#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SLC25A19	60386	genome.wustl.edu	37	17	73269841	73269842	+	Intron	INS	-	-	TTATT	rs3082641|rs35986946|rs55758835	byFrequency	TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr17:73269841_73269842insTTATT	ENST00000402418.3	-	6	1684				MIF4GD_ENST00000325102.8_5'Flank|MIF4GD_ENST00000579297.1_5'Flank|RP11-649A18.12_ENST00000585075.1_RNA|MIF4GD_ENST00000577542.1_5'Flank|SLC25A19_ENST00000416858.2_Intron|MIF4GD_ENST00000245551.5_5'Flank|SLC25A19_ENST00000320362.3_Intron|SLC25A19_ENST00000442286.2_Intron|SLC25A19_ENST00000580994.1_Intron|SLC25A19_ENST00000375261.4_Intron|RP11-649A18.12_ENST00000582668.1_RNA|MIF4GD_ENST00000578305.1_5'Flank|MIF4GD_ENST00000580571.1_5'Flank			Q9HC21	TPC_HUMAN	solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19						deoxynucleotide transport (GO:0030302)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	deoxynucleotide transmembrane transporter activity (GO:0030233)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_cancers(13;5.98e-08)|all_epithelial(9;1.16e-08)|Breast(9;3.1e-08)		all cancers(21;6.82e-07)|Epithelial(20;6.86e-06)			AAAATAGCAAAttattttattt	0.465														4192	0.837061	0.7103	0.879	5008	,	,		24978	0.9256		0.7992	False		,,,				2504	0.9264																0								ENSG00000263843																																			RP11-649A18.12	SO:0001627	intron_variant	0				Clone_based_vega_gene		CCDS11720.1	17q25.1	2013-05-22	2007-03-08		ENSG00000125454	ENSG00000125454		"""Solute carriers"""	14409	protein-coding gene	gene with protein product		606521	"""solute carrier family 25 (mitochondrial deoxynucleotide carrier), member 19"", ""microcephaly, Amish"""	MCPHA		11474176, 11226231, 19798730	Standard	NM_021734		Approved	DNC, MUP1, TPC	uc002jnw.4	Q9HC21		ENST00000402418.3:c.775-121->AATAA	17.37:g.73269847_73269851dupTTATT		Somatic	NA	NA	NA		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	E9PF74|Q6V9R7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000402418.3	37	NULL	CCDS11720.1	17																																																																																			-	-		0.465	SLC25A19-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC100287042	protein_coding	OTTHUMT00000447282.1	-	NM_021734			73269842	+1	no_errors	ENST00000585075	ensembl	human	known	74_37	rna	INS	0.003:0.004	TTATT
DCAF10	79269	genome.wustl.edu	37	9	37860098	37860098	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr9:37860098A>T	ENST00000377724.3	+	6	1584	c.1219A>T	c.(1219-1221)Agt>Tgt	p.S407C	RP11-613M10.9_ENST00000540557.1_Intron|DCAF10_ENST00000483167.1_3'UTR|DCAF10_ENST00000242323.7_Missense_Mutation_p.S370C	NM_024345.3	NP_077321.3	Q5QP82	DCA10_HUMAN	DDB1 and CUL4 associated factor 10	407					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	12						TCTTGGTGAGAGTGACCACGG	0.463																																																	0								ENSG00000122741						135.0	113.0	121.0					9																	37860098		2203	4300	6503	DCAF10	SO:0001583	missense	0			-	HGNC	BC003520	CCDS6613.2, CCDS75835.1	9p13.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000122741	ENSG00000122741		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	23686	protein-coding gene	gene with protein product			"""WD repeat domain 32"""	WDR32			Standard	NM_001286810		Approved	MGC10765, FLJ23201	uc004aao.3	Q5QP82	OTTHUMG00000019934	ENST00000377724.3:c.1219A>T	9.37:g.37860098A>T	ENSP00000366953:p.Ser407Cys	Somatic	0	44	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	11	67.65	A4VCJ5|Q32NE2|Q8N2Q5|Q96ET5|Q9BTQ5|Q9H5P6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S407C	ENST00000377724.3	37	c.1219	CCDS6613.2	9	.	.	.	.	.	.	.	.	.	.	A	17.76	3.468965	0.63625	.	.	ENSG00000122741	ENST00000377724;ENST00000242323	T;T	0.73789	-0.4;-0.78	5.9	1.97	0.26223	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.043136	0.85682	D	0.000000	T	0.55909	0.1950	N	0.08118	0	0.24955	N	0.991765	B;B	0.32425	0.03;0.371	B;B	0.35971	0.008;0.215	T	0.55075	-0.8197	10	0.66056	D	0.02	.	12.1536	0.54064	0.5338:0.4661:0.0:0.0	.	370;407	Q5QP82-2;Q5QP82	.;DCA10_HUMAN	C	407;370	ENSP00000366953:S407C;ENSP00000242323:S370C	ENSP00000242323:S370C	S	+	1	0	DCAF10	37850098	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.044000	0.49830	0.448000	0.26722	0.533000	0.62120	AGT	-	superfamily_WD40_repeat_dom		0.463	DCAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF10	protein_coding	OTTHUMT00000052485.2	A	NM_024345	-		37860098	+1	no_errors	ENST00000377724	ensembl	human	known	74_37	missense	SNP	1.000	T
TPTEP1	387590	genome.wustl.edu	37	22	17178547	17178547	+	IGR	SNP	G	G	A	rs543869229		TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr22:17178547G>A								KB-7G2.8 (3009 upstream) : AC005301.8 (49211 downstream)																							CGGGACATCCGTTGGGGCTCC	0.582																																																	0								ENSG00000100181																																			TPTEP1	SO:0001628	intergenic_variant	0			-	HGNC																													22.37:g.17178547G>A		Somatic	0	63	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	37	17.78		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		22																																																																																			-	-	0	0.582					TPTEP1			G		-		17178547	+1	no_errors	ENST00000558085	ensembl	human	known	74_37	rna	SNP	0.098	A
VPS4A	27183	genome.wustl.edu	37	16	69354619	69354619	+	Silent	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr16:69354619G>A	ENST00000254950.11	+	8	954	c.798G>A	c.(796-798)ctG>ctA	p.L266L	COG8_ENST00000564419.1_5'UTR	NM_013245.2	NP_037377.1			vacuolar protein sorting 4 homolog A (S. cerevisiae)											NS(1)|central_nervous_system(1)|large_intestine(2)|lung(3)	7		Ovarian(137;0.101)				ATGGGACTCTGGTTCTTGGAG	0.567																																																	0								ENSG00000132612						35.0	39.0	38.0					16																	69354619		1981	4162	6143	VPS4A	SO:0001819	synonymous_variant	0			-	HGNC	AF112215	CCDS45517.1	16q23.1	2010-04-21	2006-04-04		ENSG00000132612	ENSG00000132612		"""ATPases / AAA-type"""	13488	protein-coding gene	gene with protein product		609982	"""vacuolar protein sorting 4A (yeast homolog)"", ""vacuolar protein sorting 4A (yeast)"""			10637304, 11563910	Standard	NM_013245		Approved	VPS4, VPS4-1, FLJ22197, SKD2, SKD1, SKD1A	uc002eww.3	Q9UN37		ENST00000254950.11:c.798G>A	16.37:g.69354619G>A		Somatic	0	32	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	1	93.33		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_MIT,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_MIT,smart_AAA+_ATPase	p.L266	ENST00000254950.11	37	c.798	CCDS45517.1	16																																																																																			-	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.567	VPS4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS4A	protein_coding	OTTHUMT00000430563.3	G	NM_013245	-		69354619	+1	no_errors	ENST00000254950	ensembl	human	known	74_37	silent	SNP	1.000	A
KIAA0319L	79932	genome.wustl.edu	37	1	35917355	35917355	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr1:35917355C>T	ENST00000325722.3	-	13	2170	c.1936G>A	c.(1936-1938)Gag>Aag	p.E646K	KIAA0319L_ENST00000485551.1_5'UTR|KIAA0319L_ENST00000373266.4_Missense_Mutation_p.E83K	NM_024874.4	NP_079150.3	Q8IZA0	K319L_HUMAN	KIAA0319-like	646	PKD 4. {ECO:0000255|PROSITE- ProRule:PRU00151}.					cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(12)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	34		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTAGCATTCTCGAGCTGCACC	0.507											OREG0013354	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000142687						128.0	123.0	125.0					1																	35917355		2203	4300	6503	KIAA0319L	SO:0001583	missense	0			-	HGNC	AY163234	CCDS390.1	1p34.3	2008-10-24			ENSG00000142687	ENSG00000142687			30071	protein-coding gene	gene with protein product		613535				11347906	Standard	NM_024874		Approved	KIAA1837	uc001byx.3	Q8IZA0	OTTHUMG00000004370	ENST00000325722.3:c.1936G>A	1.37:g.35917355C>T	ENSP00000318406:p.Glu646Lys	Somatic	0	65	0.00	859	0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	68	10.53	B1AN13|D3DPR8|O95010|Q6PJJ7|Q7L1C9|Q8N2B3|Q8NDA0|Q8WY39|Q8WYZ5|Q96IC3|Q96JJ0|Q9BUW6|Q9H7V0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.E646K	ENST00000325722.3	37	c.1936	CCDS390.1	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.976877	0.74360	.	.	ENSG00000142687	ENST00000325722;ENST00000373266;ENST00000426982;ENST00000440579	T;T;T;T	0.70986	3.18;-0.39;3.18;-0.53	5.98	3.89	0.44902	PKD/Chitinase domain (1);Fibronectin, type III (1);PKD/REJ-like protein (1);PKD domain (1);	0.211885	0.50627	N	0.000111	T	0.56108	0.1963	L	0.27053	0.805	0.80722	D	1	D;P;P	0.58268	0.982;0.716;0.865	P;B;B	0.44518	0.452;0.06;0.294	T	0.50550	-0.8815	10	0.30854	T	0.27	-9.6201	8.0297	0.30457	0.0:0.7285:0.0:0.2715	.	646;646;88	Q8IZA0-2;Q8IZA0;Q8IZA0-3	.;K319L_HUMAN;.	K	646;83;646;646	ENSP00000318406:E646K;ENSP00000362363:E83K;ENSP00000395883:E646K;ENSP00000407576:E646K	ENSP00000318406:E646K	E	-	1	0	KIAA0319L	35689942	0.994000	0.37717	0.619000	0.29118	0.981000	0.71138	3.156000	0.50708	0.672000	0.31204	0.650000	0.86243	GAG	-	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_PKD/Chitinase_dom		0.507	KIAA0319L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319L	protein_coding	OTTHUMT00000012684.2	C	NM_024874	-		35917355	-1	no_errors	ENST00000325722	ensembl	human	known	74_37	missense	SNP	0.971	T
SHC4	399694	genome.wustl.edu	37	15	49170547	49170552	+	Intron	DEL	GGAGGA	GGAGGA	-			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	GGAGGA	GGAGGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr15:49170547_49170552delGGAGGA	ENST00000332408.4	-	4	1269				EID1_ENST00000560490.1_In_Frame_Del_p.EE39del|SHC4_ENST00000537958.1_5'Flank|EID1_ENST00000530028.2_In_Frame_Del_p.EE61del|SHC4_ENST00000396535.3_5'Flank|EID1_ENST00000558295.1_Intron	NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4						apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		AAGGCCCAATGGAGGAGGAGGAGGCC	0.694																																																	0								ENSG00000255302																																			EID1	SO:0001627	intron_variant	0				HGNC	AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.840+5892TCCTCC>-	15.37:g.49170553_49170558delGGAGGA		Somatic	NA	NA	NA		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6UXQ3|Q8IYW3	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.EE61in_frame_del	ENST00000332408.4	37	c.174_179	CCDS10130.1	15																																																																																			-	NULL		0.694	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EID1	protein_coding	OTTHUMT00000254371.1	GGAGGA	NM_203349			49170552	+1	no_errors	ENST00000530028	ensembl	human	known	74_37	in_frame_del	DEL	0.957:0.993:0.998:1.000:1.000:1.000	-
NOP56	10528	genome.wustl.edu	37	20	2633378	2633379	+	Intron	INS	-	-	GAGCCTGGGCCT	rs71328095|rs149713688	byFrequency	TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr20:2633378_2633379insGAGCCTGGGCCT	ENST00000329276.5	+	1	519				MIR1292_ENST00000408135.1_RNA|SNORA51_ENST00000606420.1_RNA|SNORD110_ENST00000408189.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein						cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						GGCCGCAGACAgggcctgggcc	0.748														1743	0.348043	0.2655	0.3329	5008	,	,		12117	0.4038		0.325	False		,,,				2504	0.4366																0								ENSG00000101361			2444,1274		918,608,333						-1.2	0.0		dbSNP_134	7	4565,2715		1533,1499,608	no	intron	NOP56	NM_006392.3		2451,2107,941	A1A1,A1R,RR		37.294,34.2657,36.2702				7009,3989				NOP56	SO:0001627	intron_variant	0				HGNC	Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.3+69->GAGCCTGGGCCT	20.37:g.2633378_2633379insGAGCCTGGGCCT		Somatic	NA	NA	NA		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q2M3T6|Q9NQ05	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000329276.5	37	NULL	CCDS13030.1	20																																																																																			-	-		0.748	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP56	protein_coding	OTTHUMT00000077631.2	-	NM_006392			2633379	+1	no_errors	ENST00000469588	ensembl	human	known	74_37	rna	INS	0.000:0.000	GAGCCTGGGCCT
DOCK2	1794	genome.wustl.edu	37	5	169504797	169504797	+	Silent	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr5:169504797C>T	ENST00000256935.8	+	48	5030	c.4950C>T	c.(4948-4950)tcC>tcT	p.S1650S	DOCK2_ENST00000520908.1_Silent_p.S1142S|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Silent_p.S711S	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1650					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTCTGGCTTCCATGAATTCTG	0.597																																																	0								ENSG00000134516						123.0	108.0	113.0					5																	169504797		2203	4300	6503	DOCK2	SO:0001819	synonymous_variant	0			-	HGNC	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4950C>T	5.37:g.169504797C>T		Somatic	0	29	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	13	31.58	Q2M3I0|Q96AK7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.S1650	ENST00000256935.8	37	c.4950	CCDS4371.1	5																																																																																			-	NULL		0.597	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	protein_coding	OTTHUMT00000252828.2	C	NM_004946	-		169504797	+1	no_errors	ENST00000256935	ensembl	human	known	74_37	silent	SNP	0.999	T
DGKD	8527	genome.wustl.edu	37	2	234343069	234343069	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr2:234343069G>T	ENST00000264057.2	+	4	404	c.392G>T	c.(391-393)aGa>aTa	p.R131I	DGKD_ENST00000409813.3_Missense_Mutation_p.R87I	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	131	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	GCTGATAACAGAAAAGAAATG	0.408																																																	0								ENSG00000077044						163.0	163.0	163.0					2																	234343069		2203	4300	6503	DGKD	SO:0001583	missense	0			-	HGNC	D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.392G>T	2.37:g.234343069G>T	ENSP00000264057:p.Arg131Ile	Somatic	0	80	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_SAM_2,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SAM_type1,pfam_Pleckstrin_homology,superfamily_SAM/pointed,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_SAM,pfscan_Pleckstrin_homology,pfscan_SAM,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.R131I	ENST00000264057.2	37	c.392	CCDS2504.1	2	.	.	.	.	.	.	.	.	.	.	G	28.4	4.917261	0.92249	.	.	ENSG00000077044	ENST00000264057;ENST00000427930;ENST00000447484;ENST00000409813	T;T;T;T	0.32515	1.45;1.45;1.45;1.45	4.89	4.89	0.63831	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.066582	0.64402	D	0.000018	T	0.54695	0.1874	M	0.64404	1.975	0.80722	D	1	D;D	0.76494	0.999;0.992	D;D	0.83275	0.996;0.961	T	0.54695	-0.8255	10	0.56958	D	0.05	.	18.6329	0.91366	0.0:0.0:1.0:0.0	.	87;131	Q16760-2;Q16760	.;DGKD_HUMAN	I	131;67;101;87	ENSP00000264057:R131I;ENSP00000407938:R67I;ENSP00000395530:R101I;ENSP00000386455:R87I	ENSP00000264057:R131I	R	+	2	0	DGKD	234007808	1.000000	0.71417	0.990000	0.47175	0.994000	0.84299	9.108000	0.94275	2.717000	0.92951	0.563000	0.77884	AGA	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.408	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKD	protein_coding	OTTHUMT00000257072.2	G	NM_003648	-		234343069	+1	no_errors	ENST00000264057	ensembl	human	known	74_37	missense	SNP	1.000	T
TSTD3	100130890	genome.wustl.edu	37	6	99968898	99968899	+	RNA	INS	-	-	GCGCC			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr6:99968898_99968899insGCGCC	ENST00000452647.2	+	0	330_331							H0UI37	TSTD3_HUMAN	thiosulfate sulfurtransferase (rhodanese)-like domain containing 3																		GCCGGAGCAGGAGGAGAAGGAG	0.683											OREG0017579	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000228439																																			TSTD3			0				HGNC			6q16.2	2012-07-04			ENSG00000228439	ENSG00000228439			40910	protein-coding gene	gene with protein product							Standard	NM_001195131		Approved		uc021zde.1	H0UI37	OTTHUMG00000015265		6.37:g.99968898_99968899insGCGCC		Somatic	NA	NA	NA	1347	0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000452647.2	37	NULL		6																																																																																			-	-		0.683	TSTD3-001	KNOWN	basic	antisense	TSTD3	antisense	OTTHUMT00000041605.2	-	NM_001195131			99968899	+1	no_errors	ENST00000452647	ensembl	human	known	74_37	rna	INS	0.000:0.000	GCGCC
MYADM	91663	genome.wustl.edu	37	19	54379103	54379104	+	3'UTR	INS	-	-	A	rs75956082|rs75209913|rs566590150|rs369211393		TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr19:54379103_54379104insA	ENST00000391769.2	+	0	2600_2601				MYADM_ENST00000391770.4_3'UTR|MYADM_ENST00000391771.1_3'UTR|AC008440.5_ENST00000413496.2_RNA|MYADM_ENST00000336967.3_3'UTR	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker						establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		gactccatctcaaaaaaaaaaa	0.5																																																	0								ENSG00000232220																																			AC008440.5	SO:0001624	3_prime_UTR_variant	0				Clone_based_vega_gene	AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.*1352->A	19.37:g.54379114_54379114dupA		Somatic	0	32	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000391769.2	37	NULL	CCDS12866.1	19																																																																																			-	-		0.500	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232220	protein_coding	OTTHUMT00000134337.1	-	NM_138373			54379104	-1	no_errors	ENST00000413496	ensembl	human	known	74_37	rna	INS	0.000:0.000	A
LHFPL1	340596	genome.wustl.edu	37	X	111914310	111914310	+	Silent	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chrX:111914310G>A	ENST00000371968.3	-	2	548	c.309C>T	c.(307-309)gtC>gtT	p.V103V	LHFPL1_ENST00000536453.1_Silent_p.V103V|LHFPL1_ENST00000478229.1_Intron	NM_178175.3	NP_835469.1	Q86WI0	LHPL1_HUMAN	lipoma HMGIC fusion partner-like 1	103						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)	13						AGCAACCCAGGACAGCAGCTA	0.577																																																	0								ENSG00000182508						82.0	64.0	70.0					X																	111914310		2203	4300	6503	LHFPL1	SO:0001819	synonymous_variant	0			-	HGNC	AY217350	CCDS14562.1	Xq23	2008-02-05			ENSG00000182508	ENSG00000182508			6587	protein-coding gene	gene with protein product		300566				10329012	Standard	NM_178175		Approved		uc004epq.3	Q86WI0	OTTHUMG00000022214	ENST00000371968.3:c.309C>T	X.37:g.111914310G>A		Somatic	0	21	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	26	29.73	A8K1N1|Q496M9|Q496N0|Q6UXU2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipome_HGMIC_fus_partner-like	p.V103	ENST00000371968.3	37	c.309	CCDS14562.1	X																																																																																			-	pfam_Lipome_HGMIC_fus_partner-like		0.577	LHFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHFPL1	protein_coding	OTTHUMT00000057947.1	G	NM_178175	-		111914310	-1	no_errors	ENST00000371968	ensembl	human	known	74_37	silent	SNP	1.000	A
ZNRF4	148066	genome.wustl.edu	37	19	5456439	5456439	+	Silent	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr19:5456439C>T	ENST00000222033.4	+	1	1014	c.937C>T	c.(937-939)Ctg>Ttg	p.L313L		NM_181710.3	NP_859061.3	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4	313						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			NS(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		TGCCATCTGCCTGGATGAGTA	0.627																																																	0								ENSG00000105428						88.0	100.0	96.0					19																	5456439		2133	4242	6375	ZNRF4	SO:0001819	synonymous_variant	0			-	HGNC	AK098722	CCDS42475.1	19p13.3	2013-01-09				ENSG00000105428		"""RING-type (C3HC4) zinc fingers"""	17726	protein-coding gene	gene with protein product		612063					Standard	NM_181710		Approved	spzn, Ssrzf1, RNF204	uc002mca.4	Q8WWF5		ENST00000222033.4:c.937C>T	19.37:g.5456439C>T		Somatic	0	21	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	A8K886|O75866	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.L313	ENST00000222033.4	37	c.937	CCDS42475.1	19																																																																																			-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING		0.627	ZNRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNRF4	protein_coding	OTTHUMT00000450924.1	C	NM_181710	-		5456439	+1	no_errors	ENST00000222033	ensembl	human	known	74_37	silent	SNP	0.994	T
ANTXRL	195977	genome.wustl.edu	37	10	47701296	47701296	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr10:47701296delC	ENST00000447511.2	+	17	2137	c.1872delC	c.(1870-1872)ctcfs	p.L624fs	ANTXRL_ENST00000537271.1_Frame_Shift_Del_p.S551fs	NM_001278688.1	NP_001265617.1	A6NF34	ANTRL_HUMAN	anthrax toxin receptor-like	624						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)										CTTTGTCACTCCCCCCGTCAG	0.567																																																	0								ENSG00000198250																																			ANTXRL	SO:0001589	frameshift_variant	0				HGNC		CCDS60524.1	10q11.22	2014-04-11			ENSG00000198250	ENSG00000274209			27277	protein-coding gene	gene with protein product							Standard	NM_001278688		Approved			A6NF34	OTTHUMG00000188318	ENST00000447511.2:c.1872delC	10.37:g.47701296delC	ENSP00000455449:p.Leu624fs	Somatic	0	22	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	H3BPS2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Anthrax_toxin_rcpt_extracel,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.R553fs	ENST00000447511.2	37	c.1652		10																																																																																			-	NULL		0.567	ANTXRL-002	NOVEL	not_organism_supported|basic|appris_candidate_longest	protein_coding	ANTXRL	protein_coding	OTTHUMT00000047862.2	C	XM_113625			47701296	+1	no_errors	ENST00000537271	ensembl	human	known	74_37	frame_shift_del	DEL	0.002	-
ZNF32	7580	genome.wustl.edu	37	10	44139630	44139630	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr10:44139630delC	ENST00000395797.1	-	3	878	c.690delG	c.(688-690)gggfs	p.G230fs	ZNF32-AS1_ENST00000453284.1_RNA|ZNF32-AS2_ENST00000418966.1_RNA|ZNF32_ENST00000485351.1_5'Flank|ZNF32-AS3_ENST00000458063.1_RNA|ZNF32_ENST00000374433.2_Frame_Shift_Del_p.G230fs	NM_001005368.1	NP_001005368.1	P17041	ZNF32_HUMAN	zinc finger protein 32	230					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(1)|pancreas(1)|urinary_tract(1)	14		all_neural(218;0.0182)|Ovarian(717;0.0443)|Renal(717;0.157)		Lung(62;0.179)		GAATACAATTCCCCCTGGTGT	0.522																																																	0								ENSG00000169740						97.0	95.0	96.0					10																	44139630		2203	4300	6503	ZNF32	SO:0001589	frameshift_variant	0				HGNC	U69645	CCDS7206.1	10q22-q25	2013-01-08	2006-05-11		ENSG00000169740	ENSG00000169740		"""Zinc fingers, C2H2-type"""	13095	protein-coding gene	gene with protein product		194539	"""zinc finger protein 32 (KOX 30)"""				Standard	XM_005271822		Approved	KOX30	uc001jbc.3	P17041	OTTHUMG00000018043	ENST00000395797.1:c.690delG	10.37:g.44139630delC	ENSP00000379143:p.Gly230fs	Somatic	0	36	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	Q92951	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N231fs	ENST00000395797.1	37	c.690	CCDS7206.1	10																																																																																			-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.522	ZNF32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF32	protein_coding	OTTHUMT00000047723.1	C	NM_006973			44139630	-1	no_errors	ENST00000374433	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
CTNNA3	29119	genome.wustl.edu	37	10	68280512	68280512	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr10:68280512delG	ENST00000433211.2	-	11	1568	c.1394delC	c.(1393-1395)gctfs	p.A465fs	CTNNA3_ENST00000373744.4_Frame_Shift_Del_p.A465fs	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						TGCAGCCAAAGCAAGTGCAGC	0.403																																																	0								ENSG00000183230						129.0	113.0	118.0					10																	68280512		2203	4300	6503	CTNNA3	SO:0001589	frameshift_variant	0				HGNC	AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.1394delC	10.37:g.68280512delG	ENSP00000389714:p.Ala465fs	Somatic	0	57	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	4	80.00		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.A465fs	ENST00000433211.2	37	c.1394	CCDS7269.1	10																																																																																			-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin		0.403	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA3	protein_coding	OTTHUMT00000048282.2	G	NM_013266			68280512	-1	no_errors	ENST00000373744	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
INTS3	65123	genome.wustl.edu	37	1	153737498	153737498	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr1:153737498G>T	ENST00000318967.2	+	20	2617	c.2049G>T	c.(2047-2049)caG>caT	p.Q683H	INTS3_ENST00000476843.1_3'UTR|INTS3_ENST00000512605.1_Missense_Mutation_p.Q477H|INTS3_ENST00000435409.2_Missense_Mutation_p.Q683H|INTS3_ENST00000456435.1_Missense_Mutation_p.Q477H	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	684					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ATCAGAAGCAGCCCAAGATTG	0.532																																																	0								ENSG00000143624						233.0	222.0	226.0					1																	153737498		2203	4300	6503	INTS3	SO:0001583	missense	0			-	HGNC	BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.2049G>T	1.37:g.153737498G>T	ENSP00000318641:p.Gln683His	Somatic	0	32	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Int_cplx_su3	p.Q683H	ENST00000318967.2	37	c.2049	CCDS1052.1	1	.	.	.	.	.	.	.	.	.	.	G	15.62	2.887087	0.52014	.	.	ENSG00000143624	ENST00000318967;ENST00000456435;ENST00000435409;ENST00000512605	.	.	.	4.91	1.99	0.26369	.	0.000000	0.85682	D	0.000000	T	0.57770	0.2076	M	0.64404	1.975	0.42968	D	0.994425	D;D;D	0.64830	0.994;0.98;0.988	D;D;D	0.78314	0.991;0.948;0.977	T	0.59925	-0.7362	9	0.62326	D	0.03	.	7.1424	0.25564	0.2806:0.0:0.7194:0.0	.	477;684;683	Q68E01-3;Q68E01;Q68E01-2	.;INT3_HUMAN;.	H	683;477;683;477	.	ENSP00000318641:Q683H	Q	+	3	2	INTS3	152004122	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.298000	0.43602	0.258000	0.21686	0.563000	0.77884	CAG	-	NULL		0.532	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS3	protein_coding	OTTHUMT00000090045.2	G	NM_023015	-		153737498	+1	no_errors	ENST00000318967	ensembl	human	known	74_37	missense	SNP	1.000	T
SNHG14	104472715	genome.wustl.edu	37	15	25460742	25460742	+	RNA	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr15:25460742C>T	ENST00000424208.1	+	0	2739				SNORD115-24_ENST00000363528.1_RNA|SNORD115-25_ENST00000362619.1_RNA|SNHG14_ENST00000424333.1_RNA|SNHG14_ENST00000453082.2_RNA|SNHG14_ENST00000450809.1_RNA	NR_003305.1				small nucleolar RNA host gene 14 (non-protein coding)																		ACTTAAAAATCATGCCCAATA	0.488																																																	0								ENSG00000199489						457.0	456.0	456.0					15																	25460742		876	1991	2867	SNORD115-25			0			-	HGNC			15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25460742C>T		Somatic	0	71	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	32	56.16		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000424208.1	37	NULL		15																																																																																			-	-		0.488	SNHG14-002	KNOWN	basic	antisense	SNORD115-25	processed_transcript	OTTHUMT00000126729.2	C		-		25460742	+1	no_errors	ENST00000362619	ensembl	human	known	74_37	rna	SNP	0.940	T
SLC22A18	5002	genome.wustl.edu	37	11	2940204	2940204	+	Intron	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr11:2940204C>T	ENST00000380574.1	+	8	1194				SLC22A18_ENST00000312221.5_Intron|SLC22A18_ENST00000441077.1_3'UTR|SLC22A18_ENST00000449793.2_Intron|SLC22A18_ENST00000347936.2_Intron			Q96BI1	S22AI_HUMAN	solute carrier family 22, member 18						drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|excretion (GO:0007588)|organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|symporter activity (GO:0015293)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	8		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.192)		ggattgcagacgtgaCTTTGA	0.567																																																	0								ENSG00000110628																																			SLC22A18	SO:0001627	intron_variant	0			-	HGNC	AF028738	CCDS7740.1	11p15.5	2013-05-22	2008-01-11	2004-01-21	ENSG00000110628	ENSG00000110628		"""Solute carriers"""	10964	protein-coding gene	gene with protein product		602631	"""solute carrier family 22 (organic cation transporter), member 1-like"""	ORCTL2, BWSCR1A, IMPT1, SLC22A1L		9499412, 9520460	Standard	NM_183233		Approved	BWR1A, TSSC5, ITM	uc001lwx.3	Q96BI1	OTTHUMG00000010037	ENST00000380574.1:c.764-333C>T	11.37:g.2940204C>T		Somatic	0	26	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	20	23.08	O14906|O43562|O60485|O60680|Q7LDS5|Q7LGF7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000380574.1	37	NULL	CCDS7740.1	11																																																																																			-	-		0.567	SLC22A18-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC22A18	protein_coding	OTTHUMT00000027770.1	C	NM_183233	-		2940204	+1	no_errors	ENST00000441077	ensembl	human	known	74_37	rna	SNP	0.000	T
RNF212	285498	genome.wustl.edu	37	4	1087327	1087328	+	Intron	INS	-	-	CTGCCCAGGCTGGAGCCAGCC	rs376912904|rs386670461|rs142232513|rs539986150|rs138488801	byFrequency	TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr4:1087327_1087328insCTGCCCAGGCTGGAGCCAGCC	ENST00000433731.2	-	4	308				RNF212_ENST00000333673.5_In_Frame_Ins_p.241_241S>WLAPAWAA|RNF212_ENST00000382968.5_Intron			Q495C1	RN212_HUMAN	ring finger protein 212						chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		CAGAGCCTGTGACCTCCACGGC	0.619																																																	0								ENSG00000178222																																			RNF212	SO:0001627	intron_variant	0				HGNC	AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.247-2701->GGCTGGCTCCAGCCTGGGCAG	4.37:g.1087327_1087328insCTGCCCAGGCTGGAGCCAGCC		Somatic	NA	NA	NA		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfscan_Znf_RING	p.S241in_frame_insWLAPAWAA	ENST00000433731.2	37	c.722_721	CCDS46996.1	4																																																																																			-	NULL		0.619	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF212	protein_coding	OTTHUMT00000359124.2	-	NM_194439			1087328	-1	no_errors	ENST00000333673	ensembl	human	known	74_37	in_frame_ins	INS	0.085:0.000	CTGCCCAGGCTGGAGCCAGCC
CNOT1	23019	genome.wustl.edu	37	16	58572108	58572108	+	Missense_Mutation	SNP	C	C	T	rs185344213		TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr16:58572108C>T	ENST00000317147.5	-	37	5530	c.5198G>A	c.(5197-5199)cGc>cAc	p.R1733H	CNOT1_ENST00000245138.4_Missense_Mutation_p.R584H|CNOT1_ENST00000569240.1_Missense_Mutation_p.R1728H	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1733					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		CAAATGATTGCGAATTAGCAG	0.388													C|||	1	0.000199681	0.0	0.0014	5008	,	,		21636	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000125107						103.0	94.0	97.0					16																	58572108		2198	4300	6498	CNOT1	SO:0001583	missense	0			GMAF=0.0005	HGNC	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.5198G>A	16.37:g.58572108C>T	ENSP00000320949:p.Arg1733His	Somatic	0	51	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CCR4-Not_Not1_C,superfamily_ARM-type_fold	p.R1733H	ENST00000317147.5	37	c.5198	CCDS10799.1	16	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	35	5.548859	0.96488	.	.	ENSG00000125107	ENST00000317147;ENST00000245138;ENST00000394200	T;T	0.17691	2.26;2.26	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.46112	0.1376	M	0.76838	2.35	0.80722	D	1	D;P;D	0.89917	0.999;0.702;1.0	D;B;D	0.70716	0.912;0.241;0.97	T	0.38757	-0.9646	10	0.62326	D	0.03	.	19.894	0.96945	0.0:1.0:0.0:0.0	.	584;1733;1728	B5MDN3;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	H	1733;584;1728	ENSP00000320949:R1733H;ENSP00000245138:R584H	ENSP00000245138:R584H	R	-	2	0	CNOT1	57129609	1.000000	0.71417	0.996000	0.52242	0.986000	0.74619	6.091000	0.71406	2.700000	0.92200	0.591000	0.81541	CGC	-	NULL		0.388	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	protein_coding	OTTHUMT00000257385.3	C	NM_016284	rs185344213		58572108	-1	no_errors	ENST00000317147	ensembl	human	known	74_37	missense	SNP	1.000	T
MAGEB5	347541	genome.wustl.edu	37	X	26235472	26235472	+	Silent	SNP	A	A	G			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chrX:26235472A>G	ENST00000602297.1	+	2	301	c.54A>G	c.(52-54)agA>agG	p.R18R	MAGEB5_ENST00000379029.2_Silent_p.R18R	NM_001271752.1	NP_001258681.1	Q9BZ81	MAGB5_HUMAN	melanoma antigen family B, 5	18										lung(1)|ovary(1)	2						CTAACAGTAGAGATGAGGAGT	0.488																																																	0								ENSG00000188408																																			MAGEB5	SO:0001819	synonymous_variant	0			-	HGNC	AF333705	CCDS65233.1	Xp22	2012-04-20			ENSG00000188408	ENSG00000188408			23795	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 3"""	300466				10861452	Standard	NM_001271752		Approved	MAGE-B5, CT3.3	uc031thc.1	Q9BZ81	OTTHUMG00000021288	ENST00000602297.1:c.54A>G	X.37:g.26235472A>G		Somatic	0	70	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	28	45.10		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfscan_MAGE	p.R18	ENST00000602297.1	37	c.54		X																																																																																			-	NULL		0.488	MAGEB5-001	KNOWN	basic|appris_principal	protein_coding	MAGEB5	protein_coding	OTTHUMT00000056126.2	A	XM_293407	-		26235472	+1	no_errors	ENST00000379029	ensembl	human	known	74_37	silent	SNP	0.000	G
ZXDC	79364	genome.wustl.edu	37	3	126194126	126194126	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr3:126194126G>T	ENST00000389709.3	-	1	636	c.583C>A	c.(583-585)Cac>Aac	p.H195N	ZXDC_ENST00000336332.5_Missense_Mutation_p.H195N	NM_025112.4	NP_079388.3	Q2QGD7	ZXDC_HUMAN	ZXD family zinc finger C	195					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|LRR domain binding (GO:0030275)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(1)	17				GBM - Glioblastoma multiforme(114;0.155)		GTGAGCAGGTGCACCTTGAGC	0.721																																																	0								ENSG00000070476						6.0	8.0	7.0					3																	126194126		1938	4052	5990	ZXDC	SO:0001583	missense	0			-	HGNC	AK023923	CCDS43145.1, CCDS43146.1	3q21.3	2014-02-12			ENSG00000070476	ENSG00000070476		"""Zinc fingers, C2H2-type"""	28160	protein-coding gene	gene with protein product		615746				8619474, 9110174	Standard	XM_005247757		Approved	MGC11349, FLJ13861	uc003eiv.3	Q2QGD7	OTTHUMG00000162754	ENST00000389709.3:c.583C>A	3.37:g.126194126G>T	ENSP00000374359:p.His195Asn	Somatic	0	19	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	C5J0H9|Q6DKI8|Q7L3L1|Q8NAU2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H195N	ENST00000389709.3	37	c.583	CCDS43145.1	3	.	.	.	.	.	.	.	.	.	.	G	22.9	4.348728	0.82132	.	.	ENSG00000070476	ENST00000389709;ENST00000336332	T;T	0.52754	0.65;0.65	3.53	3.53	0.40419	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	U	0.000001	T	0.76062	0.3935	H	0.95043	3.615	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.87578	0.996;0.998	D	0.83705	0.0184	10	0.87932	D	0	-17.3742	12.9961	0.58648	0.0:0.0:1.0:0.0	.	195;195	Q2QGD7-2;Q2QGD7	.;ZXDC_HUMAN	N	195	ENSP00000374359:H195N;ENSP00000337694:H195N	ENSP00000337694:H195N	H	-	1	0	ZXDC	127676816	1.000000	0.71417	1.000000	0.80357	0.688000	0.40055	7.417000	0.80156	1.701000	0.51217	0.485000	0.47835	CAC	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.721	ZXDC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZXDC	protein_coding	OTTHUMT00000370327.2	G	NM_025112	-		126194126	-1	no_errors	ENST00000389709	ensembl	human	known	74_37	missense	SNP	1.000	T
VPS54	51542	genome.wustl.edu	37	2	64193060	64193060	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr2:64193060G>A	ENST00000272322.4	-	6	687	c.533C>T	c.(532-534)aCt>aTt	p.T178I	VPS54_ENST00000354504.3_Missense_Mutation_p.T61I|VPS54_ENST00000409558.4_Missense_Mutation_p.T166I			Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 homolog (S. cerevisiae)	178					growth (GO:0040007)|homeostasis of number of cells within a tissue (GO:0048873)|musculoskeletal movement (GO:0050881)|neurofilament cytoskeleton organization (GO:0060052)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)				endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	27						TGAATTAAAAGTTAAGGAATC	0.313																																																	0								ENSG00000143952						57.0	62.0	60.0					2																	64193060		2203	4300	6503	VPS54	SO:0001583	missense	0			-	HGNC	AF102177	CCDS33208.1, CCDS46302.1	2p15-p14	2014-06-13	2006-12-19		ENSG00000143952	ENSG00000143952			18652	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 164"""	614633	"""vacuolar protein sorting 54 (yeast)"""			12039048	Standard	NM_016516		Approved	HCC8, PPP1R164	uc002scq.3	Q9P1Q0	OTTHUMG00000152627	ENST00000272322.4:c.533C>T	2.37:g.64193060G>A	ENSP00000272322:p.Thr178Ile	Somatic	0	188	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	92	8.00	Q5VIR5|Q86YF7|Q8N6G3|Q9NPV0|Q9NT07|Q9NUJ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Vps54,pfam_Vacuolar_sorting-assoc_54	p.T178I	ENST00000272322.4	37	c.533	CCDS33208.1	2	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221044	0.79464	.	.	ENSG00000143952	ENST00000354504;ENST00000272322;ENST00000409558;ENST00000483277;ENST00000394400	T;T;T	0.39997	1.15;1.05;1.05	5.47	4.57	0.56435	.	0.045974	0.85682	D	0.000000	T	0.64527	0.2606	M	0.73962	2.25	0.80722	D	1	P;D;D	0.89917	0.692;1.0;1.0	P;D;D	0.87578	0.711;0.998;0.997	T	0.67421	-0.5675	10	0.49607	T	0.09	.	15.4953	0.75643	0.0:0.0:0.8605:0.1395	.	61;178;166	Q9P1Q0-3;Q9P1Q0;Q9P1Q0-4	.;VPS54_HUMAN;.	I	61;178;166;166;178	ENSP00000346499:T61I;ENSP00000272322:T178I;ENSP00000386980:T166I	ENSP00000272322:T178I	T	-	2	0	VPS54	64046564	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.855000	0.75445	1.274000	0.44362	0.467000	0.42956	ACT	-	NULL		0.313	VPS54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS54	protein_coding	OTTHUMT00000327062.2	G	NM_016516	-		64193060	-1	no_errors	ENST00000272322	ensembl	human	known	74_37	missense	SNP	1.000	A
LAMC2	3918	genome.wustl.edu	37	1	183195971	183195971	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr1:183195971G>T	ENST00000264144.4	+	9	1270	c.1205G>T	c.(1204-1206)aGa>aTa	p.R402I	LAMC2_ENST00000493293.1_Missense_Mutation_p.R402I	NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	402	Laminin EGF-like 4; second part. {ECO:0000255|PROSITE-ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)			breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						GGCTACAAGAGAGATTCAGCG	0.547																																																	0								ENSG00000058085						191.0	202.0	198.0					1																	183195971		2203	4300	6503	LAMC2	SO:0001583	missense	0			-	HGNC	Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.1205G>T	1.37:g.183195971G>T	ENSP00000264144:p.Arg402Ile	Somatic	0	52	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_Laminin_B_type_IV,superfamily_Growth_fac_rcpt_N_dom,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin	p.R402I	ENST00000264144.4	37	c.1205	CCDS1352.1	1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.877617	0.91664	.	.	ENSG00000058085	ENST00000493293;ENST00000537180;ENST00000264144	T;T	0.64803	-0.12;-0.12	5.39	5.39	0.77823	EGF-like, laminin (2);	0.000000	0.85682	D	0.000000	D	0.83280	0.5220	M	0.88842	2.985	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.86433	0.1762	10	0.87932	D	0	.	19.1486	0.93479	0.0:0.0:1.0:0.0	.	402;402;402	Q2M1N2;Q13753;Q13753-2	.;LAMC2_HUMAN;.	I	402	ENSP00000432063:R402I;ENSP00000264144:R402I	ENSP00000264144:R402I	R	+	2	0	LAMC2	181462594	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	9.045000	0.93812	2.512000	0.84698	0.549000	0.68633	AGA	-	pfam_EGF_laminin,smart_EGF_laminin		0.547	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC2	protein_coding	OTTHUMT00000086258.1	G	NM_005562	-		183195971	+1	no_errors	ENST00000264144	ensembl	human	known	74_37	missense	SNP	1.000	T
KIF13B	23303	genome.wustl.edu	37	8	28974507	28974507	+	Silent	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr8:28974507G>A	ENST00000524189.1	-	31	3716	c.3678C>T	c.(3676-3678)tcC>tcT	p.S1226S	CTD-2647L4.1_ENST00000523661.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	1226					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		CGGAGTCCCAGGAGGCTTCTG	0.582																																																	0								ENSG00000197892						52.0	55.0	54.0					8																	28974507		1941	4147	6088	KIF13B	SO:0001819	synonymous_variant	0			-	HGNC	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.3678C>T	8.37:g.28974507G>A		Somatic	0	17	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	5	58.33	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_CAP-Gly_domain,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_CAP-Gly_domain,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_CAP-Gly_domain,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S1226	ENST00000524189.1	37	c.3678	CCDS55217.1	8																																																																																			-	pfam_Kinesin-like		0.582	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF13B	protein_coding	OTTHUMT00000376878.1	G		-		28974507	-1	no_errors	ENST00000524189	ensembl	human	known	74_37	silent	SNP	0.804	A
MAGEB4	4115	genome.wustl.edu	37	X	30260295	30260295	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chrX:30260295C>T	ENST00000378982.2	+	1	239	c.43C>T	c.(43-45)Cgc>Tgc	p.R15C	MAGEB1_ENST00000378981.3_5'Flank|MAGEB1_ENST00000397550.1_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	15										breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						CCGTGAGAAACGCCAGCGGAC	0.567																																																	0								ENSG00000120289						99.0	79.0	86.0					X																	30260295		2202	4300	6502	MAGEB4	SO:0001583	missense	0			-	HGNC		CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.43C>T	X.37:g.30260295C>T	ENSP00000368266:p.Arg15Cys	Somatic	0	46	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	22	35.29	B2R9G0|Q6FHH4|Q8IZ00	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.R15C	ENST00000378982.2	37	c.43	CCDS14221.1	X	.	.	.	.	.	.	.	.	.	.	C	13.07	2.126557	0.37533	.	.	ENSG00000120289	ENST00000378982	T	0.06933	3.24	3.22	-1.76	0.08006	Melanoma associated antigen, MAGE, N-terminal (1);	1.576910	0.05036	U	0.475533	T	0.21062	0.0507	M	0.76574	2.34	0.09310	N	1	D	0.57257	0.979	P	0.56865	0.808	T	0.27706	-1.0066	10	0.44086	T	0.13	.	7.626	0.28212	0.0:0.3504:0.0:0.6496	.	15	O15481	MAGB4_HUMAN	C	15	ENSP00000368266:R15C	ENSP00000368266:R15C	R	+	1	0	MAGEB4	30170216	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.801000	0.01743	-0.647000	0.05444	-0.268000	0.10319	CGC	-	pfam_Melanoma_ass_antigen_N		0.567	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB4	protein_coding	OTTHUMT00000056159.1	C	NM_002367	-		30260295	+1	no_errors	ENST00000378982	ensembl	human	known	74_37	missense	SNP	0.000	T
USP17L2	377630	genome.wustl.edu	37	8	11995025	11995025	+	Silent	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr8:11995025G>A	ENST00000333796.3	-	1	1561	c.1245C>T	c.(1243-1245)ctC>ctT	p.L415L	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	415	Mediates interaction with SUDS3.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						CGGGTGCCTGGAGGCAGGGGT	0.572																																																	0								ENSG00000223443						54.0	60.0	58.0					8																	11995025		1659	3714	5373	USP17L2	SO:0001819	synonymous_variant	0			-	HGNC	BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.1245C>T	8.37:g.11995025G>A		Somatic	0	130	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	61	36	62.24		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfam_HABP4_PAIRBP1-bd,pfscan_Peptidase_C19/C67	p.L415	ENST00000333796.3	37	c.1245	CCDS43713.1	8																																																																																			-	pfam_HABP4_PAIRBP1-bd		0.572	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP17L2	protein_coding	OTTHUMT00000383303.2	G	NM_201402	-		11995025	-1	no_errors	ENST00000333796	ensembl	human	known	74_37	silent	SNP	0.003	A
FLNC	2318	genome.wustl.edu	37	7	128486157	128486160	+	Frame_Shift_Del	DEL	ACCT	ACCT	-			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	ACCT	ACCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr7:128486157_128486160delACCT	ENST00000325888.8	+	22	4165_4168	c.3904_3907delACCT	c.(3904-3909)acctatfs	p.TY1302fs	FLNC_ENST00000346177.6_Frame_Shift_Del_p.TY1302fs	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1302					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CAAGACAGACACCTATGTGACAGA	0.627																																																	0								ENSG00000128591																																			FLNC	SO:0001589	frameshift_variant	0				HGNC	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.3904_3907delACCT	7.37:g.128486157_128486160delACCT	ENSP00000327145:p.Thr1302fs	Somatic	0	33	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	33	19.51	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.T1302fs	ENST00000325888.8	37	c.3904_3907	CCDS43644.1	7																																																																																			-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like		0.627	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	protein_coding	OTTHUMT00000059948.3	ACCT				128486160	+1	no_errors	ENST00000325888	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:0.980:0.983	-
GBA2	57704	genome.wustl.edu	37	9	35740618	35740618	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr9:35740618G>A	ENST00000378103.3	-	6	1557	c.1034C>T	c.(1033-1035)aCc>aTc	p.T345I	GBA2_ENST00000378088.1_5'Flank|GBA2_ENST00000467252.1_5'UTR|GBA2_ENST00000378094.4_Missense_Mutation_p.T345I|GBA2_ENST00000545786.1_Missense_Mutation_p.T351I	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	345					bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GGTTACCGTGGTAGCTGCCTG	0.592																																																	0								ENSG00000070610						113.0	89.0	97.0					9																	35740618		2203	4300	6503	GBA2	SO:0001583	missense	0			-	HGNC	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.1034C>T	9.37:g.35740618G>A	ENSP00000367343:p.Thr345Ile	Somatic	0	42	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	3	88.46	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glucosylceramidase,pfam_GBA2_N,superfamily_6-hairpin_glycosidase-like,pirsf_Beta_glucosidase_GBA2-type	p.T351I	ENST00000378103.3	37	c.1052	CCDS6589.1	9	.	.	.	.	.	.	.	.	.	.	G	12.20	1.865930	0.32977	.	.	ENSG00000070610	ENST00000378103;ENST00000378094;ENST00000545786	.	.	.	5.66	5.66	0.87406	Beta-glucosidase, GBA2 type, N-terminal (1);	0.125415	0.64402	D	0.000020	T	0.47414	0.1444	N	0.20766	0.605	0.37578	D	0.919686	P;B;B	0.51537	0.946;0.017;0.175	P;B;B	0.51453	0.67;0.009;0.129	T	0.39440	-0.9614	9	0.12766	T	0.61	-19.5581	16.9097	0.86137	0.0:0.0:1.0:0.0	.	351;345;345	F5H7P6;Q9HCG7-2;Q9HCG7	.;.;GBA2_HUMAN	I	345;345;351	.	ENSP00000367334:T345I	T	-	2	0	GBA2	35730618	0.645000	0.27286	0.996000	0.52242	0.976000	0.68499	2.805000	0.47939	2.676000	0.91093	0.655000	0.94253	ACC	-	pfam_GBA2_N,pirsf_Beta_glucosidase_GBA2-type		0.592	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GBA2	protein_coding	OTTHUMT00000055456.1	G	NM_020944	-		35740618	-1	no_errors	ENST00000545786	ensembl	human	known	74_37	missense	SNP	0.798	A
PRX	57716	genome.wustl.edu	37	19	40900180	40900182	+	In_Frame_Del	DEL	TCC	TCC	-	rs139624657|rs377069149|rs142743305		TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	TCC	TCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr19:40900180_40900182delTCC	ENST00000324001.7	-	7	4347_4349	c.4077_4079delGGA	c.(4075-4080)gaggaa>gaa	p.1359_1360EE>E	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	1359	Poly-Glu.		Missing. {ECO:0000269|PubMed:11133365}.		axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ACTGCcctcttcctcctcctcct	0.695																																																	0								ENSG00000105227																																			PRX	SO:0001651	inframe_deletion	0				HGNC	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.4077_4079delGGA	19.37:g.40900189_40900191delTCC	ENSP00000326018:p.Glu1361del	Somatic	0	27	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	29	14.71	Q9BXL9|Q9HCF2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E1361in_frame_del	ENST00000324001.7	37	c.4079_4077	CCDS33028.1	19																																																																																			-	NULL		0.695	PRX-001	KNOWN	basic|CCDS	protein_coding	PRX	protein_coding	OTTHUMT00000462582.1	TCC	NM_020956			40900182	-1	no_errors	ENST00000324001	ensembl	human	known	74_37	in_frame_del	DEL	0.908:0.904:0.008	-
SCPEP1	59342	genome.wustl.edu	37	17	55062464	55062465	+	Intron	INS	-	-	GAAAA	rs34242828|rs397829366|rs3056052|rs573491470	byFrequency	TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr17:55062464_55062465insGAAAA	ENST00000262288.3	+	3	280				SCPEP1_ENST00000571898.1_Intron|RP5-1107A17.4_ENST00000572877.1_RNA	NM_021626.2	NP_067639.1	Q9HB40	RISC_HUMAN	serine carboxypeptidase 1						negative regulation of blood pressure (GO:0045776)|positive regulation of vasodilation (GO:0045909)|retinoic acid metabolic process (GO:0042573)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	14	Breast(9;2.86e-08)					agactctgtctgaaaagaaaag	0.475																																																	0								ENSG00000263120																																			RP5-1107A17.4	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF282618	CCDS11593.1	17q22	2012-09-20			ENSG00000121064	ENSG00000121064			29507	protein-coding gene	gene with protein product	"""retinoid inducible serine carboxypeptidase"""					11447226, 12975309	Standard	NM_021626		Approved	RISC	uc002iuv.4	Q9HB40	OTTHUMG00000178129	ENST00000262288.3:c.226-274->GAAAA	17.37:g.55062470_55062474dupGAAAA		Somatic	NA	NA	NA		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q96A94|Q9H3F0	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000262288.3	37	NULL	CCDS11593.1	17																																																																																			-	-		0.475	SCPEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000263120	protein_coding	OTTHUMT00000440622.1	-	NM_021626			55062465	+1	no_errors	ENST00000572877	ensembl	human	known	74_37	rna	INS	0.001:0.001	GAAAA
LINC00686	140865	genome.wustl.edu	37	20	61326511	61326511	+	lincRNA	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr20:61326511C>T	ENST00000435412.1	-	0	196									long intergenic non-protein coding RNA 686																		CTTGGGTGGGCTTTCTGGCTG	0.637																																																	0								ENSG00000237687																																			LINC00686			0			-	HGNC	D80415		20q13.33	2012-10-24	2012-10-24	2012-10-24	ENSG00000237687	ENSG00000237687		"""Long non-coding RNAs"""	16221	non-coding RNA	RNA, long non-coding			"""chromosome 20 open reading frame 90"""	C20orf90			Standard			Approved	bA93B14.2			OTTHUMG00000032927		20.37:g.61326511C>T		Somatic	0	38	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	20	50.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000435412.1	37	NULL		20	.	.	.	.	.	.	.	.	.	.	C	2.604	-0.292398	0.05568	.	.	ENSG00000237687	ENST00000435412	.	.	.	0.158	0.158	0.14942	.	.	.	.	.	T	0.53029	0.1771	.	.	.	.	.	.	.	.	.	.	.	.	T	0.62364	-0.6870	3	0.87932	D	0	.	.	.	.	.	.	.	.	N	66	.	ENSP00000414143:S66N	S	-	2	0	C20orf90	60796956	0.003000	0.15002	0.019000	0.16419	0.019000	0.09904	-1.060000	0.03475	0.202000	0.20498	0.205000	0.17691	AGC	-	-		0.637	LINC00686-001	KNOWN	basic	lincRNA	LINC00686	lincRNA	OTTHUMT00000080056.1	C		-		61326511	-1	no_errors	ENST00000435412	ensembl	human	known	74_37	rna	SNP	0.021	T
TTC4	7268	genome.wustl.edu	37	1	55207181	55207181	+	Nonsense_Mutation	SNP	C	C	T	rs200228539		TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr1:55207181C>T	ENST00000371281.3	+	10	1246	c.1159C>T	c.(1159-1161)Cga>Tga	p.R387*	TTC4_ENST00000371284.5_3'UTR|MROH7-TTC4_ENST00000414150.2_3'UTR	NM_004623.4	NP_004614.3	O95801	TTC4_HUMAN	tetratricopeptide repeat domain 4	387										breast(2)|endometrium(3)|kidney(1)|lung(2)|stomach(1)	9						GTACCAGATACGATGACTAAG	0.512													C|||	1	0.000199681	0.0	0.0	5008	,	,		19064	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000243725						81.0	84.0	83.0					1																	55207181		2203	4300	6503	TTC4	SO:0001587	stop_gained	0			GMAF=0.0005	HGNC		CCDS596.1	1p32	2013-01-11			ENSG00000243725	ENSG00000243725		"""Tetratricopeptide (TTC) repeat domain containing"""	12394	protein-coding gene	gene with protein product		606753				9933562	Standard	NM_004623		Approved	MGC5097, FLJ41930	uc001cxx.4	O95801	OTTHUMG00000009914	ENST00000371281.3:c.1159C>T	1.37:g.55207181C>T	ENSP00000360329:p.Arg387*	Somatic	0	32	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q53Y95|Q5TA96|Q9H3I2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_TPR_repeat,pfscan_TPR-contain_dom	p.R387*	ENST00000371281.3	37	c.1159	CCDS596.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	17.64	3.439464	0.63067	.	.	ENSG00000243725	ENST00000371281;ENST00000371284	.	.	.	5.1	-0.219	0.13135	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999991	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	.	3.4176	0.07381	0.3546:0.4306:0.0803:0.1344	.	.	.	.	X	387;398	.	ENSP00000360329:R387X	R	+	1	2	TTC4	54979769	0.860000	0.29831	0.124000	0.21820	0.193000	0.23685	1.201000	0.32259	-0.108000	0.12066	-1.059000	0.02297	CGA	-	NULL		0.512	TTC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC4	protein_coding	OTTHUMT00000027432.1	C	NM_004623	rs200228539		55207181	+1	no_errors	ENST00000371281	ensembl	human	known	74_37	nonsense	SNP	0.144	T
SEZ6	124925	genome.wustl.edu	37	17	27284100	27284100	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr17:27284100delG	ENST00000317338.12	-	13	3083	c.2655delC	c.(2653-2655)cccfs	p.P885fs	PIPOX_ENST00000583215.1_Intron|SEZ6_ENST00000442608.3_Frame_Shift_Del_p.P885fs|SEZ6_ENST00000360295.9_Frame_Shift_Del_p.P885fs|SEZ6_ENST00000335960.6_Intron			Q53EL9	SEZ6_HUMAN	seizure related 6 homolog (mouse)	885	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|negative regulation of dendrite development (GO:2000171)|positive regulation of dendrite development (GO:1900006)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	apical dendrite (GO:0097440)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	29	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			TCCAATGCGAGGGGTGCCCAG	0.617																																																	0								ENSG00000063015						22.0	24.0	23.0					17																	27284100		2050	4181	6231	SEZ6	SO:0001589	frameshift_variant	0				HGNC	AY038048	CCDS45638.1, CCDS45639.1	17q11.2	2008-03-06	2001-11-28		ENSG00000063015	ENSG00000063015			15955	protein-coding gene	gene with protein product			"""seizure related gene 6 (mouse) homolog"""			17086543	Standard	NM_178860		Approved		uc002hdp.2	Q53EL9	OTTHUMG00000168010	ENST00000317338.12:c.2655delC	17.37:g.27284100delG	ENSP00000312942:p.Pro885fs	Somatic	0	19	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	B6ZDN1|Q8N701|Q8NB57|Q8ND50|Q8TD25|Q96NI5|Q96NQ3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,smart_CUB_dom,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.S886fs	ENST00000317338.12	37	c.2655	CCDS45639.1	17																																																																																			-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.617	SEZ6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6	protein_coding	OTTHUMT00000397475.3	G				27284100	-1	no_errors	ENST00000317338	ensembl	human	known	74_37	frame_shift_del	DEL	0.714	-
DNAH5	1767	genome.wustl.edu	37	5	13829759	13829759	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr5:13829759G>A	ENST00000265104.4	-	38	6408	c.6304C>T	c.(6304-6306)Cgc>Tgc	p.R2102C		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2102	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R2102C(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GCCACTGAGCGGAAATTAATC	0.448									Kartagener syndrome																																								1	Substitution - Missense(1)	endometrium(1)						ENSG00000039139						115.0	105.0	108.0					5																	13829759		2203	4300	6503	DNAH5	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	HGNC	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.6304C>T	5.37:g.13829759G>A	ENSP00000265104:p.Arg2102Cys	Somatic	0	62	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	69	10.39	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R2102C	ENST00000265104.4	37	c.6304	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	21.5	4.159228	0.78226	.	.	ENSG00000039139	ENST00000265104	T	0.15256	2.44	5.46	5.46	0.80206	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.61337	0.2339	H	0.99143	4.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77718	-0.2483	10	0.87932	D	0	.	14.1892	0.65628	0.0:0.0:0.8504:0.1495	.	2102	Q8TE73	DYH5_HUMAN	C	2102	ENSP00000265104:R2102C	ENSP00000265104:R2102C	R	-	1	0	DNAH5	13882759	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.541000	0.67212	2.550000	0.86006	0.655000	0.94253	CGC	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.448	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	protein_coding	OTTHUMT00000207057.2	G	NM_001369	-		13829759	-1	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	SNP	1.000	A
FRG2FP	100128827	genome.wustl.edu	37	3	197838274	197838275	+	RNA	DEL	AA	AA	-	rs398052594|rs71623397	byFrequency	TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr3:197838274_197838275delAA	ENST00000419104.1	+	0	396_397																											GCTTGATGTTAAAAAAAAAAAA	0.48																																																	0								ENSG00000232783																																			AC073135.3			0				Clone_based_vega_gene																													3.37:g.197838284_197838285delAA		Somatic	0	20	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	25	16.67		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000419104.1	37	NULL		3																																																																																			-	-		0.480	AC073135.3-003	KNOWN	basic	processed_transcript	ENSG00000232783	pseudogene	OTTHUMT00000339698.1	AA				197838275	+1	no_errors	ENST00000411596	ensembl	human	known	74_37	rna	DEL	0.001:0.001	-
CD2	914	genome.wustl.edu	37	1	117311333	117311333	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr1:117311333delC	ENST00000369478.3	+	5	1092	c.984delC	c.(982-984)ctcfs	p.L328fs		NM_001767.3	NP_001758.2	P06729	CD2_HUMAN	CD2 molecule	328	Pro-rich.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|heterotypic cell-cell adhesion (GO:0034113)|leukocyte migration (GO:0050900)|membrane raft polarization (GO:0001766)|natural killer cell activation (GO:0030101)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of myeloid dendritic cell activation (GO:0030887)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of T cell differentiation (GO:0045580)|single organismal cell-cell adhesion (GO:0016337)|T cell activation (GO:0042110)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			NS(1)|breast(2)|large_intestine(3)|liver(1)|lung(8)|skin(2)|stomach(1)	18	Lung SC(450;0.225)	all_cancers(81;3.15e-06)|Acute lymphoblastic leukemia(138;1.7e-08)|all_epithelial(167;8.38e-07)|all_lung(203;3.37e-06)|Lung NSC(69;2.31e-05)		Epithelial(280;6.71e-26)|OV - Ovarian serous cystadenocarcinoma(397;4.74e-24)|all cancers(265;1.93e-22)|Lung(183;0.0543)|Kidney(133;0.0813)|Colorectal(144;0.174)|KIRC - Kidney renal clear cell carcinoma(1967;0.176)|LUSC - Lung squamous cell carcinoma(189;0.189)|BRCA - Breast invasive adenocarcinoma(282;0.201)	Alefacept(DB00092)	GCCCGCCCCTCCCCAGACCTC	0.542																																					NSCLC(14;263 555 26380 43512 51332)												0								ENSG00000116824						75.0	82.0	80.0					1																	117311333		2203	4300	6503	CD2	SO:0001589	frameshift_variant	0				HGNC	BC033583	CCDS889.1	1p13	2013-01-11	2006-03-28		ENSG00000116824	ENSG00000116824		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	1639	protein-coding gene	gene with protein product		186990	"""CD2 antigen (p50), sheep red blood cell receptor"""	SRBC		2437578	Standard	NM_001767		Approved		uc001egu.4	P06729	OTTHUMG00000022750	ENST00000369478.3:c.984delC	1.37:g.117311333delC	ENSP00000358490:p.Leu328fs	Somatic	0	22	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	Q96TE5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ig_C2-set,pfam_Ig_V-set,prints_CD2	p.R330fs	ENST00000369478.3	37	c.984	CCDS889.1	1																																																																																			-	NULL		0.542	CD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD2	protein_coding	OTTHUMT00000059039.2	C	NM_001767			117311333	+1	no_errors	ENST00000369478	ensembl	human	known	74_37	frame_shift_del	DEL	0.998	-
TNFAIP1	7126	genome.wustl.edu	37	17	26671442	26671442	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr17:26671442A>G	ENST00000226225.2	+	7	1034	c.767A>G	c.(766-768)tAt>tGt	p.Y256C	POLDIP2_ENST00000003607.4_5'Flank|TNFAIP1_ENST00000583213.1_3'UTR|TNFAIP1_ENST00000544907.2_Missense_Mutation_p.Y152C	NM_021137.4	NP_066960.1	Q13829	BACD2_HUMAN	tumor necrosis factor, alpha-induced protein 1 (endothelial)	256					apoptotic process (GO:0006915)|cell migration (GO:0016477)|DNA replication (GO:0006260)|embryo development (GO:0009790)|immune response (GO:0006955)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of DNA replication (GO:0045740)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleolus (GO:0005730)	GTP-Rho binding (GO:0017049)			endometrium(3)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)	12	all_lung(13;0.000294)|Lung NSC(42;0.000964)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		GTCCTACTCTATGAGACTCCC	0.567																																																	0								ENSG00000109079						58.0	50.0	53.0					17																	26671442		2203	4300	6503	TNFAIP1	SO:0001583	missense	0			-	HGNC		CCDS11227.1	17q22-q23	2013-01-09			ENSG00000109079	ENSG00000109079		"""BTB/POZ domain containing"""	11894	protein-coding gene	gene with protein product		191161		EDP1		2406243, 2233719	Standard	NM_021137		Approved	B61, B12, MGC2317, BTBD34	uc002hay.3	Q13829	OTTHUMG00000132501	ENST00000226225.2:c.767A>G	17.37:g.26671442A>G	ENSP00000226225:p.Tyr256Cys	Somatic	0	51	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	4	84.00	B7Z6M4|Q5TZQ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_T1-type_BTB,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.Y256C	ENST00000226225.2	37	c.767	CCDS11227.1	17	.	.	.	.	.	.	.	.	.	.	A	17.54	3.415486	0.62511	.	.	ENSG00000109079	ENST00000226225;ENST00000544907	T	0.59224	0.28	5.65	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.75997	0.3926	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.78961	-0.1997	10	0.87932	D	0	-13.2031	10.6989	0.45915	0.9266:0.0:0.0734:0.0	.	256	Q13829	BACD2_HUMAN	C	256;152	ENSP00000226225:Y256C	ENSP00000226225:Y256C	Y	+	2	0	TNFAIP1	23695569	1.000000	0.71417	0.875000	0.34327	0.400000	0.30750	5.861000	0.69553	1.165000	0.42670	0.533000	0.62120	TAT	-	NULL		0.567	TNFAIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFAIP1	protein_coding	OTTHUMT00000255681.2	A	NM_021137	-		26671442	+1	no_errors	ENST00000226225	ensembl	human	known	74_37	missense	SNP	0.995	G
SEMA6A	57556	genome.wustl.edu	37	5	115822489	115822489	+	Silent	SNP	G	G	A	rs201133760	byFrequency	TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr5:115822489G>A	ENST00000343348.6	-	10	1705	c.918C>T	c.(916-918)aaC>aaT	p.N306N	CTB-118N6.3_ENST00000508640.1_RNA|CTB-118N6.3_ENST00000510682.1_RNA|SEMA6A_ENST00000503962.1_5'Flank|SEMA6A_ENST00000510263.1_Silent_p.N306N|CTB-118N6.3_ENST00000514214.1_RNA|SEMA6A_ENST00000257414.8_Silent_p.N306N	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	306	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		CATCACGCCCGTTGATACGAA	0.473													G|||	3	0.000599042	0.0	0.0014	5008	,	,		17603	0.0		0.002	False		,,,				2504	0.0																0								ENSG00000092421						140.0	136.0	137.0					5																	115822489		1998	4195	6193	SEMA6A	SO:0001819	synonymous_variant	0			GMAF=0	HGNC	AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.918C>T	5.37:g.115822489G>A		Somatic	0	126	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	54	38.64	Q9P2H9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.N306	ENST00000343348.6	37	c.918	CCDS47256.1	5																																																																																			-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.473	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA6A	protein_coding	OTTHUMT00000371270.1	G	NM_020796	rs201133760		115822489	-1	no_errors	ENST00000257414	ensembl	human	known	74_37	silent	SNP	0.994	A
LOC100631378	100631378	genome.wustl.edu	37	19	38324091	38324091	+	lincRNA	SNP	C	C	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr19:38324091C>A	ENST00000443870.1	+	0	5214				AC016582.2_ENST00000592640.1_lincRNA																							TGGTGAGACTCCCGGTATAGA	0.438																																																	0								ENSG00000225868																																			AC016582.2			0			-	Clone_based_vega_gene																													19.37:g.38324091C>A		Somatic	0	74	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	49	23.44		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000443870.1	37	NULL		19																																																																																			-	-		0.438	CTD-2554C21.3-001	KNOWN	basic	lincRNA	LOC100631378	lincRNA	OTTHUMT00000459795.1	C		-		38324091	-1	no_errors	ENST00000433142	ensembl	human	known	74_37	rna	SNP	0.047	A
DIP2C	22982	genome.wustl.edu	37	10	412231	412231	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr10:412231G>T	ENST00000280886.6	-	19	2339	c.2252C>A	c.(2251-2253)aCc>aAc	p.T751N	DIP2C_ENST00000540204.1_Missense_Mutation_p.T72N|DIP2C_ENST00000381496.3_Missense_Mutation_p.T644N	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	751						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		GGTGTTCTTGGTCATGCCAGA	0.572																																																	0								ENSG00000151240						147.0	99.0	115.0					10																	412231		2203	4300	6503	DIP2C	SO:0001583	missense	0			-	HGNC	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.2252C>A	10.37:g.412231G>T	ENSP00000280886:p.Thr751Asn	Somatic	0	70	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B4DPI5|Q5SS78	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.T751N	ENST00000280886.6	37	c.2252	CCDS7054.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.2|28.2	4.900176|4.900176	0.92035|0.92035	.|.	.|.	ENSG00000151240|ENSG00000151240	ENST00000421992|ENST00000280886;ENST00000381496;ENST00000540204	.|T;T;T	.|0.58652	.|0.32;0.32;0.52	5.35|5.35	5.35|5.35	0.76521|0.76521	.|AMP-dependent synthetase/ligase (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.77916|0.77916	0.4202|0.4202	M|M	0.82517|0.82517	2.595|2.595	0.58432|0.58432	D|D	0.999997|0.999997	.|D;D	.|0.60575	.|0.988;0.976	.|D;D	.|0.65323	.|0.93;0.934	T|T	0.80772|0.80772	-0.1233|-0.1233	5|10	.|0.62326	.|D	.|0.03	-34.3622|-34.3622	19.0863|19.0863	0.93204|0.93204	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|72;751	.|B4DPI5;Q9Y2E4	.|.;DIP2C_HUMAN	T|N	219|751;644;72	.|ENSP00000280886:T751N;ENSP00000370907:T644N;ENSP00000443826:T72N	.|ENSP00000280886:T751N	P|T	-|-	1|2	0|0	DIP2C|DIP2C	402231|402231	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.951000|0.951000	0.60555|0.60555	9.869000|9.869000	0.99810|0.99810	2.507000|2.507000	0.84556|0.84556	0.563000|0.563000	0.77884|0.77884	CCA|ACC	-	pfam_AMP-dep_Synth/Lig		0.572	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2C	protein_coding	OTTHUMT00000046389.1	G	NM_014974	-		412231	-1	no_errors	ENST00000280886	ensembl	human	known	74_37	missense	SNP	1.000	T
ASAP1	50807	genome.wustl.edu	37	8	131124344	131124344	+	Frame_Shift_Del	DEL	C	C	-	rs116410358	byFrequency	TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr8:131124344delC	ENST00000518721.1	-	24	2624	c.2397delG	c.(2395-2397)gggfs	p.G799fs	ASAP1_ENST00000357668.1_Frame_Shift_Del_p.G799fs	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	799	Pro-rich.				cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)	p.G799G(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						CCATACCTTTCCCGGCGTTCC	0.547																																																	1	Substitution - coding silent(1)	ovary(1)						ENSG00000153317						124.0	122.0	123.0					8																	131124344		2203	4300	6503	ASAP1	SO:0001589	frameshift_variant	0				HGNC	AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.2397delG	8.37:g.131124344delC	ENSP00000429900:p.Gly799fs	Somatic	0	88	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29	B2RNV3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_ArfGAP,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP,prints_p67phox	p.G801fs	ENST00000518721.1	37	c.2397	CCDS6362.1	8																																																																																			-	NULL		0.547	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAP1	protein_coding	OTTHUMT00000380170.1	C	NM_018482			131124344	-1	no_errors	ENST00000357668	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
FOXD2	2306	genome.wustl.edu	37	1	47904668	47904669	+	In_Frame_Ins	INS	-	-	CCGCAC	rs113438724|rs3046924|rs71053113	byFrequency	TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr1:47904668_47904669insCCGCAC	ENST00000334793.5	+	1	2980_2981	c.861_862insCCGCAC	c.(862-864)ccg>CCGCACccg	p.288_288P>PHP		NM_004474.3	NP_004465.3	O60548	FOXD2_HUMAN	forkhead box D2	288	Ala-rich.|Pro-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4				READ - Rectum adenocarcinoma(2;0.0908)		cggccccgcatccgcacccgca	0.787														4830	0.964457	0.9107	0.9827	5008	,	,		7050	0.9881		0.992	False		,,,				2504	0.9714																0								ENSG00000186564			161,17		80,1,8						-2.5	0.2		dbSNP_102	1	364,38		182,0,19	no	coding	FOXD2	NM_004474.3		262,1,27	A1A1,A1R,RR		9.4527,9.5506,9.4828				525,55				FOXD2	SO:0001652	inframe_insertion	0				HGNC	AF042832	CCDS30708.1	1p34-p32	2008-02-05			ENSG00000186564	ENSG00000186564		"""Forkhead boxes"""	3803	protein-coding gene	gene with protein product		602211		FKHL17		9403061, 12621056	Standard	NM_004474		Approved	FREAC9	uc001crm.3	O60548	OTTHUMG00000007950	ENST00000334793.5:c.874_879dupCCGCAC	1.37:g.47904669_47904674dupCCGCAC	ENSP00000335493:p.HisPro292dup	Somatic	NA	NA	NA		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5SVZ3	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.291in_frame_insPH	ENST00000334793.5	37	c.861_862	CCDS30708.1	1																																																																																			-	NULL		0.787	FOXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD2	protein_coding	OTTHUMT00000021831.1	-	NM_004474			47904669	+1	no_errors	ENST00000334793	ensembl	human	known	74_37	in_frame_ins	INS	0.056:0.602	CCGCAC
USP17L2	377630	genome.wustl.edu	37	8	11995433	11995433	+	Silent	SNP	G	G	T	rs75180221		TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr8:11995433G>T	ENST00000333796.3	-	1	1153	c.837C>A	c.(835-837)gtC>gtA	p.V279V	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	279	USP.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						ATCTCTTCAAGACAAGGATGA	0.488																																																	0								ENSG00000223443						28.0	31.0	30.0					8																	11995433		1227	2812	4039	USP17L2	SO:0001819	synonymous_variant	0			-	HGNC	BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.837C>A	8.37:g.11995433G>T		Somatic	0	124	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	50	42.53		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfam_HABP4_PAIRBP1-bd,pfscan_Peptidase_C19/C67	p.V279	ENST00000333796.3	37	c.837	CCDS43713.1	8																																																																																			-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.488	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP17L2	protein_coding	OTTHUMT00000383303.2	G	NM_201402	rs75180221		11995433	-1	no_errors	ENST00000333796	ensembl	human	known	74_37	silent	SNP	0.021	T
CFAP46	54777	genome.wustl.edu	37	10	134628237	134628237	+	Missense_Mutation	SNP	C	C	T	rs375364632		TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr10:134628237C>T	ENST00000368586.5	-	52	7302	c.7202G>A	c.(7201-7203)cGg>cAg	p.R2401Q	TTC40_ENST00000263170.5_Missense_Mutation_p.R562Q	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GGGGATGGTCCGGGGGATGCT	0.657																																																	0								ENSG00000171811	C	GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	39.0	38.0	39.0		2138	4.3	0.1	10		39	0,8600		0,0,4300	no	missense	C10orf92	NM_001200049.1	43	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	713/1028	134628237	2,13004	2203	4300	6503	TTC40	SO:0001583	missense	0			-	HGNC																												ENST00000368586.5:c.7202G>A	10.37:g.134628237C>T	ENSP00000357575:p.Arg2401Gln	Somatic	0	80	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	20	48.72		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R562Q	ENST00000368586.5	37	c.1685	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239983	0.58995	4.54E-4	0.0	ENSG00000171811	ENST00000368586;ENST00000263170	T;T	0.33654	1.4;1.4	4.32	4.32	0.51571	.	0.121359	0.35013	N	0.003503	T	0.53769	0.1817	M	0.66939	2.045	0.58432	D	0.999999	D	0.89917	1.0	D	0.64144	0.922	T	0.57682	-0.7769	10	0.62326	D	0.03	.	12.3296	0.55031	0.0:1.0:0.0:0.0	.	562	Q8IYW2	CJ092_HUMAN	Q	2401;562	ENSP00000357575:R2401Q;ENSP00000263170:R562Q	ENSP00000263170:R562Q	R	-	2	0	C10orf93	134478227	0.320000	0.24616	0.083000	0.20561	0.003000	0.03518	1.881000	0.39638	1.959000	0.56917	0.591000	0.81541	CGG	-	NULL		0.657	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	protein_coding	OTTHUMT00000051095.3	C		-		134628237	-1	no_errors	ENST00000263170	ensembl	human	known	74_37	missense	SNP	0.289	T
USP17L2	377630	genome.wustl.edu	37	8	11995496	11995496	+	Silent	SNP	G	G	C			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr8:11995496G>C	ENST00000333796.3	-	1	1090	c.774C>G	c.(772-774)ctC>ctG	p.L258L	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	258	USP.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						GCGCCCTCTGGAGACAAAGAC	0.498																																																	0								ENSG00000223443						17.0	22.0	20.0					8																	11995496		1033	2414	3447	USP17L2	SO:0001819	synonymous_variant	0			-	HGNC	BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.774C>G	8.37:g.11995496G>C		Somatic	0	101	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	45	45.78		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfam_HABP4_PAIRBP1-bd,pfscan_Peptidase_C19/C67	p.L258	ENST00000333796.3	37	c.774	CCDS43713.1	8																																																																																			-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.498	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP17L2	protein_coding	OTTHUMT00000383303.2	G	NM_201402	-		11995496	-1	no_errors	ENST00000333796	ensembl	human	known	74_37	silent	SNP	0.003	C
ZNF730	100129543	genome.wustl.edu	37	19	23329315	23329315	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr19:23329315G>C	ENST00000597761.2	+	4	1668	c.1469G>C	c.(1468-1470)aGg>aCg	p.R490T		NM_001277403.1	NP_001264332.1	Q6ZMV8	ZN730_HUMAN	zinc finger protein 730	490					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|pancreas(1)|stomach(2)|urinary_tract(1)	16						AAAGCCTTTAGGCGGTTCTCA	0.358																																																	0								ENSG00000183850																																			ZNF730	SO:0001583	missense	0			-	HGNC	AK131472	CCDS59371.1	19p12	2013-01-08			ENSG00000183850	ENSG00000183850		"""Zinc fingers, C2H2-type"", ""-"""	32470	protein-coding gene	gene with protein product							Standard	NM_001277403		Approved		uc031rkc.1	Q6ZMV8		ENST00000597761.2:c.1469G>C	19.37:g.23329315G>C	ENSP00000472959:p.Arg490Thr	Somatic	0	134	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	35	55.13		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R490T	ENST00000597761.2	37	c.1469	CCDS59371.1	19	.	.	.	.	.	.	.	.	.	.	g	0.009	-1.798836	0.00617	.	.	ENSG00000183850	ENST00000327867	.	.	.	0.926	-1.85	0.07784	.	.	.	.	.	T	0.18635	0.0447	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21211	-1.0252	5	0.21014	T	0.42	.	3.0182	0.06066	0.4072:0.2334:0.3594:0.0	.	.	.	.	T	490	.	ENSP00000329365:R490T	R	+	2	0	ZNF730	23121155	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.448000	0.06820	-1.763000	0.01307	-1.740000	0.00687	AGG	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.358	ZNF730-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF730	protein_coding	OTTHUMT00000465737.2	G	XM_001719792	-		23329315	+1	no_errors	ENST00000597761	ensembl	human	known	74_37	missense	SNP	0.040	C
MICB	4277	genome.wustl.edu	37	6	31477568	31477568	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr6:31477568G>T	ENST00000252229.6	+	6	1113	c.1034G>T	c.(1033-1035)aGc>aTc	p.S345I	MICB_ENST00000399150.3_Missense_Mutation_p.S302I|MICB_ENST00000538442.1_Missense_Mutation_p.S313I	NM_005931.3	NP_005922.2			MHC class I polypeptide-related sequence B											NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	13						GAGCTTGTGAGCCTGCAGGTC	0.527																																																	0								ENSG00000204516						124.0	121.0	122.0					6																	31477568		1249	2580	3829	MICB	SO:0001583	missense	0			-	HGNC		CCDS43449.1, CCDS75422.1, CCDS75423.1	6p21.3	2013-01-11			ENSG00000204516	ENSG00000204516		"""Immunoglobulin superfamily / C1-set domain containing"""	7091	protein-coding gene	gene with protein product		602436				8022771	Standard	NM_005931		Approved	PERB11.2	uc003ntn.4	Q29980	OTTHUMG00000031074	ENST00000252229.6:c.1034G>T	6.37:g.31477568G>T	ENSP00000252229:p.Ser345Ile	Somatic	0	45	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.S345I	ENST00000252229.6	37	c.1034	CCDS43449.1	6	.	.	.	.	.	.	.	.	.	.	N	10.51	1.371047	0.24771	.	.	ENSG00000204516	ENST00000538442;ENST00000399150;ENST00000252229	T;T;T	0.01126	5.3;5.3;5.41	1.11	-0.91	0.10511	.	.	.	.	.	T	0.00875	0.0029	L	0.27053	0.805	0.09310	N	1	D;D;D	0.71674	0.994;0.998;0.998	D;D;D	0.78314	0.983;0.991;0.991	T	0.52290	-0.8595	9	0.87932	D	0	.	3.9685	0.09443	0.4956:0.0:0.5044:0.0	.	313;302;345	F5H7Q8;A2AC57;Q29980	.;.;MICB_HUMAN	I	313;302;345	ENSP00000442345:S313I;ENSP00000382103:S302I;ENSP00000252229:S345I	ENSP00000252229:S345I	S	+	2	0	MICB	31585547	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.376000	0.07465	-0.369000	0.08028	0.313000	0.20887	AGC	-	NULL		0.527	MICB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICB	protein_coding	OTTHUMT00000076102.3	G	NM_005931	-		31477568	+1	no_errors	ENST00000252229	ensembl	human	known	74_37	missense	SNP	0.001	T
PTPRZ1	5803	genome.wustl.edu	37	7	121623806	121623806	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr7:121623806C>A	ENST00000393386.2	+	7	1118	c.707C>A	c.(706-708)aCa>aAa	p.T236K	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.T236K	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	236	Alpha-carbonic anhydrase.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						GGCTCATTGACATCTCCTCCC	0.378																																																	0								ENSG00000106278						173.0	155.0	161.0					7																	121623806		2203	4300	6503	PTPRZ1	SO:0001583	missense	0			-	HGNC	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.707C>A	7.37:g.121623806C>A	ENSP00000377047:p.Thr236Lys	Somatic	0	69	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	31	55.71	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a,prints_Tyr_Pase_rcpt/non-rcpt	p.T236K	ENST00000393386.2	37	c.707	CCDS34740.1	7	.	.	.	.	.	.	.	.	.	.	C	28.1	4.891087	0.91889	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.78126	-1.15;-1.15	5.62	5.62	0.85841	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.074260	0.56097	D	0.000037	D	0.92414	0.7592	H	0.96430	3.82	0.42913	D	0.994264	D;D	0.89917	1.0;1.0	D;D	0.76071	0.973;0.987	D	0.94216	0.7463	10	0.87932	D	0	.	20.011	0.97449	0.0:1.0:0.0:0.0	.	236;236	C9JFM0;P23471	.;PTPRZ_HUMAN	K	236	ENSP00000377047:T236K;ENSP00000410000:T236K	ENSP00000377047:T236K	T	+	2	0	PTPRZ1	121411042	1.000000	0.71417	0.959000	0.39883	0.977000	0.68977	7.256000	0.78350	2.813000	0.96785	0.543000	0.68304	ACA	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a		0.378	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	protein_coding	OTTHUMT00000347288.1	C	NM_002851	-		121623806	+1	no_errors	ENST00000393386	ensembl	human	known	74_37	missense	SNP	1.000	A
TMEM71	137835	genome.wustl.edu	37	8	133759251	133759251	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr8:133759251G>A	ENST00000356838.3	-	5	509	c.367C>T	c.(367-369)Cca>Tca	p.P123S	TMEM71_ENST00000377901.4_Missense_Mutation_p.P142S|TMEM71_ENST00000523829.1_Missense_Mutation_p.P142S|TMEM71_ENST00000517538.1_5'Flank	NM_144649.2	NP_653250.2	Q6P5X7	TMM71_HUMAN	transmembrane protein 71	142						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|skin(2)	16	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			TCTTCACTTGGAGAAGAGTTG	0.418																																																	0								ENSG00000165071						144.0	126.0	132.0					8																	133759251		2203	4300	6503	TMEM71	SO:0001583	missense	0			-	HGNC	AK057631	CCDS6366.1, CCDS47921.1	8q24.22	2005-09-02				ENSG00000165071			26572	protein-coding gene	gene with protein product						12477932	Standard	NM_144649		Approved	FLJ33069	uc003ytn.3	Q6P5X7		ENST00000356838.3:c.367C>T	8.37:g.133759251G>A	ENSP00000349296:p.Pro123Ser	Somatic	0	139	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	132	80	61.97	Q3KRC2|Q8WVZ4|Q96LX9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P123S	ENST00000356838.3	37	c.367	CCDS6366.1	8	.	.	.	.	.	.	.	.	.	.	G	8.067	0.769343	0.15983	.	.	ENSG00000165071	ENST00000523829;ENST00000356838;ENST00000377901;ENST00000522334	.	.	.	5.46	0.351	0.16042	.	0.682520	0.14718	N	0.302536	T	0.33235	0.0856	M	0.67953	2.075	0.09310	N	1	B;B;B	0.27351	0.176;0.176;0.176	B;B;B	0.26202	0.046;0.046;0.067	T	0.23691	-1.0181	9	0.18710	T	0.47	0.0158	4.7591	0.13099	0.3245:0.1518:0.5237:0.0	.	142;142;123	Q6P5X7;Q6P5X7-3;Q6P5X7-2	TMM71_HUMAN;.;.	S	142;123;142;45	.	ENSP00000349296:P123S	P	-	1	0	TMEM71	133828433	0.038000	0.19896	0.001000	0.08648	0.136000	0.21042	0.480000	0.22244	0.037000	0.15575	0.313000	0.20887	CCA	-	NULL		0.418	TMEM71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM71	protein_coding	OTTHUMT00000379591.1	G	NM_144649	-		133759251	-1	no_errors	ENST00000356838	ensembl	human	known	74_37	missense	SNP	0.002	A
GRIK5	2901	genome.wustl.edu	37	19	42567637	42567637	+	Intron	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr19:42567637C>T	ENST00000262895.3	-	3	244				GRIK5_ENST00000301218.4_Intron|GRIK5_ENST00000593562.1_Intron	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5						cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				ctgatgcaggccttggggagt	0.522																																																	0								ENSG00000105737																																			GRIK5	SO:0001627	intron_variant	0			-	HGNC		CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.245-630G>A	19.37:g.42567637C>T		Somatic	0	14	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	3	83.33	Q8WWG8	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R95	ENST00000262895.3	37	c.285	CCDS12595.1	19																																																																																			-	NULL		0.522	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK5	protein_coding	OTTHUMT00000463453.1	C		-		42567637	-1	no_errors	ENST00000594528	ensembl	human	known	74_37	silent	SNP	0.020	T
EPHA3	2042	genome.wustl.edu	37	3	89259542	89259542	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr3:89259542C>T	ENST00000336596.2	+	3	911	c.686C>T	c.(685-687)tCt>tTt	p.S229F	EPHA3_ENST00000452448.2_Missense_Mutation_p.S229F|EPHA3_ENST00000494014.1_Missense_Mutation_p.S229F	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	229	Cys-rich.		S -> Y (in a lung large cell carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.S229Y(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GTTAGAGGGTCTTGTGTCAAC	0.483										TSP Lung(6;0.00050)																																							1	Substitution - Missense(1)	lung(1)						ENSG00000044524						156.0	150.0	152.0					3																	89259542		2203	4300	6503	EPHA3	SO:0001583	missense	0			-	HGNC	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.686C>T	3.37:g.89259542C>T	ENSP00000337451:p.Ser229Phe	Somatic	0	55	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	28	39.13	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.S229F	ENST00000336596.2	37	c.686	CCDS2922.1	3	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617573	0.87359	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.73789	-0.76;2.68;-0.78	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.87853	0.6282	M	0.83223	2.63	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.74023	0.982;0.965	D	0.87250	0.2272	9	.	.	.	.	20.3465	0.98790	0.0:1.0:0.0:0.0	.	229;229	P29320;P29320-2	EPHA3_HUMAN;.	F	229	ENSP00000337451:S229F;ENSP00000399926:S229F;ENSP00000419190:S229F	.	S	+	2	0	EPHA3	89342232	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.072000	0.71238	2.798000	0.96311	0.655000	0.94253	TCT	-	pirsf_Tyr_kinase_ephrin_rcpt		0.483	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA3	protein_coding	OTTHUMT00000352995.1	C	NM_005233	-		89259542	+1	no_errors	ENST00000336596	ensembl	human	known	74_37	missense	SNP	1.000	T
RGS6	9628	genome.wustl.edu	37	14	72924986	72924986	+	Silent	SNP	A	A	C	rs540336961		TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr14:72924986A>C	ENST00000553530.1	+	5	450	c.243A>C	c.(241-243)gcA>gcC	p.A81A	RGS6_ENST00000434263.2_Silent_p.A12A|RGS6_ENST00000554782.1_5'Flank|RGS6_ENST00000553690.1_3'UTR|RGS6_ENST00000402788.2_Silent_p.A81A|RGS6_ENST00000407322.4_Silent_p.A81A|RGS6_ENST00000343854.6_Silent_p.A81A|RGS6_ENST00000404301.2_Silent_p.A81A|RGS6_ENST00000406236.4_Silent_p.A81A|RGS6_ENST00000553525.1_Silent_p.A81A|RGS6_ENST00000555571.1_Silent_p.A81A|RGS6_ENST00000355512.6_Silent_p.A81A|RGS6_ENST00000556437.1_Silent_p.A81A	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	81	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		CAGTTGAAGCAATACACTTGG	0.453																																					Ovarian(143;1926 2468 21071 48641)												0								ENSG00000182732						124.0	103.0	110.0					14																	72924986		2203	4300	6503	RGS6	SO:0001819	synonymous_variant	0			-	HGNC	AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.243A>C	14.37:g.72924986A>C		Somatic	0	68	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	39	26.42	C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RGS_dom,pfam_G-protein_gamma-like_dom,pfam_DEP_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_G-protein_gamma-like_dom,smart_DEP_dom,smart_G-protein_gamma-like_dom,smart_Regulat_G_prot_signal_superfam,pfscan_DEP_dom,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.A81	ENST00000553530.1	37	c.243	CCDS9808.1	14																																																																																			-	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom		0.453	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	RGS6	protein_coding	OTTHUMT00000413033.2	A		-		72924986	+1	no_errors	ENST00000553525	ensembl	human	known	74_37	silent	SNP	1.000	C
RHOXF2	84528	genome.wustl.edu	37	X	119293221	119293221	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chrX:119293221G>A	ENST00000371388.3	+	2	570	c.380G>A	c.(379-381)gGg>gAg	p.G127E		NM_032498.1	NP_115887.1	Q9BQY4	RHXF2_HUMAN	Rhox homeobox family, member 2	127					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(2)	8						GCCGTCGGGGGGCTGGAGCCT	0.662																																																	0								ENSG00000131721						9.0	11.0	10.0					X																	119293221		2162	4212	6374	RHOXF2	SO:0001583	missense	0			-	HGNC		CCDS14594.1	Xq24	2012-12-20			ENSG00000131721	ENSG00000131721		"""Homeoboxes / PRD class"""	30011	protein-coding gene	gene with protein product	"""cancer/testis antigen 107"""	300447				12490318	Standard	NM_032498		Approved	THG1, PEPP-2, PEPP2, CT107		Q9BQY4	OTTHUMG00000022296	ENST00000371388.3:c.380G>A	X.37:g.119293221G>A	ENSP00000360441:p.Gly127Glu	Somatic	0	57	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	64	31.18	Q9BR00	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.G127E	ENST00000371388.3	37	c.380	CCDS14594.1	X	.	.	.	.	.	.	.	.	.	.	G	12.11	1.839375	0.32513	.	.	ENSG00000131721	ENST00000371388	D	0.92397	-3.03	1.92	-1.78	0.07957	Homeodomain-related (1);Homeodomain-like (1);	.	.	.	.	D	0.84465	0.5478	N	0.19112	0.55	0.09310	N	1	P	0.41232	0.743	B	0.40602	0.334	T	0.74979	-0.3479	9	0.62326	D	0.03	-0.2643	9.2156	0.37344	0.0:0.6616:0.3384:0.0	.	127	Q9BQY4	RHXF2_HUMAN	E	127	ENSP00000360441:G127E	ENSP00000360441:G127E	G	+	2	0	RHOXF2	119177249	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.069000	0.14552	-0.617000	0.05664	-0.545000	0.04230	GGG	-	superfamily_Homeodomain-like		0.662	RHOXF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOXF2	protein_coding	OTTHUMT00000411977.1	G	NM_032498	-		119293221	+1	no_errors	ENST00000371388	ensembl	human	known	74_37	missense	SNP	0.000	A
LRIG2	9860	genome.wustl.edu	37	1	113655143	113655143	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr1:113655143G>T	ENST00000361127.5	+	14	2039	c.1841G>T	c.(1840-1842)cGc>cTc	p.R614L	LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	614	Ig-like C2-type 2.				innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		CTGACTATTCGCACTGGTGCC	0.478																																																	0								ENSG00000198799						145.0	139.0	141.0					1																	113655143		2203	4300	6503	LRIG2	SO:0001583	missense	0			-	HGNC	AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.1841G>T	1.37:g.113655143G>T	ENSP00000355396:p.Arg614Leu	Somatic	0	40	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	Q9NSN2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R614L	ENST00000361127.5	37	c.1841	CCDS30808.1	1	.	.	.	.	.	.	.	.	.	.	g	34	5.351914	0.95830	.	.	ENSG00000198799	ENST00000361127	T	0.67523	-0.27	5.45	5.45	0.79879	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.57344	0.2047	N	0.24115	0.695	0.80722	D	1	P	0.43314	0.803	P	0.53006	0.715	T	0.55140	-0.8187	10	0.24483	T	0.36	.	19.2881	0.94087	0.0:0.0:1.0:0.0	.	614	O94898	LRIG2_HUMAN	L	614	ENSP00000355396:R614L	ENSP00000355396:R614L	R	+	2	0	LRIG2	113456666	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.560000	0.86352	0.591000	0.81541	CGC	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.478	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG2	protein_coding	OTTHUMT00000033549.2	G	NM_014813	-		113655143	+1	no_errors	ENST00000361127	ensembl	human	known	74_37	missense	SNP	1.000	T
SNORD3C	780853	genome.wustl.edu	37	17	19091392	19091392	+	lincRNA	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr17:19091392G>A	ENST00000362428.1	-	0	432				SNORD3A_ENST00000365494.1_lincRNA					small nucleolar RNA, C/D box 3C																		tgaacgtgtagagcaccgaaa	0.488																																																	0								ENSG00000263934						26.0	17.0	20.0					17																	19091392		870	1968	2838	SNORD3A			0			-	HGNC			17p11.2	2013-09-05			ENSG00000199298	ENSG00000264940			33191	non-coding RNA	RNA, small nucleolar						9365252	Standard	NR_006881		Approved	U3-3					17.37:g.19091392G>A		Somatic	0	711	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	587	8.27		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000362428.1	37	NULL		17																																																																																			-	-		0.488	SNORD3C-201	KNOWN	basic	snoRNA	SNORD3A	lincRNA		G	NR_006881	-		19091392	+1	no_errors	ENST00000365494	ensembl	human	known	74_37	rna	SNP	0.996	A
SCN4A	6329	genome.wustl.edu	37	17	62018305	62018305	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr17:62018305C>G	ENST00000435607.1	-	24	5413	c.5337G>C	c.(5335-5337)atG>atC	p.M1779I	SCN4A_ENST00000578147.1_Missense_Mutation_p.M1779I	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1779					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CGTGGCCATACATCTTGCTCA	0.637																																																	0								ENSG00000007314						57.0	62.0	60.0					17																	62018305		2145	4242	6387	SCN4A	SO:0001583	missense	0			-	HGNC	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.5337G>C	17.37:g.62018305C>G	ENSP00000396320:p.Met1779Ile	Somatic	0	23	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	22	37.14	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2	p.M1779I	ENST00000435607.1	37	c.5337	CCDS45761.1	17	.	.	.	.	.	.	.	.	.	.	C	1.152	-0.646433	0.03531	.	.	ENSG00000007314	ENST00000435607	D	0.95756	-3.8	4.23	4.23	0.50019	.	0.483231	0.21618	N	0.071684	D	0.87184	0.6114	N	0.08118	0	0.29296	N	0.868999	B	0.02656	0.0	B	0.01281	0.0	T	0.79727	-0.1682	10	0.54805	T	0.06	.	6.1881	0.20508	0.0:0.7077:0.1911:0.1012	.	1779	P35499	SCN4A_HUMAN	I	1779	ENSP00000396320:M1779I	ENSP00000396320:M1779I	M	-	3	0	SCN4A	59372037	0.996000	0.38824	1.000000	0.80357	0.105000	0.19272	0.377000	0.20552	2.352000	0.79861	0.561000	0.74099	ATG	-	NULL		0.637	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	protein_coding		C	NM_000334	-		62018305	-1	no_errors	ENST00000435607	ensembl	human	known	74_37	missense	SNP	1.000	G
HCP5	10866	genome.wustl.edu	37	6	31431255	31431255	+	RNA	SNP	G	G	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr6:31431255G>T	ENST00000414046.2	+	0	327					NR_040662.1		Q6MZN7	HCP5_HUMAN	HLA complex P5 (non-protein coding)						defense response (GO:0006952)					urinary_tract(1)	1						cagaaggagagaaggtgtttt	0.448																																																	0								ENSG00000206337						33.0	30.0	31.0					6																	31431255		692	1591	2283	HCP5			0			-	HGNC	D88650		6p21.3	2012-10-16	2011-08-02		ENSG00000206337	ENSG00000206337		"""Long non-coding RNAs"""	21659	non-coding RNA	RNA, long non-coding		604676	"""HLA complex P5"""			8462994, 10199916	Standard	NR_040662		Approved	D6S2650E, P5-1	uc003ntl.3	Q6MZN7	OTTHUMG00000031282		6.37:g.31431255G>T		Somatic	0	44	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q04490	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000414046.2	37	NULL		6																																																																																			-	-		0.448	HCP5-001	KNOWN	basic	sense_overlapping	HCP5	sense_overlapping	OTTHUMT00000076614.4	G	NR_040662	-		31431255	+1	no_errors	ENST00000414046	ensembl	human	known	74_37	rna	SNP	0.034	T
CCDC170	80129	genome.wustl.edu	37	6	151869452	151869452	+	Missense_Mutation	SNP	G	G	A	rs200538059		TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr6:151869452G>A	ENST00000239374.7	+	5	701	c.602G>A	c.(601-603)cGc>cAc	p.R201H	CCDC170_ENST00000367290.5_Missense_Mutation_p.R201H	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	201								p.R201H(1)									AGAGACCTGCGCAAAGAAAAT	0.353																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000120262	G	HIS/ARG	0,3670		0,0,1835	59.0	54.0	56.0		602	3.3	1.0	6		56	1,8157		0,1,4078	yes	missense	C6orf97	NM_025059.3	29	0,1,5913	AA,AG,GG		0.0123,0.0,0.0085	benign	201/716	151869452	1,11827	1835	4079	5914	CCDC170	SO:0001583	missense	0			-	HGNC	AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.602G>A	6.37:g.151869452G>A	ENSP00000239374:p.Arg201His	Somatic	0	106	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	52	8.77	Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin,superfamily_Smac_DIABLO-like	p.R201H	ENST00000239374.7	37	c.602	CCDS43515.1	6	.	.	.	.	.	.	.	.	.	.	G	7.695	0.691904	0.15039	0.0	1.23E-4	ENSG00000120262	ENST00000239374;ENST00000367290	T;T	0.10099	2.91;2.91	5.48	3.32	0.38043	.	0.552403	0.19336	N	0.116789	T	0.01156	0.0038	N	0.02011	-0.69	0.18873	N	0.999987	B	0.02656	0.0	B	0.01281	0.0	T	0.48364	-0.9042	10	0.15499	T	0.54	1.1149	10.969	0.47428	0.2274:0.0:0.7726:0.0	.	201	Q8IYT3	CF097_HUMAN	H	201	ENSP00000239374:R201H;ENSP00000356259:R201H	ENSP00000239374:R201H	R	+	2	0	C6orf97	151911145	1.000000	0.71417	0.993000	0.49108	0.723000	0.41478	1.873000	0.39558	1.271000	0.44313	0.585000	0.79938	CGC	-	NULL		0.353	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC170	protein_coding	OTTHUMT00000042727.2	G	NM_025059	rs200538059		151869452	+1	no_errors	ENST00000367290	ensembl	human	known	74_37	missense	SNP	0.998	A
RP1L1	94137	genome.wustl.edu	37	8	10469906	10469906	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr8:10469906C>T	ENST00000382483.3	-	4	1925	c.1702G>A	c.(1702-1704)Gcc>Acc	p.A568T		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	568					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CCCTCGCTGGCCTCCTGCTGA	0.657																																																	0								ENSG00000183638						56.0	66.0	63.0					8																	10469906		2116	4236	6352	RP1L1	SO:0001583	missense	0			-	HGNC	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.1702G>A	8.37:g.10469906C>T	ENSP00000371923:p.Ala568Thr	Somatic	0	71	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	12	67.57	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.A568T	ENST00000382483.3	37	c.1702	CCDS43708.1	8	.	.	.	.	.	.	.	.	.	.	C	14.15	2.448533	0.43429	.	.	ENSG00000183638	ENST00000382483	T	0.06528	3.29	4.34	-0.551	0.11822	.	3.538250	0.01140	N	0.006183	T	0.05090	0.0136	N	0.24115	0.695	0.09310	N	1	B	0.25486	0.127	B	0.23852	0.049	T	0.38001	-0.9681	10	0.62326	D	0.03	0.8502	1.8857	0.03237	0.3486:0.3592:0.1841:0.1081	.	568	A6NKC6	.	T	568	ENSP00000371923:A568T	ENSP00000371923:A568T	A	-	1	0	RP1L1	10507316	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.756000	0.04777	0.012000	0.14892	0.455000	0.32223	GCC	-	NULL		0.657	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	protein_coding	OTTHUMT00000375673.1	C		-		10469906	-1	no_errors	ENST00000382483	ensembl	human	known	74_37	missense	SNP	0.000	T
LILRB5	10990	genome.wustl.edu	37	19	54760408	54760408	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr19:54760408T>G	ENST00000316219.5	-	3	406	c.299A>C	c.(298-300)tAt>tCt	p.Y100S	LILRB5_ENST00000450632.1_Missense_Mutation_p.Y100S|LILRB5_ENST00000449561.2_Missense_Mutation_p.Y100S|LILRB5_ENST00000345866.6_Missense_Mutation_p.Y100S	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	100	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGGGGTCTCATAGTAGCAGCG	0.632																																																	0								ENSG00000105609						166.0	161.0	163.0					19																	54760408		2203	4300	6503	LILRB5	SO:0001583	missense	0			-	HGNC	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.299A>C	19.37:g.54760408T>G	ENSP00000320390:p.Tyr100Ser	Somatic	0	52	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	39	26.42	Q8N760	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.Y100S	ENST00000316219.5	37	c.299	CCDS12885.1	19	.	.	.	.	.	.	.	.	.	.	T	6.517	0.463591	0.12402	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.13307	2.6;2.6;2.6;2.6	3.29	-1.67	0.08238	Immunoglobulin-like fold (1);	1.897590	0.02347	N	0.075545	T	0.27697	0.0681	L	0.55743	1.74	0.09310	N	1	P;B;B;D;D	0.67145	0.896;0.314;0.452;0.996;0.965	D;P;P;D;D	0.80764	0.953;0.693;0.558;0.994;0.991	T	0.19910	-1.0291	10	0.62326	D	0.03	.	1.0339	0.01544	0.1539:0.2114:0.154:0.4807	.	100;91;100;100;100	C9JMK7;Q8NF80;O75023-2;O75023-3;O75023	.;.;.;.;LIRB5_HUMAN	S	100	ENSP00000320390:Y100S;ENSP00000414225:Y100S;ENSP00000406478:Y100S;ENSP00000263430:Y100S	ENSP00000320390:Y100S	Y	-	2	0	LILRB5	59452220	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.176000	0.09811	-1.130000	0.02914	-2.085000	0.00377	TAT	-	smart_Ig_sub,smart_Ig_sub2		0.632	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB5	protein_coding	OTTHUMT00000142877.2	T		-		54760408	-1	no_errors	ENST00000450632	ensembl	human	known	74_37	missense	SNP	0.000	G
KIF4B	285643	genome.wustl.edu	37	5	154394598	154394598	+	Silent	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr5:154394598G>A	ENST00000435029.4	+	1	1339	c.1179G>A	c.(1177-1179)caG>caA	p.Q393Q		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	393					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AGAAGAATCAGTCCCTGGTAG	0.463																																																	0								ENSG00000226650						127.0	128.0	128.0					5																	154394598		2203	4300	6503	KIF4B	SO:0001819	synonymous_variant	0			-	HGNC	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.1179G>A	5.37:g.154394598G>A		Somatic	0	82	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	48	29.41		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.Q393	ENST00000435029.4	37	c.1179	CCDS47324.1	5																																																																																			-	NULL		0.463	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4B	protein_coding	OTTHUMT00000377478.1	G		-		154394598	+1	no_errors	ENST00000435029	ensembl	human	known	74_37	silent	SNP	0.065	A
SCN2A	6326	genome.wustl.edu	37	2	166243439	166243439	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr2:166243439G>A	ENST00000375437.2	+	26	5025	c.4735G>A	c.(4735-4737)Gtg>Atg	p.V1579M	SCN2A_ENST00000283256.6_Missense_Mutation_p.V1579M|SCN2A_ENST00000357398.3_Missense_Mutation_p.V1579M|SCN2A_ENST00000375427.2_Missense_Mutation_p.V1579M	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1579					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGGAGAATGTGTGCTGAAACT	0.393																																																	0								ENSG00000136531						251.0	228.0	236.0					2																	166243439		2203	4300	6503	SCN2A	SO:0001583	missense	0			-	HGNC	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.4735G>A	2.37:g.166243439G>A	ENSP00000364586:p.Val1579Met	Somatic	0	70	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	3	89.29	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.V1579M	ENST00000375437.2	37	c.4735	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	G	15.75	2.926066	0.52759	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.98889	-5.21;-5.21;-5.21;-5.21	5.17	5.17	0.71159	Ion transport (1);	0.079198	0.52532	D	0.000080	D	0.98940	0.9640	M	0.78223	2.4	0.45662	D	0.998588	P;P	0.46277	0.467;0.875	B;P	0.58266	0.237;0.836	D	0.99869	1.1094	10	0.87932	D	0	.	18.6724	0.91516	0.0:0.0:1.0:0.0	.	1579;1579	Q99250-2;Q99250	.;SCN2A_HUMAN	M	1579	ENSP00000364586:V1579M;ENSP00000349973:V1579M;ENSP00000283256:V1579M;ENSP00000364576:V1579M	ENSP00000283256:V1579M	V	+	1	0	SCN2A	165951685	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.734000	0.55037	2.418000	0.82041	0.650000	0.86243	GTG	-	pfam_Ion_trans_dom		0.393	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	protein_coding	OTTHUMT00000102659.2	G	NM_021007	-		166243439	+1	no_errors	ENST00000283256	ensembl	human	known	74_37	missense	SNP	1.000	A
MYO15A	51168	genome.wustl.edu	37	17	18023164	18023164	+	Silent	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr17:18023164C>T	ENST00000205890.5	+	2	1388	c.1050C>T	c.(1048-1050)gaC>gaT	p.D350D		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	350					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CGCCGTACGACGCGCCATACC	0.607																																																	0								ENSG00000091536						82.0	93.0	89.0					17																	18023164		2034	4177	6211	MYO15A	SO:0001819	synonymous_variant	0			-	HGNC	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.1050C>T	17.37:g.18023164C>T		Somatic	0	86	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	7	86.54	B4DFC7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.D350	ENST00000205890.5	37	c.1050	CCDS42271.1	17																																																																																			-	NULL		0.607	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	protein_coding	OTTHUMT00000132048.1	C	NM_016239	-		18023164	+1	no_errors	ENST00000205890	ensembl	human	known	74_37	silent	SNP	0.000	T
MAD1L1	8379	genome.wustl.edu	37	7	1887286	1887286	+	Intron	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr7:1887286C>T	ENST00000406869.1	-	19	2556				AC110781.3_ENST00000402221.1_Silent_p.L177L|MAD1L1_ENST00000399654.2_Intron|MAD1L1_ENST00000265854.7_Intron|AC110781.3_ENST00000480694.1_3'UTR|AC110781.3_ENST00000318959.3_Silent_p.L176L|MAD1L1_ENST00000402746.1_Intron			Q9Y6D9	MD1L1_HUMAN	MAD1 mitotic arrest deficient-like 1 (yeast)						mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|regulation of metaphase plate congression (GO:0090235)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle (GO:0005819)				central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(5)	36		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		CAGCTGCCCTCGGCCCATCTC	0.667																																																	0								ENSG00000176349																																			AC110781.3	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	U33822	CCDS43539.1	7p22	2013-01-17	2001-11-28		ENSG00000002822	ENSG00000002822			6762	protein-coding gene	gene with protein product		602686	"""MAD1 (mitotic arrest deficient, yeast, homolog)-like 1"""			10049595, 9546394	Standard	XM_005249876		Approved	HsMAD1, TXBP181, MAD1, PIG9, TP53I9	uc003slg.1	Q9Y6D9	OTTHUMG00000151493	ENST00000406869.1:c.1999-31422G>A	7.37:g.1887286C>T		Somatic	0	30	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	17	32.00	B3KR41|Q13312|Q75MI0|Q86UM4|Q9UNH0	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L176	ENST00000406869.1	37	c.528	CCDS43539.1	7																																																																																			-	NULL		0.667	MAD1L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC100128374	protein_coding	OTTHUMT00000322871.1	C	NM_003550	-		1887286	+1	no_errors	ENST00000318959	ensembl	human	known	74_37	silent	SNP	0.000	T
SMURF2	64750	genome.wustl.edu	37	17	62552085	62552085	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr17:62552085C>T	ENST00000262435.9	-	14	1650	c.1463G>A	c.(1462-1464)cGa>cAa	p.R488Q		NM_022739.3	NP_073576.1	Q9HAU4	SMUF2_HUMAN	SMAD specific E3 ubiquitin protein ligase 2	488	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				BMP signaling pathway (GO:0030509)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|SMAD binding (GO:0046332)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(4)	22	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)			TCCCATTATTCGTCCAACAAA	0.333																																																	0								ENSG00000108854						79.0	69.0	72.0					17																	62552085		2203	4300	6503	SMURF2	SO:0001583	missense	0			-	HGNC	AF301463	CCDS32707.1	17q22-q23	2012-10-05			ENSG00000108854	ENSG00000108854			16809	protein-coding gene	gene with protein product		605532				11016919	Standard	XM_005257585		Approved		uc002jep.1	Q9HAU4	OTTHUMG00000179189	ENST00000262435.9:c.1463G>A	17.37:g.62552085C>T	ENSP00000262435:p.Arg488Gln	Somatic	1	165	0.60		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	85	72	54.14	Q52LL1|Q9H260	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_C2_dom,superfamily_WW_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.R488Q	ENST00000262435.9	37	c.1463	CCDS32707.1	17	.	.	.	.	.	.	.	.	.	.	C	18.48	3.633616	0.67015	.	.	ENSG00000108854	ENST00000262435	T	0.58506	0.33	5.62	5.62	0.85841	HECT (4);	0.000000	0.85682	D	0.000000	T	0.80237	0.4586	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82764	-0.0296	10	0.87932	D	0	.	19.6588	0.95855	0.0:1.0:0.0:0.0	.	488	Q9HAU4	SMUF2_HUMAN	Q	488	ENSP00000262435:R488Q	ENSP00000262435:R488Q	R	-	2	0	SMURF2	59982547	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.770000	0.85390	2.648000	0.89879	0.563000	0.77884	CGA	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT		0.333	SMURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMURF2	protein_coding	OTTHUMT00000445227.1	C	NM_022739	-		62552085	-1	no_errors	ENST00000262435	ensembl	human	known	74_37	missense	SNP	1.000	T
LINC00955	285492	genome.wustl.edu	37	4	3589656	3589669	+	Frame_Shift_Del	DEL	ACTCCCAGATGCAG	ACTCCCAGATGCAG	-	rs537957602|rs376169500|rs370505811|rs201651178	byFrequency	TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	ACTCCCAGATGCAG	ACTCCCAGATGCAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr4:3589656_3589669delACTCCCAGATGCAG	ENST00000514422.1	+	2	310_323	c.24_37delACTCCCAGATGCAG	c.(22-39)gcactcccagatgcagacfs	p.LPDAD9fs						long intergenic non-protein coding RNA 955																		GTGCACCTGCACTCCCAGATGCAGACTTCCTGGT	0.547																																																	0								ENSG00000216560																																			LINC00955	SO:0001589	frameshift_variant	0				HGNC	AK092743		4p16.3	2014-04-09			ENSG00000216560	ENSG00000216560			26644	other	unknown							Standard	NR_040045		Approved	FLJ35424			OTTHUMG00000159817	ENST00000514422.1:c.24_37delACTCCCAGATGCAG	4.37:g.3589656_3589669delACTCCCAGATGCAG	ENSP00000427553:p.Leu9fs	Somatic	NA	NA	NA		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.D11fs	ENST00000514422.1	37	c.24_37		4																																																																																			-	NULL		0.547	LINC00955-001	NOVEL	basic|appris_principal	protein_coding	LINC00955	protein_coding	OTTHUMT00000357538.6	ACTCCCAGATGCAG				3589669	+1	no_errors	ENST00000514422	ensembl	human	novel	74_37	frame_shift_del	DEL	0.086:0.080:0.080:0.088:0.143:0.156:0.154:0.145:0.135:0.135:0.134:0.130:0.136:0.162	-
MUC16	94025	genome.wustl.edu	37	19	9026241	9026241	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr19:9026241G>A	ENST00000397910.4	-	14	36948	c.36745C>T	c.(36745-36747)Cgc>Tgc	p.R12249C		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12251	SEA 2. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGCCAGTGCGACGCATGTCC	0.552																																																	0								ENSG00000181143						244.0	223.0	230.0					19																	9026241		2076	4214	6290	MUC16	SO:0001583	missense	0			-	HGNC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.36745C>T	19.37:g.9026241G>A	ENSP00000381008:p.Arg12249Cys	Somatic	0	78	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	48	15.79	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.R12249C	ENST00000397910.4	37	c.36745	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	6.444	0.450006	0.12223	.	.	ENSG00000181143	ENST00000397910	T	0.39056	1.1	2.58	0.112	0.14623	.	.	.	.	.	T	0.29524	0.0736	M	0.71581	2.175	.	.	.	P	0.46277	0.875	B	0.28553	0.091	T	0.39121	-0.9629	8	0.87932	D	0	.	3.3118	0.07020	0.1519:0.0:0.5975:0.2506	.	12249	B5ME49	.	C	12249	ENSP00000381008:R12249C	ENSP00000381008:R12249C	R	-	1	0	MUC16	8887241	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.995000	0.01472	0.109000	0.17891	0.195000	0.17529	CGC	-	pfam_SEA_dom,smart_SEA_dom		0.552	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	G	NM_024690	-		9026241	-1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	SNP	0.000	A
PCDHAC2	56134	genome.wustl.edu	37	5	140347582	140347582	+	Missense_Mutation	SNP	C	C	G	rs551685820		TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr5:140347582C>G	ENST00000289269.5	+	1	1763	c.1231C>G	c.(1231-1233)Cga>Gga	p.R411G	PCDHA13_ENST00000409494.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	411	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTGCCTTTCCGACTGAATGG	0.572													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21228	0.0		0.0	False		,,,				2504	0.0				Melanoma(190;638 2083 3390 11909 52360)												0								ENSG00000243232						90.0	86.0	87.0					5																	140347582		2203	4300	6503	PCDHAC2	SO:0001583	missense	0			-	HGNC	AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.1231C>G	5.37:g.140347582C>G	ENSP00000289269:p.Arg411Gly	Somatic	0	26	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	10	61.54	Q2M3V1|Q9Y5F4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R411G	ENST00000289269.5	37	c.1231	CCDS4242.1	5	.	.	.	.	.	.	.	.	.	.	C	1.096	-0.662629	0.03454	.	.	ENSG00000243232	ENST00000289269	T	0.55234	0.53	5.82	0.486	0.16836	Cadherin (4);Cadherin-like (1);	0.000000	0.34725	N	0.003724	T	0.40015	0.1100	L	0.46741	1.465	0.20196	N	0.99993	B;B	0.16166	0.004;0.016	B;B	0.17722	0.013;0.019	T	0.32025	-0.9922	10	0.54805	T	0.06	.	6.2459	0.20818	0.5929:0.2398:0.0981:0.0691	.	411;411	Q9Y5I4-2;Q9Y5I4	.;PCDC2_HUMAN	G	411	ENSP00000289269:R411G	ENSP00000289269:R411G	R	+	1	2	PCDHAC2	140327766	0.993000	0.37304	0.944000	0.38274	0.015000	0.08874	1.894000	0.39768	0.055000	0.16094	-0.140000	0.14226	CGA	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.572	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHAC2	protein_coding	OTTHUMT00000251802.2	C	NM_018899	-		140347582	+1	no_errors	ENST00000289269	ensembl	human	known	74_37	missense	SNP	0.143	G
ZBTB39	9880	genome.wustl.edu	37	12	57398662	57398662	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr12:57398662T>C	ENST00000300101.2	-	2	125	c.40A>G	c.(40-42)Aac>Gac	p.N14D		NM_014830.2	NP_055645.1	O15060	ZBT39_HUMAN	zinc finger and BTB domain containing 39	14					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(3)|prostate(1)	16						AGCAGGTTGTTGGGGTGGTTG	0.527																																																	0								ENSG00000166860						115.0	104.0	108.0					12																	57398662		2203	4299	6502	ZBTB39	SO:0001583	missense	0			-	HGNC	AB002350	CCDS31839.1	12q13.3	2013-01-09				ENSG00000166860		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	29014	protein-coding gene	gene with protein product						9205841	Standard	NM_014830		Approved	KIAA0352, ZNF922	uc001sml.2	O15060		ENST00000300101.2:c.40A>G	12.37:g.57398662T>C	ENSP00000300101:p.Asn14Asp	Somatic	0	52	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A7MD38|Q9UD98	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.N14D	ENST00000300101.2	37	c.40	CCDS31839.1	12	.	.	.	.	.	.	.	.	.	.	T	9.615	1.132186	0.21041	.	.	ENSG00000166860	ENST00000300101	T	0.70282	-0.47	5.93	5.93	0.95920	BTB/POZ fold (2);	0.153333	0.64402	D	0.000018	T	0.49609	0.1567	N	0.11651	0.15	0.30355	N	0.78443	P	0.44734	0.842	B	0.33750	0.169	T	0.61168	-0.7117	10	0.72032	D	0.01	-34.0578	14.335	0.66584	0.0:0.0:0.0:1.0	.	14	O15060	ZBT39_HUMAN	D	14	ENSP00000300101:N14D	ENSP00000300101:N14D	N	-	1	0	ZBTB39	55684929	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.936000	0.63506	2.271000	0.75665	0.459000	0.35465	AAC	-	superfamily_BTB/POZ_fold		0.527	ZBTB39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB39	protein_coding	OTTHUMT00000411214.1	T	NM_014830	-		57398662	-1	no_errors	ENST00000300101	ensembl	human	known	74_37	missense	SNP	1.000	C
OBSCN	84033	genome.wustl.edu	37	1	228562289	228562289	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr1:228562289G>T	ENST00000422127.1	+	97	22543	c.22499G>T	c.(22498-22500)gGa>gTa	p.G7500V	OBSCN_ENST00000570156.2_Missense_Mutation_p.G8457V|OBSCN_ENST00000366707.4_Missense_Mutation_p.G5134V	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	7500	Ig-like 55.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TTTGCAGACGGAGCCCCCCTG	0.627																																																	0								ENSG00000154358						82.0	91.0	88.0					1																	228562289		2087	4229	6316	OBSCN	SO:0001583	missense	0			-	HGNC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.22499G>T	1.37:g.228562289G>T	ENSP00000409493:p.Gly7500Val	Somatic	0	55	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.G7500V	ENST00000422127.1	37	c.22499	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.172108	0.78452	.	.	ENSG00000154358	ENST00000422127;ENST00000366707	D;D	0.87179	-2.22;-2.22	5.16	5.16	0.70880	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.814740	0.10871	N	0.624929	D	0.95755	0.8619	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.95184	0.8302	10	0.87932	D	0	.	18.6541	0.91441	0.0:0.0:1.0:0.0	.	7500	Q5VST9	OBSCN_HUMAN	V	7500;5134	ENSP00000409493:G7500V;ENSP00000355668:G5134V	ENSP00000355668:G5134V	G	+	2	0	OBSCN	226628912	1.000000	0.71417	0.090000	0.20809	0.003000	0.03518	5.865000	0.69583	2.420000	0.82092	0.561000	0.74099	GGA	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom		0.627	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	protein_coding		G	NM_052843	-		228562289	+1	no_errors	ENST00000422127	ensembl	human	known	74_37	missense	SNP	0.942	T
TET2	54790	genome.wustl.edu	37	4	106158255	106158255	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr4:106158255G>T	ENST00000540549.1	+	3	4016	c.3156G>T	c.(3154-3156)aaG>aaT	p.K1052N	TET2_ENST00000513237.1_Missense_Mutation_p.K1073N|TET2_ENST00000545826.1_Missense_Mutation_p.K1052N|TET2_ENST00000413648.2_Missense_Mutation_p.K1052N|TET2_ENST00000305737.2_Missense_Mutation_p.K1052N|TET2_ENST00000380013.4_Missense_Mutation_p.K1052N|TET2_ENST00000394764.1_Missense_Mutation_p.K1052N			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1052					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		AATCACAGAAGCAAGTAAAAG	0.448			"""Mis N, F"""		MDS																																			Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0								ENSG00000168769						78.0	75.0	76.0					4																	106158255		2203	4300	6503	TET2	SO:0001583	missense	0			-	HGNC	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.3156G>T	4.37:g.106158255G>T	ENSP00000442788:p.Lys1052Asn	Somatic	0	45	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K1052N	ENST00000540549.1	37	c.3156	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	G	17.47	3.396828	0.62177	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648	T;T;T;T;T;T;T	0.20598	2.06;2.06;3.28;2.06;2.06;2.06;2.06	5.79	3.95	0.45737	.	0.474719	0.20378	N	0.093519	T	0.22859	0.0552	L	0.40543	1.245	0.36581	D	0.873566	P;P;P	0.51537	0.467;0.467;0.946	B;B;P	0.50314	0.279;0.279;0.637	T	0.16247	-1.0409	10	0.66056	D	0.02	.	6.3434	0.21335	0.3902:0.0:0.6098:0.0	.	1073;1052;1052	E7EQS8;Q6N021;Q6N021-2	.;TET2_HUMAN;.	N	1052;1052;1052;1073;1052;1052;1052	ENSP00000306705:K1052N;ENSP00000442788:K1052N;ENSP00000442867:K1052N;ENSP00000425443:K1073N;ENSP00000369351:K1052N;ENSP00000378245:K1052N;ENSP00000391448:K1052N	ENSP00000265149:K1052N	K	+	3	2	TET2	106377704	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.939000	0.28978	1.318000	0.45170	0.655000	0.94253	AAG	-	NULL		0.448	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	protein_coding	OTTHUMT00000253952.2	G	NM_017628	-		106158255	+1	no_errors	ENST00000380013	ensembl	human	known	74_37	missense	SNP	1.000	T
SH3BGRL	6451	genome.wustl.edu	37	X	80532631	80532631	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chrX:80532631T>C	ENST00000373212.5	+	2	452	c.194T>C	c.(193-195)cTg>cCg	p.L65P	SH3BGRL_ENST00000481106.1_3'UTR	NM_003022.2	NP_003013.1	O75368	SH3L1_HUMAN	SH3 domain binding glutamate-rich protein like	65					positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(2)|ovary(1)	4		all_lung(315;5.94e-05)				GGTTACCCCCTGCCACCTCAG	0.378																																																	0								ENSG00000131171						58.0	55.0	56.0					X																	80532631		2203	4300	6503	SH3BGRL	SO:0001583	missense	0			-	HGNC	AF042081	CCDS14449.1	Xq13.3	2014-02-19	2014-02-19		ENSG00000131171	ENSG00000131171			10823	protein-coding gene	gene with protein product		300190	"""SH3 domain binding glutamic acid-rich protein like"""			9642120	Standard	NM_003022		Approved	MGC117402	uc004eef.3	O75368	OTTHUMG00000021910	ENST00000373212.5:c.194T>C	X.37:g.80532631T>C	ENSP00000362308:p.Leu65Pro	Somatic	0	237	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	80	148	35.09	Q3SYL1|Q5JT50|Q6FIE8|Q9H0N8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glut_rich_SH3-bd,superfamily_Thioredoxin-like_fold	p.L65P	ENST00000373212.5	37	c.194	CCDS14449.1	X	.	.	.	.	.	.	.	.	.	.	T	14.80	2.644981	0.47258	.	.	ENSG00000131171	ENST00000373212	T	0.77750	-1.12	5.7	4.52	0.55395	Thioredoxin-like fold (2);	0.069891	0.56097	D	0.000022	D	0.88448	0.6439	M	0.87547	2.89	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.979;0.998;0.996	D	0.88761	0.3257	10	0.87932	D	0	-3.3786	11.2759	0.49165	0.0:0.0:0.1509:0.8491	.	17;64;65	B0AZV6;D3DTE6;O75368	.;.;SH3L1_HUMAN	P	65	ENSP00000362308:L65P	ENSP00000362308:L65P	L	+	2	0	SH3BGRL	80419287	1.000000	0.71417	0.734000	0.30879	0.289000	0.27227	7.384000	0.79751	0.760000	0.33108	-0.369000	0.07265	CTG	-	pfam_Glut_rich_SH3-bd,superfamily_Thioredoxin-like_fold		0.378	SH3BGRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BGRL	protein_coding	OTTHUMT00000057350.1	T	NM_003022	-		80532631	+1	no_errors	ENST00000373212	ensembl	human	known	74_37	missense	SNP	0.903	C
TPP2	7174	genome.wustl.edu	37	13	103301602	103301602	+	Intron	DEL	T	T	-			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr13:103301602delT	ENST00000376065.4	+	22	2909				TPP2_ENST00000376052.3_Intron	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II						antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GATGTAGTCATTTTTTTTTTG	0.333																																																	0								ENSG00000134900																																			TPP2	SO:0001627	intron_variant	0				HGNC	M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.2873+101T>-	13.37:g.103301602delT		Somatic	0	44	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	25	19.35	Q5VZU8	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376065.4	37	NULL	CCDS9502.1	13																																																																																			-	-		0.333	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP2	protein_coding	OTTHUMT00000045683.2	T				103301602	+1	no_errors	ENST00000490420	ensembl	human	known	74_37	rna	DEL	0.000	-
MAP3K10	4294	genome.wustl.edu	37	19	40721091	40721091	+	Silent	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr19:40721091G>A	ENST00000253055.3	+	10	3045	c.2757G>A	c.(2755-2757)ccG>ccA	p.P919P		NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	919					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						CAGACACTCCGGAGAGCCCTG	0.692																																																	0								ENSG00000130758						9.0	9.0	9.0					19																	40721091		2164	4272	6436	MAP3K10	SO:0001819	synonymous_variant	0			-	HGNC	X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.2757G>A	19.37:g.40721091G>A		Somatic	0	52	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	28	24.32	Q12761|Q14871	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.P919	ENST00000253055.3	37	c.2757	CCDS12549.1	19																																																																																			-	pirsf_MAPKKK9/10/11		0.692	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K10	protein_coding	OTTHUMT00000462552.1	G	NM_002446	-		40721091	+1	no_errors	ENST00000253055	ensembl	human	known	74_37	silent	SNP	0.001	A
TANK	10010	genome.wustl.edu	37	2	162017849	162017849	+	Intron	SNP	G	G	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr2:162017849G>T	ENST00000392749.2	+	1	190				TANK_ENST00000461338.1_3'UTR|TANK_ENST00000259075.2_Intron|TANK_ENST00000457476.1_Intron|AC009313.1_ENST00000425470.1_RNA|TANK_ENST00000405852.1_Intron|TANK_ENST00000402568.1_Missense_Mutation_p.K17N|TANK_ENST00000406287.1_Missense_Mutation_p.K17N	NM_001199135.1	NP_001186064.1	Q92844	TANK_HUMAN	TRAF family member-associated NFKB activator						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)	21						AGGAAGTGAAGAAGCGACGTG	0.433																																																	0								ENSG00000136560																																			TANK	SO:0001627	intron_variant	0			-	HGNC	U59863	CCDS2215.1, CCDS46436.1	2q24-q31	2008-02-05			ENSG00000136560	ENSG00000136560			11562	protein-coding gene	gene with protein product		603893		TRAF2		8710854, 8855313	Standard	NM_004180		Approved	I-TRAF	uc002ubr.2	Q92844	OTTHUMG00000132037	ENST00000392749.2:c.-50+852G>T	2.37:g.162017849G>T		Somatic	0	50	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	D3DPB5|Q7Z4J6|Q92885	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K17N	ENST00000392749.2	37	c.51	CCDS2215.1	2	.	.	.	.	.	.	.	.	.	.	G	5.988	0.366251	0.11352	.	.	ENSG00000136560	ENST00000406287;ENST00000402568	.	.	.	2.54	1.63	0.23807	.	.	.	.	.	T	0.40448	0.1117	.	.	.	0.20764	N	0.999854	.	.	.	.	.	.	T	0.35375	-0.9791	5	0.87932	D	0	.	6.5335	0.22339	0.0:0.0:0.7125:0.2874	.	.	.	.	N	17	.	ENSP00000384235:K17N	K	+	3	2	TANK	161726095	0.003000	0.15002	0.012000	0.15200	0.040000	0.13550	0.324000	0.19610	0.613000	0.30089	-0.309000	0.09137	AAG	-	NULL		0.433	TANK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TANK	protein_coding	OTTHUMT00000324232.1	G	NM_133484	-		162017849	+1	no_errors	ENST00000402568	ensembl	human	putative	74_37	missense	SNP	0.014	T
OAS3	4940	genome.wustl.edu	37	12	113401152	113401152	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr12:113401152A>G	ENST00000228928.7	+	10	2298	c.2119A>G	c.(2119-2121)Aac>Gac	p.N707D	RP1-71H24.1_ENST00000552784.1_RNA	NM_006187.2	NP_006178.2	Q9Y6K5	OAS3_HUMAN	2'-5'-oligoadenylate synthetase 3, 100kDa	707	OAS domain 2.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|nucleobase-containing compound metabolic process (GO:0006139)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|skin(2)	27						TCCCACCTGGAACGTGGGCCA	0.652																																																	0								ENSG00000111331						13.0	15.0	14.0					12																	113401152		1945	4119	6064	OAS3	SO:0001583	missense	0			-	HGNC	AF063613	CCDS44981.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111331			8088	protein-coding gene	gene with protein product		603351	"""2'-5'-oligoadenylate synthetase 3 (100 kD)"""			9790745	Standard	NM_006187		Approved		uc001tug.3	Q9Y6K5	OTTHUMG00000169795	ENST00000228928.7:c.2119A>G	12.37:g.113401152A>G	ENSP00000228928:p.Asn707Asp	Somatic	0	23	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	25	32.43	Q2HJ14|Q9H3P5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_2-5-oligoAdlate_synth_1_dom2/C,pfam_Nucleotidyltransferase,pfscan_2-5-oligoadenylate_synth_N	p.N707D	ENST00000228928.7	37	c.2119	CCDS44981.1	12	.	.	.	.	.	.	.	.	.	.	A	14.59	2.581617	0.46006	.	.	ENSG00000111331	ENST00000228928;ENST00000323881	T	0.55052	0.54	4.39	3.25	0.37280	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	.	.	.	.	T	0.42154	0.1190	L	0.28115	0.83	0.80722	D	1	B	0.26577	0.153	B	0.37304	0.246	T	0.34551	-0.9824	9	0.59425	D	0.04	.	6.3665	0.21457	0.8868:0.0:0.1132:0.0	.	707	Q9Y6K5	OAS3_HUMAN	D	707;706	ENSP00000228928:N707D	ENSP00000228928:N707D	N	+	1	0	OAS3	111885535	0.999000	0.42202	0.999000	0.59377	0.895000	0.52256	1.870000	0.39529	0.731000	0.32448	0.460000	0.39030	AAC	-	pfam_2-5-oligoAdlate_synth_1_dom2/C		0.652	OAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OAS3	protein_coding	OTTHUMT00000405920.1	A		-		113401152	+1	no_errors	ENST00000228928	ensembl	human	known	74_37	missense	SNP	0.998	G
GBP2	2634	genome.wustl.edu	37	1	89578203	89578203	+	Silent	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr1:89578203C>T	ENST00000370466.3	-	8	1582	c.1314G>A	c.(1312-1314)ctG>ctA	p.L438L	GBP2_ENST00000463660.1_5'UTR	NM_004120.3	NP_004111.2	P32456	GBP2_HUMAN	guanylate binding protein 2, interferon-inducible	438					cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(1)	20		Lung NSC(277;0.0908)		all cancers(265;0.0151)|Epithelial(280;0.0284)		TCAGCTCCTGCAGCTTCTGAG	0.463																																																	0								ENSG00000162645						180.0	174.0	176.0					1																	89578203		2203	4300	6503	GBP2	SO:0001819	synonymous_variant	0			-	HGNC	BC073163	CCDS719.1	1p22.2	2008-02-05			ENSG00000162645	ENSG00000162645			4183	protein-coding gene	gene with protein product		600412				1715024	Standard	NM_004120		Approved		uc001dmz.1	P32456	OTTHUMG00000010662	ENST00000370466.3:c.1314G>A	1.37:g.89578203C>T		Somatic	0	43	0.00		0.7370036302239749	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q6GPH0|Q6IAU2|Q86TB0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Guanylate-bd_C,pfam_Guanylate-bd_N,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.L438	ENST00000370466.3	37	c.1314	CCDS719.1	1																																																																																			-	pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C		0.463	GBP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GBP2	protein_coding	OTTHUMT00000029406.2	C	NM_004120	-		89578203	-1	no_errors	ENST00000370466	ensembl	human	known	74_37	silent	SNP	0.000	T
