam_Thr_synthase_like		0.572	THNSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THNSL2	protein_coding	OTTHUMT00000252662.1	C	NM_018271	-		88484878	+1	no_errors	ENST00000324166	ensembl	human	known	74_37	nonsense	SNP	0.075	A
TP53	7157	genome.wustl.edu	37	17	7578553	7578553	+	Splice_Site	SNP	T	T	C			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr17:7578553T>C	ENST00000269305.4	-	5	566	c.377A>G	c.(376-378)tAc>tGc	p.Y126C	TP53_ENST00000445888.2_Splice_Site_p.Y126C|TP53_ENST00000420246.2_Splice_Site_p.Y126C|TP53_ENST00000455263.2_Splice_Site_p.Y126C|TP53_ENST00000413465.2_Splice_Site_p.Y126C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Splice_Site_p.Y126C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	126	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> G (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.Y126_K132delYSPALNK(6)|p.Y126C(4)|p.Y126_N131delYSPALN(3)|p.Y126fs*44(2)|p.Y126S(2)|p.V73fs*9(1)|p.?(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.Y126fs*18(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCAGGGGAGTACTGTAGGAA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	30	Deletion - In frame(9)|Whole gene deletion(8)|Substitution - Missense(6)|Deletion - Frameshift(6)|Unknown(1)	upper_aerodigestive_tract(6)|large_intestine(4)|central_nervous_system(4)|bone(4)|lung(3)|ovary(3)|breast(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|liver(1)						ENSG00000141510						43.0	43.0	43.0					17																	7578553		2203	4300	6503	TP53	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.376-1A>G	17.37:g.7578553T>C		Somatic	0	23	0.00		0.5720907680579784	49	66.45	101	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	4	50.00	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Y126C	ENST00000269305.4	37	c.377	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	22.7	4.320083	0.81469	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D;D	0.99872	-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	M	0.90483	3.12	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;1.0;1.0;0.989;1.0;1.0;1.0	D	0.96375	0.9277	10	0.87932	D	0	-28.2517	13.8301	0.63375	0.0:0.0:0.0:1.0	.	87;126;126;33;126;126;126	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	126;126;126;126;126;126;115;33;33;126;126	ENSP00000410739:Y126C;ENSP00000352610:Y126C;ENSP00000269305:Y126C;ENSP00000398846:Y126C;ENSP00000391127:Y126C;ENSP00000391478:Y126C;ENSP00000423862:Y33C;ENSP00000424104:Y126C;ENSP00000426252:Y126C	ENSP00000269305:Y126C	Y	-	2	0	TP53	7519278	1.000000	0.71417	0.997000	0.53966	0.932000	0.56968	7.958000	0.87877	2.206000	0.71126	0.533000	0.62120	TAC	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546	-	Missense_Mutation	7578553	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	C
PHKG1	5260	genome.wustl.edu	37	7	56147316	56147316	+	IGR	SNP	G	G	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr7:56147316G>A	ENST00000297373.2	-	0	1431				SUMF2_ENST00000342190.6_Missense_Mutation_p.G277S|SUMF2_ENST00000413756.1_Silent_p.V345V|SUMF2_ENST00000437307.2_3'UTR|SUMF2_ENST00000395435.2_3'UTR|SUMF2_ENST00000434526.2_3'UTR|SUMF2_ENST00000395436.2_3'UTR|SUMF2_ENST00000275607.9_3'UTR	NM_001258460.1|NM_006213.4	NP_001245389.1|NP_006204.1	Q16816	PHKG1_HUMAN	phosphorylase kinase, gamma 1 (muscle)						carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|tau-protein kinase activity (GO:0050321)			endometrium(1)|large_intestine(1)|lung(5)	7	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GCAGCCGGGTGGTGACAAGGA	0.577											OREG0018082	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(184;580 2064 5329 24177 35303)												0								ENSG00000129103						76.0	81.0	79.0					7																	56147316		2203	4300	6503	SUMF2	SO:0001628	intergenic_variant	0			-	HGNC	X80590	CCDS5525.1, CCDS59057.1	7p11.2	2009-07-10			ENSG00000164776	ENSG00000164776	2.7.11.19		8930	protein-coding gene	gene with protein product		172470		PHKG		8530014	Standard	NM_001258459		Approved		uc011kdb.2	Q16816	OTTHUMG00000023869		7.37:g.56147316G>A		Somatic	0	74	0.00	1013	0.5720907680579784	313	11.58	41	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	44	18.52	B7Z1D0|F5H2S1|Q75LP5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FGE_dom,superfamily_C-type_lectin_fold	p.G277S	ENST00000297373.2	37	c.829	CCDS5525.1	7	.	.	.	.	.	.	.	.	.	.	G	12.19	1.862711	0.32884	.	.	ENSG00000129103	ENST00000342190	D	0.91792	-2.91	3.8	-3.12	0.05282	.	0.590849	0.18594	N	0.136660	T	0.77671	0.4165	N	0.08118	0	0.09310	N	0.999999	B;B	0.29552	0.248;0.103	B;B	0.26202	0.067;0.058	T	0.68569	-0.5374	10	0.66056	D	0.02	-25.0441	5.4125	0.16356	0.3003:0.3314:0.3683:0.0	.	240;277	Q8NBJ7-4;F8WA42	.;.	S	277	ENSP00000341938:G277S	ENSP00000341938:G277S	G	+	1	0	SUMF2	56114810	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.318000	0.08050	-0.561000	0.06094	-0.379000	0.06801	GGT	-	NULL		0.577	PHKG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUMF2	protein_coding	OTTHUMT00000251587.1	G	NM_006213	-		56147316	+1	no_errors	ENST00000342190	ensembl	human	known	74_37	missense	SNP	0.000	A
FRMPD3	84443	genome.wustl.edu	37	X	106843718	106843718	+	Silent	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chrX:106843718C>A	ENST00000276185.4	+	16	2548	c.2548C>A	c.(2548-2550)Cgg>Agg	p.R850R				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	850						cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						CCTGCCCTTCCGGATCCAGAG	0.612																																																	0								ENSG00000147234						53.0	49.0	50.0					X																	106843718		876	1991	2867	FRMPD3	SO:0001819	synonymous_variant	0			-	HGNC	AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.2548C>A	X.37:g.106843718C>A		Somatic	0	43	0.00		0.5720907680579784	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	Q96JK8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.R850	ENST00000276185.4	37	c.2548		X																																																																																			-	NULL		0.612	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	FRMPD3	protein_coding		C	XM_042978	-		106843718	+1	no_errors	ENST00000276185	ensembl	human	known	74_37	silent	SNP	0.995	A
COL5A3	50509	genome.wustl.edu	37	19	10104349	10104349	+	Splice_Site	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr19:10104349C>A	ENST00000264828.3	-	18	1727		c.e18-1		CTD-2553C6.1_ENST00000592332.1_RNA	NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3						axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.?(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CACGATCACCCTGTCCAGAGA	0.597																																																	1	Unknown(1)	breast(1)						ENSG00000080573						171.0	143.0	152.0					19																	10104349		2203	4300	6503	COL5A3	SO:0001630	splice_region_variant	0			-	HGNC	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.1642-1G>T	19.37:g.10104349C>A		Somatic	0	92	0.00		0.5720907680579784	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	8.89	Q9NZQ6	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e18-1	ENST00000264828.3	37	c.1642-1	CCDS12222.1	19	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409124	0.83340	.	.	ENSG00000080573	ENST00000264828	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0482	0.86510	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL5A3	9965349	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	6.676000	0.74498	2.634000	0.89283	0.563000	0.77884	.	-	-		0.597	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	protein_coding	OTTHUMT00000315788.1	C	NM_015719	-	Intron	10104349	-1	no_errors	ENST00000264828	ensembl	human	known	74_37	splice_site	SNP	1.000	A
KREMEN1	83999	genome.wustl.edu	37	22	29490359	29490359	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr22:29490359C>A	ENST00000407188.1	+	2	205	c.205C>A	c.(205-207)Ctg>Atg	p.L69M	KREMEN1_ENST00000400335.4_Missense_Mutation_p.L71M|KREMEN1_ENST00000327813.5_Missense_Mutation_p.L71M|KREMEN1_ENST00000400338.2_Missense_Mutation_p.L71M			Q96MU8	KREM1_HUMAN	kringle containing transmembrane protein 1	69	Kringle. {ECO:0000255|PROSITE- ProRule:PRU00121}.				cell communication (GO:0007154)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	20						ATACAACACTCTGAAATACCC	0.483																																																	0								ENSG00000183762						75.0	73.0	74.0					22																	29490359		1876	4097	5973	KREMEN1	SO:0001583	missense	0			-	HGNC	AB059618	CCDS43000.1, CCDS13849.1, CCDS43000.2	22q12.1	2008-03-27	2002-11-13	2002-11-15	ENSG00000183762	ENSG00000183762			17550	protein-coding gene	gene with protein product		609898	"""kringle containing transmembrane protein"""	KREMEN		11267660	Standard	NM_001039570		Approved	KRM1	uc011akm.1	Q96MU8	OTTHUMG00000030987	ENST00000407188.1:c.205C>A	22.37:g.29490359C>A	ENSP00000385431:p.Leu69Met	Somatic	0	82	0.00		0.5720907680579784	18	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.16	B0QY46|B0QY47|B1AJR5|Q5TIB9|Q6P3X6|Q9BY70|Q9UGS5|Q9UGU1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Kremen,pfam_Kringle,pfam_WSC_carb-bd,pfam_CUB_dom,superfamily_Kringle-like,superfamily_CUB_dom,superfamily_Scorpion_toxin-like,smart_Kringle,smart_WSC_carb-bd_subgr,smart_CUB_dom,pfscan_CUB_dom,pfscan_Kringle,pfscan_WSC_carb-bd	p.L71M	ENST00000407188.1	37	c.211	CCDS43000.2	22	.	.	.	.	.	.	.	.	.	.	C	15.10	2.734396	0.48939	.	.	ENSG00000183762	ENST00000400335;ENST00000400338;ENST00000327813;ENST00000407188	T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06	4.99	2.9	0.33743	.	0.000000	0.48286	D	0.000194	T	0.68109	0.2965	L	0.49126	1.545	0.43476	D	0.995695	D;D	0.71674	0.989;0.998	P;D	0.69142	0.885;0.962	T	0.65063	-0.6259	10	0.46703	T	0.11	.	7.0997	0.25330	0.0:0.7211:0.0:0.2789	.	71;71	Q96MU8-2;Q96MU8-3	.;.	M	71;71;71;69	ENSP00000383189:L71M;ENSP00000383192:L71M;ENSP00000331242:L71M;ENSP00000385431:L69M	ENSP00000331242:L71M	L	+	1	2	KREMEN1	27820359	0.984000	0.35163	1.000000	0.80357	0.998000	0.95712	0.324000	0.19610	0.632000	0.30432	0.650000	0.86243	CTG	-	pirsf_Kremen,pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle		0.483	KREMEN1-004	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	KREMEN1	protein_coding	OTTHUMT00000320947.1	C		-		29490359	+1	no_errors	ENST00000327813	ensembl	human	known	74_37	missense	SNP	1.000	A
FICD	11153	genome.wustl.edu	37	12	108912292	108912292	+	Missense_Mutation	SNP	C	C	A	rs200978347		TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr12:108912292C>A	ENST00000552695.1	+	3	652	c.417C>A	c.(415-417)ttC>ttA	p.F139L	FICD_ENST00000361549.2_3'UTR	NM_007076.2	NP_009007.2	Q9BVA6	FICD_HUMAN	FIC domain containing	139					negative regulation of Rho GTPase activity (GO:0034259)|protein adenylylation (GO:0018117)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein adenylyltransferase activity (GO:0070733)			NS(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(1)|prostate(1)|upper_aerodigestive_tract(2)	15						ACCCGGACTTCGTGGACGCGC	0.572																																																	0								ENSG00000198855						110.0	90.0	97.0					12																	108912292		2203	4300	6503	FICD	SO:0001583	missense	0			-	HGNC	AF049611	CCDS9116.1	12q24.1	2007-12-05				ENSG00000198855			18416	protein-coding gene	gene with protein product	"""huntingtin interacting protein 13"", ""fic S-phase protein cell division homolog (E. coli)"""					9700202	Standard	NM_007076		Approved	HYPE, HIP13	uc001tmx.1	Q9BVA6		ENST00000552695.1:c.417C>A	12.37:g.108912292C>A	ENSP00000446479:p.Phe139Leu	Somatic	0	94	0.00		0.5720907680579784	14	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	O75406	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fido,superfamily_Fido,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.F139L	ENST00000552695.1	37	c.417	CCDS9116.1	12	.	.	.	.	.	.	.	.	.	.	C	9.646	1.140362	0.21205	.	.	ENSG00000198855	ENST00000552695	T	0.75821	-0.97	5.38	-6.12	0.02124	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.319919	0.38897	N	0.001528	T	0.52041	0.1710	L	0.38175	1.15	0.80722	D	1	B	0.20459	0.045	B	0.19148	0.024	T	0.31280	-0.9949	10	0.11794	T	0.64	-10.6867	7.9911	0.30242	0.0:0.3473:0.1826:0.4701	.	139	Q9BVA6	FICD_HUMAN	L	139	ENSP00000446479:F139L	ENSP00000446479:F139L	F	+	3	2	FICD	107436422	0.004000	0.15560	0.000000	0.03702	0.275000	0.26752	-1.227000	0.02950	-1.236000	0.02542	0.655000	0.94253	TTC	-	pfscan_TPR_repeat,pfscan_TPR-contain_dom		0.572	FICD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FICD	protein_coding	OTTHUMT00000404842.1	C	NM_007076	-		108912292	+1	no_errors	ENST00000552695	ensembl	human	known	74_37	missense	SNP	0.541	A
FGD3	89846	genome.wustl.edu	37	9	95768364	95768364	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr9:95768364T>C	ENST00000375482.3	+	6	1235	c.739T>C	c.(739-741)Tac>Cac	p.Y247H	FGD3_ENST00000416701.2_Missense_Mutation_p.Y247H|FGD3_ENST00000337352.6_Missense_Mutation_p.Y247H	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	247	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						CCTGAAGATGTACGGCGAGTA	0.552																																																	0								ENSG00000127084						81.0	91.0	87.0					9																	95768364		2166	4290	6456	FGD3	SO:0001583	missense	0			-	HGNC	AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.739T>C	9.37:g.95768364T>C	ENSP00000364631:p.Tyr247His	Somatic	0	80	0.00		0.5720907680579784	25	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	57	12.31	F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.Y247H	ENST00000375482.3	37	c.739	CCDS43849.1	9	.	.	.	.	.	.	.	.	.	.	T	24.6	4.550359	0.86127	.	.	ENSG00000127084	ENST00000375482;ENST00000416701;ENST00000337352	T;T;T	0.61980	0.06;0.06;0.06	4.54	4.54	0.55810	Dbl homology (DH) domain (5);	0.000000	0.34652	N	0.003786	D	0.84701	0.5530	H	0.96518	3.835	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.89366	0.3671	10	0.87932	D	0	.	13.4128	0.60952	0.0:0.0:0.0:1.0	.	247;247;247	Q5JSP0-2;F8W7P2;Q5JSP0	.;.;FGD3_HUMAN	H	247	ENSP00000364631:Y247H;ENSP00000413833:Y247H;ENSP00000336914:Y247H	ENSP00000336914:Y247H	Y	+	1	0	FGD3	94808185	1.000000	0.71417	0.999000	0.59377	0.860000	0.49131	7.506000	0.81665	2.005000	0.58758	0.533000	0.62120	TAC	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.552	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FGD3	protein_coding	OTTHUMT00000055493.1	T	NM_033086	-		95768364	+1	no_errors	ENST00000337352	ensembl	human	known	74_37	missense	SNP	1.000	C
NT5DC4	284958	genome.wustl.edu	37	2	113484278	113484278	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr2:113484278A>G	ENST00000327581.4	+	15	1184	c.1133A>G	c.(1132-1134)gAg>gGg	p.E378G	NT5DC4_ENST00000497526.1_3'UTR			Q86YG4	NT5D4_HUMAN	5'-nucleotidase domain containing 4	378							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)										AGCAGTTGTGAGCTGCAAGTC	0.607											OREG0014901	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000144130																																			NT5DC4	SO:0001583	missense	0			-	HGNC	BC041437		2q13	2012-04-20			ENSG00000144130	ENSG00000144130			27678	protein-coding gene	gene with protein product							Standard	XM_001716359		Approved		uc002tid.3	Q86YG4	OTTHUMG00000153308	ENST00000327581.4:c.1133A>G	2.37:g.113484278A>G	ENSP00000330247:p.Glu378Gly	Somatic	0	64	0.00	1450	0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	38	22.45		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HAD-SF_hydro_IG_5-nucl,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IG_5-nucl	p.E378G	ENST00000327581.4	37	c.1133		2	.	.	.	.	.	.	.	.	.	.	A	5.095	0.203085	0.09704	.	.	ENSG00000144130	ENST00000327581	T	0.25579	1.79	4.5	2.64	0.31445	HAD-like domain (1);	0.776043	0.12319	N	0.479495	T	0.17577	0.0422	.	.	.	0.09310	N	1	B	0.10296	0.003	B	0.19666	0.026	T	0.19128	-1.0315	9	0.42905	T	0.14	.	5.6939	0.17845	0.3304:0.0:0.6696:0.0	.	378	Q86YG4	NT5D4_HUMAN	G	378	ENSP00000330247:E378G	ENSP00000330247:E378G	E	+	2	0	NT5DC4	113200749	0.001000	0.12720	0.019000	0.16419	0.019000	0.09904	0.548000	0.23314	0.999000	0.39023	-0.385000	0.06624	GAG	-	pfam_HAD-SF_hydro_IG_5-nucl,superfamily_HAD-like_dom		0.607	NT5DC4-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	NT5DC4	protein_coding	OTTHUMT00000330647.1	A	XM_001716541	-		113484278	+1	no_errors	ENST00000327581	ensembl	human	novel	74_37	missense	SNP	0.160	G
MGAM	8972	genome.wustl.edu	37	7	141778612	141778612	+	Intron	SNP	C	C	G			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr7:141778612C>G	ENST00000549489.2	+	38	4713				MGAM_ENST00000475668.2_Missense_Mutation_p.S1884C	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTTCAGGCATCCAATTCTTCT	0.403																																																	0								ENSG00000257335																																			MGAM	SO:0001627	intron_variant	0			-	HGNC	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4618+13344C>G	7.37:g.141778612C>G		Somatic	0	25	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	6	72.73	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.S1884C	ENST00000549489.2	37	c.5651	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	C	12.13	1.846940	0.32606	.	.	ENSG00000257335	ENST00000475668	.	.	.	4.77	4.77	0.60923	.	.	.	.	.	T	0.41949	0.1181	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28170	-1.0052	5	0.37606	T	0.19	.	11.3288	0.49465	0.0:0.9098:0.0:0.0902	.	.	.	.	C	1885	.	ENSP00000417515:S1885C	S	+	2	0	MGAM	141425081	0.000000	0.05858	0.012000	0.15200	0.340000	0.28889	0.096000	0.15147	2.393000	0.81446	0.556000	0.70494	TCC	-	pfam_P_trefoil,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil		0.403	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	protein_coding	OTTHUMT00000351244.3	C		-		141778612	+1	no_errors	ENST00000475668	ensembl	human	putative	74_37	missense	SNP	0.011	G
IRX4	50805	genome.wustl.edu	37	5	1881171	1881183	+	Intron	DEL	CGGTGGGGGGGGG	CGGTGGGGGGGGG	-	rs71871413|rs111961905|rs111619755	byFrequency	TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	CGGTGGGGGGGGG	CGGTGGGGGGGGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr5:1881171_1881183delCGGTGGGGGGGGG	ENST00000505790.1	-	4	754				IRX4_ENST00000231357.2_Intron|CTD-2194D22.3_ENST00000506335.1_RNA|IRX4_ENST00000513692.1_Intron|IRX4_ENST00000505938.1_5'UTR	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4						establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		GAgcgcgggccggtgggggggggcgggggggAG	0.624														3675	0.733826	0.7171	0.6931	5008	,	,		5605	0.6845		0.8072	False		,,,				2504	0.7607																0								ENSG00000113430																																			IRX4	SO:0001627	intron_variant	0				HGNC	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.298-223CCCCCCCCCACCG>-	5.37:g.1881171_1881183delCGGTGGGGGGGGG		Somatic	NA	NA	NA		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000505790.1	37	NULL	CCDS3867.1	5																																																																																			-	-		0.624	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	IRX4	protein_coding	OTTHUMT00000365500.1	CGGTGGGGGGGGG	NM_016358			1881183	-1	no_errors	ENST00000505938	ensembl	human	known	74_37	rna	DEL	0.002:0.002:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.003:0.003:0.001	-
AGFG1	3267	genome.wustl.edu	37	2	228389621	228389621	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr2:228389621C>A	ENST00000310078.8	+	5	944	c.684C>A	c.(682-684)aaC>aaA	p.N228K	AGFG1_ENST00000373671.3_Missense_Mutation_p.N228K|AGFG1_ENST00000409315.1_Missense_Mutation_p.N228K|AGFG1_ENST00000409979.2_Missense_Mutation_p.N228K|AGFG1_ENST00000409171.1_Missense_Mutation_p.N228K	NM_001135188.1|NM_001135189.1|NM_004504.4	NP_001128660.1|NP_001128661.1|NP_004495.2	P52594	AGFG1_HUMAN	ArfGAP with FG repeats 1	228					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of ARF GTPase activity (GO:0032312)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)	ARF GTPase activator activity (GO:0008060)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(2)|ovary(1)|prostate(1)|skin(4)|stomach(1)	18						CACATTTCAACAGTCATGCAG	0.403																																																	0								ENSG00000173744						138.0	125.0	129.0					2																	228389621		2203	4300	6503	AGFG1	SO:0001583	missense	0			-	HGNC		CCDS2467.1, CCDS46533.1, CCDS46534.1, CCDS46535.1	2q36	2009-11-30	2008-09-22	2008-09-22	ENSG00000173744	ENSG00000173744		"""ADP-ribosylation factor GTPase activating proteins"""	5175	protein-coding gene	gene with protein product		600862	"""HIV-1 Rev binding protein"""	HRB		7637788	Standard	NM_004504		Approved	RIP, RAB	uc002vpd.2	P52594	OTTHUMG00000133186	ENST00000310078.8:c.684C>A	2.37:g.228389621C>A	ENSP00000312059:p.Asn228Lys	Somatic	0	68	0.00		0.5720907680579784	68	19.77	17	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39	B3KUL1|E9PHX7|Q15277|Q4VAS0|Q4VAS1|Q4VAS3|Q53QT8|Q53R11	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP	p.N228K	ENST00000310078.8	37	c.684	CCDS2467.1	2	.	.	.	.	.	.	.	.	.	.	C	21.3	4.132737	0.77662	.	.	ENSG00000173744	ENST00000409979;ENST00000542592;ENST00000310078;ENST00000409315;ENST00000373671;ENST00000409171;ENST00000456594	T;T;T;T;T	0.24350	1.88;1.86;1.86;1.95;1.86	6.08	4.29	0.51040	.	0.044828	0.85682	D	0.000000	T	0.41419	0.1158	L	0.54323	1.7	0.80722	D	1	P;D;D;D	0.69078	0.948;0.991;0.997;0.985	P;P;D;P	0.75484	0.648;0.805;0.986;0.643	T	0.17531	-1.0366	10	0.13470	T	0.59	.	12.7451	0.57278	0.0:0.8675:0.0:0.1325	.	228;228;228;228	P52594-2;P52594-3;E9PHX7;P52594	.;.;.;AGFG1_HUMAN	K	228;213;228;228;228;228;150	ENSP00000387282:N228K;ENSP00000312059:N228K;ENSP00000387154:N228K;ENSP00000362775:N228K;ENSP00000387218:N228K	ENSP00000312059:N228K	N	+	3	2	AGFG1	228097865	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.119000	0.50422	0.896000	0.36366	0.591000	0.81541	AAC	-	NULL		0.403	AGFG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGFG1	protein_coding	OTTHUMT00000256895.2	C	NM_004504	-		228389621	+1	no_errors	ENST00000409979	ensembl	human	known	74_37	missense	SNP	1.000	A
CBL	867	genome.wustl.edu	37	11	119149356	119149358	+	In_Frame_Del	DEL	ATG	ATG	-			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	ATG	ATG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr11:119149356_119149358delATG	ENST00000264033.4	+	9	1740_1742	c.1364_1366delATG	c.(1363-1368)tatgat>tat	p.D460del		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	460	Asp/Glu-rich (acidic).				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E366_K477del(1)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		TCCCCAAATTATGATGATGATGA	0.473			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																															"""Dom, Rec"""	yes		11	11q23.3	867	Cas-Br-M (murine) ecotropic retroviral transforming		L	1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)						ENSG00000110395																																			CBL	SO:0001651	inframe_deletion	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML		HGNC	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.1364_1366delATG	11.37:g.119149365_119149367delATG	ENSP00000264033:p.Asp460del	Somatic	0	38	0.00		0.5720907680579784	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	A3KMP8	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/Ts_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.D459in_frame_del	ENST00000264033.4	37	c.1364_1366	CCDS8418.1	11																																																																																			-	NULL		0.473	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBL	protein_coding	OTTHUMT00000388219.4	ATG	NM_005188			119149358	+1	no_errors	ENST00000264033	ensembl	human	known	74_37	in_frame_del	DEL	1.000:0.995:1.000	-
CCL2	6347	genome.wustl.edu	37	17	32583311	32583311	+	Silent	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr17:32583311G>T	ENST00000225831.4	+	2	212	c.147G>T	c.(145-147)gcG>gcT	p.A49A	AC005549.3_ENST00000601918.1_5'Flank|CCL2_ENST00000580907.1_Silent_p.A49A	NM_002982.3	NP_002973.1	P13500	CCL2_HUMAN	chemokine (C-C motif) ligand 2	49					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|aging (GO:0007568)|angiogenesis (GO:0001525)|astrocyte cell migration (GO:0043615)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to interferon-gamma (GO:0071346)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to organic cyclic compound (GO:0071407)|cellular response to tumor necrosis factor (GO:0071356)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeleton organization (GO:0007010)|endoplasmic reticulum unfolded protein response (GO:0030968)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|helper T cell extravasation (GO:0035684)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|JAK-STAT cascade (GO:0007259)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|MAPK cascade (GO:0000165)|maternal process involved in parturition (GO:0060137)|monocyte chemotaxis (GO:0002548)|negative regulation of angiogenesis (GO:0016525)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of natural killer cell chemotaxis (GO:2000502)|negative regulation of neuron apoptotic process (GO:0043524)|neutrophil chemotaxis (GO:0030593)|organ morphogenesis (GO:0009887)|organ regeneration (GO:0031100)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of calcium ion import (GO:0090280)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of immune complex clearance by monocytes and macrophages (GO:0090265)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of T cell activation (GO:0050870)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of vascular endothelial growth factor production (GO:0010574)|response to activity (GO:0014823)|response to amino acid (GO:0043200)|response to antibiotic (GO:0046677)|response to bacterium (GO:0009617)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to glucocorticoid (GO:0051384)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to vitamin B3 (GO:0033552)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)	CCR2 chemokine receptor binding (GO:0031727)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			kidney(1)|lung(3)|pancreas(1)|upper_aerodigestive_tract(1)	6	Breast(3;0.00224)	Ovarian(249;0.0694)|Breast(31;0.151)|Lung NSC(157;0.153)		UCEC - Uterine corpus endometrioid carcinoma (308;0.000241)|BRCA - Breast invasive adenocarcinoma(366;0.0103)	Danazol(DB01406)|Mimosine(DB01055)	AGAGGCTCGCGAGCTATAGAA	0.463																																																	0								ENSG00000108691						80.0	80.0	80.0					17																	32583311		2203	4300	6503	CCL2	SO:0001819	synonymous_variant	0			-	HGNC	BC009716	CCDS11277.1	17q11.2-q21.1	2013-02-25	2002-08-22	2002-08-23	ENSG00000108691	ENSG00000108691		"""Chemokine ligands"", ""Endogenous ligands"""	10618	protein-coding gene	gene with protein product	"""monocyte chemotactic protein 1, homologous to mouse Sig-je"", ""monocyte chemoattractant protein-1"", ""monocyte chemotactic and activating factor"", ""monocyte secretory protein JE"", ""small inducible cytokine subfamily A (Cys-Cys), member 2"""	158105	"""small inducible cytokine A2 (monocyte chemotactic protein 1, homologous to mouse Sig-je)"""	SCYA2		2004761	Standard	NM_002982		Approved	MCP1, MCP-1, MCAF, SMC-CF, GDCF-2, HC11, MGC9434	uc002hhy.3	P13500	OTTHUMG00000132887	ENST00000225831.4:c.147G>T	17.37:g.32583311G>T		Somatic	0	39	0.00		0.5720907680579784	143	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B2R4V3|Q9UDF3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.A49	ENST00000225831.4	37	c.147	CCDS11277.1	17																																																																																			-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom		0.463	CCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL2	protein_coding	OTTHUMT00000256384.2	G	NM_002982	-		32583311	+1	no_errors	ENST00000225831	ensembl	human	known	74_37	silent	SNP	0.136	T
DOCK3	1795	genome.wustl.edu	37	3	51264843	51264843	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr3:51264843T>C	ENST00000266037.9	+	16	1530	c.1507T>C	c.(1507-1509)Tcc>Ccc	p.S503P		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	503	DHR-1.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GTTCCGGGGCTCCCACCTGCG	0.473																																																	0								ENSG00000088538						90.0	89.0	89.0					3																	51264843		1840	4079	5919	DOCK3	SO:0001583	missense	0			-	HGNC	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.1507T>C	3.37:g.51264843T>C	ENSP00000266037:p.Ser503Pro	Somatic	0	33	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	13.79	O15017	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.S503P	ENST00000266037.9	37	c.1507	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	T	24.5	4.535613	0.85812	.	.	ENSG00000088538	ENST00000266037	T	0.14766	2.48	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.42404	0.1201	M	0.83223	2.63	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.35847	-0.9772	10	0.54805	T	0.06	.	16.5932	0.84781	0.0:0.0:0.0:1.0	.	503	Q8IZD9	DOCK3_HUMAN	P	503	ENSP00000266037:S503P	ENSP00000266037:S503P	S	+	1	0	DOCK3	51239883	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.320000	0.78422	0.528000	0.53228	TCC	-	NULL		0.473	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	protein_coding	OTTHUMT00000346478.5	T	NM_004947	-		51264843	+1	no_errors	ENST00000266037	ensembl	human	known	74_37	missense	SNP	1.000	C
AGXT	189	genome.wustl.edu	37	2	241808604	241808604	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr2:241808604G>T	ENST00000307503.3	+	2	570	c.183G>T	c.(181-183)aaG>aaT	p.K61N		NM_000030.2	NP_000021.1	P21549	SPYA_HUMAN	alanine-glyoxylate aminotransferase	61					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process (GO:0042853)|L-cysteine catabolic process (GO:0019448)|oxalic acid secretion (GO:0046724)|pyruvate biosynthetic process (GO:0042866)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alanine-glyoxylate transaminase activity (GO:0008453)|amino acid binding (GO:0016597)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|receptor binding (GO:0005102)|serine-pyruvate transaminase activity (GO:0004760)|transaminase activity (GO:0008483)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)	18		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)	ACGAGATCAAGGAAGGCATCC	0.617																																																	0								ENSG00000172482						145.0	119.0	128.0					2																	241808604		2203	4300	6503	AGXT	SO:0001583	missense	0			-	HGNC	D13368	CCDS2543.1	2q37.3	2008-02-05	2007-04-13		ENSG00000172482	ENSG00000172482	2.6.1.44, 2.6.1.51		341	protein-coding gene	gene with protein product	"""oxalosis I"", ""primary hyperoxaluria type 1"", ""L-alanine: glyoxylate aminotransferase 1"", ""serine:pyruvate aminotransferase"", ""glycolicaciduria"""	604285		SPAT		2039493, 2045108	Standard	NM_000030		Approved	AGXT1, PH1, AGT, SPT, AGT1	uc002waa.4	P21549	OTTHUMG00000133354	ENST00000307503.3:c.183G>T	2.37:g.241808604G>T	ENSP00000302620:p.Lys61Asn	Somatic	0	45	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33	Q53QU6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase	p.K61N	ENST00000307503.3	37	c.183	CCDS2543.1	2	.	.	.	.	.	.	.	.	.	.	G	16.26	3.072712	0.55646	.	.	ENSG00000172482	ENST00000307503	D	0.87412	-2.25	4.13	2.94	0.34122	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.000000	0.85682	D	0.000000	D	0.92198	0.7526	M	0.81682	2.555	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.91862	0.5500	10	0.52906	T	0.07	-34.7233	10.6704	0.45755	0.1405:0.0:0.8595:0.0	.	61;61	B7Z548;P21549	.;SPYA_HUMAN	N	61	ENSP00000302620:K61N	ENSP00000302620:K61N	K	+	3	2	AGXT	241457277	0.996000	0.38824	1.000000	0.80357	0.799000	0.45148	2.328000	0.43867	2.018000	0.59344	0.491000	0.48974	AAG	-	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase		0.617	AGXT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGXT	protein_coding	OTTHUMT00000257186.1	G	NM_000030	-		241808604	+1	no_errors	ENST00000307503	ensembl	human	known	74_37	missense	SNP	0.890	T
ACAD9	28976	genome.wustl.edu	37	3	128627900	128627900	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr3:128627900delG	ENST00000308982.7	+	14	1524	c.1443delG	c.(1441-1443)ctgfs	p.L481fs	ACAD9_ENST00000511526.1_3'UTR	NM_014049.4	NP_054768.2	Q9H845	ACAD9_HUMAN	acyl-CoA dehydrogenase family, member 9	481						dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	30						CTGTGGACCTGGGGCTGACAG	0.577																																																	0								ENSG00000177646						65.0	58.0	60.0					3																	128627900		2203	4300	6503	ACAD9	SO:0001589	frameshift_variant	0				HGNC	AF078854	CCDS3053.1	3q21.3	2013-05-24	2010-04-30		ENSG00000177646	ENSG00000177646		"""Mitochondrial respiratory chain complex assembly factors"""	21497	protein-coding gene	gene with protein product		611103	"""acyl-Coenzyme A dehydrogenase family, member 9"""			12359260, 21057504, 20816094	Standard	NM_014049		Approved	NPD002, MGC14452	uc003ela.4	Q9H845	OTTHUMG00000159942	ENST00000308982.7:c.1443delG	3.37:g.128627900delG	ENSP00000312618:p.Leu481fs	Somatic	0	38	0.00		0.5720907680579784	85	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29	D3DNB8|Q8WXX3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_AcylCo_DH/oxidase_C,pfam_AcylCoA_DH/ox_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_DH_2_C,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_AcylCo_DH/oxidase_C	p.L483fs	ENST00000308982.7	37	c.1443	CCDS3053.1	3																																																																																			-	NULL		0.577	ACAD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD9	protein_coding	OTTHUMT00000358405.1	G	NM_014049			128627900	+1	no_errors	ENST00000308982	ensembl	human	known	74_37	frame_shift_del	DEL	0.997	-
THAP3	90326	genome.wustl.edu	37	1	6688526	6688526	+	Intron	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr1:6688526G>T	ENST00000054650.4	+	3	232				THAP3_ENST00000484676.1_3'UTR|THAP3_ENST00000307896.6_Intron|THAP3_ENST00000377627.3_Intron	NM_001195753.1	NP_001182682.1	Q8WTV1	THAP3_HUMAN	THAP domain containing, apoptosis associated protein 3								DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|large_intestine(1)|prostate(1)	4	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		GTCCAGCCTTGCTGGGCCTCA	0.562																																																	0								ENSG00000041988						26.0	24.0	25.0					1																	6688526		2202	4299	6501	THAP3	SO:0001627	intron_variant	0			-	HGNC	BC022081	CCDS86.1, CCDS55572.1, CCDS55573.1	1p36.1	2013-01-25			ENSG00000041988	ENSG00000041988		"""THAP (C2CH-type zinc finger) domain containing"""	20855	protein-coding gene	gene with protein product		612532				12575992	Standard	NM_138350		Approved		uc001aod.3	Q8WTV1	OTTHUMG00000001440	ENST00000054650.4:c.75-33G>T	1.37:g.6688526G>T		Somatic	0	60	0.00		0.5720907680579784	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q569K1|Q5TH66|Q5TH67|Q8N8T6|Q9BSC7|Q9Y3H2|Q9Y3H3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000054650.4	37	NULL	CCDS55572.1	1																																																																																			-	-		0.562	THAP3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	THAP3	protein_coding	OTTHUMT00000004203.1	G	NM_138350	-		6688526	+1	no_errors	ENST00000484676	ensembl	human	known	74_37	rna	SNP	0.002	T
VEPH1	79674	genome.wustl.edu	37	3	157081226	157081227	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr3:157081226_157081227insT	ENST00000362010.2	-	9	1968_1969	c.1661_1662insA	c.(1660-1662)aacfs	p.N554fs	VEPH1_ENST00000392832.2_Frame_Shift_Ins_p.N554fs|VEPH1_ENST00000392833.2_Frame_Shift_Ins_p.N554fs|RP11-550I24.2_ENST00000487238.1_RNA|VEPH1_ENST00000543418.1_Frame_Shift_Ins_p.N554fs	NM_001167912.1	NP_001161384.1	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain-containing 1	554						plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|cervix(1)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|pancreas(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			CTTTGCTGAGGTTTTTTTTTAA	0.396																																																	0								ENSG00000197415																																			VEPH1	SO:0001589	frameshift_variant	0				HGNC	AL713656	CCDS3179.1, CCDS54661.1, CCDS54662.1, CCDS54663.1	3q24-q25	2013-01-10	2012-12-10		ENSG00000197415	ENSG00000197415		"""Pleckstrin homology (PH) domain containing"""	25735	protein-coding gene	gene with protein product		609594	"""ventricular zone expressed PH domain homolog 1 (zebrafish)"""			11214970, 15388229	Standard	NM_024621		Approved	FLJ12604, KIAA1692	uc003fbk.2	Q14D04	OTTHUMG00000158711	ENST00000362010.2:c.1662dupA	3.37:g.157081235_157081235dupT	ENSP00000354919:p.Asn554fs	Somatic	0	27	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	D3DNL0|F5GZ91|Q2TAA9|Q3MIX2|Q6PEL3|Q86TL5|Q8TCR3|Q96SP7|Q9C0H1|Q9H9Q7	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.N554fs	ENST00000362010.2	37	c.1662_1661	CCDS3179.1	3																																																																																			-	NULL		0.396	VEPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VEPH1	protein_coding	OTTHUMT00000351845.3	-	NM_024621			157081227	-1	no_errors	ENST00000362010	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	T
SHANK3	85358	genome.wustl.edu	37	22	51143505	51143505	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr22:51143505delG	ENST00000414786.2	+	16	2195	c.1968delG	c.(1966-1968)gagfs	p.E656fs	SHANK3_ENST00000445220.2_Frame_Shift_Del_p.E671fs|SHANK3_ENST00000262795.3_Frame_Shift_Del_p.E686fs			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	670	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		AGCCAGAAGAGGACGGGGCTC	0.587																																																	0								ENSG00000251322						82.0	94.0	90.0					22																	51143505		2156	4255	6411	SHANK3	SO:0001589	frameshift_variant	0				HGNC	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.1968delG	22.37:g.51143505delG	ENSP00000464552:p.Glu656fs	Somatic	0	53	0.00		0.5720907680579784	57	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	7	22.22	D7UT47|Q8TET3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SAM_type1,pfam_Ankyrin_rpt,pfam_SAM_2,pfam_SH3_2,pfam_PDZ,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.D687fs	ENST00000414786.2	37	c.2058		22																																																																																			-	NULL		0.587	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	SHANK3	protein_coding	OTTHUMT00000316674.2	G	NM_001080420			51143505	+1	no_errors	ENST00000262795	ensembl	human	known	74_37	frame_shift_del	DEL	0.791	-
C5orf42	65250	genome.wustl.edu	37	5	37206408	37206408	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr5:37206408delG	ENST00000508244.1	-	16	3133	c.3040delC	c.(3040-3042)ctgfs	p.L1014fs	C5orf42_ENST00000274258.7_5'UTR|C5orf42_ENST00000425232.2_Frame_Shift_Del_p.L1014fs			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1014						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TCTGGAACCAGGCCACCAATA	0.438																																																	0								ENSG00000197603						134.0	114.0	120.0					5																	37206408		692	1591	2283	C5orf42	SO:0001589	frameshift_variant	0				HGNC		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.3040delC	5.37:g.37206408delG	ENSP00000421690:p.Leu1014fs	Somatic	0	78	0.00		0.5720907680579784	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	79	15.96	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_Quino_amine_DH_bsu	p.L1014fs	ENST00000508244.1	37	c.3040	CCDS34146.2	5																																																																																			-	NULL		0.438	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	protein_coding	OTTHUMT00000360806.1	G	NM_023073			37206408	-1	no_errors	ENST00000425232	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
NPLOC4	55666	genome.wustl.edu	37	17	79575877	79575877	+	Intron	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr17:79575877G>T	ENST00000331134.6	-	6	651				NPLOC4_ENST00000574344.1_Intron|NPLOC4_ENST00000374747.5_Intron|NPLOC4_ENST00000539314.1_Intron	NM_017921.2	NP_060391.2	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4 homolog (S. cerevisiae)						ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)	endoplasmic reticulum (GO:0005783)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			AGCGAGTGCAGTCTCACACGT	0.592																																																	0								ENSG00000182446						34.0	35.0	35.0					17																	79575877		2120	4224	6344	NPLOC4	SO:0001627	intron_variant	0			-	HGNC	AB040932	CCDS45812.1	17q25.3	2012-09-20			ENSG00000182446	ENSG00000182446			18261	protein-coding gene	gene with protein product		606590				11574150, 10811609	Standard	NM_017921		Approved	NPL4, FLJ20657, KIAA1499	uc002kas.3	Q8TAT6	OTTHUMG00000177990	ENST00000331134.6:c.436-29C>A	17.37:g.79575877G>T		Somatic	0	56	0.00		0.5720907680579784	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	Q8N3J1|Q9H8V2|Q9H964|Q9NWR5|Q9P229	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000331134.6	37	NULL	CCDS45812.1	17																																																																																			-	-		0.592	NPLOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPLOC4	protein_coding	OTTHUMT00000440140.1	G		-		79575877	-1	no_errors	ENST00000570300	ensembl	human	known	74_37	rna	SNP	0.006	T
RNF169	254225	genome.wustl.edu	37	11	74554931	74554931	+	IGR	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr11:74554931C>A	ENST00000299563.4	+	0	7823				XRRA1_ENST00000527087.1_Intron|XRRA1_ENST00000340360.6_Missense_Mutation_p.R698L|XRRA1_ENST00000321448.8_Missense_Mutation_p.R423L|RN7SL239P_ENST00000490061.2_RNA	NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169						cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						CCGGGGATCCCGCAAGCGAAT	0.557																																																	0								ENSG00000166435						90.0	96.0	94.0					11																	74554931		1929	4127	6056	XRRA1	SO:0001628	intergenic_variant	0			-	HGNC	AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516		11.37:g.74554931C>A		Somatic	0	75	0.00		0.5720907680579784	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q6N015	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.R698L	ENST00000299563.4	37	c.2093	CCDS41691.1	11	.	.	.	.	.	.	.	.	.	.	C	28.1	4.888160	0.91814	.	.	ENSG00000166435	ENST00000340360;ENST00000321448;ENST00000344880;ENST00000398418	T;T	0.60920	0.15;0.89	5.36	4.46	0.54185	.	.	.	.	.	T	0.71126	0.3303	M	0.74881	2.28	0.80722	D	1	D;D;D;D	0.69078	0.984;0.969;0.997;0.997	P;P;P;P	0.61533	0.687;0.753;0.89;0.89	T	0.74942	-0.3492	9	0.72032	D	0.01	-9.2333	11.6626	0.51356	0.0:0.9152:0.0:0.0848	.	698;642;308;684	Q6P2D8;Q6P2D8-4;Q8TEH2;Q6P2D8-3	XRRA1_HUMAN;.;.;.	L	698;423;684;642	ENSP00000339918:R698L;ENSP00000319303:R423L	ENSP00000319303:R423L	R	-	2	0	XRRA1	74232579	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.387000	0.44389	1.503000	0.48686	0.561000	0.74099	CGG	-	NULL		0.557	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRRA1	protein_coding	OTTHUMT00000384741.1	C	XM_495886	-		74554931	-1	no_errors	ENST00000340360	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF208	7757	genome.wustl.edu	37	19	22156134	22156134	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr19:22156134G>T	ENST00000397126.4	-	4	1850	c.1702C>A	c.(1702-1704)Ctt>Att	p.L568I	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	568					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TGATAACTAAGGGTTGAGGAC	0.348																																																	0								ENSG00000160321						24.0	24.0	24.0					19																	22156134		1927	4105	6032	ZNF208	SO:0001583	missense	0			-	HGNC	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1702C>A	19.37:g.22156134G>T	ENSP00000380315:p.Leu568Ile	Somatic	0	36	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	35	18.60		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L568I	ENST00000397126.4	37	c.1702	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	G	10.44	1.352251	0.24512	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.53857	0.6	2.82	-0.969	0.10310	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.62405	0.2425	.	.	.	0.09310	N	1	D	0.56287	0.975	D	0.68192	0.956	T	0.52902	-0.8513	8	0.66056	D	0.02	.	3.8868	0.09102	0.2071:0.0:0.4802:0.3127	.	468	O43345	ZN208_HUMAN	I	568;468	ENSP00000380315:L568I	ENSP00000380315:L568I	L	-	1	0	ZNF208	21947974	0.005000	0.15991	0.000000	0.03702	0.000000	0.00434	0.203000	0.17315	-0.694000	0.05113	-2.649000	0.00149	CTT	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.348	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	protein_coding	OTTHUMT00000464302.1	G	NM_007153	-		22156134	-1	no_errors	ENST00000397126	ensembl	human	novel	74_37	missense	SNP	0.003	T
PIGZ	80235	genome.wustl.edu	37	3	196675189	196675189	+	Silent	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr3:196675189G>T	ENST00000412723.1	-	3	725	c.579C>A	c.(577-579)tcC>tcA	p.S193S	PIGZ_ENST00000443835.1_Missense_Mutation_p.P90H	NM_025163.2	NP_079439.2	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Z	193					GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	alpha-1,2-mannosyltransferase activity (GO:0000026)|mannosyltransferase activity (GO:0000030)			breast(1)|endometrium(1)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	14	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		TTACATGGGAGGATACCAGCA	0.607																																																	0								ENSG00000119227						113.0	101.0	105.0					3																	196675189		2203	4300	6503	PIGZ	SO:0001819	synonymous_variant	0			-	HGNC	BC018804	CCDS3324.1	3q29	2013-02-26	2006-06-28		ENSG00000119227	ENSG00000119227		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	30596	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 4"", ""dol-P-Man dependent GPI mannosyltransferase"""	611671	"""phosphatidylinositol glycan, class Z"""			15208306	Standard	NM_025163		Approved	FLJ12768, MGC52163, SMP3	uc003fxh.3	Q86VD9	OTTHUMG00000155522	ENST00000412723.1:c.579C>A	3.37:g.196675189G>T		Somatic	0	78	0.00		0.5720907680579784	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q9H9G6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPI_mannosylTrfase	p.P90H	ENST00000412723.1	37	c.269	CCDS3324.1	3	.	.	.	.	.	.	.	.	.	.	G	2.066	-0.414187	0.04766	.	.	ENSG00000119227	ENST00000443835	.	.	.	5.19	-0.0286	0.13921	.	.	.	.	.	T	0.28764	0.0713	.	.	.	0.23994	N	0.996233	.	.	.	.	.	.	T	0.35525	-0.9785	5	0.72032	D	0.01	-20.3531	0.8722	0.01217	0.2071:0.2281:0.3314:0.2334	.	.	.	.	H	90	.	ENSP00000389327:P90H	P	-	2	0	PIGZ	198159586	0.939000	0.31865	0.474000	0.27266	0.117000	0.20001	-0.067000	0.11579	-0.222000	0.09958	0.549000	0.68633	CCT	-	NULL		0.607	PIGZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGZ	protein_coding	OTTHUMT00000340486.2	G	NM_025163	-		196675189	-1	no_errors	ENST00000443835	ensembl	human	putative	74_37	missense	SNP	0.845	T
NARFL	64428	genome.wustl.edu	37	16	789597	789597	+	Intron	SNP	G	G	T	rs368038868		TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr16:789597G>T	ENST00000251588.2	-	2	179				NARFL_ENST00000301694.5_Intron|NARFL_ENST00000568545.1_5'Flank|NARFL_ENST00000540986.1_Intron	NM_022493.1	NP_071938.1	Q9H6Q4	NARFL_HUMAN	nuclear prelamin A recognition factor-like						hematopoietic progenitor cell differentiation (GO:0002244)|iron-sulfur cluster assembly (GO:0016226)|oxygen homeostasis (GO:0032364)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	CIA complex (GO:0097361)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|large_intestine(1)|lung(7)	9		Hepatocellular(780;0.0218)				AAGTGTTTCGGATCAGCCGGG	0.547																																																	0								ENSG00000103245						136.0	107.0	117.0					16																	789597		2200	4300	6500	NARFL	SO:0001627	intron_variant	0			-	HGNC	AY129231	CCDS10425.1	16p13.3	2009-12-17			ENSG00000103245	ENSG00000103245			14179	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 1"""	611118				16956324	Standard	NM_022493		Approved	FLJ21988, PRN, HPRN, IOP1	uc002cjr.3	Q9H6Q4	OTTHUMG00000122093	ENST00000251588.2:c.162+45C>A	16.37:g.789597G>T		Somatic	0	29	0.00		0.5720907680579784	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	A1L385|B3KTJ3|Q53GC6|Q96S10|Q9H6J8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P70T	ENST00000251588.2	37	c.208	CCDS10425.1	16																																																																																			-	NULL		0.547	NARFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARFL	protein_coding	OTTHUMT00000242855.1	G	NM_022493	-		789597	-1	no_errors	ENST00000570289	ensembl	human	known	74_37	missense	SNP	0.000	T
PKHD1L1	93035	genome.wustl.edu	37	8	110477410	110477410	+	Silent	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr8:110477410G>T	ENST00000378402.5	+	49	8453	c.8349G>T	c.(8347-8349)ccG>ccT	p.P2783P		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2783					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CTCACACACCGAACAAGGCTG	0.408										HNSCC(38;0.096)																																							0								ENSG00000205038						88.0	91.0	90.0					8																	110477410		1955	4135	6090	PKHD1L1	SO:0001819	synonymous_variant	0			-	HGNC	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.8349G>T	8.37:g.110477410G>T		Somatic	0	41	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	47	9.62	Q567P2|Q9UF27	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.P2783	ENST00000378402.5	37	c.8349	CCDS47911.1	8																																																																																			-	NULL		0.408	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	protein_coding	OTTHUMT00000381017.1	G	NM_177531	-		110477410	+1	no_errors	ENST00000378402	ensembl	human	known	74_37	silent	SNP	0.032	T
HLA-DRB6	3128	genome.wustl.edu	37	6	32521699	32521699	+	RNA	SNP	C	C	G			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr6:32521699C>G	ENST00000411500.1	-	0	784					NR_001298.1				major histocompatibility complex, class II, DR beta 6 (pseudogene)																		ACAAAGCCCCCGACTCCACTC	0.483																																																	0								ENSG00000229391																																			HLA-DRB6			0			-	HGNC	L76566		6p21.3	2011-07-08			ENSG00000229391	ENSG00000229391		"""Histocompatibility complex"""	4954	pseudogene	pseudogene						1529427, 10436177	Standard	NR_001298		Approved		uc003obn.1		OTTHUMG00000031028		6.37:g.32521699C>G		Somatic	0	67	0.00		0.5720907680579784	654	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	69	17	79.31		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000411500.1	37	NULL		6																																																																																			-	-		0.483	HLA-DRB6-002	KNOWN	basic	processed_transcript	HLA-DRB6	pseudogene	OTTHUMT00000272900.1	C	NR_001298	-		32521699	-1	no_errors	ENST00000411500	ensembl	human	known	74_37	rna	SNP	0.376	G
SLC15A5	729025	genome.wustl.edu	37	12	16392681	16392681	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr12:16392681G>T	ENST00000344941.3	-	5	1095	c.1096C>A	c.(1096-1098)Ctg>Atg	p.L366M		NM_001170798.1	NP_001164269.1	A6NIM6	S15A5_HUMAN	solute carrier family 15, member 5	366					peptide transport (GO:0015833)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			breast(2)|lung(1)	3						AAATACTCCAGAAAAGGAGCC	0.408																																																	0								ENSG00000188991						112.0	104.0	106.0					12																	16392681		692	1591	2283	SLC15A5	SO:0001583	missense	0			-	HGNC			12p12.3	2013-07-18			ENSG00000188991	ENSG00000188991		"""Solute carriers"""	33455	protein-coding gene	gene with protein product						21044875	Standard	NM_001170798		Approved		uc021qvs.1	A6NIM6	OTTHUMG00000168793	ENST00000344941.3:c.1096C>A	12.37:g.16392681G>T	ENSP00000340402:p.Leu366Met	Somatic	0	93	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_POT_fam,superfamily_MFS_dom_general_subst_transpt	p.L366M	ENST00000344941.3	37	c.1096		12	.	.	.	.	.	.	.	.	.	.	G	0.703	-0.789983	0.02884	.	.	ENSG00000188991	ENST00000344941	T	0.05580	3.42	4.55	0.416	0.16416	.	0.764763	0.13140	N	0.410729	T	0.03959	0.0111	N	0.12746	0.255	0.19775	N	0.999954	.	.	.	.	.	.	T	0.42481	-0.9449	8	0.49607	T	0.09	.	5.5748	0.17216	0.3544:0.0:0.3877:0.2579	.	.	.	.	M	366	ENSP00000340402:L366M	ENSP00000340402:L366M	L	-	1	2	SLC15A5	16283948	0.162000	0.22906	0.374000	0.26016	0.876000	0.50452	0.347000	0.20014	0.300000	0.22699	-0.284000	0.09977	CTG	-	pfam_POT_fam,superfamily_MFS_dom_general_subst_transpt		0.408	SLC15A5-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	SLC15A5	protein_coding	OTTHUMT00000401119.2	G	XM_001129090	-		16392681	-1	no_errors	ENST00000344941	ensembl	human	novel	74_37	missense	SNP	0.049	T
NME6	10201	genome.wustl.edu	37	3	48339991	48339991	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr3:48339991delG	ENST00000452211.1	-	3	253	c.16delC	c.(16-18)cgafs	p.R6fs	NME6_ENST00000421967.1_Frame_Shift_Del_p.R14fs|NME6_ENST00000447314.1_Intron|NME6_ENST00000444069.1_Intron|NME6_ENST00000415644.1_Frame_Shift_Del_p.R6fs|NME6_ENST00000415053.1_Frame_Shift_Del_p.R6fs|NME6_ENST00000451657.1_Frame_Shift_Del_p.R6fs|NME6_ENST00000435684.1_Frame_Shift_Del_p.R6fs|NME6_ENST00000442597.1_Frame_Shift_Del_p.R6fs|NME6_ENST00000426689.2_Frame_Shift_Del_p.R6fs|ZNF589_ENST00000412564.1_Intron|NME6_ENST00000450160.1_Frame_Shift_Del_p.R6fs|NME6_ENST00000426723.1_Frame_Shift_Del_p.R6fs			O75414	NDK6_HUMAN	NME/NM23 nucleoside diphosphate kinase 6	6					apoptotic process (GO:0006915)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|negative regulation of cell growth (GO:0030308)|negative regulation of mitosis (GO:0045839)|UTP biosynthetic process (GO:0006228)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			breast(1)|large_intestine(5)	6				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		TGAGGGCTTCGCAAGATTGAG	0.547																																																	0								ENSG00000172113						85.0	67.0	73.0					3																	48339991		2203	4300	6503	NME6	SO:0001589	frameshift_variant	0				HGNC	AF051941	CCDS2763.1	3p21.31	2012-05-18	2012-05-18		ENSG00000172113	ENSG00000172113			20567	protein-coding gene	gene with protein product		608294	"""non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase)"""			10453732, 19852809	Standard	NM_005793		Approved	NM23-H6, IPIA-ALPHA	uc003cso.3	O75414	OTTHUMG00000133531	ENST00000452211.1:c.16delC	3.37:g.48339991delG	ENSP00000392352:p.Arg6fs	Somatic	0	52	0.00		0.5720907680579784	37	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	B4DGW7|B4DM99|Q53HM5|Q96E73|Q9BQ63	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Nucleoside_diP_kinase,prints_Nucleoside_diP_kinase	p.R14fs	ENST00000452211.1	37	c.40		3																																																																																			-	NULL		0.547	NME6-005	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_candidate	protein_coding	NME6	protein_coding	OTTHUMT00000346107.1	G	NM_005793			48339991	-1	no_errors	ENST00000421967	ensembl	human	known	74_37	frame_shift_del	DEL	0.541	-
TECPR2	9895	genome.wustl.edu	37	14	102904421	102904421	+	Silent	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr14:102904421C>A	ENST00000359520.7	+	10	2683	c.2457C>A	c.(2455-2457)tcC>tcA	p.S819S	TECPR2_ENST00000558678.1_Silent_p.S819S	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	819					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						TGGTGGTCTCCGAGAAGTATA	0.587											OREG0022547	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000196663						143.0	146.0	145.0					14																	102904421		2203	4300	6503	TECPR2	SO:0001819	synonymous_variant	0			-	HGNC	AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.2457C>A	14.37:g.102904421C>A		Somatic	0	47	0.00	1370	0.5720907680579784	25	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Beta-propeller_rpt_TECPR,superfamily_WD40_repeat_dom,superfamily_RCC1/BLIP-II,smart_WD40_repeat,smart_Beta-propeller_rpt_TECPR	p.S819	ENST00000359520.7	37	c.2457	CCDS32162.1	14																																																																																			-	NULL		0.587	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECPR2	protein_coding	OTTHUMT00000415056.2	C	NM_014844	-		102904421	+1	no_errors	ENST00000359520	ensembl	human	known	74_37	silent	SNP	0.019	A
ACP1	52	genome.wustl.edu	37	2	272129	272129	+	Silent	SNP	C	C	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr2:272129C>T	ENST00000272065.5	+	3	303	c.210C>T	c.(208-210)ccC>ccT	p.P70P	ACP1_ENST00000407983.3_Silent_p.P70P|ACP1_ENST00000484464.1_3'UTR|ACP1_ENST00000272067.6_Intron|ACP1_ENST00000439645.2_Intron|ACP1_ENST00000405233.1_Intron	NM_004300.3	NP_004291.1	P24666	PPAC_HUMAN	acid phosphatase 1, soluble	70						cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|extracellular vesicular exosome (GO:0070062)	acid phosphatase activity (GO:0003993)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(1)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	12	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00175)|Lung NSC(108;0.216)|all_epithelial(98;0.236)		all cancers(51;0.000391)|Epithelial(75;0.00281)|OV - Ovarian serous cystadenocarcinoma(76;0.00542)|GBM - Glioblastoma multiforme(21;0.127)	Adenine(DB00173)	ACGGCATTCCCATGAGCCACG	0.572																																																	0								ENSG00000143727						162.0	139.0	147.0					2																	272129		2203	4300	6503	ACP1	SO:0001819	synonymous_variant	0			-	HGNC	M87546	CCDS1639.1, CCDS1640.1, CCDS46217.1	2p25	2011-06-09			ENSG00000143727	ENSG00000143727	3.1.3.2	"""Protein tyrosine phosphatases / Class II Cys-based PTPs"""	122	protein-coding gene	gene with protein product		171500					Standard	NM_001040649		Approved		uc002qwf.3	P24666	OTTHUMG00000086933	ENST00000272065.5:c.210C>T	2.37:g.272129C>T		Somatic	0	80	0.00		0.5720907680579784	106	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A8K1L9|B5MCC7|P24667|Q16035|Q16036|Q16725|Q3KQX8|Q53RU0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ptyr_pPase_SF,superfamily_Ptyr_pPase_SF,smart_Ptyr_pPase_SF,prints_Tyr_Pase_low_mol_wt_mml,prints_Tyr_phospatase/Ars_reductase	p.P70	ENST00000272065.5	37	c.210	CCDS1639.1	2																																																																																			-	pfam_Ptyr_pPase_SF,superfamily_Ptyr_pPase_SF,smart_Ptyr_pPase_SF		0.572	ACP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACP1	protein_coding	OTTHUMT00000195862.3	C		-		272129	+1	no_errors	ENST00000272065	ensembl	human	known	74_37	silent	SNP	1.000	T
BAI1	575	genome.wustl.edu	37	8	143570413	143570413	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr8:143570413G>A	ENST00000517894.1	+	15	3364	c.2470G>A	c.(2470-2472)Gtg>Atg	p.V824M	BAI1_ENST00000323289.5_Missense_Mutation_p.V824M			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	824					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					TGAAGCATCCGTGTTTGTGGT	0.672																																																	0								ENSG00000181790						52.0	52.0	52.0					8																	143570413		2000	4149	6149	BAI1	SO:0001583	missense	0			-	HGNC	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.2470G>A	8.37:g.143570413G>A	ENSP00000430945:p.Val824Met	Somatic	0	86	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	39	15.22		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_Thrombospondin_1_rpt,pfam_DUF3497,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.V824M	ENST00000517894.1	37	c.2470		8	.	.	.	.	.	.	.	.	.	.	G	14.57	2.575935	0.45902	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.10005	2.92;2.92	4.94	4.94	0.65067	.	0.255230	0.31566	U	0.007437	T	0.20740	0.0499	L	0.55481	1.735	0.33733	D	0.618518	D	0.71674	0.998	P	0.59703	0.862	T	0.16276	-1.0408	10	0.36615	T	0.2	.	9.317	0.37941	0.0989:0.0:0.9011:0.0	.	824	E9PBK0	.	M	824	ENSP00000430945:V824M;ENSP00000313046:V824M	ENSP00000313046:V824M	V	+	1	0	BAI1	143567415	1.000000	0.71417	0.926000	0.36857	0.265000	0.26407	3.804000	0.55568	2.269000	0.75478	0.462000	0.41574	GTG	-	pfam_DUF3497		0.672	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	BAI1	protein_coding	OTTHUMT00000379963.3	G	NM_001702	-		143570413	+1	no_errors	ENST00000323289	ensembl	human	known	74_37	missense	SNP	0.997	A
PHKG1	5260	genome.wustl.edu	37	7	56155339	56155339	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr7:56155339G>T	ENST00000297373.2	-	3	408	c.214C>A	c.(214-216)Ctg>Atg	p.L72M	PHKG1_ENST00000537360.1_Missense_Mutation_p.A36D|PHKG1_ENST00000452681.2_Missense_Mutation_p.L72M|PHKG1_ENST00000489604.1_5'UTR	NM_001258460.1|NM_006213.4	NP_001245389.1|NP_006204.1	Q16816	PHKG1_HUMAN	phosphorylase kinase, gamma 1 (muscle)	72	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|tau-protein kinase activity (GO:0050321)			endometrium(1)|large_intestine(1)|lung(5)	7	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ACCTCCTTCAGCGTGGCTTCT	0.652																																					Melanoma(184;580 2064 5329 24177 35303)												0								ENSG00000164776						76.0	51.0	60.0					7																	56155339		2203	4300	6503	PHKG1	SO:0001583	missense	0			-	HGNC	X80590	CCDS5525.1, CCDS59057.1	7p11.2	2009-07-10			ENSG00000164776	ENSG00000164776	2.7.11.19		8930	protein-coding gene	gene with protein product		172470		PHKG		8530014	Standard	NM_001258459		Approved		uc011kdb.2	Q16816	OTTHUMG00000023869	ENST00000297373.2:c.214C>A	7.37:g.56155339G>T	ENSP00000297373:p.Leu72Met	Somatic	0	40	0.00		0.5720907680579784	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	B7Z1D0|F5H2S1|Q75LP5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Phosph_kin_gamma	p.L72M	ENST00000297373.2	37	c.214	CCDS5525.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.52|10.52	1.372275|1.372275	0.24857|0.24857	.|.	.|.	ENSG00000164776|ENSG00000164776	ENST00000537360|ENST00000452681;ENST00000297373	T|T;T	0.70045|0.44881	-0.45|3.13;0.91	5.42|5.42	3.52|3.52	0.40303|0.40303	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.606658	.|0.14620	.|N	.|0.308456	T|T	0.26231|0.26231	0.0640|0.0640	N|N	0.21508|0.21508	0.67|0.67	0.21675|0.21675	N|N	0.999596|0.999596	B|B;B;B	0.18166|0.19331	0.026|0.0;0.035;0.01	B|B;B;B	0.13407|0.24848	0.009|0.026;0.026;0.056	T|T	0.12268|0.12268	-1.0554|-1.0554	9|10	0.62326|0.33940	D|T	0.03|0.23	-17.4861|-17.4861	4.577|4.577	0.12238|0.12238	0.0777:0.2142:0.5106:0.1976|0.0777:0.2142:0.5106:0.1976	.|.	36|72;72;72	B7Z5U3|B7Z6U2;F5H2S1;Q16816	.|.;.;PHKG1_HUMAN	D|M	36|72	ENSP00000441528:A36D|ENSP00000445440:L72M;ENSP00000297373:L72M	ENSP00000441528:A36D|ENSP00000297373:L72M	A|L	-|-	2|1	0|2	PHKG1|PHKG1	56122833|56122833	0.063000|0.063000	0.20901|0.20901	0.991000|0.991000	0.47740|0.47740	0.721000|0.721000	0.41392|0.41392	0.443000|0.443000	0.21644|0.21644	1.439000|1.439000	0.47511|0.47511	0.563000|0.563000	0.77884|0.77884	GCT|CTG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.652	PHKG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKG1	protein_coding	OTTHUMT00000251587.1	G	NM_006213	-		56155339	-1	no_errors	ENST00000452681	ensembl	human	known	74_37	missense	SNP	0.733	T
TRAF3IP3	80342	genome.wustl.edu	37	1	209955427	209955427	+	Silent	SNP	G	G	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr1:209955427G>A	ENST00000367024.1	+	17	2106	c.1590G>A	c.(1588-1590)gtG>gtA	p.V530V	TRAF3IP3_ENST00000010338.4_Silent_p.V510V|TRAF3IP3_ENST00000477431.1_Missense_Mutation_p.A142T|TRAF3IP3_ENST00000367025.3_Silent_p.V530V|TRAF3IP3_ENST00000467830.1_3'UTR|TRAF3IP3_ENST00000367026.3_Silent_p.V510V			Q9Y228	T3JAM_HUMAN	TRAF3 interacting protein 3	530						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32				OV - Ovarian serous cystadenocarcinoma(81;0.045)		GGCTCCCAGTGCTGATGGTGG	0.478																																																	0								ENSG00000009790						123.0	112.0	116.0					1																	209955427		2203	4300	6503	TRAF3IP3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS1490.1, CCDS1490.2, CCDS73023.1	1q32.3-q41	2008-02-05			ENSG00000009790	ENSG00000009790			30766	protein-coding gene	gene with protein product	"""TRAF3 interacting Jun N terminal kinase (JNK) activating modulator"""	608255				14572659	Standard	XR_247044		Approved	T3JAM	uc001hho.3	Q9Y228	OTTHUMG00000036480	ENST00000367024.1:c.1590G>A	1.37:g.209955427G>A		Somatic	0	71	0.00		0.5720907680579784	36	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	40	14.89	A1L464|A6NIU9|Q2YDB5|Q4VY06|Q7Z706	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu_zip_homeo	p.A142T	ENST00000367024.1	37	c.424	CCDS1490.2	1	.	.	.	.	.	.	.	.	.	.	G	12.22	1.871136	0.33069	.	.	ENSG00000009790	ENST00000477431	T	0.50277	0.75	5.29	1.15	0.20763	.	.	.	.	.	T	0.41558	0.1164	.	.	.	0.19775	N	0.99995	.	.	.	.	.	.	T	0.40813	-0.9543	6	0.72032	D	0.01	2.8265	3.4085	0.07350	0.0793:0.2742:0.3649:0.2816	.	.	.	.	T	142	ENSP00000417417:A142T	ENSP00000417417:A142T	A	+	1	0	TRAF3IP3	208022050	0.529000	0.26322	0.012000	0.15200	0.772000	0.43724	0.014000	0.13333	-0.034000	0.13713	0.557000	0.71058	GCT	-	NULL		0.478	TRAF3IP3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRAF3IP3	protein_coding	OTTHUMT00000088734.2	G		-		209955427	+1	no_errors	ENST00000477431	ensembl	human	putative	74_37	missense	SNP	0.079	A
DNAH8	1769	genome.wustl.edu	37	6	38998064	38998064	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr6:38998064A>G	ENST00000359357.3	+	91	13623	c.13369A>G	c.(13369-13371)Agg>Ggg	p.R4457G	DNAH8_ENST00000441566.1_Missense_Mutation_p.R4421G			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	4457					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CAAGAAACCCAGGCGAACTGA	0.493																																																	0								ENSG00000124721						135.0	126.0	129.0					6																	38998064		2203	4300	6503	DNAH8	SO:0001583	missense	0			-	HGNC	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.13369A>G	6.37:g.38998064A>G	ENSP00000352312:p.Arg4457Gly	Somatic	0	60	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R4457G	ENST00000359357.3	37	c.13369		6	.	.	.	.	.	.	.	.	.	.	A	11.93	1.785421	0.31593	.	.	ENSG00000124721	ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.08546	3.08;3.08;3.08	5.15	-1.05	0.10036	Dynein heavy chain (1);	0.053545	0.64402	D	0.000001	T	0.04815	0.0130	M	0.86178	2.8	0.23581	N	0.997363	B	0.34061	0.436	B	0.36766	0.232	T	0.33085	-0.9882	10	0.24483	T	0.36	.	10.3043	0.43672	0.4496:0.4822:0.0682:0.0	.	4457	Q96JB1	DYH8_HUMAN	G	4662;4457;4421	ENSP00000333363:R4662G;ENSP00000352312:R4457G;ENSP00000402294:R4421G	ENSP00000333363:R4662G	R	+	1	2	DNAH8	39106042	0.001000	0.12720	0.619000	0.29118	0.982000	0.71751	0.182000	0.16900	-0.026000	0.13895	0.528000	0.53228	AGG	-	pfam_Dynein_heavy_dom		0.493	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	protein_coding	OTTHUMT00000043574.1	A	NM_001206927	-		38998064	+1	no_errors	ENST00000359357	ensembl	human	known	74_37	missense	SNP	0.016	G
MRGPRX4	117196	genome.wustl.edu	37	11	18195201	18195201	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr11:18195201G>A	ENST00000314254.3	+	1	818	c.398G>A	c.(397-399)cGc>cAc	p.R133H	RP11-113D6.6_ENST00000527671.1_Intron	NM_054032.3	NP_473373.2	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	133						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						TACCGCTGCCGCCGCCCCACA	0.582																																																	0								ENSG00000179817						153.0	148.0	150.0					11																	18195201		2199	4293	6492	MRGPRX4	SO:0001583	missense	0			-	HGNC	AY042216	CCDS7831.1	11p15.1	2013-10-10			ENSG00000179817	ENSG00000179817		"""GPCR / Class A : Orphans"""	17617	protein-coding gene	gene with protein product		607230				11551509	Standard	NM_054032		Approved	MRGX4	uc001mnv.1	Q96LA9	OTTHUMG00000166442	ENST00000314254.3:c.398G>A	11.37:g.18195201G>A	ENSP00000314042:p.Arg133His	Somatic	0	28	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	6	53.85	Q3KNU3|Q3KNU4|Q502W0|Q8TDD6|Q8TDD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.R133H	ENST00000314254.3	37	c.398	CCDS7831.1	11	.	.	.	.	.	.	.	.	.	.	G	3.009	-0.204359	0.06180	.	.	ENSG00000179817	ENST00000314254	T	0.09817	2.94	2.86	-4.82	0.03171	GPCR, rhodopsin-like superfamily (1);	0.860927	0.10112	N	0.714573	T	0.03095	0.0091	N	0.03084	-0.415	0.09310	N	1	B	0.18013	0.025	B	0.14023	0.01	T	0.46400	-0.9194	10	0.07482	T	0.82	.	7.3041	0.26436	0.6394:0.0:0.3606:0.0	.	133	Q96LA9	MRGX4_HUMAN	H	133	ENSP00000314042:R133H	ENSP00000314042:R133H	R	+	2	0	MRGPRX4	18151777	0.000000	0.05858	0.449000	0.26957	0.147000	0.21601	-0.618000	0.05578	-0.630000	0.05567	-1.137000	0.01932	CGC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.582	MRGPRX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX4	protein_coding	OTTHUMT00000389788.1	G	NM_054032	-		18195201	+1	no_errors	ENST00000314254	ensembl	human	known	74_37	missense	SNP	0.003	A
FAM217B	63939	genome.wustl.edu	37	20	58519635	58519635	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr20:58519635G>T	ENST00000358293.3	+	5	1052	c.637G>T	c.(637-639)Ggg>Tgg	p.G213W	FAM217B_ENST00000469084.1_3'UTR|FAM217B_ENST00000360816.3_Missense_Mutation_p.G213W	NM_001190826.1	NP_001177755.1	Q9NTX9	F217B_HUMAN	family with sequence similarity 217, member B	213																	CACTGCCCCTGGGACCTCAGG	0.537																																																	0								ENSG00000196227						34.0	40.0	38.0					20																	58519635		2203	4298	6501	FAM217B	SO:0001583	missense	0			-	HGNC	AL109928	CCDS13484.1	20q13.33	2012-02-07	2012-02-07	2012-02-07	ENSG00000196227	ENSG00000196227			16170	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 177"""	C20orf177			Standard	NM_022106		Approved	dJ551D2.5	uc002ybc.3	Q9NTX9	OTTHUMG00000032873	ENST00000358293.3:c.637G>T	20.37:g.58519635G>T	ENSP00000351040:p.Gly213Trp	Somatic	0	66	0.00		0.5720907680579784	4	20.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	39	13.33	B3KWH1|Q9NTA3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G213W	ENST00000358293.3	37	c.637	CCDS13484.1	20	.	.	.	.	.	.	.	.	.	.	G	16.01	3.002595	0.54254	.	.	ENSG00000196227	ENST00000358293;ENST00000360816	T;T	0.26660	1.72;1.72	5.8	3.87	0.44632	.	0.768824	0.11980	N	0.510874	T	0.36441	0.0967	L	0.34521	1.04	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	T	0.11131	-1.0600	10	0.72032	D	0.01	-20.4218	6.8862	0.24202	0.2033:0.13:0.6668:0.0	.	213	Q9NTX9	CT177_HUMAN	W	213	ENSP00000351040:G213W;ENSP00000354056:G213W	ENSP00000351040:G213W	G	+	1	0	C20orf177	57953030	0.378000	0.25114	0.014000	0.15608	0.008000	0.06430	0.710000	0.25748	1.459000	0.47892	0.655000	0.94253	GGG	-	NULL		0.537	FAM217B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM217B	protein_coding	OTTHUMT00000268139.1	G	NM_022106	-		58519635	+1	no_errors	ENST00000358293	ensembl	human	known	74_37	missense	SNP	0.051	T
LRP2	4036	genome.wustl.edu	37	2	170009390	170009390	+	Missense_Mutation	SNP	C	C	T	rs142934522	byFrequency	TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr2:170009390C>T	ENST00000263816.3	-	67	12665	c.12380G>A	c.(12379-12381)cGc>cAc	p.R4127H		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4127					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.R4127H(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AAGATTATTGCGGCCGGATTC	0.473													C|||	4	0.000798722	0.0015	0.0014	5008	,	,		20869	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	lung(1)						ENSG00000081479	C	HIS/ARG	3,4403	6.2+/-15.9	0,3,2200	239.0	236.0	237.0		12380	-2.1	0.0	2	dbSNP_134	237	33,8567	22.8+/-68.1	1,31,4268	yes	missense	LRP2	NM_004525.2	29	1,34,6468	TT,TC,CC		0.3837,0.0681,0.2768	possibly-damaging	4127/4656	170009390	36,12970	2203	4300	6503	LRP2	SO:0001583	missense	0			-	HGNC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.12380G>A	2.37:g.170009390C>T	ENSP00000263816:p.Arg4127His	Somatic	0	57	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	30	36.17	O00711|Q16215	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.R4127H	ENST00000263816.3	37	c.12380	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	8.209	0.799792	0.16397	6.81E-4	0.003837	ENSG00000081479	ENST00000263816	D	0.91351	-2.83	5.59	-2.13	0.07144	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.630193	0.18293	N	0.145670	T	0.75917	0.3915	L	0.29908	0.895	0.22001	N	0.999424	P	0.49961	0.93	B	0.32928	0.155	T	0.71213	-0.4659	10	0.34782	T	0.22	.	5.0719	0.14611	0.0933:0.5419:0.1917:0.1731	.	4127	P98164	LRP2_HUMAN	H	4127	ENSP00000263816:R4127H	ENSP00000263816:R4127H	R	-	2	0	LRP2	169717636	0.003000	0.15002	0.002000	0.10522	0.271000	0.26615	0.344000	0.19962	-0.713000	0.04981	-2.018000	0.00433	CGC	-	superfamily_Growth_fac_rcpt_N_dom		0.473	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	protein_coding	OTTHUMT00000255231.2	C	NM_004525	rs142934522		170009390	-1	no_errors	ENST00000263816	ensembl	human	known	74_37	missense	SNP	0.272	T
PITX3	5309	genome.wustl.edu	37	10	103991442	103991443	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr10:103991442_103991443delTG	ENST00000370002.3	-	3	376_377	c.223_224delCA	c.(223-225)cagfs	p.Q75fs	PITX3_ENST00000539804.1_Frame_Shift_Del_p.Q75fs	NM_005029.3	NP_005020.1	O75364	PITX3_HUMAN	paired-like homeodomain 3	75					dopaminergic neuron differentiation (GO:0071542)|lens development in camera-type eye (GO:0002088)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|locomotory behavior (GO:0007626)|midbrain development (GO:0030901)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(1)|large_intestine(2)|lung(2)	5		Colorectal(252;0.00957)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		CTCTAGCTCCTGTAGCTGCTGG	0.658																																																	0								ENSG00000107859																																			PITX3	SO:0001589	frameshift_variant	0				HGNC		CCDS7532.1	10q24.32	2013-11-14	2007-07-12		ENSG00000107859	ENSG00000107859		"""Homeoboxes / PRD class"""	9006	protein-coding gene	gene with protein product		602669	"""paired-like homeodomain transcription factor 3"", ""anterior segment mesenchymal dysgenesis"""	ASMD		9620774	Standard	NM_005029		Approved		uc001kuu.1	O75364	OTTHUMG00000018952	ENST00000370002.3:c.223_224delCA	10.37:g.103991442_103991443delTG	ENSP00000359019:p.Gln75fs	Somatic	0	55	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	Q5VZL2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pirsf_Homeobox_Pitx/unc30,pfscan_OAR_dom,pfscan_Homeobox_dom	p.Q75fs	ENST00000370002.3	37	c.224_223	CCDS7532.1	10																																																																																			-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pirsf_Homeobox_Pitx/unc30,pfscan_Homeobox_dom		0.658	PITX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PITX3	protein_coding	OTTHUMT00000050031.1	TG				103991443	-1	no_errors	ENST00000370002	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
NDOR1	27158	genome.wustl.edu	37	9	140108673	140108673	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr9:140108673C>A	ENST00000344894.5	+	6	613	c.530C>A	c.(529-531)aCc>aAc	p.T177N	NDOR1_ENST00000371521.4_Missense_Mutation_p.T177N|NDOR1_ENST00000458322.2_Missense_Mutation_p.T177N|NDOR1_ENST00000427047.2_Missense_Mutation_p.T143N	NM_001144028.1|NM_014434.2	NP_001137500.1|NP_055249.1			NADPH dependent diflavin oxidoreductase 1											breast(1)|endometrium(5)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		TCCAAGTTCACCCTGCTGTTC	0.697																																																	0								ENSG00000188566						37.0	30.0	33.0					9																	140108673		2203	4298	6501	NDOR1	SO:0001583	missense	0			-	HGNC	BC015735	CCDS7036.1, CCDS48061.1, CCDS48062.1, CCDS48063.1	9q34.3	2008-02-05			ENSG00000188566	ENSG00000188566			29838	protein-coding gene	gene with protein product	"""NADPH dependent FMN and FAD containing oxidoreductase"""	606073				10625700, 12631275	Standard	XM_005266066		Approved	NR1, bA350O14.9	uc004clx.3	Q9UHB4	OTTHUMG00000020986	ENST00000344894.5:c.530C>A	9.37:g.140108673C>A	ENSP00000343344:p.Thr177Asn	Somatic	0	45	0.00		0.5720907680579784	32	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_Riboflavin_synthase-like_b-brl,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.T177N	ENST00000344894.5	37	c.530	CCDS7036.1	9	.	.	.	.	.	.	.	.	.	.	C	8.012	0.757682	0.15846	.	.	ENSG00000188566	ENST00000458322;ENST00000427047;ENST00000371521;ENST00000344894	T;T;T;T	0.03181	4.26;4.02;4.26;4.26	4.57	0.576	0.17380	Riboflavin synthase-like beta-barrel (1);	0.403479	0.25836	N	0.027991	T	0.03434	0.0099	L	0.53249	1.67	0.24481	N	0.99435	B;B;B;B	0.06786	0.001;0.0;0.001;0.0	B;B;B;B	0.08055	0.001;0.002;0.003;0.001	T	0.44143	-0.9347	10	0.17832	T	0.49	-0.0332	5.2138	0.15332	0.0:0.4994:0.1655:0.3351	.	177;143;177;177	D3YTG6;D3YTH9;Q9UHB4-2;Q9UHB4	.;.;.;NDOR1_HUMAN	N	177;143;177;177	ENSP00000389905:T177N;ENSP00000394309:T143N;ENSP00000360576:T177N;ENSP00000343344:T177N	ENSP00000343344:T177N	T	+	2	0	NDOR1	139228494	0.000000	0.05858	0.945000	0.38365	0.750000	0.42670	0.370000	0.20433	0.229000	0.21039	-0.150000	0.13652	ACC	-	superfamily_Riboflavin_synthase-like_b-brl		0.697	NDOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDOR1	protein_coding	OTTHUMT00000254704.1	C	NM_014434	-		140108673	+1	no_errors	ENST00000371521	ensembl	human	known	74_37	missense	SNP	0.482	A
MACF1	23499	genome.wustl.edu	37	1	39800992	39800992	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr1:39800992delA	ENST00000372915.3	+	36	8834	c.8747delA	c.(8746-8748)gaafs	p.E2916fs	MACF1_ENST00000545844.1_Intron|MACF1_ENST00000564288.1_Frame_Shift_Del_p.E2911fs|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000567887.1_Frame_Shift_Del_p.E2948fs|MACF1_ENST00000289893.4_Frame_Shift_Del_p.E1351fs|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000361689.2_Intron			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	2916					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GAAGAGCAGGAAAAAGCAGTG	0.348																																																	0								ENSG00000127603						47.0	52.0	51.0					1																	39800992		2203	4300	6503	MACF1	SO:0001589	frameshift_variant	0				HGNC	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.8747delA	1.37:g.39800992delA	ENSP00000362006:p.Glu2916fs	Somatic	0	56	0.00		0.5720907680579784	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_RNaseH-like_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.A2950fs	ENST00000372915.3	37	c.8843		1																																																																																			-	superfamily_RNaseH-like_dom		0.348	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	protein_coding	OTTHUMT00000392096.1	A	NM_033044			39800992	+1	no_errors	ENST00000567887	ensembl	human	putative	74_37	frame_shift_del	DEL	0.536	-
MMP2	4313	genome.wustl.edu	37	16	55518075	55518075	+	Splice_Site	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr16:55518075G>T	ENST00000219070.4	+	3	1037	c.528G>T	c.(526-528)tgG>tgT	p.W176C	MMP2_ENST00000570308.1_Splice_Site_p.W100C|MMP2_ENST00000543485.1_Splice_Site_p.W100C|MMP2_ENST00000437642.2_Splice_Site_p.W126C	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	176	Collagenase-like 1.				angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	TTGGCCGCTGGGGTAGGCAGA	0.582																																																	0								ENSG00000087245						59.0	50.0	53.0					16																	55518075		2198	4300	6498	MMP2	SO:0001630	splice_region_variant	0			-	HGNC		CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.529+1G>T	16.37:g.55518075G>T		Somatic	0	64	0.00		0.5720907680579784	1235	0.08	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_M10_metallopeptidase,pfam_FN_type2_col-bd,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Kringle-like,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_FN_type2_col-bd,smart_Hemopexin-like_repeat,pfscan_FN_type2_col-bd,prints_Pept_M10A	p.W176C	ENST00000219070.4	37	c.528	CCDS10752.1	16	.	.	.	.	.	.	.	.	.	.	G	16.86	3.238185	0.58886	.	.	ENSG00000087245	ENST00000219070;ENST00000543485;ENST00000437642	T;T;T	0.20598	2.06;2.06;2.06	4.72	4.72	0.59763	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.163679	0.56097	D	0.000027	T	0.27384	0.0672	N	0.12182	0.205	0.80722	D	1	D;D	0.76494	0.987;0.999	B;P	0.61397	0.42;0.888	T	0.24476	-1.0159	10	0.56958	D	0.05	.	18.0532	0.89356	0.0:0.0:1.0:0.0	.	126;176	E9PE45;P08253	.;MMP2_HUMAN	C	176;100;126	ENSP00000219070:W176C;ENSP00000444143:W100C;ENSP00000394237:W126C	ENSP00000219070:W176C	W	+	3	0	MMP2	54075576	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.209000	0.51122	2.346000	0.79739	0.455000	0.32223	TGG	-	pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo,prints_Pept_M10A		0.582	MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP2	protein_coding	OTTHUMT00000256913.3	G		-	Missense_Mutation	55518075	+1	no_errors	ENST00000219070	ensembl	human	known	74_37	missense	SNP	1.000	T
YWHAQ	10971	genome.wustl.edu	37	2	9770428	9770428	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr2:9770428C>T	ENST00000381844.4	-	1	317	c.154G>A	c.(154-156)Gtc>Atc	p.V52I	YWHAQ_ENST00000238081.3_Missense_Mutation_p.V52I			P27348	1433T_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta	52					apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|small GTPase mediated signal transduction (GO:0007264)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|protein complex (GO:0043234)	protein N-terminus binding (GO:0047485)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	6	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.241)		CGGCCCCCGACCACGTTCTTG	0.607																																																	0								ENSG00000134308						51.0	53.0	52.0					2																	9770428		2203	4300	6503	YWHAQ	SO:0001583	missense	0			-	HGNC	AF070556	CCDS1666.1	2p25.2-p25.1	2013-12-03	2013-12-03		ENSG00000134308	ENSG00000134308			12854	protein-coding gene	gene with protein product	"""protein tau"""	609009	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide"""			11080204	Standard	NM_006826		Approved	HS1, 14-3-3	uc002qzx.3	P27348	OTTHUMG00000013848	ENST00000381844.4:c.154G>A	2.37:g.9770428C>T	ENSP00000371267:p.Val52Ile	Somatic	0	42	0.00		0.5720907680579784	513	0.19	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	D6W4Z5|Q567U5|Q5TZU8|Q9UP48	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3,prints_14-3-3	p.V52I	ENST00000381844.4	37	c.154	CCDS1666.1	2	.	.	.	.	.	.	.	.	.	.	C	27.4	4.825734	0.90955	.	.	ENSG00000134308	ENST00000238081;ENST00000381844;ENST00000539979;ENST00000446619	T;T;T	0.38401	1.14;1.14;1.14	5.23	5.23	0.72850	14-3-3 domain (4);	0.000000	0.64402	D	0.000013	T	0.41673	0.1169	L	0.35644	1.08	0.58432	D	0.999999	B	0.24092	0.097	P	0.45343	0.477	T	0.13737	-1.0498	10	0.02654	T	1	.	18.7935	0.91983	0.0:1.0:0.0:0.0	.	52	P27348	1433T_HUMAN	I	52;52;17;52	ENSP00000238081:V52I;ENSP00000371267:V52I;ENSP00000398990:V52I	ENSP00000238081:V52I	V	-	1	0	YWHAQ	9687879	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.644000	0.83416	2.438000	0.82558	0.491000	0.48974	GTC	-	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3,prints_14-3-3		0.607	YWHAQ-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	YWHAQ	protein_coding	OTTHUMT00000039014.4	C	NM_006826	-		9770428	-1	no_errors	ENST00000238081	ensembl	human	known	74_37	missense	SNP	1.000	T
ACTB	60	genome.wustl.edu	37	7	5567794	5567808	+	In_Frame_Del	DEL	GTGGATGCCACAGGA	GTGGATGCCACAGGA	-	rs370842886|rs377390140|rs373362107	byFrequency	TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	GTGGATGCCACAGGA	GTGGATGCCACAGGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr7:5567794_5567808delGTGGATGCCACAGGA	ENST00000331789.5	-	5	1002_1016	c.811_825delTCCTGTGGCATCCAC	c.(811-825)tcctgtggcatccacdel	p.SCGIH271del	AC006483.1_ENST00000579427.1_RNA|ACTB_ENST00000464611.1_5'Flank	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta	271					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		AGGTAGTTTCGTGGATGCCACAGGACTCCATGCCT	0.572																																																	0								ENSG00000075624																																			ACTB	SO:0001651	inframe_deletion	0				HGNC	M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.811_825delTCCTGTGGCATCCAC	7.37:g.5567794_5567808delGTGGATGCCACAGGA	ENSP00000349960:p.Ser271_His275del	Somatic	NA	NA	NA		0.5720907680579784	14741	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.SCGIH271in_frame_del	ENST00000331789.5	37	c.825_811	CCDS5341.1	7																																																																																			-	pfam_Actin-related,smart_Actin-related		0.572	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTB	protein_coding	OTTHUMT00000059589.4	GTGGATGCCACAGGA	NM_001101			5567808	-1	no_errors	ENST00000331789	ensembl	human	known	74_37	in_frame_del	DEL	0.895:1.000:1.000:1.000:1.000:1.000:0.993:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
PLXNB1	5364	genome.wustl.edu	37	3	48462153	48462153	+	Missense_Mutation	SNP	C	C	A	rs374536221		TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr3:48462153C>A	ENST00000358536.4	-	10	2218	c.1949G>T	c.(1948-1950)gGg>gTg	p.G650V	PLXNB1_ENST00000456774.1_Missense_Mutation_p.G650V|PLXNB1_ENST00000358459.4_Missense_Mutation_p.G650V|PLXNB1_ENST00000296440.6_Missense_Mutation_p.G650V|PLXNB1_ENST00000448774.2_Intron	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	650					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CCAGTTACACCCCCAGCGGCT	0.642																																																	0								ENSG00000164050	T	VAL/GLY,VAL/GLY	1,4405	2.1+/-5.4	0,1,2202	54.0	48.0	50.0		1949,1949	4.4	1.0	3		50	0,8600		0,0,4300	no	missense,missense	PLXNB1	NM_001130082.1,NM_002673.4	109,109	0,1,6502	AA,AC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	650/2136,650/2136	48462153	1,13005	2203	4300	6503	PLXNB1	SO:0001583	missense	0			-	HGNC	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.1949G>T	3.37:g.48462153C>A	ENSP00000351338:p.Gly650Val	Somatic	0	84	0.00		0.5720907680579784	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.G650V	ENST00000358536.4	37	c.1949	CCDS2765.1	3	.	.	.	.	.	.	.	.	.	.	c	18.82	3.704557	0.68615	2.27E-4	0.0	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000456774	T;T;T;T	0.03386	3.95;3.97;3.95;3.97	5.24	4.38	0.52667	.	0.063397	0.64402	D	0.000008	T	0.16811	0.0404	M	0.80746	2.51	0.80722	D	1	D;P	0.89917	1.0;0.869	D;P	0.74674	0.984;0.731	T	0.02047	-1.1223	10	0.30854	T	0.27	.	13.1637	0.59558	0.0:0.923:0.0:0.077	.	650;650	O43157;O43157-2	PLXB1_HUMAN;.	V	650	ENSP00000296440:G650V;ENSP00000351242:G650V;ENSP00000351338:G650V;ENSP00000414199:G650V	ENSP00000296440:G650V	G	-	2	0	PLXNB1	48437157	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.664000	0.61540	1.242000	0.43836	-0.215000	0.12644	GGG	-	superfamily_Plexin-like_fold,smart_Plexin-like_fold		0.642	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLXNB1	protein_coding	OTTHUMT00000344454.1	C	NM_002673	-		48462153	-1	no_errors	ENST00000296440	ensembl	human	known	74_37	missense	SNP	1.000	A
LUZP2	338645	genome.wustl.edu	37	11	24750765	24750765	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr11:24750765G>A	ENST00000336930.6	+	2	179	c.113G>A	c.(112-114)cGa>cAa	p.R38Q	LUZP2_ENST00000533227.1_5'UTR|LUZP2_ENST00000531187.1_3'UTR			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	38						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						TTTAAGGAGCGAAGCACCATT	0.433																																																	0								ENSG00000187398						72.0	73.0	73.0					11																	24750765		2203	4299	6502	LUZP2	SO:0001583	missense	0			-	HGNC	AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.113G>A	11.37:g.24750765G>A	ENSP00000336817:p.Arg38Gln	Somatic	0	38	0.00		0.5720907680579784	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	20	31.03	A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R38Q	ENST00000336930.6	37	c.113	CCDS31446.1	11	.	.	.	.	.	.	.	.	.	.	G	35	5.569002	0.96540	.	.	ENSG00000187398	ENST00000336930;ENST00000529015	T;T	0.27557	1.66;1.66	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.55273	0.1910	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.52653	-0.8547	10	0.66056	D	0.02	-14.8207	17.9426	0.89030	0.0:0.0:1.0:0.0	.	38	Q86TE4	LUZP2_HUMAN	Q	38	ENSP00000336817:R38Q;ENSP00000437032:R38Q	ENSP00000336817:R38Q	R	+	2	0	LUZP2	24707341	1.000000	0.71417	0.999000	0.59377	0.944000	0.59088	8.890000	0.92477	2.843000	0.97960	0.655000	0.94253	CGA	-	NULL		0.433	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LUZP2	protein_coding	OTTHUMT00000387861.1	G	NM_001009909	-		24750765	+1	no_errors	ENST00000336930	ensembl	human	known	74_37	missense	SNP	1.000	A
RTL1	388015	genome.wustl.edu	37	14	101350508	101350508	+	Silent	SNP	G	G	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr14:101350508G>A	ENST00000534062.1	-	1	676	c.618C>T	c.(616-618)ttC>ttT	p.F206F	MIR136_ENST00000385207.1_RNA|MIR433_ENST00000384837.1_RNA|MIR432_ENST00000606207.1_RNA|MIR127_ENST00000384876.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	206					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						GATCGCCAGAGAAGTGCTTTG	0.493																																																	0								ENSG00000254656						108.0	89.0	95.0					14																	101350508		692	1591	2283	RTL1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.618C>T	14.37:g.101350508G>A		Somatic	0	41	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	6	64.71	E9PKS8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Retrotrans_gag_dom,superfamily_Peptidase_aspartic_dom	p.F206	ENST00000534062.1	37	c.618	CCDS53910.1	14																																																																																			-	NULL		0.493	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	protein_coding	OTTHUMT00000395127.1	G	NM_001134888	-		101350508	-1	no_errors	ENST00000534062	ensembl	human	known	74_37	silent	SNP	0.694	A
TRIM67	440730	genome.wustl.edu	37	1	231342468	231342468	+	Missense_Mutation	SNP	G	G	T	rs201556896	byFrequency	TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr1:231342468G>T	ENST00000366653.5	+	7	1751	c.1751G>T	c.(1750-1752)cGa>cTa	p.R584L	TRIM67_ENST00000366652.2_Missense_Mutation_p.R584L|TRIM67_ENST00000444294.3_Missense_Mutation_p.R582L|TRIM67_ENST00000449018.3_Missense_Mutation_p.R522L			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	584	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)	p.R584Q(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				TACAACGCCCGAGTCAAAGCT	0.507																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000119283						76.0	83.0	80.0					1																	231342468		2063	4220	6283	TRIM67	SO:0001583	missense	0			-	HGNC	AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.1751G>T	1.37:g.231342468G>T	ENSP00000355613:p.Arg584Leu	Somatic	0	51	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	Q5TER7|Q5TER8|Q7Z4K7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.R584L	ENST00000366653.5	37	c.1751	CCDS44333.1	1	.	.	.	.	.	.	.	.	.	.	G	18.57	3.651598	0.67472	.	.	ENSG00000119283	ENST00000444294;ENST00000366652;ENST00000449018;ENST00000366653	T;T;T;T	0.36878	1.23;1.23;1.23;1.23	5.5	5.5	0.81552	Concanavalin A-like lectin/glucanase (1);Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.64627	0.2615	H	0.95294	3.65	0.80722	D	1	B	0.31879	0.344	B	0.42738	0.396	T	0.71321	-0.4628	10	0.62326	D	0.03	.	19.7611	0.96319	0.0:0.0:1.0:0.0	.	584	Q6ZTA4	TRI67_HUMAN	L	582;584;522;584	ENSP00000412124:R582L;ENSP00000355612:R584L;ENSP00000400163:R522L;ENSP00000355613:R584L	ENSP00000355612:R584L	R	+	2	0	TRIM67	229409091	1.000000	0.71417	0.997000	0.53966	0.146000	0.21551	9.658000	0.98594	2.741000	0.93983	0.655000	0.94253	CGA	-	pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.507	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	TRIM67	protein_coding	OTTHUMT00000092649.3	G	NM_001004342	-		231342468	+1	no_errors	ENST00000366652	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC24A1	9187	genome.wustl.edu	37	15	65916825	65916825	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr15:65916825G>T	ENST00000261892.6	+	2	694	c.407G>T	c.(406-408)gGt>gTt	p.G136V	SLC24A1_ENST00000546330.1_Missense_Mutation_p.G136V|SLC24A1_ENST00000537259.1_Missense_Mutation_p.G136V|SLC24A1_ENST00000339868.6_Missense_Mutation_p.G136V|SLC24A1_ENST00000544319.2_Missense_Mutation_p.G136V|SLC24A1_ENST00000399033.4_Missense_Mutation_p.G136V	NM_001254740.1|NM_004727.2	NP_001241669.1|NP_004718.1	O60721	NCKX1_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 1	136					calcium ion transport (GO:0006816)|ion transport (GO:0006811)|phototransduction, visible light (GO:0007603)|response to light intensity (GO:0009642)|rhodopsin mediated signaling pathway (GO:0016056)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						ACAGCAGCAGGTACAGAAAGA	0.428																																																	0								ENSG00000074621						71.0	73.0	72.0					15																	65916825		2024	4175	6199	SLC24A1	SO:0001583	missense	0			-	HGNC	AF062922	CCDS45284.1, CCDS73742.1, CCDS73743.1, CCDS73744.1	15q22.31	2014-01-28			ENSG00000074621	ENSG00000074621		"""Solute carriers"""	10975	protein-coding gene	gene with protein product		603617				9856482	Standard	NM_004727		Approved	NCKX1, NCKX, RODX, KIAA0702, HsT17412, CSNB1D	uc010ujf.2	O60721	OTTHUMG00000167960	ENST00000261892.6:c.407G>T	15.37:g.65916825G>T	ENSP00000261892:p.Gly136Val	Somatic	0	66	0.00		0.5720907680579784	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	O43485|O75184|Q17RM9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger,tigrfam_K/Na/Ca-exchanger	p.G136V	ENST00000261892.6	37	c.407	CCDS45284.1	15	.	.	.	.	.	.	.	.	.	.	G	13.79	2.343506	0.41498	.	.	ENSG00000074621	ENST00000537259;ENST00000261892;ENST00000339868;ENST00000544319;ENST00000399033;ENST00000546330	T;T;T;T;T;T	0.66280	0.03;-0.2;2.01;0.08;-0.2;2.01	4.8	-1.32	0.09201	.	1.138820	0.06590	N	0.751836	T	0.48732	0.1516	L	0.42245	1.32	0.09310	N	1	B;B;B;P;P	0.47962	0.1;0.061;0.061;0.903;0.844	B;B;B;B;B	0.43052	0.056;0.025;0.025;0.406;0.23	T	0.41805	-0.9488	10	0.36615	T	0.2	.	0.7224	0.00943	0.3115:0.2089:0.3254:0.1542	.	136;136;136;136;136	O60721-2;Q17RM9;O60721;F5H127;B4E1W0	.;.;NCKX1_HUMAN;.;.	V	136	ENSP00000439693:G136V;ENSP00000261892:G136V;ENSP00000341837:G136V;ENSP00000445163:G136V;ENSP00000381991:G136V;ENSP00000439190:G136V	ENSP00000261892:G136V	G	+	2	0	SLC24A1	63703878	0.000000	0.05858	0.000000	0.03702	0.269000	0.26545	0.334000	0.19787	-0.018000	0.14079	0.655000	0.94253	GGT	-	tigrfam_K-dep_Na/Ca-exchanger		0.428	SLC24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC24A1	protein_coding	OTTHUMT00000397304.1	G	NM_004727	-		65916825	+1	no_errors	ENST00000261892	ensembl	human	known	74_37	missense	SNP	0.000	T
SRGAP3	9901	genome.wustl.edu	37	3	9101969	9101969	+	Silent	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr3:9101969G>T	ENST00000383836.3	-	6	1174	c.747C>A	c.(745-747)gcC>gcA	p.A249A	SRGAP3_ENST00000360413.3_Silent_p.A249A|SRGAP3_ENST00000433332.3_5'UTR	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	249	F-BAR domain.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		CTGCGTTGGTGGCTGCCAGAT	0.507			T	RAF1	pilocytic astrocytoma																																			Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	0								ENSG00000196220						223.0	194.0	204.0					3																	9101969		2203	4300	6503	SRGAP3	SO:0001819	synonymous_variant	0			-	HGNC	AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.747C>A	3.37:g.9101969G>T		Somatic	0	88	0.00		0.5720907680579784	5	16.67	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	40	23.08	Q8IX13|Q8IZV8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_FCH_dom,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.A249	ENST00000383836.3	37	c.747	CCDS2572.1	3																																																																																			-	NULL		0.507	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRGAP3	protein_coding	OTTHUMT00000207137.3	G		-		9101969	-1	no_errors	ENST00000383836	ensembl	human	known	74_37	silent	SNP	1.000	T
PPP1R12B	4660	genome.wustl.edu	37	1	202407189	202407190	+	Intron	INS	-	-	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr1:202407189_202407190insT	ENST00000608999.1	+	10	1611				PPP1R12B_ENST00000356764.2_3'UTR|RP11-175B9.2_ENST00000602961.1_RNA|PPP1R12B_ENST00000336894.4_Intron|PPP1R12B_ENST00000480184.1_Frame_Shift_Ins_p.V499fs	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			TTCCAAGGCAGTTTTTTTTTTC	0.391																																																	0								ENSG00000077157																																			PPP1R12B	SO:0001627	intron_variant	0				HGNC	AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.1458+37->T	1.37:g.202407199_202407199dupT		Somatic	0	45	0.00		0.5720907680579784	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	24	17.24	A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.F503fs	ENST00000608999.1	37	c.1495_1496	CCDS1426.1	1																																																																																			-	NULL		0.391	PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP1R12B	protein_coding	OTTHUMT00000099166.3	-	NM_032105			202407190	+1	no_errors	ENST00000480184	ensembl	human	novel	74_37	frame_shift_ins	INS	0.085:0.041	T
CNDP1	84735	genome.wustl.edu	37	18	72238471	72238471	+	Silent	SNP	T	T	C			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr18:72238471T>C	ENST00000358821.3	+	7	1035	c.807T>C	c.(805-807)ctT>ctC	p.L269L	CNDP1_ENST00000582365.1_Silent_p.L226L	NM_032649.5	NP_116038	Q96KN2	CNDP1_HUMAN	carnosine dipeptidase 1 (metallopeptidase M20 family)	269						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		GTGGCATCCTTCATGAACCAA	0.413																																					Melanoma(32;1029 1042 25286 38395 44237)												0								ENSG00000150656						239.0	205.0	217.0					18																	72238471		2203	4300	6503	CNDP1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS12007.1	18q22.3	2014-07-14			ENSG00000150656	ENSG00000150656	3.4.13.20		20675	protein-coding gene	gene with protein product	"""carnosinase 1"", ""glutamate carboxypeptidase-like protein 2"""	609064				12473676	Standard	NM_032649		Approved	MGC10825, CN1, CPGL2, HsT2308	uc002llq.3	Q96KN2	OTTHUMG00000132852	ENST00000358821.3:c.807T>C	18.37:g.72238471T>C		Somatic	0	43	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	14	33.33	Q14D40|Q17S05|Q2TBG0|Q6UWK2|Q9BT98	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M20,pfam_Peptidase_M20_dimer,pirsf_GSH_degradosome_DUG1	p.L269	ENST00000358821.3	37	c.807	CCDS12007.1	18																																																																																			-	pfam_Peptidase_M20,pfam_Peptidase_M20_dimer,pirsf_GSH_degradosome_DUG1		0.413	CNDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNDP1	protein_coding	OTTHUMT00000256326.1	T	NM_032649	-		72238471	+1	no_errors	ENST00000358821	ensembl	human	known	74_37	silent	SNP	0.000	C
RNF213	57674	genome.wustl.edu	37	17	78264516	78264516	+	Silent	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr17:78264516G>T	ENST00000582970.1	+	7	1403	c.1260G>T	c.(1258-1260)ctG>ctT	p.L420L	RNF213_ENST00000508628.2_Silent_p.L469L|RNF213_ENST00000319921.4_Silent_p.L420L|RNF213_ENST00000456466.1_Silent_p.L420L	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	420					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TCTGTGAGCTGCACTACACCA	0.458																																																	0								ENSG00000173821						97.0	70.0	79.0					17																	78264516		2203	4300	6503	RNF213	SO:0001819	synonymous_variant	0			-	HGNC	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.1260G>T	17.37:g.78264516G>T		Somatic	0	71	0.00		0.5720907680579784	42	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.L420	ENST00000582970.1	37	c.1260	CCDS58606.1	17																																																																																			-	NULL		0.458	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	protein_coding	OTTHUMT00000443298.1	G	NM_020914	-		78264516	+1	no_errors	ENST00000582970	ensembl	human	known	74_37	silent	SNP	0.870	T
TMEM52	339456	genome.wustl.edu	37	1	1849499	1849499	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr1:1849499G>T	ENST00000310991.3	-	5	459	c.452C>A	c.(451-453)cCg>cAg	p.P151Q	TMEM52_ENST00000378602.3_Missense_Mutation_p.P136Q	NM_178545.3	NP_848640.1	Q8NDY8	TMM52_HUMAN	transmembrane protein 52	151						integral component of membrane (GO:0016021)				NS(1)|prostate(1)|stomach(1)	3	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.82e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.75e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TGGAGGCTCCGGGGTGTACAG	0.632																																																	0								ENSG00000178821						108.0	111.0	110.0					1																	1849499		2203	4300	6503	TMEM52	SO:0001583	missense	0			-	HGNC	AJ278736	CCDS35.1	1p36.33	2008-02-05			ENSG00000178821	ENSG00000178821			27916	protein-coding gene	gene with protein product							Standard	NM_178545		Approved		uc001aij.2	Q8NDY8	OTTHUMG00000000944	ENST00000310991.3:c.452C>A	1.37:g.1849499G>T	ENSP00000311122:p.Pro151Gln	Somatic	0	65	0.00		0.5720907680579784	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q4VXS6|Q6UX25	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P151Q	ENST00000310991.3	37	c.452	CCDS35.1	1	.	.	.	.	.	.	.	.	.	.	.	9.520	1.107999	0.20714	.	.	ENSG00000178821	ENST00000378602;ENST00000310991	T;T	0.29142	1.58;1.58	3.35	2.34	0.29019	.	0.704752	0.12174	N	0.492705	T	0.33352	0.0860	L	0.40543	1.245	0.09310	N	1	D;D	0.64830	0.966;0.994	P;P	0.55545	0.74;0.778	T	0.11084	-1.0602	10	0.49607	T	0.09	-20.7213	4.0449	0.09768	0.3856:0.0:0.6144:0.0	.	151;136	Q8NDY8;Q8NDY8-2	TMM52_HUMAN;.	Q	136;151	ENSP00000367865:P136Q;ENSP00000311122:P151Q	ENSP00000311122:P151Q	P	-	2	0	TMEM52	1839359	0.000000	0.05858	0.028000	0.17463	0.124000	0.20399	0.282000	0.18829	0.840000	0.34995	0.561000	0.74099	CCG	-	NULL		0.632	TMEM52-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM52	protein_coding	OTTHUMT00000002781.1	G	NM_178545	-		1849499	-1	no_errors	ENST00000310991	ensembl	human	known	74_37	missense	SNP	0.032	T
GPR173	54328	genome.wustl.edu	37	X	53106448	53106448	+	Silent	SNP	C	C	G			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chrX:53106448C>G	ENST00000332582.4	+	2	1136	c.645C>G	c.(643-645)cgC>cgG	p.R215R		NM_018969.5	NP_061842.1	Q9NS66	GP173_HUMAN	G protein-coupled receptor 173	215					negative regulation of neuron migration (GO:2001223)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|gonadotropin-releasing hormone receptor activity (GO:0004968)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)	16						ATCGTCACCGCAAGATGAAGC	0.597																																																	0								ENSG00000184194						23.0	22.0	23.0					X																	53106448		2197	4287	6484	GPR173	SO:0001819	synonymous_variant	0			-	HGNC	AB040801	CCDS14349.1	Xp11	2012-08-21	2006-02-15		ENSG00000184194	ENSG00000184194		"""GPCR / Class A : Orphans"""	18186	protein-coding gene	gene with protein product		300253	"""G-protein coupled receptor 173"", ""G protein coupled receptor 173"""			10833454	Standard	NM_018969		Approved	SREB3	uc004dru.3	Q9NS66	OTTHUMG00000021596	ENST00000332582.4:c.645C>G	X.37:g.53106448C>G		Somatic	0	38	0.00		0.5720907680579784	0	100.00	21	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	14	60.00	B1B0A5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.R215	ENST00000332582.4	37	c.645	CCDS14349.1	X																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.597	GPR173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR173	protein_coding	OTTHUMT00000056717.2	C	NM_018969	-		53106448	+1	no_errors	ENST00000332582	ensembl	human	known	74_37	silent	SNP	1.000	G
ZNF821	55565	genome.wustl.edu	37	16	71898846	71898846	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr16:71898846G>T	ENST00000565601.1	-	4	679	c.272C>A	c.(271-273)aCa>aAa	p.T91K	ZNF821_ENST00000313565.6_Missense_Mutation_p.T49K|ZNF821_ENST00000564943.1_Intron|ATXN1L_ENST00000569119.1_Intron|ZNF821_ENST00000425432.1_Missense_Mutation_p.T91K|ZNF821_ENST00000564134.1_Missense_Mutation_p.T91K|ZNF821_ENST00000446827.2_Missense_Mutation_p.T49K	NM_001201553.1	NP_001188482.1	O75541	ZN821_HUMAN	zinc finger protein 821	91					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(2)	13						AGGCTGTTCTGTATTTTCTAA	0.537																																																	0								ENSG00000102984						314.0	215.0	248.0					16																	71898846		2198	4300	6498	ZNF821	SO:0001583	missense	0			-	HGNC	AF070588	CCDS32481.1, CCDS56006.1, CCDS73911.1	16q22.3	2008-05-02				ENSG00000102984		"""Zinc fingers, C2H2-type"""	28043	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_017530		Approved		uc021tlb.1	O75541		ENST00000565601.1:c.272C>A	16.37:g.71898846G>T	ENSP00000455648:p.Thr91Lys	Somatic	0	76	0.00		0.5720907680579784	24	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A6NK48|B4DKK4|D3DWS3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T91K	ENST00000565601.1	37	c.272	CCDS56006.1	16	.	.	.	.	.	.	.	.	.	.	G	11.69	1.713701	0.30413	.	.	ENSG00000102984	ENST00000425432;ENST00000313565;ENST00000446827	T;T;T	0.01279	6.66;5.06;5.06	5.92	4.97	0.65823	.	0.688787	0.15037	N	0.284137	T	0.01222	0.0040	N	0.08118	0	0.24283	N	0.9952	B;B	0.14438	0.01;0.003	B;B	0.14023	0.007;0.01	T	0.51560	-0.8690	10	0.28530	T	0.3	-0.6077	14.364	0.66792	0.0708:0.0:0.9292:0.0	.	91;49	B4DKK4;O75541-2	.;.	K	91;49;49	ENSP00000398089:T91K;ENSP00000313822:T49K;ENSP00000405908:T49K	ENSP00000313822:T49K	T	-	2	0	ZNF821	70456347	1.000000	0.71417	1.000000	0.80357	0.719000	0.41307	3.581000	0.53914	1.520000	0.48965	0.655000	0.94253	ACA	-	NULL		0.537	ZNF821-006	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF821	protein_coding	OTTHUMT00000434180.1	G	NM_017530	-		71898846	-1	no_errors	ENST00000425432	ensembl	human	known	74_37	missense	SNP	0.995	T
LAMA3	3909	genome.wustl.edu	37	18	21441699	21441699	+	Silent	SNP	G	G	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr18:21441699G>A	ENST00000313654.9	+	35	4753	c.4512G>A	c.(4510-4512)gcG>gcA	p.A1504A	LAMA3_ENST00000399516.3_Silent_p.A1504A	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1504	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					GTATGGTGGCGGATCTCCAGG	0.587																																																	0								ENSG00000053747						42.0	45.0	44.0					18																	21441699		2033	4192	6225	LAMA3	SO:0001819	synonymous_variant	0			-	HGNC	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.4512G>A	18.37:g.21441699G>A		Somatic	0	29	0.00		0.5720907680579784	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Growth_fac_rcpt_N_dom,superfamily_Galactose-bd-like,superfamily_STAT_TF_coiled-coil,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.A1504	ENST00000313654.9	37	c.4512	CCDS42419.1	18																																																																																			-	superfamily_Growth_fac_rcpt_N_dom,pfscan_Laminin_B_type_IV		0.587	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	protein_coding	OTTHUMT00000254824.3	G	NM_000227, NM_198129	-		21441699	+1	no_errors	ENST00000313654	ensembl	human	known	74_37	silent	SNP	0.001	A
CNTD1	124817	genome.wustl.edu	37	17	40961674	40961674	+	3'UTR	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr17:40961674C>A	ENST00000588408.1	+	0	1390				CNTD1_ENST00000588527.1_3'UTR|CNTD1_ENST00000315066.5_3'UTR	NM_173478.2	NP_775749.2	Q8N815	CNTD1_HUMAN	cyclin N-terminal domain containing 1											central_nervous_system(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		TTTTGTATGCCAATTTCATGC	0.388																																																	0								ENSG00000176563																																			CNTD1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK097456	CCDS11440.1	17q21.31	2014-07-03	2006-03-31	2006-03-31	ENSG00000176563	ENSG00000176563			26847	protein-coding gene	gene with protein product			"""cyclin N-terminal domain containing"""	CNTD		24891606	Standard	NM_173478		Approved	FLJ40137	uc002ibm.4	Q8N815		ENST00000588408.1:c.*121C>A	17.37:g.40961674C>A		Somatic	0	41	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	Q658Q6|Q8NEP1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000588408.1	37	NULL	CCDS11440.1	17																																																																																			-	-		0.388	CNTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTD1	protein_coding	OTTHUMT00000452398.1	C	NM_173478	-		40961674	+1	no_errors	ENST00000315066	ensembl	human	known	74_37	rna	SNP	0.006	A
SIDT1	54847	genome.wustl.edu	37	3	113342518	113342518	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr3:113342518G>A	ENST00000264852.4	+	23	2971	c.2245G>A	c.(2245-2247)Gcc>Acc	p.A749T	SIDT1_ENST00000393830.3_Missense_Mutation_p.A754T|SIDT1_ENST00000463226.1_3'UTR	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	749					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)			breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						CTGCATCGTGGCCACCGCTGT	0.577																																																	0								ENSG00000072858						103.0	105.0	105.0					3																	113342518		2203	4300	6503	SIDT1	SO:0001583	missense	0			-	HGNC	AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.2245G>A	3.37:g.113342518G>A	ENSP00000264852:p.Ala749Thr	Somatic	0	37	0.00		0.5720907680579784	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	Q17RR4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A754T	ENST00000264852.4	37	c.2260	CCDS2974.1	3	.	.	.	.	.	.	.	.	.	.	G	26.8	4.769590	0.90020	.	.	ENSG00000072858	ENST00000264852;ENST00000393830	T;T	0.24723	1.84;1.84	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000002	T	0.35740	0.0942	L	0.58101	1.795	0.54753	D	0.999987	P;P	0.44241	0.829;0.749	P;P	0.45449	0.481;0.462	T	0.04386	-1.0955	10	0.49607	T	0.09	-19.5746	18.6103	0.91283	0.0:0.0:1.0:0.0	.	754;749	Q9NXL6-2;Q9NXL6	.;SIDT1_HUMAN	T	749;754	ENSP00000264852:A749T;ENSP00000377416:A754T	ENSP00000264852:A749T	A	+	1	0	SIDT1	114825208	1.000000	0.71417	0.964000	0.40570	0.975000	0.68041	4.438000	0.59961	2.695000	0.91970	0.561000	0.74099	GCC	-	NULL		0.577	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT1	protein_coding	OTTHUMT00000317564.1	G	NM_017699	-		113342518	+1	no_errors	ENST00000393830	ensembl	human	known	74_37	missense	SNP	0.995	A
DAO	1610	genome.wustl.edu	37	12	109277522	109277522	+	Intron	SNP	G	G	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr12:109277522G>A	ENST00000228476.3	+	2	195				DAO_ENST00000548052.1_3'UTR|DAO_ENST00000551281.1_Intron	NM_001917.4	NP_001908.3	P14920	OXDA_HUMAN	D-amino-acid oxidase						cellular nitrogen compound metabolic process (GO:0034641)|D-alanine catabolic process (GO:0055130)|D-serine catabolic process (GO:0036088)|D-serine metabolic process (GO:0070178)|dopamine biosynthetic process (GO:0042416)|glyoxylate metabolic process (GO:0046487)|leucine metabolic process (GO:0006551)|proline catabolic process (GO:0006562)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-amino-acid oxidase activity (GO:0003884)|FAD binding (GO:0071949)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|skin(1)	26					Flavin adenine dinucleotide(DB03147)	GCTCGGGCTCGAAGCTGGAAG	0.527																																																	0								ENSG00000110887																																			DAO	SO:0001627	intron_variant	0			-	HGNC	D11370	CCDS9122.1	12q24.11	2013-09-20			ENSG00000110887	ENSG00000110887	1.4.3.3		2671	protein-coding gene	gene with protein product		124050				1356107, 8182053	Standard	NM_001917		Approved	DAMOX	uc001tnr.4	P14920	OTTHUMG00000169360	ENST00000228476.3:c.-9-1252G>A	12.37:g.109277522G>A		Somatic	0	34	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	19	29.63	B2R7I5|Q16758|Q8N6R2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000228476.3	37	NULL	CCDS9122.1	12																																																																																			-	-		0.527	DAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAO	protein_coding	OTTHUMT00000403682.1	G		-		109277522	+1	no_errors	ENST00000548052	ensembl	human	known	74_37	rna	SNP	0.000	A
AC092265.1	0	genome.wustl.edu	37	1	30117426	30117426	+	RNA	SNP	A	A	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr1:30117426A>T	ENST00000408199.1	-	0	99																											gttctagataaacaataattt	0.378																																																	0								ENSG00000221126																																			AC092265.1			0			-	Clone_based_ensembl_gene																													1.37:g.30117426A>T		Somatic	0	109	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	65	21.69		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408199.1	37	NULL		1																																																																																			-	-		0.378	AC092265.1-201	NOVEL	basic	miRNA	ENSG00000221126	miRNA		A		-		30117426	-1	no_errors	ENST00000408199	ensembl	human	novel	74_37	rna	SNP	0.101	T
ACP1	52	genome.wustl.edu	37	2	272100	272100	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr2:272100C>A	ENST00000272065.5	+	3	274	c.181C>A	c.(181-183)Cag>Aag	p.Q61K	ACP1_ENST00000407983.3_Missense_Mutation_p.Q61K|ACP1_ENST00000484464.1_3'UTR|ACP1_ENST00000272067.6_Intron|ACP1_ENST00000439645.2_Intron|ACP1_ENST00000405233.1_Intron	NM_004300.3	NP_004291.1	P24666	PPAC_HUMAN	acid phosphatase 1, soluble	61						cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|extracellular vesicular exosome (GO:0070062)	acid phosphatase activity (GO:0003993)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(1)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	12	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00175)|Lung NSC(108;0.216)|all_epithelial(98;0.236)		all cancers(51;0.000391)|Epithelial(75;0.00281)|OV - Ovarian serous cystadenocarcinoma(76;0.00542)|GBM - Glioblastoma multiforme(21;0.127)	Adenine(DB00173)	CTACCGAGGGCAGAGCTGCAT	0.517																																																	0								ENSG00000143727						139.0	125.0	129.0					2																	272100		2203	4300	6503	ACP1	SO:0001583	missense	0			-	HGNC	M87546	CCDS1639.1, CCDS1640.1, CCDS46217.1	2p25	2011-06-09			ENSG00000143727	ENSG00000143727	3.1.3.2	"""Protein tyrosine phosphatases / Class II Cys-based PTPs"""	122	protein-coding gene	gene with protein product		171500					Standard	NM_001040649		Approved		uc002qwf.3	P24666	OTTHUMG00000086933	ENST00000272065.5:c.181C>A	2.37:g.272100C>A	ENSP00000272065:p.Gln61Lys	Somatic	0	90	0.00		0.5720907680579784	96	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A8K1L9|B5MCC7|P24667|Q16035|Q16036|Q16725|Q3KQX8|Q53RU0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ptyr_pPase_SF,superfamily_Ptyr_pPase_SF,smart_Ptyr_pPase_SF,prints_Tyr_Pase_low_mol_wt_mml,prints_Tyr_phospatase/Ars_reductase	p.Q61K	ENST00000272065.5	37	c.181	CCDS1639.1	2	.	.	.	.	.	.	.	.	.	.	C	14.79	2.639319	0.47153	.	.	ENSG00000143727	ENST00000272065;ENST00000407983	T;T	0.29917	1.55;1.55	5.63	5.63	0.86233	Phosphotyrosine protein phosphatase I superfamily (3);	.	.	.	.	T	0.30135	0.0755	L	0.38838	1.175	0.80722	D	1	B;B	0.29766	0.003;0.256	B;B	0.33960	0.005;0.173	T	0.03130	-1.1069	9	0.37606	T	0.19	.	17.5236	0.87793	0.0:1.0:0.0:0.0	.	61;61	P24666;B5MCC7	PPAC_HUMAN;.	K	61	ENSP00000272065:Q61K;ENSP00000385404:Q61K	ENSP00000272065:Q61K	Q	+	1	0	ACP1	262100	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.424000	0.80242	2.797000	0.96272	0.655000	0.94253	CAG	-	pfam_Ptyr_pPase_SF,superfamily_Ptyr_pPase_SF,smart_Ptyr_pPase_SF,prints_Tyr_phospatase/Ars_reductase		0.517	ACP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACP1	protein_coding	OTTHUMT00000195862.3	C		-		272100	+1	no_errors	ENST00000272065	ensembl	human	known	74_37	missense	SNP	1.000	A
ERICH6B	220081	genome.wustl.edu	37	13	46135548	46135548	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr13:46135548T>A	ENST00000298738.2	-	11	1527	c.1363A>T	c.(1363-1365)Aag>Tag	p.K455*		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		455										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						TCTAATTTCTTCCTATGATGA	0.388																																																	0								ENSG00000165837						456.0	385.0	407.0					13																	46135548		692	1591	2283	FAM194B	SO:0001587	stop_gained	0			-	HGNC																												ENST00000298738.2:c.1363A>T	13.37:g.46135548T>A	ENSP00000298738:p.Lys455*	Somatic	0	52	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	36	19.57	Q96MB5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K455*	ENST00000298738.2	37	c.1363	CCDS45045.1	13	.	.	.	.	.	.	.	.	.	.	T	33	5.223782	0.95139	.	.	ENSG00000165837	ENST00000298738	.	.	.	4.23	4.23	0.50019	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-19.517	10.0099	0.41979	0.0:0.0:0.0:1.0	.	.	.	.	X	455	.	ENSP00000298738:K455X	K	-	1	0	FAM194B	45033549	0.579000	0.26725	0.056000	0.19401	0.006000	0.05464	1.594000	0.36697	2.143000	0.66587	0.533000	0.62120	AAG	-	NULL		0.388	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM194B	protein_coding	OTTHUMT00000044781.3	T		-		46135548	-1	no_errors	ENST00000298738	ensembl	human	known	74_37	nonsense	SNP	0.081	A
KIAA2026	158358	genome.wustl.edu	37	9	5968043	5968044	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr9:5968043_5968044insT	ENST00000399933.3	-	3	2186_2187	c.2187_2188insA	c.(2185-2190)aaagcafs	p.A730fs	KIAA2026_ENST00000381461.2_Frame_Shift_Ins_p.A730fs	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	730	Lys-rich.							p.A730fs*15(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TTGTGTTTTGCTTTTTTTTTGA	0.327																																																	1	Insertion - Frameshift(1)	central_nervous_system(1)						ENSG00000183354																																			KIAA2026	SO:0001589	frameshift_variant	0				HGNC	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.2188dupA	9.37:g.5968052_5968052dupT	ENSP00000382815:p.Ala730fs	Somatic	0	41	0.00		0.5720907680579784	14	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	superfamily_Bromodomain	p.A729fs	ENST00000399933.3	37	c.2188_2187		9																																																																																			-	NULL		0.327	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	protein_coding	OTTHUMT00000051652.2	-	NM_001017969			5968044	-1	no_errors	ENST00000399933	ensembl	human	novel	74_37	frame_shift_ins	INS	1.000:1.000	T
RPGRIP1L	23322	genome.wustl.edu	37	16	53675388	53675388	+	Splice_Site	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr16:53675388C>A	ENST00000379925.3	-	18	2734		c.e18-1		RPGRIP1L_ENST00000564374.1_Splice_Site|RPGRIP1L_ENST00000563746.1_Splice_Site|RPGRIP1L_ENST00000262135.4_Splice_Site	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like						camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				TCAAATATTCCTGTCAAATTA	0.333																																																	0								ENSG00000103494						75.0	71.0	72.0					16																	53675388		2198	4300	6498	RPGRIP1L	SO:0001630	splice_region_variant	0			-	HGNC		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.2684-1G>T	16.37:g.53675388C>A		Somatic	0	44	0.00		0.5720907680579784	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	A0PJ88|Q9Y2K8	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e17-1	ENST00000379925.3	37	c.2684-1	CCDS32447.1	16	.	.	.	.	.	.	.	.	.	.	C	18.81	3.702697	0.68501	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	.	.	.	5.16	5.16	0.70880	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7732	0.85544	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RPGRIP1L	52232889	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	5.369000	0.66138	2.537000	0.85549	0.591000	0.81541	.	-	-		0.333	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	RPGRIP1L	protein_coding	OTTHUMT00000422187.1	C	NM_015272	-	Intron	53675388	-1	no_errors	ENST00000379925	ensembl	human	known	74_37	splice_site	SNP	1.000	A
PCDH10	57575	genome.wustl.edu	37	4	134073569	134073571	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	CTG	CTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr4:134073569_134073571delCTG	ENST00000264360.5	+	1	3100_3102	c.2274_2276delCTG	c.(2272-2277)ctctgc>ctc	p.C763del		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	763	Cys-rich.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		ATTGCTGCCTCTGCTGCTGCTGC	0.581																																																	0								ENSG00000138650																																			PCDH10	SO:0001651	inframe_deletion	0				HGNC	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2274_2276delCTG	4.37:g.134073578_134073580delCTG	ENSP00000264360:p.Cys763del	Somatic	0	40	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	Q4W5F6|Q96SF0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.C762in_frame_del	ENST00000264360.5	37	c.2274_2276	CCDS34063.1	4																																																																																			-	NULL		0.581	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	protein_coding	OTTHUMT00000364457.2	CTG	NM_032961			134073571	+1	no_errors	ENST00000264360	ensembl	human	known	74_37	in_frame_del	DEL	0.999:1.000:1.000	-
FAM78B	149297	genome.wustl.edu	37	1	166135346	166135346	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr1:166135346G>T	ENST00000338353.3	-	2	729	c.140C>A	c.(139-141)cCc>cAc	p.P47H	RP11-9L18.3_ENST00000451784.1_RNA|FAM78B_ENST00000354422.3_Missense_Mutation_p.P47H			Q5VT40	FA78B_HUMAN	family with sequence similarity 78, member B	47										central_nervous_system(1)|endometrium(5)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)					TTTGAAGTAGGGGGTCTTGTA	0.642																																																	0								ENSG00000188859						83.0	62.0	69.0					1																	166135346		2203	4300	6503	FAM78B	SO:0001583	missense	0			-	HGNC	AL626787	CCDS30931.1	1q24.1	2008-02-05			ENSG00000188859	ENSG00000188859			13495	protein-coding gene	gene with protein product							Standard	NM_001017961		Approved		uc021pee.1	Q5VT40	OTTHUMG00000034705	ENST00000338353.3:c.140C>A	1.37:g.166135346G>T	ENSP00000339681:p.Pro47His	Somatic	0	66	0.00		0.5720907680579784	24	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	B7Z693	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P47H	ENST00000338353.3	37	c.140	CCDS30931.1	1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187524	0.78789	.	.	ENSG00000188859	ENST00000354422;ENST00000338353	.	.	.	4.29	4.29	0.51040	.	0.105217	0.64402	D	0.000003	T	0.72228	0.3434	M	0.71581	2.175	0.50313	D	0.999865	D	0.89917	1.0	D	0.87578	0.998	T	0.77362	-0.2616	8	0.87932	D	0	-27.227	14.279	0.66199	0.0:0.0:1.0:0.0	.	47	Q5VT40	FA78B_HUMAN	H	47	.	ENSP00000339681:P47H	P	-	2	0	FAM78B	164401970	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.032000	0.93736	2.205000	0.71048	0.467000	0.42956	CCC	-	NULL		0.642	FAM78B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM78B	protein_coding	OTTHUMT00000343108.1	G	NM_001017961	-		166135346	-1	no_errors	ENST00000338353	ensembl	human	known	74_37	missense	SNP	1.000	T
CCDC66	285331	genome.wustl.edu	37	3	56591278	56591279	+	Frame_Shift_Ins	INS	-	-	GGGGTAAGCA	rs150150392	byFrequency	TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr3:56591278_56591279insGGGGTAAGCA	ENST00000394672.3	+	1	78_79	c.8_9insGGGGTAAGCA	c.(7-12)ttgggafs	p.-4fs	CCDC66_ENST00000326595.7_Intron|CCDC66_ENST00000436465.2_5'Flank|CCDC66_ENST00000442522.2_3'UTR|CCDC66_ENST00000538560.1_5'Flank	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66						post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		GCCATGAACTTggggtaagcag	0.584														3253	0.649561	0.5998	0.7911	5008	,	,		14138	0.5407		0.8449	False		,,,				2504	0.5276																0								ENSG00000180376		,	1477,1077		516,445,316					,	3.2	1.0		dbSNP_130	107	3821,827		1684,453,187	no	frameshift,intron	CCDC66	NM_001141947.1,NM_001012506.4	,	2200,898,503	A1A1,A1R,RR		17.7926,42.1691,26.4371	,	,		5298,1904				CCDC66	SO:0001589	frameshift_variant	0				HGNC	AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	Exception_encountered	3.37:g.56591279_56591288dupGGGGTAAGCA	ENSP00000378167:p.Gly4fs	Somatic	NA	NA	NA		0.5720907680579784	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KWL8|Q4VC34|Q8N949	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.D5fs	ENST00000394672.3	37	c.8_9	CCDS46852.1	3																																																																																			-	NULL		0.584	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC66	protein_coding	OTTHUMT00000341473.1	-	NM_001012506			56591279	+1	no_errors	ENST00000394672	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	GGGGTAAGCA
FAM9B	171483	genome.wustl.edu	37	X	8993603	8993603	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chrX:8993603G>A	ENST00000327220.5	-	8	878	c.514C>T	c.(514-516)Ctt>Ttt	p.L172F	FAM9B_ENST00000362066.3_Missense_Mutation_p.L212F|FAM9B_ENST00000428477.1_Missense_Mutation_p.L172F			Q8IZU0	FAM9B_HUMAN	family with sequence similarity 9, member B	172						nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11		Hepatocellular(5;0.219)				CTGTCACAAAGGTCTTCAAAG	0.318																																																	0								ENSG00000177138						79.0	76.0	77.0					X																	8993603		2203	4298	6501	FAM9B	SO:0001583	missense	0			-	HGNC		CCDS14132.1	Xp22.31	2014-02-17			ENSG00000177138	ENSG00000177138			18404	protein-coding gene	gene with protein product	"""testis expressed 39B"""	300478				12213195, 21085121, 21998597, 22936694	Standard	XM_005274456		Approved	TEX39B	uc011mhu.2	Q8IZU0	OTTHUMG00000021114	ENST00000327220.5:c.514C>T	X.37:g.8993603G>A	ENSP00000318716:p.Leu172Phe	Somatic	0	191	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	168	18.45	Q0IJ68|Q8N7Z8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cor1/Xlr/Xmr	p.L172F	ENST00000327220.5	37	c.514	CCDS14132.1	X	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.120720	0.00031	.	.	ENSG00000177138	ENST00000362066;ENST00000327220;ENST00000428477	.	.	.	0.605	-1.21	0.09524	.	.	.	.	.	T	0.16428	0.0395	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29610	-1.0006	7	0.12103	T	0.63	.	.	.	.	.	172;212	Q8IZU0;Q8N7Z8	FAM9B_HUMAN;.	F	212;172;172	.	ENSP00000318716:L172F	L	-	1	0	FAM9B	8953603	0.059000	0.20769	0.000000	0.03702	0.000000	0.00434	-0.338000	0.07842	-3.065000	0.00255	-3.432000	0.00037	CTT	-	pfam_Cor1/Xlr/Xmr		0.318	FAM9B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM9B	protein_coding	OTTHUMT00000055702.2	G	NM_205849	-		8993603	-1	no_errors	ENST00000327220	ensembl	human	known	74_37	missense	SNP	0.000	A
ARHGEF40	55701	genome.wustl.edu	37	14	21542353	21542353	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr14:21542353A>G	ENST00000298694.4	+	3	591	c.464A>G	c.(463-465)aAg>aGg	p.K155R	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.K155R			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	155						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						GGCATCAACAAGGACCGGCCA	0.607																																																	0								ENSG00000165801						58.0	62.0	61.0					14																	21542353		2203	4300	6503	ARHGEF40	SO:0001583	missense	0			-	HGNC		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.464A>G	14.37:g.21542353A>G	ENSP00000298694:p.Lys155Arg	Somatic	0	53	0.00		0.5720907680579784	62	24.39	20	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	28	20.00	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,superfamily_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.K155R	ENST00000298694.4	37	c.464	CCDS32041.1	14	.	.	.	.	.	.	.	.	.	.	A	14.06	2.423755	0.43020	.	.	ENSG00000165801	ENST00000298694;ENST00000555038;ENST00000298693	T;T	0.02498	4.33;4.27	4.76	4.76	0.60689	.	0.000000	0.52532	D	0.000080	T	0.02888	0.0086	L	0.31065	0.9	0.32608	N	0.525002	B;P	0.42518	0.296;0.782	B;B	0.40677	0.154;0.337	T	0.45220	-0.9276	10	0.15499	T	0.54	.	12.2726	0.54714	1.0:0.0:0.0:0.0	.	155;155	Q8TER5;G3V3N2	ARH40_HUMAN;.	R	155	ENSP00000298694:K155R;ENSP00000298693:K155R	ENSP00000298693:K155R	K	+	2	0	ARHGEF40	20612193	0.904000	0.30761	1.000000	0.80357	0.991000	0.79684	1.964000	0.40462	1.991000	0.58162	0.459000	0.35465	AAG	-	NULL		0.607	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF40	protein_coding	OTTHUMT00000413122.1	A		-		21542353	+1	no_errors	ENST00000298694	ensembl	human	known	74_37	missense	SNP	1.000	G
NCOR2	9612	genome.wustl.edu	37	12	124824721	124824722	+	In_Frame_Ins	INS	-	-	GCCGCTGCT	rs61519723|rs112797765|rs143952466	byFrequency	TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr12:124824721_124824722insGCCGCTGCT	ENST00000405201.1	-	37	5517_5518	c.5517_5518insAGCAGCGGC	c.(5515-5520)ggcggg>ggcAGCAGCGGCggg	p.1838_1839insGSS	NCOR2_ENST00000397355.1_In_Frame_Ins_p.1829_1830insGSS|NCOR2_ENST00000404621.1_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000429285.2_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000356219.3_In_Frame_Ins_p.1845_1846insGSS|NCOR2_ENST00000404121.2_In_Frame_Ins_p.1399_1400insGSS			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1849					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		cccccacccccgccgctgctgc	0.713														4762	0.950879	0.8979	0.9496	5008	,	,		14227	0.9633		0.9672	False		,,,				2504	0.9939																0								ENSG00000196498																																			NCOR2	SO:0001652	inframe_insertion	0				HGNC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5509_5517dupAGCAGCGGC	12.37:g.124824722_124824730dupGCCGCTGCT	ENSP00000384018:p.Gly1836_Ser1838dup	Somatic	NA	NA	NA		0.5720907680579784	25	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.1846in_frame_insSSG	ENST00000405201.1	37	c.5539_5538	CCDS41858.2	12																																																																																			-	NULL		0.713	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	protein_coding	OTTHUMT00000318173.2	-	NM_006312			124824722	-1	no_errors	ENST00000356219	ensembl	human	known	74_37	in_frame_ins	INS	1.000:0.999	GCCGCTGCT
PUF60	22827	genome.wustl.edu	37	8	144898811	144898811	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr8:144898811G>T	ENST00000526683.1	-	12	2114	c.1559C>A	c.(1558-1560)tCc>tAc	p.S520Y	SCRIB_ENST00000356994.2_5'Flank|SCRIB_ENST00000377533.3_5'Flank|PUF60_ENST00000524570.1_5'Flank|PUF60_ENST00000313352.7_Missense_Mutation_p.S460Y|PUF60_ENST00000349157.6_Missense_Mutation_p.S503Y|PUF60_ENST00000453551.2_Missense_Mutation_p.S477Y|SCRIB_ENST00000320476.3_5'Flank|PUF60_ENST00000456095.2_Missense_Mutation_p.S491Y|PUF60_ENST00000527197.1_Missense_Mutation_p.S474Y	NM_001271098.1|NM_078480.2	NP_001258027.1|NP_510965.1	Q9UHX1	PUF60_HUMAN	poly-U binding splicing factor 60KDa	520	Inhibits transcriptional repression, interaction with ERCC3 and apoptosis induction.|RRM 3; atypical. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(3)|lung(7)|prostate(2)	14	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;6.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			AGAGGCTATGGAAAACTCCAC	0.532																																																	0								ENSG00000179950						287.0	302.0	297.0					8																	144898811		2058	4204	6262	PUF60	SO:0001583	missense	0			-	HGNC	AF114818	CCDS47933.1, CCDS47934.1, CCDS47935.1, CCDS59514.1, CCDS59515.1, CCDS59516.1	8q24.3	2013-02-12	2007-07-27		ENSG00000179950	ENSG00000179950		"""RNA binding motif (RRM) containing"""	17042	protein-coding gene	gene with protein product	"""siah binding protein 1"", ""FBP interacting repressor"", ""pyrimidine tract binding splicing factor"", ""Ro ribonucleoprotein binding protein 1"""	604819				10668799, 10882074, 17579712	Standard	NM_078480		Approved	FIR, SIAHBP1, RoBPI	uc003yzs.4	Q9UHX1	OTTHUMG00000165155	ENST00000526683.1:c.1559C>A	8.37:g.144898811G>T	ENSP00000434359:p.Ser520Tyr	Somatic	0	80	0.00		0.5720907680579784	702	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A8K8K8|Q969E7|Q96D94|Q96H63|Q99628|Q9NZA0|Q9UJY7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PolyU-bd	p.S520Y	ENST00000526683.1	37	c.1559	CCDS47934.1	8	.	.	.	.	.	.	.	.	.	.	G	20.5	4.002674	0.74932	.	.	ENSG00000179950	ENST00000526683;ENST00000453551;ENST00000313352;ENST00000456095;ENST00000349157;ENST00000527197	T;T;T;T;T;T	0.06371	3.31;3.31;3.31;3.31;3.31;3.31	5.22	4.35	0.52113	RNA recognition motif domain, eukaryote (1);Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.123753	0.56097	N	0.000022	T	0.23370	0.0565	M	0.91818	3.245	0.80722	D	1	D;D	0.64830	0.994;0.99	P;P	0.53266	0.722;0.531	T	0.14420	-1.0473	10	0.87932	D	0	.	12.4847	0.55866	0.0809:0.0:0.9191:0.0	.	503;520	Q9UHX1-2;Q9UHX1	.;PUF60_HUMAN	Y	520;477;460;491;503;474	ENSP00000434359:S520Y;ENSP00000402953:S477Y;ENSP00000322016:S460Y;ENSP00000395417:S491Y;ENSP00000322036:S503Y;ENSP00000431960:S474Y	ENSP00000322016:S460Y	S	-	2	0	PUF60	144970799	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.952000	0.93031	1.197000	0.43143	0.551000	0.68910	TCC	-	smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom		0.532	PUF60-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PUF60	protein_coding	OTTHUMT00000382222.1	G	NM_014281	-		144898811	-1	no_errors	ENST00000526683	ensembl	human	known	74_37	missense	SNP	1.000	T
ROS1	6098	genome.wustl.edu	37	6	117662358	117662358	+	Silent	SNP	T	T	C			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr6:117662358T>C	ENST00000368508.3	-	30	5217	c.5019A>G	c.(5017-5019)caA>caG	p.Q1673Q	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Silent_p.Q1667Q	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	1673	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TCCAATTAAATTGCAAACTAG	0.373			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																			Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	0								ENSG00000047936						113.0	110.0	111.0					6																	117662358		2203	4300	6503	ROS1	SO:0001819	synonymous_variant	0			-	HGNC	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.5019A>G	6.37:g.117662358T>C		Somatic	0	53	0.00		0.5720907680579784	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	57	41.24	Q15368|Q5TDB5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_LDLR_classB_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q1673	ENST00000368508.3	37	c.5019	CCDS5116.1	6																																																																																			-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.373	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ROS1	protein_coding	OTTHUMT00000043464.1	T		-		117662358	-1	no_errors	ENST00000368508	ensembl	human	known	74_37	silent	SNP	0.596	C
OR1D2	4991	genome.wustl.edu	37	17	2996238	2996238	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr17:2996238G>T	ENST00000331459.1	-	1	52	c.53C>A	c.(52-54)tCa>tAa	p.S18*		NM_002548.2	NP_002539.2	P34982	OR1D2_HUMAN	olfactory receptor, family 1, subfamily D, member 2	18					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|G-protein coupled receptor signaling pathway (GO:0007186)|protein import into nucleus, translocation (GO:0000060)|sensory perception of smell (GO:0007608)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(2)|lung(10)|ovary(1)	15						AGGACTCTCTGACATCCCCAG	0.493																																																	0								ENSG00000184166						93.0	88.0	90.0					17																	2996238		2203	4300	6503	OR1D2	SO:0001587	stop_gained	0			-	HGNC	U04678	CCDS11019.1	17p13.3	2012-08-09			ENSG00000184166	ENSG00000184166		"""GPCR / Class A : Olfactory receptors"""	8183	protein-coding gene	gene with protein product		164342		OLFR1		1370859, 1840504	Standard	NM_002548		Approved	OR17-4	uc010vrb.2	P34982	OTTHUMG00000090619	ENST00000331459.1:c.53C>A	17.37:g.2996238G>T	ENSP00000327585:p.Ser18*	Somatic	0	49	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q6IFL8|Q96RA4|Q9UM78	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S18*	ENST00000331459.1	37	c.53	CCDS11019.1	17	.	.	.	.	.	.	.	.	.	.	G	18.80	3.701406	0.68501	.	.	ENSG00000184166	ENST00000331459	.	.	.	3.42	3.42	0.39159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.7505	0.28894	0.121:0.0:0.8789:0.0	.	.	.	.	X	18	.	ENSP00000327585:S18X	S	-	2	0	OR1D2	2942988	0.008000	0.16893	0.004000	0.12327	0.282000	0.26991	1.566000	0.36396	1.723000	0.51488	0.543000	0.68304	TCA	-	NULL		0.493	OR1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1D2	protein_coding	OTTHUMT00000207207.1	G	NM_002548	-		2996238	-1	no_errors	ENST00000331459	ensembl	human	known	74_37	nonsense	SNP	0.012	T
GRIP1	23426	genome.wustl.edu	37	12	66770956	66770956	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr12:66770956C>A	ENST00000398016.3	-	20	2643	c.2575G>T	c.(2575-2577)Gag>Tag	p.E859*	GRIP1_ENST00000359742.4_Nonsense_Mutation_p.E911*|GRIP1_ENST00000286445.7_Nonsense_Mutation_p.E911*	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		AAGGCTACCTCCAGTTCTCTC	0.428																																																	0								ENSG00000155974						190.0	188.0	189.0					12																	66770956		1859	4096	5955	GRIP1	SO:0001587	stop_gained	0			-	HGNC	AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.2575G>T	12.37:g.66770956C>A	ENSP00000381098:p.Glu859*	Somatic	0	63	0.00		0.5720907680579784	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E911*	ENST00000398016.3	37	c.2731	CCDS41807.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	41|41	8.774094|8.774094	0.98948|0.98948	.|.	.|.	ENSG00000155974|ENSG00000155974	ENST00000398016;ENST00000359742;ENST00000286445;ENST00000538211;ENST00000540433;ENST00000536215|ENST00000538164	.|.	.|.	.|.	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.80037	.|0.4550	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77640	.|-0.2512	.|3	.|.	.|.	.|.	-28.1898|-28.1898	20.0833|20.0833	0.97789|0.97789	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|C	859;911;911;859;803;751|725	.|.	.|.	E|W	-|-	1|3	0|0	GRIP1|GRIP1	65057223|65057223	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.650000|0.650000	0.38633|0.38633	7.398000|7.398000	0.79919|0.79919	2.756000|2.756000	0.94617|0.94617	0.655000|0.655000	0.94253|0.94253	GAG|TGG	-	NULL		0.428	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIP1	protein_coding	OTTHUMT00000401975.2	C		-		66770956	-1	no_errors	ENST00000359742	ensembl	human	known	74_37	nonsense	SNP	1.000	A
KLK8	11202	genome.wustl.edu	37	19	51499377	51499377	+	Missense_Mutation	SNP	C	C	T	rs56296296	byFrequency	TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr19:51499377C>T	ENST00000600767.1	-	7	1210	c.721G>A	c.(721-723)Gtc>Atc	p.V241I	KLK8_ENST00000598195.1_5'UTR|KLK8_ENST00000320838.5_3'UTR|CTB-147C22.9_ENST00000594512.1_RNA|KLK8_ENST00000347619.4_Missense_Mutation_p.V100I|KLK8_ENST00000291726.7_Missense_Mutation_p.V241I|KLK8_ENST00000391806.2_Missense_Mutation_p.V286I|KLK8_ENST00000593490.1_3'UTR			O60259	KLK8_HUMAN	kallikrein-related peptidase 8	241	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell death (GO:0008219)|keratinocyte proliferation (GO:0043616)|memory (GO:0007613)|negative regulation of axon regeneration (GO:0048681)|negative regulation of myelination (GO:0031642)|neuron projection morphogenesis (GO:0048812)|regulation of synapse organization (GO:0050807)|response to wounding (GO:0009611)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)	p.V286I(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(8)|prostate(1)	15		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.0033)|GBM - Glioblastoma multiforme(134;0.00888)		TTGGTATAGACGCCAGGTTTG	0.542																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000129455	C	ILE/VAL,ILE/VAL,ILE/VAL,	1,4405	2.1+/-5.4	0,1,2202	174.0	161.0	165.0		721,856,298,	3.6	0.9	19	dbSNP_129	165	0,8600		0,0,4300	no	missense,missense,missense,utr-3	KLK8	NM_007196.2,NM_144505.1,NM_144506.1,NM_144507.1	29,29,29,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,	241/261,286/306,100/120,	51499377	1,13005	2203	4300	6503	KLK8	SO:0001583	missense	0			-	HGNC	AB008390	CCDS12813.1, CCDS12814.1, CCDS12815.1, CCDS42600.1, CCDS74433.1	19q13	2011-09-07	2006-10-27			ENSG00000129455		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6369	protein-coding gene	gene with protein product		605644	"""kallikrein 8 (neuropsin/ovasin)"""	PRSS19		10102990, 9714609, 16800724, 16800723	Standard	NM_144505		Approved	HNP, TADG14, neuropsin, ovasin	uc002pur.1	O60259		ENST00000600767.1:c.721G>A	19.37:g.51499377C>T	ENSP00000472016:p.Val241Ile	Somatic	0	38	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	30	26.83	Q5V9X1|Q5V9X2|Q8IW69|Q9HCB3|Q9NR68|Q9NR69|Q9UIL9|Q9UQ47	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.V286I	ENST00000600767.1	37	c.856	CCDS12813.1	19	.	.	.	.	.	.	.	.	.	.	C	14.66	2.602044	0.46423	2.27E-4	0.0	ENSG00000129455	ENST00000391806;ENST00000291726;ENST00000347619	D;D;D	0.90732	-2.72;-2.72;-2.72	4.66	3.62	0.41486	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.39834	N	0.001253	D	0.92331	0.7567	L	0.52905	1.665	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.85130	0.995;0.968;0.997	D	0.90875	0.4749	10	0.48119	T	0.1	.	7.4155	0.27042	0.0:0.8058:0.0:0.1942	rs56296296	100;241;286	O60259-3;O60259;O60259-2	.;KLK8_HUMAN;.	I	286;241;100	ENSP00000375682:V286I;ENSP00000291726:V241I;ENSP00000341555:V100I	ENSP00000291726:V241I	V	-	1	0	KLK8	56191189	0.998000	0.40836	0.855000	0.33649	0.063000	0.16089	3.907000	0.56348	1.308000	0.44962	0.563000	0.77884	GTC	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.542	KLK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK8	protein_coding	OTTHUMT00000465032.2	C	NM_007196	rs56296296		51499377	-1	no_errors	ENST00000391806	ensembl	human	known	74_37	missense	SNP	0.962	T
LIMS2	55679	genome.wustl.edu	37	2	128415042	128415042	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr2:128415042A>C	ENST00000355119.4	-	2	271	c.106T>G	c.(106-108)Tac>Gac	p.Y36D	LIMS2_ENST00000545738.2_Missense_Mutation_p.Y58D|LIMS2_ENST00000409808.2_Missense_Mutation_p.Y31D|LIMS2_ENST00000410011.1_Missense_Mutation_p.Y31D|LIMS2_ENST00000409455.1_Missense_Mutation_p.Y31D|LIMS2_ENST00000324938.5_Missense_Mutation_p.Y60D	NM_001161403.1	NP_001154875.1	Q7Z4I7	LIMS2_HUMAN	LIM and senescent cell antigen-like domains 2	36	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of neural precursor cell proliferation (GO:2000178)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0681)		TGCTCATGGTACAGCTCCCCA	0.632																																																	0								ENSG00000072163						101.0	87.0	92.0					2																	128415042		2203	4300	6503	LIMS2	SO:0001583	missense	0			-	HGNC	AF520987	CCDS2147.1, CCDS54394.1, CCDS54395.1, CCDS54396.1, CCDS58725.1	2q21.1	2008-02-05			ENSG00000072163	ENSG00000072163			16084	protein-coding gene	gene with protein product		607908					Standard	NM_017980		Approved		uc002tox.3	Q7Z4I7	OTTHUMG00000131529	ENST00000355119.4:c.106T>G	2.37:g.128415042A>C	ENSP00000347240:p.Tyr36Asp	Somatic	0	71	0.00		0.5720907680579784	60	10.29	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	49	24.62	A6NLH0|B4DMV1|F5H6E6|Q7Z4I2|Q7Z4I6|Q7Z4I8|Q8NFE7|Q9HA13	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_LIM,smart_Znf_LIM,pirsf_PINCH,pfscan_Znf_LIM	p.Y60D	ENST00000355119.4	37	c.178	CCDS54395.1	2	.	.	.	.	.	.	.	.	.	.	A	22.7	4.324018	0.81580	.	.	ENSG00000072163	ENST00000545738;ENST00000355119;ENST00000324938;ENST00000409455;ENST00000410109;ENST00000409808;ENST00000410011;ENST00000544917;ENST00000422034	D;D;D;D;D;D	0.91843	-2.92;-2.92;-2.92;-2.92;-2.92;-2.92	5.25	5.25	0.73442	Zinc finger, LIM-type (5);	0.214672	0.41605	D	0.000860	D	0.97383	0.9144	H	0.96720	3.87	0.58432	D	0.999998	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.75020	0.983;0.985;0.929	D	0.98753	1.0721	10	0.87932	D	0	.	15.1498	0.72689	1.0:0.0:0.0:0.0	.	58;36;60	F5H6E6;Q7Z4I7;Q7Z4I7-2	.;LIMS2_HUMAN;.	D	58;36;60;31;31;31;31;58;31	ENSP00000443794:Y58D;ENSP00000347240:Y36D;ENSP00000326888:Y60D;ENSP00000386383:Y31D;ENSP00000386637:Y31D;ENSP00000387002:Y31D	ENSP00000326888:Y60D	Y	-	1	0	LIMS2	128131512	1.000000	0.71417	0.993000	0.49108	0.710000	0.40934	7.395000	0.79876	1.982000	0.57802	0.379000	0.24179	TAC	-	pfam_Znf_LIM,smart_Znf_LIM,pirsf_PINCH,pfscan_Znf_LIM		0.632	LIMS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LIMS2	protein_coding	OTTHUMT00000331133.2	A	NM_017980	-		128415042	-1	no_errors	ENST00000324938	ensembl	human	known	74_37	missense	SNP	1.000	C
ITGA10	8515	genome.wustl.edu	37	1	145527693	145527693	+	Missense_Mutation	SNP	G	G	T	rs146922585		TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr1:145527693G>T	ENST00000369304.3	+	2	308	c.133G>T	c.(133-135)Gtc>Ttc	p.V45F	ITGA10_ENST00000538811.1_Silent_p.V19V|ITGA10_ENST00000539363.1_Intron	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	45					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TGGATACAGTGTCTTACAACA	0.527																																																	0								ENSG00000143127						125.0	124.0	125.0					1																	145527693		2203	4300	6503	ITGA10	SO:0001583	missense	0			-	HGNC	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.133G>T	1.37:g.145527693G>T	ENSP00000358310:p.Val45Phe	Somatic	0	88	0.00		0.5720907680579784	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	45	18.18	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.V45F	ENST00000369304.3	37	c.133	CCDS918.1	1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.104898	0.77096	.	.	ENSG00000143127	ENST00000369304	T	0.74421	-0.84	5.02	4.09	0.47781	.	0.000000	0.64402	D	0.000002	D	0.84615	0.5511	M	0.90705	3.14	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.996	D	0.86163	0.1595	10	0.87932	D	0	.	9.5982	0.39587	0.0981:0.0:0.9019:0.0	.	45;45	O75578;O75578-2	ITA10_HUMAN;.	F	45	ENSP00000358310:V45F	ENSP00000358310:V45F	V	+	1	0	ITGA10	144239050	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.004000	0.63966	2.611000	0.88343	0.655000	0.94253	GTC	-	smart_Int_alpha_beta-p		0.527	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA10	protein_coding	OTTHUMT00000038537.2	G	NM_003637	-		145527693	+1	no_errors	ENST00000369304	ensembl	human	known	74_37	missense	SNP	1.000	T
TRAF7	84231	genome.wustl.edu	37	16	2220714	2220716	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr16:2220714_2220716delGAG	ENST00000326181.6	+	5	463_465	c.331_333delGAG	c.(331-333)gagdel	p.E115del		NM_032271.2	NP_115647.2	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7, E3 ubiquitin protein ligase	115					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of MAPK cascade (GO:0043410)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle (GO:0031410)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	23						CTCACTGCCCGAGGAGGAGGAGG	0.69																																																	0								ENSG00000131653																																			TRAF7	SO:0001651	inframe_deletion	0				HGNC	AL136921	CCDS10461.1	16p13.3	2013-01-10	2012-02-23	2004-06-04	ENSG00000131653	ENSG00000131653		"""RING-type (C3HC4) zinc fingers"", ""WD repeat domain containing"""	20456	protein-coding gene	gene with protein product		606692	"""ring finger and WD repeat domain 1"", ""TNF receptor-associated factor 7"""	RFWD1		11230166, 15001576	Standard	NM_032271		Approved	RNF119, DKFZp586I021, MGC7807	uc002cow.3	Q6Q0C0	OTTHUMG00000128826	ENST00000326181.6:c.331_333delGAG	16.37:g.2220723_2220725delGAG	ENSP00000318944:p.Glu115del	Somatic	0	34	0.00		0.5720907680579784	98	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	Q9H073	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_TRAF-like,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_RING,pfscan_Znf_TRAF,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.E114in_frame_del	ENST00000326181.6	37	c.331_333	CCDS10461.1	16																																																																																			-	NULL		0.690	TRAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF7	protein_coding	OTTHUMT00000250762.1	GAG	NM_032271			2220716	+1	no_errors	ENST00000326181	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
USP37	57695	genome.wustl.edu	37	2	219374834	219374834	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr2:219374834G>T	ENST00000258399.3	-	11	1305	c.893C>A	c.(892-894)gCc>gAc	p.A298D	USP37_ENST00000415516.1_Missense_Mutation_p.A226D|USP37_ENST00000454775.1_Missense_Mutation_p.A298D|USP37_ENST00000418019.1_Missense_Mutation_p.A298D	NM_020935.2	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	298					G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)			NS(2)|breast(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(5)|stomach(1)	35		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		ACTTCTTTTGGCAGAGGGAGT	0.363																																																	0								ENSG00000135913						95.0	97.0	96.0					2																	219374834		2203	4300	6503	USP37	SO:0001583	missense	0			-	HGNC	AB046814	CCDS2418.1	2q35	2008-02-05	2005-08-08		ENSG00000135913	ENSG00000135913		"""Ubiquitin-specific peptidases"""	20063	protein-coding gene	gene with protein product			"""ubiquitin specific protease 37"""			12838346	Standard	NM_020935		Approved	KIAA1594	uc010fvs.1	Q86T82	OTTHUMG00000133113	ENST00000258399.3:c.893C>A	2.37:g.219374834G>T	ENSP00000258399:p.Ala298Asp	Somatic	0	64	0.00		0.5720907680579784	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A2RUQ8|B7ZM38|B7ZM41|E9PHL3|Q2KHT2|Q53S10|Q7Z3A5|Q9HCH8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfam_Ubiquitin-int_motif,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif,pfscan_Peptidase_C19/C67	p.A298D	ENST00000258399.3	37	c.893	CCDS2418.1	2	.	.	.	.	.	.	.	.	.	.	G	17.62	3.435726	0.62955	.	.	ENSG00000135913	ENST00000258399;ENST00000454775;ENST00000415516;ENST00000418019	T;T;T;T	0.45668	0.89;0.89;0.9;0.89	5.82	5.82	0.92795	.	0.056823	0.64402	D	0.000001	T	0.59838	0.2223	L	0.56769	1.78	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.66351	0.943;0.878	T	0.48317	-0.9046	10	0.17832	T	0.49	-6.8265	20.0951	0.97834	0.0:0.0:1.0:0.0	.	226;298	Q86T82-2;Q86T82	.;UBP37_HUMAN	D	298;298;226;298	ENSP00000258399:A298D;ENSP00000393662:A298D;ENSP00000400902:A226D;ENSP00000396585:A298D	ENSP00000258399:A298D	A	-	2	0	USP37	219083078	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.464000	0.73534	2.753000	0.94483	0.467000	0.42956	GCC	-	NULL		0.363	USP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP37	protein_coding	OTTHUMT00000256779.3	G	NM_020935	-		219374834	-1	no_errors	ENST00000258399	ensembl	human	known	74_37	missense	SNP	1.000	T
TNIP3	79931	genome.wustl.edu	37	4	122068281	122068281	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr4:122068281T>C	ENST00000509841.1	-	10	967	c.889A>G	c.(889-891)Aga>Gga	p.R297G	TNIP3_ENST00000057513.3_Missense_Mutation_p.R220G|TNIP3_ENST00000454328.1_Missense_Mutation_p.R220G|TNIP3_ENST00000511909.1_5'UTR|TNIP3_ENST00000507879.1_Missense_Mutation_p.R290G	NM_001244764.1	NP_001231693.1			TNFAIP3 interacting protein 3											NS(1)|endometrium(4)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(2)	24						TGATTAAGTCTCTCTCGATCC	0.378																																																	0								ENSG00000050730						220.0	213.0	215.0					4																	122068281		2203	4300	6503	TNIP3	SO:0001583	missense	0			-	HGNC	AJ320534	CCDS3718.1, CCDS58925.1, CCDS58926.1	4q27	2008-02-05			ENSG00000050730	ENSG00000050730			19315	protein-coding gene	gene with protein product		608019				11345586	Standard	NM_024873		Approved	LIND, FLJ21162, ABIN-3	uc021xrj.1	Q96KP6	OTTHUMG00000132969	ENST00000509841.1:c.889A>G	4.37:g.122068281T>C	ENSP00000426613:p.Arg297Gly	Somatic	0	49	0.00		0.5720907680579784	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	21	43.24		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R220G	ENST00000509841.1	37	c.658	CCDS58926.1	4	.	.	.	.	.	.	.	.	.	.	T	18.83	3.707745	0.68615	.	.	ENSG00000050730	ENST00000057513;ENST00000454328;ENST00000507879;ENST00000509841	D;D;D;D	0.97791	-4.54;-4.54;-4.54;-4.54	5.4	4.18	0.49190	.	0.000000	0.64402	D	0.000001	D	0.98532	0.9510	M	0.83118	2.625	0.28295	N	0.9234	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	D	0.95553	0.8622	10	0.87932	D	0	-15.1832	12.3143	0.54946	0.0:0.0:0.1417:0.8583	.	290;220	B4DVF5;Q96KP6	.;TNIP3_HUMAN	G	220;220;290;297	ENSP00000057513:R220G;ENSP00000411817:R220G;ENSP00000427106:R290G;ENSP00000426613:R297G	ENSP00000057513:R220G	R	-	1	2	TNIP3	122287731	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	1.497000	0.35649	0.856000	0.35383	0.460000	0.39030	AGA	-	NULL		0.378	TNIP3-003	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	TNIP3	protein_coding	OTTHUMT00000364000.4	T	NM_024873	-		122068281	-1	no_errors	ENST00000057513	ensembl	human	known	74_37	missense	SNP	1.000	C
ZDHHC23	254887	genome.wustl.edu	37	3	113680733	113680733	+	3'UTR	DEL	T	T	-			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr3:113680733delT	ENST00000330212.3	+	0	2682				ZDHHC23_ENST00000488129.1_3'UTR	NM_173570.3	NP_775841.2	Q8IYP9	ZDH23_HUMAN	zinc finger, DHHC-type containing 23						protein localization to plasma membrane (GO:0072659)|protein palmitoylation (GO:0018345)	integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|urinary_tract(2)	16						TAGCTTTTGATTATAAAGCTC	0.353																																																	0								ENSG00000184307																																			ZDHHC23	SO:0001624	3_prime_UTR_variant	0				HGNC	AK127025	CCDS33827.1	3q13.31	2008-05-02			ENSG00000184307	ENSG00000184307		"""Zinc fingers, DHHC-type"""	28654	protein-coding gene	gene with protein product						12477932	Standard	NM_173570		Approved	MGC42530	uc003eau.3	Q8IYP9	OTTHUMG00000159335	ENST00000330212.3:c.*1153T>-	3.37:g.113680733delT		Somatic	0	46	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	22	18.52	D3DN76	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000330212.3	37	NULL	CCDS33827.1	3																																																																																			-	-		0.353	ZDHHC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC23	protein_coding	OTTHUMT00000354702.1	T	NM_173570			113680733	+1	no_errors	ENST00000488129	ensembl	human	putative	74_37	rna	DEL	0.901	-
RFFL	117584	genome.wustl.edu	37	17	33336054	33336054	+	3'UTR	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr17:33336054G>T	ENST00000315249.7	-	0	4247				RP5-837J1.2_ENST00000578488.1_RNA|RFFL_ENST00000580569.1_5'Flank					ring finger and FYVE-like domain containing E3 ubiquitin protein ligase											kidney(1)|large_intestine(2)|lung(3)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		ctaaagtgtggaaattatagc	0.438																																																	0								ENSG00000224113																																			RP5-837J1.2	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene	AF434816	CCDS11286.1	17q12	2012-02-23	2012-02-23		ENSG00000092871	ENSG00000092871		"""RING-type (C3HC4) zinc fingers"""	24821	protein-coding gene	gene with protein product		609735	"""ring finger and FYVE-like domain containing"""			15229288	Standard	NR_037713		Approved	rififylin, fring, RNF189, RNF34L	uc002hin.1	Q8WZ73	OTTHUMG00000132933	ENST00000315249.7:c.*2933C>A	17.37:g.33336054G>T		Somatic	0	38	0.00		0.5720907680579784	16	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000315249.7	37	NULL	CCDS11286.1	17																																																																																			-	-		0.438	RFFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000224113	protein_coding	OTTHUMT00000256460.2	G	NM_057178	-		33336054	+1	no_errors	ENST00000578488	ensembl	human	known	74_37	rna	SNP	0.002	T
NR2C2	7182	genome.wustl.edu	37	3	15062399	15062399	+	Silent	SNP	C	C	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr3:15062399C>T	ENST00000425241.1	+	5	878	c.516C>T	c.(514-516)tgC>tgT	p.C172C	NR2C2_ENST00000406272.2_Silent_p.C172C|NR2C2_ENST00000393102.3_Silent_p.C172C|NR2C2_ENST00000323373.6_Silent_p.C191C			P49116	NR2C2_HUMAN	nuclear receptor subfamily 2, group C, member 2	172					cell differentiation (GO:0030154)|gene expression (GO:0010467)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(5)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GTCAGTTTTGCCGGCTGAAAA	0.418																																																	0								ENSG00000177463						93.0	90.0	91.0					3																	15062399		2203	4300	6503	NR2C2	SO:0001819	synonymous_variant	0			-	HGNC	L27586	CCDS2621.1, CCDS74905.1	3p25	2013-01-16			ENSG00000177463	ENSG00000177463		"""Nuclear hormone receptors"""	7972	protein-coding gene	gene with protein product		601426		TR4		8661150, 8016112	Standard	XM_005265428		Approved	TAK1, TR2R1, hTAK1	uc003bzi.3	P49116	OTTHUMG00000129839	ENST00000425241.1:c.516C>T	3.37:g.15062399C>T		Somatic	0	84	0.00		0.5720907680579784	17	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A8K3H5|B6ZGT8|P55092	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt	p.C191	ENST00000425241.1	37	c.573		3																																																																																			-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt		0.418	NR2C2-002	NOVEL	basic|appris_principal	protein_coding	NR2C2	protein_coding	OTTHUMT00000340729.1	C	NM_003298	-		15062399	+1	no_errors	ENST00000323373	ensembl	human	known	74_37	silent	SNP	1.000	T
RBM44	375316	genome.wustl.edu	37	2	238737936	238737936	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr2:238737936G>T	ENST00000409864.1	+	13	2934	c.2680G>T	c.(2680-2682)Gga>Tga	p.G894*	RBM44_ENST00000316997.4_Nonsense_Mutation_p.G894*			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	893	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.					cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		AGAAATAAATGGAAAGTCAGT	0.328																																																	0								ENSG00000177483						111.0	107.0	108.0					2																	238737936		1834	4087	5921	RBM44	SO:0001587	stop_gained	0			-	HGNC	AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.2680G>T	2.37:g.238737936G>T	ENSP00000386727:p.Gly894*	Somatic	0	30	0.00		0.5720907680579784	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	A0AUW3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G894*	ENST00000409864.1	37	c.2680	CCDS46554.1	2	.	.	.	.	.	.	.	.	.	.	G	42	9.223700	0.99106	.	.	ENSG00000177483	ENST00000316997;ENST00000409864	.	.	.	4.61	4.61	0.57282	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-15.5154	13.3283	0.60473	0.0:0.0:1.0:0.0	.	.	.	.	X	894	.	ENSP00000321179:G894X	G	+	1	0	RBM44	238402675	1.000000	0.71417	0.978000	0.43139	0.964000	0.63967	3.617000	0.54181	2.274000	0.75844	0.551000	0.68910	GGA	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.328	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM44	protein_coding	OTTHUMT00000328733.2	G	NM_001080504	-		238737936	+1	no_errors	ENST00000316997	ensembl	human	known	74_37	nonsense	SNP	0.996	T
ACTB	60	genome.wustl.edu	37	7	5567780	5567791	+	In_Frame_Del	DEL	TTGAAGGTAGTT	TTGAAGGTAGTT	-	rs11546896		TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	TTGAAGGTAGTT	TTGAAGGTAGTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr7:5567780_5567791delTTGAAGGTAGTT	ENST00000331789.5	-	5	1019_1030	c.828_839delAACTACCTTCAA	c.(826-840)gaaactaccttcaac>gac	p.276_280ETTFN>D	AC006483.1_ENST00000579427.1_RNA|ACTB_ENST00000464611.1_5'Flank	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta	276			T -> I (in DFNA20; dbSNP:rs28999112). {ECO:0000269|PubMed:14684684}.		adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		CATGATGGAGTTGAAGGTAGTTTCGTGGATGC	0.571																																																	0								ENSG00000075624																																			ACTB	SO:0001651	inframe_deletion	0				HGNC	M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.828_839delAACTACCTTCAA	7.37:g.5567780_5567791delTTGAAGGTAGTT	ENSP00000349960:p.Glu276_Asn280delinsAsp	Somatic	NA	NA	NA		0.5720907680579784	15816	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.ETTFN276in_frame_delD	ENST00000331789.5	37	c.839_828	CCDS5341.1	7																																																																																			-	pfam_Actin-related,smart_Actin-related		0.571	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTB	protein_coding	OTTHUMT00000059589.4	TTGAAGGTAGTT	NM_001101			5567791	-1	no_errors	ENST00000331789	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.983:1.000:1.000:1.000	-
CILP2	148113	genome.wustl.edu	37	19	19654128	19654128	+	Missense_Mutation	SNP	G	G	A	rs201485988		TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr19:19654128G>A	ENST00000291495.5	+	7	1134	c.1049G>A	c.(1048-1050)cGc>cAc	p.R350H	CILP2_ENST00000586018.1_Missense_Mutation_p.R356H	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	350	Ig-like C2-type.					extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						CGGGGACTGCGCCCAGACCAG	0.647													G|||	1	0.000199681	0.0	0.0014	5008	,	,		16543	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000160161	G	HIS/ARG	0,4406		0,0,2203	49.0	52.0	51.0		1049	-7.8	0.0	19		51	1,8597	1.2+/-3.3	0,1,4298	no	missense	CILP2	NM_153221.2	29	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	benign	350/1157	19654128	1,13003	2203	4299	6502	CILP2	SO:0001583	missense	0			GMAF=0	HGNC	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.1049G>A	19.37:g.19654128G>A	ENSP00000291495:p.Arg350His	Somatic	0	100	0.00		0.5720907680579784	1	75.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	25	28.57	Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,superfamily_Carb-bd-like_fold,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.R350H	ENST00000291495.5	37	c.1049	CCDS12405.1	19	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	10.28	1.307532	0.23821	0.0	1.16E-4	ENSG00000160161	ENST00000291495	T	0.12255	2.7	4.79	-7.81	0.01210	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.626322	0.17411	N	0.175199	T	0.08626	0.0214	L	0.35542	1.07	0.09310	N	1	B;B	0.20052	0.041;0.041	B;B	0.21546	0.035;0.035	T	0.19516	-1.0303	10	0.36615	T	0.2	-11.0386	13.277	0.60191	0.6344:0.0:0.3656:0.0	.	350;350	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	H	350	ENSP00000291495:R350H	ENSP00000291495:R350H	R	+	2	0	CILP2	19515128	0.000000	0.05858	0.000000	0.03702	0.155000	0.21991	-0.168000	0.09925	-1.031000	0.03308	-0.489000	0.04712	CGC	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.647	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CILP2	protein_coding	OTTHUMT00000459738.3	G	NM_153221	rs201485988		19654128	+1	no_errors	ENST00000291495	ensembl	human	known	74_37	missense	SNP	0.000	A
GALNT8	26290	genome.wustl.edu	37	12	4881618	4881618	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr12:4881618C>T	ENST00000252318.2	+	11	2106	c.1769C>T	c.(1768-1770)gCt>gTt	p.A590V		NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	590	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						CAGGGAGGAGCTGTCATAAAC	0.527																																					Colon(108;631 1558 7270 20097 39846)												0								ENSG00000130035						90.0	86.0	87.0					12																	4881618		2203	4300	6503	GALNT8	SO:0001583	missense	0			-	HGNC	AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.1769C>T	12.37:g.4881618C>T	ENSP00000252318:p.Ala590Val	Somatic	0	93	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B2RU02	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.A590V	ENST00000252318.2	37	c.1769	CCDS8533.1	12	.	.	.	.	.	.	.	.	.	.	C	14.16	2.452966	0.43531	.	.	ENSG00000130035	ENST00000252318	T	0.27256	1.68	4.22	4.22	0.49857	Ricin B-related lectin (1);Ricin B lectin (3);	0.462508	0.21188	N	0.078685	T	0.35451	0.0932	M	0.68952	2.095	0.09310	N	1	P	0.44946	0.846	P	0.48982	0.597	T	0.13361	-1.0512	10	0.33940	T	0.23	.	11.9861	0.53149	0.0:1.0:0.0:0.0	.	590	Q9NY28	GALT8_HUMAN	V	590	ENSP00000252318:A590V	ENSP00000252318:A590V	A	+	2	0	GALNT8	4751879	0.004000	0.15560	0.008000	0.14137	0.003000	0.03518	1.564000	0.36375	2.195000	0.70347	0.650000	0.86243	GCT	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin		0.527	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	GALNT8	protein_coding	OTTHUMT00000388277.2	C	NM_017417	-		4881618	+1	no_errors	ENST00000252318	ensembl	human	known	74_37	missense	SNP	0.002	T
RP11-142G1.1	0	genome.wustl.edu	37	16	52289448	52289449	+	lincRNA	INS	-	-	C			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr16:52289448_52289449insC	ENST00000568286.1	+	0	317				AC007333.1_ENST00000408588.1_RNA																							aattacttttgcaccactctaa	0.312																																																	0								ENSG00000221515																																			AC007333.1			0				Clone_based_ensembl_gene																													16.37:g.52289449_52289449dupC		Somatic	0	54	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	33	8.33		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000568286.1	37	NULL		16																																																																																			-	-		0.312	RP11-142G1.1-001	KNOWN	basic	lincRNA	ENSG00000221515	lincRNA	OTTHUMT00000422568.1	-				52289449	-1	no_errors	ENST00000408588	ensembl	human	novel	74_37	rna	INS	0.001:0.001	C
GRIN2C	2905	genome.wustl.edu	37	17	72838591	72838591	+	Silent	SNP	G	G	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr17:72838591G>A	ENST00000293190.5	-	13	3831	c.3685C>T	c.(3685-3687)Ctg>Ttg	p.L1229L		NM_000835.3	NP_000826.2	Q14957	NMDE3_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2C	1229					directional locomotion (GO:0033058)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of protein catabolic process (GO:0042177)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	33	all_lung(278;0.172)|Lung NSC(278;0.207)				Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCTGACTCCAGACTGGAGATC	0.602																																																	0								ENSG00000161509						28.0	26.0	27.0					17																	72838591		2203	4300	6503	GRIN2C	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32724.1, CCDS62330.1	17q25.1	2012-08-29			ENSG00000161509	ENSG00000161509		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4587	protein-coding gene	gene with protein product		138254		NMDAR2C		9480759	Standard	NM_001278553		Approved	GluN2C	uc002jlt.1	Q14957	OTTHUMG00000044524	ENST00000293190.5:c.3685C>T	17.37:g.72838591G>A		Somatic	0	88	0.00		0.5720907680579784	9	10.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	31	44.64	B2RTT1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,pfam_NMDAR2_C,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.L1229	ENST00000293190.5	37	c.3685	CCDS32724.1	17																																																																																			-	NULL		0.602	GRIN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2C	protein_coding	OTTHUMT00000103824.1	G		-		72838591	-1	no_errors	ENST00000293190	ensembl	human	known	74_37	silent	SNP	0.998	A
USP6NL	9712	genome.wustl.edu	37	10	11505780	11505780	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr10:11505780G>T	ENST00000609104.1	-	15	1541	c.1147C>A	c.(1147-1149)Cat>Aat	p.H383N	USP6NL_ENST00000277575.5_Missense_Mutation_p.H400N|USP6NL_ENST00000379237.2_Missense_Mutation_p.H406N	NM_014688.2	NP_055503.1	Q92738	US6NL_HUMAN	USP6 N-terminal like	383					Golgi organization (GO:0007030)|plasma membrane to endosome transport (GO:0048227)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of Golgi organization (GO:1903358)|retrograde transport, plasma membrane to Golgi (GO:0035526)|virion assembly (GO:0019068)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			endometrium(3)|kidney(2)|large_intestine(6)|lung(18)|prostate(1)|skin(1)|urinary_tract(1)	32						CTCAAGTGATGGACGCCCCAA	0.592																																																	0								ENSG00000148429						28.0	31.0	30.0					10																	11505780		1924	4110	6034	USP6NL	SO:0001583	missense	0			-	HGNC	BC010351	CCDS44357.1, CCDS53492.1	10p13	2013-07-09			ENSG00000148429	ENSG00000148429			16858	protein-coding gene	gene with protein product	"""related to the N terminus of tre"""	605405	"""USP6NL intronic transcript 1 (non-protein coding)"""	USP6NL-IT1		8700515, 8700527, 12399475	Standard	XR_247492		Approved	RNTRE, KIAA0019, TRE2NL, RN-tre	uc001iks.1	Q92738	OTTHUMG00000017672	ENST00000609104.1:c.1147C>A	10.37:g.11505780G>T	ENSP00000476462:p.His383Asn	Somatic	0	78	0.00		0.5720907680579784	11	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A8KA79|Q15400|Q5VV10|Q7L0K9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.H406N	ENST00000609104.1	37	c.1216	CCDS53492.1	10	.	.	.	.	.	.	.	.	.	.	G	2.090	-0.408708	0.04799	.	.	ENSG00000148429	ENST00000535316;ENST00000277575;ENST00000379237	T;T	0.03358	3.96;3.96	5.38	-2.14	0.07123	.	0.542144	0.20128	N	0.098654	T	0.00815	0.0027	N	0.00237	-1.79	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46133	-0.9213	10	0.02654	T	1	.	10.3781	0.44094	0.1092:0.0:0.4826:0.4082	.	383;400	Q92738;Q92738-2	US6NL_HUMAN;.	N	383;400;383	ENSP00000277575:H400N;ENSP00000368539:H383N	ENSP00000277575:H400N	H	-	1	0	USP6NL	11545786	0.000000	0.05858	0.001000	0.08648	0.119000	0.20118	0.096000	0.15147	-0.249000	0.09569	-0.467000	0.05162	CAT	-	NULL		0.592	USP6NL-001	KNOWN	basic|CCDS	protein_coding	USP6NL	protein_coding	OTTHUMT00000046764.3	G	NM_014688	-		11505780	-1	no_errors	ENST00000379237	ensembl	human	known	74_37	missense	SNP	0.133	T
WDR24	84219	genome.wustl.edu	37	16	739189	739189	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr16:739189C>A	ENST00000248142.6	-	3	637	c.638G>T	c.(637-639)cGc>cTc	p.R213L	WDR24_ENST00000293883.4_Missense_Mutation_p.R151L|LA16c-313D11.12_ENST00000566927.1_RNA			Q96S15	WDR24_HUMAN	WD repeat domain 24	213										breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(3)	19		Hepatocellular(780;0.0218)				GTCCTTTCTGCGGAGGTCAAA	0.612																																																	0								ENSG00000127580						75.0	71.0	72.0					16																	739189		2200	4300	6500	WDR24	SO:0001583	missense	0			-	HGNC	AL136863	CCDS10420.1	16p13.3	2013-01-09			ENSG00000127580	ENSG00000127580		"""WD repeat domain containing"""	20852	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 21"""	C16orf21		11230166	Standard	NM_032259		Approved	DKFZp434F054, JFP7	uc002ciz.1	Q96S15	OTTHUMG00000090421	ENST00000248142.6:c.638G>T	16.37:g.739189C>A	ENSP00000248142:p.Arg213Leu	Somatic	0	54	0.00		0.5720907680579784	25	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	A2IDB8|D3DU59|Q96GC7|Q9H0B7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R213L	ENST00000248142.6	37	c.638		16	.	.	.	.	.	.	.	.	.	.	c	20.3	3.959586	0.74016	.	.	ENSG00000127580	ENST00000248142;ENST00000293883	T;T	0.33216	1.42;1.42	5.14	5.14	0.70334	.	0.117336	0.64402	D	0.000012	T	0.64940	0.2644	M	0.92169	3.28	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.70128	-0.4957	10	0.33141	T	0.24	-13.9453	17.5824	0.87972	0.0:1.0:0.0:0.0	.	151	Q96S15-2	.	L	213;151	ENSP00000248142:R213L;ENSP00000293883:R151L	ENSP00000248142:R213L	R	-	2	0	WDR24	679190	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.218000	0.77991	2.391000	0.81399	0.561000	0.74099	CGC	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.612	WDR24-201	KNOWN	basic	protein_coding	WDR24	protein_coding		C	NM_032259	-		739189	-1	no_errors	ENST00000248142	ensembl	human	known	74_37	missense	SNP	1.000	A
GLUL	2752	genome.wustl.edu	37	1	182354511	182354511	+	Missense_Mutation	SNP	G	G	A	rs532199483	byFrequency	TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr1:182354511G>A	ENST00000331872.6	-	6	1324	c.784C>T	c.(784-786)Cgg>Tgg	p.R262W	GLUL_ENST00000311223.5_Missense_Mutation_p.R262W|GLUL_ENST00000339526.4_Missense_Mutation_p.R262W|GLUL_ENST00000491322.1_5'UTR|GLUL_ENST00000417584.2_Missense_Mutation_p.R262W	NM_001033044.2	NP_001028216.1	P15104	GLNA_HUMAN	glutamate-ammonia ligase	262					cell proliferation (GO:0008283)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to starvation (GO:0009267)|glutamate catabolic process (GO:0006538)|glutamine biosynthetic process (GO:0006542)|neurotransmitter uptake (GO:0001504)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of insulin secretion (GO:0032024)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein homooligomerization (GO:0051260)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glial cell projection (GO:0097386)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|glutamate-ammonia ligase activity (GO:0004356)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			endometrium(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	16					Ceftriaxone(DB01212)|Diazoxide(DB01119)|L-Glutamine(DB00130)|L-Methionine(DB00134)|Pegvisomant(DB00082)	TTCTCCTCCCGCATGGCCTTG	0.502																																																	0								ENSG00000135821						55.0	52.0	53.0					1																	182354511		2203	4300	6503	GLUL	SO:0001583	missense	0			-	HGNC	AL161952	CCDS1344.1	1q31	2010-05-04	2010-05-04		ENSG00000135821	ENSG00000135821	6.3.1.2		4341	protein-coding gene	gene with protein product	"""glutamine synthetase"""	138290	"""glutamate-ammonia ligase (glutamine synthase)"""	GLNS		1681907, 2888076	Standard	NM_002065		Approved		uc001gpa.2	P15104	OTTHUMG00000037407	ENST00000331872.6:c.784C>T	1.37:g.182354511G>A	ENSP00000356537:p.Arg262Trp	Somatic	0	39	0.00		0.5720907680579784	1936	0.15	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	Q499Y9|Q5T9Z1|Q7Z3W4|Q8IZ17	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Gln_synth_cat_dom,pfam_Gln_synt_beta,superfamily_Gln_synt_beta	p.R262W	ENST00000331872.6	37	c.784	CCDS1344.1	1	.	.	.	.	.	.	.	.	.	.	G	16.37	3.104507	0.56291	.	.	ENSG00000135821	ENST00000331872;ENST00000311223;ENST00000417584;ENST00000339526	D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17	5.44	2.23	0.28157	Glutamine synthetase, catalytic domain (1);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91476	0.7309	H	0.96604	3.85	0.80722	D	1	P	0.38800	0.648	B	0.40506	0.331	D	0.92129	0.5710	10	0.87932	D	0	-8.2927	12.5786	0.56378	0.0:0.0:0.335:0.665	.	262	P15104	GLNA_HUMAN	W	262	ENSP00000356537:R262W;ENSP00000307900:R262W;ENSP00000398320:R262W;ENSP00000344958:R262W	ENSP00000307900:R262W	R	-	1	2	GLUL	180621134	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.984000	0.29565	0.652000	0.30806	-0.127000	0.14921	CGG	-	pfam_Gln_synth_cat_dom		0.502	GLUL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUL	protein_coding	OTTHUMT00000091043.1	G	NM_002065	-		182354511	-1	no_errors	ENST00000311223	ensembl	human	known	74_37	missense	SNP	1.000	A
CYP4F11	57834	genome.wustl.edu	37	19	16034882	16034882	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr19:16034882C>A	ENST00000402119.4	-	6	1084	c.658G>T	c.(658-660)Gaa>Taa	p.E220*	CYP4F11_ENST00000326742.8_Nonsense_Mutation_p.E220*|CYP4F11_ENST00000248041.8_Nonsense_Mutation_p.E220*|CYP4F11_ENST00000591841.1_5'UTR	NM_021187.3	NP_067010.3			cytochrome P450, family 4, subfamily F, polypeptide 11											NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						GCAATATATTCACTGGGCTTC	0.473																																																	0								ENSG00000171903						84.0	82.0	83.0					19																	16034882		2203	4300	6503	CYP4F11	SO:0001587	stop_gained	0			-	HGNC	AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903		"""Cytochrome P450s"""	13265	protein-coding gene	gene with protein product		611517	"""cytochrome P450, subfamily IVF, polypeptide 11"""			10964514, 9068972	Standard	NM_021187		Approved		uc002nbu.2	Q9HBI6		ENST00000402119.4:c.658G>T	19.37:g.16034882C>A	ENSP00000384588:p.Glu220*	Somatic	0	52	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	29	9.38		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.E220*	ENST00000402119.4	37	c.658	CCDS12337.1	19	.	.	.	.	.	.	.	.	.	.	c	15.18	2.757853	0.49468	.	.	ENSG00000171903	ENST00000402119;ENST00000248041;ENST00000326742	.	.	.	2.52	-2.04	0.07343	.	0.652316	0.12737	U	0.443324	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	2.5673	0.04786	0.1791:0.5159:0.1771:0.1279	.	.	.	.	X	220	.	ENSP00000248041:E220X	E	-	1	0	CYP4F11	15895882	0.026000	0.19158	0.306000	0.25113	0.083000	0.17756	0.519000	0.22862	-0.039000	0.13602	-0.680000	0.03767	GAA	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.473	CYP4F11-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYP4F11	protein_coding	OTTHUMT00000460385.2	C	NM_021187	-		16034882	-1	no_errors	ENST00000248041	ensembl	human	known	74_37	nonsense	SNP	0.547	A
CCDC30	728621	genome.wustl.edu	37	1	43108234	43108234	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr1:43108234C>G	ENST00000340612.4	+	11	1729	c.1729C>G	c.(1729-1731)Cag>Gag	p.Q577E	CCDC30_ENST00000342022.4_Missense_Mutation_p.Q577E|CCDC30_ENST00000428554.2_Missense_Mutation_p.Q577E|CCDC30_ENST00000507855.1_Missense_Mutation_p.Q366E|CCDC30_ENST00000390640.4_Missense_Mutation_p.Q366E			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30	577						extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						AGAGCAAGAACAGTTGATCCA	0.468																																																	0								ENSG00000186409						171.0	166.0	168.0					1																	43108234		2203	4300	6503	CCDC30	SO:0001583	missense	0			-	HGNC	AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000340612.4:c.1729C>G	1.37:g.43108234C>G	ENSP00000340378:p.Gln577Glu	Somatic	0	66	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	62	19.48	Q14F06|Q5VVM5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q577E	ENST00000340612.4	37	c.1729	CCDS30690.1	1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.206028	0.00292	.	.	ENSG00000186409	ENST00000428554;ENST00000507855;ENST00000340612;ENST00000342022;ENST00000390640	T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1	5.62	0.453	0.16639	.	0.272836	0.39687	N	0.001288	T	0.10680	0.0261	N	0.01874	-0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.26360	-1.0105	10	0.02654	T	1	.	2.5241	0.04687	0.1586:0.2869:0.4176:0.1369	.	577;366	Q5VVM6;Q5VVM6-2	CCD30_HUMAN;.	E	577;366;577;577;366	ENSP00000397035:Q577E;ENSP00000426711:Q366E;ENSP00000340378:Q577E;ENSP00000339280:Q577E;ENSP00000375051:Q366E	ENSP00000340378:Q577E	Q	+	1	0	CCDC30	42880821	0.038000	0.19896	0.002000	0.10522	0.223000	0.24884	0.995000	0.29706	-0.154000	0.11118	-0.165000	0.13383	CAG	-	NULL		0.468	CCDC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC30	protein_coding	OTTHUMT00000019524.3	C	NM_025030	-		43108234	+1	no_errors	ENST00000340612	ensembl	human	known	74_37	missense	SNP	0.036	G
CD5L	922	genome.wustl.edu	37	1	157805788	157805788	+	Silent	SNP	G	G	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr1:157805788G>A	ENST00000368174.4	-	3	309	c.213C>T	c.(211-213)agC>agT	p.S71S	CD5L_ENST00000484609.1_5'UTR	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	71	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TAGGGGTTCCGCTGGCAGCTC	0.542																																																	0								ENSG00000073754						162.0	168.0	166.0					1																	157805788		2203	4300	6503	CD5L	SO:0001819	synonymous_variant	0			-	HGNC	U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.213C>T	1.37:g.157805788G>A		Somatic	0	33	0.00		0.5720907680579784	62	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	17	32.00	A8K7M5|Q6UX63	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.S71	ENST00000368174.4	37	c.213	CCDS1171.1	1																																																																																			-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR		0.542	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD5L	protein_coding	OTTHUMT00000058346.1	G	NM_005894	-		157805788	-1	no_errors	ENST00000368174	ensembl	human	known	74_37	silent	SNP	0.000	A
SNX18	112574	genome.wustl.edu	37	5	53815309	53815309	+	Silent	SNP	G	G	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr5:53815309G>A	ENST00000326277.3	+	1	1717	c.1527G>A	c.(1525-1527)gaG>gaA	p.E509E	SNX18_ENST00000343017.6_Silent_p.E509E|SNX18_ENST00000381410.4_Silent_p.E509E	NM_052870.2	NP_443102.2	Q96RF0	SNX18_HUMAN	sorting nexin 18	509	BAR.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				TCTTCGCGGAGCAGCCCAGGC	0.587																																																	0								ENSG00000178996						86.0	83.0	84.0					5																	53815309		2203	4300	6503	SNX18	SO:0001819	synonymous_variant	0			-	HGNC	AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000326277.3:c.1527G>A	5.37:g.53815309G>A		Somatic	0	43	0.00		0.5720907680579784	92	1.08	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	B4E2B3|H7BXX3|Q05BB3|Q0VG02	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sorting_nexin_WASP-bd-dom,pfam_Phox,pfam_SH3_domain,pfam_SH3_2,superfamily_Phox,superfamily_SH3_domain,smart_SH3_domain,smart_Phox,pirsf_Snx9,pfscan_Phox,pfscan_SH3_domain	p.E509	ENST00000326277.3	37	c.1527	CCDS3962.1	5																																																																																			-	pfam_Sorting_nexin_WASP-bd-dom,pirsf_Snx9		0.587	SNX18-001	KNOWN	basic|CCDS	protein_coding	SNX18	protein_coding	OTTHUMT00000214072.2	G		-		53815309	+1	no_errors	ENST00000326277	ensembl	human	known	74_37	silent	SNP	1.000	A
IDO1	3620	genome.wustl.edu	37	8	39771493	39771493	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr8:39771493G>T	ENST00000518237.1	+	1	691	c.52G>T	c.(52-54)Gat>Tat	p.D18Y	IDO1_ENST00000522495.1_Missense_Mutation_p.D18Y|RP11-44K6.3_ENST00000517623.1_RNA|RP11-44K6.2_ENST00000520185.1_RNA	NM_002164.5	NP_002155.1	P14902	I23O1_HUMAN	indoleamine 2,3-dioxygenase 1	18					cellular nitrogen compound metabolic process (GO:0034641)|cytokine production involved in inflammatory response (GO:0002534)|female pregnancy (GO:0007565)|kynurenic acid biosynthetic process (GO:0034276)|multicellular organismal response to stress (GO:0033555)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chronic inflammatory response (GO:0002678)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of type 2 immune response (GO:0002830)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)|swimming behavior (GO:0036269)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytosol (GO:0005829)|smooth muscle contractile fiber (GO:0030485)|stereocilium bundle (GO:0032421)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(2)	12					L-Tryptophan(DB00150)|Melatonin(DB01065)	GTACCATATTGATGAAGAAGT	0.448																																																	0								ENSG00000131203						83.0	83.0	83.0					8																	39771493		1924	4135	6059	IDO1	SO:0001583	missense	0			-	HGNC	M34455	CCDS47847.1	8p12-p11	2009-01-07	2009-01-07	2009-01-07		ENSG00000131203	1.13.11.52		6059	protein-coding gene	gene with protein product		147435	"""indoleamine-pyrrole 2,3 dioxygenase"""	IDO, INDO		2109605, 8404046	Standard	NM_002164		Approved		uc003xnm.3	P14902		ENST00000518237.1:c.52G>T	8.37:g.39771493G>T	ENSP00000430950:p.Asp18Tyr	Somatic	0	69	0.00		0.5720907680579784	118	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q540B4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Indolamine_dOase	p.D18Y	ENST00000518237.1	37	c.52	CCDS47847.1	8	.	.	.	.	.	.	.	.	.	.	G	11.60	1.686675	0.29962	.	.	ENSG00000131203	ENST00000518804;ENST00000519154;ENST00000522495;ENST00000522840;ENST00000518237	T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79	5.66	1.17	0.20885	.	0.358411	0.24267	N	0.040040	T	0.54532	0.1864	M	0.71871	2.18	0.27060	N	0.963574	D	0.62365	0.991	P	0.62382	0.901	T	0.47142	-0.9140	9	.	.	.	-18.2688	1.5071	0.02489	0.1792:0.1443:0.4674:0.2091	.	18	P14902	I23O1_HUMAN	Y	18	ENSP00000429297:D18Y;ENSP00000428716:D18Y;ENSP00000430505:D18Y;ENSP00000429933:D18Y;ENSP00000430950:D18Y	.	D	+	1	0	IDO1	39890650	0.999000	0.42202	0.853000	0.33588	0.035000	0.12851	0.766000	0.26560	0.407000	0.25591	-0.291000	0.09656	GAT	-	pfam_Indolamine_dOase		0.448	IDO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDO1	protein_coding	OTTHUMT00000376987.1	G	NM_002164	-		39771493	+1	no_errors	ENST00000518237	ensembl	human	known	74_37	missense	SNP	0.504	T
SLC6A11	6538	genome.wustl.edu	37	3	10916711	10916711	+	Silent	SNP	G	G	A	rs144481019		TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chr3:10916711G>A	ENST00000254488.2	+	6	888	c.822G>A	c.(820-822)acG>acA	p.T274T		NM_014229.1	NP_055044.1	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 11	274					brain development (GO:0007420)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter binding (GO:0042165)|neurotransmitter:sodium symporter activity (GO:0005328)	p.T274T(2)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(13)|ovary(1)|skin(4)	35				OV - Ovarian serous cystadenocarcinoma(96;0.229)	Clobazam(DB00349)	GAGGGGTCACGTTGCCCGGGG	0.557																																																	2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)						ENSG00000132164	G		0,4406		0,0,2203	212.0	188.0	196.0		822	-3.5	0.7	3	dbSNP_134	196	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	SLC6A11	NM_014229.1		0,4,6499	AA,AG,GG		0.0465,0.0,0.0308		274/633	10916711	4,13002	2203	4300	6503	SLC6A11	SO:0001819	synonymous_variant	0			-	HGNC	S75989	CCDS2602.1	3p25.3	2013-07-19	2013-07-19		ENSG00000132164	ENSG00000132164		"""Solute carriers"""	11044	protein-coding gene	gene with protein product	"""GABA transporter 3"""	607952	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 11"""			7874447	Standard	NM_014229		Approved	GAT3	uc003bvz.3	P48066	OTTHUMG00000129718	ENST00000254488.2:c.822G>A	3.37:g.10916711G>A		Somatic	0	73	0.00		0.5720907680579784	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	31	32.61	B2R6U6|Q8IYC9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/ntran_symport,superfamily_S-AdoMet_deCO2ase_core,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_GABA_GAT3	p.T274	ENST00000254488.2	37	c.822	CCDS2602.1	3																																																																																			-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.557	SLC6A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A11	protein_coding	OTTHUMT00000251927.1	G	NM_014229	rs144481019		10916711	+1	no_errors	ENST00000254488	ensembl	human	known	74_37	silent	SNP	0.096	A
GABRQ	55879	genome.wustl.edu	37	X	151815504	151815504	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YU-01A-12D-A33E-09	TCGA-DX-A6YU-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ace05a35-d1b2-4aa7-9c34-05b79d14a493	da7c4573-b81f-450f-9aeb-48c58a975706	g.chrX:151815504G>A	ENST00000370306.2	+	4	422	c.402G>A	c.(400-402)atG>atA	p.M134I		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	134					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ACTATCGGATGCATGAGAAGT	0.483																																																	0								ENSG00000147402						304.0	211.0	242.0					X																	151815504		2203	4300	6503	GABRQ	SO:0001583	missense	0			-	HGNC	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.402G>A	X.37:g.151815504G>A	ENSP00000359329:p.Met134Ile	Somatic	0	90	0.00		0.5720907680579784	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	41	31.67	A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAt_rcpt,prints_GABAA_rcpt,prints_Neur_channel,prints_GABAAb_rcpt,prints_GABAAa_rcpt,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.M134I	ENST00000370306.2	37	c.402	CCDS14707.1	X	.	.	.	.	.	.	.	.	.	.	G	10.36	1.329244	0.24167	.	.	ENSG00000147402	ENST00000370306	T	0.77098	-1.07	5.42	3.59	0.41128	Neurotransmitter-gated ion-channel ligand-binding (3);	0.467652	0.18599	N	0.136516	T	0.69024	0.3065	L	0.34521	1.04	0.22066	N	0.999384	P	0.34462	0.454	B	0.34931	0.192	T	0.60667	-0.7218	10	0.87932	D	0	.	12.7988	0.57573	0.0:0.3064:0.6936:0.0	.	134	Q9UN88	GBRT_HUMAN	I	134	ENSP00000359329:M134I	ENSP00000359329:M134I	M	+	3	0	GABRQ	151566160	1.000000	0.71417	0.002000	0.10522	0.211000	0.24417	1.332000	0.33805	0.433000	0.26313	0.544000	0.68410	ATG	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.483	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRQ	protein_coding	OTTHUMT00000058763.2	G	NM_018558	-		151815504	+1	no_errors	ENST00000370306	ensembl	human	known	74_37	missense	SNP	0.425	A
