#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ANK3	288	genome.wustl.edu	37	10	61833091	61833091	+	Silent	SNP	G	G	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr10:61833091G>T	ENST00000280772.2	-	37	7739	c.7548C>A	c.(7546-7548)tcC>tcA	p.S2516S	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron|ANK3_ENST00000355288.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2516					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TATAGATTTTGGAGAGAATTT	0.413																																																	0								ENSG00000151150						102.0	111.0	108.0					10																	61833091		2203	4300	6503	ANK3	SO:0001819	synonymous_variant	0			-	HGNC	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.7548C>A	10.37:g.61833091G>T		Somatic	0	45	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.S2516	ENST00000280772.2	37	c.7548	CCDS7258.1	10																																																																																			-	NULL		0.413	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	protein_coding	OTTHUMT00000048201.4	G	NM_020987	-		61833091	-1	no_errors	ENST00000280772	ensembl	human	known	74_37	silent	SNP	1.000	T
TTC39B	158219	genome.wustl.edu	37	9	15211327	15211327	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr9:15211327A>T	ENST00000512701.2	-	5	587	c.551T>A	c.(550-552)tTc>tAc	p.F184Y	TTC39B_ENST00000507285.1_Missense_Mutation_p.F19Y|TTC39B_ENST00000541445.1_Missense_Mutation_p.F118Y|TTC39B_ENST00000297615.5_Missense_Mutation_p.F115Y|TTC39B_ENST00000380850.4_Missense_Mutation_p.F184Y|TTC39B_ENST00000582994.1_5'Flank|TTC39B_ENST00000507993.1_Missense_Mutation_p.F19Y|TTC39B_ENST00000355694.2_Missense_Mutation_p.F118Y			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	184										NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						CTGTTGCTCGAAGGTCAGGAC	0.463																																																	0								ENSG00000155158						154.0	133.0	141.0					9																	15211327		2203	4300	6503	TTC39B	SO:0001583	missense	0			-	HGNC	AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.551T>A	9.37:g.15211327A>T	ENSP00000422496:p.Phe184Tyr	Somatic	0	46	0.00		0.6230499004162908	3	57.14	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	29	36.96	A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_OMP_IML2_mit/TPR_39,smart_TPR_repeat	p.F184Y	ENST00000512701.2	37	c.551	CCDS6477.2	9	.	.	.	.	.	.	.	.	.	.	A	34	5.308083	0.95629	.	.	ENSG00000155158	ENST00000380850;ENST00000297615;ENST00000355694;ENST00000512701;ENST00000507285;ENST00000507993;ENST00000541445	T;T;T;T;T;T;T	0.57595	0.39;0.39;0.39;0.39;0.39;0.39;0.39	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.72518	0.3470	M	0.76328	2.33	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;0.999;0.989;0.989	D;D;D;D;D	0.87578	0.997;0.998;0.996;0.934;0.934	T	0.74278	-0.3717	10	0.51188	T	0.08	-21.6203	15.7917	0.78369	1.0:0.0:0.0:0.0	.	115;184;184;118;118	F5H705;E9PAQ9;E9PE60;A5PLN1;Q5VTQ0	.;.;.;.;TT39B_HUMAN	Y	184;115;118;184;19;19;118	ENSP00000370231:F184Y;ENSP00000297615:F115Y;ENSP00000347920:F118Y;ENSP00000422496:F184Y;ENSP00000426539:F19Y;ENSP00000423392:F19Y;ENSP00000442880:F118Y	ENSP00000297615:F115Y	F	-	2	0	TTC39B	15201327	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	8.930000	0.92872	2.218000	0.71995	0.533000	0.62120	TTC	-	pfam_OMP_IML2_mit/TPR_39		0.463	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC39B	protein_coding	OTTHUMT00000051758.3	A	NM_152574	-		15211327	-1	no_errors	ENST00000512701	ensembl	human	known	74_37	missense	SNP	1.000	T
EIF2AK3	9451	genome.wustl.edu	37	2	88885426	88885426	+	Missense_Mutation	SNP	G	G	A	rs200171164		TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr2:88885426G>A	ENST00000303236.3	-	9	1884	c.1583C>T	c.(1582-1584)aCg>aTg	p.T528M	EIF2AK3_ENST00000419748.1_Missense_Mutation_p.T377M	NM_004836.5	NP_004827.4	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 3	528					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|bone mineralization (GO:0030282)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|chondrocyte development (GO:0002063)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum organization (GO:0007029)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|fat cell differentiation (GO:0045444)|insulin secretion (GO:0030073)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of myelination (GO:0031642)|negative regulation of translation (GO:0017148)|negative regulation of translational initiation in response to stress (GO:0032057)|ossification (GO:0001503)|positive regulation of protein binding (GO:0032092)|positive regulation of signal transduction (GO:0009967)|protein autophosphorylation (GO:0046777)|protein homooligomerization (GO:0051260)|protein phosphorylation (GO:0006468)|regulation of fatty acid metabolic process (GO:0019217)|response to endoplasmic reticulum stress (GO:0034976)|skeletal system development (GO:0001501)|SREBP signaling pathway (GO:0032933)|translation (GO:0006412)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			ovary(3)	3						AAACAAAATCGTTGCAACTAT	0.408																																					GBM(138;671 1851 16235 39058 45249)												0								ENSG00000172071						223.0	202.0	209.0					2																	88885426		2203	4300	6503	EIF2AK3	SO:0001583	missense	0			-	HGNC	AF110146	CCDS33241.1	2p12	2008-05-21			ENSG00000172071	ENSG00000172071			3255	protein-coding gene	gene with protein product		604032				10026192, 10575235	Standard	NM_004836		Approved	PEK, PERK	uc002stc.4	Q9NZJ5	OTTHUMG00000155046	ENST00000303236.3:c.1583C>T	2.37:g.88885426G>A	ENSP00000307235:p.Thr528Met	Somatic	0	115	0.00		0.6230499004162908	21	12.50	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	55	30.86	A0AVH1|A0AVH2|B2RCU9|O95846|Q53QY0|Q53SB1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like_supfam,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.T528M	ENST00000303236.3	37	c.1583	CCDS33241.1	2	.	.	.	.	.	.	.	.	.	.	G	20.5	4.001736	0.74932	.	.	ENSG00000172071	ENST00000419748;ENST00000303236;ENST00000535951;ENST00000415570	T;T;T	0.50548	0.74;0.74;0.74	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.68979	0.3060	M	0.68317	2.08	0.58432	D	0.999997	D	0.89917	1.0	D	0.85130	0.997	T	0.63862	-0.6541	10	0.37606	T	0.19	-22.0537	20.3343	0.98733	0.0:0.0:1.0:0.0	.	528	Q9NZJ5	E2AK3_HUMAN	M	377;528;377;407	ENSP00000408325:T377M;ENSP00000307235:T528M;ENSP00000412076:T407M	ENSP00000307235:T528M	T	-	2	0	EIF2AK3	88666541	1.000000	0.71417	0.189000	0.23252	0.585000	0.36419	8.441000	0.90313	2.822000	0.97130	0.650000	0.86243	ACG	-	NULL		0.408	EIF2AK3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	EIF2AK3	protein_coding	OTTHUMT00000338233.2	G	NM_004836	rs200171164		88885426	-1	no_errors	ENST00000303236	ensembl	human	known	74_37	missense	SNP	1.000	A
TMEM211	255349	genome.wustl.edu	37	22	25331358	25331358	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr22:25331358G>T	ENST00000423535.1	-	3	544	c.545C>A	c.(544-546)aCc>aAc	p.T182N	TMEM211_ENST00000382744.1_Missense_Mutation_p.T111N|TMEM211_ENST00000407886.1_Missense_Mutation_p.T111N			Q6ICI0	TM211_HUMAN	transmembrane protein 211	182						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						GAAGATGATGGTCCTCCCTTG	0.522																																																	0								ENSG00000206069						110.0	101.0	104.0					22																	25331358		2203	4300	6503	TMEM211	SO:0001583	missense	0			-	HGNC		CCDS33624.1	22q11.23	2009-01-12			ENSG00000206069	ENSG00000206069			33725	protein-coding gene	gene with protein product							Standard	NM_001001663		Approved	bA9F11.1	uc003abk.1	Q6ICI0	OTTHUMG00000150790	ENST00000423535.1:c.545C>A	22.37:g.25331358G>T	ENSP00000387813:p.Thr182Asn	Somatic	0	34	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	10	37.50		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipome_HGMIC_fus_partner-like	p.T182N	ENST00000423535.1	37	c.545		22	.	.	.	.	.	.	.	.	.	.	G	2.384	-0.341496	0.05243	.	.	ENSG00000206069	ENST00000407886;ENST00000423535;ENST00000382744	T;T;T	0.77229	-1.08;-0.65;-1.08	3.72	1.54	0.23209	.	0.962208	0.08543	N	0.930123	T	0.68495	0.3007	L	0.51422	1.61	0.09310	N	1	B	0.33073	0.396	B	0.29176	0.099	T	0.58405	-0.7642	10	0.54805	T	0.06	-26.0238	5.3803	0.16187	0.2838:0.0:0.7162:0.0	.	182	Q6ICI0	TM211_HUMAN	N	111;182;111	ENSP00000385494:T111N;ENSP00000387813:T182N;ENSP00000372192:T111N	ENSP00000372192:T111N	T	-	2	0	TMEM211	23661358	0.444000	0.25649	0.003000	0.11579	0.016000	0.09150	1.071000	0.30666	0.484000	0.27630	0.455000	0.32223	ACC	-	NULL		0.522	TMEM211-202	KNOWN	basic|appris_principal	protein_coding	TMEM211	protein_coding		G	NM_001001663	-		25331358	-1	no_errors	ENST00000423535	ensembl	human	known	74_37	missense	SNP	0.024	T
ALMS1	7840	genome.wustl.edu	37	2	73827825	73827825	+	Missense_Mutation	SNP	G	G	A	rs187887110		TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr2:73827825G>A	ENST00000264448.6	+	18	11797	c.11686G>A	c.(11686-11688)Ggt>Agt	p.G3896S	ALMS1_ENST00000409009.1_Missense_Mutation_p.G3854S	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	3896					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						GATTGTGAACGGTGCCAAAAA	0.458													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19532	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000116127	G	SER/GLY	2,4152		0,2,2075	61.0	61.0	61.0		11686	4.2	0.2	2		61	0,8478		0,0,4239	no	missense	ALMS1	NM_015120.4	56	0,2,6314	AA,AG,GG		0.0,0.0481,0.0158	probably-damaging	3896/4168	73827825	2,12630	2077	4239	6316	ALMS1	SO:0001583	missense	0			GMAF=0.0005	HGNC	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.11686G>A	2.37:g.73827825G>A	ENSP00000264448:p.Gly3896Ser	Somatic	0	95	0.00		0.6230499004162908	2	90.91	20	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	7	84.09	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G3896S	ENST00000264448.6	37	c.11686	CCDS42697.1	2	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	18.43	3.621324	0.66787	4.81E-4	0.0	ENSG00000116127	ENST00000409009;ENST00000264448	T;T	0.06849	3.26;3.25	5.2	4.25	0.50352	.	0.214042	0.33477	N	0.004873	T	0.16385	0.0394	L	0.46157	1.445	0.26659	N	0.971945	D;D	0.76494	0.999;0.999	D;P	0.67548	0.952;0.903	T	0.03761	-1.1006	10	0.46703	T	0.11	.	6.224	0.20698	0.1932:0.0:0.8068:0.0	.	3854;3896	B8ZZJ3;Q8TCU4	.;ALMS1_HUMAN	S	3854;3896	ENSP00000386627:G3854S;ENSP00000264448:G3896S	ENSP00000264448:G3896S	G	+	1	0	ALMS1	73681333	0.990000	0.36364	0.232000	0.24009	0.820000	0.46376	2.265000	0.43311	2.718000	0.92993	0.650000	0.86243	GGT	-	NULL		0.458	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	protein_coding	OTTHUMT00000327776.1	G	NM_015120	rs187887110		73827825	+1	no_errors	ENST00000264448	ensembl	human	known	74_37	missense	SNP	0.127	A
ADAMTS9	56999	genome.wustl.edu	37	3	64502706	64502707	+	3'UTR	DEL	AC	AC	-	rs372944190		TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr3:64502706_64502707delAC	ENST00000498707.1	-	0	6246_6247				ADAMTS9_ENST00000295903.4_3'UTR|ADAMTS9_ENST00000467257.1_5'UTR	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9						glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		tcacacacaaacacacacacac	0.347																																																	0								ENSG00000163638																																			ADAMTS9	SO:0001624	3_prime_UTR_variant	0				HGNC	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.*97GT>-	3.37:g.64502716_64502717delAC		Somatic	0	28	0.00		0.6230499004162908	14	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000498707.1	37	NULL	CCDS2903.1	3																																																																																			-	-		0.347	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS9	protein_coding	OTTHUMT00000351891.1	AC				64502707	-1	no_errors	ENST00000467257	ensembl	human	known	74_37	rna	DEL	0.000:0.000	-
MUC4	4585	genome.wustl.edu	37	3	195506473	195506473	+	Missense_Mutation	SNP	A	A	G	rs201922637	byFrequency	TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr3:195506473A>G	ENST00000463781.3	-	2	12437	c.11978T>C	c.(11977-11979)gTa>gCa	p.V3993A	MUC4_ENST00000475231.1_Missense_Mutation_p.V3993A|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATACTGAGGAAGT	0.592													.|||	1598	0.319089	0.6029	0.2147	5008	,	,		8683	0.0952		0.3479	False		,,,				2504	0.2106																0								ENSG00000145113						10.0	7.0	8.0					3																	195506473		636	1378	2014	MUC4	SO:0001583	missense	0			-	HGNC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11978T>C	3.37:g.195506473A>G	ENSP00000417498:p.Val3993Ala	Somatic	0	14	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	5	44.44	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.V3993A	ENST00000463781.3	37	c.11978	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	N	0.517	-0.863910	0.02590	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35605	1.44;1.3	0.481	-0.963	0.10330	.	0.000000	0.24912	N	0.034619	T	0.13030	0.0316	N	0.08118	0	0.80722	P	0.0	B	0.14805	0.011	B	0.06405	0.002	T	0.21655	-1.0239	8	.	.	.	.	3.3255	0.07066	0.247:0.2672:0.4857:0.0	.	3865	E7ESK3	.	A	3993	ENSP00000417498:V3993A;ENSP00000420243:V3993A	.	V	-	2	0	MUC4	196991252	0.000000	0.05858	0.000000	0.03702	0.143000	0.21401	-0.813000	0.04491	-1.477000	0.01872	0.055000	0.15244	GTA	-	NULL		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	protein_coding	OTTHUMT00000324081.6	A	NM_018406	rs201922637		195506473	-1	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	SNP	0.000	G
ADIRF	10974	genome.wustl.edu	37	10	88728453	88728453	+	Intron	SNP	T	T	A	rs368836654	byFrequency	TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr10:88728453T>A	ENST00000372013.3	+	1	414				RP11-96C23.5_ENST00000433214.2_RNA|RP11-96C23.15_ENST00000609363.1_RNA|ADIRF-AS1_ENST00000440490.1_RNA|ADIRF-AS1_ENST00000418273.2_RNA|ADIRF-AS1_ENST00000609111.1_RNA	NM_006829.2	NP_006820.1	Q15847	ADIRF_HUMAN	adipogenesis regulatory factor						cell differentiation (GO:0030154)|cellular response to cisplatin (GO:0072719)|cellular response to radiation (GO:0071478)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of response to drug (GO:2001023)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)											CGCAAGTTCCTGGACCGGCAG	0.701																																																	0								ENSG00000272734																																			ADIRF-AS1	SO:0001627	intron_variant	0			-	HGNC	BC004471	CCDS7381.1	10q23.31	2013-02-20	2013-02-20	2013-02-20	ENSG00000148671	ENSG00000148671			24043	protein-coding gene	gene with protein product	"""adipose specific 2"", ""adipose most abundant gene transcript 2"", ""adipogenesis factor rich in obesity"""		"""chromosome 10 open reading frame 116"""	C10orf116		8619847, 23239344	Standard	NM_006829		Approved	APM2, AFRO	uc001ked.2	Q15847	OTTHUMG00000018668	ENST00000372013.3:c.61+91T>A	10.37:g.88728453T>A		Somatic	0	13	0.00		0.6230499004162908	2	33.33	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	1	87.50		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372013.3	37	NULL	CCDS7381.1	10																																																																																			-	-		0.701	ADIRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADIRF-AS1	protein_coding	OTTHUMT00000049194.1	T	NM_006829	-		88728453	-1	no_errors	ENST00000609111	ensembl	human	known	74_37	rna	SNP	0.000	A
BET1	10282	genome.wustl.edu	37	7	93605345	93605345	+	5'UTR	SNP	A	A	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr7:93605345A>T	ENST00000471446.1	-	0	124				AC006378.2_ENST00000426193.2_RNA|AC006378.2_ENST00000426634.1_RNA			O15155	BET1_HUMAN	Bet1 golgi vesicular membrane trafficking protein						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)|vesicle fusion with Golgi apparatus (GO:0048280)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				large_intestine(2)|lung(1)|prostate(1)|skin(1)	5	all_cancers(62;2.22e-10)|all_epithelial(64;1.38e-09)|Lung NSC(181;0.218)	Breast(660;0.000162)|Ovarian(593;0.000626)	STAD - Stomach adenocarcinoma(171;0.000967)			AATGCTGAGGAACAGTCAAAA	0.393																																																	0								ENSG00000105829																																			BET1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF007551	CCDS5635.1	7q21.1-q22	2013-03-08	2013-03-08		ENSG00000105829	ENSG00000105829			14562	protein-coding gene	gene with protein product	"""Golgi vesicular membrane trafficking protein p18"", ""Bet1p homolog"""	605456	"""Bet1 (S. cerevisiae) homolog"", ""BET1 homolog (S. cerevisiae)"", ""blocked early in transport 1 homolog (S. cerevisiae)"""			9382863, 10449330	Standard	XM_005250109		Approved	hbet1	uc003unf.1	O15155	OTTHUMG00000023487	ENST00000471446.1:c.-411T>A	7.37:g.93605345A>T		Somatic	0	61	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	38	28.30	Q96EA0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_T_SNARE_dom,pfscan_T_SNARE_dom	p.V101	ENST00000471446.1	37	c.303		7																																																																																			-	NULL		0.393	BET1-006	KNOWN	basic	processed_transcript	BET1	protein_coding	OTTHUMT00000341560.1	A	NM_005868	-		93605345	-1	no_errors	ENST00000357520	ensembl	human	known	74_37	silent	SNP	0.007	T
HOOK1	51361	genome.wustl.edu	37	1	60314110	60314110	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr1:60314110G>C	ENST00000371208.3	+	11	1310	c.1053G>C	c.(1051-1053)atG>atC	p.M351I	HOOK1_ENST00000395561.2_Missense_Mutation_p.M309I|HOOK1_ENST00000465876.1_3'UTR	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	351	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					TGATGTATATGCATAATACAG	0.348																																																	0								ENSG00000134709						85.0	85.0	85.0					1																	60314110		2203	4300	6503	HOOK1	SO:0001583	missense	0			-	HGNC	AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.1053G>C	1.37:g.60314110G>C	ENSP00000360252:p.Met351Ile	Somatic	0	55	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	28	24.32	A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hook-related_fam,superfamily_Prefoldin	p.M351I	ENST00000371208.3	37	c.1053	CCDS612.1	1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883153	0.91740	.	.	ENSG00000134709	ENST00000371208;ENST00000395561	T;T	0.18016	2.24;2.24	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.35913	0.0948	L	0.58428	1.81	0.80722	D	1	P	0.51933	0.949	P	0.58331	0.837	T	0.00385	-1.1773	10	0.24483	T	0.36	.	20.2956	0.98549	0.0:0.0:1.0:0.0	.	351	Q9UJC3	HOOK1_HUMAN	I	351;309	ENSP00000360252:M351I;ENSP00000378928:M309I	ENSP00000360252:M351I	M	+	3	0	HOOK1	60086698	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.230000	0.95299	2.805000	0.96524	0.460000	0.39030	ATG	-	pfam_Hook-related_fam		0.348	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK1	protein_coding	OTTHUMT00000024934.1	G	NM_015888	-		60314110	+1	no_errors	ENST00000371208	ensembl	human	known	74_37	missense	SNP	1.000	C
SLC27A5	10998	genome.wustl.edu	37	19	59010563	59010563	+	Silent	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr19:59010563C>T	ENST00000263093.2	-	8	1801	c.1692G>A	c.(1690-1692)acG>acA	p.T564T	SLC27A5_ENST00000599700.1_5'UTR|SLC27A5_ENST00000601355.1_Silent_p.T480T|SLC27A5_ENST00000594786.1_5'UTR	NM_012254.2	NP_036386.1	Q9Y2P5	S27A5_HUMAN	solute carrier family 27 (fatty acid transporter), member 5	564					bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|ketone body biosynthetic process (GO:0046951)|plasma membrane long-chain fatty acid transport (GO:0015911)|small molecule metabolic process (GO:0044281)|triglyceride mobilization (GO:0006642)|very long-chain fatty acid metabolic process (GO:0000038)	basal plasma membrane (GO:0009925)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|protein complex (GO:0043234)	ATP binding (GO:0005524)|cholate-CoA ligase activity (GO:0047747)|fatty acid transporter activity (GO:0015245)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.181)		CCACCTCGTGCGTGGACACGT	0.642																																																	0								ENSG00000083807						81.0	71.0	74.0					19																	59010563		2203	4300	6503	SLC27A5	SO:0001819	synonymous_variant	0			-	HGNC	AF064255	CCDS12983.1	19q13.43	2013-07-15			ENSG00000083807	ENSG00000083807		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10999	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 3"""	603314				10479480, 10749848	Standard	NM_012254		Approved	FATP5, VLACSR, VLCS-H2, VLCSH2, FACVL3, FLJ22987, ACSVL6, ACSB	uc002qtc.2	Q9Y2P5	OTTHUMG00000183543	ENST00000263093.2:c.1692G>A	19.37:g.59010563C>T		Somatic	0	64	0.00		0.6230499004162908	32	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B3KVP6|B4DPQ1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig	p.T564	ENST00000263093.2	37	c.1692	CCDS12983.1	19																																																																																			-	pfam_AMP-dep_Synth/Lig		0.642	SLC27A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A5	protein_coding	OTTHUMT00000467060.1	C	NM_012254	-		59010563	-1	no_errors	ENST00000263093	ensembl	human	known	74_37	silent	SNP	0.197	T
NXPH3	11248	genome.wustl.edu	37	17	47656469	47656469	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr17:47656469C>A	ENST00000328741.5	+	2	928	c.566C>A	c.(565-567)tCg>tAg	p.S189*	RP5-1029K10.4_ENST00000503624.1_RNA|NXPH3_ENST00000513748.1_Nonsense_Mutation_p.S189*	NM_007225.2	NP_009156.2	O95157	NXPH3_HUMAN	neurexophilin 3	189	V (Cys-rich).				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				endometrium(2)|large_intestine(3)|lung(4)|pancreas(1)|skin(2)	12	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)					CGCCGGACCTCGCTTTGCACC	0.592																																																	0								ENSG00000182575						95.0	92.0	93.0					17																	47656469		2203	4300	6503	NXPH3	SO:0001587	stop_gained	0			-	HGNC	AF043468	CCDS11550.1	17q	2008-07-03				ENSG00000182575			8077	protein-coding gene	gene with protein product		604636				9570794	Standard	NM_007225		Approved	NPH3	uc002ipa.3	O95157		ENST00000328741.5:c.566C>A	17.37:g.47656469C>A	ENSP00000329295:p.Ser189*	Somatic	0	34	0.00		0.6230499004162908	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	Q8NDC3|Q8TBF6|Q9ULR1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NXPH/NXPE,pirsf_Neurexophilin	p.S189*	ENST00000328741.5	37	c.566	CCDS11550.1	17	.	.	.	.	.	.	.	.	.	.	c	35	5.448163	0.96205	.	.	ENSG00000182575	ENST00000328741;ENST00000513748	.	.	.	4.44	4.44	0.53790	.	0.401030	0.25701	N	0.028873	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-6.4206	12.7421	0.57259	0.0:0.8346:0.1654:0.0	.	.	.	.	X	189	.	ENSP00000329295:S189X	S	+	2	0	NXPH3	45011468	0.011000	0.17503	1.000000	0.80357	0.997000	0.91878	2.034000	0.41145	2.310000	0.77875	0.556000	0.70494	TCG	-	pfam_NXPH/NXPE,pirsf_Neurexophilin		0.592	NXPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXPH3	protein_coding	OTTHUMT00000365143.1	C		-		47656469	+1	no_errors	ENST00000328741	ensembl	human	known	74_37	nonsense	SNP	0.997	A
USP46	64854	genome.wustl.edu	37	4	53497234	53497234	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr4:53497234delG	ENST00000441222.3	-	2	298	c.114delC	c.(112-114)gtcfs	p.V38fs	USP46_ENST00000508499.1_Frame_Shift_Del_p.V31fs|USP46_ENST00000504078.1_5'Flank|USP46_ENST00000451218.2_Intron	NM_022832.3	NP_073743.2	P62068	UBP46_HUMAN	ubiquitin specific peptidase 46	38	USP.				adult feeding behavior (GO:0008343)|behavioral fear response (GO:0001662)|behavioral response to ethanol (GO:0048149)|protein deubiquitination (GO:0016579)|regulation of synaptic transmission, GABAergic (GO:0032228)|righting reflex (GO:0060013)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)	12			LUSC - Lung squamous cell carcinoma(32;0.0295)			TACTTACATTGACCAATCCGA	0.333																																																	0								ENSG00000109189						61.0	55.0	57.0					4																	53497234		1841	4091	5932	USP46	SO:0001589	frameshift_variant	0				HGNC	AK022614	CCDS47053.1, CCDS47054.1	4q12	2008-02-05	2005-08-08		ENSG00000109189	ENSG00000109189		"""Ubiquitin-specific peptidases"""	20075	protein-coding gene	gene with protein product		612849	"""ubiquitin specific protease 46"""			12838346	Standard	NM_022832		Approved	FLJ12552	uc003gzn.3	P62068	OTTHUMG00000160640	ENST00000441222.3:c.114delC	4.37:g.53497234delG	ENSP00000407818:p.Val38fs	Somatic	0	38	0.00		0.6230499004162908	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	9	18.18	B7Z3Y7|B7Z675|B7Z7S3|G8ACC7|Q80V95|Q9H7U4|Q9H9T8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.N39fs	ENST00000441222.3	37	c.114	CCDS47053.1	4																																																																																			-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.333	USP46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP46	protein_coding	OTTHUMT00000361516.2	G	NM_022832			53497234	-1	no_errors	ENST00000441222	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
CCT5	22948	genome.wustl.edu	37	5	10261729	10261729	+	Missense_Mutation	SNP	G	G	A	rs140095139	byFrequency	TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr5:10261729G>A	ENST00000280326.4	+	8	1471	c.1051G>A	c.(1051-1053)Gag>Aag	p.E351K	CTD-2256P15.4_ENST00000606194.1_RNA|CCT5_ENST00000515390.1_Missense_Mutation_p.E296K|CCT5_ENST00000506600.1_Missense_Mutation_p.E258K|CCT5_ENST00000515676.1_Missense_Mutation_p.E313K|CCT5_ENST00000503026.1_Missense_Mutation_p.E330K	NM_012073.3	NP_036205.1	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	351					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|response to virus (GO:0009615)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleolus (GO:0005730)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|G-protein beta-subunit binding (GO:0031681)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(2)	26						GCTCACAGCCGAGAAGCTGGG	0.517																																																	0								ENSG00000150753	G	LYS/GLU	0,4406		0,0,2203	170.0	179.0	176.0		1051	4.5	0.8	5	dbSNP_134	176	2,8598	2.2+/-6.3	0,2,4298	no	missense	CCT5	NM_012073.3	56	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging	351/542	10261729	2,13004	2203	4300	6503	CCT5	SO:0001583	missense	0			-	HGNC	D43950	CCDS3877.1	5p15.2	2014-09-17			ENSG00000150753	ENSG00000150753		"""Heat Shock Proteins / Chaperonins"""	1618	protein-coding gene	gene with protein product		610150					Standard	NM_012073		Approved	KIAA0098	uc003jeq.3	P48643	OTTHUMG00000131042	ENST00000280326.4:c.1051G>A	5.37:g.10261729G>A	ENSP00000280326:p.Glu351Lys	Somatic	0	56	0.00		0.6230499004162908	869	26.54	315	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	60	18.92	A8JZY8|A8K2X8|B4DYD8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_epsi	p.E351K	ENST00000280326.4	37	c.1051	CCDS3877.1	5	.	.	.	.	.	.	.	.	.	.	G	27.0	4.792887	0.90453	0.0	2.33E-4	ENSG00000150753	ENST00000280326;ENST00000503026;ENST00000515390;ENST00000440011;ENST00000515676;ENST00000506600	T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2	5.39	4.5	0.54988	.	0.045357	0.85682	D	0.000000	T	0.78792	0.4339	M	0.65320	2	0.80722	D	1	B;P;B;P;P;P	0.46457	0.232;0.878;0.335;0.839;0.839;0.839	B;P;B;B;B;B	0.45753	0.07;0.492;0.034;0.37;0.37;0.37	T	0.80148	-0.1503	10	0.52906	T	0.07	-37.331	15.0426	0.71803	0.0:0.1428:0.8572:0.0	.	258;296;200;349;351;351	B4DYD8;E7ENZ3;B4DZY9;Q9BU08;A8K2X8;P48643	.;.;.;.;.;TCPE_HUMAN	K	351;330;296;324;313;258	ENSP00000280326:E351K;ENSP00000423318:E330K;ENSP00000426923:E296K;ENSP00000427297:E313K;ENSP00000423052:E258K	ENSP00000280326:E351K	E	+	1	0	CCT5	10314729	1.000000	0.71417	0.839000	0.33178	0.982000	0.71751	9.193000	0.94954	1.234000	0.43709	0.558000	0.71614	GAG	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,tigrfam_Chap_CCT_epsi		0.517	CCT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT5	protein_coding	OTTHUMT00000253688.2	G		rs140095139		10261729	+1	no_errors	ENST00000280326	ensembl	human	known	74_37	missense	SNP	0.999	A
EPN3	55040	genome.wustl.edu	37	17	48617655	48617655	+	Silent	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr17:48617655G>A	ENST00000268933.3	+	6	1518	c.939G>A	c.(937-939)ccG>ccA	p.P313P	RP11-94C24.8_ENST00000513017.1_RNA|EPN3_ENST00000541226.1_Intron|EPN3_ENST00000537145.1_Silent_p.P341P	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	313						clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			CCCTGGCCCCGCCCTCCACAC	0.662																																																	0								ENSG00000049283						88.0	69.0	76.0					17																	48617655		2203	4300	6503	EPN3	SO:0001819	synonymous_variant	0			-	HGNC	AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.939G>A	17.37:g.48617655G>A		Somatic	0	44	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	18	25.00	A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N,pfscan_Ubiquitin-int_motif	p.P341	ENST00000268933.3	37	c.1023	CCDS11570.1	17																																																																																			-	NULL		0.662	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPN3	protein_coding	OTTHUMT00000367573.1	G	NM_017957	-		48617655	+1	no_errors	ENST00000537145	ensembl	human	known	74_37	silent	SNP	0.952	A
TREML2	79865	genome.wustl.edu	37	6	41168714	41168716	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr6:41168714_41168716delCAG	ENST00000483722.1	-	1	216_218	c.31_33delCTG	c.(31-33)ctgdel	p.L11del		NM_024807.2	NP_079083.2	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid cells-like 2	11					T cell activation (GO:0042110)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)	18	Ovarian(28;0.0418)|Colorectal(47;0.196)					CCTGTGGCCACAGCAGCAGCAGC	0.631																																																	0								ENSG00000112195			143,4121		8,127,1997						4.0	1.0			26	249,8005		8,233,3886	no	coding	TREML2	NM_024807.2		16,360,5883	A1A1,A1R,RR		3.0167,3.3537,3.1315				392,12126				TREML2	SO:0001651	inframe_deletion	0				HGNC	AK023755	CCDS4853.1, CCDS4853.2	6p21.1	2013-01-11	2004-04-14	2004-04-16	ENSG00000112195	ENSG00000112195		"""Immunoglobulin superfamily / V-set domain containing"""	21092	protein-coding gene	gene with protein product	"""TREM-like transcript 2"""	609715	"""chromosome 6 open reading frame 76"""	C6orf76		12645956	Standard	NM_024807		Approved	FLJ13693, TLT2, dJ238O23.1	uc010jxm.1	Q5T2D2	OTTHUMG00000016349	ENST00000483722.1:c.31_33delCTG	6.37:g.41168723_41168725delCAG	ENSP00000418767:p.Leu11del	Somatic	0	98	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	44	10.20	Q08AP8|Q08AP9|Q8IWY0|Q9H8E9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfscan_Ig-like_dom	p.L11in_frame_del	ENST00000483722.1	37	c.33_31	CCDS4853.2	6																																																																																			-	NULL		0.631	TREML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TREML2	protein_coding	OTTHUMT00000043756.3	CAG	NM_024807			41168716	-1	no_errors	ENST00000483722	ensembl	human	known	74_37	in_frame_del	DEL	0.997:1.000:1.000	-
DEAF1	10522	genome.wustl.edu	37	11	680002	680003	+	Intron	INS	-	-	ACCAGGATG	rs71278583|rs398038332|rs67467914	byFrequency	TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr11:680002_680003insACCAGGATG	ENST00000382409.3	-	8	1482				RP11-754B17.1_ENST00000527799.1_RNA|DEAF1_ENST00000338675.6_Intron|DEAF1_ENST00000525904.1_5'UTR	NM_021008.2	NP_066288.2	O75398	DEAF1_HUMAN	DEAF1 transcription factor						anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		CACAGGAGAAAACCAGGATGGC	0.52														2632	0.525559	0.2927	0.5303	5008	,	,		20992	0.7173		0.5686	False		,,,				2504	0.5951																0								ENSG00000177030																																			DEAF1	SO:0001627	intron_variant	0				HGNC	AF049460	CCDS31327.1	11p15.5	2013-01-10	2013-01-10		ENSG00000177030	ENSG00000177030		"""Zinc fingers, MYND-type"""	14677	protein-coding gene	gene with protein product		602635	"""deformed epidermal autoregulatory factor 1 (Drosophila)"""			9773984	Standard	XR_428838		Approved	NUDR, SPN, ZMYND5	uc001lqq.1	O75398	OTTHUMG00000165363	ENST00000382409.3:c.998-186->CATCCTGGT	11.37:g.680003_680011dupACCAGGATG		Somatic	NA	NA	NA		0.6230499004162908	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000382409.3	37	NULL	CCDS31327.1	11																																																																																			-	-		0.520	DEAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEAF1	protein_coding	OTTHUMT00000383614.3	-	NM_021008			680003	-1	no_errors	ENST00000525904	ensembl	human	known	74_37	rna	INS	0.000:0.000	ACCAGGATG
SSTR3	6753	genome.wustl.edu	37	22	37603369	37603369	+	Silent	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr22:37603369C>T	ENST00000328544.3	-	2	1007	c.474G>A	c.(472-474)ccG>ccA	p.P158P	SSTR3_ENST00000402501.1_Silent_p.P158P	NM_001051.3	NP_001042.1	P32745	SSR3_HUMAN	somatostatin receptor 3	158					cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of cell proliferation (GO:0008285)|response to starvation (GO:0042594)|somatostatin signaling pathway (GO:0038170)|spermatogenesis (GO:0007283)	ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	14					Pasireotide(DB06663)	TGCGGGCCACCGGAGCTGTGC	0.682																																																	0								ENSG00000183473						50.0	48.0	49.0					22																	37603369		2203	4298	6501	SSTR3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS13944.1	22q13.1	2012-08-08			ENSG00000183473	ENSG00000278195		"""GPCR / Class A : Somatostatin receptors"""	11332	protein-coding gene	gene with protein product		182453				8449518	Standard	XM_006724311		Approved		uc003arb.3	P32745	OTTHUMG00000150537	ENST00000328544.3:c.474G>A	22.37:g.37603369C>T		Somatic	0	18	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	7	63.16	A8K550|Q53ZR7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Somatstn_rcpt_3,prints_GPCR_Rhodpsn,prints_Somatstn_rcpt,prints_Somatstn_rcpt_5,prints_Neuropept_B/W_rcpt	p.P158	ENST00000328544.3	37	c.474	CCDS13944.1	22																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM		0.682	SSTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSTR3	protein_coding	OTTHUMT00000318802.1	C		-		37603369	-1	no_errors	ENST00000328544	ensembl	human	known	74_37	silent	SNP	0.000	T
MAGEC1	9947	genome.wustl.edu	37	X	140996230	140996230	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chrX:140996230G>T	ENST00000285879.4	+	4	3326	c.3040G>T	c.(3040-3042)Gcc>Tcc	p.A1014S	MAGEC1_ENST00000406005.2_Missense_Mutation_p.A81S	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	1014	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GGGCACCTATGCCTCTGAGGA	0.547										HNSCC(15;0.026)																																							0								ENSG00000155495						86.0	78.0	81.0					X																	140996230		2203	4300	6503	MAGEC1	SO:0001583	missense	0			-	HGNC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.3040G>T	X.37:g.140996230G>T	ENSP00000285879:p.Ala1014Ser	Somatic	0	57	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.26	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfscan_MAGE	p.A1014S	ENST00000285879.4	37	c.3040	CCDS35417.1	X	.	.	.	.	.	.	.	.	.	.	g	9.349	1.065135	0.20067	.	.	ENSG00000155495	ENST00000285879;ENST00000406005	T;T	0.05925	3.37;3.37	0.837	0.837	0.18896	.	.	.	.	.	T	0.16342	0.0393	M	0.79475	2.455	0.09310	N	1	P	0.46952	0.887	P	0.53518	0.728	T	0.05852	-1.0860	8	0.72032	D	0.01	.	.	.	.	.	1014	O60732	MAGC1_HUMAN	S	1014;81	ENSP00000285879:A1014S;ENSP00000385500:A81S	ENSP00000285879:A1014S	A	+	1	0	MAGEC1	140823896	0.001000	0.12720	0.006000	0.13384	0.090000	0.18270	0.081000	0.14823	0.696000	0.31696	0.279000	0.19357	GCC	-	pfam_MAGE,pfscan_MAGE		0.547	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	protein_coding	OTTHUMT00000058604.1	G	NM_005462	-		140996230	+1	no_errors	ENST00000285879	ensembl	human	known	74_37	missense	SNP	0.005	T
NLGN1	22871	genome.wustl.edu	37	3	173997210	173997210	+	Silent	SNP	G	G	A	rs200258151	byFrequency	TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr3:173997210G>A	ENST00000457714.1	+	6	1848	c.1419G>A	c.(1417-1419)gcG>gcA	p.A473A	NLGN1_ENST00000361589.4_Silent_p.A473A|NLGN1_ENST00000401917.3_Silent_p.A513A|NLGN1_ENST00000545397.1_Silent_p.A473A	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	490					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			TAGCCACAGCGGATCTTCACT	0.498													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17609	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000169760	G		1,4405	2.1+/-5.4	0,1,2202	90.0	87.0	88.0		1419	4.9	1.0	3		88	0,8600		0,0,4300	no	coding-synonymous	NLGN1	NM_014932.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		473/824	173997210	1,13005	2203	4300	6503	NLGN1	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.1419G>A	3.37:g.173997210G>A		Somatic	0	44	0.00		0.6230499004162908	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	27	28.21	Q9UPT2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.A513	ENST00000457714.1	37	c.1539	CCDS3222.1	3																																																																																			-	pfam_CarbesteraseB		0.498	NLGN1-001	KNOWN	basic|CCDS	protein_coding	NLGN1	protein_coding	OTTHUMT00000347054.3	G	NM_014932	rs200258151		173997210	+1	no_errors	ENST00000401917	ensembl	human	known	74_37	silent	SNP	1.000	A
RRM2	6241	genome.wustl.edu	37	2	10269400	10269400	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr2:10269400A>G	ENST00000304567.5	+	10	1126	c.1057A>G	c.(1057-1059)Att>Gtt	p.I353V	RRM2_ENST00000360566.2_Missense_Mutation_p.I413V	NM_001034.3	NP_001025.1	P31350	RIR2_HUMAN	ribonucleotide reductase M2	353					deoxyribonucleoside diphosphate metabolic process (GO:0009186)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein heterotetramerization (GO:0051290)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)			NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|skin(1)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)|OV - Ovarian serous cystadenocarcinoma(76;0.221)	Cladribine(DB00242)|Gallium nitrate(DB05260)	TATGGAGAATATTTCACTGGA	0.393																																																	0								ENSG00000171848						82.0	81.0	81.0					2																	10269400		2203	4300	6503	RRM2	SO:0001583	missense	0			-	HGNC		CCDS1669.1, CCDS54334.1	2p25-p24	2012-10-02	2009-07-10		ENSG00000171848	ENSG00000171848	1.17.4.1		10452	protein-coding gene	gene with protein product		180390	"""ribonucleotide reductase M2 polypeptide"""				Standard	NM_001034		Approved		uc021vdr.1	P31350	OTTHUMG00000090449	ENST00000304567.5:c.1057A>G	2.37:g.10269400A>G	ENSP00000302955:p.Ile353Val	Somatic	0	63	0.00		0.6230499004162908	224	47.42	202	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	31	47.46	B2R9B5|J3KP43|Q5WRU7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNR_small,superfamily_Ferritin-like_SF	p.I413V	ENST00000304567.5	37	c.1237	CCDS1669.1	2	.	.	.	.	.	.	.	.	.	.	A	18.84	3.710146	0.68730	.	.	ENSG00000171848	ENST00000360566;ENST00000304567	D;D	0.97731	-4.51;-4.51	5.67	5.67	0.87782	Ferritin/ribonucleotide reductase-like (1);Ribonucleotide reductase-related (1);	0.000000	0.85682	D	0.000000	D	0.97820	0.9284	M	0.92738	3.34	0.80722	D	1	B	0.18863	0.031	B	0.17433	0.018	D	0.96612	0.9453	10	0.87932	D	0	-21.2513	15.92	0.79556	1.0:0.0:0.0:0.0	.	353	P31350	RIR2_HUMAN	V	413;353	ENSP00000353770:I413V;ENSP00000302955:I353V	ENSP00000302955:I353V	I	+	1	0	RRM2	10186851	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.110000	0.94302	2.159000	0.67721	0.455000	0.32223	ATT	-	superfamily_Ferritin-like_SF		0.393	RRM2-013	KNOWN	basic|appris_principal|CCDS	protein_coding	RRM2	protein_coding	OTTHUMT00000364902.2	A		-		10269400	+1	no_errors	ENST00000360566	ensembl	human	known	74_37	missense	SNP	1.000	G
TSC1	7248	genome.wustl.edu	37	9	135772703	135772703	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr9:135772703T>C	ENST00000298552.3	-	22	3064	c.2843A>G	c.(2842-2844)tAt>tGt	p.Y948C	TSC1_ENST00000440111.2_Missense_Mutation_p.Y948C|TSC1_ENST00000545250.1_Missense_Mutation_p.Y897C	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	948					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		CTGAGCCTCATACCTGCTCTC	0.423			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																														yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	1	Unknown(1)	bone(1)						ENSG00000165699						106.0	110.0	109.0					9																	135772703		2203	4300	6503	TSC1	SO:0001583	missense	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	-	HGNC	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.2843A>G	9.37:g.135772703T>C	ENSP00000298552:p.Tyr948Cys	Somatic	0	69	0.00		0.6230499004162908	7	56.25	9	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	14	67.44	B7Z897|Q5VVN5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hamartin,superfamily_ARM-type_fold	p.Y948C	ENST00000298552.3	37	c.2843	CCDS6956.1	9	.	.	.	.	.	.	.	.	.	.	T	15.90	2.970225	0.53614	.	.	ENSG00000165699	ENST00000298552;ENST00000440111;ENST00000545250	D;D;D	0.87029	-2.2;-2.2;-2.03	5.61	5.61	0.85477	.	0.062767	0.64402	D	0.000003	D	0.84897	0.5574	M	0.62723	1.935	0.80722	D	1	P;P	0.42456	0.78;0.453	B;B	0.37346	0.247;0.159	D	0.85382	0.1120	10	0.42905	T	0.14	-13.3069	14.9826	0.71321	0.0:0.0:0.0:1.0	.	897;948	B7Z897;Q92574	.;TSC1_HUMAN	C	948;948;897	ENSP00000298552:Y948C;ENSP00000394524:Y948C;ENSP00000444017:Y897C	ENSP00000298552:Y948C	Y	-	2	0	TSC1	134762524	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.006000	0.63978	2.137000	0.66172	0.528000	0.53228	TAT	-	NULL		0.423	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSC1	protein_coding	OTTHUMT00000054799.1	T		-		135772703	-1	no_errors	ENST00000298552	ensembl	human	known	74_37	missense	SNP	1.000	C
ZNF790	388536	genome.wustl.edu	37	19	37314268	37314268	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr19:37314268G>C	ENST00000356725.4	-	4	268	c.148C>G	c.(148-150)Cag>Gag	p.Q50E	CTD-2162K18.5_ENST00000587278.1_RNA|CTD-2162K18.5_ENST00000588906.1_RNA	NM_001242802.1|NM_206894.3	NP_001229731.1|NP_996777.2	Q6PG37	ZN790_HUMAN	zinc finger protein 790	50	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	32	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GCTTCTGGCTGATAAATGCAA	0.428																																																	0								ENSG00000197863						46.0	42.0	44.0					19																	37314268		2203	4300	6503	ZNF790	SO:0001583	missense	0			-	HGNC	BC057245	CCDS12496.1	19q13.12	2013-01-08			ENSG00000197863	ENSG00000197863		"""Zinc fingers, C2H2-type"", ""-"""	33114	protein-coding gene	gene with protein product							Standard	NM_206894		Approved	MGC62100, FLJ20350	uc021utm.1	Q6PG37	OTTHUMG00000165616	ENST00000356725.4:c.148C>G	19.37:g.37314268G>C	ENSP00000349161:p.Gln50Glu	Somatic	0	44	0.00		0.6230499004162908	3	66.67	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	12	57.14		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q50E	ENST00000356725.4	37	c.148	CCDS12496.1	19	.	.	.	.	.	.	.	.	.	.	G	8.598	0.886198	0.17540	.	.	ENSG00000197863	ENST00000356725;ENST00000528994;ENST00000525288	T;T;T	0.00784	5.7;5.7;5.7	3.58	-0.421	0.12332	Krueppel-associated box (3);	.	.	.	.	T	0.00608	0.0020	N	0.16266	0.395	0.09310	N	1	P	0.38504	0.634	B	0.33254	0.16	T	0.52895	-0.8514	9	0.62326	D	0.03	.	8.5918	0.33693	0.0:0.0:0.3925:0.6075	.	50	Q6PG37	ZN790_HUMAN	E	50	ENSP00000349161:Q50E;ENSP00000435944:Q50E;ENSP00000433389:Q50E	ENSP00000349161:Q50E	Q	-	1	0	ZNF790	42006108	0.000000	0.05858	0.850000	0.33497	0.481000	0.33189	-0.463000	0.06696	0.251000	0.21505	0.460000	0.39030	CAG	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.428	ZNF790-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF790	protein_coding	OTTHUMT00000385341.2	G	NM_206894	-		37314268	-1	no_errors	ENST00000356725	ensembl	human	known	74_37	missense	SNP	0.277	C
ANKRD35	148741	genome.wustl.edu	37	1	145558228	145558228	+	Silent	SNP	T	T	C			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr1:145558228T>C	ENST00000355594.4	+	5	432	c.345T>C	c.(343-345)gcT>gcC	p.A115A	ANKRD35_ENST00000544626.1_Intron	NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	115										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					ATGAAGATGCTGTGGATGCAG	0.537																																					Melanoma(9;127 754 22988 51047)												0								ENSG00000198483						118.0	105.0	109.0					1																	145558228		2203	4300	6503	ANKRD35	SO:0001819	synonymous_variant	0			-	HGNC	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.345T>C	1.37:g.145558228T>C		Somatic	0	35	0.00		0.6230499004162908	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.A115	ENST00000355594.4	37	c.345	CCDS919.1	1																																																																																			-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.537	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD35	protein_coding	OTTHUMT00000038515.1	T	NM_144698	-		145558228	+1	no_errors	ENST00000355594	ensembl	human	known	74_37	silent	SNP	0.998	C
CLCN5	1184	genome.wustl.edu	37	X	49779214	49779214	+	Intron	SNP	C	C	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chrX:49779214C>A	ENST00000376088.3	+	4	657				MIR660_ENST00000385235.1_RNA|MIR502_ENST00000606349.1_RNA|CLCN5_ENST00000482218.2_Intron|CLCN5_ENST00000376091.3_Intron	NM_001127898.1|NM_001127899.1	NP_001121370.1|NP_001121371.1	P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5						chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					CCTGCTCCCCCTCTCTAATCC	0.537																																																	0								ENSG00000272080						37.0	35.0	36.0					X																	49779214		1558	3569	5127	MIR502	SO:0001627	intron_variant	0			-	HGNC	X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000376088.3:c.17-27711C>A	X.37:g.49779214C>A		Somatic	0	56	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	A1L475|B3KPN6|Q5JQD5|Q7RTN8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376088.3	37	NULL	CCDS48115.1	X																																																																																			-	-		0.537	CLCN5-001	KNOWN	basic|CCDS	protein_coding	MIR502	protein_coding	OTTHUMT00000056542.2	C		-		49779214	+1	no_errors	ENST00000606349	ensembl	human	known	74_37	rna	SNP	0.550	A
KIAA2022	340533	genome.wustl.edu	37	X	73961334	73961334	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chrX:73961334C>A	ENST00000055682.6	-	3	3669	c.3058G>T	c.(3058-3060)Gat>Tat	p.D1020Y		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1020					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						GTGATATCATCATCGCCATCC	0.473																																																	0								ENSG00000050030						78.0	71.0	74.0					X																	73961334		2203	4300	6503	KIAA2022	SO:0001583	missense	0			-	HGNC		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.3058G>T	X.37:g.73961334C>A	ENSP00000055682:p.Asp1020Tyr	Somatic	0	37	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D1020Y	ENST00000055682.6	37	c.3058	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	C	22.0	4.230222	0.79688	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.37584	1.19;1.19	5.58	5.58	0.84498	.	0.264036	0.42548	D	0.000691	T	0.50017	0.1591	L	0.47716	1.5	0.80722	D	1	P	0.45212	0.853	P	0.54026	0.74	T	0.50136	-0.8863	10	0.87932	D	0	-1.8784	18.6356	0.91378	0.0:1.0:0.0:0.0	.	1020	Q5QGS0	K2022_HUMAN	Y	1020	ENSP00000362567:D1020Y;ENSP00000055682:D1020Y	ENSP00000055682:D1020Y	D	-	1	0	KIAA2022	73878059	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.487000	0.81328	2.344000	0.79699	0.600000	0.82982	GAT	-	NULL		0.473	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	protein_coding	OTTHUMT00000057270.2	C	NM_001008537	-		73961334	-1	no_errors	ENST00000055682	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC4A10	57282	genome.wustl.edu	37	2	162719573	162719573	+	Splice_Site	SNP	G	G	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr2:162719573G>T	ENST00000446997.1	+	6	859		c.e6+1		SLC4A10_ENST00000272716.5_Splice_Site|SLC4A10_ENST00000535165.1_Splice_Site|SLC4A10_ENST00000493021.1_Splice_Site|SLC4A10_ENST00000375514.5_Splice_Site|SLC4A10_ENST00000421911.1_Splice_Site|SLC4A10_ENST00000415876.2_Splice_Site	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10						bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	GACAAAAATGGTAAATGTTTA	0.323																																																	0								ENSG00000144290						68.0	74.0	72.0					2																	162719573		1841	4114	5955	SLC4A10	SO:0001630	splice_region_variant	0			-	HGNC		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.766+1G>T	2.37:g.162719573G>T		Somatic	0	61	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	20	48.72	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e6+1	ENST00000446997.1	37	c.766+1	CCDS54411.1	2	.	.	.	.	.	.	.	.	.	.	G	22.9	4.353794	0.82243	.	.	ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000535165;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6853	0.95977	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC4A10	162427819	1.000000	0.71417	1.000000	0.80357	0.746000	0.42486	9.751000	0.98889	2.759000	0.94783	0.591000	0.81541	.	-	-		0.323	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC4A10	protein_coding	OTTHUMT00000333090.1	G	NM_022058	-	Intron	162719573	+1	no_errors	ENST00000446997	ensembl	human	known	74_37	splice_site	SNP	1.000	T
ACSL3	2181	genome.wustl.edu	37	2	223806326	223806326	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr2:223806326A>G	ENST00000357430.3	+	17	2648	c.2117A>G	c.(2116-2118)aAa>aGa	p.K706R	ACSL3_ENST00000392066.3_Missense_Mutation_p.K706R	NM_004457.3	NP_004448.2	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	706					brain development (GO:0007420)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty acid import (GO:0044539)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)|positive regulation of phosphatidylcholine biosynthetic process (GO:2001247)|positive regulation of secretion (GO:0051047)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)|skin(2)	22		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	AAAGAGCTTAAAACACATTAC	0.408			T	ETV1	prostate																																			Dom	yes		2	2q36	2181	acyl-CoA synthetase long-chain family member 3		E	0								ENSG00000123983						105.0	102.0	103.0					2																	223806326		2203	4300	6503	ACSL3	SO:0001583	missense	0			-	HGNC	D89053	CCDS2455.1	2q34-q35	2008-02-05	2004-02-19	2004-02-20	ENSG00000123983	ENSG00000123983		"""Acyl-CoA synthetase family"""	3570	protein-coding gene	gene with protein product		602371	"""fatty-acid-Coenzyme A ligase, long-chain 3"""	FACL3			Standard	NM_004457		Approved	ACS3, PRO2194	uc002vnj.3	O95573	OTTHUMG00000133160	ENST00000357430.3:c.2117A>G	2.37:g.223806326A>G	ENSP00000350012:p.Lys706Arg	Somatic	0	46	0.00		0.6230499004162908	77	50.96	80	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	22	31.25	Q60I92|Q8IUM9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig	p.K706R	ENST00000357430.3	37	c.2117	CCDS2455.1	2	.	.	.	.	.	.	.	.	.	.	A	13.22	2.173437	0.38413	.	.	ENSG00000123983	ENST00000357430;ENST00000392066	T;T	0.20200	2.09;2.09	5.94	5.94	0.96194	.	0.046320	0.85682	D	0.000000	T	0.17746	0.0426	L	0.39514	1.22	0.58432	D	0.999997	B	0.15473	0.013	B	0.19946	0.027	T	0.08371	-1.0725	10	0.13108	T	0.6	-24.4618	12.6022	0.56503	0.8242:0.1758:0.0:0.0	.	706	O95573	ACSL3_HUMAN	R	706	ENSP00000350012:K706R;ENSP00000375918:K706R	ENSP00000350012:K706R	K	+	2	0	ACSL3	223514570	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.794000	0.75135	2.265000	0.75225	0.482000	0.46254	AAA	-	NULL		0.408	ACSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSL3	protein_coding	OTTHUMT00000256862.2	A	NM_004457	-		223806326	+1	no_errors	ENST00000357430	ensembl	human	known	74_37	missense	SNP	1.000	G
MYH6	4624	genome.wustl.edu	37	14	23862702	23862702	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr14:23862702G>A	ENST00000356287.3	-	22	2983	c.2954C>T	c.(2953-2955)gCt>gTt	p.A985V	MYH6_ENST00000405093.3_Missense_Mutation_p.A985V			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	985					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		ATCCAGCCCAGCCATCTCCTC	0.527																																																	0								ENSG00000197616						187.0	181.0	183.0					14																	23862702		2203	4300	6503	MYH6	SO:0001583	missense	0			-	HGNC	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.2954C>T	14.37:g.23862702G>A	ENSP00000348634:p.Ala985Val	Somatic	0	38	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A985V	ENST00000356287.3	37	c.2954	CCDS9600.1	14	.	.	.	.	.	.	.	.	.	.	g	17.55	3.416677	0.62511	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.83591	-1.74;-1.74	5.12	5.12	0.69794	.	.	.	.	.	D	0.85349	0.5676	M	0.79926	2.475	0.54753	D	0.999987	B	0.17852	0.024	B	0.21151	0.033	D	0.83606	0.0131	9	0.87932	D	0	.	18.9196	0.92520	0.0:0.0:1.0:0.0	.	985	P13533	MYH6_HUMAN	V	985	ENSP00000386041:A985V;ENSP00000348634:A985V	ENSP00000348634:A985V	A	-	2	0	MYH6	22932542	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.532000	0.98057	2.557000	0.86248	0.650000	0.86243	GCT	-	NULL		0.527	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH6	protein_coding	OTTHUMT00000071796.3	G		-		23862702	-1	no_errors	ENST00000356287	ensembl	human	known	74_37	missense	SNP	1.000	A
TUBGCP5	114791	genome.wustl.edu	37	15	22851033	22851033	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr15:22851033G>T	ENST00000283645.4	+	11	1425	c.1295G>T	c.(1294-1296)cGg>cTg	p.R432L	TUBGCP5_ENST00000453949.2_Missense_Mutation_p.R432L|TUBGCP5_ENST00000559846.1_3'UTR	NM_052903.4	NP_443135.3	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	432					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)	p.R432L(1)		breast(5)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	46		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		AATGTCGTCCGGGCCTCTCAC	0.478																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000153575						162.0	153.0	156.0					15																	22851033		2203	4300	6503	TUBGCP5	SO:0001583	missense	0			-	HGNC	AB067486	CCDS73697.1, CCDS73698.1	15q11.1	2014-04-17			ENSG00000153575	ENSG00000275835			18600	protein-coding gene	gene with protein product	"""gamma-tubulin complex component GCP5"""	608147				11694571	Standard	NM_052903		Approved	GCP5, KIAA1899	uc001yur.4	Q96RT8	OTTHUMG00000188371	ENST00000283645.4:c.1295G>T	15.37:g.22851033G>T	ENSP00000283645:p.Arg432Leu	Somatic	0	47	0.00		0.6230499004162908	25	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	23	23.33	E9PB12|Q6IQ52|Q96PY8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TUBGCP	p.R432L	ENST00000283645.4	37	c.1295	CCDS10008.1	15	.	.	.	.	.	.	.	.	.	.	.	19.13	3.767084	0.69878	.	.	ENSG00000153575	ENST00000283645;ENST00000453949	T;T	0.08546	3.08;3.08	5.62	4.64	0.57946	.	0.000000	0.85682	D	0.000000	T	0.16300	0.0392	L	0.56769	1.78	0.80722	D	1	P;P	0.48834	0.916;0.916	P;P	0.49502	0.613;0.613	T	0.00446	-1.1734	10	0.39692	T	0.17	-23.5634	16.3335	0.83051	0.0:0.132:0.868:0.0	.	432;432	Q96RT8;E9PB12	GCP5_HUMAN;.	L	432	ENSP00000283645:R432L;ENSP00000409217:R432L	ENSP00000283645:R432L	R	+	2	0	TUBGCP5	20402474	1.000000	0.71417	0.992000	0.48379	0.887000	0.51463	7.332000	0.79203	2.795000	0.96236	0.655000	0.94253	CGG	-	pfam_TUBGCP		0.478	TUBGCP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP5	protein_coding	OTTHUMT00000250998.2	G	NM_052903	-		22851033	+1	no_errors	ENST00000283645	ensembl	human	known	74_37	missense	SNP	1.000	T
KRT6C	286887	genome.wustl.edu	37	12	52867394	52867394	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr12:52867394C>T	ENST00000252250.6	-	1	175	c.128G>A	c.(127-129)gGc>gAc	p.G43D		NM_173086.4	NP_775109.2	P48668	K2C6C_HUMAN	keratin 6C	43	Head.				intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|prostate(2)|skin(2)	23				BRCA - Breast invasive adenocarcinoma(357;0.0828)		GCCACCACTGCCCCTGGAGCG	0.667																																																	0								ENSG00000170465						15.0	23.0	20.0					12																	52867394		2136	4255	6391	KRT6C	SO:0001583	missense	0			-	HGNC	L42611	CCDS8829.1	12q13.13	2013-01-16	2006-07-17	2006-07-17	ENSG00000170465	ENSG00000170465		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20406	protein-coding gene	gene with protein product		612315	"""keratin 6E"""	KRT6E		7543104, 16831889	Standard	NM_173086		Approved		uc001sal.4	P48668	OTTHUMG00000169596	ENST00000252250.6:c.128G>A	12.37:g.52867394C>T	ENSP00000252250:p.Gly43Asp	Somatic	0	56	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A1L4L5|P48666|Q2TAZ9|Q7RTN9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.G43D	ENST00000252250.6	37	c.128	CCDS8829.1	12	.	.	.	.	.	.	.	.	.	.	c	13.72	2.321913	0.41096	.	.	ENSG00000170465	ENST00000252250;ENST00000411979	D	0.98617	-5.03	3.02	3.02	0.34903	.	0.246454	0.29814	N	0.011138	D	0.98950	0.9643	M	0.92077	3.27	0.38158	D	0.938945	D	0.54047	0.964	P	0.53450	0.726	D	0.99930	1.1317	10	0.87932	D	0	.	15.2806	0.73781	0.0:1.0:0.0:0.0	.	43	P48668	K2C6C_HUMAN	D	43;28	ENSP00000252250:G43D	ENSP00000252250:G43D	G	-	2	0	KRT6C	51153661	0.094000	0.21725	0.999000	0.59377	0.501000	0.33797	3.115000	0.50391	1.979000	0.57680	0.514000	0.50259	GGC	-	NULL		0.667	KRT6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6C	protein_coding	OTTHUMT00000404976.1	C	NM_173086	-		52867394	-1	no_errors	ENST00000252250	ensembl	human	known	74_37	missense	SNP	1.000	T
JUN	3725	genome.wustl.edu	37	1	59248443	59248443	+	Silent	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr1:59248443G>A	ENST00000371222.2	-	1	1342	c.300C>T	c.(298-300)ccC>ccT	p.P100P	RP4-794H19.2_ENST00000419531.2_lincRNA	NM_002228.3	NP_002219.1	P05412	JUN_HUMAN	jun proto-oncogene	100					aging (GO:0007568)|angiogenesis (GO:0001525)|axon regeneration (GO:0031103)|cellular response to calcium ion (GO:0071277)|cellular response to potassium ion starvation (GO:0051365)|circadian rhythm (GO:0007623)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leading edge cell differentiation (GO:0035026)|learning (GO:0007612)|liver development (GO:0001889)|membrane depolarization (GO:0051899)|microglial cell activation (GO:0001774)|monocyte differentiation (GO:0030224)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA binding (GO:0043392)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990441)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA replication (GO:0045740)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|release of cytochrome c from mitochondria (GO:0001836)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|SMAD protein import into nucleus (GO:0007184)|SMAD protein signal transduction (GO:0060395)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nuclear chromosome (GO:0000228)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|R-SMAD binding (GO:0070412)|Rho GTPase activator activity (GO:0005100)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|kidney(2)|lung(5)|skin(1)	10	all_cancers(7;8.55e-07)				Arsenic trioxide(DB01169)|Irbesartan(DB01029)|Pseudoephedrine(DB00852)|Vinblastine(DB00570)	TCACGTTCTTGGGGCACAGGA	0.672			A		sarcoma																																			Dom	yes		1	1p32-p31	3725	jun oncogene		M	0								ENSG00000177606						75.0	82.0	80.0					1																	59248443		2203	4297	6500	JUN	SO:0001819	synonymous_variant	0			-	HGNC	AY217548	CCDS610.1	1p32-p31	2013-01-10	2010-08-27		ENSG00000177606	ENSG00000177606		"""basic leucine zipper proteins"""	6204	protein-coding gene	gene with protein product		165160	"""v-jun avian sarcoma virus 17 oncogene homolog"", ""v-jun sarcoma virus 17 oncogene homolog (avian)"", ""jun oncogene"""			3194415	Standard	NM_002228		Approved	c-Jun, AP-1	uc001cze.3	P05412	OTTHUMG00000008376	ENST00000371222.2:c.300C>T	1.37:g.59248443G>A		Somatic	0	43	0.00		0.6230499004162908	2023	13.57	321	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	119	10.53	Q6FHM7|Q96G93	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_JNK,pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Jun	p.P100	ENST00000371222.2	37	c.300	CCDS610.1	1																																																																																			-	pfam_JNK		0.672	JUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JUN	protein_coding	OTTHUMT00000023042.1	G	NM_002228	-		59248443	-1	no_errors	ENST00000371222	ensembl	human	known	74_37	silent	SNP	1.000	A
RASA1	5921	genome.wustl.edu	37	5	86658444	86658444	+	Missense_Mutation	SNP	C	C	T	rs199894378		TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr5:86658444C>T	ENST00000274376.6	+	10	1973	c.1409C>T	c.(1408-1410)gCc>gTc	p.A470V	RASA1_ENST00000456692.2_Missense_Mutation_p.A293V|RASA1_ENST00000512763.1_Missense_Mutation_p.A303V|RASA1_ENST00000506290.1_Missense_Mutation_p.A304V	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	470					blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		ACAAAGGATGCCTTTTATAAA	0.318																																																	0								ENSG00000145715						79.0	86.0	83.0					5																	86658444		2203	4291	6494	RASA1	SO:0001583	missense	0			-	HGNC		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.1409C>T	5.37:g.86658444C>T	ENSP00000274376:p.Ala470Val	Somatic	0	101	0.00		0.6230499004162908	36	2.70	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B2R6W3|Q9UDI1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH2,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_SH2,smart_SH3_domain,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_RasGAP,prints_SH2	p.A470V	ENST00000274376.6	37	c.1409	CCDS34200.1	5	.	.	.	.	.	.	.	.	.	.	C	25.3	4.625523	0.87560	.	.	ENSG00000145715	ENST00000274376;ENST00000534133;ENST00000456692;ENST00000512763;ENST00000506290	T;T;T;T	0.13538	2.58;2.58;2.58;2.58	5.28	5.28	0.74379	.	0.099626	0.64402	D	0.000002	T	0.16300	0.0392	L	0.54323	1.7	0.80722	D	1	B;B;B;B;B	0.31837	0.192;0.342;0.192;0.124;0.192	B;B;B;B;B	0.25506	0.038;0.039;0.028;0.061;0.041	T	0.02596	-1.1136	10	0.33940	T	0.23	.	19.2595	0.93962	0.0:1.0:0.0:0.0	.	304;303;304;293;470	E9PGC0;B4DTL2;B4DTX4;P20936-2;P20936	.;.;.;.;RASA1_HUMAN	V	470;503;293;303;304	ENSP00000274376:A470V;ENSP00000411221:A293V;ENSP00000422008:A303V;ENSP00000420905:A304V	ENSP00000274376:A470V	A	+	2	0	RASA1	86694200	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	5.964000	0.70379	2.614000	0.88457	0.455000	0.32223	GCC	-	NULL		0.318	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASA1	protein_coding	OTTHUMT00000369729.1	C	NM_002890	-		86658444	+1	no_errors	ENST00000274376	ensembl	human	known	74_37	missense	SNP	1.000	T
GNS	2799	genome.wustl.edu	37	12	65115480	65115480	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr12:65115480G>T	ENST00000258145.3	-	12	1484	c.1314C>A	c.(1312-1314)tgC>tgA	p.C438*	GNS_ENST00000543646.1_Nonsense_Mutation_p.C470*|GNS_ENST00000418919.2_Nonsense_Mutation_p.C382*|GNS_ENST00000542058.1_Nonsense_Mutation_p.C418*	NM_002076.3	NP_002067.1	P15586	GNS_HUMAN	glucosamine (N-acetyl)-6-sulfatase	438					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(4)	15	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)		AGTCTGGGAAGCATTGCTGTA	0.423																																																	0								ENSG00000135677						140.0	118.0	125.0					12																	65115480		2203	4300	6503	GNS	SO:0001587	stop_gained	0			-	HGNC		CCDS8970.1	12q14	2010-05-04	2008-08-01		ENSG00000135677	ENSG00000135677	3.1.6.14		4422	protein-coding gene	gene with protein product	"""Sanfilippo disease IIID"", ""N-acetylglucosamine-6-sulfatase"""	607664					Standard	NM_002076		Approved		uc001ssg.4	P15586	OTTHUMG00000168819	ENST00000258145.3:c.1314C>A	12.37:g.65115480G>T	ENSP00000258145:p.Cys438*	Somatic	0	22	0.00		0.6230499004162908	215	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	B4DYH8|Q53F05	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core,pirsf_GlcNAc_6-SO4ase	p.C438*	ENST00000258145.3	37	c.1314	CCDS8970.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.8|27.8	4.861131|4.861131	0.91433|0.91433	.|.	.|.	ENSG00000135677|ENSG00000135677	ENST00000418919;ENST00000258145;ENST00000543646;ENST00000542058;ENST00000539825|ENST00000540196	.|.	.|.	.|.	5.71|5.71	-5.86|-5.86	0.02304|0.02304	.|.	0.087047|.	0.85682|.	D|.	0.000000|.	.|T	.|0.58163	.|0.2103	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.63107	.|-0.6711	.|3	.|.	.|.	.|.	-21.6015|-21.6015	17.3523|17.3523	0.87327|0.87327	0.4393:0.0:0.5607:0.0|0.4393:0.0:0.5607:0.0	.|.	.|.	.|.	.|.	X|I	382;438;470;418;355|224	.|.	.|.	C|L	-|-	3|1	2|0	GNS|GNS	63401747|63401747	1.000000|1.000000	0.71417|0.71417	0.925000|0.925000	0.36789|0.36789	0.852000|0.852000	0.48524|0.48524	1.156000|1.156000	0.31712|0.31712	-0.990000|-0.990000	0.03481|0.03481	-1.300000|-1.300000	0.01332|0.01332	TGC|CTT	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core,pirsf_GlcNAc_6-SO4ase		0.423	GNS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GNS	protein_coding	OTTHUMT00000401195.2	G		-		65115480	-1	no_errors	ENST00000258145	ensembl	human	known	74_37	nonsense	SNP	0.920	T
LGALS3BP	3959	genome.wustl.edu	37	17	76967850	76967850	+	Silent	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr17:76967850G>A	ENST00000262776.3	-	6	1874	c.1566C>T	c.(1564-1566)gcC>gcT	p.A522A	LGALS3BP_ENST00000591778.1_3'UTR	NM_005567.3	NP_005558.1	Q08380	LG3BP_HUMAN	lectin, galactoside-binding, soluble, 3 binding protein	522					cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(5)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(99;0.0677)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			AGAGCATCAGGGCTTTGTTTT	0.602											OREG0024787	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(89;1105 1755 18102 21513)												0								ENSG00000108679						58.0	57.0	57.0					17																	76967850		2203	4300	6503	LGALS3BP	SO:0001819	synonymous_variant	0			-	HGNC	L13210	CCDS11759.1	17q25	2014-07-09				ENSG00000108679		"""BTB/POZ domain containing"", ""Endogenous ligands"""	6564	protein-coding gene	gene with protein product	"""L3 antigen"", ""Mac-2-binding protein"", ""serum protein 90K"", ""transport and golgi organization 10 homolog B (Drosophila)"""	600626				7698018, 8034587, 8390986	Standard	NM_005567		Approved	MAC-2-BP, 90K, BTBD17B, TANGO10B, M2BP, gp90, CyCAP	uc002jwh.3	Q08380		ENST00000262776.3:c.1566C>T	17.37:g.76967850G>A		Somatic	0	59	0.00	1172	0.6230499004162908	1188	28.38	474	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	34	26.09	Q7M4S0|Q9UCH8|Q9UCH9|Q9UCI0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SRCR,pfam_BACK,superfamily_Srcr_rcpt-rel,superfamily_BTB/POZ_fold,smart_Srcr_rcpt-rel,smart_BACK,pfscan_BTB/POZ-like,pfscan_SRCR,prints_SRCR	p.A522	ENST00000262776.3	37	c.1566	CCDS11759.1	17																																																																																			-	NULL		0.602	LGALS3BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGALS3BP	protein_coding	OTTHUMT00000437785.3	G	NM_005567	-		76967850	-1	no_errors	ENST00000262776	ensembl	human	known	74_37	silent	SNP	0.981	A
GJA9	81025	genome.wustl.edu	37	1	39341869	39341869	+	5'UTR	SNP	T	T	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr1:39341869T>A	ENST00000360786.3	-	0	154				GJA9_ENST00000454994.2_Intron|GJA9_ENST00000357771.3_Intron|MYCBP_ENST00000397572.2_5'Flank|RP5-864K19.4_ENST00000433671.2_RNA|MYCBP_ENST00000489803.1_Intron|RP5-864K19.4_ENST00000456813.1_RNA|RP5-864K19.4_ENST00000443161.1_RNA			P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa						cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			AGCAAACCTATGGTGAAAATA	0.348																																																	0								ENSG00000228436																																			RP5-864K19.4	SO:0001623	5_prime_UTR_variant	0			-	Clone_based_vega_gene	AF179597	CCDS432.1	1p34	2008-02-05	2007-11-06	2007-11-06	ENSG00000131233	ENSG00000131233		"""Ion channels / Gap junction proteins (connexins)"""	19155	protein-coding gene	gene with protein product	"""connexin 59"""	611923	"""gap junction protein, alpha 10, 59kDa"""	GJA10			Standard	NM_030772		Approved	CX59, CX58	uc021olr.1	P57773	OTTHUMG00000000482	ENST00000360786.3:c.-99A>T	1.37:g.39341869T>A		Somatic	0	60	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	27	37.21	B2R722|B3KVQ2|Q5TA63|Q96KG0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000360786.3	37	NULL	CCDS432.1	1																																																																																			-	-		0.348	GJA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000228436	protein_coding	OTTHUMT00000001205.1	T	NM_030772	-		39341869	+1	no_errors	ENST00000443161	ensembl	human	known	74_37	rna	SNP	0.058	A
CHRNA7	1139	genome.wustl.edu	37	15	32460485	32460485	+	Silent	SNP	C	C	T	rs200301018		TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr15:32460485C>T	ENST00000306901.3	+	10	1432	c.1335C>T	c.(1333-1335)aaC>aaT	p.N445N	CHRNA7_ENST00000454250.3_Silent_p.N474N|CHRNA7_ENST00000455693.2_Silent_p.N264N	NM_000746.5	NP_000737.1	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7 (neuronal)	445					activation of MAPK activity (GO:0000187)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to ethanol (GO:0048149)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular calcium ion homeostasis (GO:0006874)|cognition (GO:0050890)|dopamine biosynthetic process (GO:0042416)|endocytosis (GO:0006897)|generation of ovulation cycle rhythm (GO:0060112)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|memory (GO:0007613)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of tumor necrosis factor production (GO:0032720)|neuronal action potential (GO:0019228)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate involved in baroreceptor response to decreased systemic arterial blood pressure (GO:0001988)|regulation of norepinephrine secretion (GO:0014061)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to food (GO:0032094)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|T cell activation (GO:0042110)	acetylcholine-gated channel complex (GO:0005892)|apical plasma membrane (GO:0016324)|asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|external side of plasma membrane (GO:0009897)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|acetylcholine-gated cation channel activity (GO:0022848)|beta-amyloid binding (GO:0001540)|chloride channel regulator activity (GO:0017081)|drug binding (GO:0008144)|protein homodimerization activity (GO:0042803)|toxic substance binding (GO:0015643)			endometrium(3)|large_intestine(1)|lung(6)|ovary(2)	12		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	ACATTGCCAACCGCTTCCGCT	0.667																																					Esophageal Squamous(193;529 2900 40232 43193)												0								ENSG00000175344						1.0	2.0	2.0					15																	32460485		1021	2461	3482	CHRNA7	SO:0001819	synonymous_variant	0			-	HGNC	Z23141	CCDS10027.1, CCDS53924.1	15q13.3	2012-02-11	2012-02-07		ENSG00000175344	ENSG00000175344		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1960	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 7 (neuronal)"""	118511	"""cholinergic receptor, nicotinic, alpha polypeptide 7"""			8188270	Standard	NM_001190455		Approved		uc021sic.2	P36544	OTTHUMG00000129285	ENST00000306901.3:c.1335C>T	15.37:g.32460485C>T		Somatic	0	18	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	3	62.50	A8K7Q4|B4DFS0|Q15826|Q8IUZ4|Q96RH2|Q99555|Q9BXH0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.N474	ENST00000306901.3	37	c.1422	CCDS10027.1	15																																																																																			-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel		0.667	CHRNA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHRNA7	protein_coding	OTTHUMT00000251410.2	C		rs200301018		32460485	+1	no_errors	ENST00000454250	ensembl	human	known	74_37	silent	SNP	1.000	T
PRAMEF11	440560	genome.wustl.edu	37	1	12887523	12887523	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr1:12887523C>T	ENST00000535591.1	-	3	529	c.334G>A	c.(334-336)Gaa>Aaa	p.E112K		NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	112					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						AGCCAAAGTTCTACAAACACA	0.498																																																	0								ENSG00000204513																																			PRAMEF11	SO:0001583	missense	0			-	HGNC	AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.334G>A	1.37:g.12887523C>T	ENSP00000439551:p.Glu112Lys	Somatic	0	240	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	71	83	46.10		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E112K	ENST00000535591.1	37	c.334	CCDS53268.1	1	.	.	.	.	.	.	.	.	.	.	.	10.61	1.397443	0.25205	.	.	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	T;T	0.14022	2.54;2.54	1.48	1.48	0.22813	.	0.522608	0.16108	N	0.229234	T	0.11239	0.0274	L	0.45352	1.415	0.09310	N	1	B	0.27679	0.185	B	0.27380	0.079	T	0.21518	-1.0243	10	0.87932	D	0	.	6.4564	0.21932	0.0:1.0:0.0:0.0	.	112	O60813	PRA11_HUMAN	K	112;153;112	ENSP00000439551:E112K;ENSP00000391839:E112K	ENSP00000328783:E153K	E	-	1	0	PRAMEF11	12810110	0.000000	0.05858	0.018000	0.16275	0.012000	0.07955	0.131000	0.15870	1.137000	0.42214	0.400000	0.26472	GAA	-	NULL		0.498	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF11	protein_coding		C	XM_496341	-		12887523	-1	no_errors	ENST00000535591	ensembl	human	known	74_37	missense	SNP	0.020	T
CLASP2	23122	genome.wustl.edu	37	3	33602411	33602411	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr3:33602411T>A	ENST00000468888.2	-	28	2889	c.2843A>T	c.(2842-2844)gAt>gTt	p.D948V	CLASP2_ENST00000399362.4_Missense_Mutation_p.D947V|CLASP2_ENST00000539981.1_Missense_Mutation_p.D717V|CLASP2_ENST00000480013.1_Missense_Mutation_p.D727V|CLASP2_ENST00000359576.5_Missense_Mutation_p.D939V|CLASP2_ENST00000307312.7_Missense_Mutation_p.D429V|CLASP2_ENST00000461133.3_Missense_Mutation_p.D707V			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	728	Interaction with RSN and localization to the Golgi and kinetochores.				axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						TTGAAGATCATCTTTGTGGAC	0.383																																																	0								ENSG00000163539						148.0	154.0	152.0					3																	33602411		1861	4111	5972	CLASP2	SO:0001583	missense	0			-	HGNC	AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.2843A>T	3.37:g.33602411T>A	ENSP00000419974:p.Asp948Val	Somatic	0	85	0.00		0.6230499004162908	21	8.70	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	65	8.45	Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.D947V	ENST00000468888.2	37	c.2840		3	.	.	.	.	.	.	.	.	.	.	T	22.8	4.338894	0.81911	.	.	ENSG00000163539	ENST00000468888;ENST00000399362;ENST00000359576;ENST00000307312;ENST00000539981;ENST00000480013;ENST00000461133	T;T;T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31;-0.31;-0.31	5.48	5.48	0.80851	Armadillo-like helical (1);Armadillo-type fold (1);	0.104955	0.64402	D	0.000003	T	0.60038	0.2238	N	0.12182	0.205	0.80722	D	1	P;P;B	0.48350	0.909;0.773;0.078	P;B;B	0.50617	0.646;0.369;0.102	T	0.65857	-0.6066	10	0.51188	T	0.08	-20.1628	15.5744	0.76365	0.0:0.0:0.0:1.0	.	728;939;947	O75122;F5H604;E7ERI8	CLAP2_HUMAN;.;.	V	948;947;939;429;717;727;707	ENSP00000419974:D948V;ENSP00000382297:D947V;ENSP00000352581:D939V;ENSP00000304743:D429V;ENSP00000439039:D717V;ENSP00000417518:D727V;ENSP00000419305:D707V	ENSP00000304743:D429V	D	-	2	0	CLASP2	33577415	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.717000	0.84732	2.086000	0.62901	0.533000	0.62120	GAT	-	superfamily_ARM-type_fold		0.383	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	CLASP2	protein_coding	OTTHUMT00000344320.4	T	NM_001207044	-		33602411	-1	no_errors	ENST00000399362	ensembl	human	known	74_37	missense	SNP	1.000	A
ABCA4	24	genome.wustl.edu	37	1	94463415	94463415	+	Splice_Site	SNP	G	G	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr1:94463415G>T	ENST00000370225.3	-	48	6816		c.e48+1		ABCA4_ENST00000536513.1_Splice_Site|ABCA4_ENST00000535881.1_Splice_Site	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4						phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GGGCCAACTTGCCTGGTCCAG	0.567																																																	0								ENSG00000198691						105.0	88.0	94.0					1																	94463415		2203	4300	6503	ABCA4	SO:0001630	splice_region_variant	0			-	HGNC	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.6729+1C>A	1.37:g.94463415G>T		Somatic	0	40	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	14	26.32	O15112|O60438|O60915|Q0QD48|Q4LE31	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e48+2	ENST00000370225.3	37	c.6729+2	CCDS747.1	1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.948479	0.53186	.	.	ENSG00000198691	ENST00000546054;ENST00000370225;ENST00000536513;ENST00000535881	.	.	.	5.39	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.4966	0.07657	0.3664:0.0:0.6336:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ABCA4	94236003	1.000000	0.71417	1.000000	0.80357	0.640000	0.38277	4.651000	0.61447	2.523000	0.85059	0.563000	0.77884	.	-	-		0.567	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	protein_coding	OTTHUMT00000029320.1	G	NM_000350	-	Intron	94463415	-1	no_errors	ENST00000370225	ensembl	human	known	74_37	splice_site	SNP	1.000	T
SMARCC2	6601	genome.wustl.edu	37	12	56583194	56583194	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr12:56583194C>T	ENST00000267064.4	-	1	138	c.52G>A	c.(52-54)Gcg>Acg	p.A18T	RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000347471.4_Missense_Mutation_p.A18T|SMARCC2_ENST00000550164.1_Missense_Mutation_p.A18T|SMARCC2_ENST00000550859.1_5'Flank|SMARCC2_ENST00000394023.3_Missense_Mutation_p.A18T	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	18					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			ACGGTGTCCGCGGCCTCGTAG	0.726																																																	0								ENSG00000139613						45.0	42.0	43.0					12																	56583194		2203	4299	6502	SMARCC2	SO:0001583	missense	0			-	HGNC	U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.52G>A	12.37:g.56583194C>T	ENSP00000267064:p.Ala18Thr	Somatic	0	91	0.00		0.6230499004162908	66	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.33	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.A18T	ENST00000267064.4	37	c.52	CCDS8907.1	12	.	.	.	.	.	.	.	.	.	.	c	15.06	2.720473	0.48728	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	T;T;T;T	0.22743	1.94;1.94;1.94;1.94	2.06	0.0325	0.14176	.	0.207047	0.30538	N	0.009408	T	0.09905	0.0243	N	0.22421	0.69	0.27760	N	0.943869	B;B;B;B	0.19706	0.038;0.022;0.022;0.038	B;B;B;B	0.04013	0.001;0.0;0.0;0.001	T	0.14643	-1.0465	10	0.62326	D	0.03	0.0868	1.0099	0.01495	0.2309:0.3893:0.2273:0.1524	.	18;23;18;18	F8VTJ5;Q59G16;Q8TAQ2;Q8TAQ2-2	.;.;SMRC2_HUMAN;.	T	18	ENSP00000377591:A18T;ENSP00000449396:A18T;ENSP00000302919:A18T;ENSP00000267064:A18T	ENSP00000267064:A18T	A	-	1	0	SMARCC2	54869461	1.000000	0.71417	0.996000	0.52242	0.975000	0.68041	1.600000	0.36762	0.010000	0.14839	-0.549000	0.04216	GCG	-	NULL		0.726	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCC2	protein_coding	OTTHUMT00000408370.1	C		-		56583194	-1	no_errors	ENST00000267064	ensembl	human	known	74_37	missense	SNP	0.977	T
ABCG5	64240	genome.wustl.edu	37	2	44041643	44041643	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr2:44041643C>T	ENST00000260645.1	-	12	1874	c.1735G>A	c.(1735-1737)Gag>Aag	p.E579K	ABCG5_ENST00000405322.1_Missense_Mutation_p.E408K|ABCG5_ENST00000543989.1_Missense_Mutation_p.E184K	NM_022436.2	NP_071881.1	Q9H222	ABCG5_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 5	579	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)			breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	CCGTAGAACTCATTGACTACA	0.308																																																	0								ENSG00000138075						77.0	78.0	77.0					2																	44041643		2202	4295	6497	ABCG5	SO:0001583	missense	0			-	HGNC	T93792	CCDS1814.1	2p21	2012-03-14	2008-07-31		ENSG00000138075	ENSG00000138075		"""ATP binding cassette transporters / subfamily G"""	13886	protein-coding gene	gene with protein product	"""sterolin 1"""	605459				11099417, 11452359	Standard	NM_022436		Approved	STSL	uc002rtn.3	Q9H222	OTTHUMG00000128758	ENST00000260645.1:c.1735G>A	2.37:g.44041643C>T	ENSP00000260645:p.Glu579Lys	Somatic	0	149	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	130	23.98	Q2T9G2|Q96QZ2|Q96QZ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_2_trans,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E579K	ENST00000260645.1	37	c.1735	CCDS1814.1	2	.	.	.	.	.	.	.	.	.	.	C	31	5.074191	0.94000	.	.	ENSG00000138075	ENST00000260645;ENST00000405322;ENST00000543989	T;T;T	0.74002	-0.8;-0.8;-0.8	5.09	5.09	0.68999	ABC-2 type transporter (1);	0.719989	0.12710	N	0.445600	D	0.86981	0.6064	M	0.76002	2.32	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.991;0.999	D	0.86395	0.1738	10	0.66056	D	0.02	.	18.2993	0.90158	0.0:1.0:0.0:0.0	.	408;579	E7EX35;Q9H222	.;ABCG5_HUMAN	K	579;408;184	ENSP00000260645:E579K;ENSP00000384513:E408K;ENSP00000445107:E184K	ENSP00000260645:E579K	E	-	1	0	ABCG5	43895147	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.683000	0.74533	2.639000	0.89480	0.557000	0.71058	GAG	-	pfam_ABC_2_trans		0.308	ABCG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG5	protein_coding	OTTHUMT00000250675.1	C	NM_022436	-		44041643	-1	no_errors	ENST00000260645	ensembl	human	known	74_37	missense	SNP	1.000	T
BET1	10282	genome.wustl.edu	37	7	93605346	93605346	+	5'UTR	SNP	A	A	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr7:93605346A>T	ENST00000471446.1	-	0	123				AC006378.2_ENST00000426193.2_RNA|AC006378.2_ENST00000426634.1_RNA			O15155	BET1_HUMAN	Bet1 golgi vesicular membrane trafficking protein						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)|vesicle fusion with Golgi apparatus (GO:0048280)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				large_intestine(2)|lung(1)|prostate(1)|skin(1)	5	all_cancers(62;2.22e-10)|all_epithelial(64;1.38e-09)|Lung NSC(181;0.218)	Breast(660;0.000162)|Ovarian(593;0.000626)	STAD - Stomach adenocarcinoma(171;0.000967)			ATGCTGAGGAACAGTCAAAAT	0.388																																																	0								ENSG00000105829																																			BET1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF007551	CCDS5635.1	7q21.1-q22	2013-03-08	2013-03-08		ENSG00000105829	ENSG00000105829			14562	protein-coding gene	gene with protein product	"""Golgi vesicular membrane trafficking protein p18"", ""Bet1p homolog"""	605456	"""Bet1 (S. cerevisiae) homolog"", ""BET1 homolog (S. cerevisiae)"", ""blocked early in transport 1 homolog (S. cerevisiae)"""			9382863, 10449330	Standard	XM_005250109		Approved	hbet1	uc003unf.1	O15155	OTTHUMG00000023487	ENST00000471446.1:c.-412T>A	7.37:g.93605346A>T		Somatic	0	62	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	39	26.42	Q96EA0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_T_SNARE_dom,pfscan_T_SNARE_dom	p.V101D	ENST00000471446.1	37	c.302		7																																																																																			-	NULL		0.388	BET1-006	KNOWN	basic	processed_transcript	BET1	protein_coding	OTTHUMT00000341560.1	A	NM_005868	-		93605346	-1	no_errors	ENST00000357520	ensembl	human	known	74_37	missense	SNP	0.005	T
PTX4	390667	genome.wustl.edu	37	16	1536545	1536545	+	Missense_Mutation	SNP	C	C	T	rs148493506		TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr16:1536545C>T	ENST00000447419.2	-	3	857	c.832G>A	c.(832-834)Gcc>Acc	p.A278T	PTX4_ENST00000293922.1_Missense_Mutation_p.A273T|PTX4_ENST00000440447.2_Silent_p.T129T			Q96A99	PTX4_HUMAN	pentraxin 4, long	278	Pentaxin.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						CTGGTGGAGGCGTTTGGGAAA	0.647																																																	0								ENSG00000251692	C	THR/ALA	1,4397	2.1+/-5.4	0,1,2198	47.0	47.0	47.0		817	-3.1	0.0	16	dbSNP_134	47	0,8600		0,0,4300	no	missense	PTX4	NM_001013658.1	58	0,1,6498	TT,TC,CC		0.0,0.0227,0.0077	benign	273/474	1536545	1,12997	2199	4300	6499	PTX4	SO:0001583	missense	0			-	HGNC		CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.832G>A	16.37:g.1536545C>T	ENSP00000445277:p.Ala278Thr	Somatic	0	12	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	3	66.67		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pentaxin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.A278T	ENST00000447419.2	37	c.832		16	.	.	.	.	.	.	.	.	.	.	C	2.204	-0.382340	0.04966	2.27E-4	0.0	ENSG00000251692	ENST00000447419;ENST00000293922	T;T	0.62105	0.05;0.05	5.58	-3.06	0.05379	.	0.370607	0.26227	N	0.025597	T	0.33000	0.0848	N	0.21508	0.67	0.20638	N	0.999871	B	0.28378	0.209	B	0.22753	0.041	T	0.23726	-1.0180	10	0.11794	T	0.64	.	4.5068	0.11893	0.2312:0.4007:0.0:0.3681	.	273	Q96A99-2	.	T	278;273	ENSP00000445277:A278T;ENSP00000293922:A273T	ENSP00000293922:A273T	A	-	1	0	PTX4	1476546	0.000000	0.05858	0.041000	0.18516	0.004000	0.04260	-2.305000	0.01133	-0.159000	0.11021	-0.841000	0.03054	GCC	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin		0.647	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	PTX4	protein_coding	OTTHUMT00000432526.1	C	NM_001013658	rs148493506		1536545	-1	no_errors	ENST00000447419	ensembl	human	known	74_37	missense	SNP	0.013	T
SEL1L2	80343	genome.wustl.edu	37	20	13936777	13936777	+	Splice_Site	SNP	G	G	A	rs377357095		TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr20:13936777G>A	ENST00000284951.5	-	2	133	c.59C>T	c.(58-60)aCt>aTt	p.T20I	SEL1L2_ENST00000378072.5_Splice_Site_p.T20I|AL117333.1_ENST00000408401.1_RNA|SEL1L2_ENST00000486903.1_5'UTR			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	20						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						TGCTTTGATAGCTGCAATACA	0.214																																																	0								ENSG00000101251						38.0	36.0	37.0					20																	13936777		1781	4030	5811	SEL1L2	SO:0001630	splice_region_variant	0			-	HGNC	AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.59-1C>T	20.37:g.13936777G>A		Somatic	0	129	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	63	29.21	B4DXX5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sel1-like,smart_Sel1-like	p.T20I	ENST00000284951.5	37	c.59		20	.	.	.	.	.	.	.	.	.	.	G	0.042	-1.282421	0.01398	.	.	ENSG00000101251	ENST00000378072;ENST00000284951	T;T	0.22945	1.93;2.26	4.57	0.926	0.19430	.	0.816969	0.10656	N	0.649244	T	0.10937	0.0267	N	0.08118	0	0.09310	N	1	B;B	0.19583	0.037;0.037	B;B	0.18871	0.015;0.023	T	0.38650	-0.9651	10	0.16896	T	0.51	.	5.8104	0.18463	0.0:0.099:0.4404:0.4606	.	20;20	B4DXX5;Q5TEA6	.;SE1L2_HUMAN	I	20	ENSP00000367312:T20I;ENSP00000284951:T20I	ENSP00000284951:T20I	T	-	2	0	SEL1L2	13884777	0.988000	0.35896	0.126000	0.21872	0.031000	0.12232	0.222000	0.17699	0.038000	0.15604	0.462000	0.41574	ACT	-	NULL		0.214	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SEL1L2	protein_coding	OTTHUMT00000078067.3	G	NM_025229	-	Missense_Mutation	13936777	-1	no_errors	ENST00000284951	ensembl	human	known	74_37	missense	SNP	0.440	A
GPR158	57512	genome.wustl.edu	37	10	25891039	25891039	+	3'UTR	DEL	A	A	-			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr10:25891039delA	ENST00000376351.3	+	0	6843				GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158						protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						TGGTTCTCCTAAAACTATTAT	0.363																																																	0								ENSG00000151025																																			GPR158	SO:0001624	3_prime_UTR_variant	0				HGNC	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.*2836A>-	10.37:g.25891039delA		Somatic	0	49	0.00		0.6230499004162908	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	21	36.36	Q6QR81|Q9ULT3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376351.3	37	NULL	CCDS31166.1	10																																																																																			-	-		0.363	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	protein_coding	OTTHUMT00000047248.2	A	XM_166110			25891039	+1	no_errors	ENST00000490549	ensembl	human	known	74_37	rna	DEL	0.994	-
AHNAK	79026	genome.wustl.edu	37	11	62288755	62288755	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr11:62288755C>T	ENST00000378024.4	-	5	13408	c.13134G>A	c.(13132-13134)atG>atA	p.M4378I	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4378					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CCTTGATGTTCATCTCTGGCA	0.473																																																	0								ENSG00000124942						146.0	152.0	150.0					11																	62288755		2202	4299	6501	AHNAK	SO:0001583	missense	0			-	HGNC	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.13134G>A	11.37:g.62288755C>T	ENSP00000367263:p.Met4378Ile	Somatic	0	106	0.00		0.6230499004162908	771	31.90	363	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	49	30.00	A1A586	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.M4378I	ENST00000378024.4	37	c.13134	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	C	6.448	0.450753	0.12223	.	.	ENSG00000124942	ENST00000378024	T	0.01126	5.3	4.84	2.96	0.34315	.	0.056663	0.64402	D	0.000005	T	0.01695	0.0054	L	0.61218	1.895	0.31043	N	0.716115	B	0.13145	0.007	B	0.12156	0.007	T	0.14008	-1.0488	10	0.21014	T	0.42	.	10.8698	0.46877	0.0:0.8439:0.0:0.1561	.	4378	Q09666	AHNK_HUMAN	I	4378	ENSP00000367263:M4378I	ENSP00000367263:M4378I	M	-	3	0	AHNAK	62045331	0.984000	0.35163	1.000000	0.80357	0.141000	0.21300	1.185000	0.32065	0.562000	0.29204	0.551000	0.68910	ATG	-	NULL		0.473	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	protein_coding	OTTHUMT00000395572.1	C	NM_024060	-		62288755	-1	no_errors	ENST00000378024	ensembl	human	known	74_37	missense	SNP	1.000	T
RP1-241P17.4	0	genome.wustl.edu	37	X	114953402	114953402	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chrX:114953402G>A	ENST00000449327.1	-	1	267	c.148C>T	c.(148-150)Cga>Tga	p.R50*																								AATCCCTGTCGTTCACAATAG	0.443																																																	0								ENSG00000228532																																			RP1-241P17.4	SO:0001587	stop_gained	0			-	Clone_based_vega_gene																												ENST00000449327.1:c.148C>T	X.37:g.114953402G>A	ENSP00000391266:p.Arg50*	Somatic	0	96	0.00		0.6230499004162908	133	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	27	48.08		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rad60/SUMO_like,pfam_Ubiquitin_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	p.R50*	ENST00000449327.1	37	c.148		X	.	.	.	.	.	.	.	.	.	.	G	12.74	2.028590	0.35797	.	.	ENSG00000228532	ENST00000449327	.	.	.	1.79	-0.197	0.13228	.	0.127827	0.30285	U	0.009973	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.4677	0.11698	0.1615:0.2279:0.6106:0.0	.	.	.	.	X	50	.	ENSP00000391266:R50X	R	-	1	2	RP1-241P17.4	114859658	0.991000	0.36638	0.338000	0.25549	0.422000	0.31414	0.406000	0.21032	-0.099000	0.12263	-0.583000	0.04132	CGA	-	pfam_Rad60/SUMO_like,pfam_Ubiquitin_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup		0.443	RP1-241P17.4-001	NOVEL	basic|appris_principal	protein_coding	ENSG00000228532	protein_coding	OTTHUMT00000057980.1	G		-		114953402	-1	no_errors	ENST00000449327	ensembl	human	novel	74_37	nonsense	SNP	0.673	A
BET1	10282	genome.wustl.edu	37	7	93605343	93605343	+	5'UTR	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr7:93605343G>A	ENST00000471446.1	-	0	126				AC006378.2_ENST00000426193.2_RNA|AC006378.2_ENST00000426634.1_RNA			O15155	BET1_HUMAN	Bet1 golgi vesicular membrane trafficking protein						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)|vesicle fusion with Golgi apparatus (GO:0048280)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				large_intestine(2)|lung(1)|prostate(1)|skin(1)	5	all_cancers(62;2.22e-10)|all_epithelial(64;1.38e-09)|Lung NSC(181;0.218)	Breast(660;0.000162)|Ovarian(593;0.000626)	STAD - Stomach adenocarcinoma(171;0.000967)			CAAATGCTGAGGAACAGTCAA	0.398																																																	0								ENSG00000105829																																			BET1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF007551	CCDS5635.1	7q21.1-q22	2013-03-08	2013-03-08		ENSG00000105829	ENSG00000105829			14562	protein-coding gene	gene with protein product	"""Golgi vesicular membrane trafficking protein p18"", ""Bet1p homolog"""	605456	"""Bet1 (S. cerevisiae) homolog"", ""BET1 homolog (S. cerevisiae)"", ""blocked early in transport 1 homolog (S. cerevisiae)"""			9382863, 10449330	Standard	XM_005250109		Approved	hbet1	uc003unf.1	O15155	OTTHUMG00000023487	ENST00000471446.1:c.-409C>T	7.37:g.93605343G>A		Somatic	0	62	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	39	29.09	Q96EA0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_T_SNARE_dom,pfscan_T_SNARE_dom	p.P102L	ENST00000471446.1	37	c.305		7																																																																																			-	NULL		0.398	BET1-006	KNOWN	basic	processed_transcript	BET1	protein_coding	OTTHUMT00000341560.1	G	NM_005868	-		93605343	-1	no_errors	ENST00000357520	ensembl	human	known	74_37	missense	SNP	0.017	A
OR5H14	403273	genome.wustl.edu	37	3	97868430	97868430	+	Silent	SNP	T	T	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr3:97868430T>A	ENST00000437310.1	+	1	261	c.201T>A	c.(199-201)gcT>gcA	p.A67A	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						GGAATTTAGCTTTTGTGGATG	0.398																																																	0								ENSG00000236032						310.0	313.0	312.0					3																	97868430		2203	4300	6503	OR5H14	SO:0001819	synonymous_variant	0			-	HGNC		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.201T>A	3.37:g.97868430T>A		Somatic	0	95	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	26	43.48	B9EH15	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A67	ENST00000437310.1	37	c.201	CCDS33798.1	3																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.398	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H14	protein_coding	OTTHUMT00000359112.1	T		-		97868430	+1	no_errors	ENST00000437310	ensembl	human	known	74_37	silent	SNP	0.000	A
TRPC5	7224	genome.wustl.edu	37	X	111090651	111090651	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chrX:111090651C>T	ENST00000262839.2	-	6	2309	c.1391G>A	c.(1390-1392)cGt>cAt	p.R464H		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	464					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CTCCCTTGGACGAGAACCATT	0.428																																																	0								ENSG00000072315						75.0	63.0	67.0					X																	111090651		2203	4300	6503	TRPC5	SO:0001583	missense	0			-	HGNC	AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.1391G>A	X.37:g.111090651C>T	ENSP00000262839:p.Arg464His	Somatic	0	38	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	18	41.94	B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC5_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.R464H	ENST00000262839.2	37	c.1391	CCDS14561.1	X	.	.	.	.	.	.	.	.	.	.	C	12.97	2.098511	0.37048	.	.	ENSG00000072315	ENST00000262839	T	0.70869	-0.52	5.51	5.51	0.81932	Ion transport (1);	0.058084	0.64402	D	0.000003	T	0.55321	0.1913	N	0.25485	0.75	0.49687	D	0.999811	B;B	0.15930	0.006;0.015	B;B	0.15870	0.009;0.014	T	0.50972	-0.8764	10	0.15066	T	0.55	-5.5772	12.0125	0.53295	0.0:0.9192:0.0:0.0808	.	465;464	Q59G51;Q9UL62	.;TRPC5_HUMAN	H	464	ENSP00000262839:R464H	ENSP00000262839:R464H	R	-	2	0	TRPC5	110977307	0.055000	0.20627	1.000000	0.80357	0.998000	0.95712	1.489000	0.35562	2.325000	0.78763	0.529000	0.55759	CGT	-	pfam_Ion_trans_dom,tigrfam_TRP_channel		0.428	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC5	protein_coding	OTTHUMT00000057945.1	C	NM_012471	-		111090651	-1	no_errors	ENST00000262839	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF335	63925	genome.wustl.edu	37	20	44578874	44578876	+	In_Frame_Del	DEL	TGT	TGT	-			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	TGT	TGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr20:44578874_44578876delTGT	ENST00000322927.2	-	22	3569_3571	c.3469_3471delACA	c.(3469-3471)acadel	p.T1157del	ZNF335_ENST00000426788.1_In_Frame_Del_p.T1002del	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	1157					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				GGGTGGCCAGTGTTTCGTCATCA	0.626																																																	0								ENSG00000198026																																			ZNF335	SO:0001651	inframe_deletion	0				HGNC	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.3469_3471delACA	20.37:g.44578874_44578876delTGT	ENSP00000325326:p.Thr1157del	Somatic	0	35	0.00		0.6230499004162908	60	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	30	14.29	B4DLG7|Q548D0|Q9H684	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T1157in_frame_del	ENST00000322927.2	37	c.3471_3469	CCDS13389.1	20																																																																																			-	NULL		0.626	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF335	protein_coding	OTTHUMT00000079553.1	TGT	NM_022095			44578876	-1	no_errors	ENST00000322927	ensembl	human	known	74_37	in_frame_del	DEL	0.141:0.993:0.993	-
ZNF76	7629	genome.wustl.edu	37	6	35262984	35262984	+	Missense_Mutation	SNP	G	G	A	rs73409749	byFrequency	TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr6:35262984G>A	ENST00000373953.3	+	14	1938	c.1672G>A	c.(1672-1674)Gct>Act	p.A558T	ZNF76_ENST00000440666.2_Missense_Mutation_p.A532T|DEF6_ENST00000542066.1_5'Flank|DEF6_ENST00000316637.5_5'Flank|ZNF76_ENST00000339411.5_Missense_Mutation_p.A503T	NM_003427.3	NP_003418.2	P36508	ZNF76_HUMAN	zinc finger protein 76	558					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						GCAGCAAGGGGCTGTGACCCT	0.602																																					Esophageal Squamous(52;92 1039 20612 23956 34676)												0								ENSG00000065029						65.0	51.0	56.0					6																	35262984		2203	4300	6503	ZNF76	SO:0001583	missense	0			-	HGNC	M91592	CCDS4801.1, CCDS75435.1	6p21.31	2013-01-08	2011-02-25		ENSG00000065029	ENSG00000065029		"""Zinc fingers, C2H2-type"""	13149	protein-coding gene	gene with protein product		194549	"""zinc finger protein 76 (expressed in testis)"""	D6S229E		1427894	Standard	XM_005249364		Approved	Zfp523, ZNF523	uc003oki.1	P36508	OTTHUMG00000014564	ENST00000373953.3:c.1672G>A	6.37:g.35262984G>A	ENSP00000363064:p.Ala558Thr	Somatic	0	48	0.00		0.6230499004162908	41	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q9BQB2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A558T	ENST00000373953.3	37	c.1672	CCDS4801.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.31|16.31	3.088574|3.088574	0.55968|0.55968	.|.	.|.	ENSG00000065029|ENSG00000065029	ENST00000373953;ENST00000440666;ENST00000339411|ENST00000448999;ENST00000417184	T;T;T|.	0.10477|.	2.95;2.95;2.87|.	5.91|5.91	-0.613|-0.613	0.11594|0.11594	.|.	0.319821|.	0.22584|.	N|.	0.058165|.	T|T	0.17408|0.17408	0.0418|0.0418	N|N	0.22421|0.22421	0.69|0.69	0.32725|0.32725	N|N	0.509737|0.509737	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.04013|.	0.001;0.0|.	T|T	0.09552|0.09552	-1.0669|-1.0669	10|6	0.32370|0.54805	T|T	0.25|0.06	.|.	5.4369|5.4369	0.16486|0.16486	0.4237:0.1918:0.3844:0.0|0.4237:0.1918:0.3844:0.0	.|.	503;558|.	P36508-2;P36508|.	.;ZNF76_HUMAN|.	T|D	558;532;503|349;375	ENSP00000363064:A558T;ENSP00000392243:A532T;ENSP00000344097:A503T|.	ENSP00000344097:A503T|ENSP00000410765:G375D	A|G	+|+	1|2	0|0	ZNF76|ZNF76	35370962|35370962	0.100000|0.100000	0.21855|0.21855	0.549000|0.549000	0.28204|0.28204	0.952000|0.952000	0.60782|0.60782	-0.176000|-0.176000	0.09811|0.09811	-0.129000|-0.129000	0.11620|0.11620	0.655000|0.655000	0.94253|0.94253	GCT|GGC	-	NULL		0.602	ZNF76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF76	protein_coding	OTTHUMT00000040279.2	G	NM_003427	-		35262984	+1	no_errors	ENST00000373953	ensembl	human	known	74_37	missense	SNP	0.953	A
COL19A1	1310	genome.wustl.edu	37	6	70909399	70909399	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr6:70909399A>C	ENST00000322773.4	+	49	3284	c.3182A>C	c.(3181-3183)aAg>aCg	p.K1061T	COL19A1_ENST00000393344.1_Missense_Mutation_p.K683T	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	1061	Triple-helical region 6 (COL6).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						CCACCAGGGAAGGATGGGTTG	0.488																																																	0								ENSG00000082293						67.0	71.0	69.0					6																	70909399		2203	4300	6503	COL19A1	SO:0001583	missense	0			-	HGNC		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.3182A>C	6.37:g.70909399A>C	ENSP00000316030:p.Lys1061Thr	Somatic	0	86	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	48	9.43	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.K1061T	ENST00000322773.4	37	c.3182	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	A	16.20	3.055660	0.55325	.	.	ENSG00000082293	ENST00000322773;ENST00000393344;ENST00000393333	D;D	0.93488	-3.23;-3.23	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.95098	0.8412	M	0.81497	2.545	0.47153	D	0.999336	D	0.89917	1.0	D	0.66084	0.941	D	0.93867	0.7159	10	0.15952	T	0.53	.	16.3469	0.83138	1.0:0.0:0.0:0.0	.	1061	Q14993	COJA1_HUMAN	T	1061;683;136	ENSP00000316030:K1061T;ENSP00000377013:K683T	ENSP00000316030:K1061T	K	+	2	0	COL19A1	70966120	1.000000	0.71417	0.993000	0.49108	0.774000	0.43823	6.372000	0.73123	2.263000	0.75096	0.528000	0.53228	AAG	-	NULL		0.488	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	protein_coding	OTTHUMT00000041127.1	A		-		70909399	+1	no_errors	ENST00000322773	ensembl	human	known	74_37	missense	SNP	1.000	C
PARP6	56965	genome.wustl.edu	37	15	72541646	72541646	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr15:72541646C>T	ENST00000569795.1	-	20	2188	c.1501G>A	c.(1501-1503)Gca>Aca	p.A501T	PARP6_ENST00000260376.7_Intron|PARP6_ENST00000287196.9_Missense_Mutation_p.A501T|PARP6_ENST00000413097.2_Intron			Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6	501	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.						NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|skin(1)|urinary_tract(1)	18						CCATAGGCTGCTCCATGCAGC	0.488																																																	0								ENSG00000137817						82.0	83.0	83.0					15																	72541646		1938	4130	6068	PARP6	SO:0001583	missense	0			-	HGNC	AL390093	CCDS10241.2	15q22	2010-02-16			ENSG00000137817	ENSG00000137817		"""Poly (ADP-ribose) polymerases"""	26921	protein-coding gene	gene with protein product						15273990	Standard	XM_005254557		Approved	pART17	uc002auc.3	Q2NL67	OTTHUMG00000133443	ENST00000569795.1:c.1501G>A	15.37:g.72541646C>T	ENSP00000456348:p.Ala501Thr	Somatic	0	53	0.00		0.6230499004162908	17	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	Q9H7C5|Q9H9X6|Q9HAF3|Q9NPS6|Q9UFG4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.A501T	ENST00000569795.1	37	c.1501	CCDS10241.2	15	.	.	.	.	.	.	.	.	.	.	C	29.4	5.002848	0.93287	.	.	ENSG00000137817	ENST00000419739;ENST00000287196	T;T	0.13901	2.55;2.55	4.93	4.93	0.64822	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.000000	0.64402	U	0.000002	T	0.33323	0.0859	L	0.58101	1.795	0.80722	D	1	D;D;D	0.69078	0.996;0.997;0.997	D;D;D	0.85130	0.997;0.989;0.994	T	0.00901	-1.1521	10	0.24483	T	0.36	-7.4672	17.6582	0.88184	0.0:1.0:0.0:0.0	.	502;501;434	Q0VDG0;Q2NL67;A0PJ50	.;PARP6_HUMAN;.	T	502;501	ENSP00000403265:A502T;ENSP00000287196:A501T	ENSP00000287196:A501T	A	-	1	0	PARP6	70328700	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.513000	0.81739	2.719000	0.93026	0.655000	0.94253	GCA	-	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom		0.488	PARP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP6	protein_coding	OTTHUMT00000257315.2	C	NM_020214	-		72541646	-1	no_errors	ENST00000287196	ensembl	human	known	74_37	missense	SNP	1.000	T
SDK2	54549	genome.wustl.edu	37	17	71382003	71382003	+	Missense_Mutation	SNP	C	C	A	rs562611295	byFrequency	TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr17:71382003C>A	ENST00000392650.3	-	32	4552	c.4552G>T	c.(4552-4554)Gtg>Ttg	p.V1518L	SDK2_ENST00000388726.3_Missense_Mutation_p.V1518L	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1518	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CGGATTAGCACGGAGGTGGTG	0.637																																																	0								ENSG00000069188						76.0	65.0	68.0					17																	71382003		2203	4299	6502	SDK2	SO:0001583	missense	0			-	HGNC	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.4552G>T	17.37:g.71382003C>A	ENSP00000376421:p.Val1518Leu	Somatic	0	26	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	24	38.46	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V1518L	ENST00000392650.3	37	c.4552	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707220	0.89018	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893	T;T;T	0.53857	0.6;0.6;0.6	4.57	4.57	0.56435	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.55577	0.1929	N	0.20881	0.62	0.58432	D	0.999996	D;P;D	0.69078	0.997;0.929;0.994	D;P;D	0.64687	0.928;0.79;0.928	T	0.49390	-0.8945	10	0.15066	T	0.55	.	17.3082	0.87201	0.0:1.0:0.0:0.0	.	1518;1518;1518	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	L	1142;1518;1518;694;1518	ENSP00000376421:V1518L;ENSP00000373378:V1518L;ENSP00000407098:V694L	ENSP00000324967:V1518L	V	-	1	0	SDK2	68893598	1.000000	0.71417	0.995000	0.50966	0.945000	0.59286	7.046000	0.76592	2.248000	0.74166	0.655000	0.94253	GTG	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.637	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	protein_coding	OTTHUMT00000327598.2	C	NM_019064	-		71382003	-1	no_errors	ENST00000392650	ensembl	human	known	74_37	missense	SNP	1.000	A
PCDH20	64881	genome.wustl.edu	37	13	61987993	61987994	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr13:61987993_61987994insC	ENST00000409186.1	-	5	2343_2344	c.238_239insG	c.(238-240)gtgfs	p.V80fs	PCDH20_ENST00000409204.4_Frame_Shift_Ins_p.V80fs			Q8N6Y1	PCD20_HUMAN	protocadherin 20	80	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		GCCGATGAGCACCCCCGCGGGT	0.663																																																	0								ENSG00000197991																																			PCDH20	SO:0001589	frameshift_variant	0				HGNC	AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.239dupG	13.37:g.61987998_61987998dupC	ENSP00000386653:p.Val80fs	Somatic	0	18	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V80fs	ENST00000409186.1	37	c.239_238	CCDS9442.2	13																																																																																			-	pfscan_Cadherin		0.663	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCDH20	protein_coding	OTTHUMT00000333054.2	-	NM_022843			61987994	-1	no_errors	ENST00000409186	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:0.994	C
DAPP1	27071	genome.wustl.edu	37	4	100756843	100756843	+	Silent	SNP	C	C	T	rs554960188		TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr4:100756843C>T	ENST00000512369.1	+	2	233	c.165C>T	c.(163-165)gaC>gaT	p.D55D	DAPP1_ENST00000296414.7_Silent_p.D55D	NM_014395.2	NP_055210.2	Q9UN19	DAPP1_HUMAN	dual adaptor of phosphotyrosine and 3-phosphoinositides	55	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|lung(4)	6				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)		ATGGATGTGACGGCAGCTACC	0.547																																																	0								ENSG00000070190						130.0	127.0	128.0					4																	100756843		2072	4203	6275	DAPP1	SO:0001819	synonymous_variant	0			-	HGNC	AF186022	CCDS47112.1	4q25-q27	2013-02-14			ENSG00000070190	ENSG00000070190		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	16500	protein-coding gene	gene with protein product		605768				10432293	Standard	NM_014395		Approved	BAM32	uc003hvf.4	Q9UN19	OTTHUMG00000160974	ENST00000512369.1:c.165C>T	4.37:g.100756843C>T		Somatic	0	41	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	12	45.45	Q8TCK5|Q9UHF2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SH2,pfam_Pleckstrin_homology,smart_SH2,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH2,prints_SH2	p.D55	ENST00000512369.1	37	c.165	CCDS47112.1	4																																																																																			-	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2		0.547	DAPP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DAPP1	protein_coding	OTTHUMT00000363215.1	C		-		100756843	+1	no_errors	ENST00000512369	ensembl	human	known	74_37	silent	SNP	0.976	T
MAP2K4	6416	genome.wustl.edu	37	17	12013743	12013743	+	Splice_Site	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr17:12013743G>A	ENST00000353533.5	+	6	748	c.685G>A	c.(685-687)Gat>Aat	p.D229N	MAP2K4_ENST00000415385.3_Splice_Site_p.D240N|MAP2K4_ENST00000581941.1_3'UTR	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	229	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		TATTCACAGAGGTGGGTATGG	0.313			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																			Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	11	Whole gene deletion(10)|Unknown(1)	ovary(4)|breast(4)|biliary_tract(1)|large_intestine(1)|pancreas(1)						ENSG00000065559						89.0	90.0	89.0					17																	12013743		2203	4299	6502	MAP2K4	SO:0001630	splice_region_variant	0			-	HGNC	L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.685+1G>A	17.37:g.12013743G>A		Somatic	0	148	0.00		0.6230499004162908	12	14.29	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	40	32.20	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D240N	ENST00000353533.5	37	c.718	CCDS11162.1	17	.	.	.	.	.	.	.	.	.	.	G	17.15	3.315198	0.60524	.	.	ENSG00000065559	ENST00000353533;ENST00000415385;ENST00000538465;ENST00000536413	D;D	0.92965	-3.14;-3.14	5.32	5.32	0.75619	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97204	0.9086	M	0.93507	3.425	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.99;0.997;0.998	D	0.98021	1.0371	10	0.87932	D	0	.	18.1455	0.89653	0.0:0.0:1.0:0.0	.	101;240;229	B7ZA62;P45985-2;P45985	.;.;MP2K4_HUMAN	N	229;240;206;101	ENSP00000262445:D229N;ENSP00000410402:D240N	ENSP00000262445:D229N	D	+	1	0	MAP2K4	11954468	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.110000	0.94302	2.639000	0.89480	0.557000	0.71058	GAT	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.313	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP2K4	protein_coding	OTTHUMT00000441226.1	G		-	Missense_Mutation	12013743	+1	no_errors	ENST00000415385	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC13A4	26266	genome.wustl.edu	37	7	135366355	135366355	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr7:135366355A>G	ENST00000354042.4	-	16	2526	c.1837T>C	c.(1837-1839)Tac>Cac	p.Y613H	C7orf73_ENST00000422968.1_Intron|SLC13A4_ENST00000491630.1_5'UTR	NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	613					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						CATGCTGGGTAAGTGTCCAGG	0.542																																																	0								ENSG00000164707						188.0	139.0	156.0					7																	135366355		2203	4300	6503	SLC13A4	SO:0001583	missense	0			-	HGNC	AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.1837T>C	7.37:g.135366355A>G	ENSP00000297282:p.Tyr613His	Somatic	0	66	0.00		0.6230499004162908	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	146	10.98	A4D1Q4|Q8N631	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom,pfam_DctM	p.Y613H	ENST00000354042.4	37	c.1837	CCDS5840.1	7	.	.	.	.	.	.	.	.	.	.	A	16.03	3.008063	0.54361	.	.	ENSG00000164707	ENST00000354042	T	0.68765	-0.35	5.11	5.11	0.69529	.	0.111999	0.64402	D	0.000008	T	0.65954	0.2741	M	0.63843	1.955	0.31021	N	0.718109	D;P	0.57571	0.98;0.856	B;B	0.44278	0.445;0.328	T	0.74144	-0.3760	10	0.62326	D	0.03	.	12.9197	0.58224	1.0:0.0:0.0:0.0	.	482;613	Q59HF0;Q9UKG4	.;S13A4_HUMAN	H	613	ENSP00000297282:Y613H	ENSP00000297282:Y613H	Y	-	1	0	SLC13A4	135016895	1.000000	0.71417	0.981000	0.43875	0.408000	0.30992	9.103000	0.94232	2.160000	0.67779	0.454000	0.30748	TAC	-	NULL		0.542	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A4	protein_coding	OTTHUMT00000340558.1	A	NM_012450	-		135366355	-1	no_errors	ENST00000354042	ensembl	human	known	74_37	missense	SNP	1.000	G
KIF13B	23303	genome.wustl.edu	37	8	28924925	28924925	+	3'UTR	DEL	A	A	-			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr8:28924925delA	ENST00000524189.1	-	0	8615				CTD-2647L4.5_ENST00000560714.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B						metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		ACAAGTCATTAGAGTCTTTGG	0.328																																																	0								ENSG00000259607																																			CTD-2647L4.5	SO:0001624	3_prime_UTR_variant	0				Clone_based_vega_gene	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.*3096T>-	8.37:g.28924925delA		Somatic	0	45	0.00		0.6230499004162908	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	11	15.38	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000524189.1	37	NULL	CCDS55217.1	8																																																																																			-	-		0.328	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000259607	protein_coding	OTTHUMT00000376878.1	A				28924925	+1	no_errors	ENST00000560714	ensembl	human	known	74_37	rna	DEL	0.899	-
MYBPC1	4604	genome.wustl.edu	37	12	102008351	102008351	+	Intron	SNP	A	A	G			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr12:102008351A>G	ENST00000550270.1	+	2	61				MYBPC1_ENST00000547405.1_Intron|MYBPC1_ENST00000551300.1_Intron|MYBPC1_ENST00000549145.1_Intron|MYBPC1_ENST00000547509.1_Intron|MYBPC1_ENST00000541119.1_Intron|MYBPC1_ENST00000361466.2_Intron|MYBPC1_ENST00000553190.1_Intron|MYBPC1_ENST00000392934.3_Intron|MYBPC1_ENST00000550501.1_3'UTR|MYBPC1_ENST00000452455.2_Intron|MYBPC1_ENST00000441232.1_Intron|MYBPC1_ENST00000545503.2_Intron|MYBPC1_ENST00000360610.2_Intron|MYBPC1_ENST00000361685.2_Intron|MYBPC1_ENST00000536007.1_Intron			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type						cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						GGCTGCAAATACAGAGGGTCC	0.502																																																	0								ENSG00000196091						54.0	47.0	50.0					12																	102008351		2203	4300	6503	MYBPC1	SO:0001627	intron_variant	0			-	HGNC		CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.61+42A>G	12.37:g.102008351A>G		Somatic	0	62	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	32	15.79	B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000550270.1	37	NULL	CCDS9085.1	12																																																																																			-	-		0.502	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYBPC1	protein_coding	OTTHUMT00000408806.1	A		-		102008351	+1	no_errors	ENST00000550501	ensembl	human	known	74_37	rna	SNP	0.003	G
RP11-1166P10.1	0	genome.wustl.edu	37	16	31993452	31993452	+	RNA	SNP	G	G	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr16:31993452G>T	ENST00000568570.1	+	0	262																											GCTGAGGACCGGGATGACATG	0.662																																																	0								ENSG00000260628																																			RP11-1166P10.1			0			-	Clone_based_vega_gene																													16.37:g.31993452G>T		Somatic	0	66	0.00		0.6230499004162908	17	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	33	20.93		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000568570.1	37	NULL		16																																																																																			-	-		0.662	RP11-1166P10.1-002	KNOWN	basic	processed_transcript	ENSG00000260628	pseudogene	OTTHUMT00000432457.1	G		-		31993452	+1	no_errors	ENST00000568570	ensembl	human	known	74_37	rna	SNP	1.000	T
AEBP2	121536	genome.wustl.edu	37	12	19667686	19667686	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr12:19667686T>A	ENST00000398864.3	+	7	1475	c.1449T>A	c.(1447-1449)gaT>gaA	p.D483E	AEBP2_ENST00000266508.9_Missense_Mutation_p.D483E|AEBP2_ENST00000541908.1_Missense_Mutation_p.D254E|AEBP2_ENST00000360995.4_Missense_Mutation_p.D267E	NM_001114176.1	NP_001107648.1	Q6ZN18	AEBP2_HUMAN	AE binding protein 2	483	Interaction with SUZ12.				chromatin modification (GO:0016568)	ESC/E(Z) complex (GO:0035098)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					TACCCAAAGATACTGCCTTGC	0.323																																																	0								ENSG00000139154						78.0	75.0	76.0					12																	19667686		1821	4079	5900	AEBP2	SO:0001583	missense	0			-	HGNC		CCDS44841.1, CCDS44842.1, CCDS58215.1	12p12.3	2012-10-02			ENSG00000139154	ENSG00000139154			24051	protein-coding gene	gene with protein product						10329662	Standard	NM_153207		Approved	MGC17922	uc001ref.2	Q6ZN18	OTTHUMG00000168906	ENST00000398864.3:c.1449T>A	12.37:g.19667686T>A	ENSP00000381840:p.Asp483Glu	Somatic	0	72	0.00		0.6230499004162908	10	66.67	20	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	13	53.57	Q59FS5|Q6ZN62|Q96BG3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D483E	ENST00000398864.3	37	c.1449	CCDS44841.1	12	.	.	.	.	.	.	.	.	.	.	T	17.30	3.354879	0.61293	.	.	ENSG00000139154	ENST00000541908;ENST00000398864;ENST00000435841;ENST00000266508;ENST00000360995;ENST00000512223;ENST00000398731	T;T;T;T	0.69926	-0.25;-0.33;-0.44;-0.19	5.79	2.09	0.27110	.	.	.	.	.	T	0.70666	0.3250	L	0.39898	1.24	0.40415	D	0.979782	D	0.64830	0.994	D	0.72625	0.978	T	0.66685	-0.5861	9	0.37606	T	0.19	.	9.825	0.40905	0.0:0.2504:0.0:0.7496	.	483	Q6ZN18	AEBP2_HUMAN	E	254;483;417;483;267;93;81	ENSP00000437983:D254E;ENSP00000381840:D483E;ENSP00000266508:D483E;ENSP00000354267:D267E	ENSP00000266508:D483E	D	+	3	2	AEBP2	19558953	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.670000	0.46833	0.454000	0.26884	0.524000	0.50904	GAT	-	NULL		0.323	AEBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AEBP2	protein_coding	OTTHUMT00000401575.1	T	NM_153207	-		19667686	+1	no_errors	ENST00000398864	ensembl	human	known	74_37	missense	SNP	1.000	A
PHKA1	5255	genome.wustl.edu	37	X	71932722	71932722	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chrX:71932722C>G	ENST00000373542.4	-	2	295	c.136G>C	c.(136-138)Gat>Cat	p.D46H	PHKA1_ENST00000339490.3_Missense_Mutation_p.D46H|PHKA1_ENST00000541944.1_Missense_Mutation_p.D46H|PHKA1_ENST00000373539.3_Missense_Mutation_p.D46H|PHKA1-AS1_ENST00000420998.1_RNA|PHKA1_ENST00000373545.3_Missense_Mutation_p.D46H	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	46					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					TACACATTATCTCGGACCCAA	0.507																																																	0								ENSG00000067177						68.0	56.0	60.0					X																	71932722		2203	4300	6503	PHKA1	SO:0001583	missense	0			-	HGNC		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.136G>C	X.37:g.71932722C>G	ENSP00000362643:p.Asp46His	Somatic	0	53	0.00		0.6230499004162908	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	22	24.14	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.D46H	ENST00000373542.4	37	c.136	CCDS14421.1	X	.	.	.	.	.	.	.	.	.	.	C	24.4	4.531812	0.85706	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.99905	-7.71;-7.71;-7.71;-7.71;-7.71	4.67	4.67	0.58626	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.046059	0.85682	D	0.000000	D	0.99921	0.9963	H	0.94306	3.52	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;1.0	D	0.95864	0.8885	10	0.87932	D	0	-9.1022	14.0737	0.64877	0.0:1.0:0.0:0.0	.	46;46;46	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	H	46	ENSP00000362646:D46H;ENSP00000362643:D46H;ENSP00000441251:D46H;ENSP00000342469:D46H;ENSP00000362640:D46H	ENSP00000342469:D46H	D	-	1	0	PHKA1	71849447	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.521000	0.81832	2.284000	0.76573	0.600000	0.82982	GAT	-	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like		0.507	PHKA1-001	KNOWN	basic|CCDS	protein_coding	PHKA1	protein_coding	OTTHUMT00000058896.1	C		-		71932722	-1	no_errors	ENST00000373539	ensembl	human	known	74_37	missense	SNP	1.000	G
TBC1D22B	55633	genome.wustl.edu	37	6	37247153	37247153	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr6:37247153G>T	ENST00000373491.3	+	3	333	c.187G>T	c.(187-189)Gca>Tca	p.A63S		NM_017772.2	NP_060242.2	Q9NU19	TB22B_HUMAN	TBC1 domain family, member 22B	63							Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|prostate(1)	15			OV - Ovarian serous cystadenocarcinoma(102;0.241)			TCATGAGTTTGCACGGAATAC	0.418																																																	0								ENSG00000065491						151.0	142.0	145.0					6																	37247153		2203	4300	6503	TBC1D22B	SO:0001583	missense	0			-	HGNC	AK096340	CCDS4832.1	6p21.2	2005-01-05	2005-01-05	2005-01-05	ENSG00000065491	ENSG00000065491			21602	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 197"""	C6orf197			Standard	NM_017772		Approved	FLJ20337, dJ744I24.2	uc003onn.3	Q9NU19	OTTHUMG00000014619	ENST00000373491.3:c.187G>T	6.37:g.37247153G>T	ENSP00000362590:p.Ala63Ser	Somatic	0	62	0.00		0.6230499004162908	11	38.89	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	39	22.00	A8KA28|Q32MQ8|Q5VUK9|Q6P4C3|Q7Z6P7|Q9BPV6|Q9BUT5|Q9NXB6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.A63S	ENST00000373491.3	37	c.187	CCDS4832.1	6	.	.	.	.	.	.	.	.	.	.	G	20.4	3.983741	0.74474	.	.	ENSG00000065491	ENST00000373491	D	0.88431	-2.38	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.82522	0.5055	M	0.62723	1.935	0.80722	D	1	B	0.32051	0.354	B	0.29353	0.101	T	0.80612	-0.1305	10	0.21540	T	0.41	.	18.6505	0.91429	0.0:0.0:1.0:0.0	.	63	Q9NU19	TB22B_HUMAN	S	63	ENSP00000362590:A63S	ENSP00000362590:A63S	A	+	1	0	TBC1D22B	37355131	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.416000	0.97383	2.766000	0.95052	0.655000	0.94253	GCA	-	NULL		0.418	TBC1D22B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D22B	protein_coding	OTTHUMT00000040402.1	G	NM_017772	-		37247153	+1	no_errors	ENST00000373491	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC9A8	23315	genome.wustl.edu	37	20	48467301	48467301	+	Intron	DEL	T	T	-	rs564652819		TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr20:48467301delT	ENST00000361573.2	+	7	576				SLC9A8_ENST00000541138.1_Intron|SLC9A8_ENST00000539601.1_Intron|SLC9A8_ENST00000417961.1_Frame_Shift_Del_p.G179fs			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8						ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			TTCTCCAGGGTTTTTTTTTTG	0.333																																																	0								ENSG00000197818			105,169,3990		0,0,105,2,165,1860	46.0	46.0	46.0			3.5	0.9	20		47	200,298,7756		0,0,200,6,286,3635	no	intron	SLC9A8	NM_015266.1		0,0,305,8,451,5495	A1A1,A1A2,A1R,A2A2,A2R,RR		6.0334,6.4259,6.1671			48467301	305,467,11746	2203	4300	6503	SLC9A8	SO:0001627	intron_variant	0				HGNC	AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.535-46T>-	20.37:g.48467301delT		Somatic	0	19	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	15	28.57	B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Cation/H_exchanger,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.F182fs	ENST00000361573.2	37	c.537	CCDS13421.1	20																																																																																			-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger		0.333	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A8	protein_coding	OTTHUMT00000106483.3	T	XM_030524			48467301	+1	no_errors	ENST00000417961	ensembl	human	known	74_37	frame_shift_del	DEL	0.189	-
PCLO	27445	genome.wustl.edu	37	7	82582943	82582944	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr7:82582943_82582944insT	ENST00000333891.9	-	5	7662_7663	c.7325_7326insA	c.(7324-7326)aagfs	p.K2442fs	PCLO_ENST00000423517.2_Frame_Shift_Ins_p.K2442fs|PCLO_ENST00000437081.1_5'Flank	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.K2442N(2)|p.K2373N(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CAACTGTTAACTTTTTTTTAGG	0.495																																																	3	Substitution - Missense(3)	haematopoietic_and_lymphoid_tissue(3)						ENSG00000186472																																			PCLO	SO:0001589	frameshift_variant	0				HGNC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.7326dupA	7.37:g.82582951_82582951dupT	ENSP00000334319:p.Lys2442fs	Somatic	0	44	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67		Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.L2443fs	ENST00000333891.9	37	c.7326_7325	CCDS47630.1	7																																																																																			-	NULL		0.495	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	protein_coding	OTTHUMT00000337368.5	-	NM_014510			82582944	-1	no_errors	ENST00000333891	ensembl	human	known	74_37	frame_shift_ins	INS	0.096:0.984	T
TMEM132A	54972	genome.wustl.edu	37	11	60704165	60704165	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr11:60704165G>A	ENST00000453848.2	+	11	3016	c.2858G>A	c.(2857-2859)cGa>cAa	p.R953Q	TMEM132A_ENST00000005286.4_Missense_Mutation_p.R954Q			Q24JP5	T132A_HUMAN	transmembrane protein 132A	953	Confers cellular localization similar to full-length form. {ECO:0000250}.					endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						ACCCTGGCCCGAAAGGAGGCT	0.697																																																	0								ENSG00000006118						10.0	14.0	13.0					11																	60704165		2179	4278	6457	TMEM132A	SO:0001583	missense	0			-	HGNC	AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.2858G>A	11.37:g.60704165G>A	ENSP00000405823:p.Arg953Gln	Somatic	0	41	0.00		0.6230499004162908	78	29.73	33	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	22	21.43	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R954Q	ENST00000453848.2	37	c.2861	CCDS44618.1	11	.	.	.	.	.	.	.	.	.	.	G	16.90	3.250416	0.59212	.	.	ENSG00000006118	ENST00000444690;ENST00000453848;ENST00000005286	T;T	0.05925	3.37;3.37	4.55	4.55	0.56014	.	0.250281	0.28047	N	0.016809	T	0.09992	0.0245	L	0.53249	1.67	0.29495	N	0.85534	P;P	0.52061	0.95;0.95	B;B	0.42798	0.398;0.398	T	0.02661	-1.1127	10	0.87932	D	0	-20.3357	15.6405	0.76997	0.0:0.0:1.0:0.0	.	953;954	Q24JP5;Q24JP5-2	T132A_HUMAN;.	Q	704;953;954	ENSP00000405823:R953Q;ENSP00000005286:R954Q	ENSP00000005286:R954Q	R	+	2	0	TMEM132A	60460741	0.943000	0.32029	0.992000	0.48379	0.953000	0.61014	2.611000	0.46334	2.537000	0.85549	0.655000	0.94253	CGA	-	NULL		0.697	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	TMEM132A	protein_coding	OTTHUMT00000396352.1	G	NM_017870	-		60704165	+1	no_errors	ENST00000005286	ensembl	human	known	74_37	missense	SNP	0.905	A
KNDC1	85442	genome.wustl.edu	37	10	134980985	134980985	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr10:134980985G>C	ENST00000304613.3	+	2	224	c.203G>C	c.(202-204)aGc>aCc	p.S68T	KNDC1_ENST00000530127.1_3'UTR|KNDC1_ENST00000368571.2_Missense_Mutation_p.S3T|KNDC1_ENST00000368572.2_Missense_Mutation_p.S68T			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	68	KIND 1. {ECO:0000255|PROSITE- ProRule:PRU00709}.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TCCATGCGGAGCGTGGCCCAC	0.657																																																	0								ENSG00000171798						43.0	33.0	36.0					10																	134980985		2199	4298	6497	KNDC1	SO:0001583	missense	0			-	HGNC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.203G>C	10.37:g.134980985G>C	ENSP00000304437:p.Ser68Thr	Somatic	0	56	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	21	41.67	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,superfamily_Kinase-like_dom,smart_KIND,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.S68T	ENST00000304613.3	37	c.203	CCDS7674.1	10	.	.	.	.	.	.	.	.	.	.	.	13.72	2.322190	0.41096	.	.	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.73575	-0.76;-0.76;1.0	4.05	3.14	0.36123	KIND (2);	0.140304	0.44483	D	0.000444	T	0.81498	0.4835	M	0.62723	1.935	0.40708	D	0.982546	D;D	0.71674	0.998;0.996	D;D	0.70935	0.971;0.966	T	0.82002	-0.0673	10	0.87932	D	0	-9.6631	9.4479	0.38708	0.1089:0.0:0.8911:0.0	.	3;68	Q76NI1-2;Q76NI1	.;VKIND_HUMAN	T	68;68;3	ENSP00000304437:S68T;ENSP00000357561:S68T;ENSP00000357560:S3T	ENSP00000304437:S68T	S	+	2	0	KNDC1	134830975	1.000000	0.71417	0.123000	0.21794	0.016000	0.09150	9.236000	0.95360	0.826000	0.34661	0.313000	0.20887	AGC	-	smart_KIND		0.657	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	KNDC1	protein_coding	OTTHUMT00000277044.3	G	NM_152643	-		134980985	+1	no_errors	ENST00000368572	ensembl	human	known	74_37	missense	SNP	1.000	C
NAT1	9	genome.wustl.edu	37	8	18080367	18080367	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr8:18080367delT	ENST00000517492.1	+	3	1449	c.811delT	c.(811-813)tttfs	p.F271fs	NAT1_ENST00000539092.1_Frame_Shift_Del_p.F271fs|NAT1_ENST00000545197.1_Frame_Shift_Del_p.F333fs|NAT1_ENST00000307719.4_Frame_Shift_Del_p.F271fs|NAT1_ENST00000520546.1_Frame_Shift_Del_p.F271fs|NAT1_ENST00000541942.1_Frame_Shift_Del_p.F271fs|NAT1_ENST00000518029.1_Frame_Shift_Del_p.F271fs|NAT1_ENST00000535084.1_Frame_Shift_Del_p.F271fs			Q8IZM9	S38A6_HUMAN	N-acetyltransferase 1 (arylamine N-acetyltransferase)	0					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(2)|urinary_tract(1)	9				Colorectal(111;0.0519)|COAD - Colon adenocarcinoma(73;0.208)		GAAAAATATATTTAATATTTC	0.333																																																	0								ENSG00000171428						30.0	33.0	32.0					8																	18080367		2196	4299	6495	NAT1	SO:0001589	frameshift_variant	0				HGNC	BC047666	CCDS6007.1, CCDS55205.1	8p22	2012-01-18			ENSG00000171428	ENSG00000171428	2.3.1.5		7645	protein-coding gene	gene with protein product		108345		AAC1		7773298	Standard	NM_001160174		Approved		uc003wyt.3	P18440	OTTHUMG00000097001	ENST00000517492.1:c.811delT	8.37:g.18080367delT	ENSP00000429407:p.Phe271fs	Somatic	0	76	0.00		0.6230499004162908	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	C9JWA6|Q86SY5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Arylamine_N-AcTrfase,prints_Arylamine_N-AcTrfase	p.F333fs	ENST00000517492.1	37	c.997	CCDS6007.1	8																																																																																			-	pfam_Arylamine_N-AcTrfase,prints_Arylamine_N-AcTrfase		0.333	NAT1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NAT1	protein_coding	OTTHUMT00000374828.1	T	NM_000662			18080367	+1	no_errors	ENST00000545197	ensembl	human	known	74_37	frame_shift_del	DEL	0.982	-
SYPL2	284612	genome.wustl.edu	37	1	110019410	110019410	+	Silent	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr1:110019410C>T	ENST00000369872.3	+	4	483	c.267C>T	c.(265-267)atC>atT	p.I89I	SYPL2_ENST00000401021.3_Silent_p.I89I|SYPL2_ENST00000475497.1_3'UTR	NM_001040709.1	NP_001035799.1	Q5VXT5	SYPL2_HUMAN	synaptophysin-like 2	89	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cellular calcium ion homeostasis (GO:0006874)|substantia nigra development (GO:0021762)	integral component of synaptic vesicle membrane (GO:0030285)	transporter activity (GO:0005215)	p.I89I(2)		breast(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	16		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0436)|READ - Rectum adenocarcinoma(129;0.0698)|Epithelial(280;0.0808)|all cancers(265;0.0869)|LUSC - Lung squamous cell carcinoma(189;0.231)		TGCACCGGATCCAATATGAGA	0.592																																																	2	Substitution - coding silent(2)	lung(2)						ENSG00000143028						56.0	60.0	59.0					1																	110019410		2031	4184	6215	SYPL2	SO:0001819	synonymous_variant	0			-	HGNC	AK131459	CCDS41365.1	1p13.3	2008-02-05			ENSG00000143028	ENSG00000143028			27638	protein-coding gene	gene with protein product	"""mitsugumin-29"""					12975309	Standard	NM_001040709		Approved	Mg29	uc001dxp.3	Q5VXT5	OTTHUMG00000010969	ENST00000369872.3:c.267C>T	1.37:g.110019410C>T		Somatic	0	18	0.00		0.6230499004162908	3	40.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	23	30.30	A8K0E8|A8KAL7|I0IT67|Q6ZMX1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Marvel,prints_Synaptophysin/porin	p.I89	ENST00000369872.3	37	c.267	CCDS41365.1	1																																																																																			-	pfam_Marvel		0.592	SYPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYPL2	protein_coding	OTTHUMT00000030191.1	C	NM_001006603	-		110019410	+1	no_errors	ENST00000369872	ensembl	human	known	74_37	silent	SNP	0.927	T
GPR55	9290	genome.wustl.edu	37	2	231775273	231775273	+	Silent	SNP	G	G	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr2:231775273G>T	ENST00000392040.1	-	2	597	c.405C>A	c.(403-405)ccC>ccA	p.P135P	GPR55_ENST00000392039.2_Silent_p.P135P|AC012507.4_ENST00000454890.1_RNA	NM_005683.3	NP_005674.2	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	135					activation of phospholipase C activity (GO:0007202)|bone resorption (GO:0045453)|cannabinoid signaling pathway (GO:0038171)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho protein signal transduction (GO:0035025)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|G-protein coupled receptor activity (GO:0004930)	p.P135P(1)		endometrium(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		AGATCTTCCTGGGGGACCGGA	0.542																																																	1	Substitution - coding silent(1)	lung(1)						ENSG00000135898						51.0	50.0	51.0					2																	231775273		2203	4300	6503	GPR55	SO:0001819	synonymous_variant	0			-	HGNC	AF096786	CCDS2480.1	2q37	2012-08-21			ENSG00000135898	ENSG00000135898		"""GPCR / Class A : Orphans"""	4511	protein-coding gene	gene with protein product		604107				9931487	Standard	NM_005683		Approved		uc002vrg.3	Q9Y2T6	OTTHUMG00000133224	ENST00000392040.1:c.405C>A	2.37:g.231775273G>T		Somatic	0	47	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	Q8N580	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.P135	ENST00000392040.1	37	c.405	CCDS2480.1	2																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.542	GPR55-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR55	protein_coding	OTTHUMT00000332618.1	G	NM_005683	-		231775273	-1	no_errors	ENST00000392039	ensembl	human	known	74_37	silent	SNP	0.948	T
MYO3A	53904	genome.wustl.edu	37	10	26463350	26463350	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr10:26463350T>C	ENST00000265944.5	+	30	4323	c.4157T>C	c.(4156-4158)gTa>gCa	p.V1386A	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1386					ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						CCAACAGAAGTAGCAAGAAAC	0.388																																																	0								ENSG00000095777						141.0	132.0	135.0					10																	26463350		2203	4300	6503	MYO3A	SO:0001583	missense	0			-	HGNC	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.4157T>C	10.37:g.26463350T>C	ENSP00000265944:p.Val1386Ala	Somatic	0	60	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	40	24.53	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_dom,prints_Myosin_head_motor_dom	p.V1386A	ENST00000265944.5	37	c.4157	CCDS7148.1	10	.	.	.	.	.	.	.	.	.	.	T	7.436	0.639771	0.14386	.	.	ENSG00000095777	ENST00000265944	T	0.76060	-0.99	5.94	-3.72	0.04411	.	0.872750	0.10166	N	0.707700	T	0.51415	0.1673	N	0.22421	0.69	0.24330	N	0.995003	B	0.02656	0.0	B	0.04013	0.001	T	0.39603	-0.9606	10	0.09338	T	0.73	.	7.6591	0.28392	0.0:0.381:0.4178:0.2012	.	1386	Q8NEV4	MYO3A_HUMAN	A	1386	ENSP00000265944:V1386A	ENSP00000265944:V1386A	V	+	2	0	MYO3A	26503356	0.006000	0.16342	0.018000	0.16275	0.400000	0.30750	-0.524000	0.06222	-0.677000	0.05231	-0.376000	0.06991	GTA	-	NULL		0.388	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO3A	protein_coding	OTTHUMT00000047259.1	T	NM_017433	-		26463350	+1	no_errors	ENST00000265944	ensembl	human	known	74_37	missense	SNP	0.063	C
LINC01159	102682016	genome.wustl.edu	37	2	105484676	105484676	+	RNA	SNP	C	C	G			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr2:105484676C>G	ENST00000433433.1	-	0	381				AC018730.3_ENST00000434764.1_RNA|RP11-13J10.1_ENST00000598623.1_RNA|AC018730.4_ENST00000454183.1_RNA																							GTGGGAGAGGCGCTGCTCTGG	0.652																																																	0								ENSG00000229743																																			AC018730.3			0			-	Clone_based_vega_gene																													2.37:g.105484676C>G		Somatic	0	50	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	14	54.84		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000433433.1	37	NULL		2																																																																																			-	-		0.652	AC018730.3-001	KNOWN	basic	antisense	ENSG00000229743	antisense	OTTHUMT00000329325.1	C		-		105484676	-1	no_errors	ENST00000433433	ensembl	human	known	74_37	rna	SNP	0.002	G
MLLT4	4301	genome.wustl.edu	37	6	168366692	168366694	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr6:168366692_168366694delGAG	ENST00000447894.2	+	31	5203_5205	c.5203_5205delGAG	c.(5203-5205)gagdel	p.E1740del	MLLT4_ENST00000366806.2_In_Frame_Del_p.E1740del|MLLT4_ENST00000392112.1_Intron|MLLT4_ENST00000351017.4_In_Frame_Del_p.E1747del|MLLT4_ENST00000400822.3_In_Frame_Del_p.E1750del			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	1740					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		TGCATACAATgaggaggaggagg	0.581			T	MLL	AL																																			Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	0								ENSG00000130396			35,2895		2,31,1432						1.1	0.0			7	53,5815		5,43,2886	no	intron	MLLT4	NM_001207008.1		7,74,4318	A1A1,A1R,RR		0.9032,1.1945,1.0002				88,8710				MLLT4	SO:0001651	inframe_deletion	0				HGNC	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.5203_5205delGAG	6.37:g.168366701_168366703delGAG	ENSP00000404595:p.Glu1740del	Somatic	0	47	0.00		0.6230499004162908	21	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	23	17.86	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ras-assoc,pfam_Dil_domain,pfam_PDZ,pfam_FHA_dom,superfamily_PDZ,superfamily_SMAD_FHA_domain,smart_Ras-assoc,smart_FHA_dom,smart_PDZ,pfscan_Dilute,pfscan_PDZ,pfscan_Ras-assoc	p.E1738in_frame_del	ENST00000447894.2	37	c.5203_5205		6																																																																																			-	NULL		0.581	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	MLLT4	protein_coding	OTTHUMT00000372077.1	GAG	NM_005936			168366694	+1	no_errors	ENST00000366806	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
MET	4233	genome.wustl.edu	37	7	116339237	116339237	+	Silent	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr7:116339237C>T	ENST00000318493.6	+	2	286	c.99C>T	c.(97-99)tcC>tcT	p.S33S	MET_ENST00000397752.3_Silent_p.S33S|MET_ENST00000436117.2_Silent_p.S33S			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TAGCAAAGTCCGAGATGAATG	0.498			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																															Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	0								ENSG00000105976						91.0	90.0	90.0					7																	116339237		1964	4165	6129	MET	SO:0001819	synonymous_variant	0	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	-	HGNC	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.99C>T	7.37:g.116339237C>T		Somatic	0	70	0.00		0.6230499004162908	42	68.61	94	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	33	53.52	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Semap_dom,pfscan_Prot_kinase_dom	p.S33	ENST00000318493.6	37	c.99	CCDS47689.1	7																																																																																			-	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfscan_Semap_dom		0.498	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MET	protein_coding	OTTHUMT00000059620.3	C		-		116339237	+1	no_errors	ENST00000318493	ensembl	human	known	74_37	silent	SNP	0.005	T
PTTG1IP	754	genome.wustl.edu	37	21	46276273	46276276	+	Frame_Shift_Del	DEL	AAGT	AAGT	-			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	AAGT	AAGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr21:46276273_46276276delAAGT	ENST00000330938.3	-	4	501_504	c.281_284delACTT	c.(280-285)aactttfs	p.NF94fs	PTTG1IP_ENST00000494690.1_5'UTR|PTTG1IP_ENST00000397886.3_Frame_Shift_Del_p.NF73fs|PTTG1IP_ENST00000445724.2_Intron|PTTG1IP_ENST00000397887.3_Intron	NM_004339.3	NP_004330.1	P53801	PTTG_HUMAN	pituitary tumor-transforming 1 interacting protein	94					multicellular organismal development (GO:0007275)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	receptor activity (GO:0004872)			ovary(1)|prostate(1)	2				Colorectal(79;0.0659)		CAGCGCCTCAAAGTTCACTGGAGA	0.613																																																	0								ENSG00000183255																																			PTTG1IP	SO:0001589	frameshift_variant	0				HGNC	AF149785	CCDS13715.1, CCDS68221.1	21q22.3	2008-07-04			ENSG00000183255	ENSG00000183255			13524	protein-coding gene	gene with protein product		603784		C21orf3, C21orf1		9570958, 10830953	Standard	NM_004339		Approved	PBF	uc002zgb.2	P53801	OTTHUMG00000090254	ENST00000330938.3:c.281_284delACTT	21.37:g.46276273_46276276delAAGT	ENSP00000328325:p.Asn94fs	Somatic	0	45	0.00		0.6230499004162908	344	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	B2RDP7|D3DSL9|Q9NS09	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	smart_Plexin-like_fold	p.N94fs	ENST00000330938.3	37	c.284_281	CCDS13715.1	21																																																																																			-	NULL		0.613	PTTG1IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTTG1IP	protein_coding	OTTHUMT00000206553.1	AAGT				46276276	-1	no_errors	ENST00000330938	ensembl	human	known	74_37	frame_shift_del	DEL	0.995:1.000:1.000:1.000	-
WWC1	23286	genome.wustl.edu	37	5	167894900	167894900	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr5:167894900delC	ENST00000265293.4	+	22	3708	c.3206delC	c.(3205-3207)gcafs	p.A1071fs	WWC1_ENST00000521089.1_Frame_Shift_Del_p.A1077fs	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	1071	Interaction with histone H3.				cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		ATGATGAGGGCAGCTGCCAAG	0.612																																																	0								ENSG00000113645						80.0	78.0	79.0					5																	167894900		2203	4300	6503	WWC1	SO:0001589	frameshift_variant	0				HGNC	AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.3206delC	5.37:g.167894900delC	ENSP00000265293:p.Ala1071fs	Somatic	0	49	0.00		0.6230499004162908	11	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_WW_dom,superfamily_C2_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.A1069fs	ENST00000265293.4	37	c.3206	CCDS4366.1	5																																																																																			-	NULL		0.612	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WWC1	protein_coding	OTTHUMT00000252791.2	C	NM_015238			167894900	+1	no_errors	ENST00000265293	ensembl	human	known	74_37	frame_shift_del	DEL	0.970	-
BET1	10282	genome.wustl.edu	37	7	93605300	93605300	+	5'UTR	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr7:93605300G>A	ENST00000471446.1	-	0	169				AC006378.2_ENST00000426193.2_RNA|AC006378.2_ENST00000426634.1_RNA			O15155	BET1_HUMAN	Bet1 golgi vesicular membrane trafficking protein						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)|vesicle fusion with Golgi apparatus (GO:0048280)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				large_intestine(2)|lung(1)|prostate(1)|skin(1)	5	all_cancers(62;2.22e-10)|all_epithelial(64;1.38e-09)|Lung NSC(181;0.218)	Breast(660;0.000162)|Ovarian(593;0.000626)	STAD - Stomach adenocarcinoma(171;0.000967)			AGATGGCACTGAAAGTAAGCC	0.388																																																	0								ENSG00000105829																																			BET1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF007551	CCDS5635.1	7q21.1-q22	2013-03-08	2013-03-08		ENSG00000105829	ENSG00000105829			14562	protein-coding gene	gene with protein product	"""Golgi vesicular membrane trafficking protein p18"", ""Bet1p homolog"""	605456	"""Bet1 (S. cerevisiae) homolog"", ""BET1 homolog (S. cerevisiae)"", ""blocked early in transport 1 homolog (S. cerevisiae)"""			9382863, 10449330	Standard	XM_005250109		Approved	hbet1	uc003unf.1	O15155	OTTHUMG00000023487	ENST00000471446.1:c.-366C>T	7.37:g.93605300G>A		Somatic	0	59	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	34	47.69	Q96EA0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_T_SNARE_dom,pfscan_T_SNARE_dom	p.F116	ENST00000471446.1	37	c.348		7																																																																																			-	NULL		0.388	BET1-006	KNOWN	basic	processed_transcript	BET1	protein_coding	OTTHUMT00000341560.1	G	NM_005868	-		93605300	-1	no_errors	ENST00000357520	ensembl	human	known	74_37	silent	SNP	0.136	A
RP11-105C19.2	0	genome.wustl.edu	37	16	22623130	22623130	+	lincRNA	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr16:22623130G>A	ENST00000567401.1	-	0	387				RP11-105C19.1_ENST00000566098.1_lincRNA																							ACATAGGTGAGCTACAGATGG	0.393																																																	0								ENSG00000260973																																			RP11-105C19.2			0			-	Clone_based_vega_gene																													16.37:g.22623130G>A		Somatic	0	49	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	34	17.07		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000567401.1	37	NULL		16																																																																																			-	-		0.393	RP11-105C19.2-001	KNOWN	basic	lincRNA	ENSG00000260973	lincRNA	OTTHUMT00000434000.1	G		-		22623130	-1	no_errors	ENST00000567401	ensembl	human	known	74_37	rna	SNP	0.395	A
IGFN1	91156	genome.wustl.edu	37	1	201181230	201181230	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr1:201181230G>T	ENST00000335211.4	+	12	7339	c.7209G>T	c.(7207-7209)aaG>aaT	p.K2403N	IGFN1_ENST00000295591.8_5'UTR|IGFN1_ENST00000451870.2_Intron	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CGAACTCCAAGGATGGTCCAG	0.592																																																	0								ENSG00000163395						31.0	28.0	29.0					1																	201181230		692	1591	2283	IGFN1	SO:0001583	missense	0			-	HGNC	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.7209G>T	1.37:g.201181230G>T	ENSP00000334714:p.Lys2403Asn	Somatic	0	28	0.00		0.6230499004162908	35	5.41	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	6	66.67	F8WAI1|Q9NT72	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.K2403N	ENST00000335211.4	37	c.7209	CCDS53455.1	1	.	.	.	.	.	.	.	.	.	.	g	13.08	2.129812	0.37630	.	.	ENSG00000163395	ENST00000335211	T	0.59224	0.28	2.73	-0.748	0.11087	.	.	.	.	.	T	0.31638	0.0803	N	0.08118	0	0.09310	N	0.999999	.	.	.	.	.	.	T	0.23440	-1.0188	6	.	.	.	.	7.3829	0.26866	0.4783:0.0:0.5217:0.0	.	.	.	.	N	2403	ENSP00000334714:K2403N	.	K	+	3	2	IGFN1	199447853	0.001000	0.12720	0.000000	0.03702	0.082000	0.17680	0.348000	0.20031	-0.112000	0.11979	0.298000	0.19748	AAG	-	NULL		0.592	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	protein_coding		G	NM_178275	-		201181230	+1	no_errors	ENST00000335211	ensembl	human	known	74_37	missense	SNP	0.000	T
RASGRP2	10235	genome.wustl.edu	37	11	64508388	64508388	+	Intron	DEL	C	C	-			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr11:64508388delC	ENST00000354024.3	-	5	624				RASGRP2_ENST00000377489.1_Frame_Shift_Del_p.A135fs|RASGRP2_ENST00000377486.3_Frame_Shift_Del_p.A135fs|RASGRP2_ENST00000377494.1_Intron|RASGRP2_ENST00000394429.1_3'UTR|RASGRP2_ENST00000394430.1_Frame_Shift_Del_p.A135fs|RASGRP2_ENST00000394428.1_3'UTR|RASGRP2_ENST00000377497.3_Intron|RASGRP2_ENST00000394432.3_Intron|RASGRP2_ENST00000377487.1_Frame_Shift_Del_p.A135fs	NM_153819.1	NP_722541.1	Q7LDG7	GRP2_HUMAN	RAS guanyl releasing protein 2 (calcium and DAG-regulated)						blood coagulation (GO:0007596)|cellular response to calcium ion (GO:0071277)|platelet activation (GO:0030168)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ATACTGAGTGCCCCCCCAGCC	0.532											OREG0004006	type=REGULATORY REGION|Gene=RASGRP2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0								ENSG00000068831		,,	12,4252		4,4,2124	53.0	44.0	47.0		,,	-0.4	0.0	11		47	34,8220		15,4,4108	no	intron,intron,intron	RASGRP2	NM_153819.1,NM_001098671.1,NM_001098670.1	,,	19,8,6232	A1A1,A1R,RR		0.4119,0.2814,0.3675	,,	,,	64508388	46,12472	2201	4297	6498	RASGRP2	SO:0001627	intron_variant	0				HGNC	U78170	CCDS31598.1	11q13	2014-09-17			ENSG00000068831	ENSG00000068831		"""EF-hand domain containing"""	9879	protein-coding gene	gene with protein product		605577				9789079	Standard	NM_001098670		Approved	CALDAG-GEFI	uc009ypv.3	Q7LDG7	OTTHUMG00000045420	ENST00000354024.3:c.371+31G>-	11.37:g.64508388delC		Somatic	0	24	0.00	1077	0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	A6NDC7|O00538|Q9UL65	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,pfscan_Ras-like_Gua-exchang_fac_N	p.A135fs	ENST00000354024.3	37	c.403	CCDS31598.1	11																																																																																			-	NULL		0.532	RASGRP2-002	NOVEL	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	RASGRP2	protein_coding	OTTHUMT00000142062.1	C	NM_153819			64508388	-1	no_errors	ENST00000377486	ensembl	human	putative	74_37	frame_shift_del	DEL	0.001	-
OPN1SW	611	genome.wustl.edu	37	7	128415802	128415802	+	Missense_Mutation	SNP	T	T	G	rs200504235		TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr7:128415802T>G	ENST00000249389.2	-	1	42	c.43A>C	c.(43-45)Atc>Ctc	p.I15L		NM_001708.2	NP_001699.1	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive	15					phototransduction (GO:0007602)|phototransduction, visible light (GO:0007603)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)|receptor activity (GO:0004872)			NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|stomach(1)	19						ACTGAAGAGATATTTTTGAAC	0.522													T|||	1	0.000199681	0.0008	0.0	5008	,	,		17509	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000128617	T	LEU/ILE	1,4405	2.1+/-5.4	0,1,2202	55.0	60.0	59.0		43	-0.3	0.4	7		59	0,8600		0,0,4300	yes	missense	OPN1SW	NM_001708.2	5	0,1,6502	GG,GT,TT		0.0,0.0227,0.0077	benign	15/349	128415802	1,13005	2203	4300	6503	OPN1SW	SO:0001583	missense	0			GMAF=0.0005	HGNC	U53874	CCDS5806.1	7q31.3-q32	2013-01-08	2008-04-16		ENSG00000128617	ENSG00000128617		"""GPCR / Class A : Opsin receptors"""	1012	protein-coding gene	gene with protein product	"""color blindness, tritan"", ""blue-sensitive opsin"""	613522	"""blue cone photoreceptor pigment"""	BCP		2937147, 8270261	Standard	NM_001708		Approved	BOP, CBT	uc003vnt.4	P03999	OTTHUMG00000158311	ENST00000249389.2:c.43A>C	7.37:g.128415802T>G	ENSP00000249389:p.Ile15Leu	Somatic	0	59	0.00		0.6230499004162908	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	80	25.93	Q13877	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Opsin_blue,prints_GPCR_Rhodpsn,prints_Opsin	p.I15L	ENST00000249389.2	37	c.43	CCDS5806.1	7	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	T	5.561	0.288291	0.10513	2.27E-4	0.0	ENSG00000128617	ENST00000249389	T	0.36157	1.27	4.87	-0.303	0.12792	.	0.716386	0.14218	N	0.333594	T	0.23926	0.0579	L	0.44542	1.39	0.27052	N	0.963752	B	0.02656	0.0	B	0.06405	0.002	T	0.18999	-1.0319	10	0.26408	T	0.33	.	4.7141	0.12887	0.0:0.2685:0.3506:0.3809	.	15	P03999	OPSB_HUMAN	L	15	ENSP00000249389:I15L	ENSP00000249389:I15L	I	-	1	0	OPN1SW	128203038	0.999000	0.42202	0.433000	0.26760	0.019000	0.09904	0.546000	0.23284	-0.188000	0.10499	-0.648000	0.03929	ATC	-	prints_Opsin_blue		0.522	OPN1SW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPN1SW	protein_coding	OTTHUMT00000350655.1	T	NM_001708	rs200504235		128415802	-1	no_errors	ENST00000249389	ensembl	human	known	74_37	missense	SNP	0.972	G
PCDH7	5099	genome.wustl.edu	37	4	30723421	30723421	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr4:30723421T>A	ENST00000361762.2	+	1	1385	c.377T>A	c.(376-378)cTg>cAg	p.L126Q	PCDH7_ENST00000543491.1_Missense_Mutation_p.L126Q	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	126	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						TGGGTGGACCTGTTTGAGGGT	0.622																																																	0								ENSG00000169851						56.0	44.0	48.0					4																	30723421		2203	4300	6503	PCDH7	SO:0001583	missense	0			-	HGNC	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.377T>A	4.37:g.30723421T>A	ENSP00000355243:p.Leu126Gln	Somatic	0	61	0.00		0.6230499004162908	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	5	66.67	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L126Q	ENST00000361762.2	37	c.377	CCDS33971.1	4	.	.	.	.	.	.	.	.	.	.	T	18.10	3.549501	0.65311	.	.	ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135	T;T	0.59224	0.3;0.28	5.24	5.24	0.73138	Cadherin (3);	.	.	.	.	T	0.76176	0.3951	M	0.78456	2.415	0.52099	D	0.999948	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.79557	-0.1754	9	0.66056	D	0.02	.	14.8227	0.70085	0.0:0.0:0.0:1.0	.	126;126;126	F5GWJ1;O60245-3;O60245	.;.;PCDH7_HUMAN	Q	126	ENSP00000355243:L126Q;ENSP00000441802:L126Q	ENSP00000330302:L126Q	L	+	2	0	PCDH7	30332519	1.000000	0.71417	1.000000	0.80357	0.673000	0.39480	7.943000	0.87716	1.984000	0.57885	0.374000	0.22700	CTG	-	smart_Cadherin,pfscan_Cadherin		0.622	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH7	protein_coding	OTTHUMT00000360366.1	T	NM_032457, NM_002589	-		30723421	+1	no_errors	ENST00000543491	ensembl	human	known	74_37	missense	SNP	1.000	A
NOMO2	283820	genome.wustl.edu	37	16	18554998	18554998	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr16:18554998C>G	ENST00000381474.3	-	7	741	c.676G>C	c.(676-678)Gat>Cat	p.D226H	NOMO2_ENST00000543392.1_Missense_Mutation_p.D59H|NOMO2_ENST00000330537.6_Missense_Mutation_p.D226H	NM_001004060.1	NP_001004060.1	Q5JPE7	NOMO2_HUMAN	NODAL modulator 2	226						endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(4)|kidney(1)|large_intestine(2)|liver(3)|lung(5)|ovary(3)|prostate(1)|skin(1)	20						GGCTCCCCATCACTTCGGACA	0.473																																																	0								ENSG00000185164						175.0	140.0	152.0					16																	18554998		2196	4298	6494	NOMO2	SO:0001583	missense	0			-	HGNC	AL512687	CCDS10570.1, CCDS32394.1	16p12.3	2008-02-05			ENSG00000185164	ENSG00000185164			22652	protein-coding gene	gene with protein product		609158				15257293	Standard	NM_001004060		Approved	NOMO, PM5	uc002dfe.3	Q5JPE7	OTTHUMG00000131366	ENST00000381474.3:c.676G>C	16.37:g.18554998C>G	ENSP00000370883:p.Asp226His	Somatic	0	156	0.00		0.6230499004162908	210	11.34	27	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	133	11.92	Q4G177	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF2012,superfamily_Carb-bd-like_fold,superfamily_CarboxyPept-like_regulatory,superfamily_Collagen-bd_Cna_B-typ_dom	p.D226H	ENST00000381474.3	37	c.676	CCDS32394.1	16	.	.	.	.	.	.	.	.	.	.	.	19.92	3.915677	0.73098	.	.	ENSG00000185164	ENST00000330537;ENST00000381474;ENST00000543392	T;T;T	0.04275	3.68;3.67;3.66	3.24	3.24	0.37175	Carboxypeptidase-like, regulatory domain (1);	0.000000	0.85682	D	0.000000	T	0.17874	0.0429	M	0.77103	2.36	0.80722	D	1	D;D	0.76494	0.999;0.991	P;P	0.61800	0.894;0.747	T	0.02371	-1.1169	10	0.56958	D	0.05	-25.9319	13.9357	0.64023	0.0:1.0:0.0:0.0	.	59;226	Q4G177;Q5JPE7	.;NOMO2_HUMAN	H	226;226;59	ENSP00000331851:D226H;ENSP00000370883:D226H;ENSP00000439970:D59H	ENSP00000331851:D226H	D	-	1	0	NOMO2	18462499	1.000000	0.71417	0.992000	0.48379	0.961000	0.63080	6.814000	0.75236	1.781000	0.52344	0.400000	0.26472	GAT	-	superfamily_CarboxyPept-like_regulatory		0.473	NOMO2-002	KNOWN	basic|CCDS	protein_coding	NOMO2	protein_coding	OTTHUMT00000435858.1	C	NM_001004060	-		18554998	-1	no_errors	ENST00000381474	ensembl	human	known	74_37	missense	SNP	1.000	G
GRAP2	9402	genome.wustl.edu	37	22	40351885	40351885	+	Silent	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr22:40351885C>T	ENST00000344138.4	+	3	404	c.141C>T	c.(139-141)ccC>ccT	p.P47P	GRAP2_ENST00000544756.1_Intron|GRAP2_ENST00000543252.1_Silent_p.P47P|GRAP2_ENST00000478445.1_3'UTR|GRAP2_ENST00000399090.2_Intron|GRAP2_ENST00000540310.1_Intron|GRAP2_ENST00000407075.3_Silent_p.P47P	NM_004810.2	NP_004801.1	O75791	GRAP2_HUMAN	GRB2-related adaptor protein 2	47	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell-cell signaling (GO:0007267)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleus (GO:0005634)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						GATATGTGCCCAAGAATTTCA	0.463																																																	0								ENSG00000100351						109.0	96.0	100.0					22																	40351885		2203	4300	6503	GRAP2	SO:0001819	synonymous_variant	0			-	HGNC	AF102694	CCDS13999.1	22q13.2	2013-02-14			ENSG00000100351	ENSG00000100351		"""SH2 domain containing"""	4563	protein-coding gene	gene with protein product		604518				9878555, 10224278	Standard	XM_005261836		Approved	Grf40, GrbX, GRBLG, GADS, Mona	uc003ayh.2	O75791	OTTHUMG00000151097	ENST00000344138.4:c.141C>T	22.37:g.40351885C>T		Somatic	0	62	0.00		0.6230499004162908	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	18	68.97	B7Z8I3|O43726|Q9NRB7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_domain,pfam_SH2,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2,prints_SH3_domain	p.P47	ENST00000344138.4	37	c.141	CCDS13999.1	22																																																																																			-	pfam_SH3_domain,pfam_SH3_2,smart_SH3_domain,pfscan_SH3_domain		0.463	GRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAP2	protein_coding	OTTHUMT00000321295.1	C	NM_004810	-		40351885	+1	no_errors	ENST00000344138	ensembl	human	known	74_37	silent	SNP	1.000	T
SALL1	6299	genome.wustl.edu	37	16	51175081	51175081	+	Missense_Mutation	SNP	G	G	T	rs201220768		TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr16:51175081G>T	ENST00000251020.4	-	2	1085	c.1052C>A	c.(1051-1053)cCg>cAg	p.P351Q	SALL1_ENST00000541611.1_Intron|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.P254Q	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	351					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TTCAGAGGACGGGGTGGTAAC	0.512																																					GBM(103;1352 1446 1855 4775 8890)												0								ENSG00000103449						68.0	73.0	72.0					16																	51175081		2198	4300	6498	SALL1	SO:0001583	missense	0			-	HGNC	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1052C>A	16.37:g.51175081G>T	ENSP00000251020:p.Pro351Gln	Somatic	0	30	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P351Q	ENST00000251020.4	37	c.1052	CCDS10747.1	16	.	.	.	.	.	.	.	.	.	.	G	16.72	3.202508	0.58234	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.08370	3.11;3.1	4.52	4.52	0.55395	.	0.219921	0.48286	D	0.000189	T	0.07052	0.0179	N	0.21448	0.665	0.52099	D	0.999945	B	0.21309	0.054	B	0.21151	0.033	T	0.34254	-0.9836	10	0.15066	T	0.55	.	17.4195	0.87511	0.0:0.0:1.0:0.0	.	351	Q9NSC2	SALL1_HUMAN	Q	351;254;315	ENSP00000251020:P351Q;ENSP00000407914:P254Q	ENSP00000251020:P351Q	P	-	2	0	SALL1	49732582	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.849000	0.75414	2.317000	0.78254	0.462000	0.41574	CCG	-	NULL		0.512	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	protein_coding	OTTHUMT00000256883.2	G	NM_002968	-		51175081	-1	no_errors	ENST00000251020	ensembl	human	known	74_37	missense	SNP	1.000	T
PKD1L2	114780	genome.wustl.edu	37	16	81208264	81208264	+	RNA	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr16:81208264C>T	ENST00000527937.1	-	0	720				PKD1L2_ENST00000337114.4_RNA|PKD1L2_ENST00000533478.1_RNA|PKD1L2_ENST00000525539.1_RNA|PKD1L2_ENST00000531391.1_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						AATGGCCGCACGCAGACCCTG	0.597																																																	0								ENSG00000166473																																			PKD1L2			0			-	HGNC	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81208264C>T		Somatic	0	53	0.00		0.6230499004162908	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	29	30.95	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Coatomer/clathrin_app_Ig-like,pfscan_REJ-like	p.V203M	ENST00000527937.1	37	c.607		16	.	.	.	.	.	.	.	.	.	.	c	9.443	1.088556	0.20390	.	.	ENSG00000166473	ENST00000527937	T	0.23147	1.92	2.64	-4.09	0.03951	.	.	.	.	.	T	0.15305	0.0369	.	.	.	0.09310	N	1	B	0.14012	0.009	B	0.06405	0.002	T	0.33240	-0.9876	8	0.87932	D	0	.	4.3139	0.10984	0.0:0.2101:0.1819:0.608	.	203	Q7Z442-6	.	M	203	ENSP00000432818:V203M	ENSP00000432818:V203M	V	-	1	0	PKD1L2	79765765	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.205000	0.01232	-0.593000	0.05844	-1.027000	0.02421	GTG	-	pfscan_REJ-like		0.597	PKD1L2-007	KNOWN	basic|exp_conf	protein_coding	PKD1L2	polymorphic_pseudogene	OTTHUMT00000387978.1	C		-		81208264	-1	no_errors	ENST00000527937	ensembl	human	known	74_37	missense	SNP	0.000	T
