#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
NPY4R	5540	genome.wustl.edu	37	10	47087136	47087136	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr10:47087136C>A	ENST00000395716.1	+	2	438	c.353C>A	c.(352-354)gCc>gAc	p.A118D	NPY4R_ENST00000374312.1_Missense_Mutation_p.A118D			P50391	NPY4R_HUMAN	neuropeptide Y receptor Y4	118					blood circulation (GO:0008015)|digestion (GO:0007586)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|pancreatic polypeptide receptor activity (GO:0001602)|peptide binding (GO:0042277)|peptide YY receptor activity (GO:0001601)										AAGATGTCGGCCTTCATCCAG	0.582																																																	0								ENSG00000204174						280.0	255.0	263.0					10																	47087136		2203	4300	6503	NPY4R	SO:0001583	missense	0			-	HGNC		CCDS73100.1	10q11.2	2013-03-26	2013-03-26	2013-03-26	ENSG00000204174	ENSG00000204174		"""GPCR / Class A : Neuropeptide receptors : Y"""	9329	protein-coding gene	gene with protein product		601790	"""pancreatic polypeptide receptor 1"""	PPYR1		9417917	Standard	NM_005972		Approved	Y4, PP1	uc001jee.3	P50391	OTTHUMG00000018108	ENST00000395716.1:c.353C>A	10.37:g.47087136C>A	ENSP00000379066:p.Ala118Asp	Somatic	0	41	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	33	19.51	Q13456|Q5ISU3|Q5T2X9|Q6FH06	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_NPY4_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.A118D	ENST00000395716.1	37	c.353	CCDS31193.1	10	.	.	.	.	.	.	.	.	.	.	C	9.317	1.057162	0.19907	.	.	ENSG00000204174	ENST00000374312;ENST00000395716	T;T	0.38077	1.16;1.16	5.0	3.15	0.36227	GPCR, rhodopsin-like superfamily (1);	0.245466	0.42053	D	0.000779	T	0.35278	0.0926	M	0.81682	2.555	0.30801	N	0.73983	P	0.34699	0.464	B	0.32928	0.155	T	0.44711	-0.9310	10	0.54805	T	0.06	.	4.8391	0.13481	0.1697:0.65:0.0:0.1803	.	118	P50391	NPY4R_HUMAN	D	118	ENSP00000363431:A118D;ENSP00000379066:A118D	ENSP00000363431:A118D	A	+	2	0	PPYR1	46507142	1.000000	0.71417	0.064000	0.19789	0.030000	0.12068	5.635000	0.67841	0.643000	0.30638	-0.136000	0.14681	GCC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM		0.582	NPY4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPY4R	protein_coding	OTTHUMT00000047837.1	C		-		47087136	+1	no_errors	ENST00000374312	ensembl	human	known	74_37	missense	SNP	0.979	A
MRGPRX2	117194	genome.wustl.edu	37	11	19076965	19076965	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr11:19076965G>T	ENST00000329773.2	-	2	1072	c.985C>A	c.(985-987)Ctg>Atg	p.L329M		NM_054030.2	NP_473371.1	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	329					positive regulation of cytokinesis (GO:0032467)|sensory perception of pain (GO:0019233)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide binding (GO:0042923)			NS(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	15						CTCTACACCAGACTGCTTCTC	0.532																																					GBM(198;1966 2199 4849 37227 49954)												0								ENSG00000183695						59.0	59.0	59.0					11																	19076965		2199	4293	6492	MRGPRX2	SO:0001583	missense	0			-	HGNC		CCDS7847.1	11p15.1	2013-10-10			ENSG00000183695	ENSG00000183695		"""GPCR / Class A : Orphans"""	17983	protein-coding gene	gene with protein product		607228				11551509	Standard	NM_054030		Approved	MRGX2	uc001mph.3	Q96LB1	OTTHUMG00000166098	ENST00000329773.2:c.985C>A	11.37:g.19076965G>T	ENSP00000333800:p.Leu329Met	Somatic	0	36	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	B5B0C7|Q4QXW4|Q4QXW7|Q4QXX0|Q4QXX2|Q4QXX3|Q4QXX4|Q4QXX6|Q4QXX7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.L329M	ENST00000329773.2	37	c.985	CCDS7847.1	11	.	.	.	.	.	.	.	.	.	.	.	13.16	2.154999	0.38021	.	.	ENSG00000183695	ENST00000329773	T	0.07021	3.23	4.03	-0.17	0.13335	.	3.755410	0.00866	N	0.001974	T	0.21881	0.0527	M	0.61703	1.905	0.09310	N	1	D	0.71674	0.998	D	0.66716	0.946	T	0.10291	-1.0636	10	0.72032	D	0.01	.	1.8332	0.03134	0.1094:0.1996:0.3903:0.3007	.	329	Q96LB1	MRGX2_HUMAN	M	329	ENSP00000333800:L329M	ENSP00000333800:L329M	L	-	1	2	MRGPRX2	19033541	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.287000	0.08388	-0.015000	0.14150	0.655000	0.94253	CTG	-	NULL		0.532	MRGPRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX2	protein_coding	OTTHUMT00000387819.1	G	NM_054030	-		19076965	-1	no_errors	ENST00000329773	ensembl	human	known	74_37	missense	SNP	0.000	T
RELN	5649	genome.wustl.edu	37	7	103183203	103183203	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr7:103183203G>A	ENST00000428762.1	-	43	6805	c.6646C>T	c.(6646-6648)Cga>Tga	p.R2216*	RELN_ENST00000343529.5_Nonsense_Mutation_p.R2216*|RELN_ENST00000424685.2_Nonsense_Mutation_p.R2216*	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2216					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCCAGGTCTCGTGTCATCAAC	0.373																																					NSCLC(146;835 1944 15585 22231 52158)												0								ENSG00000189056						119.0	112.0	114.0					7																	103183203		2203	4300	6503	RELN	SO:0001587	stop_gained	0			-	HGNC		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6646C>T	7.37:g.103183203G>A	ENSP00000392423:p.Arg2216*	Somatic	0	58	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	44	31.25	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Sialidases,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.R2216*	ENST00000428762.1	37	c.6646	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	G	48	14.610394	0.99803	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	.	.	.	5.93	5.93	0.95920	.	0.220988	0.39909	N	0.001236	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.3495	0.98807	0.0:0.0:1.0:0.0	.	.	.	.	X	2216	.	ENSP00000345694:R2216X	R	-	1	2	RELN	102970439	0.808000	0.29022	1.000000	0.80357	0.969000	0.65631	2.586000	0.46119	2.814000	0.96858	0.591000	0.81541	CGA	-	superfamily_Sialidases		0.373	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	protein_coding	OTTHUMT00000348148.1	G	NM_005045	-		103183203	-1	no_errors	ENST00000424685	ensembl	human	known	74_37	nonsense	SNP	0.991	A
FGD5	152273	genome.wustl.edu	37	3	14960294	14960294	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr3:14960294G>T	ENST00000285046.5	+	13	3633	c.3523G>T	c.(3523-3525)Gct>Tct	p.A1175S	FGD5_ENST00000543601.1_Missense_Mutation_p.A934S|FGD5-AS1_ENST00000430166.1_RNA|FGD5_ENST00000476851.1_3'UTR	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	1175	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						AGTGCCCTACGCTCTAAAGAT	0.597																																																	0								ENSG00000154783						101.0	99.0	100.0					3																	14960294		2045	4193	6238	FGD5	SO:0001583	missense	0			-	HGNC	AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.3523G>T	3.37:g.14960294G>T	ENSP00000285046:p.Ala1175Ser	Somatic	0	95	0.00		0.6597972753633179	28	76.47	91	WXS	Illumina HiSeq 2500	Phase_IV	tier1	79	35	69.30	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.A1175S	ENST00000285046.5	37	c.3523	CCDS46767.1	3	.	.	.	.	.	.	.	.	.	.	G	13.92	2.380868	0.42207	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	T;T	0.74842	-0.88;-0.88	3.86	3.86	0.44501	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.280885	0.25025	N	0.033733	T	0.77246	0.4102	L	0.54323	1.7	0.24173	N	0.995611	B;B	0.32620	0.173;0.378	P;P	0.47827	0.558;0.558	T	0.67273	-0.5712	10	0.27082	T	0.32	-18.4664	12.6537	0.56776	0.0:0.0:1.0:0.0	.	934;1175	B7ZM68;Q6ZNL6	.;FGD5_HUMAN	S	1175;934	ENSP00000285046:A1175S;ENSP00000445949:A934S	ENSP00000285046:A1175S	A	+	1	0	FGD5	14935298	0.569000	0.26643	0.319000	0.25293	0.646000	0.38490	3.278000	0.51662	1.988000	0.58038	0.591000	0.81541	GCT	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.597	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD5	protein_coding	OTTHUMT00000340628.1	G	NM_152536	-		14960294	+1	no_errors	ENST00000285046	ensembl	human	known	74_37	missense	SNP	0.530	T
ZNF740	283337	genome.wustl.edu	37	12	53580211	53580211	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr12:53580211G>A	ENST00000416904.3	+	6	855	c.410G>A	c.(409-411)cGt>cAt	p.R137H		NM_001004304.3	NP_001004304.1	Q8NDX6	ZN740_HUMAN	zinc finger protein 740	137					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)	3						TGTGATATGCGTTTCATCCAG	0.502																																																	0								ENSG00000139651						77.0	79.0	78.0					12																	53580211		2036	4182	6218	ZNF740	SO:0001583	missense	0			-	HGNC	BC053557	CCDS44896.1	12q13.13	2013-01-08				ENSG00000139651		"""Zinc fingers, C2H2-type"""	27465	protein-coding gene	gene with protein product							Standard	NM_001004304		Approved	Zfp740	uc001scb.4	Q8NDX6		ENST00000416904.3:c.410G>A	12.37:g.53580211G>A	ENSP00000409463:p.Arg137His	Somatic	0	53	0.00		0.6597972753633179	25	19.35	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	56	20.00	A8K9M9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R137H	ENST00000416904.3	37	c.410	CCDS44896.1	12	.	.	.	.	.	.	.	.	.	.	G	27.4	4.827887	0.90955	.	.	ENSG00000139651	ENST00000416904	T	0.19938	2.11	5.75	5.75	0.90469	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.108925	0.39083	N	0.001468	T	0.44726	0.1307	M	0.73430	2.235	0.49051	D	0.999746	D	0.89917	1.0	D	0.68353	0.957	T	0.33292	-0.9874	10	0.72032	D	0.01	-14.9527	12.4482	0.55664	0.0778:0.0:0.9222:0.0	.	137	Q8NDX6	ZN740_HUMAN	H	137	ENSP00000409463:R137H	ENSP00000409463:R137H	R	+	2	0	ZNF740	51866478	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.419000	0.66435	2.894000	0.99253	0.655000	0.94253	CGT	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.502	ZNF740-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF740	protein_coding	OTTHUMT00000406890.2	G	NM_001004304	-		53580211	+1	no_errors	ENST00000416904	ensembl	human	known	74_37	missense	SNP	1.000	A
INPP5D	3635	genome.wustl.edu	37	2	234072418	234072418	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr2:234072418G>A	ENST00000359570.5	+	14	1270	c.1270G>A	c.(1270-1272)Gac>Aac	p.D424N	INPP5D_ENST00000538935.1_Missense_Mutation_p.D423N|INPP5D_ENST00000455936.2_Missense_Mutation_p.D188N|INPP5D_ENST00000450745.1_Missense_Mutation_p.D188N			Q92835	SHIP1_HUMAN	inositol polyphosphate-5-phosphatase, 145kDa	436					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|determination of adult lifespan (GO:0008340)|immunoglobulin mediated immune response (GO:0016064)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of bone resorption (GO:0045779)|negative regulation of immune response (GO:0050777)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of neutrophil differentiation (GO:0045659)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of signal transduction (GO:0009968)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of erythrocyte differentiation (GO:0045648)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|membrane (GO:0016020)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)			central_nervous_system(1)|ovary(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		AAAGACGCGGGACGACTCTGC	0.557																																					NSCLC(82;1215 1426 16163 20348 41018)												0								ENSG00000168918						147.0	153.0	151.0					2																	234072418		2055	4187	6242	INPP5D	SO:0001583	missense	0			-	HGNC	U57650	CCDS74672.1	2q37.1	2013-02-14	2002-08-29		ENSG00000168918	ENSG00000168918		"""SH2 domain containing"""	6079	protein-coding gene	gene with protein product		601582	"""inositol polyphosphate-5-phosphatase, 145kD"""			8643691, 8874179	Standard	NM_001017915		Approved	SHIP, hp51CN	uc010zmp.2	Q92835	OTTHUMG00000133688	ENST00000359570.5:c.1270G>A	2.37:g.234072418G>A	ENSP00000352575:p.Asp424Asn	Somatic	0	59	0.00		0.6597972753633179	11	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	70	16.67	O00145|Q13544|Q13545|Q6P5A4|Q92656|Q9UE80	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Endo/exonuclease/phosphatase,pfam_SH2,superfamily_Endo/exonuclease/phosphatase,smart_SH2,smart_IPPc,pfscan_SH2,prints_SH2	p.D424N	ENST00000359570.5	37	c.1270		2	.	.	.	.	.	.	.	.	.	.	G	33	5.214614	0.95104	.	.	ENSG00000168918	ENST00000359570;ENST00000538935;ENST00000450745;ENST00000455936;ENST00000435188;ENST00000415617;ENST00000445964	D;D;D;D;D;D;D	0.97232	-4.28;-4.22;-4.3;-4.3;-4.27;-4.27;-4.27	5.08	5.08	0.68730	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.102976	0.64402	D	0.000004	D	0.98005	0.9343	.	.	.	0.53688	D	0.999977	D;D	0.69078	0.997;0.987	P;P	0.62491	0.903;0.841	D	0.97752	1.0215	9	0.41790	T	0.15	.	18.6649	0.91486	0.0:0.0:1.0:0.0	.	435;436	Q92835-2;Q92835	.;SHIP1_HUMAN	N	424;423;188;188;57;57;57	ENSP00000352575:D424N;ENSP00000441010:D423N;ENSP00000407916:D188N;ENSP00000404610:D188N;ENSP00000400151:D57N;ENSP00000397421:D57N;ENSP00000405338:D57N	ENSP00000352575:D424N	D	+	1	0	INPP5D	233736490	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	9.203000	0.95033	2.652000	0.90054	0.655000	0.94253	GAC	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc		0.557	INPP5D-201	KNOWN	basic|appris_principal	protein_coding	INPP5D	protein_coding		G	NM_001017915	-		234072418	+1	no_errors	ENST00000359570	ensembl	human	known	74_37	missense	SNP	1.000	A
GALNT6	11226	genome.wustl.edu	37	12	51785401	51785402	+	5'Flank	INS	-	-	AGCCGC	rs143011477	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr12:51785401_51785402insAGCCGC	ENST00000356317.3	-	0	0				SLC4A8_ENST00000535225.2_Intron|GALNT6_ENST00000603203.1_5'UTR	NM_007210.3	NP_009141.2	Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CGCCGAGGCAAAGCCGCAGCCG	0.757														1258	0.251198	0.0234	0.245	5008	,	,		9662	0.2897		0.4155	False		,,,				2504	0.3548																0								ENSG00000139629																																			GALNT6	SO:0001631	upstream_gene_variant	0				HGNC	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4			12.37:g.51785402_51785407dupAGCCGC	Exception_encountered	Somatic	NA	NA	NA		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q8IYH4|Q9H6G2|Q9UIV5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000356317.3	37	NULL	CCDS8813.1	12																																																																																			-	-		0.757	GALNT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT6	protein_coding	OTTHUMT00000469736.1	-	NM_007210			51785402	-1	no_errors	ENST00000603203	ensembl	human	known	74_37	rna	INS	0.021:0.127	AGCCGC
CCDC27	148870	genome.wustl.edu	37	1	3679935	3679935	+	Silent	SNP	G	G	A	rs201495912		TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr1:3679935G>A	ENST00000294600.2	+	7	1302	c.1218G>A	c.(1216-1218)tcG>tcA	p.S406S		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	406	Glu-rich.									breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		TGGCCGAGTCGTTTGAGGAGG	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		18046	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000162592			0,4406		0,0,2203	63.0	63.0	63.0		1218	-5.7	0.0	1		63	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CCDC27	NM_152492.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		406/657	3679935	1,13005	2203	4300	6503	CCDC27	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC		CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.1218G>A	1.37:g.3679935G>A		Somatic	0	61	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	78	23.53	Q5TBV3|Q96M50	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin	p.S406	ENST00000294600.2	37	c.1218	CCDS50.1	1																																																																																			-	NULL		0.607	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC27	protein_coding	OTTHUMT00000009740.1	G	NM_152492	rs201495912		3679935	+1	no_errors	ENST00000294600	ensembl	human	known	74_37	silent	SNP	0.000	A
TDRD1	56165	genome.wustl.edu	37	10	115962849	115962849	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr10:115962849G>A	ENST00000369280.1	+	7	1175	c.715G>A	c.(715-717)Gtt>Att	p.V239I	TDRD1_ENST00000369281.2_Missense_Mutation_p.V239I|TDRD1_ENST00000422662.1_5'UTR|TDRD1_ENST00000369282.1_Missense_Mutation_p.V239I|TDRD1_ENST00000251864.2_Missense_Mutation_p.V239I			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	239					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		TCCACTTGGAGTTACTAAGGA	0.373																																																	0								ENSG00000095627						95.0	90.0	92.0					10																	115962849		2203	4300	6503	TDRD1	SO:0001583	missense	0			-	HGNC	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.715G>A	10.37:g.115962849G>A	ENSP00000358286:p.Val239Ile	Somatic	0	66	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	62	39.22	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tudor,pfam_Znf_MYND,smart_Tudor,pfscan_Tudor,pfscan_Znf_MYND	p.V239I	ENST00000369280.1	37	c.715		10	.	.	.	.	.	.	.	.	.	.	G	4.196	0.035101	0.08148	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369281;ENST00000369280	T;T;T;T	0.19532	3.02;3.01;2.14;3.03	5.96	-1.25	0.09405	.	1.045250	0.07480	N	0.903690	T	0.14527	0.0351	L	0.44542	1.39	0.22127	N	0.999347	B;B;B;B	0.14012	0.005;0.005;0.009;0.004	B;B;B;B	0.18561	0.01;0.01;0.022;0.011	T	0.39396	-0.9616	10	0.13853	T	0.58	-1.4698	4.4234	0.11492	0.3932:0.3101:0.2967:0.0	.	239;239;239;239	Q9BXT4;B7WPM2;Q9BXT4-3;Q9BXT4-2	TDRD1_HUMAN;.;.;.	I	239	ENSP00000358288:V239I;ENSP00000251864:V239I;ENSP00000358287:V239I;ENSP00000358286:V239I	ENSP00000251864:V239I	V	+	1	0	TDRD1	115952839	0.877000	0.30153	0.153000	0.22517	0.429000	0.31625	0.018000	0.13422	-0.090000	0.12462	-0.225000	0.12378	GTT	-	NULL		0.373	TDRD1-001	KNOWN	basic	protein_coding	TDRD1	protein_coding	OTTHUMT00000050457.2	G		-		115962849	+1	no_errors	ENST00000251864	ensembl	human	known	74_37	missense	SNP	0.262	A
EXO1	9156	genome.wustl.edu	37	1	242013723	242013723	+	5'UTR	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr1:242013723G>A	ENST00000366548.3	+	0	589				EXO1_ENST00000518483.1_5'UTR|EXO1_ENST00000493702.1_3'UTR|EXO1_ENST00000348581.5_5'UTR	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1						DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			AGTTAATTTGGCACCATGGGG	0.358								Editing and processing nucleases																																									0								ENSG00000174371						88.0	85.0	86.0					1																	242013723		2203	4300	6503	EXO1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.-5G>A	1.37:g.242013723G>A		Somatic	0	46	0.00		0.6597972753633179	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.26	O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366548.3	37	NULL	CCDS1620.1	1																																																																																			-	-		0.358	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXO1	protein_coding	OTTHUMT00000096405.1	G	NM_006027	-		242013723	+1	no_errors	ENST00000493702	ensembl	human	known	74_37	rna	SNP	0.918	A
ZNF645	158506	genome.wustl.edu	37	X	22291373	22291373	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chrX:22291373G>A	ENST00000323684.1	+	1	309	c.265G>A	c.(265-267)Gga>Aga	p.G89R		NM_152577.3	NP_689790.1	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	89					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|large_intestine(8)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	27						TGACAAAGTCGGATATAAAGT	0.403																																																	0								ENSG00000175809						73.0	64.0	67.0					X																	22291373		2203	4300	6503	ZNF645	SO:0001583	missense	0			-	HGNC	AK098601	CCDS14205.1	Xp22.11	2014-01-21			ENSG00000175809	ENSG00000175809			26371	protein-coding gene	gene with protein product							Standard	NM_152577		Approved	FLJ25735, HAKAIL, CT138	uc004dai.2	Q8N7E2	OTTHUMG00000021242	ENST00000323684.1:c.265G>A	X.37:g.22291373G>A	ENSP00000323348:p.Gly89Arg	Somatic	0	68	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	83	13.40	A0AV29|A0AV31|E3SBK4|Q6DJY9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfscan_Znf_RING,pfscan_Znf_C2H2	p.G89R	ENST00000323684.1	37	c.265	CCDS14205.1	X	.	.	.	.	.	.	.	.	.	.	G	13.54	2.267674	0.40095	.	.	ENSG00000175809	ENST00000323684	T	0.33216	1.42	3.49	0.633	0.17712	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.406566	0.23834	U	0.044116	T	0.19604	0.0471	L	0.46157	1.445	0.09310	N	1	D	0.54772	0.968	B	0.39617	0.305	T	0.17077	-1.0381	10	0.45353	T	0.12	.	4.096	0.09991	0.2276:0.0:0.5869:0.1855	.	89	Q8N7E2	ZN645_HUMAN	R	89	ENSP00000323348:G89R	ENSP00000323348:G89R	G	+	1	0	ZNF645	22201294	0.000000	0.05858	0.001000	0.08648	0.030000	0.12068	0.136000	0.15974	0.017000	0.15025	0.436000	0.28706	GGA	-	pfscan_Znf_RING		0.403	ZNF645-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF645	protein_coding	OTTHUMT00000056037.1	G	NM_152577	-		22291373	+1	no_errors	ENST00000323684	ensembl	human	known	74_37	missense	SNP	0.002	A
ZNF813	126017	genome.wustl.edu	37	19	54007225	54007225	+	IGR	SNP	C	C	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr19:54007225C>T	ENST00000396421.4	+	0	300				CTD-2224J9.8_ENST00000601966.1_RNA			Q6ZN06	ZN813_HUMAN	zinc finger protein 813						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		GGGGCTCATGCTCTGGGGCAG	0.597																																																	0								ENSG00000213777																																			CTD-2224J9.8	SO:0001628	intergenic_variant	0			-	Clone_based_vega_gene	AK091460	CCDS46172.1	19q13.41	2013-01-08			ENSG00000198346	ENSG00000198346		"""Zinc fingers, C2H2-type"", ""-"""	33257	protein-coding gene	gene with protein product							Standard	NM_001004301		Approved	FLJ16542	uc002qbu.2	Q6ZN06	OTTHUMG00000158309		19.37:g.54007225C>T		Somatic	0	11	0.00		0.6597972753633179	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	14	30.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000396421.4	37	NULL		19																																																																																			-	-		0.597	ZNF813-201	KNOWN	basic	protein_coding	ENSG00000213777	protein_coding		C	NM_001004301	-		54007225	+1	no_errors	ENST00000597004	ensembl	human	known	74_37	rna	SNP	0.844	T
ADCK5	203054	genome.wustl.edu	37	8	145617535	145617549	+	Splice_Site	DEL	GGGGGTGCAAGGTGA	GGGGGTGCAAGGTGA	-	rs563415390|rs148509143|rs374281647	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	GGGGGTGCAAGGTGA	GGGGGTGCAAGGTGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr8:145617535_145617549delGGGGGTGCAAGGTGA	ENST00000308860.6	+	12	1301_1311	c.1257_1267delGGGGGTGCAAGGTGA	c.(1255-1269)ctgggggtgcaaggt>ctgt	p.GVQG420del	CPSF1_ENST00000531727.1_5'Flank|MIR939_ENST00000401314.1_RNA	NM_174922.3	NP_777582.4	Q3MIX3	ADCK5_HUMAN	aarF domain containing kinase 5	420						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	protein serine/threonine kinase activity (GO:0004674)	p.?(2)		endometrium(1)|lung(2)|prostate(2)|skin(1)|stomach(2)	8	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;8.96e-41)|Epithelial(56;4.08e-40)|all cancers(56;4.51e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CAGCCGCACTGGGGGTGCAAGGTGAGGGGGTGCAA	0.73														3140	0.626997	0.8109	0.562	5008	,	,		8769	0.6577		0.4205	False		,,,				2504	0.6053																2	Unknown(2)	prostate(2)						ENSG00000173137			1836,894		805,226,334						4.5	0.7		dbSNP_120	4	2015,4403		639,737,1833	no	coding-near-splice	ADCK5	NM_174922.3		1444,963,2167	A1A1,A1R,RR		31.3961,32.7473,42.0966				3851,5297				ADCK5	SO:0001630	splice_region_variant	0				HGNC	BC032402	CCDS34965.1, CCDS34965.2	8q24.3	2004-07-06			ENSG00000173137	ENSG00000173137			21738	protein-coding gene	gene with protein product							Standard	NM_174922		Approved	FLJ35454	uc003zch.3	Q3MIX3	OTTHUMG00000165190	ENST00000308860.6:c.1267+1GGGGGTGCAAGGTGA>-	8.37:g.145617535_145617549delGGGGGTGCAAGGTGA		Somatic	NA	NA	NA		0.6597972753633179	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KS46|Q5U4P1|Q6P2S4|Q8N5V3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_UbiB_dom,superfamily_Kinase-like_dom	p.G420fs	ENST00000308860.6	37	c.1257_1267	CCDS34965.1	8																																																																																			-	NULL		0.730	ADCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCK5	protein_coding	OTTHUMT00000382556.2	GGGGGTGCAAGGTGA	NM_174922		In_Frame_Del	145617549	+1	no_errors	ENST00000308860	ensembl	human	known	74_37	frame_shift_del	DEL	0.999:0.998:1.000:0.999:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
FAM204A	63877	genome.wustl.edu	37	10	120070202	120070202	+	3'UTR	SNP	C	C	G			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr10:120070202C>G	ENST00000369183.4	-	0	1128				FAM204A_ENST00000469758.1_5'Flank	NM_022063.2	NP_071346.1	Q9H8W3	F204A_HUMAN	family with sequence similarity 204, member A											kidney(1)|large_intestine(5)|lung(4)|ovary(1)	11						TTCAATAGGACAAAGTCCTTA	0.254																																																	0								ENSG00000165669																																			FAM204A	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK023250	CCDS7605.1	10q26.12	2011-06-01	2011-06-01	2011-06-01	ENSG00000165669	ENSG00000165669			25794	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 84"""	C10orf84		12477932	Standard	NM_022063		Approved	FLJ13188, bA319I23.1	uc010qss.1	Q9H8W3	OTTHUMG00000019131	ENST00000369183.4:c.*167G>C	10.37:g.120070202C>G		Somatic	0	11	0.00		0.6597972753633179	84	28.21	33	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	12	25.00	D3DRC6|Q5T373|Q9H5V5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369183.4	37	NULL	CCDS7605.1	10																																																																																			-	-		0.254	FAM204A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM204A	protein_coding	OTTHUMT00000050596.2	C	NM_022063	-		120070202	-1	no_errors	ENST00000491416	ensembl	human	known	74_37	rna	SNP	0.001	G
SORD2P	653381	genome.wustl.edu	37	15	45123755	45123756	+	RNA	INS	-	-	C	rs11429544	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr15:45123755_45123756insC	ENST00000561384.2	-	0	871_872																											GGAGGCCTCTGCCCCGTGCACT	0.574													CCCCC|CCCC|CCCCC|deletion	185	0.0369409	0.0756	0.0303	5008	,	,		16468	0.0407		0.002	False		,,,				2504	0.0215																0								ENSG00000259479																																			CTD-2008A1.2			0				Clone_based_vega_gene																													15.37:g.45123759_45123759dupC		Somatic	0	47	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	29	14.71		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000561384.2	37	NULL		15																																																																																			-	-		0.574	CTD-2008A1.2-002	PUTATIVE	basic	processed_transcript	ENSG00000259479	pseudogene	OTTHUMT00000416181.2	-				45123756	-1	no_errors	ENST00000561384	ensembl	human	putative	74_37	rna	INS	0.632:0.983	C
PRKD1	5587	genome.wustl.edu	37	14	30396622	30396623	+	In_Frame_Ins	INS	-	-	CCCGGA	rs200987283|rs139860047|rs45471692	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr14:30396622_30396623insCCCGGA	ENST00000331968.5	-	1	325_326	c.96_97insTCCGGG	c.(94-99)gggccc>gggTCCGGGccc	p.31_32insGS	PRKD1_ENST00000415220.2_In_Frame_Ins_p.31_32insGS	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	31					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		GCGGGCCCGGGCCCGGACCCTG	0.762														343	0.0684904	0.003	0.0548	5008	,	,		4659	0.1567		0.0507	False		,,,				2504	0.0941																0								ENSG00000184304			31,2319		11,9,1155						3.1	1.0		dbSNP_127	3	234,5084		58,118,2483	no	coding	PRKD1	NM_002742.2		69,127,3638	A1A1,A1R,RR		4.4002,1.3191,3.4559				265,7403				PRKD1	SO:0001652	inframe_insertion	0				HGNC		CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.91_96dupTCCGGG	14.37:g.30396623_30396628dupCCCGGA	ENSP00000333568:p.Gly30_Ser31dup	Somatic	NA	NA	NA		0.6597972753633179	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NL64|B2RAF6	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.32in_frame_insSG	ENST00000331968.5	37	c.97_96	CCDS9637.1	14																																																																																			-	NULL		0.762	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKD1	protein_coding	OTTHUMT00000276611.2	-	NM_002742			30396623	-1	no_errors	ENST00000331968	ensembl	human	known	74_37	in_frame_ins	INS	1.000:1.000	CCCGGA
AHCTF1	25909	genome.wustl.edu	37	1	247002973	247002973	+	3'UTR	SNP	T	T	C			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr1:247002973T>C	ENST00000391829.2	-	0	8059				AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000326225.3_3'UTR|AHCTF1_ENST00000366508.1_3'UTR			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1						cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			ATTAAAATATTAAAAGCCCAC	0.299																																					Colon(145;197 1800 4745 15099 26333)												0								ENSG00000153207																																			AHCTF1	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.*1135A>G	1.37:g.247002973T>C		Somatic	0	60	0.00		0.6597972753633179	20	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000391829.2	37	NULL		1																																																																																			-	-		0.299	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	protein_coding		T	NM_015446	-		247002973	-1	no_errors	ENST00000470300	ensembl	human	known	74_37	rna	SNP	0.000	C
FSCB	84075	genome.wustl.edu	37	14	44976108	44976108	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr14:44976108G>A	ENST00000340446.4	-	1	374	c.83C>T	c.(82-84)aCc>aTc	p.T28I	RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000556228.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	28						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		AATACGATGGGTAGCTTTGGG	0.428																																																	0								ENSG00000189139						243.0	233.0	236.0					14																	44976108		2203	4300	6503	FSCB	SO:0001583	missense	0			-	HGNC	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.83C>T	14.37:g.44976108G>A	ENSP00000344579:p.Thr28Ile	Somatic	0	67	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	91	22.22	Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T28I	ENST00000340446.4	37	c.83	CCDS9679.1	14	.	.	.	.	.	.	.	.	.	.	G	10.55	1.382372	0.24944	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.14893	2.47	5.49	1.57	0.23409	.	.	.	.	.	T	0.17959	0.0431	L	0.50333	1.59	0.09310	N	1	P	0.50528	0.936	P	0.46320	0.512	T	0.13361	-1.0512	9	0.72032	D	0.01	-1.5349	4.9021	0.13781	0.2514:0.0:0.5971:0.1515	.	28	Q5H9T9	FSCB_HUMAN	I	28	ENSP00000344579:T28I	ENSP00000344579:T28I	T	-	2	0	FSCB	44045858	0.008000	0.16893	0.029000	0.17559	0.172000	0.22775	0.560000	0.23500	0.379000	0.24794	0.555000	0.69702	ACC	-	NULL		0.428	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	protein_coding	OTTHUMT00000276788.1	G	NM_032135	-		44976108	-1	no_errors	ENST00000340446	ensembl	human	known	74_37	missense	SNP	0.003	A
OR4C5	79346	genome.wustl.edu	37	11	48387285	48387286	+	Frame_Shift_Ins	INS	-	-	GTCTTTAGTAG	rs369896820|rs10839482		TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr11:48387285_48387286insGTCTTTAGTAG	ENST00000319813.3	-	1	731_732	c.732_733insCTACTAAAGAC	c.(730-735)tgctcafs	p.S245fs				Q8NGB2	OR4C5_HUMAN	olfactory receptor, family 4, subfamily C, member 5	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										TTCCGCTGTGAGCAGAGGATTA	0.465																																																	0								ENSG00000176540																																			OR4C5	SO:0001589	frameshift_variant	0				HGNC			11p11.2	2013-03-27	2004-03-04	2004-03-05	ENSG00000176540	ENSG00000176540		"""GPCR / Class A : Olfactory receptors"""	14702	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 5 pseudogene"""	OR4C5P			Standard	NG_002247		Approved	OR4C5Q		Q8NGB2	OTTHUMG00000169462	ENST00000319813.3:c.732_733insCTACTAAAGAC	11.37:g.48387285_48387286insGTCTTTAGTAG	ENSP00000321338:p.Ser245fs	Somatic	NA	NA	NA		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6IFB2	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S244fs	ENST00000319813.3	37	c.733_732		11																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.465	OR4C5-001	KNOWN	basic|appris_principal	protein_coding	OR4C5	protein_coding	OTTHUMT00000404174.1	-	NG_002247			48387286	-1	no_errors	ENST00000319813	ensembl	human	known	74_37	frame_shift_ins	INS	0.078:0.007	GTCTTTAGTAG
LOC100130331	100130331	genome.wustl.edu	37	1	238090237	238090237	+	RNA	SNP	G	G	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr1:238090237G>T	ENST00000450451.1	+	0	1743					NR_027247.2																						TCCATCATTGGGCACCCCCGG	0.602																																																	0								ENSG00000237250																																			RP11-193H5.1			0			-	Clone_based_vega_gene																													1.37:g.238090237G>T		Somatic	0	17	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	17	32.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000450451.1	37	NULL		1																																																																																			-	-		0.602	RP11-193H5.1-001	KNOWN	basic	antisense	LOC100130331	antisense	OTTHUMT00000095477.1	G		-		238090237	+1	no_errors	ENST00000450451	ensembl	human	known	74_37	rna	SNP	1.000	T
PRPF31	26121	genome.wustl.edu	37	19	54625279	54625279	+	Silent	SNP	C	C	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr19:54625279C>T	ENST00000321030.4	+	4	628	c.279C>T	c.(277-279)atC>atT	p.I93I	PRPF31_ENST00000391755.1_Silent_p.I93I|AC012314.8_ENST00000452097.1_RNA|PRPF31_ENST00000498612.1_3'UTR|PRPF31_ENST00000419967.1_Silent_p.I93I	NM_015629.3	NP_056444.3	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31	93					mRNA splicing, via spliceosome (GO:0000398)|spliceosomal tri-snRNP complex assembly (GO:0000244)	Cajal body (GO:0015030)|MLL1 complex (GO:0071339)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|U2-type spliceosomal complex (GO:0005684)|U4 snRNP (GO:0005687)|U4/U6 x U5 tri-snRNP complex (GO:0046540)|U4atac snRNP (GO:0005690)	poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|snRNP binding (GO:0070990)			breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)|urinary_tract(3)	12	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					ACCGCGTCATCGTGGATGCCA	0.627																																																	0								ENSG00000105618						96.0	65.0	75.0					19																	54625279		2203	4300	6503	PRPF31	SO:0001819	synonymous_variant	0			-	HGNC	AL050369	CCDS12879.1	19q13.4	2013-07-16	2013-06-10		ENSG00000105618	ENSG00000105618			15446	protein-coding gene	gene with protein product		606419	"""PRP31 pre-mRNA processing factor 31 homolog (yeast)"", ""PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae)"""	RP11		11545739	Standard	NM_015629		Approved	NY-BR-99, PRP31, hPrp31, SNRNP61	uc002qdh.2	Q8WWY3	OTTHUMG00000066040	ENST00000321030.4:c.279C>T	19.37:g.54625279C>T		Somatic	0	29	0.00		0.6597972753633179	288	29.93	123	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	39	22.00	Q17RB4|Q8N7F9|Q9H271|Q9Y439	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Nop_dom,pfam_Prp31_C,pfam_NOSIC,smart_NOSIC	p.I93	ENST00000321030.4	37	c.279	CCDS12879.1	19																																																																																			-	pfam_NOSIC,smart_NOSIC		0.627	PRPF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF31	protein_coding	OTTHUMT00000141417.2	C		-		54625279	+1	no_errors	ENST00000321030	ensembl	human	known	74_37	silent	SNP	0.904	T
CDH26	60437	genome.wustl.edu	37	20	58587783	58587784	+	Intron	INS	-	-	A	rs370682137	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr20:58587783_58587784insA	ENST00000244047.5	+	15	2483				CDH26_ENST00000350849.6_Stop_Codon_Ins|CDH26_ENST00000348616.4_Stop_Codon_Ins|CDH26_ENST00000497614.1_3'UTR|CDH26_ENST00000244049.3_Stop_Codon_Ins			Q8IXH8	CAD26_HUMAN	cadherin 26						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.*833fs?(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			TGTTCCTTCCTAAAAAAAAAAG	0.396													|||unknown(HR)	163	0.0325479	0.1082	0.0115	5008	,	,		18084	0.003		0.004	False		,,,				2504	0.0051																1	Deletion - Frameshift(1)	ovary(1)						ENSG00000124215																																			CDH26	SO:0001627	intron_variant	0				HGNC	AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.2172+5941->A	20.37:g.58587793_58587793dupA		Somatic	0	59	0.00		0.6597972753633179	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	51	8.93	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.*834fs	ENST00000244047.5	37	c.2497_2498		20																																																																																			-	NULL		0.396	CDH26-201	KNOWN	basic	protein_coding	CDH26	protein_coding		-	NM_177980			58587784	+1	no_errors	ENST00000348616	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.000	A
CNTN2	6900	genome.wustl.edu	37	1	205030406	205030406	+	Silent	SNP	C	C	T	rs199743054		TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr1:205030406C>T	ENST00000331830.4	+	8	1115	c.831C>T	c.(829-831)gaC>gaT	p.D277D	AL583832.1_ENST00000515887.1_RNA	NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	277	Ig-like C2-type 3.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GCAAAGTGGACGGCTCCCTGT	0.652											OREG0014144	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(183;2548 2817 37099 41192)												0								ENSG00000184144						91.0	69.0	77.0					1																	205030406		2203	4300	6503	CNTN2	SO:0001819	synonymous_variant	0			-	HGNC	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.831C>T	1.37:g.205030406C>T		Somatic	0	30	0.00	2149	0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	P78432|Q5T054	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.D277	ENST00000331830.4	37	c.831	CCDS1449.1	1																																																																																			-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.652	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN2	protein_coding	OTTHUMT00000090080.3	C	NM_005076	rs199743054		205030406	+1	no_errors	ENST00000331830	ensembl	human	known	74_37	silent	SNP	0.974	T
SYN2	6854	genome.wustl.edu	37	3	12226673	12226673	+	RNA	SNP	G	G	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr3:12226673G>T	ENST00000432424.2	+	0	3342							Q92777	SYN2_HUMAN	synapsin II						neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)			breast(5)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	18						TTCCAGATGGGTTGCATAAGA	0.348																																																	0								ENSG00000157152																																			SYN2			0			-	HGNC		CCDS74900.1, CCDS74901.1	3p25.2	2013-09-20			ENSG00000157152	ENSG00000157152			11495	protein-coding gene	gene with protein product		600755				8530057	Standard	XM_006713311		Approved	SYNII, SYNIIa, SYNIIb	uc003bwm.3	Q92777	OTTHUMG00000155335		3.37:g.12226673G>T		Somatic	0	41	0.00		0.6597972753633179	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	A8MY98	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000432424.2	37	NULL		3																																																																																			-	-		0.348	SYN2-002	KNOWN	basic	processed_transcript	SYN2	processed_transcript	OTTHUMT00000339528.3	G	NM_133625	-		12226673	+1	no_errors	ENST00000425297	ensembl	human	known	74_37	rna	SNP	0.009	T
RHBG	57127	genome.wustl.edu	37	1	156354347	156354348	+	Frame_Shift_Ins	INS	-	-	C	rs71591938|rs11303415|rs587735548	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr1:156354347_156354348insC	ENST00000368249.1	+	9	1302_1303	c.1264_1265insC	c.(1264-1266)tccfs	p.S422fs	RHBG_ENST00000494874.1_Intron|RHBG_ENST00000255013.3_Frame_Shift_Ins_p.S353fs|RHBG_ENST00000368246.2_Splice_Site|RHBG_ENST00000400992.2_Frame_Shift_Ins_p.S390fs	NM_001256396.1|NM_020407.4	NP_001243325.1|NP_065140.3	Q9H310	RHBG_HUMAN	Rh family, B glycoprotein (gene/pseudogene)	422	Interaction with ANK3.				ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	anchored component of plasma membrane (GO:0046658)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|spectrin-associated cytoskeleton (GO:0014731)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)	p.R425fs*>17(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					CTTTCTGGACTCCCCCCCCAGA	0.634											OREG0013871	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Deletion - Frameshift(1)	ovary(1)						ENSG00000132677																																			RHBG	SO:0001589	frameshift_variant	0				HGNC	AF193807		1q22	2013-05-22	2009-01-22		ENSG00000132677	ENSG00000132677		"""Solute carriers"""	14572	protein-coding gene	gene with protein product		607079	"""Rhesus blood group, B glycoprotein"""			10852913	Standard	NM_020407		Approved	SLC42A2	uc010pho.3	Q9H310	OTTHUMG00000024057	ENST00000368249.1:c.1272dupC	1.37:g.156354355_156354355dupC	ENSP00000357232:p.Ser422fs	Somatic	0	71	0.00	1777	0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	97	17.80	A8K475|Q5SZW4|Q5SZW6|Q5SZW7|Q6P193|Q6YJI2|Q6YJI3	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom,prints_RhesusRHD	p.R393fs	ENST00000368249.1	37	c.1168_1169		1																																																																																			-	superfamily_NH4_transpt_AmtB-like_dom		0.634	RHBG-001	NOVEL	basic	protein_coding	RHBG	protein_coding	OTTHUMT00000060589.2	-	NM_001256395			156354348	+1	no_errors	ENST00000400992	ensembl	human	known	74_37	frame_shift_ins	INS	0.006:0.723	C
SLC9A2	6549	genome.wustl.edu	37	2	103274465	103274465	+	Silent	SNP	G	G	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr2:103274465G>T	ENST00000233969.2	+	2	874	c.732G>T	c.(730-732)ctG>ctT	p.L244L		NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	244					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						GAGAGTCCCTGCTGAATGATG	0.532																																																	0								ENSG00000115616						154.0	144.0	147.0					2																	103274465		2203	4300	6503	SLC9A2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.732G>T	2.37:g.103274465G>T		Somatic	0	42	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	B2RMS2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cation/H_exchanger,prints_Na/H_exchanger_2,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.L244	ENST00000233969.2	37	c.732	CCDS2062.1	2																																																																																			-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger		0.532	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A2	protein_coding	OTTHUMT00000253292.2	G		-		103274465	+1	no_errors	ENST00000233969	ensembl	human	known	74_37	silent	SNP	1.000	T
SCTR	6344	genome.wustl.edu	37	2	120209612	120209612	+	Missense_Mutation	SNP	G	G	A	rs144810736	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr2:120209612G>A	ENST00000019103.5	-	9	1162	c.895C>T	c.(895-897)Cgt>Tgt	p.R299C		NM_002980.2	NP_002971.2	P47872	SCTR_HUMAN	secretin receptor	299					digestion (GO:0007586)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic microtubule (GO:0005881)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	secretin receptor activity (GO:0015055)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)	19					Secretin(DB00021)	ACAGGACCACGAATGATCCAC	0.592													G|||	2	0.000399361	0.0	0.0029	5008	,	,		21577	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000080293	G	CYS/ARG	4,4402	8.1+/-20.4	0,4,2199	146.0	104.0	118.0		895	5.3	1.0	2	dbSNP_134	118	33,8567	21.6+/-65.8	0,33,4267	yes	missense	SCTR	NM_002980.2	180	0,37,6466	AA,AG,GG		0.3837,0.0908,0.2845	probably-damaging	299/441	120209612	37,12969	2203	4300	6503	SCTR	SO:0001583	missense	0			-	HGNC		CCDS2127.1	2q14.1	2012-08-10			ENSG00000080293	ENSG00000080293		"""GPCR / Class B : Glucagon receptors"""	10608	protein-coding gene	gene with protein product		182098				1646711	Standard	NM_002980		Approved		uc002tma.3	P47872	OTTHUMG00000131407	ENST00000019103.5:c.895C>T	2.37:g.120209612G>A	ENSP00000019103:p.Arg299Cys	Somatic	0	41	0.00		0.6597972753633179	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	29	35.56	Q12961|Q13213|Q53T00	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_secretin_rcpt,prints_GPCR_2_VIP_rcpt_1	p.R299C	ENST00000019103.5	37	c.895	CCDS2127.1	2	.	.	.	.	.	.	.	.	.	.	G	21.6	4.168832	0.78339	9.08E-4	0.003837	ENSG00000080293	ENST00000019103	T	0.36520	1.25	5.33	5.33	0.75918	GPCR, family 2-like (1);	0.000000	0.47852	D	0.000206	T	0.64472	0.2601	M	0.86502	2.82	0.58432	D	0.999997	D	0.89917	1.0	D	0.83275	0.996	T	0.69661	-0.5085	10	0.87932	D	0	.	13.6707	0.62422	0.0:0.0:0.8356:0.1644	.	299	P47872	SCTR_HUMAN	C	299	ENSP00000019103:R299C	ENSP00000019103:R299C	R	-	1	0	SCTR	119926082	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.818000	0.55678	2.775000	0.95449	0.655000	0.94253	CGT	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like		0.592	SCTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCTR	protein_coding	OTTHUMT00000254198.2	G		rs144810736		120209612	-1	no_errors	ENST00000019103	ensembl	human	known	74_37	missense	SNP	1.000	A
ANGPTL4	51129	genome.wustl.edu	37	19	8430863	8430863	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr19:8430863G>A	ENST00000301455.2	+	2	515	c.344G>A	c.(343-345)aGg>aAg	p.R115K	ANGPTL4_ENST00000393962.2_Missense_Mutation_p.R115K|ANGPTL4_ENST00000541807.1_5'UTR	NM_139314.1	NP_647475.1	Q9BY76	ANGL4_HUMAN	angiopoietin-like 4	115					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|cellular lipid metabolic process (GO:0044255)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of lipoprotein lipase activity (GO:0051005)|positive regulation of angiogenesis (GO:0045766)|protein homooligomerization (GO:0051260)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	enzyme inhibitor activity (GO:0004857)			large_intestine(1)|lung(1)|ovary(2)|skin(2)	6						CAGAACAGCAGGATCCAGCAA	0.552																																																	0								ENSG00000167772						76.0	70.0	72.0					19																	8430863		2203	4300	6503	ANGPTL4	SO:0001583	missense	0			-	HGNC	AF202636	CCDS12200.1, CCDS42493.1	19p13.3	2013-10-07				ENSG00000167772		"""Fibrinogen C domain containing"""	16039	protein-coding gene	gene with protein product	"""fasting-induced adipose factor"", ""hepatic angiopoietin-related protein"", ""PPARG angiopoietin related protein"", ""hepatic fibrinogen/angiopoietin-related protein"", ""peroxisome proliferator-activated receptor (PPAR) gamma induced angiopoietin-related protein"", ""angiopoietin-related protein 4"""	605910				10698685, 10866690, 23960078	Standard	NM_139314		Approved	pp1158, PGAR, ARP4, HFARP, FIAF, NL2	uc002mjq.1	Q9BY76		ENST00000301455.2:c.344G>A	19.37:g.8430863G>A	ENSP00000301455:p.Arg115Lys	Somatic	0	49	0.00		0.6597972753633179	7	58.82	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	54	43.30	A8MY84|B4E089|D6W670|F5H0I2|Q53HQ6|Q53HU1|Q6UXN0|Q9HBV4|Q9NZU4|Q9Y5B3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.R115K	ENST00000301455.2	37	c.344	CCDS12200.1	19	.	.	.	.	.	.	.	.	.	.	G	15.38	2.816887	0.50633	.	.	ENSG00000167772	ENST00000301455;ENST00000393962	T;T	0.42513	0.97;0.97	4.81	2.61	0.31194	.	2.329500	0.01348	N	0.011810	T	0.27900	0.0687	N	0.12746	0.255	0.80722	D	1	B;B	0.27594	0.182;0.182	B;B	0.27380	0.079;0.079	T	0.07635	-1.0762	10	0.28530	T	0.3	.	6.0619	0.19842	0.2577:0.0:0.7423:0.0	.	115;115	A8MY84;Q9BY76	.;ANGL4_HUMAN	K	115	ENSP00000301455:R115K;ENSP00000377534:R115K	ENSP00000301455:R115K	R	+	2	0	ANGPTL4	8336863	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.835000	0.48175	0.362000	0.24319	0.655000	0.94253	AGG	-	NULL		0.552	ANGPTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL4	protein_coding	OTTHUMT00000460322.1	G	NM_139314	-		8430863	+1	no_errors	ENST00000301455	ensembl	human	known	74_37	missense	SNP	1.000	A
TNFRSF21	27242	genome.wustl.edu	37	6	47200704	47200704	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr6:47200704C>T	ENST00000296861.2	-	6	2158	c.1765G>A	c.(1765-1767)Gta>Ata	p.V589I		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	589					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			TCCAGGCGTACCTGCCGCAAC	0.532																																																	0								ENSG00000146072						75.0	75.0	75.0					6																	47200704		2203	4300	6503	TNFRSF21	SO:0001583	missense	0			-	HGNC	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.1765G>A	6.37:g.47200704C>T	ENSP00000296861:p.Val589Ile	Somatic	0	40	0.00		0.6597972753633179	30	26.83	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	15	59.46	B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Death_domain,superfamily_DEATH-like_dom,smart_TNFR/NGFR_Cys_rich_reg,smart_Death_domain,pfscan_Death_domain,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_21	p.V589I	ENST00000296861.2	37	c.1765	CCDS4921.1	6	.	.	.	.	.	.	.	.	.	.	C	26.6	4.752436	0.89753	.	.	ENSG00000146072	ENST00000296861;ENST00000419206	T	0.69435	-0.4	5.84	5.84	0.93424	.	0.112081	0.64402	D	0.000010	T	0.67335	0.2882	L	0.27053	0.805	0.80722	D	1	D	0.76494	0.999	D	0.65443	0.935	T	0.71679	-0.4520	10	0.87932	D	0	.	18.3151	0.90218	0.0:1.0:0.0:0.0	.	589	O75509	TNR21_HUMAN	I	589;278	ENSP00000296861:V589I	ENSP00000296861:V589I	V	-	1	0	TNFRSF21	47308663	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.070000	0.71220	2.765000	0.95021	0.655000	0.94253	GTA	-	superfamily_DEATH-like_dom		0.532	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF21	protein_coding	OTTHUMT00000040814.1	C	NM_014452	-		47200704	-1	no_errors	ENST00000296861	ensembl	human	known	74_37	missense	SNP	1.000	T
NOTCH3	4854	genome.wustl.edu	37	19	15276214	15276214	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr19:15276214G>T	ENST00000263388.2	-	31	5855	c.5780C>A	c.(5779-5781)gCc>gAc	p.A1927D		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1927					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			AGCATGGCTGGCGATGAGCTC	0.582																																																	0								ENSG00000074181						92.0	78.0	82.0					19																	15276214		2203	4300	6503	NOTCH3	SO:0001583	missense	0			-	HGNC	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5780C>A	19.37:g.15276214G>T	ENSP00000263388:p.Ala1927Asp	Somatic	0	26	0.00		0.6597972753633179	84	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_3,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.A1927D	ENST00000263388.2	37	c.5780	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743813	0.69418	.	.	ENSG00000074181	ENST00000263388	T	0.62498	0.02	5.14	5.14	0.70334	Ankyrin repeat-containing domain (4);	0.000000	0.32190	N	0.006458	T	0.57359	0.2048	N	0.17082	0.46	0.43029	D	0.99459	P	0.51933	0.949	P	0.50537	0.643	T	0.61272	-0.7096	10	0.46703	T	0.11	.	17.5455	0.87860	0.0:0.0:1.0:0.0	.	1927	Q9UM47	NOTC3_HUMAN	D	1927	ENSP00000263388:A1927D	ENSP00000263388:A1927D	A	-	2	0	NOTCH3	15137214	0.993000	0.37304	1.000000	0.80357	0.479000	0.33129	2.647000	0.46639	2.676000	0.91093	0.561000	0.74099	GCC	-	pirsf_Notch,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.582	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	protein_coding	OTTHUMT00000465714.1	G	NM_000435	-		15276214	-1	no_errors	ENST00000263388	ensembl	human	known	74_37	missense	SNP	1.000	T
TRIM64C	646754	genome.wustl.edu	37	11	49075541	49075541	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr11:49075541C>A	ENST00000530230.1	-	7	1068	c.1069G>T	c.(1069-1071)Gat>Tat	p.D357Y		NM_001206631.1	NP_001193560.1	A6NLI5	TR64C_HUMAN	tripartite motif containing 64C	357	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						GTCCTAGAATCTCGACAGACT	0.443																																																	0								ENSG00000214891																																			TRIM64C	SO:0001583	missense	0			-	HGNC		CCDS73287.1	11p11.12	2014-04-02	2011-01-25		ENSG00000214891	ENSG00000214891		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	37148	protein-coding gene	gene with protein product			"""tripartite motif-containing 64C"""				Standard	NM_001206631		Approved		uc021qiy.1	A6NLI5	OTTHUMG00000166752	ENST00000530230.1:c.1069G>T	11.37:g.49075541C>A	ENSP00000431987:p.Asp357Tyr	Somatic	1	103	0.96		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	62	37.37		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.D357Y	ENST00000530230.1	37	c.1069		11	.	.	.	.	.	.	.	.	.	.	C	10.52	1.372841	0.24857	.	.	ENSG00000214891	ENST00000530230	T	0.62232	0.04	1.55	0.612	0.17591	.	.	.	.	.	T	0.73497	0.3594	M	0.92122	3.275	0.09310	N	1	.	.	.	.	.	.	T	0.65393	-0.6179	7	0.87932	D	0	.	3.8742	0.09050	0.0:0.762:0.0:0.238	.	.	.	.	Y	357	ENSP00000431987:D357Y	ENSP00000431987:D357Y	D	-	1	0	TRIM64C	49032117	0.005000	0.15991	0.002000	0.10522	0.052000	0.14988	0.390000	0.20768	0.242000	0.21303	0.184000	0.17185	GAT	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin		0.443	TRIM64C-001	KNOWN	basic|appris_principal	protein_coding	TRIM64C	protein_coding	OTTHUMT00000391366.1	C		-		49075541	-1	no_errors	ENST00000530230	ensembl	human	known	74_37	missense	SNP	0.014	A
IGKC	3514	genome.wustl.edu	37	2	89156778	89156778	+	RNA	SNP	C	C	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr2:89156778C>A	ENST00000390237.2	-	0	418				AC096579.7_ENST00000430694.1_RNA|AC096579.13_ENST00000452230.1_RNA			P01834	IGKC_HUMAN	immunoglobulin kappa constant						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)										TGGAGGACCGCAATAGGGGTA	0.522																																																	0								ENSG00000231486																																			AC096579.7			0			-	Clone_based_vega_gene	J00241		2p11.2	2013-01-14			ENSG00000211592	ENSG00000211592		"""Immunoglobulins / IGK locus"""	5716	other	immunoglobulin gene		147200				10354514	Standard	NG_000834		Approved	HCAK1		P01834	OTTHUMG00000151684		2.37:g.89156778C>A		Somatic	0	12	0.00		0.6597972753633179	3480	0.11	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	6	50.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000390237.2	37	NULL		2																																																																																			-	-		0.522	IGKC-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	ENSG00000231486	IG_C_gene	OTTHUMT00000323482.1	C	NG_000834	-		89156778	-1	no_errors	ENST00000430694	ensembl	human	known	74_37	rna	SNP	0.000	A
AHCTF1	25909	genome.wustl.edu	37	1	247003195	247003195	+	3'UTR	SNP	C	C	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr1:247003195C>A	ENST00000391829.2	-	0	7837				AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000326225.3_3'UTR|AHCTF1_ENST00000366508.1_3'UTR			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1						cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CTCTCCCAACCTCAATAATCT	0.408																																					Colon(145;197 1800 4745 15099 26333)												0								ENSG00000153207																																			AHCTF1	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.*913G>T	1.37:g.247003195C>A		Somatic	0	28	0.00		0.6597972753633179	33	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000391829.2	37	NULL		1																																																																																			-	-		0.408	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	protein_coding		C	NM_015446	-		247003195	-1	no_errors	ENST00000470300	ensembl	human	known	74_37	rna	SNP	0.000	A
NELL1	4745	genome.wustl.edu	37	11	20939733	20939733	+	Silent	SNP	C	C	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr11:20939733C>T	ENST00000357134.5	+	6	761	c.609C>T	c.(607-609)atC>atT	p.I203I	NELL1_ENST00000325319.5_Silent_p.I146I|NELL1_ENST00000298925.5_Silent_p.I231I|NELL1_ENST00000532434.1_Silent_p.I203I	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	203	Laminin G-like.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						TCAAGGGGATCATCCAAGATG	0.378																																																	0								ENSG00000165973						145.0	140.0	142.0					11																	20939733		2203	4299	6502	NELL1	SO:0001819	synonymous_variant	0			-	HGNC	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.609C>T	11.37:g.20939733C>T		Somatic	0	64	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	45	15.09	B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_VWF_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_VWC_out,smart_VWF_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_VWF_C	p.I203	ENST00000357134.5	37	c.609	CCDS7855.1	11																																																																																			-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G		0.378	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL1	protein_coding	OTTHUMT00000387588.1	C	NM_006157	-		20939733	+1	no_errors	ENST00000357134	ensembl	human	known	74_37	silent	SNP	0.991	T
PCDHB17	54661	genome.wustl.edu	37	5	140536443	140536443	+	Silent	SNP	C	C	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr5:140536443C>A	ENST00000539533.1	+	1	867	c.867C>A	c.(865-867)atC>atA	p.I289I						protocadherin beta 17 pseudogene																		CCAATCAAATCATTCAGGCCT	0.423																																																	0								ENSG00000255622																																			PCDHB17	SO:0001819	synonymous_variant	0			-	Uniprot_gn	AF152527		5q31	2010-01-26				ENSG00000255622		"""Cadherins / Protocadherins : Clustered"""	14547	pseudogene	pseudogene						10380929	Standard	NR_001280		Approved	PCDH-psi1	uc003lis.3			ENST00000539533.1:c.867C>A	5.37:g.140536443C>A		Somatic	0	45	0.00		0.6597972753633179	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	47	33.80		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I289	ENST00000539533.1	37	c.867		5																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.423	PCDHB17-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000255622	protein_coding		C		-		140536443	+1	no_errors	ENST00000539533	ensembl	human	known	74_37	silent	SNP	0.000	A
FBN3	84467	genome.wustl.edu	37	19	8197971	8197971	+	Silent	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr19:8197971G>A	ENST00000600128.1	-	14	2025	c.1611C>T	c.(1609-1611)acC>acT	p.T537T	FBN3_ENST00000601739.1_Silent_p.T537T|FBN3_ENST00000270509.2_Silent_p.T537T			Q75N90	FBN3_HUMAN	fibrillin 3	537	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						ACATGGTGCTGGTGGCACACT	0.642																																																	0								ENSG00000142449						53.0	34.0	40.0					19																	8197971		2201	4298	6499	FBN3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.1611C>T	19.37:g.8197971G>A		Somatic	0	74	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	92	76	54.76	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.T537	ENST00000600128.1	37	c.1611	CCDS12196.1	19																																																																																			-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom		0.642	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	protein_coding	OTTHUMT00000461428.2	G	NM_032447	-		8197971	-1	no_errors	ENST00000270509	ensembl	human	known	74_37	silent	SNP	1.000	A
P2RY4	5030	genome.wustl.edu	37	X	69479428	69479428	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chrX:69479428G>T	ENST00000374519.2	-	1	226	c.47C>A	c.(46-48)cCa>cAa	p.P16Q		NM_002565.3	NP_002556.1	P51582	P2RY4_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 4	16					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|transepithelial chloride transport (GO:0030321)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|uridine nucleotide receptor activity (GO:0015065)|UTP-activated nucleotide receptor activity (GO:0045030)			cervix(2)|endometrium(2)|large_intestine(8)|lung(6)	18						GCCAGGACCTGGGCTGAGGCC	0.582													g|||	1	0.000264901	0.0	0.0	3775	,	,		15531	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000186912						27.0	24.0	25.0					X																	69479428		2203	4299	6502	P2RY4	SO:0001583	missense	0			-	HGNC	X91852	CCDS14398.1	Xq13	2012-08-08			ENSG00000186912	ENSG00000186912		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8542	protein-coding gene	gene with protein product		300038				8537336	Standard	NM_002565		Approved	NRU, P2Y4, UNR, P2P	uc004dxz.1	P51582	OTTHUMG00000021769	ENST00000374519.2:c.47C>A	X.37:g.69479428G>T	ENSP00000363643:p.Pro16Gln	Somatic	0	70	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	124	8.82	Q4VBB7|Q4VBB8|Q502W2|Q5JT22	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_P2Y4_rcpt,prints_GPCR_Rhodpsn,prints_P2Y2_rcpt	p.P16Q	ENST00000374519.2	37	c.47	CCDS14398.1	X	.	.	.	.	.	.	.	.	.	.	g	7.879	0.729757	0.15507	.	.	ENSG00000186912	ENST00000374519	T	0.71579	-0.58	3.71	2.81	0.32909	.	1.715750	0.03496	U	0.217294	T	0.53626	0.1808	N	0.08118	0	0.09310	N	1	B	0.16802	0.019	B	0.08055	0.003	T	0.44982	-0.9292	10	0.51188	T	0.08	.	7.8855	0.29648	0.1005:0.0:0.7405:0.1591	.	16	P51582	P2RY4_HUMAN	Q	16	ENSP00000363643:P16Q	ENSP00000363643:P16Q	P	-	2	0	P2RY4	69396153	0.003000	0.15002	0.001000	0.08648	0.039000	0.13416	0.672000	0.25187	0.237000	0.21200	-1.355000	0.01225	CCA	-	prints_P2Y4_rcpt		0.582	P2RY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY4	protein_coding	OTTHUMT00000057058.2	G	NM_002565	-		69479428	-1	no_errors	ENST00000374519	ensembl	human	known	74_37	missense	SNP	0.001	T
TP53	7157	genome.wustl.edu	37	17	7577074	7577075	+	Frame_Shift_Ins	INS	-	-	TTCTC			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr17:7577074_7577075insTTCTC	ENST00000269305.4	-	8	1052_1053	c.863_864insGAGAA	c.(862-864)aatfs	p.N288fs	TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Frame_Shift_Ins_p.N288fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Frame_Shift_Ins_p.N288fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.N288fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.N288fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	288	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		N -> D (in a sporadic cancer; somatic mutation).|N -> K (in sporadic cancers; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> T (in sporadic cancers; somatic mutation).|N -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.N288fs*13(17)|p.0?(8)|p.N288S(6)|p.E286fs*17(2)|p.?(2)|p.N288fs*18(2)|p.R283fs*16(2)|p.N288fs*17(1)|p.L265_K305del41(1)|p.N288fs*15(1)|p.T284_G293del10(1)|p.E285_L289delEEENL(1)|p.R283fs*56(1)|p.N288K(1)|p.E285fs*13(1)|p.N288fs*57(1)|p.E287fs*17(1)|p.V272_K292del21(1)|p.E285_N288delEEEN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTTGCGGAGATTCTCTTCCTC	0.569		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	51	Deletion - Frameshift(27)|Whole gene deletion(8)|Substitution - Missense(7)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)	upper_aerodigestive_tract(22)|breast(5)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|liver(3)|large_intestine(2)|stomach(2)|central_nervous_system(2)|urinary_tract(2)|ovary(2)|biliary_tract(1)|lung(1)|oesophagus(1)|prostate(1)						ENSG00000141510																																			TP53	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.859_863dupGAGAA	17.37:g.7577075_7577079dupTTCTC	ENSP00000269305:p.Asn288fs	Somatic	NA	NA	NA		0.6597972753633179	40	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.N288fs	ENST00000269305.4	37	c.864_863	CCDS11118.1	17																																																																																			-	pfam_p53_DNA-bd		0.569	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	-	NM_000546			7577075	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_ins	INS	0.990:0.994	TTCTC
IGDCC3	9543	genome.wustl.edu	37	15	65621813	65621813	+	Missense_Mutation	SNP	C	C	T	rs371434447		TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr15:65621813C>T	ENST00000327987.4	-	13	2371	c.2120G>A	c.(2119-2121)cGa>cAa	p.R707Q	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	707					neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TTTCTCGTCTCGGCCCAGCTG	0.662																																																	0								ENSG00000174498	C	GLN/ARG	1,4395		0,1,2197	49.0	58.0	55.0		2120	3.3	0.5	15		55	0,8584		0,0,4292	no	missense	IGDCC3	NM_004884.3	43	0,1,6489	TT,TC,CC		0.0,0.0227,0.0077	benign	707/815	65621813	1,12979	2198	4292	6490	IGDCC3	SO:0001583	missense	0			-	HGNC	AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.2120G>A	15.37:g.65621813C>T	ENSP00000332773:p.Arg707Gln	Somatic	0	70	0.00		0.6597972753633179	13	23.53	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	108	20.00	O95215	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R707Q	ENST00000327987.4	37	c.2120	CCDS10205.1	15	.	.	.	.	.	.	.	.	.	.	C	6.655	0.489291	0.12641	2.27E-4	0.0	ENSG00000174498	ENST00000327987	T	0.65549	-0.16	5.29	3.35	0.38373	.	0.946368	0.08825	N	0.888237	T	0.41811	0.1175	N	0.19112	0.55	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.28933	-1.0028	10	0.18710	T	0.47	-0.0428	3.631	0.08131	0.3147:0.4664:0.1365:0.0825	.	707	Q8IVU1	IGDC3_HUMAN	Q	707	ENSP00000332773:R707Q	ENSP00000332773:R707Q	R	-	2	0	IGDCC3	63408866	0.000000	0.05858	0.480000	0.27341	0.003000	0.03518	0.716000	0.25836	0.572000	0.29383	0.655000	0.94253	CGA	-	NULL		0.662	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGDCC3	protein_coding	OTTHUMT00000256826.1	C	NM_004884	-		65621813	-1	no_errors	ENST00000327987	ensembl	human	known	74_37	missense	SNP	0.003	T
AL133247.2	0	genome.wustl.edu	37	2	31751174	31751175	+	RNA	INS	-	-	ATATATATATATATATAT	rs192604242|rs10529926	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr2:31751174_31751175insATATATATATATATATAT	ENST00000435713.1	+	0	0				SRD5A2_ENST00000405650.1_RNA																							TACATATATACGGGACTATTAT	0.441																																																	0								ENSG00000049319																																			SRD5A2			0				HGNC																													2.37:g.31751174_31751175insATATATATATATATATAT		Somatic	NA	NA	NA		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000435713.1	37	NULL		2																																																																																			-	-		0.441	AL133247.2-001	KNOWN	basic|exp_conf	antisense	SRD5A2	antisense	OTTHUMT00000325125.1	-				31751175	-1	no_errors	ENST00000233139	ensembl	human	known	74_37	rna	INS	0.000:0.000	ATATATATATATATATAT
FPGT-TNNI3K	100526835	genome.wustl.edu	37	1	74929126	74929126	+	Splice_Site	SNP	G	G	T	rs145840620		TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr1:74929126G>T	ENST00000370899.3	+	23	2353	c.2316G>T	c.(2314-2316)gcG>gcT	p.A772A	TNNI3K_ENST00000370891.2_Splice_Site_p.A772A|FPGT-TNNI3K_ENST00000557284.2_Splice_Site_p.A785A|TNNI3K_ENST00000326637.3_Splice_Site_p.A671A	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough																		GGTTTGCAGCGGCTGCGGCAG	0.443																																																	0								ENSG00000259030						147.0	143.0	144.0					1																	74929126		2203	4300	6503	FPGT-TNNI3K	SO:0001630	splice_region_variant	0			-	HGNC			1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.2315-1G>T	1.37:g.74929126G>T		Somatic	0	58	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A785	ENST00000370899.3	37	c.2355		1																																																																																			-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.443	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	FPGT-TNNI3K	protein_coding	OTTHUMT00000026438.3	G		-	Silent	74929126	+1	no_errors	ENST00000557284	ensembl	human	known	74_37	silent	SNP	0.977	T
PASD1	139135	genome.wustl.edu	37	X	150840783	150840783	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chrX:150840783G>C	ENST00000370357.4	+	14	1811	c.1566G>C	c.(1564-1566)caG>caC	p.Q522H		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	522	Lys-rich.					nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					agaagctgcaggagcagaaaa	0.547																																																	0								ENSG00000166049						39.0	40.0	40.0					X																	150840783		2161	4213	6374	PASD1	SO:0001583	missense	0			-	HGNC	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.1566G>C	X.37:g.150840783G>C	ENSP00000359382:p.Gln522His	Somatic	0	48	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	26	29.73	Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_PAS,smart_PAS,pfscan_PAS	p.Q522H	ENST00000370357.4	37	c.1566	CCDS35431.1	X	.	.	.	.	.	.	.	.	.	.	G	5.936	0.356749	0.11239	.	.	ENSG00000166049	ENST00000370357	T	0.68624	-0.34	1.01	1.01	0.19927	.	.	.	.	.	T	0.59252	0.2180	N	0.08118	0	0.09310	N	1	D	0.62365	0.991	D	0.69824	0.966	T	0.47328	-0.9126	9	0.52906	T	0.07	.	4.9567	0.14044	0.0:0.0:1.0:0.0	.	522	Q8IV76	PASD1_HUMAN	H	522	ENSP00000359382:Q522H	ENSP00000359382:Q522H	Q	+	3	2	PASD1	150591439	0.000000	0.05858	0.004000	0.12327	0.017000	0.09413	0.176000	0.16782	0.759000	0.33084	0.284000	0.19432	CAG	-	NULL		0.547	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PASD1	protein_coding	OTTHUMT00000060879.2	G	NM_173493	-		150840783	+1	no_errors	ENST00000370357	ensembl	human	known	74_37	missense	SNP	0.004	C
COL7A1	1294	genome.wustl.edu	37	3	48622990	48622990	+	Splice_Site	SNP	C	C	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr3:48622990C>T	ENST00000328333.8	-	31	4001	c.3894G>A	c.(3892-3894)agG>agA	p.R1298R	COL7A1_ENST00000454817.1_Splice_Site_p.R1298R	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	1298	Interrupted collagenous region.|Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CCACACTCACCCTCTCGCCCT	0.572																																																	0								ENSG00000114270						59.0	69.0	66.0					3																	48622990		2203	4298	6501	COL7A1	SO:0001630	splice_region_variant	0			-	HGNC	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.3894+1G>A	3.37:g.48622990C>T		Somatic	0	57	0.00		0.6597972753633179	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	70	15.48	Q14054|Q16507	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fibronectin_type3,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.R1298	ENST00000328333.8	37	c.3894	CCDS2773.1	3																																																																																			-	pfam_Collagen		0.572	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	protein_coding	OTTHUMT00000257519.1	C	NM_000094	-	Silent	48622990	-1	no_errors	ENST00000328333	ensembl	human	known	74_37	silent	SNP	1.000	T
EVI5L	115704	genome.wustl.edu	37	19	7916385	7916385	+	Silent	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr19:7916385G>A	ENST00000270530.4	+	7	1015	c.819G>A	c.(817-819)tcG>tcA	p.S273S	EVI5L_ENST00000538904.2_Silent_p.S273S	NM_145245.3	NP_660288.1	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like	273	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	12						TGTATGCCTCGTCCTGGTTCC	0.607																																																	0								ENSG00000142459						348.0	234.0	273.0					19																	7916385		2203	4300	6503	EVI5L	SO:0001819	synonymous_variant	0			-	HGNC	BC014111	CCDS12188.1, CCDS54209.1	19p13	2013-07-09				ENSG00000142459			30464	protein-coding gene	gene with protein product						23669355	Standard	NM_001159944		Approved		uc010xjz.2	Q96CN4		ENST00000270530.4:c.819G>A	19.37:g.7916385G>A		Somatic	0	58	0.00		0.6597972753633179	45	45.78	38	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	101	29.37	B9A6I9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.S273	ENST00000270530.4	37	c.819	CCDS12188.1	19																																																																																			-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom		0.607	EVI5L-001	KNOWN	basic|CCDS	protein_coding	EVI5L	protein_coding	OTTHUMT00000461347.1	G	NM_145245	-		7916385	+1	no_errors	ENST00000538904	ensembl	human	known	74_37	silent	SNP	0.046	A
LINC00577	100113403	genome.wustl.edu	37	6	105388066	105388084	+	lincRNA	DEL	GTTCGGAATGATGTCCAGG	GTTCGGAATGATGTCCAGG	-	rs145567994	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	GTTCGGAATGATGTCCAGG	GTTCGGAATGATGTCCAGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr6:105388066_105388084delGTTCGGAATGATGTCCAGG	ENST00000369123.3	-	0	154_172					NR_046407.1				long intergenic non-protein coding RNA 577																		GAATTGTGCTGTTCGGAATGATGTCCAGGGCATCTGTAG	0.429																																																	0								ENSG00000203809																																			LINC00577			0				HGNC	AW612153, BF223582		6q21	2012-10-12	2012-03-01	2012-03-01	ENSG00000203809	ENSG00000203809		"""Long non-coding RNAs"""	21553	non-coding RNA	RNA, long non-coding			"""chromosome 6 open reading frame 220"""	C6orf220			Standard	NR_046407		Approved	dJ439I14.1	uc031spf.1		OTTHUMG00000015289		6.37:g.105388066_105388084delGTTCGGAATGATGTCCAGG		Somatic	NA	NA	NA		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369123.3	37	NULL		6																																																																																			-	-		0.429	LINC00577-001	KNOWN	basic	lincRNA	LINC00577	lincRNA	OTTHUMT00000041645.2	GTTCGGAATGATGTCCAGG				105388084	-1	no_errors	ENST00000369123	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.005:0.004:0.004:0.005:0.001:0.001:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-
PIP5K1B	8395	genome.wustl.edu	37	9	71437582	71437583	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr9:71437582_71437583insA	ENST00000265382.3	+	4	357_358	c.52_53insA	c.(52-54)gaafs	p.E18fs	PIP5K1B_ENST00000541509.1_Frame_Shift_Ins_p.E18fs|RP11-203L2.4_ENST00000442103.1_RNA	NM_003558.2	NP_003549.1	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, beta	18					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			breast(1)|large_intestine(2)|stomach(1)	4				Lung(182;0.133)		ACAAAATGAAGAAAAAACCTAT	0.386																																																	0								ENSG00000107242																																			PIP5K1B	SO:0001589	frameshift_variant	0				HGNC	U78579	CCDS6624.1, CCDS65063.1	9q13	2008-02-05			ENSG00000107242	ENSG00000107242			8995	protein-coding gene	gene with protein product		602745				9177790, 8841185	Standard	NM_003558		Approved	STM7, MSS4	uc004agu.4	O14986	OTTHUMG00000019976	ENST00000265382.3:c.58dupA	9.37:g.71437588_71437588dupA	ENSP00000265382:p.Glu18fs	Somatic	0	56	0.00		0.6597972753633179	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	51	34.62	A8K9L9|B4DIG7|P78518|P78519|Q5T5K6|Q5T5K8|Q5T5K9|Q5VZ00|Q7KYT5|Q8NHQ5|Q92749	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.T20fs	ENST00000265382.3	37	c.52_53	CCDS6624.1	9																																																																																			-	NULL		0.386	PIP5K1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP5K1B	protein_coding	OTTHUMT00000052561.2	-	NM_003558			71437583	+1	no_errors	ENST00000478500	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
SMAD5	4090	genome.wustl.edu	37	5	135513612	135513613	+	3'UTR	INS	-	-	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr5:135513612_135513613insA	ENST00000514641.2	+	0	2203_2204				SMAD5_ENST00000545620.1_3'UTR|SMAD5_ENST00000545279.1_3'UTR			Q99717	SMAD5_HUMAN	SMAD family member 5						BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cardiac muscle contraction (GO:0060048)|cartilage development (GO:0051216)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|embryonic pattern specification (GO:0009880)|erythrocyte differentiation (GO:0030218)|germ cell development (GO:0007281)|intracellular signal transduction (GO:0035556)|Mullerian duct regression (GO:0001880)|osteoblast fate commitment (GO:0002051)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|large_intestine(4)|lung(3)	8			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCCACCAACTTAAAAAAAAAAA	0.351																																																	0								ENSG00000113658																																			SMAD5	SO:0001624	3_prime_UTR_variant	0				HGNC	U59913	CCDS75308.1	5q31	2008-02-05	2006-11-06	2004-05-26		ENSG00000113658		"""SMADs"""	6771	protein-coding gene	gene with protein product		603110	"""MAD, mothers against decapentaplegic homolog 5 (Drosophila)"", ""SMAD, mothers against DPP homolog 5 (Drosophila)"""	MADH5		8673135	Standard	NM_005903		Approved	Dwfc, JV5-1	uc003lbl.1	Q99717		ENST00000514641.2:c.*2201->A	5.37:g.135513623_135513623dupA		Somatic	0	9	0.00		0.6597972753633179	46	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	7	30.00	O14688|Q15798|Q9UQA1	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000514641.2	37	NULL		5																																																																																			-	-		0.351	SMAD5-001	KNOWN	basic	processed_transcript	SMAD5	protein_coding	OTTHUMT00000372096.2	-	NM_005903			135513613	+1	no_errors	ENST00000514641	ensembl	human	known	74_37	rna	INS	0.702:0.549	A
PDE1C	5137	genome.wustl.edu	37	7	32109993	32109993	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr7:32109993T>C	ENST00000396191.1	-	1	468	c.13A>G	c.(13-15)Acc>Gcc	p.T5A	PDE1C_ENST00000396193.1_Intron|PDE1C_ENST00000396182.2_Missense_Mutation_p.T5A|PDE1C_ENST00000396184.3_Missense_Mutation_p.T5A|PDE1C_ENST00000321453.7_Missense_Mutation_p.T5A	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	5					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	ATCTCCTTGGTTGGCGACTCC	0.557																																																	0								ENSG00000154678						119.0	122.0	121.0					7																	32109993		2203	4300	6503	PDE1C	SO:0001583	missense	0			-	HGNC	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.13A>G	7.37:g.32109993T>C	ENSP00000379494:p.Thr5Ala	Somatic	0	63	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	110	26.17	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.T5A	ENST00000396191.1	37	c.13	CCDS55099.1	7	.	.	.	.	.	.	.	.	.	.	T	9.163	1.019127	0.19355	.	.	ENSG00000154678	ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182;ENST00000396189	T;T;T;T	0.71103	-0.54;-0.54;-0.51;-0.51	4.94	4.94	0.65067	.	.	.	.	.	T	0.42268	0.1195	N	0.01048	-1.04	0.34891	D	0.745576	B;B	0.19445	0.0;0.036	B;B	0.22152	0.002;0.038	T	0.50457	-0.8826	9	0.17832	T	0.49	.	14.7175	0.69280	0.0:0.0:0.0:1.0	.	5;5	Q14123-2;Q14123	.;PDE1C_HUMAN	A	5	ENSP00000379494:T5A;ENSP00000318105:T5A;ENSP00000379487:T5A;ENSP00000379485:T5A	ENSP00000318105:T5A	T	-	1	0	PDE1C	32076518	1.000000	0.71417	0.949000	0.38748	0.464000	0.32679	7.716000	0.84723	2.186000	0.69663	0.533000	0.62120	ACC	-	NULL		0.557	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PDE1C	protein_coding	OTTHUMT00000328458.1	T		-		32109993	-1	no_errors	ENST00000321453	ensembl	human	known	74_37	missense	SNP	1.000	C
KIZ-AS1	101929591	genome.wustl.edu	37	20	21142511	21142511	+	RNA	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr20:21142511G>A	ENST00000591761.1	-	0	5142				PLK1S1_ENST00000457464.1_RNA|RP5-872K7.7_ENST00000425746.2_RNA																							TGGTGTTGCAGGTTGCAGTGC	0.408																																																	0								ENSG00000088970						59.0	53.0	55.0					20																	21142511		1895	4105	6000	PLK1S1			0			-	HGNC																													20.37:g.21142511G>A		Somatic	0	79	0.00		0.6597972753633179	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	77	12.50		Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000591761.1	37	c.NULL		20																																																																																			-	-		0.408	RP4-777D9.2-002	KNOWN	basic	antisense	PLK1S1	antisense	OTTHUMT00000078258.2	G		-		21142511	+1	no_errors	ENST00000246027	ensembl	human	known	74_37	splice_site	SNP	0.991	A
ARAP2	116984	genome.wustl.edu	37	4	36212251	36212251	+	Silent	SNP	T	T	G			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr4:36212251T>G	ENST00000303965.4	-	6	1737	c.1248A>C	c.(1246-1248)tcA>tcC	p.S416S		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	416					regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						CTTCTACTGTTGAGTATTCTG	0.363																																																	0								ENSG00000047365						115.0	122.0	120.0					4																	36212251		2203	4299	6502	ARAP2	SO:0001819	synonymous_variant	0			-	HGNC	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.1248A>C	4.37:g.36212251T>G		Somatic	0	69	0.00		0.6597972753633179	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	40	20.00	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_SAM_2,pfam_Ras-assoc,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.S416	ENST00000303965.4	37	c.1248	CCDS3441.1	4																																																																																			-	NULL		0.363	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP2	protein_coding	OTTHUMT00000215074.2	T	NM_015230	-		36212251	-1	no_errors	ENST00000303965	ensembl	human	known	74_37	silent	SNP	0.988	G
DSCAM	1826	genome.wustl.edu	37	21	41496170	41496170	+	Silent	SNP	G	G	A	rs201137339	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr21:41496170G>A	ENST00000400454.1	-	20	4125	c.3648C>T	c.(3646-3648)aaC>aaT	p.N1216N		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1216	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GGATGATGCCGTTCAGCTTGA	0.572													G|||	4	0.000798722	0.003	0.0	5008	,	,		17417	0.0		0.0	False		,,,				2504	0.0				Melanoma(134;970 1778 1785 21664 32388)												0								ENSG00000171587	G		11,4069		0,11,2029	155.0	164.0	161.0		3648	-3.6	1.0	21		161	0,8370		0,0,4185	no	coding-synonymous	DSCAM	NM_001389.3		0,11,6214	AA,AG,GG		0.0,0.2696,0.0884		1216/2013	41496170	11,12439	2040	4185	6225	DSCAM	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.3648C>T	21.37:g.41496170G>A		Somatic	0	98	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	85	23.21	O60468	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.N1216	ENST00000400454.1	37	c.3648	CCDS42929.1	21																																																																																			-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.572	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	protein_coding	OTTHUMT00000195029.1	G	NM_001389	rs201137339		41496170	-1	no_errors	ENST00000400454	ensembl	human	known	74_37	silent	SNP	0.975	A
RGPD3	653489	genome.wustl.edu	37	2	107069174	107069174	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr2:107069174G>A	ENST00000409886.3	-	5	701	c.614C>T	c.(613-615)tCg>tTg	p.S205L	RGPD3_ENST00000304514.7_Missense_Mutation_p.S205L	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	205					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TACAACACACGAATTCCACTC	0.428																																																	0								ENSG00000153165						1.0	1.0	1.0					2																	107069174		105	218	323	RGPD3	SO:0001583	missense	0			-	HGNC		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.614C>T	2.37:g.107069174G>A	ENSP00000386588:p.Ser205Leu	Somatic	0	27	0.00		0.6597972753633179	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	45	22.41	B8ZZM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.S205L	ENST00000409886.3	37	c.614	CCDS46379.1	2	.	.	.	.	.	.	.	.	.	.	.	3.687	-0.064302	0.07273	.	.	ENSG00000153165	ENST00000409886;ENST00000304514;ENST00000440524	T;T	0.32753	1.44;1.44	2.69	1.75	0.24633	.	.	.	.	.	T	0.30479	0.0766	M	0.66939	2.045	0.21105	N	0.999783	B	0.09022	0.002	B	0.04013	0.001	T	0.28202	-1.0051	9	0.56958	D	0.05	-2.8542	7.9075	0.29771	0.1378:0.0:0.8622:0.0	.	205	A6NKT7	RGPD3_HUMAN	L	205;205;148	ENSP00000386588:S205L;ENSP00000303659:S205L	ENSP00000303659:S205L	S	-	2	0	RGPD3	106435606	0.948000	0.32251	0.996000	0.52242	0.210000	0.24377	1.390000	0.34464	0.416000	0.25844	0.186000	0.17326	TCG	-	NULL		0.428	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	protein_coding	OTTHUMT00000329975.1	G	XM_929931	-		107069174	-1	no_errors	ENST00000304514	ensembl	human	known	74_37	missense	SNP	0.946	A
EGFL8	80864	genome.wustl.edu	37	6	32134340	32134340	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr6:32134340C>T	ENST00000395512.1	+	3	272	c.167C>T	c.(166-168)cCa>cTa	p.P56L	AGPAT1_ENST00000490711.1_5'Flank|EGFL8_ENST00000333845.6_Missense_Mutation_p.P56L|PPT2-EGFL8_ENST00000422437.1_3'UTR			Q99944	EGFL8_HUMAN	EGF-like-domain, multiple 8	56	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|urinary_tract(1)	10						TACAGCCAACCAGTGTACAAG	0.587																																																	0								ENSG00000241404						116.0	102.0	107.0					6																	32134340		1511	2709	4220	EGFL8	SO:0001583	missense	0			-	HGNC	U89336	CCDS4743.1	6p21	2010-06-25	2003-05-21	2003-05-23	ENSG00000241404	ENSG00000241404			13944	protein-coding gene	gene with protein product		609897	"""chromosome 6 open reading frame 8"""	C6orf8			Standard	NM_030652		Approved	NG3		Q99944	OTTHUMG00000031222	ENST00000395512.1:c.167C>T	6.37:g.32134340C>T	ENSP00000378888:p.Pro56Leu	Somatic	0	55	0.00		0.6597972753633179	20	31.03	9	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	27	47.06	B0S884|G5E9Q0|Q5JP23|Q5SSX3|Q8IV30	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EMI_domain,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_EMI_domain	p.P56L	ENST00000395512.1	37	c.167	CCDS4743.1	6	.	.	.	.	.	.	.	.	.	.	C	29.6	5.023256	0.93462	.	.	ENSG00000241404	ENST00000333845;ENST00000395512;ENST00000432129	T;T;T	0.44482	0.92;0.92;0.92	5.93	5.93	0.95920	EMI domain (2);	.	.	.	.	T	0.58119	0.2100	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.59506	-0.7442	9	0.66056	D	0.02	-9.0746	15.841	0.78845	0.0:1.0:0.0:0.0	.	56	Q99944	EGFL8_HUMAN	L	56	ENSP00000333380:P56L;ENSP00000378888:P56L;ENSP00000401694:P56L	ENSP00000333380:P56L	P	+	2	0	EGFL8	32242318	0.995000	0.38212	0.942000	0.38095	0.990000	0.78478	5.383000	0.66219	2.814000	0.96858	0.655000	0.94253	CCA	-	pfam_EMI_domain,pfscan_EMI_domain		0.587	EGFL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGFL8	protein_coding	OTTHUMT00000076463.3	C	NM_030652	-		32134340	+1	no_errors	ENST00000333845	ensembl	human	known	74_37	missense	SNP	0.997	T
SLC12A5	57468	genome.wustl.edu	37	20	44669254	44669254	+	Splice_Site	SNP	G	G	A	rs142641765		TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr20:44669254G>A	ENST00000454036.2	+	7	972		c.e7+1		SLC12A5_ENST00000243964.3_Splice_Site|SLC12A5_ENST00000372315.1_Silent_p.P285P	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5						cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CCAACTTCCCGTGAGTGCTGC	0.567																																																	0								ENSG00000124140	G	,	0,4406		0,0,2203	183.0	151.0	162.0		,	5.0	1.0	20	dbSNP_134	162	1,8599	1.2+/-3.3	0,1,4299	no	splice-5,splice-5	SLC12A5	NM_001134771.1,NM_020708.4	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	,	44669254	1,13005	2203	4300	6503	SLC12A5	SO:0001630	splice_region_variant	0			-	HGNC	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.923+1G>A	20.37:g.44669254G>A		Somatic	0	20	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	38	30.91	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e7+1	ENST00000454036.2	37	c.923+1	CCDS46610.1	20	.	.	.	.	.	.	.	.	.	.	G	26.0	4.693747	0.88735	0.0	1.16E-4	ENSG00000124140	ENST00000454036;ENST00000243964	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3986	0.87453	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC12A5	44102661	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.657000	0.98554	2.572000	0.86782	0.655000	0.94253	.	-	-		0.567	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	SLC12A5	protein_coding	OTTHUMT00000471538.1	G		rs142641765	Intron	44669254	+1	no_errors	ENST00000454036	ensembl	human	known	74_37	splice_site	SNP	1.000	A
F3	2152	genome.wustl.edu	37	1	94998750	94998750	+	Silent	SNP	G	G	T	rs5901	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr1:94998750G>T	ENST00000334047.7	-	4	650	c.487C>A	c.(487-489)Cgg>Agg	p.R163R	F3_ENST00000480356.1_5'UTR|F3_ENST00000370207.4_Silent_p.R163R	NM_001993.4	NP_001984.1	P13726	TF_HUMAN	coagulation factor III (thromboplastin, tissue factor)	163			R -> W (in dbSNP:rs5901).		activation of blood coagulation via clotting cascade (GO:0002543)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of plasma proteins involved in acute inflammatory response (GO:0002541)|blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)|protease binding (GO:0002020)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(7)	14		all_lung(203;0.00106)|Lung NSC(277;0.00475)		all cancers(265;0.0232)|Epithelial(280;0.121)	Coagulation factor VIIa(DB00036)	ACTAAAGTCCGTTCATCTTCT	0.403																																					Melanoma(40;358 1339 15970 39161)												0								ENSG00000117525						133.0	118.0	123.0					1																	94998750		2203	4300	6503	F3	SO:0001819	synonymous_variant	0			-	HGNC	BC011029	CCDS750.1, CCDS53345.1	1p22-p21	2012-10-02			ENSG00000117525	ENSG00000117525		"""CD molecules"""	3541	protein-coding gene	gene with protein product		134390					Standard	NM_001993		Approved	CD142	uc001dqr.3	P13726	OTTHUMG00000010716	ENST00000334047.7:c.487C>A	1.37:g.94998750G>T		Somatic	0	57	0.00		0.6597972753633179	21	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	D3DT47|Q6FHG2|Q86WH4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,pirsf_Tissue_fac/coagulation_fac-3,prints_Tissue_factor	p.R163	ENST00000334047.7	37	c.487	CCDS750.1	1																																																																																			-	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,pirsf_Tissue_fac/coagulation_fac-3,prints_Tissue_factor		0.403	F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F3	protein_coding	OTTHUMT00000029593.1	G	NM_001993	-		94998750	-1	no_errors	ENST00000334047	ensembl	human	known	74_37	silent	SNP	0.000	T
PLA2G2A	5320	genome.wustl.edu	37	1	20305467	20305472	+	Intron	DEL	CACACA	CACACA	-	rs71857665|rs376364585|rs531707871|rs3061293|rs2236769		TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	CACACA	CACACA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr1:20305467_20305472delCACACA	ENST00000375111.3	-	3	166				PLA2G2A_ENST00000400520.3_Intron|PLA2G2A_ENST00000496748.1_Intron	NM_000300.3|NM_001161727.1	NP_000291.1|NP_001155199.1	P14555	PA2GA_HUMAN	phospholipase A2, group IIA (platelets, synovial fluid)						defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of epithelial cell proliferation (GO:0050680)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidic acid metabolic process (GO:0046473)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|small molecule metabolic process (GO:0044281)|somatic stem cell maintenance (GO:0035019)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|phospholipase A2 activity (GO:0004623)|phospholipid binding (GO:0005543)			central_nervous_system(1)|lung(6)|prostate(1)|stomach(1)	9		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00459)|Lung NSC(340;0.00475)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000138)|Kidney(64;0.000171)|GBM - Glioblastoma multiforme(114;0.00032)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Diclofenac(DB00586)|Ginkgo biloba(DB01381)|Indomethacin(DB00328)|Suramin(DB04786)	TCCAGCAATGcacacacacacacaca	0.553																																																	0								ENSG00000188257																																			PLA2G2A	SO:0001627	intron_variant	0				HGNC	BC005919	CCDS201.1	1p35	2008-09-19			ENSG00000188257	ENSG00000188257	3.1.1.4		9031	protein-coding gene	gene with protein product		172411		PLA2B, PLA2L		8838795	Standard	NM_000300		Approved		uc010odb.2	P14555	OTTHUMG00000002699	ENST00000375111.3:c.106-95TGTGTG>-	1.37:g.20305473_20305478delCACACA		Somatic	NA	NA	NA		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K5I7|Q6DN24|Q6IBD9|Q9UCD2	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000375111.3	37	NULL	CCDS201.1	1																																																																																			-	-		0.553	PLA2G2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G2A	protein_coding	OTTHUMT00000007675.1	CACACA	NM_000300			20305472	-1	no_errors	ENST00000461140	ensembl	human	known	74_37	rna	DEL	0.006:0.005:0.003:0.001:0.001:0.000	-
USH2A	7399	genome.wustl.edu	37	1	216500945	216500945	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr1:216500945G>T	ENST00000307340.3	-	5	1222	c.836C>A	c.(835-837)gCa>gAa	p.A279E	USH2A_ENST00000366942.3_Missense_Mutation_p.A279E|USH2A_ENST00000366943.2_Missense_Mutation_p.A279E	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	279	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTTTGTAAGTGCCACTTGGTA	0.353										HNSCC(13;0.011)																																							0								ENSG00000042781						154.0	147.0	150.0					1																	216500945		2203	4300	6503	USH2A	SO:0001583	missense	0			-	HGNC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.836C>A	1.37:g.216500945G>T	ENSP00000305941:p.Ala279Glu	Somatic	0	58	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	41	34.92	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.A279E	ENST00000307340.3	37	c.836	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.043913	0.93685	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.80994	-1.44;-1.44;-1.44	5.76	4.85	0.62838	Concanavalin A-like lectin/glucanase (1);LamG-like jellyroll fold (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin, N-terminal (2);	0.183135	0.25839	U	0.027978	D	0.86806	0.6021	M	0.61703	1.905	0.38266	D	0.942013	D;D	0.69078	0.997;0.993	P;D	0.63192	0.904;0.912	D	0.89237	0.3581	10	0.66056	D	0.02	.	14.6527	0.68808	0.0696:0.0:0.9304:0.0	.	279;279	O75445-2;O75445	.;USH2A_HUMAN	E	279	ENSP00000305941:A279E;ENSP00000355910:A279E;ENSP00000355909:A279E	ENSP00000305941:A279E	A	-	2	0	USH2A	214567568	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	7.137000	0.77295	1.441000	0.47550	0.563000	0.77884	GCA	-	superfamily_ConA-like_lec_gl_sf,smart_LamG-like,smart_Laminin_N,pfscan_Laminin_N		0.353	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	protein_coding	OTTHUMT00000128138.1	G	NM_007123	-		216500945	-1	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	SNP	1.000	T
SCN11A	11280	genome.wustl.edu	37	3	38948824	38948843	+	Intron	DEL	TGTGTGTGTGTATATATCTA	TGTGTGTGTGTATATATCTA	-	rs138466233|rs371006611|rs200809384|rs62242293	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	TGTGTGTGTGTATATATCTA	TGTGTGTGTGTATATATCTA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr3:38948824_38948843delTGTGTGTGTGTATATATCTA	ENST00000302328.3	-	10	1672				SCN11A_ENST00000450244.1_Intron|SCN11A_ENST00000444237.2_Intron|AC116038.1_ENST00000401122.1_RNA|SCN11A_ENST00000456224.3_Intron	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit						cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	tgtgtgtgtgtgtgtgtgtgtATATATCTATATATacaca	0.386																																																	0								ENSG00000215941																																			AC116038.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.1473+596TAGATATATACACACACACA>-	3.37:g.38948824_38948843delTGTGTGTGTGTATATATCTA		Somatic	NA	NA	NA		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000302328.3	37	NULL	CCDS33737.1	3																																																																																			-	-		0.386	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215941	protein_coding	OTTHUMT00000109746.4	TGTGTGTGTGTATATATCTA	NM_014139			38948843	+1	no_errors	ENST00000401122	ensembl	human	novel	74_37	rna	DEL	0.137:0.126:0.125:0.119:0.107:0.069:0.062:0.049:0.028:0.020:0.007:0.002:0.001:0.001:0.002:0.002:0.002:0.001:0.001:0.001	-
SORL1	6653	genome.wustl.edu	37	11	121403173	121403173	+	Splice_Site	SNP	G	G	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr11:121403173G>T	ENST00000260197.7	+	12	1726	c.1597G>T	c.(1597-1599)Gca>Tca	p.A533S	SORL1_ENST00000532451.1_3'UTR	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	533					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		TCCTCTTCAGGCACTTCCTGG	0.512																																																	0								ENSG00000137642						118.0	101.0	107.0					11																	121403173		2203	4299	6502	SORL1	SO:0001630	splice_region_variant	0			-	HGNC	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.1597-1G>T	11.37:g.121403173G>T		Somatic	0	37	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B2RNX7|Q92856	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_Fibronectin_type3,pfam_LDLR_classB_rpt,superfamily_Fibronectin_type3,superfamily_LDrepeatLR_classA_rpt,smart_VPS10,smart_LDLR_classB_rpt,smart_LDrepeatLR_classA_rpt,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.A533S	ENST00000260197.7	37	c.1597	CCDS8436.1	11	.	.	.	.	.	.	.	.	.	.	G	14.06	2.423040	0.43020	.	.	ENSG00000137642	ENST00000260197	T	0.42513	0.97	5.03	4.11	0.48088	VPS10 (1);	0.275715	0.33127	N	0.005244	T	0.22704	0.0548	N	0.14661	0.345	0.80722	D	1	B	0.28667	0.219	B	0.22880	0.042	T	0.05517	-1.0880	9	.	.	.	.	10.2283	0.43238	0.0:0.1481:0.6982:0.1537	.	533	Q92673	SORL_HUMAN	S	533	ENSP00000260197:A533S	.	A	+	1	0	SORL1	120908383	1.000000	0.71417	0.976000	0.42696	0.930000	0.56654	6.101000	0.71479	1.088000	0.41272	0.655000	0.94253	GCA	-	smart_VPS10		0.512	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORL1	protein_coding	OTTHUMT00000387626.2	G	NM_003105	-	Missense_Mutation	121403173	+1	no_errors	ENST00000260197	ensembl	human	known	74_37	missense	SNP	1.000	T
GIMAP8	155038	genome.wustl.edu	37	7	150174830	150174830	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr7:150174830G>A	ENST00000307271.3	+	5	2534	c.1960G>A	c.(1960-1962)Gaa>Aaa	p.E654K		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	654						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		GTCCCAAGCCGAAAAACTCCT	0.463																																																	0								ENSG00000171115						43.0	48.0	46.0					7																	150174830		2165	4288	6453	GIMAP8	SO:0001583	missense	0			-	HGNC	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.1960G>A	7.37:g.150174830G>A	ENSP00000305107:p.Glu654Lys	Somatic	0	131	0.00		0.6597972753633179	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	82	124	39.61		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AIG1,superfamily_P-loop_NTPase	p.E654K	ENST00000307271.3	37	c.1960	CCDS34777.1	7	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.568140	0.00133	.	.	ENSG00000171115	ENST00000307271	T	0.05319	3.46	3.5	-6.99	0.01605	AIG1 (1);	1.518970	0.04492	N	0.379769	T	0.01661	0.0053	N	0.01109	-1.01	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23691	-1.0181	10	0.17369	T	0.5	.	1.1102	0.01702	0.3935:0.0925:0.2347:0.2792	.	654	Q8ND71	GIMA8_HUMAN	K	654	ENSP00000305107:E654K	ENSP00000305107:E654K	E	+	1	0	GIMAP8	149805763	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.873000	0.01637	-5.955000	0.00008	-1.384000	0.01168	GAA	-	pfam_AIG1		0.463	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP8	protein_coding	OTTHUMT00000350701.1	G	NM_175571	-		150174830	+1	no_errors	ENST00000307271	ensembl	human	known	74_37	missense	SNP	0.000	A
LPIN1	23175	genome.wustl.edu	37	2	11955338	11955338	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr2:11955338C>T	ENST00000256720.2	+	17	2359	c.2266C>T	c.(2266-2268)Ccc>Tcc	p.P756S	LPIN1_ENST00000404113.2_Missense_Mutation_p.P257S|LPIN1_ENST00000396097.1_Missense_Mutation_p.P486S|LPIN1_ENST00000396099.1_Missense_Mutation_p.P798S|LPIN1_ENST00000449576.2_Missense_Mutation_p.P841S|LPIN1_ENST00000425416.2_Missense_Mutation_p.P762S	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	756	C-LIP.				cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		GCTGCTGAGTCCCAGCAGCCT	0.637																																																	0								ENSG00000134324						26.0	29.0	28.0					2																	11955338		2203	4300	6503	LPIN1	SO:0001583	missense	0			-	HGNC	D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.2266C>T	2.37:g.11955338C>T	ENSP00000256720:p.Pro756Ser	Somatic	0	33	0.00		0.6597972753633179	37	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LNS2,pfam_Lipin_N,superfamily_HAD-like_dom,superfamily_WD40_repeat_dom,smart_LNS2	p.P841S	ENST00000256720.2	37	c.2521	CCDS1682.1	2	.	.	.	.	.	.	.	.	.	.	C	18.38	3.610375	0.66558	.	.	ENSG00000134324	ENST00000449576;ENST00000396099;ENST00000425416;ENST00000256720;ENST00000396097;ENST00000404113	D;D;D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93;-1.93;-1.93	4.94	4.05	0.47172	HAD-like domain (2);LNS2, Lipin/Ned1/Smp2 (2);	0.051910	0.85682	D	0.000000	D	0.93180	0.7828	M	0.89163	3.01	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.97	D;D;D	0.97110	1.0;1.0;0.992	D	0.94287	0.7525	10	0.87932	D	0	-23.1896	15.2248	0.73342	0.0:0.8586:0.1414:0.0	.	257;841;756	B4DET9;F5GY24;Q14693	.;.;LPIN1_HUMAN	S	841;798;762;756;486;257	ENSP00000397908:P841S;ENSP00000379406:P798S;ENSP00000401522:P762S;ENSP00000256720:P756S;ENSP00000379404:P486S;ENSP00000386120:P257S	ENSP00000256720:P756S	P	+	1	0	LPIN1	11872789	1.000000	0.71417	0.992000	0.48379	0.458000	0.32498	7.338000	0.79269	1.061000	0.40601	-0.310000	0.09108	CCC	-	pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2		0.637	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPIN1	protein_coding	OTTHUMT00000239296.3	C	NM_145693	-		11955338	+1	no_errors	ENST00000449576	ensembl	human	known	74_37	missense	SNP	1.000	T
GOLGA8I	283796	genome.wustl.edu	37	15	23259867	23259867	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr15:23259867G>T	ENST00000450802.3	+	8	635	c.537G>T	c.(535-537)gaG>gaT	p.E179D		NM_001282468.1|NM_001282472.1|NM_001282484.1|NM_001282490.1|NM_001282493.1|NM_001282494.1	NP_001269397.1|NP_001269401.1|NP_001269413.1|NP_001269419.1|NP_001269422.1|NP_001269423.1	A6NC78	GOG8I_HUMAN	golgin A8 family, member I	179						Golgi apparatus (GO:0005794)|membrane (GO:0016020)											GTAAAGGAGAGTTAGAGAGTG	0.527																																																	0								ENSG00000153666																																			GOLGA8I	SO:0001583	missense	0			-	HGNC	AK093104		15q11.2	2013-01-17	2012-10-05	2012-10-05	ENSG00000153666	ENSG00000277561			26660	other	unknown	"""FLJ35785"""		"""golgi autoantigen, golgin subfamily a, 9 pseudogene"", ""golgin A9, pseudogene"", ""golgin A8 family, member I, pseudogene"""	GOLGA9P, GOLGA8IP			Standard	NR_024074		Approved	FLJ35785	uc001yvh.1	A6NC78	OTTHUMG00000129149	ENST00000450802.3:c.537G>T	15.37:g.23259867G>T	ENSP00000399637:p.Glu179Asp	Somatic	0	111	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	137	21.26		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E179D	ENST00000450802.3	37	c.537		15	.	.	.	.	.	.	.	.	.	.	.	12.79	2.044941	0.36085	.	.	ENSG00000153666	ENST00000450802	T	0.20069	2.1	0.83	0.83	0.18854	.	.	.	.	.	T	0.39835	0.1093	.	.	.	.	.	.	D	0.89917	1.0	D	0.83275	0.996	T	0.50866	-0.8777	7	0.56958	D	0.05	.	7.6315	0.28243	0.0:0.0:1.0:0.0	.	98	Q8NA68	.	D	179	ENSP00000399637:E179D	ENSP00000399637:E179D	E	+	3	2	GOLGA8IP	20811308	0.989000	0.36119	0.011000	0.14972	0.365000	0.29674	-0.217000	0.09253	0.775000	0.33450	0.064000	0.15345	GAG	-	NULL		0.527	GOLGA8I-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	GOLGA8I	protein_coding	OTTHUMT00000251213.2	G	NR_024074	-		23259867	+1	no_errors	ENST00000450802	ensembl	human	known	74_37	missense	SNP	0.696	T
OR8D1	283159	genome.wustl.edu	37	11	124179847	124179847	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr11:124179847C>A	ENST00000357821.2	-	1	886	c.816G>T	c.(814-816)aaG>aaT	p.K272N		NM_001002917.1	NP_001002917.1	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D, member 1	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(1)|lung(7)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		CAGAGGACACCTTCTCCTGGT	0.463																																																	0								ENSG00000196341						109.0	104.0	106.0					11																	124179847		2201	4299	6500	OR8D1	SO:0001583	missense	0			-	HGNC	AF238489	CCDS31706.1	11q25	2012-08-09			ENSG00000196341	ENSG00000196341		"""GPCR / Class A : Olfactory receptors"""	8481	protein-coding gene	gene with protein product				OR8D3			Standard	NM_001002917		Approved	OST004	uc010sag.2	Q8WZ84	OTTHUMG00000165977	ENST00000357821.2:c.816G>T	11.37:g.124179847C>A	ENSP00000350474:p.Lys272Asn	Somatic	0	79	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	46	34.29	B2RNL4|Q6IEW1|Q8NGH0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K272N	ENST00000357821.2	37	c.816	CCDS31706.1	11	.	.	.	.	.	.	.	.	.	.	c	8.692	0.907606	0.17833	.	.	ENSG00000196341	ENST00000357821	T	0.00207	8.55	4.29	-2.53	0.06326	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38436	U	0.001689	T	0.00496	0.0016	M	0.92077	3.27	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.48456	-0.9034	10	0.59425	D	0.04	.	4.2567	0.10721	0.2431:0.3836:0.0:0.3732	.	272	Q8WZ84	OR8D1_HUMAN	N	272	ENSP00000350474:K272N	ENSP00000350474:K272N	K	-	3	2	OR8D1	123685057	0.000000	0.05858	0.266000	0.24541	0.005000	0.04900	-2.707000	0.00820	-0.105000	0.12132	-0.363000	0.07495	AAG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.463	OR8D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8D1	protein_coding	OTTHUMT00000387285.1	C	NM_001002917	-		124179847	-1	no_errors	ENST00000357821	ensembl	human	known	74_37	missense	SNP	0.000	A
ASTN2	23245	genome.wustl.edu	37	9	119204815	119204815	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr9:119204815A>G	ENST00000313400.4	-	21	3615	c.3515T>C	c.(3514-3516)gTg>gCg	p.V1172A	ASTN2_ENST00000288520.5_Missense_Mutation_p.V273A|ASTN2_ENST00000341734.4_Missense_Mutation_p.V224A|ASTN2_ENST00000361209.2_Missense_Mutation_p.V1121A|ASTN2_ENST00000361477.3_Missense_Mutation_p.V224A|ASTN2_ENST00000373996.3_Missense_Mutation_p.V1168A			O75129	ASTN2_HUMAN	astrotactin 2	1172	Fibronectin type-III.				negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						TCGTGTATCCACAGCATACAG	0.537																																																	0								ENSG00000148219						152.0	126.0	135.0					9																	119204815		2203	4300	6503	ASTN2	SO:0001583	missense	0			-	HGNC	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.3515T>C	9.37:g.119204815A>G	ENSP00000314038:p.Val1172Ala	Somatic	0	47	0.00		0.6597972753633179	23	4.17	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	82	10.87	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,superfamily_Fibronectin_type3,smart_MACPF	p.V1172A	ENST00000313400.4	37	c.3515		9	.	.	.	.	.	.	.	.	.	.	A	20.2	3.950882	0.73787	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000288520;ENST00000341734;ENST00000373986;ENST00000361209;ENST00000361477	T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86	5.43	5.43	0.79202	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.59689	0.2212	L	0.36672	1.1	0.80722	D	1	D;D;D;D;D;D;D	0.64830	0.99;0.99;0.971;0.994;0.966;0.99;0.99	D;D;P;D;P;D;D	0.73380	0.971;0.971;0.761;0.97;0.872;0.971;0.98	T	0.63373	-0.6652	10	0.87932	D	0	-20.342	15.5086	0.75760	1.0:0.0:0.0:0.0	.	224;224;1121;1172;1168;224;273	B7ZKP4;B7ZKP5;O75129-2;O75129;O75129-3;O75129-6;O75129-4	.;.;.;ASTN2_HUMAN;.;.;.	A	1172;1168;273;224;895;1121;224	ENSP00000314038:V1172A;ENSP00000363108:V1168A;ENSP00000288520:V273A;ENSP00000339925:V224A;ENSP00000363098:V895A;ENSP00000354504:V1121A;ENSP00000355116:V224A	ENSP00000288520:V273A	V	-	2	0	ASTN2	118244636	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.150000	0.94667	2.061000	0.61500	0.533000	0.62120	GTG	-	superfamily_Fibronectin_type3		0.537	ASTN2-201	KNOWN	basic	protein_coding	ASTN2	protein_coding		A	NM_014010	-		119204815	-1	no_errors	ENST00000313400	ensembl	human	known	74_37	missense	SNP	1.000	G
EPOR	2057	genome.wustl.edu	37	19	11489388	11489388	+	Silent	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr19:11489388G>A	ENST00000222139.6	-	7	998	c.894C>T	c.(892-894)acC>acT	p.T298T	EPOR_ENST00000592375.2_Silent_p.T298T	NM_000121.3	NP_000112.1	P19235	EPOR_HUMAN	erythropoietin receptor	298					brain development (GO:0007420)|decidualization (GO:0046697)|erythropoietin-mediated signaling pathway (GO:0038162)|heart development (GO:0007507)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	erythropoietin receptor activity (GO:0004900)|identical protein binding (GO:0042802)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)|Epoetin Zeta(DB08923)|Peginesatide(DB08894)	CCTTGTGGGTGGTGAAGAGGC	0.537																																																	0								ENSG00000187266						109.0	100.0	103.0					19																	11489388		2203	4300	6503	EPOR	SO:0001819	synonymous_variant	0			-	HGNC	M34986	CCDS12260.1	19p13.3-p13.2	2013-02-11				ENSG00000187266		"""Fibronectin type III domain containing"""	3416	protein-coding gene	gene with protein product		133171					Standard	NM_000121		Approved		uc002mrj.2	P19235		ENST00000222139.6:c.894C>T	19.37:g.11489388G>A		Somatic	0	52	0.00		0.6597972753633179	25	30.56	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	85	20.56	B2RCG4|Q15443|Q2M205	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Erythropoietin_rcpt,pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.T298	ENST00000222139.6	37	c.894	CCDS12260.1	19																																																																																			-	pirsf_Erythropoietin_rcpt		0.537	EPOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPOR	protein_coding	OTTHUMT00000458791.1	G		-		11489388	-1	no_errors	ENST00000222139	ensembl	human	known	74_37	silent	SNP	1.000	A
PTGIR	5739	genome.wustl.edu	37	19	47124905	47124905	+	Missense_Mutation	SNP	C	C	T	rs200508770		TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr19:47124905C>T	ENST00000291294.2	-	3	926	c.793G>A	c.(793-795)Gcc>Acc	p.A265T	PTGIR_ENST00000598865.1_Missense_Mutation_p.A53T|PTGIR_ENST00000594275.1_Missense_Mutation_p.A22T|PTGIR_ENST00000597185.1_5'UTR	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	265					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	CTGTCAGGGGCGACAGCCTGG	0.642																																																	0								ENSG00000160013						36.0	32.0	33.0					19																	47124905		2159	4229	6388	PTGIR	SO:0001583	missense	0			-	HGNC		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.793G>A	19.37:g.47124905C>T	ENSP00000291294:p.Ala265Thr	Somatic	0	59	0.00		0.6597972753633179	133	7.64	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	93	12.15		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Prostglndn_IP_rcpt,prints_Prostanoid_rcpt,prints_Thbox_rcpt	p.A265T	ENST00000291294.2	37	c.793	CCDS12686.1	19	.	.	.	.	.	.	.	.	.	.	C	6.984	0.551608	0.13374	.	.	ENSG00000160013	ENST00000291294	T	0.72167	-0.63	4.39	-0.764	0.11027	GPCR, rhodopsin-like superfamily (1);	0.739442	0.12672	N	0.448680	T	0.41743	0.1172	N	0.12182	0.205	0.09310	N	1	B	0.16166	0.016	B	0.20184	0.028	T	0.22521	-1.0214	10	0.09590	T	0.72	-16.2589	2.6653	0.05046	0.349:0.3006:0.0:0.3504	.	265	P43119	PI2R_HUMAN	T	265	ENSP00000291294:A265T	ENSP00000291294:A265T	A	-	1	0	PTGIR	51816745	0.020000	0.18652	0.980000	0.43619	0.336000	0.28762	-0.688000	0.05150	0.066000	0.16515	-0.367000	0.07326	GCC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Prostglndn_IP_rcpt		0.642	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGIR	protein_coding	OTTHUMT00000466581.1	C		rs200508770		47124905	-1	no_errors	ENST00000291294	ensembl	human	known	74_37	missense	SNP	0.008	T
TPTE	7179	genome.wustl.edu	37	21	11020842	11020842	+	5'UTR	SNP	A	A	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr21:11020842A>T	ENST00000415664.2	-	0	416				BAGE2_ENST00000470054.1_RNA			P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GGATGGTAACACTGACCACAC	0.363																																																	0								ENSG00000166157																																			TPTE	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000415664.2:c.-2920T>A	21.37:g.11020842A>T		Somatic	1	219	0.45		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	245	8.24	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000415664.2	37	NULL		21																																																																																			-	-		0.363	TPTE-006	KNOWN	basic	processed_transcript	TPTE	protein_coding	OTTHUMT00000340030.1	A		-		11020842	-1	no_errors	ENST00000415664	ensembl	human	known	74_37	rna	SNP	1.000	T
AK5	26289	genome.wustl.edu	37	1	77857160	77857161	+	Intron	INS	-	-	TGTGTA			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr1:77857160_77857161insTGTGTA	ENST00000354567.2	+	7	1154				AC095030.1_ENST00000408737.1_RNA|AK5_ENST00000344720.5_Intron	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5						ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						acacatatgtgtgtgtgtatgt	0.233																																																	0								ENSG00000221664																																			AC095030.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.892-19505->TGTGTA	1.37:g.77857160_77857161insTGTGTA		Somatic	NA	NA	NA		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000354567.2	37	NULL	CCDS675.1	1																																																																																			-	-		0.233	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221664	protein_coding	OTTHUMT00000026993.4	-	NM_174858			77857161	-1	no_errors	ENST00000408737	ensembl	human	novel	74_37	rna	INS	0.993:0.992	TGTGTA
SOX30	11063	genome.wustl.edu	37	5	157065660	157065660	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr5:157065660C>A	ENST00000265007.6	-	4	1799	c.1458G>T	c.(1456-1458)caG>caT	p.Q486H	SOX30_ENST00000311371.5_Intron|SOX30_ENST00000519442.1_Missense_Mutation_p.Q181H	NM_178424.1	NP_848511.1	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30	486					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to corticosteroid (GO:0031960)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	23	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGACGCTGGGCTGGAAAAGTG	0.527																																					Esophageal Squamous(31;525 799 19355 21125 41744)												0								ENSG00000039600						60.0	61.0	61.0					5																	157065660		2203	4300	6503	SOX30	SO:0001583	missense	0			-	HGNC	AB022083	CCDS4339.1, CCDS4340.1	5q33	2010-10-21			ENSG00000039600	ENSG00000039600		"""SRY (sex determining region Y)-boxes"""	30635	protein-coding gene	gene with protein product		606698				15019997, 11678506	Standard	NM_178424		Approved		uc003lxb.1	O94993	OTTHUMG00000130247	ENST00000265007.6:c.1458G>T	5.37:g.157065660C>A	ENSP00000265007:p.Gln486His	Somatic	0	41	0.00		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	86	17.31	O94995|Q8IYX6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.Q486H	ENST00000265007.6	37	c.1458	CCDS4339.1	5	.	.	.	.	.	.	.	.	.	.	C	17.50	3.404460	0.62288	.	.	ENSG00000039600	ENST00000265007;ENST00000519442	D;D	0.97959	-4.36;-4.63	5.49	3.46	0.39613	.	0.111699	0.40728	N	0.001040	D	0.96244	0.8775	N	0.24115	0.695	0.26855	N	0.968072	D;D	0.65815	0.976;0.995	P;P	0.62885	0.556;0.908	D	0.91147	0.4950	10	0.34782	T	0.22	.	9.1802	0.37136	0.0:0.7288:0.0:0.2712	.	181;486	B4DXW7;O94993	.;SOX30_HUMAN	H	486;181	ENSP00000265007:Q486H;ENSP00000427984:Q181H	ENSP00000265007:Q486H	Q	-	3	2	SOX30	156998238	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.265000	0.33027	1.329000	0.45376	-0.142000	0.14014	CAG	-	NULL		0.527	SOX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SOX30	protein_coding	OTTHUMT00000252571.2	C	NM_007017	-		157065660	-1	no_errors	ENST00000265007	ensembl	human	known	74_37	missense	SNP	0.997	A
PGM5	5239	genome.wustl.edu	37	9	71080114	71080114	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr9:71080114C>A	ENST00000396396.1	+	7	1378	c.1149C>A	c.(1147-1149)agC>agA	p.S383R	PGM5_ENST00000396392.1_Missense_Mutation_p.S383R	NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	383	Substrate binding. {ECO:0000250|UniProtKB:P00949}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)			endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						GGGAAGAGAGCTTTGGCACTG	0.478																																																	0								ENSG00000154330						210.0	190.0	197.0					9																	71080114		2203	4300	6503	PGM5	SO:0001583	missense	0			-	HGNC	L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.1149C>A	9.37:g.71080114C>A	ENSP00000379678:p.Ser383Arg	Somatic	0	50	0.00		0.6597972753633179	31	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	37	37.29	B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-III,pfam_A-D-PHexomutase_a/b/a-II,superfamily_A-D-PHexomutase_a/b/a-I/II/III,prints_Alpha-D-phosphohexomutase_SF	p.S383R	ENST00000396396.1	37	c.1149	CCDS6622.2	9	.	.	.	.	.	.	.	.	.	.	C	19.27	3.795843	0.70452	.	.	ENSG00000154330	ENST00000396396;ENST00000396392	T;T	0.68479	-0.33;-0.33	5.87	1.83	0.25207	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);Alpha-D-phosphohexomutase, alpha/beta/alpha domain III (1);	0.000000	0.85682	D	0.000000	D	0.87857	0.6283	H	0.99487	4.59	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	D	0.88725	0.3232	10	0.87932	D	0	.	10.2516	0.43372	0.0:0.6944:0.0:0.3056	.	383	Q15124	PGM5_HUMAN	R	383	ENSP00000379678:S383R;ENSP00000379674:S383R	ENSP00000379674:S383R	S	+	3	2	PGM5	70269934	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.201000	0.32259	0.438000	0.26450	0.655000	0.94253	AGC	-	pfam_A-D-PHexomutase_a/b/a-III,superfamily_A-D-PHexomutase_a/b/a-I/II/III		0.478	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PGM5	protein_coding	OTTHUMT00000052548.2	C	NM_021965	-		71080114	+1	no_errors	ENST00000396396	ensembl	human	known	74_37	missense	SNP	1.000	A
GOLGA6L6	727832	genome.wustl.edu	37	15	20739938	20739943	+	In_Frame_Del	DEL	CTCCTG	CTCCTG	-	rs201222558		TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	CTCCTG	CTCCTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr15:20739938_20739943delCTCCTG	ENST00000427390.2	-	8	1897_1902	c.1807_1812delCAGGAG	c.(1807-1812)caggagdel	p.QE603del		NM_001145004.1	NP_001138476.1	A8MZA4	GG6L6_HUMAN	golgin A6 family-like 6	603	Gln-rich.|Glu-rich.									NS(3)|endometrium(4)|kidney(1)|skin(3)	11						acatcttctcctcctgctcctgcctc	0.553																																																	0								ENSG00000215405			8,1308		2,4,652							0.0			5	46,2864		5,36,1414	no	coding	GOLGA6L6	NM_001145004.1		7,40,2066	A1A1,A1R,RR		1.5808,0.6079,1.2778				54,4172				GOLGA6L6	SO:0001651	inframe_deletion	0				HGNC	AK093450	CCDS45184.1	15q11.2	2014-02-12	2010-02-12		ENSG00000215405	ENSG00000277322			37225	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 6"""				Standard	NM_001145004		Approved	FLJ36131	uc001ytk.2	A8MZA4	OTTHUMG00000171663	ENST00000427390.2:c.1807_1812delCAGGAG	15.37:g.20739944_20739949delCTCCTG	ENSP00000398615:p.Gln603_Glu604del	Somatic	NA	NA	NA		0.6597972753633179	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	D3YTC0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.QE603in_frame_del	ENST00000427390.2	37	c.1812_1807	CCDS45184.1	15																																																																																			-	NULL		0.553	GOLGA6L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6L6	protein_coding	OTTHUMT00000414660.3	CTCCTG	NM_001145004			20739943	-1	no_errors	ENST00000427390	ensembl	human	known	74_37	in_frame_del	DEL	0.795:0.773:0.743:0.715:0.709:0.706	-
HDAC5	10014	genome.wustl.edu	37	17	42158226	42158226	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr17:42158226G>C	ENST00000393622.2	-	21	2963	c.2632C>G	c.(2632-2634)Cag>Gag	p.Q878E	HDAC5_ENST00000586802.1_Missense_Mutation_p.Q878E|HDAC5_ENST00000225983.6_Missense_Mutation_p.Q879E|HDAC5_ENST00000336057.5_Missense_Mutation_p.Q793E	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	878	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		AACGCCTGCTGGGTGCCATTG	0.542																																																	0								ENSG00000108840						138.0	116.0	124.0					17																	42158226		2203	4300	6503	HDAC5	SO:0001583	missense	0			-	HGNC	AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.2632C>G	17.37:g.42158226G>C	ENSP00000377244:p.Gln878Glu	Somatic	0	65	0.00		0.6597972753633179	173	13.00	26	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	75	16.67	C9JFV9|O60340|O60528|Q96DY4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.Q879E	ENST00000393622.2	37	c.2635	CCDS45696.1	17	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778695	0.90195	.	.	ENSG00000108840	ENST00000225983;ENST00000393622;ENST00000336057	T;T;T	0.69806	-0.43;-0.43;-0.43	4.63	4.63	0.57726	Histone deacetylase domain (2);	0.000000	0.64402	D	0.000001	T	0.77850	0.4192	M	0.66297	2.02	0.80722	D	1	P;P;D	0.54964	0.472;0.933;0.969	B;P;P	0.59889	0.115;0.664;0.865	T	0.80663	-0.1282	10	0.66056	D	0.02	-15.3658	16.4039	0.83651	0.0:0.0:1.0:0.0	.	793;879;878	Q9UQL6-2;Q9UQL6-3;Q9UQL6	.;.;HDAC5_HUMAN	E	879;878;793	ENSP00000225983:Q879E;ENSP00000377244:Q878E;ENSP00000337290:Q793E	ENSP00000225983:Q879E	Q	-	1	0	HDAC5	39513752	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.630000	0.98420	2.411000	0.81874	0.563000	0.77884	CAG	-	pfam_His_deacetylse_dom,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse		0.542	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC5	protein_coding	OTTHUMT00000457686.1	G	NM_001015053	-		42158226	-1	no_errors	ENST00000225983	ensembl	human	known	74_37	missense	SNP	1.000	C
THSD7A	221981	genome.wustl.edu	37	7	11633081	11633081	+	Silent	SNP	G	G	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr7:11633081G>T	ENST00000423059.4	-	3	1322	c.1071C>A	c.(1069-1071)atC>atA	p.I357I		NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	357					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		ACTCTTTGGTGATCACACAGG	0.488										HNSCC(18;0.044)																																							0								ENSG00000005108						114.0	112.0	113.0					7																	11633081		1946	4141	6087	THSD7A	SO:0001819	synonymous_variant	0			-	HGNC		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.1071C>A	7.37:g.11633081G>T		Somatic	0	23	0.00		0.6597972753633179	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	38	17.39		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.I357	ENST00000423059.4	37	c.1071	CCDS47543.1	7																																																																																			-	NULL		0.488	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	protein_coding	OTTHUMT00000325944.4	G	XM_928187.2	-		11633081	-1	no_errors	ENST00000423059	ensembl	human	known	74_37	silent	SNP	0.422	T
GPR114	221188	genome.wustl.edu	37	16	57609003	57609003	+	Splice_Site	SNP	C	C	T	rs370635864		TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr16:57609003C>T	ENST00000340339.4	+	11	2008	c.1485C>T	c.(1483-1485)taC>taT	p.Y495Y	GPR114_ENST00000394361.4_3'UTR|GPR114_ENST00000349457.3_Splice_Site_p.Y495Y	NM_153837.1	NP_722579.1	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114	495					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(5)|ovary(2)|stomach(1)|urinary_tract(1)	23						ACTCGCTCTACGGTAGGGCTG	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		18969	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000159618	C		0,4396		0,0,2198	68.0	60.0	63.0		1485	-3.3	1.0	16		63	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous-near-splice	GPR114	NM_153837.1		0,1,6497	TT,TC,CC		0.0116,0.0,0.0077		495/529	57609003	1,12995	2198	4300	6498	GPR114	SO:0001630	splice_region_variant	0			-	HGNC	AY140956	CCDS10785.1	16q13	2014-08-08			ENSG00000159618	ENSG00000159618		"""-"", ""GPCR / Class B : Orphans"""	19010	protein-coding gene	gene with protein product						12435584	Standard	NM_153837		Approved	PGR27	uc002ely.3	Q8IZF4	OTTHUMG00000133461	ENST00000340339.4:c.1486+1C>T	16.37:g.57609003C>T		Somatic	0	40	0.00		0.6597972753633179	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	28	22.22	B3KXZ5|Q6ZMH7|Q6ZML4|Q86SL8|Q8IZ14	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_orphan_rcpt_GPR56	p.Y495	ENST00000340339.4	37	c.1485	CCDS10785.1	16																																																																																			-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like		0.597	GPR114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR114	protein_coding	OTTHUMT00000257336.3	C	NM_153837	-	Silent	57609003	+1	no_errors	ENST00000340339	ensembl	human	known	74_37	silent	SNP	0.931	T
ZNF12	7559	genome.wustl.edu	37	7	6732294	6732294	+	Silent	SNP	C	C	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr7:6732294C>T	ENST00000405858.1	-	5	820	c.279G>A	c.(277-279)caG>caA	p.Q93Q	ZNF12_ENST00000404360.1_Silent_p.Q57Q|ZNF12_ENST00000342651.5_Silent_p.Q93Q|AC073343.2_ENST00000577401.1_RNA|AC073343.13_ENST00000366167.2_RNA	NM_006956.2|NM_016265.3	NP_008887.2|NP_057349.2	P17014	ZNF12_HUMAN	zinc finger protein 12	93					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(3)	16		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		TTTCCTCTTCCTGGATTCTCT	0.348																																																	0								ENSG00000164631						124.0	124.0	124.0					7																	6732294		1821	4087	5908	ZNF12	SO:0001819	synonymous_variant	0			-	HGNC	X52334, AB021643	CCDS47538.1, CCDS47539.1	7p21.1	2013-01-08	2005-06-09		ENSG00000164631	ENSG00000164631		"""Zinc fingers, C2H2-type"", ""-"""	12902	protein-coding gene	gene with protein product		194536	"""zinc finger protein 325"""	ZNF325			Standard	NM_016265		Approved	KOX3, GIOT-3	uc003sqt.1	P17014	OTTHUMG00000151910	ENST00000405858.1:c.279G>A	7.37:g.6732294C>T		Somatic	0	48	0.00		0.6597972753633179	16	15.79	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	78	9.30	A8MYC4|A8WFQ8|B2RNQ7|B4DF45|Q6N016|Q8NHZ0|Q9H9P0|Q9ULZ6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q93	ENST00000405858.1	37	c.279	CCDS47538.1	7																																																																																			-	NULL		0.348	ZNF12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF12	protein_coding	OTTHUMT00000324373.2	C	NM_016265	-		6732294	-1	no_errors	ENST00000405858	ensembl	human	known	74_37	silent	SNP	0.000	T
