#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
LILRA4	23547	genome.wustl.edu	37	19	54844969	54844969	+	Silent	SNP	C	C	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr19:54844969C>T	ENST00000291759.4	-	8	1430	c.1374G>A	c.(1372-1374)ctG>ctA	p.L458L	AC008984.2_ENST00000507363.1_RNA	NM_012276.3	NP_036408.3	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4	458					immune system process (GO:0002376)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	32	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		TCCCGAGGAACAGCAGGACCA	0.562																																																	0								ENSG00000239961						100.0	88.0	92.0					19																	54844969		2203	4300	6503	LILRA4	SO:0001819	synonymous_variant	0			-	HGNC	AF041261	CCDS12890.1	19q13.4	2013-01-11			ENSG00000239961	ENSG00000239961		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15503	protein-coding gene	gene with protein product		607517				10941842	Standard	NM_012276		Approved	ILT7, CD85g	uc002qfj.3	P59901	OTTHUMG00000065355	ENST00000291759.4:c.1374G>A	19.37:g.54844969C>T		Somatic	0	74	0.00		0.6081089112834981	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	43	50.00	Q32MC4	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like_dom	p.L458	ENST00000291759.4	37	c.1374	CCDS12890.1	19																																																																																			-	pirsf_A1B_glyco/leuk_Ig-like_rcpt		0.562	LILRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA4	protein_coding	OTTHUMT00000140229.2	C	NM_012276	-		54844969	-1	no_errors	ENST00000291759	ensembl	human	known	74_37	silent	SNP	0.000	T
MXD3	83463	genome.wustl.edu	37	5	176734831	176734831	+	Silent	SNP	G	G	A			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr5:176734831G>A	ENST00000439742.2	-	5	934	c.456C>T	c.(454-456)gaC>gaT	p.D152D	MXD3_ENST00000513063.1_Silent_p.D152D|MXD3_ENST00000423571.2_Silent_p.D152D|MXD3_ENST00000427908.2_Silent_p.D152D	NM_031300.3	NP_112590.1	Q9BW11	MAD3_HUMAN	MAX dimerization protein 3	152					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)					all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGTCCAGACTGTCCGCCCGCA	0.706																																																	0								ENSG00000213347						14.0	15.0	15.0					5																	176734831		2189	4283	6472	MXD3	SO:0001819	synonymous_variant	0			-	HGNC	BC000745	CCDS4416.1, CCDS47347.1	5q35.3	2013-03-20			ENSG00000213347	ENSG00000213347		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	14008	protein-coding gene	gene with protein product		609450					Standard	NM_031300		Approved	MAD3, bHLHc13	uc003mgb.2	Q9BW11	OTTHUMG00000130854	ENST00000439742.2:c.456C>T	5.37:g.176734831G>A		Somatic	0	28	0.00		0.6081089112834981	149	25.85	53	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	41	30.51	B4E0J1|Q53HK1|Q7Z4Y0|Q8NDJ7|Q96ME3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.D152	ENST00000439742.2	37	c.456	CCDS4416.1	5																																																																																			-	NULL		0.706	MXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXD3	protein_coding	OTTHUMT00000253427.1	G		-		176734831	-1	no_errors	ENST00000439742	ensembl	human	known	74_37	silent	SNP	1.000	A
MARCH7	64844	genome.wustl.edu	37	2	160605149	160605149	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr2:160605149G>A	ENST00000259050.4	+	5	1470	c.1348G>A	c.(1348-1350)Gca>Aca	p.A450T	MARCH7_ENST00000409175.1_Missense_Mutation_p.A450T|MARCH7_ENST00000539065.1_Missense_Mutation_p.A394T|MARCH7_ENST00000409591.1_Missense_Mutation_p.A412T	NM_001282805.1|NM_001282807.1|NM_022826.2	NP_001269734.1|NP_001269736.1|NP_073737.1	Q9H992	MARH7_HUMAN	membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase	450					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(2)	18						CAGACCACAAGCATCTGCAGC	0.443																																																	0								ENSG00000136536						107.0	111.0	109.0					2																	160605149		2203	4300	6503	MARCH7	SO:0001583	missense	0			-	HGNC	AK022973	CCDS2210.1, CCDS63038.1, CCDS63039.1	2q24.2	2013-01-09	2012-02-23	2005-01-27	ENSG00000136536	ENSG00000136536		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	17393	protein-coding gene	gene with protein product		613334	"""axotrophin"", ""membrane-associated ring finger (C3HC4) 7"""	AXOT		14722266	Standard	XM_005246773		Approved	MARCH-VII, RNF177	uc002uax.3	Q9H992	OTTHUMG00000132029	ENST00000259050.4:c.1348G>A	2.37:g.160605149G>A	ENSP00000259050:p.Ala450Thr	Somatic	0	44	0.00		0.6081089112834981	76	1.30	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A8K9X1|B7Z7P5|D3DPB0|Q53GQ1|Q9BTR9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.A450T	ENST00000259050.4	37	c.1348	CCDS2210.1	2	.	.	.	.	.	.	.	.	.	.	G	7.508	0.654111	0.14580	.	.	ENSG00000136536	ENST00000409175;ENST00000539065;ENST00000259050;ENST00000409591	T;T;T;T	0.11712	2.76;2.75;2.76;2.75	5.59	3.49	0.39957	.	0.313741	0.33732	N	0.004603	T	0.03095	0.0091	N	0.04880	-0.145	0.25146	N	0.99046	B;B;B	0.09022	0.002;0.001;0.0	B;B;B	0.09377	0.004;0.001;0.0	T	0.43048	-0.9415	10	0.02654	T	1	-13.2385	0.9041	0.01281	0.1587:0.2451:0.346:0.2501	.	394;412;450	F5H6W4;B7Z7P5;Q9H992	.;.;MARH7_HUMAN	T	450;394;450;412	ENSP00000386830:A450T;ENSP00000442992:A394T;ENSP00000259050:A450T;ENSP00000387238:A412T	ENSP00000259050:A450T	A	+	1	0	MARCH7	160313395	0.889000	0.30405	1.000000	0.80357	0.995000	0.86356	1.133000	0.31430	1.305000	0.44909	0.655000	0.94253	GCA	-	NULL		0.443	MARCH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH7	protein_coding	OTTHUMT00000255040.3	G	NM_022826	-		160605149	+1	no_errors	ENST00000259050	ensembl	human	known	74_37	missense	SNP	1.000	A
CLPX	10845	genome.wustl.edu	37	15	65450174	65450174	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr15:65450174T>C	ENST00000300107.3	-	8	1155	c.967A>G	c.(967-969)Act>Gct	p.T323A		NM_006660.3	NP_006651.2	O76031	CLPX_HUMAN	caseinolytic mitochondrial matrix peptidase chaperone subunit	323					ATP catabolic process (GO:0006200)|positive regulation of peptidase activity (GO:0010952)|protein folding (GO:0006457)|proteolysis involved in cellular protein catabolic process (GO:0051603)	endopeptidase Clp complex (GO:0009368)|mitochondrial endopeptidase Clp complex (GO:0009841)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|metal ion binding (GO:0046872)|peptidase activator activity (GO:0016504)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)|skin(2)	16						CCAGCCTGAGTCAAAGTTGTA	0.388																																																	0								ENSG00000166855						162.0	142.0	149.0					15																	65450174		2202	4299	6501	CLPX	SO:0001583	missense	0			-	HGNC	AJ006267	CCDS10202.1	15q22.31	2013-09-12	2013-09-12		ENSG00000166855	ENSG00000166855		"""ATPases / AAA-type"""	2088	protein-coding gene	gene with protein product		615611	"""ClpX (caseinolytic protease X, E. coli) homolog"", ""ClpX caseinolytic protease X homolog (E. coli)"", ""ClpX caseinolytic peptidase X homolog (E. coli)"""			22841477	Standard	NM_006660		Approved		uc002aom.3	O76031	OTTHUMG00000133139	ENST00000300107.3:c.967A>G	15.37:g.65450174T>C	ENSP00000300107:p.Thr323Ala	Somatic	0	80	0.00		0.6081089112834981	39	50.63	40	WXS	Illumina HiSeq 2500	Phase_IV	tier1	61	48	55.96	A1L428|A8K8F1|B9EGI8|Q9H4D9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA-2,pfam_Clp_ATPase_C,pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_Sigma_54_int,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_Clp_protease_ATP-bd_su_ClpX	p.T323A	ENST00000300107.3	37	c.967	CCDS10202.1	15	.	.	.	.	.	.	.	.	.	.	T	33	5.211606	0.95069	.	.	ENSG00000166855	ENST00000300107;ENST00000546194	T	0.43294	0.95	6.07	6.07	0.98685	ATPase, AAA-2 (1);ATPase, AAA+ type, core (1);	0.043317	0.85682	D	0.000000	T	0.71151	0.3306	M	0.88979	2.995	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.85130	0.992;0.997	T	0.77104	-0.2711	10	0.87932	D	0	.	16.6407	0.85098	0.0:0.0:0.0:1.0	.	323;323	Q9H072;O76031	.;CLPX_HUMAN	A	323	ENSP00000300107:T323A	ENSP00000300107:T323A	T	-	1	0	CLPX	63237227	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	2.326000	0.78906	0.533000	0.62120	ACT	-	pfam_ATPase_AAA-2,pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_Sigma_54_int,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_Clp_protease_ATP-bd_su_ClpX		0.388	CLPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPX	protein_coding	OTTHUMT00000256828.2	T	NM_006660	-		65450174	-1	no_errors	ENST00000300107	ensembl	human	known	74_37	missense	SNP	1.000	C
PIK3C2G	5288	genome.wustl.edu	37	12	18439811	18439811	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr12:18439811G>T	ENST00000266497.5	+	2	747	c.709G>T	c.(709-711)Gta>Tta	p.V237L	PIK3C2G_ENST00000536967.1_3'UTR|PIK3C2G_ENST00000433979.1_Missense_Mutation_p.V237L|PIK3C2G_ENST00000538779.1_Missense_Mutation_p.V237L|PIK3C2G_ENST00000535651.1_Missense_Mutation_p.V237L|RERGL_ENST00000541632.1_Intron			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	237					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				GCTAGTGGAAGTACCTCAAAG	0.289																																																	0								ENSG00000139144						47.0	44.0	45.0					12																	18439811		1808	4065	5873	PIK3C2G	SO:0001583	missense	0			-	HGNC	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.709G>T	12.37:g.18439811G>T	ENSP00000266497:p.Val237Leu	Somatic	0	93	0.00		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	65	50	56.52	A1L3U0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_Phox,pfam_PI3K_Ras-bd_dom,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,superfamily_Phox,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_dom,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.V237L	ENST00000266497.5	37	c.709	CCDS44839.1	12	.	.	.	.	.	.	.	.	.	.	G	11.64	1.698346	0.30142	.	.	ENSG00000139144	ENST00000535651;ENST00000433979;ENST00000266497;ENST00000538779	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	3.87	2.98	0.34508	.	1.993970	0.02224	N	0.064252	T	0.29093	0.0723	N	0.17082	0.46	0.20873	N	0.99984	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.09377	0.002;0.004;0.002	T	0.16100	-1.0414	10	0.18710	T	0.47	-1.3182	7.6158	0.28156	0.1158:0.0:0.8842:0.0	.	236;237;237	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	L	237	ENSP00000443850:V237L;ENSP00000404845:V237L;ENSP00000266497:V237L;ENSP00000445381:V237L	ENSP00000266497:V237L	V	+	1	0	PIK3C2G	18331078	0.989000	0.36119	0.988000	0.46212	0.754000	0.42855	2.249000	0.43169	1.231000	0.43661	0.585000	0.79938	GTA	-	NULL		0.289	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PIK3C2G	protein_coding	OTTHUMT00000401316.1	G	NM_004570	-		18439811	+1	no_errors	ENST00000538779	ensembl	human	known	74_37	missense	SNP	0.990	T
IL17RD	54756	genome.wustl.edu	37	3	57132322	57132322	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr3:57132322G>A	ENST00000296318.7	-	12	1497	c.1409C>T	c.(1408-1410)gCg>gTg	p.A470V	IL17RD_ENST00000427856.2_Missense_Mutation_p.A446V|IL17RD_ENST00000463523.1_Missense_Mutation_p.A326V|IL17RD_ENST00000320057.5_Missense_Mutation_p.A326V	NM_017563.3	NP_060033.3	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D	470	SEFIR. {ECO:0000255|PROSITE- ProRule:PRU00867}.				signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)	16				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)		GCTGAGCGCCGCGGACGAACT	0.572																																																	0								ENSG00000144730						47.0	47.0	47.0					3																	57132322		2203	4300	6503	IL17RD	SO:0001583	missense	0			-	HGNC	AF494208	CCDS2880.2	3p21.1	2008-02-05			ENSG00000144730	ENSG00000144730		"""Interleukins and interleukin receptors"""	17616	protein-coding gene	gene with protein product		606807				11802164, 12604616	Standard	NM_017563		Approved	SEF, IL17RLM, FLJ35755, IL-17RD	uc003dil.3	Q8NFM7	OTTHUMG00000150171	ENST00000296318.7:c.1409C>T	3.37:g.57132322G>A	ENSP00000296318:p.Ala470Val	Somatic	0	27	0.00		0.6081089112834981	7	56.25	9	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	38	20.83	Q2NKP7|Q58EZ7|Q6RVF4|Q6UWI5|Q8N113|Q8NFS0|Q9UFA0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEFIR,superfamily_TIR_dom	p.A470V	ENST00000296318.7	37	c.1409	CCDS2880.2	3	.	.	.	.	.	.	.	.	.	.	G	10.35	1.326816	0.24080	.	.	ENSG00000144730	ENST00000296318;ENST00000320057;ENST00000427856;ENST00000463523	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	5.54	2.39	0.29439	SEFIR (1);	0.902169	0.09720	N	0.764573	T	0.22360	0.0539	L	0.36672	1.1	0.09310	N	1	B;B;B	0.32543	0.375;0.142;0.324	B;B;B	0.28849	0.095;0.059;0.035	T	0.18053	-1.0349	10	0.46703	T	0.11	-0.1845	6.7638	0.23556	0.0:0.2382:0.3831:0.3787	.	326;470;446	B4DXM5;Q8NFM7;Q8NFM7-3	.;I17RD_HUMAN;.	V	470;326;446;326	ENSP00000296318:A470V;ENSP00000322250:A326V;ENSP00000399209:A446V;ENSP00000417516:A326V	ENSP00000296318:A470V	A	-	2	0	IL17RD	57107362	0.000000	0.05858	0.001000	0.08648	0.215000	0.24574	-0.446000	0.06837	0.660000	0.30964	0.655000	0.94253	GCG	-	pfam_SEFIR		0.572	IL17RD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17RD	protein_coding	OTTHUMT00000316680.1	G	NM_017563	-		57132322	-1	no_errors	ENST00000296318	ensembl	human	known	74_37	missense	SNP	0.000	A
SPATA31D1	389763	genome.wustl.edu	37	9	84609274	84609274	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr9:84609274G>A	ENST00000344803.2	+	4	3936	c.3889G>A	c.(3889-3891)Gtg>Atg	p.V1297M		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1297					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AGTGAGTCCTGTGAGACCCAA	0.537																																																	0								ENSG00000214929						38.0	39.0	38.0					9																	84609274		1942	4144	6086	SPATA31D1	SO:0001583	missense	0			-	HGNC		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3889G>A	9.37:g.84609274G>A	ENSP00000341988:p.Val1297Met	Somatic	0	40	0.00		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	35	54.55		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V1297M	ENST00000344803.2	37	c.3889	CCDS47986.1	9	.	.	.	.	.	.	.	.	.	.	G	2.989	-0.208565	0.06140	.	.	ENSG00000214929	ENST00000344803	T	0.04917	3.53	3.19	-3.54	0.04653	.	1.800120	0.03998	U	0.295983	T	0.03305	0.0096	N	0.12182	0.205	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.40701	-0.9549	10	0.36615	T	0.2	1.6795	1.719	0.02908	0.1416:0.424:0.1407:0.2938	.	1297	Q6ZQQ2	F75D1_HUMAN	M	1297	ENSP00000341988:V1297M	ENSP00000341988:V1297M	V	+	1	0	FAM75D1	83799094	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.610000	0.02064	-0.861000	0.04094	-3.688000	0.00024	GTG	-	NULL		0.537	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31D1	protein_coding	OTTHUMT00000402325.1	G	NM_001001670	-		84609274	+1	no_errors	ENST00000344803	ensembl	human	known	74_37	missense	SNP	0.000	A
FIP1L1	81608	genome.wustl.edu	37	4	54319248	54319249	+	Frame_Shift_Del	DEL	AG	AG	-	rs143671659		TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr4:54319248_54319249delAG	ENST00000337488.6	+	16	1641_1642	c.1447_1448delAG	c.(1447-1449)agafs	p.R483fs	FIP1L1_ENST00000358575.5_Frame_Shift_Del_p.R477fs|FIP1L1_ENST00000507166.1_Intron|FIP1L1_ENST00000306932.6_Frame_Shift_Del_p.R409fs	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1	483	Arg-rich.|Glu-rich.|Sufficient for interaction with CPSF1 and CSTF3.				mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R487fs*3(2)		large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			agaACGCACCAGAGAGAGAGAG	0.47			T	PDGFRA	idiopathic hypereosinophilic syndrome																																			Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	2	Deletion - Frameshift(2)	large_intestine(1)|kidney(1)						ENSG00000145216																																			FIP1L1	SO:0001589	frameshift_variant	0				HGNC	AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.1447_1448delAG	4.37:g.54319258_54319259delAG	ENSP00000336752:p.Arg483fs	Somatic	0	18	0.00		0.6081089112834981	252	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Fip1	p.E486fs	ENST00000337488.6	37	c.1447_1448	CCDS3491.1	4																																																																																			-	NULL		0.470	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	FIP1L1	protein_coding	OTTHUMT00000250602.1	AG	NM_030917			54319249	+1	no_errors	ENST00000337488	ensembl	human	known	74_37	frame_shift_del	DEL	0.975:0.991	-
RP11-435B5.5	0	genome.wustl.edu	37	1	143380773	143380773	+	lincRNA	SNP	T	T	A	rs2939197		TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:143380773T>A	ENST00000428624.1	+	0	1783				RP11-435B5.4_ENST00000423249.1_lincRNA																							TTTTTTATATTGTGACTTTCA	0.269																																																	0								ENSG00000238261																																			RP11-435B5.5			0			-	Clone_based_vega_gene																													1.37:g.143380773T>A		Somatic	0	21	0.00		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			-	-		0.269	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	lincRNA	OTTHUMT00000037971.1	T		rs200474762		143380773	+1	no_errors	ENST00000423394	ensembl	human	known	74_37	rna	SNP	0.000	A
ABAT	18	genome.wustl.edu	37	16	8857959	8857959	+	Silent	SNP	C	C	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr16:8857959C>T	ENST00000396600.2	+	7	1338	c.400C>T	c.(400-402)Ctg>Ttg	p.L134L	ABAT_ENST00000425191.2_Silent_p.L134L|ABAT_ENST00000567812.1_Silent_p.L149L|ABAT_ENST00000569156.1_Silent_p.L134L|ABAT_ENST00000268251.8_Silent_p.L134L	NM_000663.4	NP_000654.2	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase	134					behavioral response to cocaine (GO:0048148)|copulation (GO:0007620)|gamma-aminobutyric acid catabolic process (GO:0009450)|locomotory behavior (GO:0007626)|negative regulation of blood pressure (GO:0045776)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|synaptic transmission (GO:0007268)	4-aminobutyrate transaminase complex (GO:0032144)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	(S)-3-amino-2-methylpropionate transaminase activity (GO:0047298)|4-aminobutyrate transaminase activity (GO:0003867)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|succinate-semialdehyde dehydrogenase binding (GO:0032145)			breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	26					L-Alanine(DB00160)|Phenelzine(DB00780)|Pyruvic acid(DB00119)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	CCTCGGAATCCTGCCTCCGGA	0.562																																																	0								ENSG00000183044						93.0	83.0	86.0					16																	8857959		2197	4300	6497	ABAT	SO:0001819	synonymous_variant	0			-	HGNC	L32961	CCDS10534.1	16p13.2	2011-01-10			ENSG00000183044	ENSG00000183044	2.6.1.19		23	protein-coding gene	gene with protein product	"""4-aminobutyrate transaminase"""	137150				7721088	Standard	NM_020686		Approved	GABAT	uc002czc.4	P80404	OTTHUMG00000048201	ENST00000396600.2:c.400C>T	16.37:g.8857959C>T		Somatic	0	33	0.00		0.6081089112834981	1	66.67	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	35	41.94	A8K386|Q16260|Q8N5W2|Q96BG2|Q99800	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase,tigrfam_4NH2But_aminotransferase_euk	p.L134	ENST00000396600.2	37	c.400	CCDS10534.1	16																																																																																			-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase,tigrfam_4NH2But_aminotransferase_euk		0.562	ABAT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ABAT	protein_coding	OTTHUMT00000433620.2	C	NM_020686	-		8857959	+1	no_errors	ENST00000268251	ensembl	human	known	74_37	silent	SNP	1.000	T
AC026320.1	0	genome.wustl.edu	37	3	191693744	191693749	+	RNA	DEL	GTGTGT	GTGTGT	-	rs199865256|rs371584059		TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	GTGTGT	GTGTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr3:191693744_191693749delGTGTGT	ENST00000401201.1	+	0	2_7																											ctctctctcCgtgtgtgtgtgtgtgt	0.49																																																	0								ENSG00000216020																																			AC026320.1			0				Clone_based_ensembl_gene																													3.37:g.191693750_191693755delGTGTGT		Somatic	NA	NA	NA		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401201.1	37	NULL		3																																																																																			-	-		0.490	AC026320.1-201	NOVEL	basic	miRNA	ENSG00000216020	miRNA		GTGTGT				191693749	+1	no_errors	ENST00000401201	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.000	-
PRAMEF19	645414	genome.wustl.edu	37	1	13695804	13695804	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:13695804A>T	ENST00000376101.2	-	3	953	c.954T>A	c.(952-954)aaT>aaA	p.N318K	PRAMEF19_ENST00000540591.1_Missense_Mutation_p.N387K			Q5SWL8	PRA19_HUMAN	PRAME family member 19	318					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					lung(3)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGGACGTGTCATTGCCGTGAA	0.557																																																	0								ENSG00000204480						9.0	11.0	10.0					1																	13695804		2068	4146	6214	PRAMEF19	SO:0001583	missense	0			-	HGNC			1p36.21	2013-01-17			ENSG00000204480	ENSG00000204480		"""-"""	24908	protein-coding gene	gene with protein product							Standard	NM_001099790		Approved	OTTHUMG00000007919	uc009vnu.1	Q5SWL8	OTTHUMG00000007919	ENST00000376101.2:c.954T>A	1.37:g.13695804A>T	ENSP00000365269:p.Asn318Lys	Somatic	0	120	0.00		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	69	31.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.N387K	ENST00000376101.2	37	c.1161		1	.	.	.	.	.	.	.	.	.	.	A	12.42	1.931493	0.34096	.	.	ENSG00000204480	ENST00000376101;ENST00000540591	T;T	0.66099	-0.19;4.77	1.18	0.145	0.14829	.	0.000000	0.85682	D	0.000000	T	0.74869	0.3773	M	0.86502	2.82	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63242	-0.6681	10	0.87932	D	0	.	3.4735	0.07575	0.295:0.0:0.705:0.0	.	387	F5H544	.	K	318;387	ENSP00000365269:N318K;ENSP00000446004:N387K	ENSP00000365269:N318K	N	-	3	2	PRAMEF19	13568391	0.000000	0.05858	0.002000	0.10522	0.105000	0.19272	-0.138000	0.10374	0.056000	0.16144	0.136000	0.15936	AAT	-	NULL		0.557	PRAMEF19-001	KNOWN	basic	protein_coding	PRAMEF19	protein_coding	OTTHUMT00000021794.2	A	NM_001099790	-		13695804	-1	no_errors	ENST00000540591	ensembl	human	known	74_37	missense	SNP	0.002	T
CNST	163882	genome.wustl.edu	37	1	246810848	246810848	+	Missense_Mutation	SNP	G	G	C	rs145092607		TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:246810848G>C	ENST00000366513.4	+	9	1614	c.1345G>C	c.(1345-1347)Gag>Cag	p.E449Q	CNST_ENST00000483271.1_3'UTR|CNST_ENST00000366512.3_Missense_Mutation_p.E449Q	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	449					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						ATTGATTTCTGAGGGTAAATA	0.473											OREG0014367	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000162852						154.0	166.0	162.0					1																	246810848		2203	4300	6503	CNST	SO:0001583	missense	0			-	HGNC	AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.1345G>C	1.37:g.246810848G>C	ENSP00000355470:p.Glu449Gln	Somatic	0	42	0.00	2468	0.6081089112834981	30	3.23	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	73	20.65	Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E449Q	ENST00000366513.4	37	c.1345	CCDS1628.1	1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.270801	0.40194	.	.	ENSG00000162852	ENST00000366513;ENST00000366512	T;T	0.19938	2.14;2.11	5.19	3.32	0.38043	.	0.600262	0.16751	N	0.201043	T	0.28928	0.0718	M	0.72894	2.215	0.09310	N	0.999998	P;D	0.56746	0.873;0.977	B;P	0.51016	0.382;0.656	T	0.16188	-1.0411	10	0.49607	T	0.09	-9.0811	4.2874	0.10862	0.2832:0.0:0.5607:0.1561	.	449;449	Q6PJW8;Q6PJW8-2	CNST_HUMAN;.	Q	449	ENSP00000355470:E449Q;ENSP00000355469:E449Q	ENSP00000355469:E449Q	E	+	1	0	CNST	244877471	0.004000	0.15560	0.215000	0.23724	0.622000	0.37654	1.225000	0.32551	0.697000	0.31718	0.467000	0.42956	GAG	-	NULL		0.473	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNST	protein_coding	OTTHUMT00000096780.1	G	NM_152609	-		246810848	+1	no_errors	ENST00000366513	ensembl	human	known	74_37	missense	SNP	0.012	C
CST3	1471	genome.wustl.edu	37	20	23618269	23618282	+	Frame_Shift_Del	DEL	GCGCACCACCTGCA	GCGCACCACCTGCA	-	rs373743268|rs377587451	byFrequency	TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	GCGCACCACCTGCA	GCGCACCACCTGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr20:23618269_23618282delGCGCACCACCTGCA	ENST00000398411.1	-	1	300_313	c.218_231delTGCAGGTGGTGCGC	c.(217-231)ctgcaggtggtgcgcfs	p.LQVVR73fs	CST3_ENST00000398409.1_Frame_Shift_Del_p.LQVVR73fs|CST3_ENST00000376925.3_Frame_Shift_Del_p.LQVVR73fs			P01034	CYTC_HUMAN	cystatin C	73					apoptotic process (GO:0006915)|brain development (GO:0007420)|cell activation (GO:0001775)|cellular response to hydrogen peroxide (GO:0070301)|circadian sleep/wake cycle, REM sleep (GO:0042747)|defense response (GO:0006952)|embryo implantation (GO:0007566)|extracellular fibril organization (GO:0043206)|eye development (GO:0001654)|negative regulation of blood vessel remodeling (GO:0060313)|negative regulation of cell death (GO:0060548)|negative regulation of collagen catabolic process (GO:0010711)|negative regulation of elastin catabolic process (GO:0060311)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extracellular matrix disassembly (GO:0010716)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|regulation of programmed cell death (GO:0043067)|regulation of tissue remodeling (GO:0034103)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient levels (GO:0031667)|response to toxic substance (GO:0009636)|salivary gland development (GO:0007431)|Sertoli cell development (GO:0060009)	basement membrane (GO:0005604)|cell projection (GO:0042995)|contractile fiber (GO:0043292)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	beta-amyloid binding (GO:0001540)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|protease binding (GO:0002020)			large_intestine(2)|lung(1)|ovary(1)	4	Lung NSC(19;0.0789)|Colorectal(13;0.0993)|all_lung(19;0.169)					GCTTGCGGGCGCGCACCACCTGCAGCGCGCGGCT	0.724																																																	0								ENSG00000101439																																			CST3	SO:0001589	frameshift_variant	0				HGNC		CCDS13158.1	20p11.2	2008-04-15	2008-04-15		ENSG00000101439	ENSG00000101439			2475	protein-coding gene	gene with protein product		604312	"""cystatin C (amyloid angiopathy and cerebral hemorrhage)"""			8486384	Standard	NM_000099		Approved		uc002wtn.1	P01034	OTTHUMG00000032080	ENST00000398411.1:c.218_231delTGCAGGTGGTGCGC	20.37:g.23618269_23618282delGCGCACCACCTGCA	ENSP00000381448:p.Leu73fs	Somatic	NA	NA	NA		0.6081089112834981	1833	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2R5J9|D3DW42|Q6FGW9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	p.L73fs	ENST00000398411.1	37	c.231_218	CCDS13158.1	20																																																																																			-	pfam_Prot_inh_cystat,smart_Prot_inh_cystat		0.724	CST3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	CST3	protein_coding	OTTHUMT00000256831.1	GCGCACCACCTGCA	NM_000099			23618282	-1	no_errors	ENST00000376925	ensembl	human	known	74_37	frame_shift_del	DEL	0.010:0.014:0.007:0.010:0.010:0.003:0.010:0.026:0.021:0.004:0.000:0.000:0.000:0.000	-
TRAF4	9618	genome.wustl.edu	37	17	27076468	27076468	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr17:27076468A>G	ENST00000262395.5	+	7	1415	c.1286A>G	c.(1285-1287)gAg>gGg	p.E429G	AC010761.10_ENST00000579468.1_RNA|TRAF4_ENST00000262396.6_Splice_Site|TRAF4_ENST00000444415.3_Intron|AC010761.9_ENST00000577325.1_RNA	NM_004295.3	NP_004286.2	Q9BUZ4	TRAF4_HUMAN	TNF receptor-associated factor 4	429	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein kinase activity (GO:0045860)|regulation of apoptotic process (GO:0042981)|respiratory gaseous exchange (GO:0007585)|respiratory tube development (GO:0030323)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	DNA binding (GO:0003677)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|WW domain binding (GO:0050699)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10	Lung NSC(42;0.01)		Epithelial(11;3.26e-05)|all cancers(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.235)			TCCCTGGATGAGAGTTCTCTG	0.552																																																	0								ENSG00000076604						64.0	63.0	63.0					17																	27076468		2203	4300	6503	TRAF4	SO:0001583	missense	0			-	HGNC	X80200	CCDS11243.1	17q11-q21.3	2013-01-09			ENSG00000076604	ENSG00000076604		"""RING-type (C3HC4) zinc fingers"""	12034	protein-coding gene	gene with protein product		602464				7592751, 7490069	Standard	NM_004295		Approved	CART1, MLN62, RNF83	uc002hcs.3	Q9BUZ4	OTTHUMG00000132677	ENST00000262395.5:c.1286A>G	17.37:g.27076468A>G	ENSP00000262395:p.Glu429Gly	Somatic	0	37	0.00		0.6081089112834981	4	89.74	35	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	0	100.00	O75615|Q14848|Q2KJU4|Q2PJN8	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e5-2	ENST00000262395.5	37	c.463-2	CCDS11243.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.32|16.32	3.089626|3.089626	0.55968|0.55968	.|.	.|.	ENSG00000076604|ENSG00000076604	ENST00000262396|ENST00000262395;ENST00000454852;ENST00000394924;ENST00000394925	.|T	.|0.32023	.|1.47	6.11|6.11	5.04|5.04	0.67666|0.67666	.|TRAF-type (1);TRAF-like (1);MATH (3);	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.31606	.|0.0802	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	D|D	1|1	.|P	.|0.42757	.|0.789	.|B	.|0.43658	.|0.426	.|T	.|0.03706	.|-1.1011	.|10	.|0.39692	.|T	.|0.17	.|.	11.0142|11.0142	0.47679|0.47679	0.9283:0.0:0.0717:0.0|0.9283:0.0:0.0717:0.0	.|.	.|429	.|Q9BUZ4	.|TRAF4_HUMAN	.|G	-1|429;157;126;103	.|ENSP00000262395:E429G	.|ENSP00000262395:E429G	.|E	+|+	.|2	.|0	TRAF4|TRAF4	24100595|24100595	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	6.950000|6.950000	0.75977|0.75977	2.343000|2.343000	0.79666|0.79666	0.533000|0.533000	0.62120|0.62120	.|GAG	-	-		0.552	TRAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF4	protein_coding	OTTHUMT00000255944.2	A	NM_145751	-		27076468	+1	no_errors	ENST00000262396	ensembl	human	novel	74_37	splice_site	SNP	1.000	G
STXBP3	6814	genome.wustl.edu	37	1	109321988	109321988	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:109321988G>T	ENST00000370008.3	+	9	815	c.765G>T	c.(763-765)caG>caT	p.Q255H	STXBP3_ENST00000485167.1_3'UTR	NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	255	Mediates interaction with DOC2B. {ECO:0000250}.				blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		TGACCTTTCAGGCAATGGCAT	0.368																																																	0								ENSG00000116266						199.0	187.0	191.0					1																	109321988		2203	4300	6503	STXBP3	SO:0001583	missense	0			-	HGNC	D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.765G>T	1.37:g.109321988G>T	ENSP00000359025:p.Gln255His	Somatic	0	43	0.00		0.6081089112834981	21	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sec1-like,superfamily_Sec1-like	p.Q255H	ENST00000370008.3	37	c.765	CCDS790.1	1	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803589	0.70682	.	.	ENSG00000116266	ENST00000370008	D	0.82167	-1.58	5.77	3.63	0.41609	.	0.056656	0.64402	N	0.000001	D	0.87649	0.6230	M	0.89478	3.035	0.53005	D	0.99996	D	0.89917	1.0	D	0.91635	0.999	D	0.87797	0.2622	10	0.87932	D	0	-10.1474	4.1217	0.10108	0.2173:0.0:0.5775:0.2051	.	255	O00186	STXB3_HUMAN	H	255	ENSP00000359025:Q255H	ENSP00000359025:Q255H	Q	+	3	2	STXBP3	109123511	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.316000	0.51960	1.396000	0.46663	0.655000	0.94253	CAG	-	pfam_Sec1-like,superfamily_Sec1-like		0.368	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP3	protein_coding	OTTHUMT00000030591.1	G	NM_007269	-		109321988	+1	no_errors	ENST00000370008	ensembl	human	known	74_37	missense	SNP	1.000	T
DNAH14	127602	genome.wustl.edu	37	1	225539462	225539462	+	Missense_Mutation	SNP	C	C	G	rs541679195		TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:225539462C>G	ENST00000445597.2	+	50	8722	c.8722C>G	c.(8722-8724)Ctt>Gtt	p.L2908V	DNAH14_ENST00000430092.1_Missense_Mutation_p.L3711V|DNAH14_ENST00000439375.2_Missense_Mutation_p.L3711V			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	2908					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						GTGCAAATCCCTTTTATCAAA	0.418																																																	0								ENSG00000185842						136.0	117.0	123.0					1																	225539462		692	1591	2283	DNAH14	SO:0001583	missense	0			-	HGNC	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.8722C>G	1.37:g.225539462C>G	ENSP00000409472:p.Leu2908Val	Somatic	0	63	0.00		0.6081089112834981	1	33.33	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	91	9.90	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Tautomerase/MIF_sf,smart_AAA+_ATPase	p.L3711V	ENST00000445597.2	37	c.11131		1	.	.	.	.	.	.	.	.	.	.	C	17.75	3.466174	0.63625	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.44881	0.91;2.95;2.95	5.18	4.26	0.50523	.	.	.	.	.	T	0.37598	0.1009	.	.	.	0.80722	D	1	B	0.33637	0.42	B	0.37650	0.255	T	0.12091	-1.0561	8	0.26408	T	0.33	.	14.2432	0.65971	0.1509:0.8491:0.0:0.0	.	3711	Q0VDD8-4	.	V	2908;3711;3711	ENSP00000409472:L2908V;ENSP00000414402:L3711V;ENSP00000392061:L3711V	ENSP00000414402:L3711V	L	+	1	0	DNAH14	223606085	1.000000	0.71417	0.696000	0.30242	0.861000	0.49209	4.559000	0.60796	1.288000	0.44600	0.603000	0.83216	CTT	-	pfam_Dynein_heavy_dom		0.418	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	protein_coding	OTTHUMT00000331217.3	C	XM_059166	-		225539462	+1	no_errors	ENST00000430092	ensembl	human	known	74_37	missense	SNP	0.988	G
MT-ND2	4536	genome.wustl.edu	37	M	2833	2833	+	5'Flank	SNP	A	A	G			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chrM:2833A>G	ENST00000361453.3	+	0	0				MT-TM_ENST00000387377.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TL1_ENST00000386347.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						CCTCGGAGCAGAACCCAACCT	0.428																																																	0								ENSG00000210082																																			MT-RNR2	SO:0001631	upstream_gene_variant	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2833A>G	Exception_encountered	Somatic	0	261	0.00		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	134	9	93.71	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			-	-		0.428	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	protein_coding		A	YP_003024027	rs3928312		2833	+1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	SNP	NULL	G
CHMP4B	128866	genome.wustl.edu	37	20	32438798	32438798	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr20:32438798G>C	ENST00000217402.2	+	3	574	c.409G>C	c.(409-411)Gac>Cac	p.D137H		NM_176812.4	NP_789782.1	Q9H444	CHM4B_HUMAN	charged multivesicular body protein 4B	137					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|negative regulation of autophagic vacuole assembly (GO:1902902)|negative regulation of neuron death (GO:1901215)|positive regulation of viral release from host cell (GO:1902188)|posttranslational protein targeting to membrane (GO:0006620)|protein homooligomerization (GO:0051260)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|ESCRT III complex (GO:0000815)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13						GGACATTGCTGACCAGCAAGA	0.438																																																	0								ENSG00000101421						127.0	115.0	119.0					20																	32438798		2203	4300	6503	CHMP4B	SO:0001583	missense	0			-	HGNC	AL050349	CCDS13228.1	20q11.22	2011-09-21	2011-09-21	2005-04-04	ENSG00000101421	ENSG00000101421		"""Charged multivesicular body proteins"""	16171	protein-coding gene	gene with protein product		610897	"""chromosome 20 open reading frame 178"", ""chromatin modifying protein 4B"""	C20orf178		14678797	Standard	NM_176812		Approved	dJ553F4.4, Shax1, SNF7-2, VPS32B	uc002xaa.3	Q9H444	OTTHUMG00000032272	ENST00000217402.2:c.409G>C	20.37:g.32438798G>C	ENSP00000217402:p.Asp137His	Somatic	0	86	0.00		0.6081089112834981	568	33.64	288	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	144	15.79	E1P5N4|Q53ZD6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Snf7	p.D137H	ENST00000217402.2	37	c.409	CCDS13228.1	20	.	.	.	.	.	.	.	.	.	.	G	32	5.192566	0.94960	.	.	ENSG00000101421	ENST00000217402	T	0.75260	-0.92	5.66	5.66	0.87406	.	0.085587	0.85682	D	0.000000	D	0.84772	0.5546	M	0.64630	1.985	0.80722	D	1	P	0.41366	0.747	P	0.58577	0.841	D	0.84547	0.0642	10	0.87932	D	0	-28.3174	20.1253	0.97977	0.0:0.0:1.0:0.0	.	137	Q9H444	CHM4B_HUMAN	H	137	ENSP00000217402:D137H	ENSP00000217402:D137H	D	+	1	0	CHMP4B	31902459	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.832000	0.97577	0.655000	0.94253	GAC	-	pfam_Snf7		0.438	CHMP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHMP4B	protein_coding	OTTHUMT00000078738.2	G		-		32438798	+1	no_errors	ENST00000217402	ensembl	human	known	74_37	missense	SNP	1.000	C
BAZ2A	11176	genome.wustl.edu	37	12	57004285	57004285	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr12:57004285G>T	ENST00000551812.1	-	8	1886	c.1693C>A	c.(1693-1695)Cgc>Agc	p.R565S	BAZ2A_ENST00000549884.1_Missense_Mutation_p.R563S|BAZ2A_ENST00000379441.3_Missense_Mutation_p.R535S|BAZ2A_ENST00000179765.5_Missense_Mutation_p.R533S	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	565	MBD. {ECO:0000255|PROSITE- ProRule:PRU00338}.				chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						TTCTTGATGCGCACCTCTCTC	0.592																																																	0								ENSG00000076108						45.0	48.0	47.0					12																	57004285		2093	4229	6322	BAZ2A	SO:0001583	missense	0			-	HGNC	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.1693C>A	12.37:g.57004285G>T	ENSP00000446880:p.Arg565Ser	Somatic	0	35	0.00		0.6081089112834981	41	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	41	10.87	B3KN66|O00536|O15030|Q68DI8|Q96H26	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_dom,superfamily_Znf_FYVE_PHD,smart_Methyl_CpG_DNA-bd,smart_AT_hook_DNA-bd_motif,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.R565S	ENST00000551812.1	37	c.1693	CCDS44924.1	12	.	.	.	.	.	.	.	.	.	.	G	20.7	4.026829	0.75390	.	.	ENSG00000076108	ENST00000379441;ENST00000179765;ENST00000551812;ENST00000549884;ENST00000551996	D;D;D;D	0.99470	-5.96;-5.96;-5.96;-5.96	4.86	4.86	0.63082	Methyl-CpG DNA binding (4);DNA-binding, integrase-type (1);	0.000000	0.85682	D	0.000000	D	0.99302	0.9756	M	0.68317	2.08	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.98264	1.0500	10	0.66056	D	0.02	.	12.3875	0.55340	0.0:0.0:0.8314:0.1686	.	563;565	F8VU39;Q9UIF9	.;BAZ2A_HUMAN	S	535;533;565;563;220	ENSP00000368754:R535S;ENSP00000179765:R533S;ENSP00000446880:R565S;ENSP00000447941:R563S	ENSP00000179765:R533S	R	-	1	0	BAZ2A	55290552	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.906000	0.69900	2.697000	0.92050	0.591000	0.81541	CGC	-	pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_dom,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd		0.592	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAZ2A	protein_coding	OTTHUMT00000408561.1	G	NM_013449	-		57004285	-1	no_errors	ENST00000551812	ensembl	human	known	74_37	missense	SNP	1.000	T
GOLGA6L4	643707	genome.wustl.edu	37	15	82934933	82934933	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr15:82934933T>C	ENST00000559949.1	-	6	706	c.647A>G	c.(646-648)cAt>cGt	p.H216R	RP13-996F3.5_ENST00000560844.1_5'UTR																NS(1)	1						CTCCTGTTCATGTAGCCTCTC	0.542																																																	0								ENSG00000215749																																			RP13-996F3.5	SO:0001583	missense	0			-	Clone_based_vega_gene																												ENST00000559949.1:c.647A>G	15.37:g.82934933T>C	ENSP00000453573:p.His216Arg	Somatic	0	15	0.00		0.6081089112834981	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	20	35.48		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.H216R	ENST00000559949.1	37	c.647		15	.	.	.	.	.	.	.	.	.	.	.	0.024	-1.387709	0.01194	.	.	ENSG00000215749	ENST00000426571	.	.	.	.	.	.	.	.	.	.	.	T	0.11196	0.0273	.	.	.	.	.	.	B	0.17038	0.02	B	0.08055	0.003	T	0.25641	-1.0126	5	0.06891	T	0.86	.	1.4582	0.02390	0.3337:0.332:0.0:0.3343	.	216	E7ES67	.	R	216	.	ENSP00000405228:H216R	H	-	2	0	AC126339.1	80731988	0.000000	0.05858	0.016000	0.15963	0.016000	0.09150	-0.357000	0.07651	-2.094000	0.00854	-2.075000	0.00382	CAT	-	NULL		0.542	RP13-996F3.5-001	PUTATIVE	basic|appris_principal	protein_coding	GOLGA6L4	protein_coding	OTTHUMT00000419268.1	T		-		82934933	-1	no_errors	ENST00000559949	ensembl	human	putative	74_37	missense	SNP	0.551	C
ABHD16A	7920	genome.wustl.edu	37	6	31661170	31661170	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr6:31661170G>A	ENST00000395952.3	-	6	631	c.469C>T	c.(469-471)Cca>Tca	p.P157S	ABHD16A_ENST00000538874.1_Silent_p.G58G|ABHD16A_ENST00000375842.4_5'UTR|ABHD16A_ENST00000440843.2_Missense_Mutation_p.P124S|XXbac-BPG32J3.20_ENST00000461287.1_3'UTR	NM_021160.2	NP_066983.1	O95870	ABHGA_HUMAN	abhydrolase domain containing 16A	157						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	10						AAGTCGACTGGCCAGCTCCGG	0.567																																																	0								ENSG00000204427						43.0	43.0	43.0					6																	31661170		1510	2708	4218	ABHD16A	SO:0001583	missense	0			-	HGNC	AF129756	CCDS4713.1, CCDS54988.1	6p21.3	2013-01-17	2010-12-09	2010-12-09	ENSG00000204427	ENSG00000204427		"""Abhydrolase domain containing"""	13921	protein-coding gene	gene with protein product		142620	"""HLA-B associated transcript 5"""	BAT5		2911734, 2813433	Standard	NM_021160		Approved	NG26, D6S82E	uc003nvy.2	O95870	OTTHUMG00000031177	ENST00000395952.3:c.469C>T	6.37:g.31661170G>A	ENSP00000379282:p.Pro157Ser	Somatic	0	59	0.00		0.6081089112834981	46	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A2BEY3|B7Z4R6|Q5SRR1|Q5SRR2|Q8WYH0|Q9NW33	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AB_hydrolase_1	p.P157S	ENST00000395952.3	37	c.469	CCDS4713.1	6	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224544	0.79576	.	.	ENSG00000204427	ENST00000395952;ENST00000440843	.	.	.	5.63	5.63	0.86233	.	0.055492	0.64402	D	0.000001	T	0.75729	0.3889	M	0.81497	2.545	0.80722	D	1	D;D	0.71674	0.998;0.965	D;P	0.64776	0.929;0.656	T	0.79024	-0.1972	9	0.87932	D	0	-9.6894	17.1851	0.86865	0.0:0.0:1.0:0.0	.	124;157	B7Z4R6;O95870	.;ABHGA_HUMAN	S	157;124	.	ENSP00000379282:P157S	P	-	1	0	ABHD16A	31769149	1.000000	0.71417	0.998000	0.56505	0.556000	0.35491	7.990000	0.88215	2.654000	0.90174	0.561000	0.74099	CCA	-	NULL		0.567	ABHD16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD16A	protein_coding	OTTHUMT00000076342.4	G		-		31661170	-1	no_errors	ENST00000395952	ensembl	human	known	74_37	missense	SNP	1.000	A
SYNE1	23345	genome.wustl.edu	37	6	152473241	152473241	+	Silent	SNP	C	C	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr6:152473241C>T	ENST00000367255.5	-	134	24766	c.24165G>A	c.(24163-24165)caG>caA	p.Q8055Q	SYNE1_ENST00000423061.1_Silent_p.Q7984Q|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000448038.1_Silent_p.Q7984Q|SYNE1_ENST00000354674.4_Silent_p.Q210Q|SYNE1_ENST00000539504.1_Silent_p.Q210Q|SYNE1_ENST00000356820.4_Silent_p.Q2579Q|SYNE1_ENST00000341594.5_Silent_p.Q7667Q|SYNE1_ENST00000265368.4_Silent_p.Q8055Q	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8055					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCAGTTCCAGCTGCGTCAGGC	0.547										HNSCC(10;0.0054)																																							0								ENSG00000131018						95.0	80.0	85.0					6																	152473241		2203	4300	6503	SYNE1	SO:0001819	synonymous_variant	0			-	HGNC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.24165G>A	6.37:g.152473241C>T		Somatic	0	46	0.00		0.6081089112834981	26	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.Q8055	ENST00000367255.5	37	c.24165	CCDS5236.2	6																																																																																			-	superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin		0.547	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	protein_coding	OTTHUMT00000334755.2	C	NM_182961	-		152473241	-1	no_errors	ENST00000265368	ensembl	human	known	74_37	silent	SNP	1.000	T
UGT8	7368	genome.wustl.edu	37	4	115544435	115544435	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr4:115544435C>A	ENST00000310836.6	+	2	921	c.399C>A	c.(397-399)gaC>gaA	p.D133E	UGT8_ENST00000394511.3_Missense_Mutation_p.D133E	NM_001128174.1	NP_001121646	Q16880	CGT_HUMAN	UDP glycosyltransferase 8	133					axon cargo transport (GO:0008088)|central nervous system development (GO:0007417)|cytoskeleton organization (GO:0007010)|galactosylceramide biosynthetic process (GO:0006682)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to paranode region of axon (GO:0002175)	integral component of membrane (GO:0016021)	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity (GO:0003851)|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity (GO:0008489)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)		AAAAATTTGACCTGCTGCTGG	0.428																																																	0								ENSG00000174607						159.0	159.0	159.0					4																	115544435		2203	4300	6503	UGT8	SO:0001583	missense	0			-	HGNC	AK127970	CCDS3705.1	4q26	2013-02-21	2008-07-31	2005-07-20	ENSG00000174607	ENSG00000174607	2.4.1.45	"""UDP glucuronosyltransferases"""	12555	protein-coding gene	gene with protein product	"""2-hydroxyacylsphingosine 1-beta-galactosyltransferase"""	601291	"""UDP-galactose ceramide galactosyltransferase"""	CGT		8661025	Standard	NM_003360		Approved		uc003ibs.2	Q16880	OTTHUMG00000132915	ENST00000310836.6:c.399C>A	4.37:g.115544435C>A	ENSP00000311648:p.Asp133Glu	Somatic	0	48	0.00		0.6081089112834981	4	33.33	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	B3KXU7|O00196	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.D133E	ENST00000310836.6	37	c.399	CCDS3705.1	4	.	.	.	.	.	.	.	.	.	.	C	17.15	3.316113	0.60524	.	.	ENSG00000174607	ENST00000310836;ENST00000507710;ENST00000394511	T;T;T	0.12147	2.71;2.71;2.71	5.19	2.5	0.30297	.	0.000000	0.85682	D	0.000000	T	0.32315	0.0825	M	0.75884	2.315	0.58432	D	0.999995	D	0.61080	0.989	D	0.70716	0.97	T	0.02983	-1.1086	10	0.59425	D	0.04	.	9.5206	0.39133	0.0:0.711:0.0:0.289	.	133	Q16880	CGT_HUMAN	E	133	ENSP00000311648:D133E;ENSP00000421446:D133E;ENSP00000378019:D133E	ENSP00000311648:D133E	D	+	3	2	UGT8	115763884	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.640000	0.37186	0.702000	0.31825	-0.143000	0.13931	GAC	-	pfam_UDP_glucos_trans		0.428	UGT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT8	protein_coding	OTTHUMT00000256426.2	C	NM_003360	-		115544435	+1	no_errors	ENST00000310836	ensembl	human	known	74_37	missense	SNP	1.000	A
ORC2	4999	genome.wustl.edu	37	2	201778717	201778717	+	Splice_Site	SNP	T	T	A	rs200066674|rs201460825	byFrequency	TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr2:201778717T>A	ENST00000234296.2	-	16	1716		c.e16-2			NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2						DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						AAAATTCCCCTAAAAAAAAAA	0.289																																																	0								ENSG00000115942						33.0	34.0	34.0					2																	201778717		2201	4300	6501	ORC2	SO:0001630	splice_region_variant	0			-	HGNC		CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.1467-2A>T	2.37:g.201778717T>A		Somatic	1	120	0.76		0.6081089112834981	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	123	9.15	Q13204|Q53TX5	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e14-2	ENST00000234296.2	37	c.1467-2	CCDS2334.1	2	.	.	.	.	.	.	.	.	.	.	T	18.47	3.631382	0.67015	.	.	ENSG00000115942	ENST00000234296	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0919	0.72201	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ORC2	201486962	1.000000	0.71417	0.982000	0.44146	0.760000	0.43138	7.328000	0.79160	1.949000	0.56562	0.533000	0.62120	.	-	-		0.289	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORC2	protein_coding	OTTHUMT00000256191.2	T	NM_006190	-	Intron	201778717	-1	no_errors	ENST00000234296	ensembl	human	known	74_37	splice_site	SNP	1.000	A
MUC3A	4584	genome.wustl.edu	37	7	100608194	100608195	+	Intron	INS	-	-	GTCTGGG			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr7:100608194_100608195insGTCTGGG	ENST00000319509.7	+	6	2041				RP11-395B7.2_ENST00000434775.1_RNA|RP11-395B7.2_ENST00000420080.1_RNA			Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						GTGGCCCCTCCACACTCCCCCA	0.614																																																	0								ENSG00000225946																																			RP11-395B7.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.2042-112->GTCTGGG	7.37:g.100608194_100608195insGTCTGGG		Somatic	NA	NA	NA		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000319509.7	37	NULL		7																																																																																			-	-		0.614	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	ENSG00000225946	protein_coding	OTTHUMT00000347215.1	-	XM_001725354			100608195	-1	no_errors	ENST00000420080	ensembl	human	known	74_37	rna	INS	0.001:0.000	GTCTGGG
TUBA3E	112714	genome.wustl.edu	37	2	130951829	130951829	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr2:130951829C>T	ENST00000312988.7	-	4	686	c.586G>A	c.(586-588)Gaa>Aaa	p.E196K		NM_207312.2	NP_997195	Q6PEY2	TBA3E_HUMAN	tubulin, alpha 3e	196					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|kidney(7)|large_intestine(6)|lung(9)|skin(2)	28	Colorectal(110;0.1)					TCAGAATGTTCCAGGGTCGTG	0.537																																																	0								ENSG00000152086						101.0	101.0	101.0					2																	130951829		2200	4291	6491	TUBA3E	SO:0001583	missense	0			-	HGNC	BC057811	CCDS2158.1	2q21.1	2007-03-16			ENSG00000152086	ENSG00000152086		"""Tubulins"""	20765	protein-coding gene	gene with protein product							Standard	NM_207312		Approved		uc002tqv.3	Q6PEY2	OTTHUMG00000131626	ENST00000312988.7:c.586G>A	2.37:g.130951829C>T	ENSP00000318197:p.Glu196Lys	Somatic	0	103	0.00		0.6081089112834981	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	52	46	52.53		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin	p.E196K	ENST00000312988.7	37	c.586	CCDS2158.1	2	.	.	.	.	.	.	.	.	.	.	c	15.94	2.980416	0.53827	.	.	ENSG00000152086	ENST00000312988	T	0.70282	-0.47	2.71	2.71	0.32032	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.50627	U	0.000114	D	0.85004	0.5598	H	0.95224	3.64	0.48696	D	0.999694	P	0.35656	0.514	P	0.50970	0.655	D	0.87893	0.2685	10	0.87932	D	0	.	11.1953	0.48709	0.0:1.0:0.0:0.0	.	196	Q6PEY2	TBA3E_HUMAN	K	196	ENSP00000318197:E196K	ENSP00000318197:E196K	E	-	1	0	TUBA3E	130668299	1.000000	0.71417	0.980000	0.43619	0.880000	0.50808	6.636000	0.74299	1.540000	0.49301	0.449000	0.29647	GAA	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin		0.537	TUBA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA3E	protein_coding	OTTHUMT00000254519.1	C	NM_207312	-		130951829	-1	no_errors	ENST00000312988	ensembl	human	known	74_37	missense	SNP	1.000	T
RANBP17	64901	genome.wustl.edu	37	5	170632550	170632550	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr5:170632550G>C	ENST00000523189.1	+	20	2329	c.2165G>C	c.(2164-2166)aGa>aCa	p.R722T	RANBP17_ENST00000521759.1_3'UTR	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	722					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GGGCTGGCAAGAGATCTTCGA	0.448			T	TRD@	ALL																																			Dom	yes		5	5q34	64901	RAN binding protein 17		L	0								ENSG00000204764						196.0	166.0	176.0					5																	170632550		2203	4300	6503	RANBP17	SO:0001583	missense	0			-	HGNC	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.2165G>C	5.37:g.170632550G>C	ENSP00000427975:p.Arg722Thr	Somatic	0	60	0.00		0.6081089112834981	32	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	96	15.04	Q8IU74	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.R722T	ENST00000523189.1	37	c.2165	CCDS34287.1	5	.	.	.	.	.	.	.	.	.	.	G	23.9	4.470959	0.84533	.	.	ENSG00000204764	ENST00000523189;ENST00000534916	T	0.67698	-0.28	5.96	5.96	0.96718	Armadillo-type fold (1);	0.000000	0.64402	D	0.000002	D	0.87059	0.6083	M	0.93808	3.46	0.53005	D	0.999964	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.74674	0.979;0.984;0.979	D	0.88511	0.3089	10	0.54805	T	0.06	-14.8189	20.017	0.97481	0.0:0.0:1.0:0.0	.	722;47;722	Q546R4;Q96M10;Q9H2T7	.;.;RBP17_HUMAN	T	722;152	ENSP00000427975:R722T	ENSP00000427975:R722T	R	+	2	0	RANBP17	170565155	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.428000	0.90278	2.832000	0.97577	0.655000	0.94253	AGA	-	superfamily_ARM-type_fold		0.448	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RANBP17	protein_coding	OTTHUMT00000372036.1	G	NM_022897	-		170632550	+1	no_errors	ENST00000523189	ensembl	human	known	74_37	missense	SNP	1.000	C
FLT1	2321	genome.wustl.edu	37	13	29041107	29041107	+	Nonsense_Mutation	SNP	G	G	T	rs142924808		TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr13:29041107G>T	ENST00000282397.4	-	3	572	c.321C>A	c.(319-321)tgC>tgA	p.C107*	FLT1_ENST00000539099.1_Nonsense_Mutation_p.C107*|FLT1_ENST00000541932.1_Nonsense_Mutation_p.C107*	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	107	Ig-like C2-type 1.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTAGATATTTGCAGCTGTAGA	0.373																																																	0								ENSG00000102755						175.0	165.0	169.0					13																	29041107		2203	4300	6503	FLT1	SO:0001587	stop_gained	0			-	HGNC	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.321C>A	13.37:g.29041107G>T	ENSP00000282397:p.Cys107*	Somatic	0	42	0.00		0.6081089112834981	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR1_rcpt	p.C107*	ENST00000282397.4	37	c.321	CCDS9330.1	13	.	.	.	.	.	.	.	.	.	.	G	39	7.628217	0.98399	.	.	ENSG00000102755	ENST00000282397;ENST00000541932;ENST00000450836;ENST00000539099	.	.	.	5.81	4.96	0.65561	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.6452	0.62277	0.0725:0.0:0.9275:0.0	.	.	.	.	X	107	.	ENSP00000282397:C107X	C	-	3	2	FLT1	27939107	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	3.100000	0.50275	1.436000	0.47453	0.650000	0.86243	TGC	-	smart_Ig_sub,pfscan_Ig-like_dom		0.373	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT1	protein_coding	OTTHUMT00000044322.1	G		-		29041107	-1	no_errors	ENST00000282397	ensembl	human	known	74_37	nonsense	SNP	1.000	T
NINL	22981	genome.wustl.edu	37	20	25443278	25443279	+	Intron	INS	-	-	TTTGTTTTGT	rs200513281|rs377227803|rs113237945		TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr20:25443278_25443279insTTTGTTTTGT	ENST00000278886.6	-	20	3497				NINL_ENST00000422516.1_Intron	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						TTAAGTAGTCAtttgttttgtt	0.361																																																	0								ENSG00000101004																																			NINL	SO:0001627	intron_variant	0				HGNC		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.3424-101->ACAAAACAAA	20.37:g.25443279_25443288dupTTTGTTTTGT		Somatic	NA	NA	NA		0.6081089112834981	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000278886.6	37	NULL	CCDS33452.1	20																																																																																			-	-		0.361	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NINL	protein_coding	OTTHUMT00000078445.3	-	NM_025176			25443279	-1	no_errors	ENST00000496509	ensembl	human	known	74_37	rna	INS	0.010:0.013	TTTGTTTTGT
MPDZ	8777	genome.wustl.edu	37	9	13121767	13121767	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr9:13121767delT	ENST00000319217.7	-	38	5449	c.5202delA	c.(5200-5202)aaafs	p.K1734fs	MPDZ_ENST00000541718.1_Frame_Shift_Del_p.K1734fs|MPDZ_ENST00000536827.1_Frame_Shift_Del_p.K1701fs|MPDZ_ENST00000546205.1_Frame_Shift_Del_p.K1748fs|MPDZ_ENST00000381015.4_Frame_Shift_Del_p.K1734fs|MPDZ_ENST00000381022.2_Frame_Shift_Del_p.K1734fs|MPDZ_ENST00000447879.1_Frame_Shift_Del_p.K1701fs|MPDZ_ENST00000538841.1_Frame_Shift_Del_p.K593fs|MPDZ_ENST00000541093.1_5'UTR	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1734	PDZ 11. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		ATCCTAGGCCTTTTCCCGGCT	0.453																																																	0								ENSG00000107186						117.0	112.0	114.0					9																	13121767		1934	4151	6085	MPDZ	SO:0001589	frameshift_variant	0				HGNC	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.5202delA	9.37:g.13121767delT	ENSP00000320006:p.Lys1734fs	Somatic	0	43	0.00		0.6081089112834981	24	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_PDZ,pfscan_L27,pfscan_PDZ	p.G1735fs	ENST00000319217.7	37	c.5202		9																																																																																			-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ		0.453	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	MPDZ	protein_coding	OTTHUMT00000055485.2	T	NM_003829			13121767	-1	no_errors	ENST00000319217	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
CRTC2	200186	genome.wustl.edu	37	1	153924094	153924094	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:153924094T>C	ENST00000368633.1	-	11	1173	c.1046A>G	c.(1045-1047)aAt>aGt	p.N349S	CRTC2_ENST00000476883.1_5'Flank|CRTC2_ENST00000368630.3_Intron	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	349	Ser-rich.				gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)			NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GAGGTTGGGATTGCTTAGGGA	0.582																																																	0								ENSG00000160741						86.0	89.0	88.0					1																	153924094		2203	4300	6503	CRTC2	SO:0001583	missense	0			-	HGNC	AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.1046A>G	1.37:g.153924094T>C	ENSP00000357622:p.Asn349Ser	Somatic	0	34	0.00		0.6081089112834981	118	59.45	173	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	58	48.21	Q6UUV8|Q7Z3X7|Q8N332	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.N349S	ENST00000368633.1	37	c.1046	CCDS30875.1	1	.	.	.	.	.	.	.	.	.	.	T	11.74	1.728880	0.30684	.	.	ENSG00000160741	ENST00000368633	T	0.12361	2.69	4.35	4.35	0.52113	.	0.132595	0.48286	D	0.000195	T	0.17152	0.0412	M	0.62723	1.935	0.35480	D	0.798072	D	0.63880	0.993	D	0.72625	0.978	T	0.06789	-1.0807	10	0.13853	T	0.58	-9.5422	11.5331	0.50622	0.0:0.0:0.0:1.0	.	349	Q53ET0	CRTC2_HUMAN	S	349	ENSP00000357622:N349S	ENSP00000357622:N349S	N	-	2	0	CRTC2	152190718	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.776000	0.75023	1.836000	0.53414	0.455000	0.32223	AAT	-	NULL		0.582	CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	CRTC2	protein_coding	OTTHUMT00000090272.3	T	NM_181715	-		153924094	-1	no_errors	ENST00000368633	ensembl	human	known	74_37	missense	SNP	1.000	C
ANGEL2	90806	genome.wustl.edu	37	1	213186627	213186627	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:213186627G>T	ENST00000366962.3	-	2	347	c.193C>A	c.(193-195)Cct>Act	p.P65T	ANGEL2_ENST00000544555.1_Intron|ANGEL2_ENST00000540642.1_Intron|ANGEL2_ENST00000360506.2_Intron|ANGEL2_ENST00000535388.1_Intron	NM_144567.3	NP_653168.2	Q5VTE6	ANGE2_HUMAN	angel homolog 2 (Drosophila)	65										central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(1)	24				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		TATGGGTAAGGAGCTCGAGAG	0.463																																																	0								ENSG00000174606						157.0	151.0	153.0					1																	213186627		2203	4300	6503	ANGEL2	SO:0001583	missense	0			-	HGNC	AL079275	CCDS1512.1, CCDS73027.1	1q32.3	2014-06-17			ENSG00000174606	ENSG00000174606			30534	protein-coding gene	gene with protein product						11943475	Standard	XM_005273344		Approved	KIAA0759L, FLJ12793, Ccr4d	uc001hjz.3	Q5VTE6	OTTHUMG00000036927	ENST00000366962.3:c.193C>A	1.37:g.213186627G>T	ENSP00000355929:p.Pro65Thr	Somatic	0	76	0.00		0.6081089112834981	32	11.11	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	51	74	40.80	B7Z2U4|D3DTA3|Q86X13|Q8NHH3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.P65T	ENST00000366962.3	37	c.193	CCDS1512.1	1	.	.	.	.	.	.	.	.	.	.	G	14.04	2.417248	0.42918	.	.	ENSG00000174606	ENST00000366962;ENST00000310246	T	0.23552	1.9	5.53	5.53	0.82687	.	0.131051	0.51477	D	0.000087	T	0.29620	0.0739	L	0.32530	0.975	0.80722	D	1	D;P	0.56521	0.976;0.91	P;B	0.52481	0.7;0.335	T	0.00651	-1.1626	10	0.41790	T	0.15	-16.9548	12.6382	0.56694	0.1192:0.0:0.8808:0.0	.	43;65	Q96AL9;Q5VTE6	.;ANGE2_HUMAN	T	65;43	ENSP00000355929:P65T	ENSP00000309755:P43T	P	-	1	0	ANGEL2	211253250	0.999000	0.42202	0.713000	0.30519	0.720000	0.41350	3.108000	0.50337	2.745000	0.94114	0.563000	0.77884	CCT	-	NULL		0.463	ANGEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL2	protein_coding	OTTHUMT00000089693.1	G	NM_144567	-		213186627	-1	no_errors	ENST00000366962	ensembl	human	known	74_37	missense	SNP	0.993	T
MRPL42	28977	genome.wustl.edu	37	12	93881334	93881334	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr12:93881334delC	ENST00000549982.1	+	5	442	c.281delC	c.(280-282)accfs	p.T94fs	MRPL42_ENST00000552217.1_Frame_Shift_Del_p.T94fs|MRPL42_ENST00000547098.1_Frame_Shift_Del_p.T94fs|MRPL42_ENST00000548545.1_Frame_Shift_Del_p.T94fs|MRPL42_ENST00000361630.2_Frame_Shift_Del_p.T94fs|MRPL42_ENST00000393128.4_Frame_Shift_Del_p.T94fs	NM_014050.3|NM_172177.3	NP_054769.1|NP_751917.1	Q9Y6G3	RM42_HUMAN	mitochondrial ribosomal protein L42	94					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)	7						GTGCTGAAAACCAGATTGGAA	0.393																																																	0								ENSG00000198015						135.0	122.0	126.0					12																	93881334		2203	4300	6503	MRPL42	SO:0001589	frameshift_variant	0				HGNC	AB051626	CCDS9045.1	12q22	2014-02-12			ENSG00000198015	ENSG00000198015		"""Mitochondrial ribosomal proteins / large subunits"", ""Mitochondrial ribosomal proteins / small subunits"""	14493	protein-coding gene	gene with protein product	"""mitochondrial ribosomal protein S32"""	611847				11279123, 11042152	Standard	NM_014050		Approved	MRPS32, MRP-L31, RPML31, PTD007, HSPC204, MRPL31	uc001tcr.3	Q9Y6G3	OTTHUMG00000170157	ENST00000549982.1:c.281delC	12.37:g.93881334delC	ENSP00000449884:p.Thr94fs	Somatic	0	64	0.00		0.6081089112834981	512	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	90	558	13.89	Q6FID1|Q96Q48|Q9P0S1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ribosomal-S32_mit	p.R95fs	ENST00000549982.1	37	c.281	CCDS9045.1	12																																																																																			-	pfam_Ribosomal-S32_mit		0.393	MRPL42-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPL42	protein_coding	OTTHUMT00000407715.1	C	NM_014050			93881334	+1	no_errors	ENST00000361630	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
TPCN2	219931	genome.wustl.edu	37	11	68854656	68854656	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr11:68854656C>T	ENST00000294309.3	+	24	2263	c.2162C>T	c.(2161-2163)aCt>aTt	p.T721I	TPCN2_ENST00000542467.1_Missense_Mutation_p.T539I|TPCN2_ENST00000442692.2_3'UTR	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	721					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TACCAGATGACTGTGGAGCTC	0.657																																																	0								ENSG00000162341						41.0	43.0	42.0					11																	68854656		2200	4294	6494	TPCN2	SO:0001583	missense	0			-	HGNC	AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.2162C>T	11.37:g.68854656C>T	ENSP00000294309:p.Thr721Ile	Somatic	0	72	0.00		0.6081089112834981	91	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q9NT82	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom	p.T721I	ENST00000294309.3	37	c.2162	CCDS8189.1	11	.	.	.	.	.	.	.	.	.	.	C	15.53	2.860977	0.51482	.	.	ENSG00000162341	ENST00000294309;ENST00000542467	D;D	0.98090	-4.29;-4.71	4.32	3.39	0.38822	.	0.994201	0.08146	N	0.990877	D	0.97586	0.9209	M	0.71581	2.175	0.09310	N	1	P;P	0.48230	0.856;0.907	B;P	0.47744	0.282;0.556	D	0.91788	0.5441	10	0.66056	D	0.02	-9.2842	14.0797	0.64912	0.0:0.8477:0.1523:0.0	.	539;721	E7ETX0;Q8NHX9	.;TPC2_HUMAN	I	721;539	ENSP00000294309:T721I;ENSP00000445551:T539I	ENSP00000294309:T721I	T	+	2	0	TPCN2	68611232	0.147000	0.22687	0.001000	0.08648	0.262000	0.26303	3.350000	0.52224	0.928000	0.37168	0.561000	0.74099	ACT	-	NULL		0.657	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPCN2	protein_coding	OTTHUMT00000396878.2	C	NM_139075	-		68854656	+1	no_errors	ENST00000294309	ensembl	human	known	74_37	missense	SNP	0.015	T
FLNA	2316	genome.wustl.edu	37	X	153587439	153587439	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chrX:153587439C>G	ENST00000369850.3	-	26	4623	c.4387G>C	c.(4387-4389)Gtt>Ctt	p.V1463L	FLNA_ENST00000422373.1_Missense_Mutation_p.V1463L|FLNA_ENST00000344736.4_Missense_Mutation_p.V1463L|FLNA_ENST00000360319.4_Missense_Mutation_p.V1463L|FLNA_ENST00000369856.3_5'Flank	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1463					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TTGGCACGAACCATGCCTGGG	0.587																																																	0								ENSG00000196924						141.0	146.0	144.0					X																	153587439		2084	4209	6293	FLNA	SO:0001583	missense	0			-	HGNC	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.4387G>C	X.37:g.153587439C>G	ENSP00000358866:p.Val1463Leu	Somatic	0	58	0.00		0.6081089112834981	1614	0.06	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	44	29.03	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.V1463L	ENST00000369850.3	37	c.4387	CCDS48194.1	X	.	.	.	.	.	.	.	.	.	.	C	22.9	4.351449	0.82132	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.91577	-2.87;-2.87;-2.87;-2.87	5.69	5.69	0.88448	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	D	0.94142	0.8121	L	0.60067	1.865	0.80722	D	1	D;P	0.69078	0.997;0.767	D;P	0.69142	0.962;0.475	D	0.94629	0.7820	10	0.87932	D	0	.	17.4064	0.87474	0.0:1.0:0.0:0.0	.	1463;1463	P21333-2;P21333	.;FLNA_HUMAN	L	1463;1436;1463;1463;1463	ENSP00000353467:V1463L;ENSP00000416926:V1463L;ENSP00000358866:V1463L;ENSP00000358863:V1463L	ENSP00000358863:V1463L	V	-	1	0	FLNA	153240633	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	4.910000	0.63321	2.379000	0.81126	0.600000	0.82982	GTT	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like		0.587	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNA	protein_coding	OTTHUMT00000058942.3	C		-		153587439	-1	no_errors	ENST00000369850	ensembl	human	known	74_37	missense	SNP	1.000	G
XPO4	64328	genome.wustl.edu	37	13	21361716	21361716	+	Silent	SNP	C	C	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr13:21361716C>T	ENST00000255305.6	-	21	3140	c.3069G>A	c.(3067-3069)caG>caA	p.Q1023Q	XPO4_ENST00000400602.2_Silent_p.Q1023Q			Q9C0E2	XPO4_HUMAN	exportin 4	1023					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		CCAGGCAAAGCTGGCAAACCT	0.378																																																	0								ENSG00000132953						127.0	125.0	125.0					13																	21361716		1898	4125	6023	XPO4	SO:0001819	synonymous_variant	0			-	HGNC	AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.3069G>A	13.37:g.21361716C>T		Somatic	0	34	0.00		0.6081089112834981	16	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q5VUZ5|Q8N3V6|Q9H934	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.Q1023	ENST00000255305.6	37	c.3069	CCDS41872.1	13																																																																																			-	superfamily_ARM-type_fold		0.378	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	XPO4	protein_coding	OTTHUMT00000044096.1	C	NM_022459	-		21361716	-1	no_errors	ENST00000255305	ensembl	human	known	74_37	silent	SNP	1.000	T
MUC3A	4584	genome.wustl.edu	37	7	100608197	100608198	+	Intron	INS	-	-	GGG	rs373235112		TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr7:100608197_100608198insGGG	ENST00000319509.7	+	6	2041				RP11-395B7.2_ENST00000434775.1_RNA|RP11-395B7.2_ENST00000420080.1_RNA			Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						GCCCCTCCACACTCCCCCAGAC	0.609																																																	0								ENSG00000225946																																			RP11-395B7.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.2042-109->GGG	7.37:g.100608197_100608198insGGG		Somatic	0	15	0.00		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67	O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000319509.7	37	NULL		7																																																																																			-	-		0.609	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	ENSG00000225946	protein_coding	OTTHUMT00000347215.1	-	XM_001725354			100608198	-1	no_errors	ENST00000420080	ensembl	human	known	74_37	rna	INS	0.000:0.000	GGG
ENAH	55740	genome.wustl.edu	37	1	225707034	225707051	+	In_Frame_Del	DEL	TCCAGGCGTTCCTGCCGC	TCCAGGCGTTCCTGCCGC	-	rs148381397|rs566336314|rs71170086|rs140432837|rs372263028	byFrequency	TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	TCCAGGCGTTCCTGCCGC	TCCAGGCGTTCCTGCCGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:225707034_225707051delTCCAGGCGTTCCTGCCGC	ENST00000366844.3	-	5	1102_1119	c.651_668delGCGGCAGGAACGCCTGGA	c.(649-669)gagcggcaggaacgcctggat>gat	p.ERQERL217del	ENAH_ENST00000391874.2_5'UTR|ENAH_ENST00000284563.6_In_Frame_Del_p.ERQERL236del|ENAH_ENST00000366843.2_In_Frame_Del_p.ERQERL217del	NM_001008493.1|NM_018212.4	NP_001008493.1|NP_060682.2	Q8N8S7	ENAH_HUMAN	enabled homolog (Drosophila)	217					actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|intracellular transport (GO:0046907)|neural tube closure (GO:0001843)|T cell receptor signaling pathway (GO:0050852)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)|synapse (GO:0045202)	WW domain binding (GO:0050699)			NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.19)		CCTCTCCCGATCCAGGcgttcctgccgctccaggcgtt	0.592																																																	0								ENSG00000154380																																			ENAH	SO:0001651	inframe_deletion	0				HGNC	AK001635	CCDS31040.1, CCDS31041.1	1q32.2	2013-08-06			ENSG00000154380	ENSG00000154380			18271	protein-coding gene	gene with protein product	"""mammalian enabled"""	609061				1420303	Standard	XM_005273182		Approved	FLJ10773, NDPP1, MENA	uc001hpc.1	Q8N8S7	OTTHUMG00000037742	ENST00000366844.3:c.651_668delGCGGCAGGAACGCCTGGA	1.37:g.225707034_225707051delTCCAGGCGTTCCTGCCGC	ENSP00000355809:p.Glu217_Leu222del	Somatic	NA	NA	NA		0.6081089112834981	307	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	D0PQI2|Q502W5|Q5T5M7|Q5VTQ9|Q5VTR0|Q9NVF3|Q9UFB8	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_WH1/EVH1,pfam_VASP_tetra,smart_WH1/EVH1,pfscan_WH1/EVH1	p.ERQERL217in_frame_del	ENST00000366844.3	37	c.668_651	CCDS31041.1	1																																																																																			-	NULL		0.592	ENAH-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENAH	protein_coding	OTTHUMT00000357426.2	TCCAGGCGTTCCTGCCGC	NM_018212			225707051	-1	no_errors	ENST00000366844	ensembl	human	known	74_37	in_frame_del	DEL	0.907:0.905:0.902:0.900:0.899:0.898:0.897:0.897:0.897:0.898:0.899:0.901:0.903:0.906:0.909:0.913:0.917:0.921	-
STK36	27148	genome.wustl.edu	37	2	219562254	219562254	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr2:219562254C>A	ENST00000295709.3	+	24	3109	c.2830C>A	c.(2830-2832)Ctg>Atg	p.L944M	STK36_ENST00000440309.1_Missense_Mutation_p.L944M|STK36_ENST00000392106.2_Missense_Mutation_p.L923M|STK36_ENST00000392105.3_Missense_Mutation_p.L923M	NM_015690.4	NP_056505.2			serine/threonine kinase 36											biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		CCTGAGCTGCCTGTCCCAGCA	0.552																																																	0								ENSG00000163482						75.0	68.0	70.0					2																	219562254		2203	4300	6503	STK36	SO:0001583	missense	0			-	HGNC	AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.2830C>A	2.37:g.219562254C>A	ENSP00000295709:p.Leu944Met	Somatic	0	30	0.00		0.6081089112834981	32	3.03	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L944M	ENST00000295709.3	37	c.2830	CCDS2421.1	2	.	.	.	.	.	.	.	.	.	.	C	15.82	2.947042	0.53186	.	.	ENSG00000163482	ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309	T;T;T;T	0.79554	-1.25;-1.27;-1.28;-1.25	5.24	2.27	0.28462	.	0.000000	0.33057	N	0.005323	T	0.80166	0.4573	L	0.32530	0.975	0.37569	D	0.919375	D;P;P	0.76494	0.999;0.949;0.915	D;P;P	0.83275	0.996;0.712;0.519	T	0.77624	-0.2518	10	0.36615	T	0.2	-2.9825	5.476	0.16695	0.1444:0.6054:0.0:0.2502	.	923;923;944	A8MU99;Q9NRP7-2;Q9NRP7	.;.;STK36_HUMAN	M	944;923;923;944	ENSP00000295709:L944M;ENSP00000375955:L923M;ENSP00000375954:L923M;ENSP00000394095:L944M	ENSP00000295709:L944M	L	+	1	2	STK36	219270498	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	0.947000	0.29082	0.792000	0.33850	0.655000	0.94253	CTG	-	NULL		0.552	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK36	protein_coding	OTTHUMT00000256723.2	C		-		219562254	+1	no_errors	ENST00000295709	ensembl	human	known	74_37	missense	SNP	0.998	A
BHLHB9	80823	genome.wustl.edu	37	X	102003976	102003976	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chrX:102003976C>T	ENST00000372735.1	+	4	638	c.53C>T	c.(52-54)gCt>gTt	p.A18V	BHLHB9_ENST00000447531.1_Missense_Mutation_p.A18V|BHLHB9_ENST00000361229.4_Missense_Mutation_p.A18V|BHLHB9_ENST00000457056.1_Missense_Mutation_p.A18V|BHLHB9_ENST00000448867.1_Missense_Mutation_p.A18V			Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class B, 9	18					learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neurogenesis (GO:0050769)|positive regulation of synapse assembly (GO:0051965)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GAAAAAAAGGCTGCTATACAA	0.507																																																	0								ENSG00000198908						74.0	68.0	70.0					X																	102003976		2203	4300	6503	BHLHB9	SO:0001583	missense	0			-	HGNC	AB051488	CCDS14502.1	Xq23	2014-03-21			ENSG00000198908	ENSG00000198908		"""Basic helix-loop-helix proteins"", ""Armadillo repeat containing"""	29353	protein-coding gene	gene with protein product		300921				11214970, 15034937, 16221301	Standard	NM_030639		Approved	p60TRP, KIAA1701, GASP3	uc011mrv.2	Q6PI77	OTTHUMG00000022060	ENST00000372735.1:c.53C>T	X.37:g.102003976C>T	ENSP00000361820:p.Ala18Val	Somatic	0	37	0.00		0.6081089112834981	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q9C0G2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.A18V	ENST00000372735.1	37	c.53	CCDS14502.1	X	.	.	.	.	.	.	.	.	.	.	C	8.974	0.973685	0.18736	.	.	ENSG00000198908	ENST00000457056;ENST00000361229;ENST00000447531;ENST00000448867;ENST00000372735	T;T;T;T;T	0.13778	2.56;2.56;2.56;2.56;2.56	4.07	4.07	0.47477	.	.	.	.	.	T	0.10594	0.0259	L	0.27053	0.805	0.09310	N	1	B	0.26081	0.141	B	0.22152	0.038	T	0.17471	-1.0368	8	.	.	.	-13.445	13.2841	0.60232	0.0:1.0:0.0:0.0	.	18	Q6PI77	BHLH9_HUMAN	V	18	ENSP00000403226:A18V;ENSP00000354675:A18V;ENSP00000405893:A18V;ENSP00000391722:A18V;ENSP00000361820:A18V	.	A	+	2	0	BHLHB9	101890632	0.133000	0.22466	0.004000	0.12327	0.021000	0.10359	2.075000	0.41538	2.299000	0.77371	0.436000	0.28706	GCT	-	NULL		0.507	BHLHB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BHLHB9	protein_coding	OTTHUMT00000057630.1	C	NM_030639	-		102003976	+1	no_errors	ENST00000361229	ensembl	human	known	74_37	missense	SNP	0.007	T
PTPRVP	148713	genome.wustl.edu	37	1	202146847	202146847	+	RNA	SNP	C	C	T	rs558301725		TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:202146847C>T	ENST00000482597.1	+	0	2029					NR_002930.2				protein tyrosine phosphatase, receptor type, V, pseudogene																		GCAACCTCTCCCTGTCAGTGC	0.662													C|||	1	0.000199681	0.0	0.0	5008	,	,		20092	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000243323																																			PTPRVP			0			-	HGNC	AJ629456		1q32.1	2013-09-26	2010-03-16	2010-03-16	ENSG00000243323	ENSG00000243323		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	13421	pseudogene	pseudogene				PTPRV		15358244	Standard	NR_002930		Approved	OST-PTP, ESP	uc009xaa.2		OTTHUMG00000040524		1.37:g.202146847C>T		Somatic	0	36	0.00		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	35	25.53		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000482597.1	37	NULL		1																																																																																			-	-		0.662	PTPRVP-003	KNOWN	basic	processed_transcript	PTPRVP	pseudogene	OTTHUMT00000334021.1	C	XM_086287	-		202146847	+1	no_errors	ENST00000482597	ensembl	human	known	74_37	rna	SNP	0.347	T
CYP39A1	51302	genome.wustl.edu	37	6	46518104	46518104	+	Silent	SNP	C	C	T	rs200048080		TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr6:46518104C>T	ENST00000275016.2	-	12	1612	c.1409G>A	c.(1408-1410)tGa>tAa	p.*470*		NM_016593.3	NP_057677.2	Q9NYL5	CP39A_HUMAN	cytochrome P450, family 39, subfamily A, polypeptide 1	0					bile acid biosynthetic process (GO:0006699)|bile acid catabolic process (GO:0030573)|bile acid metabolic process (GO:0008206)|cholesterol catabolic process (GO:0006707)|digestion (GO:0007586)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	24-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033782)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)|steroid 7-alpha-hydroxylase activity (GO:0008387)		EIF3K/CYP39A1(2)	NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)	21						CAACAGATGTCATATTCTTTG	0.478																																																	0								ENSG00000146233						130.0	136.0	134.0					6																	46518104		2203	4300	6503	CYP39A1	SO:0001819	synonymous_variant	0			-	HGNC	AF237982	CCDS4916.1, CCDS75465.1	6p21.1-p11.2	2008-02-05	2003-01-14		ENSG00000146233	ENSG00000146233		"""Cytochrome P450s"""	17449	protein-coding gene	gene with protein product		605994	"""cytochrome P450, subfamily XXXIX (oxysterol 7 alpha-hydroxylase), polypeptide 1"""			10748047	Standard	NM_016593		Approved		uc003oyf.1	Q9NYL5	OTTHUMG00000014785	ENST00000275016.2:c.1409G>A	6.37:g.46518104C>T		Somatic	0	47	0.00		0.6081089112834981	20	80.95	85	WXS	Illumina HiSeq 2500	Phase_IV	tier1	202	30	86.70	Q5VTT0|Q96FW5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I	p.*470	ENST00000275016.2	37	c.1409	CCDS4916.1	6																																																																																			-	NULL		0.478	CYP39A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP39A1	protein_coding	OTTHUMT00000040787.1	C		-		46518104	-1	no_errors	ENST00000275016	ensembl	human	known	74_37	silent	SNP	0.929	T
NDUFAF1	51103	genome.wustl.edu	37	15	41689216	41689216	+	Silent	SNP	G	G	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr15:41689216G>T	ENST00000260361.4	-	2	423	c.42C>A	c.(40-42)ctC>ctA	p.L14L		NM_016013.3	NP_057097.2	Q9Y375	CIA30_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 1	14					mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|mitochondrial respiratory chain complex I (GO:0005747)	unfolded protein binding (GO:0051082)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	12		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;8e-17)|GBM - Glioblastoma multiforme(113;1.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.114)		AGAATTTTCTGAGAAAATAAG	0.423																																																	0								ENSG00000137806						38.0	39.0	38.0					15																	41689216		2202	4299	6501	NDUFAF1	SO:0001819	synonymous_variant	0			-	HGNC	AF151823	CCDS10075.1	15q11.2-q21.3	2012-10-12	2012-05-08		ENSG00000137806	ENSG00000137806		"""Mitochondrial respiratory chain complex assembly factors"""	18828	protein-coding gene	gene with protein product		606934				11935339, 10810093	Standard	NM_016013		Approved	CIA30, CGI-65	uc001znx.3	Q9Y375	OTTHUMG00000130340	ENST00000260361.4:c.42C>A	15.37:g.41689216G>T		Somatic	0	52	0.00		0.6081089112834981	29	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q9BVZ5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_NADH-UbQ_OxRdtase-assoc_prot30,superfamily_Galactose-bd-like	p.L14	ENST00000260361.4	37	c.42	CCDS10075.1	15																																																																																			-	NULL		0.423	NDUFAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFAF1	protein_coding	OTTHUMT00000252692.2	G	NM_016013	-		41689216	-1	no_errors	ENST00000260361	ensembl	human	known	74_37	silent	SNP	0.000	T
RP11-764K9.1	0	genome.wustl.edu	37	9	68400476	68400476	+	lincRNA	SNP	G	G	C			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr9:68400476G>C	ENST00000417843.2	-	0	1343																											AGGCCACAGTGTGGACtgttg	0.483																																																	0								ENSG00000225411																																			RP11-764K9.1			0			-	Clone_based_vega_gene																													9.37:g.68400476G>C		Somatic	0	19	0.00		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	16	23.81		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			-	-		0.483	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	lincRNA	OTTHUMT00000129817.2	G		-		68400476	-1	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	SNP	0.009	C
EFCAB2	84288	genome.wustl.edu	37	1	245133623	245133624	+	Frame_Shift_Ins	INS	-	-	CCTCC	rs145835471|rs78699431|rs373891984	byFrequency	TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:245133623_245133624insCCTCC	ENST00000366522.2	+	1	340_341	c.199_200insCCTCC	c.(199-201)tccfs	p.S67fs	RP11-156E8.1_ENST00000607453.1_Frame_Shift_Ins_p.R252fs|EFCAB2_ENST00000366523.1_Intron|EFCAB2_ENST00000447569.2_5'Flank			Q5VUJ9	EFCB2_HUMAN	EF-hand calcium binding domain 2	67							calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|stomach(2)	13	all_cancers(71;2.93e-06)|all_epithelial(71;2.13e-05)|all_lung(81;0.0337)|Lung NSC(105;0.0472)|Ovarian(71;0.0584)|Breast(184;0.0716)|all_neural(11;0.0982)		OV - Ovarian serous cystadenocarcinoma(106;0.015)			GAGCGGCCCCTCCTCCAGGCCA	0.743														2490	0.497204	0.2315	0.415	5008	,	,		8334	0.7272		0.5517	False		,,,				2504	0.6217																0								ENSG00000203666																																			EFCAB2	SO:0001589	frameshift_variant	0				HGNC	AB209286	CCDS31082.1, CCDS44341.1	1q44	2014-07-18			ENSG00000203666	ENSG00000203666		"""EF-hand domain containing"""	28166	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 8"""					23427265	Standard	NM_032328		Approved	MGC12458, DRC8, CFAP200	uc001ibc.2	Q5VUJ9	OTTHUMG00000040474	ENST00000366522.2:c.200_204dupCCTCC	1.37:g.245133624_245133628dupCCTCC	ENSP00000355479:p.Ser67fs	Somatic	NA	NA	NA		0.6081089112834981	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DZE9|Q59G23|Q9BS36	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	smart_EF_hand_dom,pfscan_EF_hand_dom	p.R69fs	ENST00000366522.2	37	c.199_200		1																																																																																			-	NULL		0.743	EFCAB2-001	KNOWN	basic	protein_coding	EFCAB2	protein_coding	OTTHUMT00000097407.2	-				245133624	+1	no_errors	ENST00000366522	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.000	CCTCC
CCDC132	55610	genome.wustl.edu	37	7	92985322	92985322	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr7:92985322T>G	ENST00000305866.5	+	27	2833	c.2705T>G	c.(2704-2706)tTt>tGt	p.F902C	CCDC132_ENST00000544910.1_Missense_Mutation_p.F872C|CCDC132_ENST00000541136.1_3'UTR|CCDC132_ENST00000535481.1_Missense_Mutation_p.F622C|CCDC132_ENST00000474412.1_3'UTR	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	902						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			GATAAAGAATTTGTAGAAACT	0.348																																																	0								ENSG00000004766						46.0	45.0	45.0					7																	92985322		1822	4075	5897	CCDC132	SO:0001583	missense	0			-	HGNC	AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.2705T>G	7.37:g.92985322T>G	ENSP00000307666:p.Phe902Cys	Somatic	0	66	0.00		0.6081089112834981	14	48.28	14	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	31	59.74	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Vacuolar_sorting-assoc_54,pfam_DUF2451_C	p.F902C	ENST00000305866.5	37	c.2705	CCDS43617.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.76|18.76	3.693077|3.693077	0.68271|0.68271	.|.	.|.	ENSG00000004766|ENSG00000004766	ENST00000305866;ENST00000544910;ENST00000535481|ENST00000443443	.|.	.|.	.|.	5.77|5.77	5.77|5.77	0.91146|0.91146	Protein of unknown function DUF2451, C-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.68805|0.68805	0.3041|0.3041	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.997;0.997;0.999|.	D;P;D|.	0.70487|.	0.944;0.906;0.969|.	T|T	0.66031|0.66031	-0.6024|-0.6024	9|5	0.87932|.	D|.	0|.	-22.0032|-22.0032	16.4116|16.4116	0.83717|0.83717	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	622;872;902|.	B4DS55;F5H5U7;Q96JG6|.	.;.;CC132_HUMAN|.	C|M	902;872;622|126	.|.	ENSP00000307666:F902C|.	F|I	+|+	2|3	0|3	CCDC132|CCDC132	92823258|92823258	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.783000|0.783000	0.44284|0.44284	5.886000|5.886000	0.69743|0.69743	2.340000|2.340000	0.79590|0.79590	0.528000|0.528000	0.53228|0.53228	TTT|ATT	-	pfam_DUF2451_C		0.348	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC132	protein_coding	OTTHUMT00000341687.1	T	NM_017667	-		92985322	+1	no_errors	ENST00000305866	ensembl	human	known	74_37	missense	SNP	1.000	G
FLJ36000	284124	genome.wustl.edu	37	17	21911266	21911267	+	lincRNA	INS	-	-	TGTGTG	rs66463211|rs377372339|rs142914886|rs572886648	byFrequency	TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr17:21911266_21911267insTGTGTG	ENST00000581223.2	+	0	1991_1992					NR_027084.1																						gtttttgtttctgtgtgtgtgt	0.505																																																	0								ENSG00000266795																																			RP11-744K17.9			0				Clone_based_vega_gene																													17.37:g.21911267_21911272dupTGTGTG		Somatic	NA	NA	NA		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000581223.2	37	NULL		17																																																																																			-	-		0.505	RP11-744K17.9-001	KNOWN	basic	lincRNA	FLJ36000	lincRNA	OTTHUMT00000451067.1	-				21911267	+1	no_errors	ENST00000581223	ensembl	human	known	74_37	rna	INS	0.004:0.024	TGTGTG
CWH43	80157	genome.wustl.edu	37	4	49005809	49005809	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr4:49005809G>C	ENST00000226432.4	+	7	1043	c.860G>C	c.(859-861)gGc>gCc	p.G287A	CWH43_ENST00000513409.1_Missense_Mutation_p.G260A	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	287					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						GCTGTGTCTGGCTGTGTCTTC	0.512																																																	0								ENSG00000109182						98.0	86.0	90.0					4																	49005809		2203	4300	6503	CWH43	SO:0001583	missense	0			-	HGNC		CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.860G>C	4.37:g.49005809G>C	ENSP00000226432:p.Gly287Ala	Somatic	0	36	0.00		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	1	94.12	B2RPD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Endo/exonuclease/phosphatase	p.G287A	ENST00000226432.4	37	c.860	CCDS3486.1	4	.	.	.	.	.	.	.	.	.	.	G	11.00	1.509949	0.27036	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	T;T	0.55760	1.11;0.5	3.91	3.91	0.45181	.	0.000000	0.53938	D	0.000045	T	0.70072	0.3182	M	0.69823	2.125	0.35890	D	0.829639	D	0.89917	1.0	D	0.91635	0.999	T	0.76793	-0.2828	9	.	.	.	.	15.3556	0.74425	0.0:0.0:1.0:0.0	.	287	Q9H720	PG2IP_HUMAN	A	287;260	ENSP00000226432:G287A;ENSP00000422802:G260A	.	G	+	2	0	CWH43	48700566	1.000000	0.71417	0.158000	0.22627	0.006000	0.05464	5.830000	0.69324	2.480000	0.83734	0.591000	0.81541	GGC	-	NULL		0.512	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWH43	protein_coding	OTTHUMT00000250496.2	G	NM_025087	-		49005809	+1	no_errors	ENST00000226432	ensembl	human	known	74_37	missense	SNP	0.574	C
RNF213	57674	genome.wustl.edu	37	17	78313806	78313806	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr17:78313806G>A	ENST00000582970.1	+	26	5782	c.5639G>A	c.(5638-5640)cGc>cAc	p.R1880H	RNF213_ENST00000508628.2_Missense_Mutation_p.R1929H|RNF213_ENST00000336301.6_5'Flank	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	1880					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TTGCTGCGCCGCTGCCTGACC	0.627																																																	0								ENSG00000173821						20.0	22.0	21.0					17																	78313806		692	1591	2283	RNF213	SO:0001583	missense	0			-	HGNC	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.5639G>A	17.37:g.78313806G>A	ENSP00000464087:p.Arg1880His	Somatic	0	26	0.00		0.6081089112834981	1	90.00	9	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	2	94.12	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.R1880H	ENST00000582970.1	37	c.5639	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	G	14.79	2.639845	0.47153	.	.	ENSG00000173821	ENST00000508628;ENST00000411702	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	T	0.75598	0.3871	M	0.62723	1.935	0.80722	D	1	.	.	.	.	.	.	T	0.76900	-0.2788	6	0.87932	D	0	.	19.4123	0.94679	0.0:0.0:1.0:0.0	.	.	.	.	H	1880;1929	.	ENSP00000396478:R1929H	R	+	2	0	RNF213	75928401	1.000000	0.71417	1.000000	0.80357	0.308000	0.27856	9.500000	0.97977	2.825000	0.97269	0.650000	0.86243	CGC	-	NULL		0.627	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	protein_coding	OTTHUMT00000443298.1	G	NM_020914	-		78313806	+1	no_errors	ENST00000582970	ensembl	human	known	74_37	missense	SNP	1.000	A
TRDN	10345	genome.wustl.edu	37	6	123786032	123786033	+	Intron	INS	-	-	A	rs201431159		TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr6:123786032_123786033insA	ENST00000398178.3	-	10	953				TRDN_ENST00000546248.1_Frame_Shift_Ins_p.S297fs|RP11-532N4.2_ENST00000589182.1_RNA|TRDN_ENST00000334268.4_Intron|RP11-532N4.2_ENST00000418467.2_RNA|RP11-532N4.2_ENST00000434768.1_RNA|RP11-532N4.2_ENST00000427828.1_RNA|RP11-532N4.2_ENST00000587049.1_RNA|RP11-532N4.2_ENST00000587106.2_RNA	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin						cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		AGATCTTTAAGAAAAAAAAAAG	0.386																																																	0								ENSG00000186439																																			TRDN	SO:0001627	intron_variant	0				HGNC	U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.931+17->T	6.37:g.123786042_123786042dupA		Somatic	0	32	0.00		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	20	9.09	A5D6W5|F5H2W7|Q6NSB8	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Asp-B-hydro/Triadin_dom	p.S297fs	ENST00000398178.3	37	c.890_889	CCDS55053.1	6																																																																																			-	NULL		0.386	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRDN	protein_coding		-				123786033	-1	no_errors	ENST00000546248	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.000	A
LRIG2	9860	genome.wustl.edu	37	1	113637357	113637357	+	Silent	SNP	C	C	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:113637357C>T	ENST00000361127.5	+	6	981	c.783C>T	c.(781-783)ggC>ggT	p.G261G		NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	261					innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		CATTTTTTGGCTTGAATAACA	0.403																																																	0								ENSG00000198799						153.0	157.0	156.0					1																	113637357		2203	4300	6503	LRIG2	SO:0001819	synonymous_variant	0			-	HGNC	AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.783C>T	1.37:g.113637357C>T		Somatic	0	98	0.00		0.6081089112834981	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	Q9NSN2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G261	ENST00000361127.5	37	c.783	CCDS30808.1	1																																																																																			-	smart_Leu-rich_rpt_typical-subtyp		0.403	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG2	protein_coding	OTTHUMT00000033549.2	C	NM_014813	-		113637357	+1	no_errors	ENST00000361127	ensembl	human	known	74_37	silent	SNP	0.987	T
HERC2	8924	genome.wustl.edu	37	15	28391408	28391408	+	Silent	SNP	G	G	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr15:28391408G>T	ENST00000261609.7	-	71	11091	c.10983C>A	c.(10981-10983)gtC>gtA	p.V3661V		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CGATCCTGTTGACGCCGTCCA	0.567																																																	0								ENSG00000128731						152.0	106.0	122.0					15																	28391408		2203	4300	6503	HERC2	SO:0001819	synonymous_variant	0			-	HGNC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.10983C>A	15.37:g.28391408G>T		Somatic	0	35	0.00		0.6081089112834981	18	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.V3661	ENST00000261609.7	37	c.10983	CCDS10021.1	15																																																																																			-	superfamily_CUB_dom		0.567	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	protein_coding	OTTHUMT00000251358.2	G	NM_004667	-		28391408	-1	no_errors	ENST00000261609	ensembl	human	known	74_37	silent	SNP	1.000	T
TESK2	10420	genome.wustl.edu	37	1	45809610	45809610	+	3'UTR	DEL	A	A	-			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:45809610delA	ENST00000372086.3	-	0	3018				TOE1_ENST00000495703.1_3'UTR|TESK2_ENST00000486676.1_5'UTR|TESK2_ENST00000372084.1_3'UTR|TESK2_ENST00000341771.6_3'UTR|TOE1_ENST00000372090.5_3'UTR	NM_007170.2	NP_009101.2	Q96S53	TESK2_HUMAN	testis-specific kinase 2						actin cytoskeleton organization (GO:0030036)|focal adhesion assembly (GO:0048041)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	32	Acute lymphoblastic leukemia(166;0.155)					AAAGTTTTACAAAAAAAAAAA	0.363																																																	0								ENSG00000070759																																			TESK2	SO:0001624	3_prime_UTR_variant	0				HGNC	AJ132545	CCDS41323.1	1p32	2010-04-27			ENSG00000070759	ENSG00000070759	2.7.12.1		11732	protein-coding gene	gene with protein product		604746				10512679	Standard	NM_007170		Approved		uc001cns.1	Q96S53	OTTHUMG00000007680	ENST00000372086.3:c.*902T>-	1.37:g.45809610delA		Somatic	0	52	0.00		0.6081089112834981	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.64	Q5T422|Q5T423|Q8N520|Q9Y3Q6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372086.3	37	NULL	CCDS41323.1	1																																																																																			-	-		0.363	TESK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TESK2	protein_coding	OTTHUMT00000020523.1	A	NM_007170			45809610	-1	no_errors	ENST00000486676	ensembl	human	known	74_37	rna	DEL	0.794	-
APC	324	genome.wustl.edu	37	5	112175084	112175084	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr5:112175084G>T	ENST00000457016.1	+	16	4173	c.3793G>T	c.(3793-3795)Gaa>Taa	p.E1265*	APC_ENST00000508376.2_Nonsense_Mutation_p.E1265*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.E1265*			P25054	APC_HUMAN	adenomatous polyposis coli	1265	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.E1265*(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTATTGTGTAGAAGATACTCC	0.383		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)		yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	3	Substitution - Nonsense(1)|Unknown(1)|Deletion - Frameshift(1)	large_intestine(1)|soft_tissue(1)|skin(1)						ENSG00000134982						53.0	55.0	55.0					5																	112175084		2202	4300	6502	APC	SO:0001587	stop_gained	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	-	HGNC	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3793G>T	5.37:g.112175084G>T	ENSP00000413133:p.Glu1265*	Somatic	0	31	0.00		0.6081089112834981	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	2	91.67	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_APC_dom,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.E1265*	ENST00000457016.1	37	c.3793	CCDS4107.1	5	.	.	.	.	.	.	.	.	.	.	G	40	8.023727	0.98616	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-23.7007	20.5568	0.99304	0.0:0.0:1.0:0.0	.	.	.	.	X	1265	.	.	E	+	1	0	APC	112202983	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	9.476000	0.97823	2.861000	0.98227	0.655000	0.94253	GAA	-	pfam_APC_Cys-rich_rpt		0.383	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	protein_coding	OTTHUMT00000250738.2	G	NM_000038	-		112175084	+1	no_errors	ENST00000257430	ensembl	human	known	74_37	nonsense	SNP	1.000	T
OR10J5	127385	genome.wustl.edu	37	1	159505683	159505683	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:159505683G>T	ENST00000334857.2	-	1	159	c.115C>A	c.(115-117)Ctg>Atg	p.L39M		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	39						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					TTAGCAACCAGAGTTAAAATG	0.403																																																	0								ENSG00000184155						136.0	122.0	127.0					1																	159505683		2203	4300	6503	OR10J5	SO:0001583	missense	0			-	HGNC		CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.115C>A	1.37:g.159505683G>T	ENSP00000334441:p.Leu39Met	Somatic	0	48	0.00		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B9EH35|Q6IFH2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L39M	ENST00000334857.2	37	c.115	CCDS30910.1	1	.	.	.	.	.	.	.	.	.	.	G	9.644	1.139780	0.21205	.	.	ENSG00000184155	ENST00000334857	T	0.00611	6.23	4.43	1.48	0.22813	.	.	.	.	.	T	0.00967	0.0032	M	0.82193	2.58	0.09310	N	1	D	0.89917	1.0	D	0.71184	0.972	T	0.46624	-0.9178	9	0.52906	T	0.07	.	8.3329	0.32197	0.2727:0.0:0.7273:0.0	.	39	Q8NHC4	O10J5_HUMAN	M	39	ENSP00000334441:L39M	ENSP00000334441:L39M	L	-	1	2	OR10J5	157772307	0.001000	0.12720	0.002000	0.10522	0.315000	0.28087	-0.196000	0.09532	0.214000	0.20742	0.557000	0.71058	CTG	-	prints_GPCR_Rhodpsn		0.403	OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J5	protein_coding	OTTHUMT00000059021.1	G	NM_001004469	-		159505683	-1	no_errors	ENST00000334857	ensembl	human	known	74_37	missense	SNP	0.004	T
C2orf47	79568	genome.wustl.edu	37	2	200820505	200820505	+	5'UTR	DEL	T	T	-	rs281766	byFrequency	TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr2:200820505delT	ENST00000392290.1	+	0	180				C2orf47_ENST00000295079.2_5'UTR|C2orf69_ENST00000491721.1_3'UTR|TYW5_ENST00000354611.4_5'Flank|TYW5_ENST00000452512.2_5'Flank			Q8WWC4	CB047_HUMAN	chromosome 2 open reading frame 47							mitochondrion (GO:0005739)				cervix(1)|endometrium(2)|large_intestine(1)|lung(5)	9						CAGGCACCGGTGTGAAGGGTC	0.617																																																	0								ENSG00000178074						21.0	27.0	25.0					2																	200820505		2173	4287	6460	C2orf69	SO:0001623	5_prime_UTR_variant	0				HGNC	BC017959	CCDS2329.1	2q33.1	2011-03-08			ENSG00000162972	ENSG00000162972			26198	protein-coding gene	gene with protein product						12477932	Standard	NM_024520		Approved	DKFZp666A212, FLJ22555	uc002uvm.3	Q8WWC4	OTTHUMG00000132771	ENST00000392290.1:c.-17T>-	2.37:g.200820505delT		Somatic	0	35	0.00		0.6081089112834981	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	10	47.37	Q658V9|Q9H671	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392290.1	37	NULL	CCDS2329.1	2																																																																																			-	-		0.617	C2orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf69	protein_coding	OTTHUMT00000256146.1	T	NM_024520			200820505	+1	no_errors	ENST00000491721	ensembl	human	known	74_37	rna	DEL	0.987	-
HNRNPR	10236	genome.wustl.edu	37	1	23636875	23636875	+	3'UTR	DEL	T	T	-			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:23636875delT	ENST00000374612.1	-	0	2097				HNRNPR_ENST00000476660.1_5'UTR|HNRNPR_ENST00000302271.6_3'UTR|HNRNPR_ENST00000478691.1_3'UTR|HNRNPR_ENST00000606561.1_3'UTR|HNRNPR_ENST00000374616.3_3'UTR|HNRNPR_ENST00000427764.2_3'UTR	NM_001102398.1|NM_005826.3	NP_001095868.1|NP_005817.1	O43390	HNRPR_HUMAN	heterogeneous nuclear ribonucleoprotein R						gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)		GTTAAGCCAATTTTTTTTTTT	0.343																																																	0								ENSG00000125944																																			HNRNPR	SO:0001624	3_prime_UTR_variant	0				HGNC	AF000364	CCDS232.1, CCDS44085.1, CCDS60020.1, CCDS72726.1, CCDS72727.1	1p36.12	2013-02-12		2007-08-16	ENSG00000125944	ENSG00000125944		"""RNA binding motif (RRM) containing"""	5047	protein-coding gene	gene with protein product		607201		HNRPR		9421497	Standard	XM_005245711		Approved	hnRNP-R	uc001bgp.4	O43390	OTTHUMG00000003224	ENST00000374612.1:c.*72A>-	1.37:g.23636875delT		Somatic	0	43	0.00		0.6081089112834981	318	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	38	13.64	Q2L7G6|Q5TEH1|Q9BV64|S4R3J4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000374612.1	37	NULL	CCDS232.1	1																																																																																			-	-		0.343	HNRNPR-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	HNRNPR	protein_coding	OTTHUMT00000008889.1	T	NM_005826			23636875	-1	no_errors	ENST00000476660	ensembl	human	known	74_37	rna	DEL	0.936	-
MXRA5	25878	genome.wustl.edu	37	X	3236006	3236006	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chrX:3236006C>G	ENST00000217939.6	-	6	5870	c.5716G>C	c.(5716-5718)Gag>Cag	p.E1906Q		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1906	Ig-like C2-type 3.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TTGAGAACCTCAAACCGTTGT	0.473																																																	0								ENSG00000101825						52.0	40.0	44.0					X																	3236006		2203	4300	6503	MXRA5	SO:0001583	missense	0			-	HGNC	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.5716G>C	X.37:g.3236006C>G	ENSP00000217939:p.Glu1906Gln	Somatic	0	32	0.00		0.6081089112834981	180	28.46	72	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	54	18.18	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.E1906Q	ENST00000217939.6	37	c.5716	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	c	13.61	2.287536	0.40494	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.67523	-0.27	3.22	3.22	0.36961	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.35151	U	0.003413	T	0.55386	0.1917	N	0.11201	0.11	0.46631	D	0.999136	P	0.39601	0.68	P	0.47941	0.562	T	0.55055	-0.8200	10	0.27785	T	0.31	.	14.3589	0.66757	0.0:1.0:0.0:0.0	.	1906	Q9NR99	MXRA5_HUMAN	Q	1906	ENSP00000217939:E1906Q	ENSP00000217939:E1906Q	E	-	1	0	MXRA5	3246006	1.000000	0.71417	0.011000	0.14972	0.341000	0.28922	3.132000	0.50523	1.239000	0.43787	0.529000	0.55759	GAG	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.473	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	protein_coding	OTTHUMT00000055655.2	C	NM_015419	-		3236006	-1	no_errors	ENST00000217939	ensembl	human	known	74_37	missense	SNP	1.000	G
LOC101927209	101927209	genome.wustl.edu	37	1	142621208	142621208	+	lincRNA	SNP	G	G	A	rs201624115		TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:142621208G>A	ENST00000610091.1	-	0	6364				RP11-417J8.3_ENST00000426408.1_lincRNA																							tgtagatataggcaggttata	0.343																																																	0								ENSG00000230880																																			RP11-417J8.3			0			-	Clone_based_vega_gene																													1.37:g.142621208G>A		Somatic	0	75	0.00		0.6081089112834981	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	79	11.24		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			-	-		0.343	RP11-417J8.6-001	KNOWN	basic	lincRNA	LOC101927209	lincRNA	OTTHUMT00000037265.2	G		rs201624115		142621208	+1	no_errors	ENST00000412092	ensembl	human	known	74_37	rna	SNP	0.022	A
EML6	400954	genome.wustl.edu	37	2	55184997	55184997	+	Silent	SNP	C	C	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr2:55184997C>T	ENST00000356458.6	+	32	5077	c.4557C>T	c.(4555-4557)gaC>gaT	p.D1519D	EML6_ENST00000490828.1_3'UTR	NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	1519						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						CCGACTCAGACACGCAGTTTG	0.577																																																	0								ENSG00000214595						67.0	67.0	67.0					2																	55184997		692	1591	2283	EML6	SO:0001819	synonymous_variant	0			-	HGNC		CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.4557C>T	2.37:g.55184997C>T		Somatic	0	80	0.00		0.6081089112834981	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	58	20.55	A8MUB5|B6ZDG7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D1519	ENST00000356458.6	37	c.4557	CCDS46286.1	2																																																																																			-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.577	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	EML6	protein_coding	OTTHUMT00000324997.3	C	XM_001725002	-		55184997	+1	no_errors	ENST00000356458	ensembl	human	novel	74_37	silent	SNP	1.000	T
SLC9C2	284525	genome.wustl.edu	37	1	173526547	173526547	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:173526547C>T	ENST00000367714.3	-	10	1569	c.1147G>A	c.(1147-1149)Gtt>Att	p.V383I	RP3-436N22.3_ENST00000431459.1_RNA|SLC9C2_ENST00000466087.1_5'UTR|SLC9C2_ENST00000536496.1_Missense_Mutation_p.V281I	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	383					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										AAATTAAAAACTCCTTTAATT	0.358																																																	0								ENSG00000162753						132.0	144.0	140.0					1																	173526547		2203	4300	6503	SLC9C2	SO:0001583	missense	0			-	HGNC	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.1147G>A	1.37:g.173526547C>T	ENSP00000356687:p.Val383Ile	Somatic	0	84	0.00		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	51	30.67	Q86UF3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cation/H_exchanger,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.V383I	ENST00000367714.3	37	c.1147	CCDS1308.1	1	.	.	.	.	.	.	.	.	.	.	C	2.161	-0.392213	0.04932	.	.	ENSG00000162753	ENST00000367714;ENST00000536496	T;T	0.24151	1.87;1.87	5.57	-3.25	0.05079	Cation/H+ exchanger (1);	1.118770	0.06767	N	0.782799	T	0.04815	0.0130	N	0.19112	0.55	0.09310	N	1	B	0.15141	0.012	B	0.19946	0.027	T	0.44922	-0.9296	10	0.54805	T	0.06	-4.6968	4.0852	0.09943	0.3191:0.2488:0.0:0.4321	.	383	Q5TAH2	S9A11_HUMAN	I	383;281	ENSP00000356687:V383I;ENSP00000445437:V281I	ENSP00000356687:V383I	V	-	1	0	SLC9A11	171793170	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.820000	0.04457	-0.417000	0.07461	-0.293000	0.09583	GTT	-	pfam_Cation/H_exchanger		0.358	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9C2	protein_coding	OTTHUMT00000084205.1	C	NM_178527	-		173526547	-1	no_errors	ENST00000367714	ensembl	human	known	74_37	missense	SNP	0.000	T
CPA1	1357	genome.wustl.edu	37	7	130022006	130022006	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr7:130022006C>A	ENST00000011292.3	+	4	589	c.439C>A	c.(439-441)Cag>Aag	p.Q147K	CPA1_ENST00000484324.1_Missense_Mutation_p.Q59K	NM_001868.2	NP_001859.1	P15085	CBPA1_HUMAN	carboxypeptidase A1 (pancreatic)	147					proteolysis (GO:0006508)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(18;0.0435)					CAGCAAGATCCAGATTGGCAA	0.527																																																	0								ENSG00000091704						132.0	103.0	113.0					7																	130022006		2203	4300	6503	CPA1	SO:0001583	missense	0			-	HGNC		CCDS5820.1	7q32	2012-02-10			ENSG00000091704	ENSG00000091704	3.4.17.1		2296	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase A"""	114850		CPA			Standard	NM_001868		Approved		uc003vpx.3	P15085	OTTHUMG00000157826	ENST00000011292.3:c.439C>A	7.37:g.130022006C>A	ENSP00000011292:p.Gln147Lys	Somatic	0	37	0.00		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A4D1M1|Q53XU0|Q9BS67|Q9UCF2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.Q147K	ENST00000011292.3	37	c.439	CCDS5820.1	7	.	.	.	.	.	.	.	.	.	.	C	0.888	-0.726491	0.03158	.	.	ENSG00000091704	ENST00000481342;ENST00000011292;ENST00000476062;ENST00000484324	T;T;T;T	0.10573	2.86;2.86;2.86;2.86	5.46	1.32	0.21799	Peptidase M14, carboxypeptidase A (2);	0.558393	0.20964	N	0.082509	T	0.06781	0.0173	L	0.35414	1.06	0.29477	N	0.856602	B;B	0.27264	0.003;0.173	B;B	0.29524	0.016;0.103	T	0.40757	-0.9546	10	0.02654	T	1	.	9.3035	0.37861	0.2552:0.3323:0.4125:0.0	.	59;147	B4DDW9;P15085	.;CBPA1_HUMAN	K	59;147;59;59	ENSP00000420218:Q59K;ENSP00000011292:Q147K;ENSP00000419408:Q59K;ENSP00000419497:Q59K	ENSP00000011292:Q147K	Q	+	1	0	CPA1	129809242	0.003000	0.15002	0.957000	0.39632	0.600000	0.36913	-0.091000	0.11146	-0.030000	0.13804	-0.314000	0.08810	CAG	-	pfam_Peptidase_M14,smart_Peptidase_M14		0.527	CPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA1	protein_coding	OTTHUMT00000349736.2	C	NM_001868	-		130022006	+1	no_errors	ENST00000011292	ensembl	human	known	74_37	missense	SNP	0.696	A
GYPC	2995	genome.wustl.edu	37	2	127453545	127453545	+	Missense_Mutation	SNP	G	G	A	rs200879714		TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr2:127453545G>A	ENST00000259254.4	+	4	545	c.214G>A	c.(214-216)Gtc>Atc	p.V72I	GYPC_ENST00000409836.3_Missense_Mutation_p.V53I|GYPC_ENST00000356887.7_Missense_Mutation_p.V51I|GYPC_ENST00000464053.1_3'UTR	NM_002101.4	NP_002092.1	P04921	GLPC_HUMAN	glycophorin C (Gerbich blood group)	72						cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|prostate(2)|urinary_tract(1)	13	Colorectal(110;0.0533)			BRCA - Breast invasive adenocarcinoma(221;0.075)		TGTGGCCATCGTCCTAGTCTC	0.607																																					Melanoma(110;806 1600 6704 9981 33404)												0								ENSG00000136732	G	ILE/VAL,ILE/VAL	0,4406		0,0,2203	196.0	153.0	167.0		214,157	2.4	0.3	2		167	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	GYPC	NM_002101.3,NM_016815.2	29,29	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	possibly-damaging,possibly-damaging	72/129,53/110	127453545	3,13003	2203	4300	6503	GYPC	SO:0001583	missense	0			-	HGNC		CCDS2136.1, CCDS46402.1, CCDS58724.1	2q14-q21	2014-07-19			ENSG00000136732	ENSG00000136732		"""CD molecules"", ""Blood group antigens"""	4704	protein-coding gene	gene with protein product		110750					Standard	NM_016815		Approved	GPC, GYPD, Ge, CD236, CD236R	uc002tnq.4	P04921	OTTHUMG00000131464	ENST00000259254.4:c.214G>A	2.37:g.127453545G>A	ENSP00000259254:p.Val72Ile	Somatic	0	24	0.00		0.6081089112834981	103	53.60	119	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	9	64.29	B2R522|Q53SV9|Q92642	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Neurexin-like	p.V72I	ENST00000259254.4	37	c.214	CCDS2136.1	2	.	.	.	.	.	.	.	.	.	.	G	11.53	1.666058	0.29604	0.0	3.49E-4	ENSG00000136732	ENST00000259254;ENST00000356887;ENST00000409836	T;T;T	0.17854	2.7;2.25;2.74	5.22	2.41	0.29592	.	.	.	.	.	T	0.11067	0.0270	L	0.47190	1.495	0.31909	N	0.6149	P;P	0.47545	0.597;0.897	B;B	0.31290	0.041;0.127	T	0.18840	-1.0324	9	0.44086	T	0.13	-5.7083	6.9613	0.24599	0.1526:0.0:0.7071:0.1403	.	51;72	P04921-2;P04921	.;GLPC_HUMAN	I	72;51;53	ENSP00000259254:V72I;ENSP00000349354:V51I;ENSP00000386904:V53I	ENSP00000259254:V72I	V	+	1	0	GYPC	127170015	0.995000	0.38212	0.285000	0.24819	0.020000	0.10135	2.361000	0.44160	0.201000	0.20466	0.561000	0.74099	GTC	-	NULL		0.607	GYPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GYPC	protein_coding	OTTHUMT00000254297.1	G	NM_002101	rs200879714		127453545	+1	no_errors	ENST00000259254	ensembl	human	known	74_37	missense	SNP	0.965	A
RPL7L1	285855	genome.wustl.edu	37	6	42851403	42851403	+	Intron	SNP	T	T	G			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr6:42851403T>G	ENST00000493763.1	+	3	587				RPL7L1_ENST00000602561.1_Intron|RPL7L1_ENST00000304734.5_Intron|RPL7L1_ENST00000397415.3_Intron|RPL7L1_ENST00000424341.2_Intron	NM_198486.2	NP_940888.2	Q6DKI1	RL7L_HUMAN	ribosomal protein L7-like 1							ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)	6	Colorectal(47;0.196)		Colorectal(64;0.00237)|all cancers(41;0.00288)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.088)			AAAGTGTTGCTTAAGCTTTAG	0.438																																																	0								ENSG00000146223						49.0	49.0	49.0					6																	42851403		2203	4300	6503	RPL7L1	SO:0001627	intron_variant	0			-	HGNC		CCDS4873.1	6p21.1	2011-01-14			ENSG00000146223	ENSG00000146223		"""L ribosomal proteins"""	21370	protein-coding gene	gene with protein product							Standard	NM_198486		Approved	dJ475N16.4	uc003osq.1	Q6DKI1	OTTHUMG00000014710	ENST00000493763.1:c.284+51T>G	6.37:g.42851403T>G		Somatic	0	70	0.00		0.6081089112834981	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	58	37.63	A8K7D4|B7Z652|Q5TFZ5|Q6PEK3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000493763.1	37	NULL	CCDS4873.1	6																																																																																			-	-		0.438	RPL7L1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL7L1	protein_coding	OTTHUMT00000314417.1	T	XM_209769	-		42851403	+1	no_errors	ENST00000487619	ensembl	human	putative	74_37	rna	SNP	0.015	G
C1orf61	10485	genome.wustl.edu	37	1	156386395	156386395	+	Intron	SNP	C	C	A			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:156386395C>A	ENST00000368243.1	-	3	188					NM_006365.1	NP_006356.1	Q13536	CROC4_HUMAN	chromosome 1 open reading frame 61							nucleus (GO:0005634)				large_intestine(2)|lung(2)|skin(1)	5	Hepatocellular(266;0.158)					GTTTACCCATCCTAAGTGCTG	0.373																																																	0								ENSG00000125462																																			C1orf61	SO:0001627	intron_variant	0			-	HGNC		CCDS1142.1	1q22	2014-03-17			ENSG00000125462	ENSG00000125462			30780	protein-coding gene	gene with protein product	"""contingent replication of cDNA-4"", ""transcriptional activator of the c fos promoter"""					10995546, 23012322	Standard	XM_005244832		Approved	CROC4	uc001fou.1	Q13536	OTTHUMG00000031022	ENST00000368243.1:c.71+165G>T	1.37:g.156386395C>A		Somatic	0	13	0.00		0.6081089112834981	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	12	33.33	B1ALL5|B1ALL8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368243.1	37	NULL	CCDS1142.1	1																																																																																			-	-		0.373	C1orf61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf61	protein_coding	OTTHUMT00000075988.1	C	NM_006365	-		156386395	-1	no_errors	ENST00000462458	ensembl	human	known	74_37	rna	SNP	0.000	A
KCNA4	3739	genome.wustl.edu	37	11	30033192	30033192	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr11:30033192C>A	ENST00000328224.6	-	2	2267	c.1034G>T	c.(1033-1035)gGc>gTc	p.G345V	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	345					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	ACCATGCCCGCCAGCACTCAG	0.502																																																	0								ENSG00000182255						84.0	77.0	79.0					11																	30033192		2032	4196	6228	KCNA4	SO:0001583	missense	0			-	HGNC	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.1034G>T	11.37:g.30033192C>A	ENSP00000328511:p.Gly345Val	Somatic	0	60	0.00		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	3	88.46		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_volt-dep_Kv1.4_TID,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.4,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.G345V	ENST00000328224.6	37	c.1034	CCDS41629.1	11	.	.	.	.	.	.	.	.	.	.	C	2.212	-0.380463	0.05000	.	.	ENSG00000182255	ENST00000328224	D	0.96802	-4.13	5.43	5.43	0.79202	.	1.390190	0.04470	N	0.375789	D	0.94928	0.8360	L	0.58810	1.83	0.28796	N	0.899046	B	0.18461	0.028	B	0.11329	0.006	D	0.83950	0.0316	10	0.26408	T	0.33	.	9.8522	0.41064	0.0:0.8485:0.0:0.1515	.	345	P22459	KCNA4_HUMAN	V	345	ENSP00000328511:G345V	ENSP00000328511:G345V	G	-	2	0	KCNA4	29989768	0.995000	0.38212	0.152000	0.22495	0.033000	0.12548	3.807000	0.55591	2.554000	0.86153	0.655000	0.94253	GGC	-	NULL		0.502	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA4	protein_coding	OTTHUMT00000388074.2	C	NM_002233	-		30033192	-1	no_errors	ENST00000328224	ensembl	human	known	74_37	missense	SNP	0.129	A
TCTE3	6991	genome.wustl.edu	37	6	170144314	170144314	+	Silent	SNP	C	C	A			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr6:170144314C>A	ENST00000366774.3	-	2	277	c.177G>T	c.(175-177)gtG>gtT	p.V59V		NM_174910.1	NP_777570.1	Q8IZS6	TC1D3_HUMAN	t-complex-associated-testis-expressed 3	59					transport (GO:0006810)	cytoplasm (GO:0005737)|dynein complex (GO:0030286)|membrane (GO:0016020)|microtubule (GO:0005874)	motor activity (GO:0003774)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|prostate(1)	4		Breast(66;0.000338)		OV - Ovarian serous cystadenocarcinoma(33;1.08e-21)|BRCA - Breast invasive adenocarcinoma(81;1.32e-07)|GBM - Glioblastoma multiforme(31;0.00157)		AAGGAGGCTCCACATACTGAA	0.388																																																	0								ENSG00000184786						65.0	67.0	66.0					6																	170144314		2203	4300	6503	TCTE3	SO:0001819	synonymous_variant	0			-	HGNC	AF519569	CCDS5310.1	6q27	2014-06-03			ENSG00000184786	ENSG00000184786			11695	protein-coding gene	gene with protein product	"""Tctex1 domain containing 3"""	186977				1505969, 12584439	Standard	NM_174910		Approved	TCTEX1D3	uc003qxe.1	Q8IZS6	OTTHUMG00000016068	ENST00000366774.3:c.177G>T	6.37:g.170144314C>A		Somatic	0	39	0.00		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tctex	p.V59	ENST00000366774.3	37	c.177	CCDS5310.1	6																																																																																			-	NULL		0.388	TCTE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCTE3	protein_coding	OTTHUMT00000043243.1	C	NM_174910	-		170144314	-1	no_errors	ENST00000366774	ensembl	human	known	74_37	silent	SNP	0.329	A
NUMA1	4926	genome.wustl.edu	37	11	71728741	71728741	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr11:71728741G>T	ENST00000393695.3	-	13	1442	c.1111C>A	c.(1111-1113)Cag>Aag	p.Q371K	NUMA1_ENST00000358965.6_Missense_Mutation_p.Q371K|RP11-849H4.4_ENST00000502284.1_RNA|NUMA1_ENST00000351960.6_Missense_Mutation_p.Q371K	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1											central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						ACCTTGTCCTGCAGGGCTGCG	0.577			T	RARA	APL																																			Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	0								ENSG00000137497						78.0	71.0	74.0					11																	71728741		2200	4293	6493	NUMA1	SO:0001583	missense	0			-	HGNC	Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.1111C>A	11.37:g.71728741G>T	ENSP00000377298:p.Gln371Lys	Somatic	0	47	0.00		0.6081089112834981	145	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin	p.Q371K	ENST00000393695.3	37	c.1111	CCDS31633.1	11	.	.	.	.	.	.	.	.	.	.	G	11.23	1.577103	0.28092	.	.	ENSG00000137497	ENST00000351960;ENST00000358965;ENST00000393695;ENST00000542977;ENST00000537217	T;T;T;T;T	0.48201	2.2;2.6;2.6;1.39;0.82	5.51	4.59	0.56863	.	0.278024	0.31976	N	0.006776	T	0.37461	0.1004	L	0.58101	1.795	0.26762	N	0.969982	P;B;B;B;B;B	0.40660	0.726;0.287;0.287;0.0;0.287;0.0	B;B;B;B;B;B	0.37047	0.24;0.079;0.079;0.002;0.079;0.001	T	0.27640	-1.0068	10	0.07325	T	0.83	.	10.2298	0.43247	0.0:0.1479:0.6987:0.1534	.	371;371;371;371;371;371	F5H6Y5;F5H4J1;A8K394;Q14980-2;Q14980;Q9BTE9	.;.;.;.;NUMA1_HUMAN;.	K	371	ENSP00000260051:Q371K;ENSP00000351851:Q371K;ENSP00000377298:Q371K;ENSP00000444880:Q371K;ENSP00000442936:Q371K	ENSP00000260051:Q371K	Q	-	1	0	NUMA1	71406389	1.000000	0.71417	1.000000	0.80357	0.371000	0.29859	3.725000	0.54970	1.299000	0.44798	-0.182000	0.12963	CAG	-	NULL		0.577	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMA1	protein_coding	OTTHUMT00000395769.1	G		-		71728741	-1	no_errors	ENST00000393695	ensembl	human	known	74_37	missense	SNP	1.000	T
TMEM132C	92293	genome.wustl.edu	37	12	128899915	128899915	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr12:128899915G>T	ENST00000435159.2	+	2	724	c.724G>T	c.(724-726)Gcc>Tcc	p.A242S		NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	242						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						AGGGGACTGTGCCGGGGGTGA	0.642																																																	0								ENSG00000181234						64.0	75.0	72.0					12																	128899915		692	1591	2283	TMEM132C	SO:0001583	missense	0			-	HGNC	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.724G>T	12.37:g.128899915G>T	ENSP00000410852:p.Ala242Ser	Somatic	0	75	0.00		0.6081089112834981	53	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q69YX8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A242S	ENST00000435159.2	37	c.724		12	.	.	.	.	.	.	.	.	.	.	G	1.334	-0.596095	0.03771	.	.	ENSG00000181234	ENST00000435159	T	0.12147	2.71	5.09	-1.53	0.08611	.	.	.	.	.	T	0.05410	0.0143	N	0.14661	0.345	0.09310	N	1	B	0.15141	0.012	B	0.14023	0.01	T	0.43343	-0.9397	9	0.02654	T	1	.	5.7864	0.18336	0.6785:0.0:0.1673:0.1542	.	242	Q8N3T6	T132C_HUMAN	S	242	ENSP00000410852:A242S	ENSP00000410852:A242S	A	+	1	0	TMEM132C	127465868	0.000000	0.05858	0.035000	0.18076	0.882000	0.50991	0.325000	0.19628	-0.090000	0.12462	0.655000	0.94253	GCC	-	NULL		0.642	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	protein_coding		G	XM_044062	-		128899915	+1	no_errors	ENST00000435159	ensembl	human	known	74_37	missense	SNP	0.004	T
NCF4	4689	genome.wustl.edu	37	22	37266336	37266336	+	Intron	SNP	G	G	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr22:37266336G>T	ENST00000248899.6	+	5	526				NCF4_ENST00000397147.4_Intron|CTA-833B7.2_ENST00000431290.1_RNA|CTA-833B7.2_ENST00000330602.2_RNA	NM_000631.4	NP_000622.2	Q15080	NCF4_HUMAN	neutrophil cytosolic factor 4, 40kDa						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|positive regulation of catalytic activity (GO:0043085)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|membrane (GO:0016020)|NADPH oxidase complex (GO:0043020)|phagolysosome (GO:0032010)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein dimerization activity (GO:0046983)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			cervix(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16					Dextromethorphan(DB00514)	CTGTTATCAGGCATCATGCAT	0.502																																																	0								ENSG00000183822																																			CTA-833B7.2	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	X77094	CCDS13934.1, CCDS13935.1	22q13.1	2014-09-17	2002-08-29		ENSG00000100365	ENSG00000100365			7662	protein-coding gene	gene with protein product	"""neutrophil NADPH oxidase factor 4"""	601488	"""neutrophil cytosolic factor 4 (40kD)"""			8839867	Standard	NM_013416		Approved	p40phox, SH3PXD4	uc003apy.4	Q15080	OTTHUMG00000150548	ENST00000248899.6:c.343-121G>T	22.37:g.37266336G>T		Somatic	0	38	0.00		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	56	8.20	A8K4F9|O60808|Q86U56|Q9BU98|Q9NP45	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000248899.6	37	NULL	CCDS13934.1	22																																																																																			-	-		0.502	NCF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000183822	protein_coding	OTTHUMT00000318863.1	G	NM_000631	-		37266336	-1	no_errors	ENST00000330602	ensembl	human	known	74_37	rna	SNP	0.002	T
B4GALNT1	2583	genome.wustl.edu	37	12	58022875	58022875	+	Missense_Mutation	SNP	G	G	A	rs200510000		TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr12:58022875G>A	ENST00000341156.4	-	7	1351	c.767C>T	c.(766-768)cCg>cTg	p.P256L	B4GALNT1_ENST00000418555.2_Missense_Mutation_p.P201L|B4GALNT1_ENST00000550943.1_5'Flank|B4GALNT1_ENST00000449184.3_Intron	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	256					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			AGGGTTGGGCGGGTGTCTTAT	0.577																																																	0								ENSG00000135454	G	LEU/PRO	0,4406		0,0,2203	68.0	63.0	65.0		767	4.3	0.8	12		65	5,8595		0,5,4295	yes	missense	B4GALNT1	NM_001478.3	98	0,5,6498	AA,AG,GG		0.0581,0.0,0.0384	probably-damaging	256/534	58022875	5,13001	2203	4300	6503	B4GALNT1	SO:0001583	missense	0			-	HGNC	M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.767C>T	12.37:g.58022875G>A	ENSP00000341562:p.Pro256Leu	Somatic	0	69	0.00		0.6081089112834981	746	18.96	175	WXS	Illumina HiSeq 2500	Phase_IV	tier1	142	691	17.03	B4DE26|Q8N636	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_2,pirsf_GM2_synthase	p.P256L	ENST00000341156.4	37	c.767	CCDS8950.1	12	.	.	.	.	.	.	.	.	.	.	.	12.59	1.984464	0.35036	0.0	5.81E-4	ENSG00000135454	ENST00000341156;ENST00000418555	T;T	0.19105	2.17;2.22	5.23	4.34	0.51931	.	0.456770	0.22088	N	0.064790	T	0.16896	0.0406	L	0.39147	1.195	0.28489	N	0.914586	B;B	0.15473	0.013;0.006	B;B	0.10450	0.002;0.005	T	0.13602	-1.0503	10	0.21540	T	0.41	-8.1271	10.9142	0.47126	0.0888:0.0:0.9112:0.0	.	201;256	B4DE26;Q00973	.;B4GN1_HUMAN	L	256;201	ENSP00000341562:P256L;ENSP00000401601:P201L	ENSP00000341562:P256L	P	-	2	0	B4GALNT1	56309142	0.965000	0.33210	0.819000	0.32651	0.622000	0.37654	4.056000	0.57448	1.215000	0.43411	0.655000	0.94253	CCG	-	pirsf_GM2_synthase		0.577	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT1	protein_coding	OTTHUMT00000407853.1	G	NM_001478	rs200510000		58022875	-1	no_errors	ENST00000341156	ensembl	human	known	74_37	missense	SNP	0.038	A
C4BPB	725	genome.wustl.edu	37	1	207271592	207271592	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:207271592G>C	ENST00000243611.5	+	5	895	c.601G>C	c.(601-603)Gag>Cag	p.E201Q	C4BPB_ENST00000470767.1_3'UTR|C4BPB_ENST00000391923.1_Missense_Mutation_p.E201Q|C4BPB_ENST00000367076.3_Missense_Mutation_p.E200Q|C4BPB_ENST00000367078.3_Missense_Mutation_p.E201Q	NM_000716.3	NP_000707.1	P20851	C4BPB_HUMAN	complement component 4 binding protein, beta	201					blood coagulation (GO:0007596)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|negative regulation of complement activation, classical pathway (GO:0045959)|positive regulation of protein catabolic process (GO:0045732)|regulation of complement activation (GO:0030449)|regulation of opsonization (GO:1903027)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)				breast(2)|lung(1)|ovary(1)	4						tcccaaaccagagtgtgagaa	0.517																																																	0								ENSG00000123843						138.0	115.0	123.0					1																	207271592		2203	4300	6503	C4BPB	SO:0001583	missense	0			-	HGNC	L11245	CCDS1476.1, CCDS31005.1	1q32	2008-07-18	2001-11-28		ENSG00000123843	ENSG00000123843			1328	protein-coding gene	gene with protein product	"""complement component 4 binding protein, beta chain"", ""C4b binding protein, beta chain"""	120831	"""complement component 4-binding protein, beta"""	C4BP		2300577, 8325877	Standard	XM_005273255		Approved		uc001hfj.3	P20851	OTTHUMG00000036035	ENST00000243611.5:c.601G>C	1.37:g.207271592G>C	ENSP00000243611:p.Glu201Gln	Somatic	0	83	0.00		0.6081089112834981	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	57	32	64.04	A5JYP8|D3DT81|Q5VVR0|Q9BS25	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.E201Q	ENST00000243611.5	37	c.601	CCDS1476.1	1	.	.	.	.	.	.	.	.	.	.	G	6.707	0.499034	0.12762	.	.	ENSG00000123843	ENST00000367078;ENST00000243611;ENST00000367076;ENST00000391923	T;T;T;T	0.23754	1.92;1.92;1.89;1.92	3.95	3.01	0.34805	.	1.290640	0.05637	N	0.582689	T	0.18593	0.0446	L	0.27053	0.805	0.19775	N	0.999956	B;B	0.24368	0.062;0.102	B;B	0.16289	0.007;0.015	T	0.23940	-1.0174	10	0.16896	T	0.51	-0.1205	9.5781	0.39470	0.0:0.2146:0.7854:0.0	.	201;200	P20851;P20851-2	C4BPB_HUMAN;.	Q	201;201;200;201	ENSP00000356045:E201Q;ENSP00000243611:E201Q;ENSP00000356043:E200Q;ENSP00000375790:E201Q	ENSP00000243611:E201Q	E	+	1	0	C4BPB	205338215	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.263000	0.18478	0.998000	0.38996	0.655000	0.94253	GAG	-	NULL		0.517	C4BPB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C4BPB	protein_coding	OTTHUMT00000087847.2	G	NM_000716	-		207271592	+1	no_errors	ENST00000243611	ensembl	human	known	74_37	missense	SNP	0.001	C
PRODH2	58510	genome.wustl.edu	37	19	36297635	36297635	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr19:36297635C>T	ENST00000301175.3	-	7	1021	c.1004G>A	c.(1003-1005)tGg>tAg	p.W335*		NM_021232.1	NP_067055.1	Q9UF12	PROD2_HUMAN	proline dehydrogenase (oxidase) 2	335					proline catabolic process to glutamate (GO:0010133)	mitochondrial inner membrane (GO:0005743)	proline dehydrogenase activity (GO:0004657)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CGGGCTGTTCCAGCGCACAGC	0.657																																																	0								ENSG00000250799						27.0	27.0	27.0					19																	36297635		2203	4300	6503	PRODH2	SO:0001587	stop_gained	0			-	HGNC	U80018	CCDS12478.1	19q13.1	2014-07-11				ENSG00000250799			17325	protein-coding gene	gene with protein product							Standard	NM_021232		Approved	HSPOX1	uc002obx.1	Q9UF12		ENST00000301175.3:c.1004G>A	19.37:g.36297635C>T	ENSP00000301175:p.Trp335*	Somatic	0	83	0.00		0.6081089112834981	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	164	1239	11.66		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Proline_DH	p.W335*	ENST00000301175.3	37	c.1004	CCDS12478.1	19	.	.	.	.	.	.	.	.	.	.	C	17.34	3.364962	0.61513	.	.	ENSG00000250799	ENST00000301175	.	.	.	4.94	3.91	0.45181	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	8.9375	0.35708	0.0:0.9004:0.0:0.0996	.	.	.	.	X	335	.	ENSP00000301175:W335X	W	-	2	0	PRODH2	40989475	1.000000	0.71417	1.000000	0.80357	0.160000	0.22226	3.547000	0.53663	1.314000	0.45095	0.591000	0.81541	TGG	-	pfam_Proline_DH		0.657	PRODH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRODH2	protein_coding	OTTHUMT00000452552.2	C	NM_021232	-		36297635	-1	no_errors	ENST00000301175	ensembl	human	known	74_37	nonsense	SNP	1.000	T
R3HCC1	203069	genome.wustl.edu	37	8	23152352	23152352	+	Silent	SNP	A	A	G			TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr8:23152352A>G	ENST00000411463.1	+	8	1287	c.1287A>G	c.(1285-1287)tcA>tcG	p.S429S	R3HCC1_ENST00000265806.6_Silent_p.S202S|R3HCC1_ENST00000518454.1_Silent_p.S202S|R3HCC1_ENST00000522012.1_3'UTR			Q9Y3T6	R3HC1_HUMAN	R3H domain and coiled-coil containing 1	429							nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)			central_nervous_system(1)|skin(2)	3						CCAAGCAGTCAAAGCTCAAAG	0.582																																																	0								ENSG00000104679						49.0	49.0	49.0					8																	23152352		692	1591	2283	R3HCC1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS47826.1	8p21.3	2012-05-23		2005-11-20	ENSG00000104679	ENSG00000104679			27329	protein-coding gene	gene with protein product						12477932	Standard	XM_005273427		Approved	DKFZp564N123	uc003xdf.3	Q9Y3T6	OTTHUMG00000163786	ENST00000411463.1:c.1287A>G	8.37:g.23152352A>G		Somatic	0	51	0.00		0.6081089112834981	219	0.90	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	B7ZLI1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.S429	ENST00000411463.1	37	c.1287		8																																																																																			-	NULL		0.582	R3HCC1-201	KNOWN	basic|appris_principal	protein_coding	R3HCC1	protein_coding		A	NM_001136108	-		23152352	+1	no_errors	ENST00000411463	ensembl	human	known	74_37	silent	SNP	0.105	G
CD101	9398	genome.wustl.edu	37	1	117559985	117559985	+	Missense_Mutation	SNP	C	C	T	rs371863251		TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr1:117559985C>T	ENST00000256652.4	+	5	1560	c.1502C>T	c.(1501-1503)aCt>aTt	p.T501I	CD101_ENST00000369470.1_Missense_Mutation_p.T501I	NM_001256106.1|NM_001256109.1|NM_001256111.1|NM_004258.4	NP_001243035.1|NP_001243038.1|NP_001243040.1|NP_004249.2	Q93033	IGSF2_HUMAN	CD101 molecule	501	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(14)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						ATCACCTTCACTGCCATCACA	0.517																																																	0								ENSG00000134256	C	ILE/THR	1,4405	2.1+/-5.4	0,1,2202	99.0	90.0	93.0		1502	2.7	0.0	1		93	0,8600		0,0,4300	no	missense	CD101	NM_004258.3	89	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	501/1022	117559985	1,13005	2203	4300	6503	CD101	SO:0001583	missense	0			-	HGNC	Z33642	CCDS891.1	1p13	2013-01-29	2009-10-27	2009-10-27	ENSG00000134256	ENSG00000134256		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5949	protein-coding gene	gene with protein product		604516	"""immunoglobulin superfamily, member 2"""	IGSF2		7722300	Standard	NM_004258		Approved	V7	uc010oxb.2	Q93033	OTTHUMG00000012029	ENST00000256652.4:c.1502C>T	1.37:g.117559985C>T	ENSP00000256652:p.Thr501Ile	Somatic	0	36	0.00		0.6081089112834981	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	Q15856	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.T501I	ENST00000256652.4	37	c.1502	CCDS891.1	1	.	.	.	.	.	.	.	.	.	.	C	11.22	1.574316	0.28092	2.27E-4	0.0	ENSG00000134256	ENST00000256652;ENST00000369470	T;T	0.62639	0.01;0.01	4.62	2.72	0.32119	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.038600	0.07580	N	0.920109	T	0.39627	0.1085	L	0.54323	1.7	0.09310	N	1	B	0.27316	0.175	B	0.34038	0.174	T	0.48468	-0.9033	10	0.48119	T	0.1	-0.5717	6.1531	0.20322	0.0:0.7071:0.191:0.1019	.	501	Q93033	IGSF2_HUMAN	I	501	ENSP00000256652:T501I;ENSP00000358482:T501I	ENSP00000256652:T501I	T	+	2	0	CD101	117361508	0.000000	0.05858	0.000000	0.03702	0.725000	0.41563	-0.470000	0.06639	0.645000	0.30675	0.655000	0.94253	ACT	-	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom		0.517	CD101-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CD101	protein_coding	OTTHUMT00000033274.1	C	NM_004258	-		117559985	+1	no_errors	ENST00000256652	ensembl	human	known	74_37	missense	SNP	0.001	T
RTFDC1	51507	genome.wustl.edu	37	20	55093337	55093337	+	3'UTR	SNP	C	C	T	rs375109613	byFrequency	TCGA-DX-A7EI-01A-11D-A33E-09	TCGA-DX-A7EI-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be26a68a-6f7b-4f67-94ba-2def13816208	ececb6a0-c3f5-4daa-84c1-d752cacc49e7	g.chr20:55093337C>T	ENST00000023939.4	+	0	1044				RTFDC1_ENST00000395881.3_3'UTR|GCNT7_ENST00000243913.4_Intron|FAM209A_ENST00000481560.1_3'UTR|RTFDC1_ENST00000357348.5_3'UTR	NM_001283035.1|NM_001283036.1|NM_016407.3	NP_001269964.1|NP_001269965.1|NP_057491.2	Q9BY42	RTF2_HUMAN	replication termination factor 2 domain containing 1																		GCACTGCCACCGCTCCTGCCC	0.567													C|||	6	0.00119808	0.0	0.0014	5008	,	,		18749	0.0		0.0	False		,,,				2504	0.0051																0								ENSG00000124103	C	,	1,4405	2.1+/-5.4	0,1,2202	54.0	60.0	58.0		,	-4.2	0.0	20		58	14,8586	11.2+/-40.8	0,14,4286	no	utr-3,intron	C20orf43,GCNT7	NM_016407.3,NM_080615.1	,	0,15,6488	TT,TC,CC		0.1628,0.0227,0.1153	,	,	55093337	15,12991	2203	4300	6503	FAM209A	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF161513	CCDS13453.1, CCDS63316.1, CCDS63317.1	20q13	2012-10-29	2012-10-29	2012-10-29	ENSG00000022277	ENSG00000022277			15890	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 43"""	C20orf43			Standard	NM_001283035		Approved	HSPC164, CDAO5	uc002xxt.2	Q9BY42	OTTHUMG00000032801	ENST00000023939.4:c.*16C>T	20.37:g.55093337C>T		Somatic	0	39	0.00		0.6081089112834981	201	55.77	256	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	38	50.65	E1P5Z9|Q9BYL7|Q9HCV9|Q9NX29|Q9NZZ8|Q9P002|Q9UHW3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000023939.4	37	NULL	CCDS13453.1	20																																																																																			-	-		0.567	RTFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM209A	protein_coding	OTTHUMT00000079817.2	C	NM_016407	-		55093337	+1	no_errors	ENST00000481560	ensembl	human	known	74_37	rna	SNP	0.000	T
