#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
COL1A1	1277	genome.wustl.edu	37	17	48272451	48272451	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr17:48272451C>T	ENST00000225964.5	-	20	1428	c.1310G>A	c.(1309-1311)gGt>gAt	p.G437D		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	437	Triple-helical region.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	GCCAGGAGCACCAGGTTCACC	0.637			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																																	Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	0								ENSG00000108821						54.0	57.0	56.0					17																	48272451		2203	4300	6503	COL1A1	SO:0001583	missense	0			-	HGNC	Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.1310G>A	17.37:g.48272451C>T	ENSP00000225964:p.Gly437Asp	Somatic	0	42	0.00		0.4911483017230278	935	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.G437D	ENST00000225964.5	37	c.1310	CCDS11561.1	17	.	.	.	.	.	.	.	.	.	.	C	15.88	2.963467	0.53507	.	.	ENSG00000108821	ENST00000225964	D	0.99532	-6.1	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.99816	0.9919	H	0.98068	4.14	0.80722	D	1	D	0.76494	0.999	D	0.97110	1.0	D	0.96986	0.9718	10	0.87932	D	0	.	17.4882	0.87694	0.0:1.0:0.0:0.0	.	437	P02452	CO1A1_HUMAN	D	437	ENSP00000225964:G437D	ENSP00000225964:G437D	G	-	2	0	COL1A1	45627450	1.000000	0.71417	1.000000	0.80357	0.103000	0.19146	6.036000	0.70948	2.733000	0.93635	0.563000	0.77884	GGT	-	pfam_Collagen		0.637	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A1	protein_coding	OTTHUMT00000309036.2	C		-		48272451	-1	no_errors	ENST00000225964	ensembl	human	known	74_37	missense	SNP	1.000	T
LOXL1	4016	genome.wustl.edu	37	15	74244422	74244422	+	3'UTR	SNP	C	C	T	rs7168465		TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr15:74244422C>T	ENST00000261921.7	+	0	2295				LOXL1_ENST00000567675.1_3'UTR	NM_005576.2	NP_005567.2	Q08397	LOXL1_HUMAN	lysyl oxidase-like 1						extracellular matrix organization (GO:0030198)|oxidation-reduction process (GO:0055114)|protein deamination (GO:0018277)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor (GO:0016641)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10						TATACTTTGGCCATACCACAG	0.463																																																	0								ENSG00000129038																																			LOXL1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	L21186	CCDS10253.1	15q24-q25	2008-07-18			ENSG00000129038	ENSG00000129038			6665	protein-coding gene	gene with protein product		153456				7689553	Standard	NM_005576		Approved	LOXL, LOL	uc002awc.1	Q08397	OTTHUMG00000137595	ENST00000261921.7:c.*244C>T	15.37:g.74244422C>T		Somatic	0	45	0.00		0.4911483017230278	101	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	29	9.38	Q6NUL3|Q96BW7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000261921.7	37	NULL	CCDS10253.1	15																																																																																			-	-		0.463	LOXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL1	protein_coding	OTTHUMT00000268995.2	C	NM_005576	rs7168465		74244422	+1	no_errors	ENST00000567675	ensembl	human	known	74_37	rna	SNP	0.988	T
PACRG	135138	genome.wustl.edu	37	6	163483279	163483279	+	Missense_Mutation	SNP	G	G	T	rs374040289		TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr6:163483279G>T	ENST00000337019.3	+	4	613	c.389G>T	c.(388-390)gGa>gTa	p.G130V	PACRG_ENST00000366888.2_Missense_Mutation_p.G130V|PACRG_ENST00000366889.2_Missense_Mutation_p.G130V	NM_152410.2	NP_689623.2	Q96M98	PACRG_HUMAN	PARK2 co-regulated	130					spermatid development (GO:0007286)	cell body (GO:0044297)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm midpiece (GO:0097225)				endometrium(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)		GCTCGGCAAGGAATCCACGAC	0.433																																																	0								ENSG00000112530	G	VAL/GLY,VAL/GLY,VAL/GLY	0,4406		0,0,2203	101.0	96.0	98.0		389,389,389	4.8	1.0	6		98	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	PACRG	NM_001080378.1,NM_001080379.1,NM_152410.2	109,109,109	0,2,6501	TT,TG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging	130/258,130/258,130/297	163483279	2,13004	2203	4300	6503	PACRG	SO:0001583	missense	0			-	HGNC	AK057286	CCDS5284.1, CCDS43524.1	6q26	2004-07-01			ENSG00000112530	ENSG00000112530			19152	protein-coding gene	gene with protein product		608427				12547187	Standard	NM_001080378		Approved	PARK2CRG, FLJ32724, Glup, HAK005771	uc003qua.3	Q96M98	OTTHUMG00000016116	ENST00000337019.3:c.389G>T	6.37:g.163483279G>T	ENSP00000337946:p.Gly130Val	Somatic	0	47	0.00		0.4911483017230278	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	17	22.73	E1P5B5|Q6IMB8|Q8IZM1|Q8NHP5|Q9H1V9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Parkin_co-regulated_protein,superfamily_ARM-type_fold	p.G130V	ENST00000337019.3	37	c.389	CCDS5284.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.6|23.6	4.430739|4.430739	0.83776|0.83776	0.0|0.0	2.33E-4|2.33E-4	ENSG00000112530|ENSG00000112530	ENST00000337019;ENST00000366889;ENST00000366888|ENST00000534958	T;T;T|.	0.66280|.	-0.13;-0.2;-0.2|.	4.85|4.85	4.85|4.85	0.62838|0.62838	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84520|0.84520	0.5490|0.5490	M|M	0.92691|0.92691	3.335|3.335	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.998;1.0|.	D|D	0.88560|0.88560	0.3122|0.3122	10|5	0.87932|.	D|.	0|.	-11.5199|-11.5199	18.3664|18.3664	0.90392|0.90392	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	130;130|.	Q96M98-2;Q96M98|.	.;PACRG_HUMAN|.	V|S	130|45	ENSP00000337946:G130V;ENSP00000355855:G130V;ENSP00000355854:G130V|.	ENSP00000337946:G130V|.	G|R	+|+	2|3	0|2	PACRG|PACRG	163403269|163403269	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.366000|9.366000	0.97143|0.97143	2.401000|2.401000	0.81631|0.81631	0.609000|0.609000	0.83330|0.83330	GGA|AGG	-	pfam_Parkin_co-regulated_protein,superfamily_ARM-type_fold		0.433	PACRG-003	KNOWN	basic|CCDS	protein_coding	PACRG	protein_coding	OTTHUMT00000400424.1	G	NM_152410	-		163483279	+1	no_errors	ENST00000337019	ensembl	human	known	74_37	missense	SNP	1.000	T
ELAC2	60528	genome.wustl.edu	37	17	12906831	12906832	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr17:12906831_12906832delCA	ENST00000338034.4	-	12	1282_1283	c.1043_1044delTG	c.(1042-1044)gtgfs	p.V348fs	ELAC2_ENST00000395962.2_Frame_Shift_Del_p.V329fs|ELAC2_ENST00000426905.3_Frame_Shift_Del_p.V308fs|ELAC2_ENST00000609345.1_5'UTR	NM_018127.6|NM_173717.1	NP_060597.4|NP_776065.1	Q9BQ52	RNZ2_HUMAN	elaC ribonuclease Z 2	348					mitochondrial tRNA 3'-trailer cleavage, endonucleolytic (GO:0072684)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|skin(1)	23						TGTCCACAAGCACAGATGCTGG	0.579											OREG0024189	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000006744																																			ELAC2	SO:0001589	frameshift_variant	0				HGNC	AF304370	CCDS11164.1, CCDS54093.1	17p11.2	2013-05-24	2013-05-24		ENSG00000006744	ENSG00000006744	3.1.26.11		14198	protein-coding gene	gene with protein product	"""tRNase Z (long form)"""	605367	"""elaC (E. coli) homolog 2"", ""elaC homolog 2 (E. coli)"""			10986046, 16636667, 21559454	Standard	NM_018127		Approved	FLJ10530, HPC2	uc010vvr.2	Q9BQ52	OTTHUMG00000058764	ENST00000338034.4:c.1043_1044delTG	17.37:g.12906833_12906834delCA	ENSP00000337445:p.Val348fs	Somatic	0	85	0.00	683	0.4911483017230278	157	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	45	40.00	B4DPL9|Q6IA94|Q9HAS8|Q9HAS9|Q9NVT1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Beta-lactamas-like	p.V348fs	ENST00000338034.4	37	c.1044_1043	CCDS11164.1	17																																																																																			-	NULL		0.579	ELAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELAC2	protein_coding	OTTHUMT00000129934.5	CA				12906832	-1	no_errors	ENST00000338034	ensembl	human	known	74_37	frame_shift_del	DEL	0.933:0.932	-
INTS1	26173	genome.wustl.edu	37	7	1538144	1538144	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr7:1538144C>A	ENST00000404767.3	-	10	1414	c.1329G>T	c.(1327-1329)aaG>aaT	p.K443N	INTS1_ENST00000389470.4_Missense_Mutation_p.K571N|INTS1_ENST00000493531.1_5'Flank	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	443					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		AGATCACCAACTTGATGGTGG	0.622																																																	0								ENSG00000164880						96.0	110.0	105.0					7																	1538144		2139	4239	6378	INTS1	SO:0001583	missense	0			-	HGNC	AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.1329G>T	7.37:g.1538144C>A	ENSP00000385722:p.Lys443Asn	Somatic	0	80	0.00		0.4911483017230278	68	11.69	9	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	47	9.62	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3677,superfamily_ARM-type_fold	p.K571N	ENST00000404767.3	37	c.1713	CCDS47526.1	7	.	.	.	.	.	.	.	.	.	.	C	17.68	3.448908	0.63178	.	.	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.54675	2.43;0.56	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.69851	0.3157	M	0.73217	2.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.995	T	0.73477	-0.3970	10	0.87932	D	0	.	12.4065	0.55443	0.0:0.9175:0.0:0.0825	.	571;443	A4D212;Q8N201	.;INT1_HUMAN	N	443;571	ENSP00000385722:K443N;ENSP00000374121:K571N	ENSP00000374121:K571N	K	-	3	2	INTS1	1504670	1.000000	0.71417	0.999000	0.59377	0.378000	0.30076	2.044000	0.41241	2.216000	0.71823	0.591000	0.81541	AAG	-	NULL		0.622	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS1	protein_coding	OTTHUMT00000323683.1	C		-		1538144	-1	no_errors	ENST00000389470	ensembl	human	known	74_37	missense	SNP	1.000	A
SUGCT	79783	genome.wustl.edu	37	7	40277290	40277290	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr7:40277290G>A	ENST00000335693.4	+	7	585	c.562G>A	c.(562-564)Gct>Act	p.A188T	C7orf10_ENST00000401647.2_Missense_Mutation_p.A188T|C7orf10_ENST00000309930.5_Missense_Mutation_p.A188T	NM_001193313.1	NP_001180242.1	Q9HAC7	SUCHY_HUMAN		188					metabolic process (GO:0008152)	mitochondrion (GO:0005739)	succinate-hydroxymethylglutarate CoA-transferase activity (GO:0047369)			endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)	18						TGTTGCCTCGGCTGTTTCTGG	0.423																																																	0								ENSG00000175600						173.0	161.0	165.0					7																	40277290		1961	4168	6129	C7orf10	SO:0001583	missense	0			-	HGNC																												ENST00000335693.4:c.562G>A	7.37:g.40277290G>A	ENSP00000338475:p.Ala188Thr	Somatic	0	47	0.00		0.4911483017230278	19	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	12.90	A4D1W5|B4DR73|Q4KMW4|Q4KMW8|Q4KMZ0|Q8TE00|Q8TEY1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CoA-Trfase_fam_III,superfamily_CoA-Trfase_III_dom	p.A188T	ENST00000335693.4	37	c.562	CCDS55105.1	7	.	.	.	.	.	.	.	.	.	.	G	26.8	4.771011	0.90108	.	.	ENSG00000175600	ENST00000309930;ENST00000401647;ENST00000335693	D;T;T	0.92446	-3.04;-0.4;-0.4	5.35	5.35	0.76521	CoA-transferase family III domain (2);	0.093782	0.64402	N	0.000001	D	0.97377	0.9142	H	0.95365	3.66	0.80722	D	1	D;D;D	0.69078	0.996;0.997;0.997	D;D;D	0.70227	0.968;0.964;0.947	D	0.98274	1.0505	10	0.87932	D	0	-8.1766	19.0288	0.92946	0.0:0.0:1.0:0.0	.	188;188;151	Q4KMW8;Q9HAC7;Q9HAC7-2	.;CG010_HUMAN;.	T	188	ENSP00000312054:A188T;ENSP00000385222:A188T;ENSP00000338475:A188T	ENSP00000312054:A188T	A	+	1	0	C7orf10	40243815	1.000000	0.71417	0.998000	0.56505	0.954000	0.61252	6.243000	0.72384	2.675000	0.91044	0.655000	0.94253	GCT	-	pfam_CoA-Trfase_fam_III,superfamily_CoA-Trfase_III_dom		0.423	C7orf10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C7orf10	protein_coding	OTTHUMT00000338388.1	G		-		40277290	+1	no_errors	ENST00000309930	ensembl	human	known	74_37	missense	SNP	1.000	A
GOLGB1	2804	genome.wustl.edu	37	3	121413302	121413302	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr3:121413302T>A	ENST00000340645.5	-	13	6178	c.6053A>T	c.(6052-6054)cAa>cTa	p.Q2018L	GOLGB1_ENST00000393667.3_Missense_Mutation_p.Q2023L	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2018					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TACTTCTTGTTGTTTTTCTTT	0.368																																																	0								ENSG00000173230						149.0	153.0	152.0					3																	121413302		2203	4299	6502	GOLGB1	SO:0001583	missense	0			-	HGNC	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.6053A>T	3.37:g.121413302T>A	ENSP00000341848:p.Gln2018Leu	Somatic	0	14	0.00		0.4911483017230278	40	20.00	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	4	63.64	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.Q2018L	ENST00000340645.5	37	c.6053	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	T	13.94	2.387279	0.42308	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.22134	1.97;1.97	5.21	5.21	0.72293	.	0.000000	0.48767	D	0.000178	T	0.44582	0.1300	M	0.71581	2.175	0.54753	D	0.999987	D;D;D;D	0.89917	0.996;0.996;1.0;1.0	D;D;D;D	0.87578	0.99;0.99;0.997;0.998	T	0.33777	-0.9855	10	0.46703	T	0.11	.	13.0741	0.59077	0.0:0.0:0.0:1.0	.	1943;2023;2023;2018	F1T0J2;E7EP74;B2ZZ91;Q14789	.;.;.;GOGB1_HUMAN	L	2018;2023	ENSP00000341848:Q2018L;ENSP00000377275:Q2023L	ENSP00000341848:Q2018L	Q	-	2	0	GOLGB1	122895992	1.000000	0.71417	0.935000	0.37517	0.989000	0.77384	7.778000	0.85637	2.174000	0.68829	0.533000	0.62120	CAA	-	superfamily_Prefoldin		0.368	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	protein_coding	OTTHUMT00000355159.1	T	NM_004487	-		121413302	-1	no_errors	ENST00000340645	ensembl	human	known	74_37	missense	SNP	1.000	A
TACSTD2	4070	genome.wustl.edu	37	1	59041881	59041898	+	In_Frame_Del	DEL	CTCCCCCAGTTCCTTGAT	CTCCCCCAGTTCCTTGAT	-	rs529900062|rs376943593	byFrequency	TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	CTCCCCCAGTTCCTTGAT	CTCCCCCAGTTCCTTGAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr1:59041881_59041898delCTCCCCCAGTTCCTTGAT	ENST00000371225.2	-	1	1268_1285	c.931_948delATCAAGGAACTGGGGGAG	c.(931-948)atcaaggaactgggggagdel	p.IKELGE311del		NM_002353.2	NP_002344.2	P09758	TACD2_HUMAN	tumor-associated calcium signal transducer 2	311					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of branching involved in ureteric bud morphogenesis (GO:0090191)|negative regulation of cell motility (GO:2000146)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of stress fiber assembly (GO:0051497)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of stem cell differentiation (GO:2000738)|regulation of epithelial cell proliferation (GO:0050678)|ureteric bud morphogenesis (GO:0060675)|visual perception (GO:0007601)	basal plasma membrane (GO:0009925)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|nucleus (GO:0005634)	receptor activity (GO:0004872)					all_cancers(7;6.54e-05)					CCTTTCTCAACTCCCCCAGTTCCTTGATCTCCACCTTC	0.61																																																	0								ENSG00000184292																																			TACSTD2	SO:0001651	inframe_deletion	0				HGNC	X77753	CCDS609.1	1p32	2008-02-05			ENSG00000184292	ENSG00000184292			11530	protein-coding gene	gene with protein product		137290		M1S1		8382772, 11306819	Standard	NM_002353		Approved	TROP2, GA733-1, EGP-1	uc001cyz.4	P09758	OTTHUMG00000010067	ENST00000371225.2:c.931_948delATCAAGGAACTGGGGGAG	1.37:g.59041881_59041898delCTCCCCCAGTTCCTTGAT	ENSP00000360269:p.Ile311_Glu316del	Somatic	NA	NA	NA		0.4911483017230278	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q15658|Q6FG48|Q7Z7Q4|Q96QD2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Thyroglobulin_1,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	p.IKELGE311in_frame_del	ENST00000371225.2	37	c.948_931	CCDS609.1	1																																																																																			-	NULL		0.610	TACSTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACSTD2	protein_coding	OTTHUMT00000027818.1	CTCCCCCAGTTCCTTGAT	NM_002353			59041898	-1	no_errors	ENST00000371225	ensembl	human	known	74_37	in_frame_del	DEL	0.999:1.000:1.000:1.000:1.000:1.000:1.000:0.998:0.935:0.910:0.989:0.996:0.994:0.999:0.999:0.998:0.997:0.993	-
CYP2C19	1557	genome.wustl.edu	37	10	96609706	96609706	+	Silent	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr10:96609706G>T	ENST00000371321.3	+	8	1264	c.1182G>T	c.(1180-1182)gtG>gtT	p.V394V	CYP2C19_ENST00000464755.1_3'UTR	NM_000769.1	NP_000760	P33261	CP2CJ_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 19	394					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	(R)-limonene 6-monooxygenase activity (GO:0052741)|(S)-limonene 6-monooxygenase activity (GO:0018675)|(S)-limonene 7-monooxygenase activity (GO:0018676)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	43		Colorectal(252;0.09)		all cancers(201;6.02e-07)|KIRC - Kidney renal clear cell carcinoma(50;0.0672)|Kidney(138;0.0838)	Acenocoumarol(DB01418)|Acetylsalicylic acid(DB00945)|Adinazolam(DB00546)|Almotriptan(DB00918)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amoxicillin(DB01060)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Arformoterol(DB01274)|Artemether(DB06697)|Atomoxetine(DB00289)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Benzatropine(DB00245)|Bicalutamide(DB01128)|Bifonazole(DB04794)|Bortezomib(DB00188)|Bromazepam(DB01558)|Brompheniramine(DB00835)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carisoprodol(DB00395)|Chloramphenicol(DB00446)|Chlorpropamide(DB00672)|Cholecalciferol(DB00169)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clevidipine(DB04920)|Clobazam(DB00349)|Clomipramine(DB01242)|Clopidogrel(DB00758)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diltiazem(DB00343)|Dimethyl sulfoxide(DB01093)|Diphenhydramine(DB01075)|Dopamine(DB00988)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronabinol(DB00470)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enfuvirtide(DB00109)|Enzalutamide(DB08899)|Escitalopram(DB01175)|Esomeprazole(DB00736)|Estradiol(DB00783)|Ethanol(DB00898)|Ethotoin(DB00754)|Etoricoxib(DB01628)|Etravirine(DB06414)|Famotidine(DB00927)|Felbamate(DB00949)|Fluconazole(DB00196)|Flunitrazepam(DB01544)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Gliclazide(DB01120)|Glucosamine(DB01296)|Glyburide(DB01016)|Guanfacine(DB01018)|Haloperidol(DB00502)|Hexobarbital(DB01355)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Indomethacin(DB00328)|Isoniazid(DB00951)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Lopinavir(DB01601)|Loratadine(DB00455)|Lorcaserin(DB04871)|Losartan(DB00678)|Lovastatin(DB00227)|LULICONAZOLE(DB08933)|Lumiracoxib(DB01283)|MACITENTAN(DB08932)|Melatonin(DB01065)|Memantine(DB01043)|Meprobamate(DB00371)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methsuximide(DB05246)|Methylphenobarbital(DB00849)|Metoprolol(DB00264)|Miconazole(DB01110)|Moclobemide(DB01171)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Nicotine(DB00184)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Norethindrone(DB00717)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ospemifene(DB04938)|Oxcarbazepine(DB00776)|Oxiconazole(DB00239)|Pantoprazole(DB00213)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Pentobarbital(DB00312)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phensuximide(DB00832)|Phenytoin(DB00252)|Pimozide(DB01100)|Pioglitazone(DB01132)|Pipotiazine(DB01621)|Podofilox(DB01179)|Prasugrel(DB06209)|Praziquantel(DB01058)|Prednisone(DB00635)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propofol(DB00818)|Propranolol(DB00571)|Quazepam(DB01589)|Quetiapine(DB01224)|Quinine(DB00468)|Rabeprazole(DB01129)|Ramelteon(DB00980)|Ranitidine(DB00863)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Selegiline(DB01037)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sitaxentan(DB06268)|Sorafenib(DB00398)|Sulfanilamide(DB00259)|Tamoxifen(DB00675)|Tapentadol(DB06204)|Telmisartan(DB00966)|Temazepam(DB00231)|Teniposide(DB00444)|Terbinafine(DB00857)|Testosterone(DB00624)|Thalidomide(DB01041)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Timolol(DB00373)|Tioconazole(DB01007)|Tipranavir(DB00932)|Tofacitinib(DB08895)|Tolbutamide(DB01124)|Tolterodine(DB01036)|Topiramate(DB00273)|Torasemide(DB00214)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Trimethadione(DB00347)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zolpidem(DB00425)|Zonisamide(DB00909)	TCACTTCTGTGCTACATGACA	0.398																																																	0								ENSG00000165841						173.0	159.0	164.0					10																	96609706		2203	4300	6503	CYP2C19	SO:0001819	synonymous_variant	0			-	HGNC	M61854	CCDS7436.1	10q24	2007-12-14	2003-01-14		ENSG00000165841	ENSG00000165841		"""Cytochrome P450s"""	2621	protein-coding gene	gene with protein product		124020	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 19"""	CYP2C		2009263, 8530044	Standard	NM_000769		Approved	P450IIC19, CPCJ	uc010qnz.2	P33261	OTTHUMG00000018799	ENST00000371321.3:c.1182G>T	10.37:g.96609706G>T		Somatic	0	79	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	P33259|Q8WZB1|Q8WZB2|Q9UCD4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.V394	ENST00000371321.3	37	c.1182	CCDS7436.1	10																																																																																			-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_B		0.398	CYP2C19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C19	protein_coding	OTTHUMT00000049490.1	G	NM_000769	-		96609706	+1	no_errors	ENST00000371321	ensembl	human	known	74_37	silent	SNP	1.000	T
SSX1	6756	genome.wustl.edu	37	X	48125797	48125797	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chrX:48125797G>T	ENST00000376919.3	+	7	678	c.542G>T	c.(541-543)aGt>aTt	p.S181I		NM_001278691.1|NM_005635.2	NP_001265620.1|NP_005626.1	Q16384	SSX1_HUMAN	synovial sarcoma, X breakpoint 1	181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|transcription corepressor activity (GO:0003714)		SS18/SSX1(1169)|SS18L1/SSX1(2)	endometrium(2)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	9						GAAGAGATCAGTGACCCTGAG	0.493			T	SS18	synovial sarcoma																																Esophageal Squamous(175;994 1982 2214 6527 18857)			Dom	yes		X	Xp11.23-p11.22	6756	"""synovial sarcoma, X breakpoint 1"""		M	0								ENSG00000126752						319.0	297.0	305.0					X																	48125797		1511	2706	4217	SSX1	SO:0001583	missense	0			-	HGNC	BC001003	CCDS14290.1	Xp11.23	2009-03-12			ENSG00000126752	ENSG00000126752			11335	protein-coding gene	gene with protein product	"""cancer/testis antigen family 5, member 1"""	312820				7655467	Standard	NM_005635		Approved	CT5.1	uc004djb.1	Q16384	OTTHUMG00000021488	ENST00000376919.3:c.542G>T	X.37:g.48125797G>T	ENSP00000366118:p.Ser181Ile	Somatic	0	353	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	81	140	36.65	A3KN76|Q08AJ2|Q5JQ64	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SSXRD_motif,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.S181I	ENST00000376919.3	37	c.542	CCDS14290.1	X	.	.	.	.	.	.	.	.	.	.	N	14.28	2.489388	0.44249	.	.	ENSG00000126752	ENST00000376919	T	0.15487	2.42	2.39	2.39	0.29439	SSXRD motif (1);	0.249770	0.28971	N	0.013550	T	0.20820	0.0501	L	0.61218	1.895	0.24345	N	0.994946	P	0.36789	0.57	B	0.42386	0.386	T	0.09314	-1.0680	10	0.87932	D	0	.	7.6005	0.28073	0.0:0.0:1.0:0.0	.	181	Q16384	SSX1_HUMAN	I	181	ENSP00000366118:S181I	ENSP00000366118:S181I	S	+	2	0	SSX1	48010741	0.992000	0.36948	0.743000	0.31040	0.157000	0.22087	2.968000	0.49224	1.493000	0.48517	0.380000	0.24917	AGT	-	pfam_SSXRD_motif		0.493	SSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSX1	protein_coding	OTTHUMT00000056485.1	G	NM_005635	-		48125797	+1	no_errors	ENST00000376919	ensembl	human	known	74_37	missense	SNP	0.735	T
NPTXR	23467	genome.wustl.edu	37	22	39222586	39222586	+	Silent	SNP	G	G	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr22:39222586G>A	ENST00000333039.2	-	3	1140	c.1017C>T	c.(1015-1017)tcC>tcT	p.S339S		NM_014293.3	NP_055108	O95502	NPTXR_HUMAN	neuronal pentraxin receptor	339	Pentaxin.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			central_nervous_system(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	Melanoma(58;0.04)					GCACTGAGTAGGAGAAGGGGG	0.667																																					Pancreas(139;2521 3281 36965)												0								ENSG00000221890						67.0	64.0	65.0					22																	39222586		2203	4300	6503	NPTXR	SO:0001819	synonymous_variant	0			-	HGNC	AF052163	CCDS33647.1	22q13.1	2007-01-25			ENSG00000221890	ENSG00000221890			7954	protein-coding gene	gene with protein product		609474				16497176	Standard	NM_014293		Approved		uc003awk.3	O95502	OTTHUMG00000150458	ENST00000333039.2:c.1017C>T	22.37:g.39222586G>A		Somatic	0	75	0.00		0.4911483017230278	14	36.36	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	39	22.00		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.S339	ENST00000333039.2	37	c.1017	CCDS33647.1	22																																																																																			-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin		0.667	NPTXR-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	NPTXR	protein_coding	OTTHUMT00000318194.2	G	NM_014293	-		39222586	-1	no_errors	ENST00000333039	ensembl	human	known	74_37	silent	SNP	1.000	A
LAMA4	3910	genome.wustl.edu	37	6	112476928	112476928	+	Intron	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr6:112476928G>T	ENST00000230538.7	-	15	2215				LAMA4_ENST00000389463.4_Intron|RP1-142L7.5_ENST00000585373.1_RNA|LAMA4_ENST00000424408.2_Intron|RP1-142L7.5_ENST00000588689.1_RNA|RP1-142L7.5_ENST00000425503.1_RNA|LAMA4_ENST00000522006.1_Intron	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4						blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		AACAAACATTGTTATTTCTCC	0.363																																																	0								ENSG00000237234						97.0	97.0	97.0					6																	112476928		2203	4300	6503	RP1-142L7.5	SO:0001627	intron_variant	0			-	Clone_based_vega_gene		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.1818-20C>A	6.37:g.112476928G>T		Somatic	0	59	0.00		0.4911483017230278	2	33.33	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	25	21.88	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000230538.7	37	NULL	CCDS43491.1	6																																																																																			-	-		0.363	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000237234	protein_coding	OTTHUMT00000041876.2	G	NM_001105206	-		112476928	+1	no_errors	ENST00000588689	ensembl	human	known	74_37	rna	SNP	0.000	T
TNS3	64759	genome.wustl.edu	37	7	47408586	47408586	+	Silent	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr7:47408586G>T	ENST00000398879.1	-	17	2023	c.1657C>A	c.(1657-1659)Cgg>Agg	p.R553R	TNS3_ENST00000311160.9_Silent_p.R553R|TNS3_ENST00000355730.3_Silent_p.R313R			Q68CZ2	TENS3_HUMAN	tensin 3	553					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						CCAAAAGTCCGCTCCCGCTCA	0.627																																																	0								ENSG00000136205						39.0	43.0	42.0					7																	47408586		2039	4187	6226	TNS3	SO:0001819	synonymous_variant	0			-	HGNC	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.1657C>A	7.37:g.47408586G>T		Somatic	0	33	0.00		0.4911483017230278	16	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_dom,smart_Tyr_Pase_cat,smart_SH2,smart_PTB/PI_dom,pfscan_SH2,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.R553	ENST00000398879.1	37	c.1657	CCDS5506.2	7																																																																																			-	NULL		0.627	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS3	protein_coding	OTTHUMT00000157253.1	G	NM_022748	-		47408586	-1	no_errors	ENST00000311160	ensembl	human	known	74_37	silent	SNP	0.699	T
ANHX	647589	genome.wustl.edu	37	12	133803696	133803696	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr12:133803696A>G	ENST00000545940.1	-	4	2282	c.544T>C	c.(544-546)Tac>Cac	p.Y182H	ANHX_ENST00000419717.1_Missense_Mutation_p.Y182H			E9PGG2	ANHX_HUMAN	anomalous homeobox	182					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)										AACCAGTTGTACACCTGCTCA	0.592																																																	0								ENSG00000227059																																			ANHX	SO:0001583	missense	0			-	HGNC		CCDS53855.1	12q24.33	2012-05-18			ENSG00000227059	ENSG00000227059			40024	protein-coding gene	gene with protein product							Standard	NM_001191054		Approved		uc010tci.2	E9PGG2	OTTHUMG00000167949	ENST00000545940.1:c.544T>C	12.37:g.133803696A>G	ENSP00000439513:p.Tyr182His	Somatic	0	99	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	40	47.37	Q96MC1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.Y182H	ENST00000545940.1	37	c.544	CCDS53855.1	12	.	.	.	.	.	.	.	.	.	.	.	11.35	1.613294	0.28712	.	.	ENSG00000227059	ENST00000545940;ENST00000419717	D;D	0.96136	-3.92;-3.92	4.4	1.79	0.24919	.	.	.	.	.	D	0.88507	0.6455	N	0.16743	0.435	0.22401	N	0.999133	P	0.38922	0.651	B	0.40066	0.318	T	0.80917	-0.1168	8	.	.	.	.	3.2746	0.06894	0.6826:0.0:0.1138:0.2036	.	182	E9PGG2	.	H	182	ENSP00000439513:Y182H;ENSP00000409950:Y182H	.	Y	-	1	0	AC226150.2	.	0.972000	0.33761	0.637000	0.29366	0.650000	0.38633	1.545000	0.36169	0.665000	0.31066	0.455000	0.32223	TAC	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.592	ANHX-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ANHX	protein_coding	OTTHUMT00000397203.1	A		-		133803696	-1	no_errors	ENST00000419717	ensembl	human	known	74_37	missense	SNP	0.746	G
FOXRED2	80020	genome.wustl.edu	37	22	36894076	36894076	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr22:36894076C>G	ENST00000397224.4	-	6	1437	c.1344G>C	c.(1342-1344)caG>caC	p.Q448H	FOXRED2_ENST00000397223.4_Missense_Mutation_p.Q448H|FOXRED2_ENST00000216187.6_Missense_Mutation_p.Q448H|FOXRED2_ENST00000366463.3_5'UTR	NM_001102371.1	NP_001095841.1	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2	448					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum lumen (GO:0005788)	flavin adenine dinucleotide binding (GO:0050660)|glycoprotein binding (GO:0001948)|oxidoreductase activity (GO:0016491)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CACCGAACATCTGGTAGAGCC	0.637																																																	0								ENSG00000100350						88.0	82.0	84.0					22																	36894076		2203	4300	6503	FOXRED2	SO:0001583	missense	0			-	HGNC	BC027716	CCDS13929.1	22q12.3	2006-07-05			ENSG00000100350	ENSG00000100350			26264	protein-coding gene	gene with protein product		613777				12477932	Standard	NM_024955		Approved	FLJ23322	uc003app.4	Q8IWF2	OTTHUMG00000044614	ENST00000397224.4:c.1344G>C	22.37:g.36894076C>G	ENSP00000380401:p.Gln448His	Somatic	0	127	0.00		0.4911483017230278	30	31.82	14	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	53	29.33	B2RDI4|Q8N378|Q96BD1|Q9H5L5|Q9H6M8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	p.Q448H	ENST00000397224.4	37	c.1344	CCDS13929.1	22	.	.	.	.	.	.	.	.	.	.	C	20.7	4.039313	0.75617	.	.	ENSG00000100350	ENST00000397224;ENST00000216187;ENST00000397223	T;T;T	0.23552	1.9;1.9;1.9	5.07	4.04	0.47022	.	0.000000	0.85682	D	0.000000	T	0.45498	0.1345	M	0.84846	2.72	0.58432	D	0.999997	D	0.54772	0.968	P	0.55087	0.768	T	0.49542	-0.8929	10	0.56958	D	0.05	-33.2634	10.203	0.43097	0.0:0.8447:0.0:0.1553	.	448	Q8IWF2	FXRD2_HUMAN	H	448	ENSP00000380401:Q448H;ENSP00000216187:Q448H;ENSP00000380400:Q448H	ENSP00000216187:Q448H	Q	-	3	2	FOXRED2	35224022	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.640000	0.37186	1.105000	0.41606	0.650000	0.86243	CAG	-	NULL		0.637	FOXRED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXRED2	protein_coding	OTTHUMT00000104098.2	C	NM_024955	-		36894076	-1	no_errors	ENST00000216187	ensembl	human	known	74_37	missense	SNP	1.000	G
DMXL1	1657	genome.wustl.edu	37	5	118533525	118533525	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr5:118533525G>A	ENST00000311085.8	+	32	7699	c.7619G>A	c.(7618-7620)cGa>cAa	p.R2540Q	DMXL1_ENST00000539542.1_Missense_Mutation_p.R2540Q	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2540										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		CTTCTCCGACGACTTGAAATC	0.433																																																	0								ENSG00000172869						136.0	135.0	135.0					5																	118533525		2202	4300	6502	DMXL1	SO:0001583	missense	0			-	HGNC	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.7619G>A	5.37:g.118533525G>A	ENSP00000309690:p.Arg2540Gln	Somatic	0	99	0.00		0.4911483017230278	33	21.43	9	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	77	18.09		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R2540Q	ENST00000311085.8	37	c.7619	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	G	29.2	4.989586	0.93106	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.09723	2.96;2.95	5.41	5.41	0.78517	.	0.051242	0.85682	D	0.000000	T	0.17450	0.0419	L	0.47190	1.495	0.58432	D	0.999999	D;P	0.58268	0.982;0.895	P;B	0.48227	0.571;0.295	T	0.00857	-1.1538	10	0.30854	T	0.27	-8.6847	19.5578	0.95358	0.0:0.0:1.0:0.0	.	2540;2540	F5H269;Q9Y485	.;DMXL1_HUMAN	Q	2540	ENSP00000309690:R2540Q;ENSP00000439479:R2540Q	ENSP00000309690:R2540Q	R	+	2	0	DMXL1	118561424	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.173000	0.77612	2.695000	0.91970	0.563000	0.77884	CGA	-	NULL		0.433	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	protein_coding	OTTHUMT00000250862.1	G	NM_005509	-		118533525	+1	no_errors	ENST00000539542	ensembl	human	known	74_37	missense	SNP	1.000	A
SOX6	55553	genome.wustl.edu	37	11	16119196	16119196	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr11:16119196C>A	ENST00000352083.6	-	8	1014	c.937G>T	c.(937-939)Gca>Tca	p.A313S	SOX6_ENST00000528429.1_Missense_Mutation_p.A313S|SOX6_ENST00000527619.1_Missense_Mutation_p.A316S|SOX6_ENST00000528252.1_Missense_Mutation_p.A313S|SOX6_ENST00000316399.6_Missense_Mutation_p.A313S|SOX6_ENST00000396356.3_Missense_Mutation_p.A313S			P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6	313	Poly-Ala.				astrocyte differentiation (GO:0048708)|cardiac muscle cell differentiation (GO:0055007)|cartilage development (GO:0051216)|cell morphogenesis (GO:0000902)|cellular response to transforming growth factor beta stimulus (GO:0071560)|erythrocyte development (GO:0048821)|gene silencing (GO:0016458)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte cell fate specification (GO:0021778)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|pancreas(1)|prostate(2)	43						GCAGCAGCTGCCATTGTTGAT	0.453																																																	0								ENSG00000110693						99.0	99.0	99.0					11																	16119196		2200	4294	6494	SOX6	SO:0001583	missense	0			-	HGNC	AF309034	CCDS7821.1, CCDS53604.1, CCDS53605.1	11p15.3	2008-02-05						"""SRY (sex determining region Y)-boxes"""	16421	protein-coding gene	gene with protein product		607257				11255018	Standard	NM_033326		Approved		uc001mme.3	P35712		ENST00000352083.6:c.937G>T	11.37:g.16119196C>A	ENSP00000339876:p.Ala313Ser	Somatic	0	55	0.00		0.4911483017230278	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	27	20.59	Q86VX7|Q9BXQ3|Q9BXQ4|Q9BXQ5|Q9H0I8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.A313S	ENST00000352083.6	37	c.937		11	.	.	.	.	.	.	.	.	.	.	C	19.60	3.858267	0.71834	.	.	ENSG00000110693	ENST00000316399;ENST00000352083;ENST00000396356;ENST00000528252;ENST00000527619;ENST00000528429	D;D;D;D;D;D	0.98849	-5.08;-5.06;-5.08;-5.18;-5.17;-5.06	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	D	0.98757	0.9582	L	0.49126	1.545	0.80722	D	1	D;D;D	0.71674	0.982;0.998;0.996	P;D;D	0.76071	0.885;0.979;0.987	D	0.98600	1.0658	10	0.31617	T	0.26	.	20.5948	0.99439	0.0:1.0:0.0:0.0	.	313;313;316	P35712-3;P35712;P35712-2	.;SOX6_HUMAN;.	S	313;313;313;313;316;313	ENSP00000324948:A313S;ENSP00000339876:A313S;ENSP00000379644:A313S;ENSP00000432134:A313S;ENSP00000434455:A316S;ENSP00000433233:A313S	ENSP00000324948:A313S	A	-	1	0	SOX6	16075772	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.456000	0.80751	2.873000	0.98535	0.563000	0.77884	GCA	-	NULL		0.453	SOX6-201	KNOWN	basic|appris_candidate_longest	protein_coding	SOX6	protein_coding	OTTHUMT00000386811.1	C	NM_033326	-		16119196	-1	no_errors	ENST00000352083	ensembl	human	known	74_37	missense	SNP	1.000	A
UMODL1	89766	genome.wustl.edu	37	21	43531405	43531405	+	Intron	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr21:43531405G>T	ENST00000408910.2	+	11	1899				UMODL1_ENST00000408989.2_Silent_p.R691R|UMODL1_ENST00000400427.1_Silent_p.R619R|C21orf128_ENST00000329015.2_5'Flank|UMODL1_ENST00000400424.2_Intron	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1						adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						CCAGCCAGCGGAGCACCAGCC	0.731																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)												0								ENSG00000177398						5.0	7.0	6.0					21																	43531405		1792	3896	5688	UMODL1	SO:0001627	intron_variant	0			-	HGNC		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.1899+174G>T	21.37:g.43531405G>T		Somatic	0	24	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	16	20.00	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ZP_dom,pfam_SEA_dom,pfam_EGF-like_Ca-bd_dom,pfam_EMI_domain,pfam_WAP-type_4-diS_core,superfamily_Fibronectin_type3,superfamily_WAP-type_4-diS_core,smart_WAP-type_4-diS_core,smart_EGF-like_Ca-bd_dom,smart_Fibronectin_type3,smart_ZP_dom,pfscan_EG-like_dom,pfscan_EMI_domain,pfscan_Fibronectin_type3,pfscan_ZP_dom,prints_ZP_dom	p.R691	ENST00000408910.2	37	c.2073	CCDS42936.1	21																																																																																			-	NULL		0.731	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UMODL1	protein_coding	OTTHUMT00000195292.2	G		-		43531405	+1	no_errors	ENST00000408989	ensembl	human	known	74_37	silent	SNP	0.000	T
SEMA4G	57715	genome.wustl.edu	37	10	102744515	102744515	+	3'UTR	SNP	T	T	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr10:102744515T>A	ENST00000370250.4	+	0	3517				MRPL43_ENST00000370241.3_Intron|MRPL43_ENST00000370242.4_Intron|MRPL43_ENST00000493646.1_5'Flank|MRPL43_ENST00000342071.1_Intron|MRPL43_ENST00000318325.2_Intron|SEMA4G_ENST00000517724.1_Nonsense_Mutation_p.C658*|RP11-108L7.4_ENST00000447344.1_RNA|SEMA4G_ENST00000210633.3_3'UTR|MRPL43_ENST00000299179.5_Intron	NM_017893.3	NP_060363.2	Q9NTN9	SEM4G_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G						cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		CAGCCCCATGTGGTGACCTCT	0.567																																																	0								ENSG00000095539																																			SEMA4G	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AB046839	CCDS7501.1, CCDS55724.1	10q24.31	2013-01-11			ENSG00000095539	ENSG00000095539		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10735	protein-coding gene	gene with protein product							Standard	NM_017893		Approved	FLJ20590, KIAA1619	uc001krw.2	Q9NTN9	OTTHUMG00000018922	ENST00000370250.4:c.*627T>A	10.37:g.102744515T>A		Somatic	0	34	0.00		0.4911483017230278	8	11.11	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	23	28.12	A1A5C6|A6NJY8|Q58EY1|Q9HCF3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.C658*	ENST00000370250.4	37	c.1974		10	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	t|t|t	33|33|33	5.207230|5.207230|5.207230	0.95033|0.95033|0.95033	.|.|.	.|.|.	ENSG00000095539|ENSG00000095539|ENSG00000095539	ENST00000517724|ENST00000457585|ENST00000476171	.|.|.	.|.|.	.|.|.	4.51|4.51|4.51	3.3|3.3|3.3	0.37823|0.37823|0.37823	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|T|T	.|0.33847|0.33847	.|0.0877|0.0877	.|.|.	.|.|.	.|.|.	0.19300|0.19300|0.19300	N|N|N	0.999975|0.999975|0.999975	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|T|T	.|0.15607|0.15607	.|-1.0431|-1.0431	.|5|4	.|0.31617|.	.|T|.	.|0.26|.	.|.|.	7.3118|7.3118|7.3118	0.26479|0.26479|0.26479	0.1946:0.0:0.0:0.8054|0.1946:0.0:0.0:0.8054|0.1946:0.0:0.0:0.8054	.|.|.	.|.|.	.|.|.	.|.|.	X|E|R	658|537|121	.|.|.	.|ENSP00000405616:V537E|.	C|V|W	+|+|+	3|2|1	2|0|0	SEMA4G|SEMA4G|SEMA4G	102734505|102734505|102734505	0.824000|0.824000|0.824000	0.29247|0.29247|0.29247	0.042000|0.042000|0.042000	0.18584|0.18584|0.18584	0.960000|0.960000|0.960000	0.62799|0.62799|0.62799	1.046000|1.046000|1.046000	0.30354|0.30354|0.30354	1.891000|1.891000|1.891000	0.54761|0.54761|0.54761	0.375000|0.375000|0.375000	0.23000|0.23000|0.23000	TGT|GTG|TGG	-	NULL		0.567	SEMA4G-002	KNOWN	basic	protein_coding	SEMA4G	protein_coding	OTTHUMT00000049920.2	T		-		102744515	+1	no_errors	ENST00000517724	ensembl	human	putative	74_37	nonsense	SNP	0.005	A
DNM1P47	100216544	genome.wustl.edu	37	15	102294602	102294602	+	RNA	SNP	C	C	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr15:102294602C>T	ENST00000561463.1	+	0	2648									DNM1 pseudogene 47																		GTGGAGGAGTCGGCAGAGCAG	0.602																																																	0								ENSG00000259660																																			DNM1P47			0			-	HGNC	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102294602C>T		Somatic	0	61	0.00		0.4911483017230278	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	-		0.602	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	pseudogene	OTTHUMT00000417589.1	C	NG_009149	-		102294602	+1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	SNP	0.997	T
RIC3	79608	genome.wustl.edu	37	11	8159967	8159967	+	Intron	DEL	A	A	-	rs78612783		TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr11:8159967delA	ENST00000309737.6	-	3	351				RIC3_ENST00000539720.1_Intron|RIC3_ENST00000425599.2_Intron|RIC3_ENST00000335425.7_Intron|RIC3_ENST00000343202.4_Intron|RIC3_ENST00000530060.1_5'UTR			Q7Z5B4	RIC3_HUMAN	RIC3 acetylcholine receptor chaperone						cellular protein complex assembly (GO:0043623)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein folding (GO:0006457)|synaptic transmission, cholinergic (GO:0007271)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)	17				Epithelial(150;2.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.204)		CATATCAAACAAAAAAAAAAG	0.383																																																	0								ENSG00000166405																																			RIC3	SO:0001627	intron_variant	0				HGNC		CCDS7788.1, CCDS44533.1, CCDS55741.1, CCDS55742.1	11p15.4	2013-08-05	2013-08-05		ENSG00000166405	ENSG00000166405			30338	protein-coding gene	gene with protein product		610509	"""resistance to inhibitors of cholinesterase 3 homolog (C. elegans)"""			12821669	Standard	NM_024557		Approved	FLJ11608, PRO1385, AYST720	uc001mgd.2	Q7Z5B4	OTTHUMG00000165694	ENST00000309737.6:c.352-73T>-	11.37:g.8159967delA		Somatic	0	33	0.00		0.4911483017230278	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	B0B1U0|B2RD25|D3DQU5|Q6UX78|Q7Z5B3|Q86T94|Q8TBJ9|Q9HAH8	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000309737.6	37	NULL	CCDS55742.1	11																																																																																			-	-		0.383	RIC3-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RIC3	protein_coding	OTTHUMT00000385900.1	A	NM_024557			8159967	-1	no_errors	ENST00000524799	ensembl	human	known	74_37	rna	DEL	0.000	-
SIDT2	51092	genome.wustl.edu	37	11	117064673	117064673	+	Silent	SNP	C	C	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr11:117064673C>T	ENST00000324225.4	+	24	2847	c.2316C>T	c.(2314-2316)acC>acT	p.T772T	SIDT2_ENST00000431081.2_Silent_p.T769T|SIDT2_ENST00000532062.1_Silent_p.T64T	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	772					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		GACTCAGCACCTGGCAGGTGA	0.572																																																	0								ENSG00000149577						72.0	66.0	68.0					11																	117064673		2201	4296	6497	SIDT2	SO:0001819	synonymous_variant	0			-	HGNC	AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.2316C>T	11.37:g.117064673C>T		Somatic	0	25	0.00		0.4911483017230278	88	40.94	61	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	8	52.94	Q8NBY7|Q9Y357	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T793	ENST00000324225.4	37	c.2379	CCDS31682.1	11																																																																																			-	NULL		0.572	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT2	protein_coding	OTTHUMT00000392836.1	C	NM_015996	-		117064673	+1	no_errors	ENST00000278951	ensembl	human	known	74_37	silent	SNP	1.000	T
ZNF879	345462	genome.wustl.edu	37	5	178459892	178459892	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr5:178459892C>A	ENST00000444149.2	+	5	1131	c.943C>A	c.(943-945)Ccc>Acc	p.P315T		NM_001136116.1	NP_001129588.1	B4DU55	ZN879_HUMAN	zinc finger protein 879	315					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|pancreas(1)|stomach(1)	7						AGGAGAGAAGCCCTATAAGTG	0.418																																																	0								ENSG00000234284						51.0	47.0	48.0					5																	178459892		692	1591	2283	ZNF879	SO:0001583	missense	0			-	HGNC	AK300504	CCDS47352.1	5q35.3	2013-01-08			ENSG00000234284	ENSG00000234284		"""Zinc fingers, C2H2-type"", ""-"""	37273	protein-coding gene	gene with protein product							Standard	NM_001136116		Approved	DKFZp686E2433	uc003mjt.4	B4DU55	OTTHUMG00000163596	ENST00000444149.2:c.943C>A	5.37:g.178459892C>A	ENSP00000414887:p.Pro315Thr	Somatic	0	56	0.00		0.4911483017230278	7	12.50	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	58	21.62		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P315T	ENST00000444149.2	37	c.943	CCDS47352.1	5	.	.	.	.	.	.	.	.	.	.	C	13.36	2.213480	0.39102	.	.	ENSG00000234284	ENST00000444149	T	0.56275	0.47	4.36	3.48	0.39840	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.63046	0.2478	L	0.58302	1.8	0.80722	D	1	D	0.64830	0.994	D	0.64237	0.923	T	0.63589	-0.6603	9	0.54805	T	0.06	-9.8943	9.9944	0.41891	0.0:0.8967:0.0:0.1033	.	315	B4DU55	ZN879_HUMAN	T	315	ENSP00000414887:P315T	ENSP00000414887:P315T	P	+	1	0	ZNF879	178392498	0.988000	0.35896	1.000000	0.80357	0.449000	0.32228	2.920000	0.48844	2.393000	0.81446	0.591000	0.81541	CCC	-	pfscan_Znf_C2H2		0.418	ZNF879-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF879	protein_coding	OTTHUMT00000374447.1	C	NM_001136116	-		178459892	+1	no_errors	ENST00000444149	ensembl	human	known	74_37	missense	SNP	1.000	A
KLHL24	54800	genome.wustl.edu	37	3	183368664	183368664	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr3:183368664delT	ENST00000454652.2	+	4	906	c.520delT	c.(520-522)tttfs	p.F174fs	KLHL24_ENST00000242810.6_Frame_Shift_Del_p.F174fs|KLHL24_ENST00000476808.1_Frame_Shift_Del_p.F174fs	NM_017644.3	NP_060114.2	Q6TFL4	KLH24_HUMAN	kelch-like family member 24	174	BACK.					cell projection (GO:0042995)|cytoplasm (GO:0005737)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			AATCCAGCGCTTTGCTGATAC	0.418																																																	0								ENSG00000114796						99.0	96.0	97.0					3																	183368664		2203	4300	6503	KLHL24	SO:0001589	frameshift_variant	0				HGNC		CCDS3246.1	3q27.1	2013-02-22	2013-02-22		ENSG00000114796	ENSG00000114796		"""Kelch-like"", ""BTB/POZ domain containing"""	25947	protein-coding gene	gene with protein product		611295	"""kelch-like 24 (Drosophila)"""				Standard	XM_005247552		Approved	DRE1, FLJ20059	uc003flv.3	Q6TFL4	OTTHUMG00000156911	ENST00000454652.2:c.520delT	3.37:g.183368664delT	ENSP00000395012:p.Phe174fs	Somatic	0	17	0.00		0.4911483017230278	21	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	A5PLN8|Q9H620|Q9NXT9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.F174fs	ENST00000454652.2	37	c.520	CCDS3246.1	3																																																																																			-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin		0.418	KLHL24-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KLHL24	protein_coding	OTTHUMT00000346586.2	T	NM_017644			183368664	+1	no_errors	ENST00000242810	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
MN1	4330	genome.wustl.edu	37	22	28194945	28194945	+	Silent	SNP	C	C	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr22:28194945C>T	ENST00000302326.4	-	1	2541	c.1587G>A	c.(1585-1587)caG>caA	p.Q529Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	529	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgctgctgctgct	0.647			T	ETV6	"""AML, meningioma"""																																			Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	0								ENSG00000169184						3.0	5.0	4.0					22																	28194945		1291	2827	4118	MN1	SO:0001819	synonymous_variant	0			-	HGNC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1587G>A	22.37:g.28194945C>T		Somatic	0	61	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	18	33.33	A9Z1V9	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q529	ENST00000302326.4	37	c.1587	CCDS42998.1	22																																																																																			-	NULL		0.647	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MN1	protein_coding	OTTHUMT00000320737.1	C	NM_002430	-		28194945	-1	no_errors	ENST00000302326	ensembl	human	known	74_37	silent	SNP	0.972	T
CDK11A	728642	genome.wustl.edu	37	1	1647893	1647894	+	In_Frame_Ins	INS	-	-	TTTCTT	rs200224067|rs199866927|rs144636354		TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr1:1647893_1647894insTTTCTT	ENST00000378633.1	-	5	428_429	c.349_350insAAGAAA	c.(349-351)aga>aAAGAAAga	p.116_117insKE	CDK11A_ENST00000356200.3_In_Frame_Ins_p.92_93insKE|CDK11A_ENST00000358779.5_In_Frame_Ins_p.116_117insKE|CDK11A_ENST00000378638.2_In_Frame_Ins_p.92_93insKE|CDK11A_ENST00000357760.2_In_Frame_Ins_p.116_117insKE|RP1-283E3.8_ENST00000598846.1_RNA|CDK11A_ENST00000404249.3_In_Frame_Ins_p.126_127insKE|CDK11A_ENST00000378635.3_In_Frame_Ins_p.116_117insKE			Q9UQ88	CD11A_HUMAN	cyclin-dependent kinase 11A	116	Glu-rich.				apoptotic process (GO:0006915)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(4)|stomach(1)|urinary_tract(1)	18						TTCGTGCTCTCTTTCTTTCACT	0.485																																					Pancreas(186;965 2119 30274 40311 50569)												0								ENSG00000008128																																			CDK11A	SO:0001652	inframe_insertion	0				HGNC	AF067522	CCDS44042.1, CCDS44043.1	1p36.33	2011-11-08	2009-12-16	2009-12-16	ENSG00000008128	ENSG00000008128		"""Cyclin-dependent kinases"""	1730	protein-coding gene	gene with protein product		116951	"""cell division cycle 2-like 2"", ""cell division cycle 2-like 2 (PITSLRE proteins)"""	CDC2L3, CDC2L2		7920654, 9750192, 19884882	Standard	NM_033529		Approved	PITSLRE, CDK11-p110, CDK11-p58, CDK11-p46, p58GTA		Q9UQ88	OTTHUMG00000000703	ENST00000378633.1:c.344_349dupAAGAAA	1.37:g.1647894_1647899dupTTTCTT	ENSP00000367900:p.Lys115_Glu116dup	Somatic	NA	NA	NA		0.4911483017230278	173	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O95227|O95228|O96012|Q12821|Q12853|Q12854|Q2TAJ0|Q5QPR0|Q5QPR1|Q5QPR2|Q9UBC4|Q9UBI3|Q9UEI1|Q9UEI2|Q9UP53|Q9UP54|Q9UP55|Q9UP56|Q9UQ86|Q9UQ87|Q9UQ89	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.127in_frame_insKE	ENST00000378633.1	37	c.380_379		1																																																																																			-	NULL		0.485	CDK11A-005	NOVEL	basic	protein_coding	CDK11A	protein_coding	OTTHUMT00000001735.1	-	NM_024011			1647894	-1	no_errors	ENST00000404249	ensembl	human	known	74_37	in_frame_ins	INS	0.142:0.971	TTTCTT
ZNF683	257101	genome.wustl.edu	37	1	26691177	26691177	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr1:26691177T>C	ENST00000436292.1	-	4	980	c.860A>G	c.(859-861)gAg>gGg	p.E287G	ZNF683_ENST00000374204.1_Missense_Mutation_p.E287G|ZNF683_ENST00000349618.3_Missense_Mutation_p.E287G|ZNF683_ENST00000403843.1_Missense_Mutation_p.E287G			Q8IZ20	ZN683_HUMAN	zinc finger protein 683	287					natural killer cell differentiation (GO:0001779)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(1)	15		all_cancers(24;2.39e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.76e-26)|Colorectal(126;1.38e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00793)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.159)|LUSC - Lung squamous cell carcinoma(448;0.233)		GCCACCACGCTCCAGGCCTGG	0.612																																																	0								ENSG00000176083						70.0	72.0	71.0					1																	26691177		2203	4300	6503	ZNF683	SO:0001583	missense	0			-	HGNC	BC029505	CCDS279.2	1p36.11	2013-01-08			ENSG00000176083	ENSG00000176083		"""Zinc fingers, C2H2-type"""	28495	protein-coding gene	gene with protein product	"""hypothetical protein MGC33414"""					12477932	Standard	NM_173574		Approved	MGC33414	uc009vsj.1	Q8IZ20	OTTHUMG00000003521	ENST00000436292.1:c.860A>G	1.37:g.26691177T>C	ENSP00000388792:p.Glu287Gly	Somatic	0	121	0.00		0.4911483017230278	28	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q5T141|Q5T146|Q5T147|Q5T149|Q8NEN4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E287G	ENST00000436292.1	37	c.860		1	.	.	.	.	.	.	.	.	.	.	T	11.52	1.663048	0.29515	.	.	ENSG00000176083	ENST00000403843;ENST00000436292;ENST00000374204;ENST00000349618	T;T;T;T	0.09163	3.02;3.02;3.01;3.01	4.44	2.05	0.26809	.	0.740503	0.11606	N	0.547321	T	0.06142	0.0159	N	0.19112	0.55	0.09310	N	1	B;B	0.33238	0.403;0.001	B;B	0.33890	0.172;0.003	T	0.40572	-0.9556	10	0.25106	T	0.35	-8.5948	3.4553	0.07512	0.1972:0.1071:0.0:0.6957	.	287;287	Q8IZ20-2;Q8IZ20	.;ZN683_HUMAN	G	287	ENSP00000384782:E287G;ENSP00000388792:E287G;ENSP00000363320:E287G;ENSP00000344095:E287G	ENSP00000344095:E287G	E	-	2	0	ZNF683	26563764	0.014000	0.17966	0.001000	0.08648	0.039000	0.13416	1.548000	0.36201	0.228000	0.21019	0.459000	0.35465	GAG	-	NULL		0.612	ZNF683-202	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF683	protein_coding	OTTHUMT00000009794.2	T	NM_173574	-		26691177	-1	no_errors	ENST00000403843	ensembl	human	known	74_37	missense	SNP	0.004	C
OR10Z1	128368	genome.wustl.edu	37	1	158576852	158576852	+	Silent	SNP	G	G	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr1:158576852G>A	ENST00000361284.1	+	1	624	c.624G>A	c.(622-624)ttG>ttA	p.L208L		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					TGGTCCTCTTGGTCTCCTTCT	0.522																																																	0								ENSG00000198967						152.0	132.0	138.0					1																	158576852		2203	4300	6503	OR10Z1	SO:0001819	synonymous_variant	0			-	HGNC	AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.624G>A	1.37:g.158576852G>A		Somatic	0	34	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	Q5VYL0|Q6IFR7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L208	ENST00000361284.1	37	c.624	CCDS30901.1	1																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.522	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Z1	protein_coding	OTTHUMT00000051853.1	G	NM_001004478	-		158576852	+1	no_errors	ENST00000361284	ensembl	human	known	74_37	silent	SNP	0.029	A
TIMP2	7077	genome.wustl.edu	37	17	76851711	76851711	+	3'UTR	DEL	T	T	-			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr17:76851711delT	ENST00000262768.7	-	0	999				TIMP2_ENST00000586057.1_3'UTR|TIMP2_ENST00000536189.2_3'UTR|RP11-323N12.5_ENST00000587434.1_RNA|TIMP2_ENST00000585421.1_3'UTR	NM_003255.4	NP_003246.1	P16035	TIMP2_HUMAN	TIMP metallopeptidase inhibitor 2						aging (GO:0007568)|cellular response to organic substance (GO:0071310)|central nervous system development (GO:0007417)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of proteolysis (GO:0045861)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|regulation of Rap protein signal transduction (GO:0032487)|response to cytokine (GO:0034097)|response to drug (GO:0042493)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.194)			CCTTGGAGGCTTTTTTTGCAG	0.547																																																	0								ENSG00000267601						16.0	17.0	17.0					17																	76851711		2203	4299	6502	RP11-323N12.5	SO:0001624	3_prime_UTR_variant	0				Clone_based_vega_gene		CCDS11758.1	17q25	2008-07-18	2005-08-08		ENSG00000035862	ENSG00000035862			11821	protein-coding gene	gene with protein product		188825	"""tissue inhibitor of metalloproteinase 2"""			1427908	Standard	NM_003255		Approved	CSC-21K	uc002jwf.3	P16035	OTTHUMG00000154517	ENST00000262768.7:c.*38A>-	17.37:g.76851711delT		Somatic	0	45	0.00		0.4911483017230278	1136	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	Q16121|Q93006|Q9UDF7	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000262768.7	37	NULL	CCDS11758.1	17																																																																																			-	-		0.547	TIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267601	protein_coding	OTTHUMT00000335662.1	T	NM_003255			76851711	+1	no_errors	ENST00000587434	ensembl	human	known	74_37	rna	DEL	0.655	-
TEKT3	64518	genome.wustl.edu	37	17	15215789	15215789	+	Silent	SNP	C	C	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr17:15215789C>T	ENST00000395930.1	-	7	1074	c.888G>A	c.(886-888)gtG>gtA	p.V296V	TEKT3_ENST00000338696.2_Silent_p.V296V|RNU6-799P_ENST00000363567.1_RNA	NM_031898.2	NP_114104.1	Q9BXF9	TEKT3_HUMAN	tektin 3	296			V -> A (in dbSNP:rs6502446).		cilium morphogenesis (GO:0060271)|regulation of fertilization (GO:0080154)|sperm motility (GO:0030317)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				endometrium(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	23				UCEC - Uterine corpus endometrioid carcinoma (92;0.0877)		AGGACTCAGGCACTGAGACAC	0.473																																																	0								ENSG00000125409						46.0	48.0	47.0					17																	15215789		2203	4300	6503	TEKT3	SO:0001819	synonymous_variant	0			-	HGNC	AF334676	CCDS11169.1	17p12	2011-05-23			ENSG00000125409	ENSG00000125409			14293	protein-coding gene	gene with protein product		612683				11381029, 14735490	Standard	NM_031898		Approved	FLJ32828	uc002gon.3	Q9BXF9	OTTHUMG00000058965	ENST00000395930.1:c.888G>A	17.37:g.15215789C>T		Somatic	0	40	0.00		0.4911483017230278	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	32	17.95	B2RAS7|D3DTT0|Q8N5R5|Q96M48	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tektin,prints_Tektin	p.V296	ENST00000395930.1	37	c.888	CCDS11169.1	17																																																																																			-	pfam_Tektin		0.473	TEKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT3	protein_coding	OTTHUMT00000130385.2	C	NM_031898	-		15215789	-1	no_errors	ENST00000338696	ensembl	human	known	74_37	silent	SNP	1.000	T
CPAMD8	27151	genome.wustl.edu	37	19	17120142	17120143	+	Intron	DEL	AC	AC	-			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr19:17120142_17120143delAC	ENST00000443236.1	-	6	659				CPAMD8_ENST00000388925.4_Intron|CTD-2528A14.1_ENST00000595134.1_RNA	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8							extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						TGTAATGAAGACACAGATGCAG	0.554																																																	0								ENSG00000268985																																			CTD-2528A14.1	SO:0001627	intron_variant	0				Clone_based_vega_gene	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.628-12GT>-	19.37:g.17120144_17120145delAC		Somatic	0	76	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	38	24.00	Q8NC09|Q9ULD7	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000443236.1	37	NULL	CCDS42519.1	19																																																																																			-	-		0.554	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000268985	protein_coding	OTTHUMT00000257531.2	AC	NM_015692			17120143	+1	no_errors	ENST00000595134	ensembl	human	known	74_37	rna	DEL	0.991:0.989	-
CELP	1057	genome.wustl.edu	37	9	135962585	135962586	+	RNA	INS	-	-	GCCCCATCCCCGCTACGGGTGACTCTGAGGCC	rs641386|rs372789499|rs143200085	byFrequency	TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr9:135962585_135962586insGCCCCATCCCCGCTACGGGTGACTCTGAGGCC	ENST00000411440.2	+	0	1092_1093					NR_001275.2				carboxyl ester lipase pseudogene																		ACACTGAGGCTGCCCCTGTGTC	0.629																																																	0								ENSG00000170827																																			CELP			0				HGNC	L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135962585_135962586insGCCCCATCCCCGCTACGGGTGACTCTGAGGCC		Somatic	NA	NA	NA		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000411440.2	37	NULL		9																																																																																			-	-		0.629	CELP-002	KNOWN	basic	processed_transcript	CELP	pseudogene	OTTHUMT00000339837.1	-	NM_001808			135962586	+1	no_errors	ENST00000411440	ensembl	human	known	74_37	rna	INS	0.130:0.000	GCCCCATCCCCGCTACGGGTGACTCTGAGGCC
USP28	57646	genome.wustl.edu	37	11	113711441	113711441	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr11:113711441T>G	ENST00000003302.4	-	5	481	c.413A>C	c.(412-414)aAg>aCg	p.K138T	USP28_ENST00000545540.1_Missense_Mutation_p.K13T|USP28_ENST00000260188.5_Missense_Mutation_p.K138T|USP28_ENST00000542033.1_5'UTR|USP28_ENST00000537706.1_Missense_Mutation_p.K138T	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	138					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		GCGTTTTCTCTTTGAGCGTTT	0.423																																					Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)												0								ENSG00000048028						117.0	100.0	106.0					11																	113711441		2201	4296	6497	USP28	SO:0001583	missense	0			-	HGNC	AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.413A>C	11.37:g.113711441T>G	ENSP00000003302:p.Lys138Thr	Somatic	0	61	0.00		0.4911483017230278	16	44.83	13	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	33	32.65	B0YJC0|B0YJC1|Q9P213	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,superfamily_UBA-like,pfscan_Peptidase_C19/C67	p.K138T	ENST00000003302.4	37	c.413	CCDS31680.1	11	.	.	.	.	.	.	.	.	.	.	T	20.6	4.009498	0.75046	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000545540;ENST00000537706;ENST00000537642	T;T;T;T	0.43294	1.25;1.26;0.95;1.67	5.75	5.75	0.90469	.	0.244071	0.46442	D	0.000297	T	0.65291	0.2677	M	0.73962	2.25	0.58432	D	0.999999	D;D;D;D	0.89917	0.996;1.0;0.983;0.971	D;D;P;P	0.87578	0.917;0.998;0.883;0.862	T	0.67681	-0.5608	10	0.54805	T	0.06	-28.7226	15.7118	0.77635	0.0:0.0:0.0:1.0	.	138;13;138;138	B4E2Q2;B4E3L3;Q6NZX9;Q96RU2	.;.;.;UBP28_HUMAN	T	138;138;13;138;66	ENSP00000003302:K138T;ENSP00000260188:K138T;ENSP00000444991:K13T;ENSP00000445743:K138T	ENSP00000003302:K138T	K	-	2	0	USP28	113216651	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.294000	0.78760	2.181000	0.69327	0.477000	0.44152	AAG	-	NULL		0.423	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP28	protein_coding	OTTHUMT00000398789.1	T		-		113711441	-1	no_errors	ENST00000003302	ensembl	human	known	74_37	missense	SNP	1.000	G
NAGLU	4669	genome.wustl.edu	37	17	40695606	40695606	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr17:40695606A>G	ENST00000225927.2	+	6	1683	c.1582A>G	c.(1582-1584)Agc>Ggc	p.S528G	RP11-400F19.8_ENST00000585572.1_RNA	NM_000263.3	NP_000254.2	P54802	ANAG_HUMAN	N-acetylglucosaminidase, alpha	528					carbohydrate metabolic process (GO:0005975)|cerebellar Purkinje cell layer development (GO:0021680)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inner ear receptor cell development (GO:0060119)|locomotor rhythm (GO:0045475)|lysosome organization (GO:0007040)|middle ear morphogenesis (GO:0042474)|nervous system development (GO:0007399)|retinal rod cell development (GO:0046548)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-N-acetylglucosaminidase activity (GO:0004561)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	12		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)	GATGAATACCAGCATCTGGTA	0.632																																																	0								ENSG00000108784						25.0	23.0	24.0					17																	40695606		2191	4285	6476	NAGLU	SO:0001583	missense	0			-	HGNC		CCDS11427.1	17q21.2	2010-07-27	2010-07-27		ENSG00000108784	ENSG00000108784	3.2.1.50		7632	protein-coding gene	gene with protein product	"""Sanfilippo disease IIIB"""	609701					Standard	XM_006721920		Approved	NAG	uc002hzv.3	P54802		ENST00000225927.2:c.1582A>G	17.37:g.40695606A>G	ENSP00000225927:p.Ser528Gly	Somatic	0	42	0.00		0.4911483017230278	66	41.59	47	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	20	20.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NAGLU_tim-barrel,superfamily_Glycoside_hydrolase_SF	p.S528G	ENST00000225927.2	37	c.1582	CCDS11427.1	17	.	.	.	.	.	.	.	.	.	.	A	1.312	-0.601787	0.03744	.	.	ENSG00000108784	ENST00000225927;ENST00000377405	D	0.98649	-5.05	4.69	-1.85	0.07784	Alpha-N-acetylglucosaminidase, C-terminal (1);	0.733388	0.14074	N	0.343180	D	0.94719	0.8296	L	0.33245	0.995	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	D	0.88217	0.2894	10	0.20046	T	0.44	-0.7028	7.0095	0.24855	0.3119:0.0:0.5377:0.1504	.	528	P54802	ANAG_HUMAN	G	528;204	ENSP00000225927:S528G	ENSP00000225927:S528G	S	+	1	0	NAGLU	37949132	0.021000	0.18746	0.018000	0.16275	0.306000	0.27790	0.899000	0.28417	-0.143000	0.11334	0.459000	0.35465	AGC	-	pfam_NAGLU_tim-barrel		0.632	NAGLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAGLU	protein_coding	OTTHUMT00000450385.1	A	NM_000263	-		40695606	+1	no_errors	ENST00000225927	ensembl	human	known	74_37	missense	SNP	0.010	G
NME6	10201	genome.wustl.edu	37	3	48336679	48336679	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr3:48336679G>T	ENST00000452211.1	-	6	517	c.280C>A	c.(280-282)Ctc>Atc	p.L94I	NME6_ENST00000421967.1_Missense_Mutation_p.L102I|ZNF589_ENST00000412564.1_Intron|NME6_ENST00000450160.1_Missense_Mutation_p.S80R|NME6_ENST00000435684.1_Missense_Mutation_p.S80R|NME6_ENST00000415053.1_Missense_Mutation_p.L94I|NME6_ENST00000451657.1_Missense_Mutation_p.S80R|NME6_ENST00000442597.1_Missense_Mutation_p.L94I|NME6_ENST00000426689.2_Missense_Mutation_p.L94I|NME6_ENST00000415644.1_Intron|NME6_ENST00000447314.1_Missense_Mutation_p.L49I|NME6_ENST00000426723.1_Intron|NME6_ENST00000444069.1_5'UTR			O75414	NDK6_HUMAN	NME/NM23 nucleoside diphosphate kinase 6	94					apoptotic process (GO:0006915)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|negative regulation of cell growth (GO:0030308)|negative regulation of mitosis (GO:0045839)|UTP biosynthetic process (GO:0006228)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			breast(1)|large_intestine(5)	6				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		GTCCTCCAGAGCTGGATGGCA	0.572																																																	0								ENSG00000172113						64.0	56.0	59.0					3																	48336679		2203	4300	6503	NME6	SO:0001583	missense	0			-	HGNC	AF051941	CCDS2763.1	3p21.31	2012-05-18	2012-05-18		ENSG00000172113	ENSG00000172113			20567	protein-coding gene	gene with protein product		608294	"""non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase)"""			10453732, 19852809	Standard	NM_005793		Approved	NM23-H6, IPIA-ALPHA	uc003cso.3	O75414	OTTHUMG00000133531	ENST00000452211.1:c.280C>A	3.37:g.48336679G>T	ENSP00000392352:p.Leu94Ile	Somatic	0	63	0.00		0.4911483017230278	58	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	B4DGW7|B4DM99|Q53HM5|Q96E73|Q9BQ63	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Nucleoside_diP_kinase,prints_Nucleoside_diP_kinase	p.L102I	ENST00000452211.1	37	c.304		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.28|19.28	3.796580|3.796580	0.70567|0.70567	.|.	.|.	ENSG00000172113|ENSG00000172113	ENST00000421967;ENST00000426689;ENST00000452211;ENST00000415053;ENST00000442597;ENST00000447314;ENST00000425930;ENST00000456495|ENST00000450160;ENST00000451657;ENST00000435684	T;T;T;T;T;T;T;T|.	0.54675|.	0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56|.	4.91|4.91	2.86|2.86	0.33363|0.33363	.|.	0.236715|.	0.41938|.	D|.	0.000784|.	T|T	0.28400|0.28400	0.0702|0.0702	L|L	0.33624|0.33624	1.015|1.015	0.21604|0.21604	N|N	0.999624|0.999624	B;B|P	0.27882|0.45474	0.192;0.165|0.859	B;B|B	0.42361|0.43274	0.385;0.229|0.414	T|T	0.11060|0.11060	-1.0603|-1.0603	10|8	0.22109|0.72032	T|D	0.4|0.01	-5.4355|-5.4355	6.2452|6.2452	0.20813|0.20813	0.3486:0.0:0.6514:0.0|0.3486:0.0:0.6514:0.0	.|.	94;94|80	O75414;C9J9V6|O75414-3	NDK6_HUMAN;.|.	I|R	102;94;94;94;94;49;94;94|80	ENSP00000416658:L102I;ENSP00000440286:L94I;ENSP00000392352:L94I;ENSP00000399582:L94I;ENSP00000406642:L94I;ENSP00000414842:L49I;ENSP00000411116:L94I;ENSP00000392715:L94I|.	ENSP00000399582:L94I|ENSP00000393261:S80R	L|S	-|-	1|3	0|2	NME6|NME6	48311683|48311683	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.819000|0.819000	0.46315|0.46315	4.209000|4.209000	0.58493|0.58493	0.609000|0.609000	0.30018|0.30018	0.655000|0.655000	0.94253|0.94253	CTC|AGC	-	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Nucleoside_diP_kinase,prints_Nucleoside_diP_kinase		0.572	NME6-005	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_candidate	protein_coding	NME6	protein_coding	OTTHUMT00000346107.1	G	NM_005793	-		48336679	-1	no_errors	ENST00000421967	ensembl	human	known	74_37	missense	SNP	1.000	T
MAP1LC3A	84557	genome.wustl.edu	37	20	33147980	33147987	+	3'UTR	DEL	CTGCCTGT	CTGCCTGT	-	rs6479|rs78112782|rs112954375|rs8115693|rs75881564	byFrequency	TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	CTGCCTGT	CTGCCTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr20:33147980_33147987delCTGCCTGT	ENST00000360668.3	+	0	1405_1412				MAP1LC3A_ENST00000397709.1_3'UTR|MAP1LC3A_ENST00000374837.3_3'UTR|MAP1LC3A_ENST00000476428.1_3'UTR			Q9H492	MLP3A_HUMAN	microtubule-associated protein 1 light chain 3 alpha						autophagic vacuole assembly (GO:0000045)|mitochondrion degradation (GO:0000422)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|late endosome (GO:0005770)|microtubule (GO:0005874)|organelle membrane (GO:0031090)	phosphatidylethanolamine binding (GO:0008429)|phospholipid binding (GO:0005543)			cervix(1)|kidney(1)|large_intestine(1)|upper_aerodigestive_tract(2)	5						TTTTAGGCCCCTGCCTGTCTGCCCATCT	0.668														1964	0.392173	0.4085	0.598	5008	,	,		13027	0.4157		0.3857	False		,,,				2504	0.2065																0								ENSG00000101460																																			MAP1LC3A	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS13237.1, CCDS13238.1	20q11.22	2014-02-12			ENSG00000101460	ENSG00000101460			6838	protein-coding gene	gene with protein product		601242				8833088, 17580304	Standard	NM_032514		Approved	MAP1BLC3, MAP1ALC3, LC3, LC3A, ATG8E	uc002xaq.2	Q9H492	OTTHUMG00000032306	ENST00000360668.3:c.*285CTGCCTGT>-	20.37:g.33147980_33147987delCTGCCTGT		Somatic	NA	NA	NA		0.4911483017230278	185	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	E1P5P4|E1P5P5|Q9BXW5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000360668.3	37	NULL	CCDS13238.1	20																																																																																			-	-		0.668	MAP1LC3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1LC3A	protein_coding	OTTHUMT00000078801.2	CTGCCTGT	NM_181509			33147987	+1	no_errors	ENST00000476428	ensembl	human	known	74_37	rna	DEL	0.999:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
HELB	92797	genome.wustl.edu	37	12	66703801	66703801	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr12:66703801delT	ENST00000247815.4	+	4	1152	c.1093delT	c.(1093-1095)tttfs	p.F365fs		NM_033647.3	NP_387467.2	Q8NG08	HELB_HUMAN	helicase (DNA) B	365					DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication, synthesis of RNA primer (GO:0006269)		ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|single-stranded DNA-dependent ATP-dependent DNA helicase activity (GO:0017116)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	40			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		AGCCATCGCCTTTTCAATTTG	0.423																																																	0								ENSG00000127311						213.0	211.0	211.0					12																	66703801		2203	4300	6503	HELB	SO:0001589	frameshift_variant	0				HGNC	AF319995	CCDS8976.1	12q14.2	2009-01-15			ENSG00000127311	ENSG00000127311			17196	protein-coding gene	gene with protein product		614539				12181327	Standard	NM_033647		Approved		uc001sti.3	Q8NG08	OTTHUMG00000169006	ENST00000247815.4:c.1093delT	12.37:g.66703801delT	ENSP00000247815:p.Phe365fs	Somatic	0	42	0.00		0.4911483017230278	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	21	8.70	A8K4C9|Q4G0T2|Q9H7L5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase	p.S366fs	ENST00000247815.4	37	c.1093	CCDS8976.1	12																																																																																			-	superfamily_P-loop_NTPase		0.423	HELB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HELB	protein_coding	OTTHUMT00000401919.1	T				66703801	+1	no_errors	ENST00000247815	ensembl	human	known	74_37	frame_shift_del	DEL	0.098	-
RASGEF1C	255426	genome.wustl.edu	37	5	179542375	179542375	+	Intron	SNP	C	C	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr5:179542375C>A	ENST00000393371.2	-	10	1380				RASGEF1C_ENST00000522500.1_Intron|RASGEF1C_ENST00000361132.4_Intron			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TACTGTTAGACCAAAAGCAAT	0.478																																																	0								ENSG00000146090																																			RASGEF1C	SO:0001627	intron_variant	0			-	HGNC	AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.1084-834G>T	5.37:g.179542375C>A		Somatic	0	34	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	42	12.50	D3DWQ7|Q7Z4T0|Q8NA49	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000393371.2	37	NULL	CCDS4452.1	5																																																																																			-	-		0.478	RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RASGEF1C	protein_coding	OTTHUMT00000253506.2	C	NM_175062	-		179542375	-1	no_errors	ENST00000519456	ensembl	human	known	74_37	rna	SNP	0.008	A
FANCM	57697	genome.wustl.edu	37	14	45633722	45633722	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr14:45633722G>C	ENST00000267430.5	+	10	1827	c.1742G>C	c.(1741-1743)cGt>cCt	p.R581P	FANCM_ENST00000556036.1_Missense_Mutation_p.R581P|FANCM_ENST00000542564.2_Missense_Mutation_p.R555P	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	581	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						GGCCGTAAACGTCAAGGCAGG	0.403								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0								ENSG00000187790						68.0	63.0	65.0					14																	45633722		2203	4300	6503	FANCM	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	-	HGNC	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.1742G>C	14.37:g.45633722G>C	ENSP00000267430:p.Arg581Pro	Somatic	0	91	0.00		0.4911483017230278	1	66.67	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	84	22.94	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Restrct_endonuc-II-like,superfamily_RuvA_2-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_ERCC4_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R581P	ENST00000267430.5	37	c.1742	CCDS32070.1	14	.	.	.	.	.	.	.	.	.	.	G	32	5.116284	0.94339	.	.	ENSG00000187790	ENST00000556036;ENST00000267430;ENST00000542564	T;T;T	0.04758	3.56;3.56;3.56	6.07	6.07	0.98685	Helicase, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.30198	0.0757	M	0.88640	2.97	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.991	T	0.02477	-1.1153	10	0.87932	D	0	.	20.2544	0.98414	0.0:0.0:1.0:0.0	.	555;581;581	B2RTQ9;Q8IYD8;Q8IYD8-2	.;FANCM_HUMAN;.	P	581;581;555	ENSP00000450596:R581P;ENSP00000267430:R581P;ENSP00000442493:R555P	ENSP00000267430:R581P	R	+	2	0	FANCM	44703472	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.432000	0.97498	2.885000	0.99019	0.655000	0.94253	CGT	-	superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C		0.403	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCM	protein_coding	OTTHUMT00000410474.1	G	XM_048128	-		45633722	+1	no_errors	ENST00000267430	ensembl	human	known	74_37	missense	SNP	1.000	C
LDLRAD4	753	genome.wustl.edu	37	18	13387561	13387561	+	5'UTR	SNP	C	C	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr18:13387561C>A	ENST00000359446.5	+	0	308				LDLRAD4_ENST00000399848.3_5'UTR|LDLRAD4_ENST00000361205.4_5'UTR	NM_001276251.1	NP_001263180.1	O15165	LRAD4_HUMAN	low density lipoprotein receptor class A domain containing 4						negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	early endosome membrane (GO:0031901)|endosome (GO:0005768)|integral component of membrane (GO:0016021)	R-SMAD binding (GO:0070412)										ACCGCCCGCCCGCGCGAGAGC	0.741																																																	0								ENSG00000168675																																			LDLRAD4	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF009424, AF009428	CCDS32793.1, CCDS32794.1, CCDS32795.1, CCDS42415.1, CCDS62392.1, CCDS62393.1	18p11.21	2014-04-29	2012-10-24	2012-10-24	ENSG00000168675	ENSG00000168675			1224	protein-coding gene	gene with protein product	"""clone 22"""	606571	"""chromosome 18 open reading frame 1"""	C18orf1		9479497, 9129712, 24627487	Standard	NM_181482		Approved		uc002ksb.3	O15165	OTTHUMG00000181925	ENST00000359446.5:c.-161C>A	18.37:g.13387561C>A		Somatic	0	41	0.00		0.4911483017230278	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	B3KNT9|E9PAY9|K7EN38|O15166|O15167|O15168|Q5U646|Q6NXP3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000359446.5	37	NULL	CCDS32793.1	18																																																																																			-	-		0.741	LDLRAD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDLRAD4	protein_coding	OTTHUMT00000458326.1	C	NM_181481	-		13387561	+1	no_errors	ENST00000590371	ensembl	human	putative	74_37	rna	SNP	0.925	A
ZNF512	84450	genome.wustl.edu	37	2	27822468	27822468	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr2:27822468C>G	ENST00000355467.4	+	4	379	c.296C>G	c.(295-297)gCc>gGc	p.A99G	ZNF512_ENST00000379717.1_Missense_Mutation_p.A98G|ZNF512_ENST00000413371.2_Missense_Mutation_p.A22G|ZNF512_ENST00000494548.1_3'UTR|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000556601.1_Missense_Mutation_p.P10A|ZNF512_ENST00000416005.2_Missense_Mutation_p.A98G	NM_001271287.1|NM_001271288.1|NM_001271289.1|NM_001271318.1|NM_032434.3	NP_001258216.1|NP_001258217.1|NP_001258218.1|NP_001258247.1|NP_115810.2	Q96ME7	ZN512_HUMAN	zinc finger protein 512	99					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)					GGAGTATCAGCCAAGGGGAAA	0.403																																																	0								ENSG00000243943						110.0	111.0	111.0					2																	27822468		2203	4300	6503	ZNF512	SO:0001583	missense	0			-	HGNC	AL833748	CCDS1758.1, CCDS59428.1, CCDS59429.1	2p23	2008-02-05			ENSG00000243943	ENSG00000243943		"""Zinc fingers, C2H2-type"""	29380	protein-coding gene	gene with protein product						11347906	Standard	NM_032434		Approved	KIAA1805	uc002rla.4	Q96ME7	OTTHUMG00000097786	ENST00000355467.4:c.296C>G	2.37:g.27822468C>G	ENSP00000347648:p.Ala99Gly	Somatic	0	97	0.00		0.4911483017230278	40	29.82	17	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	39	20.41	B4DSM5|Q53RZ7|Q86XK6|Q96JM0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A99G	ENST00000355467.4	37	c.296	CCDS1758.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.77|13.77	2.336738|2.336738	0.41398|0.41398	.|.	.|.	ENSG00000243943|ENSG00000243943	ENST00000379717;ENST00000355467;ENST00000416005;ENST00000413371|ENST00000556601	.|.	.|.	.|.	5.65|5.65	3.71|3.71	0.42584|0.42584	.|.	1.287310|.	0.05013|.	N|.	0.471236|.	T|T	0.22666|0.22666	0.0547|0.0547	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.01281|.	0.0;0.0;0.0|.	T|T	0.15983|0.15983	-1.0418|-1.0418	9|5	0.19147|.	T|.	0.46|.	1.3249|1.3249	5.2301|5.2301	0.15416|0.15416	0.1409:0.6182:0.1558:0.085|0.1409:0.6182:0.1558:0.085	.|.	22;98;99|.	B4DES6;B4DSM5;Q96ME7|.	.;.;ZN512_HUMAN|.	G|A	98;99;98;22|10	.|.	ENSP00000347648:A99G|.	A|P	+|+	2|1	0|0	ZNF512|ZNF512	27675972|27675972	0.933000|0.933000	0.31639|0.31639	0.824000|0.824000	0.32777|0.32777	0.885000|0.885000	0.51271|0.51271	1.135000|1.135000	0.31454|0.31454	1.356000|1.356000	0.45884|0.45884	0.655000|0.655000	0.94253|0.94253	GCC|CCA	-	NULL		0.403	ZNF512-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF512	protein_coding	OTTHUMT00000215029.2	C	NM_032434	-		27822468	+1	no_errors	ENST00000355467	ensembl	human	known	74_37	missense	SNP	0.235	G
TNXB	7148	genome.wustl.edu	37	6	32032641	32032641	+	Silent	SNP	G	G	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr6:32032641G>A	ENST00000375244.3	-	19	6999	c.6798C>T	c.(6796-6798)caC>caT	p.H2266H	TNXB_ENST00000375247.2_Silent_p.H2266H			P22105	TENX_HUMAN	tenascin XB	2338					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GCTGGCCACCGTGGAAGCCGT	0.617																																																	0								ENSG00000168477						50.0	57.0	55.0					6																	32032641		1246	2545	3791	TNXB	SO:0001819	synonymous_variant	0			-	HGNC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.6798C>T	6.37:g.32032641G>A		Somatic	0	81	0.00		0.4911483017230278	11	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.H2266	ENST00000375244.3	37	c.6798		6																																																																																			-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.617	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	protein_coding	OTTHUMT00000268927.2	G	NM_019105	-		32032641	-1	no_errors	ENST00000375247	ensembl	human	known	74_37	silent	SNP	0.001	A
CD55	1604	genome.wustl.edu	37	1	207532941	207532941	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr1:207532941G>T	ENST00000367064.3	+	10	1390	c.1132G>T	c.(1132-1134)Ggc>Tgc	p.G378C	CD55_ENST00000367065.5_Missense_Mutation_p.G416V|CD55_ENST00000367067.4_3'UTR|CD55_ENST00000367062.4_3'UTR|CD55_ENST00000314754.8_Missense_Mutation_p.G417V|CD55_ENST00000391921.4_Missense_Mutation_p.G314C|CD55_ENST00000465534.1_3'UTR|CD55_ENST00000391920.4_3'UTR	NM_000574.3	NP_000565.1	P08174	DAF_HUMAN	CD55 molecule, decay accelerating factor for complement (Cromer blood group)	378					CD4-positive, alpha-beta T cell cytokine production (GO:0035743)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|maternal process involved in parturition (GO:0060137)|negative regulation of complement activation (GO:0045916)|positive regulation of CD4-positive, alpha-beta T cell activation (GO:2000516)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of complement activation (GO:0030449)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|respiratory burst (GO:0045730)|response to peptide hormone (GO:0043434)|response to virus (GO:0009615)|spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	enzyme inhibitor activity (GO:0004857)|lipid binding (GO:0008289)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	16					Chloramphenicol(DB00446)	AGTAACCATGGGCTTGCTGAC	0.323																																																	0								ENSG00000196352						93.0	93.0	93.0					1																	207532941		2203	4300	6503	CD55	SO:0001583	missense	0			-	HGNC	BC001288	CCDS31006.1, CCDS44307.1, CCDS73022.1	1q32	2014-09-17	2006-03-28	2006-02-23	ENSG00000196352	ENSG00000196352		"""CD molecules"", ""Blood group antigens"""	2665	protein-coding gene	gene with protein product		125240	"""decay accelerating factor for complement (CD55, Cromer blood group system)"""	DAF			Standard	XM_005273077		Approved	CR, TC, CROM	uc001hfr.4	P08174	OTTHUMG00000036255	ENST00000367064.3:c.1132G>T	1.37:g.207532941G>T	ENSP00000356031:p.Gly378Cys	Somatic	0	76	0.00		0.4911483017230278	72	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	B1AP14|D3DT83|D3DT84|E7ER69|P09679|P78361|Q14UF2|Q14UF3|Q14UF4|Q14UF5|Q14UF6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.G417V	ENST00000367064.3	37	c.1250	CCDS31006.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.23|12.23	1.875324|1.875324	0.33162|0.33162	.|.	.|.	ENSG00000196352|ENSG00000196352	ENST00000367064;ENST00000391921;ENST00000536840|ENST00000314754;ENST00000367065	T;T|T;T	0.42513|0.39997	0.97;1.3|1.05;1.07	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	.|.	.|.	.|.	.|.	T|T	0.44705|0.44705	0.1306|0.1306	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	D;D|P;D	0.89917|0.57899	1.0;1.0|0.937;0.981	D;D|B;P	0.79784|0.54026	0.993;0.993|0.326;0.74	T|T	0.17107|0.17107	-1.0380|-1.0380	9|9	0.72032|0.36615	D|T	0.01|0.2	.|.	15.3525|15.3525	0.74399|0.74399	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	314;378|416;417	B1AP15;P08174|Q14UF6;P08174-2	.;DAF_HUMAN|.;.	C|V	378;314;314|417;416	ENSP00000356031:G378C;ENSP00000375788:G314C|ENSP00000316333:G417V;ENSP00000356032:G416V	ENSP00000356031:G378C|ENSP00000316333:G417V	G|G	+|+	1|2	0|0	CD55|CD55	205599564|205599564	0.992000|0.992000	0.36948|0.36948	0.899000|0.899000	0.35326|0.35326	0.012000|0.012000	0.07955|0.07955	2.633000|2.633000	0.46519|0.46519	2.770000|2.770000	0.95276|0.95276	0.563000|0.563000	0.77884|0.77884	GGC|GGG	-	NULL		0.323	CD55-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD55	protein_coding	OTTHUMT00000088208.2	G	NM_000574	-		207532941	+1	no_errors	ENST00000314754	ensembl	human	known	74_37	missense	SNP	0.983	T
FBXO39	162517	genome.wustl.edu	37	17	6690669	6690669	+	Silent	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr17:6690669G>T	ENST00000321535.4	+	4	1381	c.1251G>T	c.(1249-1251)ctG>ctT	p.L417L		NM_153230.2	NP_694962.1	Q8N4B4	FBX39_HUMAN	F-box protein 39	417										NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	26						ACAAGACCCTGCAGGAAATTT	0.418																																																	0								ENSG00000177294						134.0	128.0	130.0					17																	6690669		2203	4300	6503	FBXO39	SO:0001819	synonymous_variant	0			-	HGNC	BC034782	CCDS11082.1	17p13.2	2014-01-21			ENSG00000177294	ENSG00000177294		"""F-boxes /  ""other"""""	28565	protein-coding gene	gene with protein product		609106				12477932	Standard	NM_153230		Approved	MGC35179, Fbx39, CT144	uc010vtg.2	Q8N4B4	OTTHUMG00000102062	ENST00000321535.4:c.1251G>T	17.37:g.6690669G>T		Somatic	0	20	0.00		0.4911483017230278	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L417	ENST00000321535.4	37	c.1251	CCDS11082.1	17																																																																																			-	NULL		0.418	FBXO39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO39	protein_coding	OTTHUMT00000219866.2	G	NM_153230	-		6690669	+1	no_errors	ENST00000321535	ensembl	human	known	74_37	silent	SNP	0.998	T
LRP1B	53353	genome.wustl.edu	37	2	141272314	141272314	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr2:141272314G>A	ENST00000389484.3	-	51	9148	c.8177C>T	c.(8176-8178)gCt>gTt	p.A2726V		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2726	LDL-receptor class A 16. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGCGGAACAAGCAAATTGGTT	0.378										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0								ENSG00000168702						98.0	92.0	94.0					2																	141272314		2203	4300	6503	LRP1B	SO:0001583	missense	0			-	HGNC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.8177C>T	2.37:g.141272314G>A	ENSP00000374135:p.Ala2726Val	Somatic	0	75	0.00		0.4911483017230278	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.A2726V	ENST00000389484.3	37	c.8177	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	G	17.14	3.314706	0.60524	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	T	0.44482	0.92	5.29	5.29	0.74685	.	0.075106	0.52532	U	0.000069	T	0.45074	0.1324	L	0.42008	1.315	0.47476	D	0.999433	B	0.28713	0.22	B	0.38156	0.266	T	0.27839	-1.0062	10	0.30854	T	0.27	.	19.2903	0.94096	0.0:0.0:1.0:0.0	.	2726	Q9NZR2	LRP1B_HUMAN	V	2726;2664	ENSP00000374135:A2726V	ENSP00000374135:A2726V	A	-	2	0	LRP1B	140988784	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.174000	0.71943	2.633000	0.89246	0.655000	0.94253	GCT	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt		0.378	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	protein_coding	OTTHUMT00000254736.2	G	NM_018557	-		141272314	-1	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	SNP	1.000	A
COL11A2	1302	genome.wustl.edu	37	6	33156189	33156189	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr6:33156189G>C	ENST00000374708.4	-	4	814	c.556C>G	c.(556-558)Cat>Gat	p.H186D	COL11A2_ENST00000374712.1_Missense_Mutation_p.H186D|COL11A2_ENST00000361917.1_Missense_Mutation_p.H186D|COL11A2_ENST00000341947.2_Missense_Mutation_p.H186D|COL11A2_ENST00000374713.1_Missense_Mutation_p.H186D|COL11A2_ENST00000395194.1_Missense_Mutation_p.H186D|COL11A2_ENST00000395197.1_Missense_Mutation_p.H186D|COL11A2_ENST00000357486.1_Missense_Mutation_p.H186D|COL11A2_ENST00000374714.1_Missense_Mutation_p.H186D	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	186	Laminin G-like.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						ATCACTCCATGGGTGTCCAAT	0.537																																					Melanoma(1;90 116 3946 5341 17093)												0								ENSG00000204248						119.0	125.0	123.0					6																	33156189		1511	2709	4220	COL11A2	SO:0001583	missense	0			-	HGNC	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.556C>G	6.37:g.33156189G>C	ENSP00000363840:p.His186Asp	Somatic	0	55	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	20	35.48	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.H186D	ENST00000374708.4	37	c.556	CCDS43452.1	6	.	.	.	.	.	.	.	.	.	.	G	6.518	0.463885	0.12402	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917;ENST00000457788;ENST00000395194	T;T;T;T;T;T;T;T;T;T	0.01871	4.59;4.59;4.59;4.59;4.59;4.59;4.59;4.59;4.59;4.59	3.72	2.81	0.32909	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);Laminin G, subdomain 2 (1);	0.461581	0.19473	U	0.113388	T	0.00300	0.0009	N	0.00268	-1.735	0.29351	N	0.865314	P;B;B;P	0.43287	0.583;0.001;0.003;0.802	B;B;B;B	0.42771	0.397;0.003;0.003;0.333	T	0.34428	-0.9829	10	0.25751	T	0.34	.	8.5253	0.33302	0.0:0.0:0.58:0.42	.	186;186;186;186	Q7Z6C3;P13942-8;P13942-6;P13942	.;.;.;COBA2_HUMAN	D	186	ENSP00000363840:H186D;ENSP00000339915:H186D;ENSP00000350079:H186D;ENSP00000363846:H186D;ENSP00000363845:H186D;ENSP00000378623:H186D;ENSP00000363844:H186D;ENSP00000355123:H186D;ENSP00000405520:H186D;ENSP00000378620:H186D	ENSP00000339915:H186D	H	-	1	0	COL11A2	33264167	0.646000	0.27295	0.914000	0.36105	0.687000	0.40016	1.095000	0.30964	0.852000	0.35287	0.453000	0.30009	CAT	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G		0.537	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	protein_coding	OTTHUMT00000076032.2	G		-		33156189	-1	no_errors	ENST00000341947	ensembl	human	known	74_37	missense	SNP	0.941	C
DPYSL5	56896	genome.wustl.edu	37	2	27167529	27167529	+	Silent	SNP	A	A	G			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr2:27167529A>G	ENST00000288699.6	+	12	1604	c.1446A>G	c.(1444-1446)ttA>ttG	p.L482L	DPYSL5_ENST00000401478.1_Silent_p.L482L	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	482					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTAGACTTTAAAGGTTAGAG	0.547																																																	0								ENSG00000157851						76.0	71.0	73.0					2																	27167529		2203	4300	6503	DPYSL5	SO:0001819	synonymous_variant	0			-	HGNC	AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.1446A>G	2.37:g.27167529A>G		Somatic	0	95	0.00		0.4911483017230278	27	3.57	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	37	28.85	Q8TCL6|Q9NQC4|Q9NRY9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.L482	ENST00000288699.6	37	c.1446	CCDS1730.1	2																																																																																			-	superfamily_Metal-dep_hydrolase_composite		0.547	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYSL5	protein_coding	OTTHUMT00000214187.2	A	NM_020134	-		27167529	+1	no_errors	ENST00000288699	ensembl	human	known	74_37	silent	SNP	0.995	G
HSF2BP	11077	genome.wustl.edu	37	21	45064234	45064234	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr21:45064234A>T	ENST00000291560.2	-	4	558	c.227T>A	c.(226-228)aTg>aAg	p.M76K	HSF2BP_ENST00000542962.1_Start_Codon_SNP_p.M1K	NM_007031.1	NP_008962.1	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding protein	76					spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)				kidney(2)|large_intestine(3)|prostate(1)|skin(1)	7				STAD - Stomach adenocarcinoma(101;0.18)		CTCACAATCCATTTTCAGCTG	0.448																																																	0								ENSG00000160207						163.0	152.0	156.0					21																	45064234		2203	4300	6503	HSF2BP	SO:0001583	missense	0			-	HGNC	AB007131	CCDS13697.1	21q22.3	2008-07-31			ENSG00000160207	ENSG00000160207			5226	protein-coding gene	gene with protein product	"""heat shock factor 2 binding protein"""	604554				9651507	Standard	XM_005261090		Approved		uc002zdi.3	O75031	OTTHUMG00000086863	ENST00000291560.2:c.227T>A	21.37:g.45064234A>T	ENSP00000291560:p.Met76Lys	Somatic	0	44	0.00		0.4911483017230278	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	B4DX36	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.M76K	ENST00000291560.2	37	c.227	CCDS13697.1	21	.	.	.	.	.	.	.	.	.	.	A	15.40	2.822794	0.50739	.	.	ENSG00000160207	ENST00000291560;ENST00000542962;ENST00000443485	.	.	.	5.48	4.33	0.51752	.	0.346964	0.35646	N	0.003067	T	0.43831	0.1265	L	0.51422	1.61	0.80722	D	1	B	0.26547	0.152	B	0.21708	0.036	T	0.29488	-1.0010	9	0.02654	T	1	.	9.6638	0.39972	0.9208:0.0:0.0792:0.0	.	76	O75031	HSF2B_HUMAN	K	76;1;76	.	ENSP00000291560:M76K	M	-	2	0	HSF2BP	43888662	1.000000	0.71417	0.860000	0.33809	0.998000	0.95712	3.258000	0.51507	0.929000	0.37192	0.533000	0.62120	ATG	-	NULL		0.448	HSF2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF2BP	protein_coding	OTTHUMT00000195620.1	A	NM_007031	-		45064234	-1	no_errors	ENST00000291560	ensembl	human	known	74_37	missense	SNP	0.998	T
ZC3H15	55854	genome.wustl.edu	37	2	187370520	187370520	+	Silent	SNP	T	T	C			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr2:187370520T>C	ENST00000337859.6	+	8	1145	c.918T>C	c.(916-918)gaT>gaC	p.D306D	ZC3H15_ENST00000544130.1_Silent_p.D101D	NM_018471.2	NP_060941.2	Q8WU90	ZC3HF_HUMAN	zinc finger CCCH-type containing 15	306					cytokine-mediated signaling pathway (GO:0019221)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			ATGATGATGATGAGGAAGCAG	0.403																																																	0								ENSG00000065548						126.0	121.0	123.0					2																	187370520		2009	4171	6180	ZC3H15	SO:0001819	synonymous_variant	0			-	HGNC		CCDS42791.1	2q32.1	2012-07-05			ENSG00000065548	ENSG00000065548		"""Zinc fingers, CCCH-type domain containing"""	29528	protein-coding gene	gene with protein product	"""likely ortholog of mouse immediate early response, erythropoietin 4"""					10880228	Standard	NM_018471		Approved	LEREPO4	uc002upo.3	Q8WU90	OTTHUMG00000154251	ENST00000337859.6:c.918T>C	2.37:g.187370520T>C		Somatic	0	87	0.00		0.4911483017230278	135	36.32	77	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	42	37.31	B4DMW2|D3DPG7|Q5QTQ4|Q8WZ06|Q9NUZ3|Q9NZ37|Q9P079	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_CCCH,smart_Znf_CCCH	p.D306	ENST00000337859.6	37	c.918	CCDS42791.1	2																																																																																			-	NULL		0.403	ZC3H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H15	protein_coding	OTTHUMT00000334547.2	T	NM_018471	-		187370520	+1	no_errors	ENST00000337859	ensembl	human	known	74_37	silent	SNP	0.998	C
MORC3	23515	genome.wustl.edu	37	21	37741363	37741363	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr21:37741363delC	ENST00000400485.1	+	15	1773	c.1697delC	c.(1696-1698)tcafs	p.S566fs	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	566					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						TTTGAAAATTCAGTTTATAAA	0.333																																																	0								ENSG00000159256						86.0	77.0	80.0					21																	37741363		1877	4117	5994	MORC3	SO:0001589	frameshift_variant	0				HGNC	AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.1697delC	21.37:g.37741363delC	ENSP00000383333:p.Ser566fs	Somatic	0	42	0.00		0.4911483017230278	30	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A8KA92|Q9UEZ2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_CW,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,pfscan_Znf_CW	p.S566fs	ENST00000400485.1	37	c.1697	CCDS42924.1	21																																																																																			-	NULL		0.333	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MORC3	protein_coding	OTTHUMT00000194640.1	C	NM_015358			37741363	+1	no_errors	ENST00000400485	ensembl	human	known	74_37	frame_shift_del	DEL	0.728	-
MOV10L1	54456	genome.wustl.edu	37	22	50558966	50558966	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr22:50558966A>G	ENST00000262794.5	+	10	1573	c.1490A>G	c.(1489-1491)cAa>cGa	p.Q497R	MOV10L1_ENST00000545383.1_Missense_Mutation_p.Q497R|MOV10L1_ENST00000395843.1_5'UTR|MOV10L1_ENST00000540615.1_Missense_Mutation_p.Q477R|MOV10L1_ENST00000395858.3_Missense_Mutation_p.Q497R	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	497					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		TTTCTTCCCCAATATCCAATC	0.368																																																	0								ENSG00000073146						113.0	115.0	114.0					22																	50558966		2203	4300	6503	MOV10L1	SO:0001583	missense	0			-	HGNC	AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.1490A>G	22.37:g.50558966A>G	ENSP00000262794:p.Gln497Arg	Somatic	0	100	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	38	29.63	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase,superfamily_NA-bd_OB-fold	p.Q497R	ENST00000262794.5	37	c.1490	CCDS14084.1	22	.	.	.	.	.	.	.	.	.	.	A	12.01	1.808939	0.31961	.	.	ENSG00000073146	ENST00000545383;ENST00000262794;ENST00000395858;ENST00000540615	D;D;T;D	0.85773	-1.84;-1.84;-1.43;-2.03	5.68	5.68	0.88126	.	0.562734	0.19264	N	0.118591	D	0.84674	0.5524	M	0.70275	2.135	0.80722	D	1	P;P;P;B	0.43094	0.799;0.682;0.554;0.411	P;B;B;B	0.45138	0.471;0.168;0.118;0.118	T	0.81200	-0.1041	10	0.18710	T	0.47	-21.3345	10.1935	0.43041	0.8514:0.0:0.0:0.1486	.	258;477;497;497	B7Z893;F5H403;A8MXC6;Q9BXT6	.;.;.;M10L1_HUMAN	R	497;497;497;477	ENSP00000438978:Q497R;ENSP00000262794:Q497R;ENSP00000379199:Q497R;ENSP00000438542:Q477R	ENSP00000262794:Q497R	Q	+	2	0	MOV10L1	48901093	0.942000	0.31987	0.949000	0.38748	0.887000	0.51463	3.734000	0.55037	2.159000	0.67721	0.528000	0.53228	CAA	-	NULL		0.368	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MOV10L1	protein_coding	OTTHUMT00000075009.2	A	NM_018995	-		50558966	+1	no_errors	ENST00000262794	ensembl	human	known	74_37	missense	SNP	0.868	G
TXNDC8	255220	genome.wustl.edu	37	9	113091512	113091512	+	Splice_Site	SNP	C	C	T	rs200152415		TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr9:113091512C>T	ENST00000374511.3	-	3	237	c.189G>A	c.(187-189)ccG>ccA	p.P63P	TXNDC8_ENST00000374507.4_Intron|TXNDC8_ENST00000423740.2_Intron|TXNDC8_ENST00000374510.4_Splice_Site_p.P63P			Q6A555	TXND8_HUMAN	thioredoxin domain containing 8 (spermatozoa)	63	Thioredoxin.				acrosome assembly (GO:0001675)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|sperm flagellum (GO:0036126)				endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4						AGATTCTTACCGGAGAATTGT	0.294													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18853	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000204193	C		2,4402	4.2+/-10.8	0,2,2200	97.0	99.0	99.0		189	4.1	1.0	9		99	2,8588	2.2+/-6.3	0,2,4293	yes	coding-synonymous-near-splice	TXNDC8	NM_001003936.2		0,4,6493	TT,TC,CC		0.0233,0.0454,0.0308		63/116	113091512	4,12990	2202	4295	6497	TXNDC8	SO:0001630	splice_region_variant	0			-	HGNC	BC035743	CCDS35104.1, CCDS69639.1, CCDS75872.1	9q31.3	2007-08-16	2007-08-16	2007-08-16	ENSG00000204193	ENSG00000204193			31454	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 3"""						Standard	XM_005251879		Approved	bA427L11.2, TRX6, SPTRX-3	uc004bes.3	Q6A555	OTTHUMG00000020481	ENST00000374511.3:c.189+1G>A	9.37:g.113091512C>T		Somatic	0	74	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	47	9.62	A1L4I2|A6NDK7|Q5T934	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.P63	ENST00000374511.3	37	c.189		9																																																																																			-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold		0.294	TXNDC8-201	KNOWN	basic|appris_candidate_longest	protein_coding	TXNDC8	protein_coding		C	NM_001003936	rs200152415	Silent	113091512	-1	no_errors	ENST00000374511	ensembl	human	known	74_37	silent	SNP	0.964	T
CMYA5	202333	genome.wustl.edu	37	5	79032251	79032251	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr5:79032251C>T	ENST00000446378.2	+	2	7694	c.7663C>T	c.(7663-7665)Cag>Tag	p.Q2555*		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2555					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AAAGAAGCAGCAGGAACATCA	0.368																																																	0								ENSG00000164309						68.0	65.0	66.0					5																	79032251		1893	4114	6007	CMYA5	SO:0001587	stop_gained	0			-	HGNC	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.7663C>T	5.37:g.79032251C>T	ENSP00000394770:p.Gln2555*	Somatic	0	36	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.Q2555*	ENST00000446378.2	37	c.7663	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	C	46	12.602527	0.99681	.	.	ENSG00000164309	ENST00000446378	.	.	.	5.16	4.29	0.51040	.	0.302484	0.23782	N	0.044602	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.7649	0.51924	0.0:0.8239:0.1761:0.0	.	.	.	.	X	2555	.	ENSP00000394770:Q2555X	Q	+	1	0	CMYA5	79068007	0.975000	0.34042	0.613000	0.29037	0.384000	0.30261	2.182000	0.42556	1.384000	0.46424	0.462000	0.41574	CAG	-	NULL		0.368	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	protein_coding	OTTHUMT00000369497.1	C	NM_153610	-		79032251	+1	no_errors	ENST00000446378	ensembl	human	known	74_37	nonsense	SNP	0.279	T
PPAP2B	8613	genome.wustl.edu	37	1	56978868	56978869	+	Intron	INS	-	-	A	rs188460333|rs367756101	byFrequency	TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr1:56978868_56978869insA	ENST00000371250.3	-	5	1185				PPAP2B_ENST00000459962.1_5'UTR	NM_003713.4	NP_003704.3	O14495	LPP3_HUMAN	phosphatidic acid phosphatase type 2B						Bergmann glial cell differentiation (GO:0060020)|blood vessel development (GO:0001568)|canonical Wnt signaling pathway involved in positive regulation of cell-cell adhesion (GO:0044329)|canonical Wnt signaling pathway involved in positive regulation of endothelial cell migration (GO:0044328)|canonical Wnt signaling pathway involved in positive regulation of wound healing (GO:0044330)|dephosphorylation (GO:0016311)|gastrulation with mouth forming second (GO:0001702)|germ cell migration (GO:0008354)|homotypic cell-cell adhesion (GO:0034109)|lipid metabolic process (GO:0006629)|negative regulation of protein phosphorylation (GO:0001933)|phospholipid metabolic process (GO:0006644)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of sphingolipid mediated signaling pathway (GO:1902068)|regulation of Wnt signaling pathway (GO:0030111)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)|sphingosine-1-phosphate phosphatase activity (GO:0042392)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17						AATGGAAGATTAAAAAAAAAAC	0.406																																																	0								ENSG00000162407																																			PPAP2B	SO:0001627	intron_variant	0				HGNC	AB000889	CCDS604.1	1p32.2	2009-05-27			ENSG00000162407	ENSG00000162407	3.1.3.4		9229	protein-coding gene	gene with protein product		607125				9305923	Standard	NM_003713		Approved	PAP-2b, LPP3	uc001cyj.2	O14495	OTTHUMG00000008160	ENST00000371250.3:c.634-1044->T	1.37:g.56978878_56978878dupA		Somatic	0	51	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	B2R651|D3DQ52|Q5U0F7|Q96GW0|Q99782	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371250.3	37	NULL	CCDS604.1	1																																																																																			-	-		0.406	PPAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAP2B	protein_coding	OTTHUMT00000022334.2	-	NM_003713			56978869	-1	no_errors	ENST00000459962	ensembl	human	putative	74_37	rna	INS	0.000:0.000	A
TMEM254	80195	genome.wustl.edu	37	10	81850173	81850173	+	Intron	SNP	C	C	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr10:81850173C>T	ENST00000372281.3	+	4	281				TMEM254_ENST00000467529.1_Intron|TMEM254_ENST00000372275.1_3'UTR|TMEM254_ENST00000372274.1_3'UTR	NM_001270372.1|NM_025125.3	NP_001257301.1|NP_079401.2	Q8TBM7	TM254_HUMAN	transmembrane protein 254							integral component of membrane (GO:0016021)											gagtgatttgcccaggtcaca	0.413																																																	0								ENSG00000133678																																			TMEM254	SO:0001627	intron_variant	0			-	HGNC	BC022252	CCDS7363.1, CCDS58086.1, CCDS58087.1, CCDS73157.1	10q23.1	2012-11-06	2012-11-06	2012-11-06	ENSG00000133678	ENSG00000133678			25804	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 57"""	C10orf57		14702039	Standard	NM_025125		Approved	FLJ13263, bA369J21.6	uc010qlw.3	Q8TBM7	OTTHUMG00000018602	ENST00000372281.3:c.252-380C>T	10.37:g.81850173C>T		Somatic	0	63	0.00		0.4911483017230278	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	D3DWC8|Q53HP4|Q5JTC0|Q5JTC1|Q6IA45|Q9H8S6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372281.3	37	NULL	CCDS7363.1	10																																																																																			-	-		0.413	TMEM254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM254	protein_coding	OTTHUMT00000049030.1	C	NM_025125	-		81850173	+1	no_errors	ENST00000476173	ensembl	human	known	74_37	rna	SNP	0.024	T
SQRDL	58472	genome.wustl.edu	37	15	45951302	45951302	+	Missense_Mutation	SNP	C	C	A	rs376077055		TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr15:45951302C>A	ENST00000260324.7	+	2	567	c.181C>A	c.(181-183)Cgc>Agc	p.R61S	RP11-96O20.4_ENST00000564080.1_Missense_Mutation_p.R61S|SQRDL_ENST00000568606.1_Missense_Mutation_p.R61S	NM_021199.3	NP_067022.1	Q9Y6N5	SQRD_HUMAN	sulfide quinone reductase-like (yeast)	61					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial inner membrane (GO:0005743)	sulfide:quinone oxidoreductase activity (GO:0070224)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	11		Lung NSC(122;0.000117)|all_lung(180;0.000737)|Melanoma(134;0.0417)		all cancers(107;5.89e-18)|GBM - Glioblastoma multiforme(94;1.21e-06)|COAD - Colon adenocarcinoma(120;0.17)|Colorectal(133;0.188)		CATGGCTGCCCGCATGAAGAG	0.617																																																	0								ENSG00000137767						46.0	49.0	48.0					15																	45951302		2197	4297	6494	SQRDL	SO:0001583	missense	0			-	HGNC	AF042284	CCDS10127.1	15q21.1	2010-08-05			ENSG00000137767	ENSG00000137767			20390	protein-coding gene	gene with protein product						10810093, 10224084	Standard	NM_021199		Approved	CGI-44	uc001zvu.4	Q9Y6N5	OTTHUMG00000131476	ENST00000260324.7:c.181C>A	15.37:g.45951302C>A	ENSP00000260324:p.Arg61Ser	Somatic	0	31	0.00		0.4911483017230278	257	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	Q9UQM8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	p.R61S	ENST00000260324.7	37	c.181	CCDS10127.1	15	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919424	0.73098	.	.	ENSG00000137767	ENST00000260324	T	0.47869	0.83	5.5	5.5	0.81552	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.41534	0.1163	L	0.35341	1.055	0.80722	D	1	B	0.31241	0.315	B	0.35073	0.195	T	0.17623	-1.0363	10	0.19590	T	0.45	.	17.9821	0.89145	0.0:1.0:0.0:0.0	.	61	Q9Y6N5	SQRD_HUMAN	S	61	ENSP00000260324:R61S	ENSP00000260324:R61S	R	+	1	0	SQRDL	43738594	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.226000	0.58606	2.580000	0.87095	0.655000	0.94253	CGC	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD		0.617	SQRDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SQRDL	protein_coding	OTTHUMT00000254319.2	C		-		45951302	+1	no_errors	ENST00000260324	ensembl	human	known	74_37	missense	SNP	1.000	A
CTAGE9	643854	genome.wustl.edu	37	6	132031121	132031121	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr6:132031121T>C	ENST00000314099.8	-	1	1085	c.1037A>G	c.(1036-1038)gAc>gGc	p.D346G	ENPP3_ENST00000357639.3_Intron|ENPP3_ENST00000358229.5_Intron|ENPP3_ENST00000414305.1_Intron	NM_001145659.1|NM_001278507.1	NP_001139131.1|NP_001265436.1	A4FU28	CTGE9_HUMAN	CTAGE family, member 9	346						integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						CTTTGTTTTGTCCACTTCAGA	0.323																																																	0								ENSG00000236761						1.0	1.0	1.0					6																	132031121		209	555	764	CTAGE9	SO:0001583	missense	0			-	HGNC		CCDS47475.1	6q23.2	2010-06-23			ENSG00000236761	ENSG00000236761			37275	protein-coding gene	gene with protein product							Standard	NM_001145659		Approved		uc011ece.2	A4FU28	OTTHUMG00000047966	ENST00000314099.8:c.1037A>G	6.37:g.132031121T>C	ENSP00000395587:p.Asp346Gly	Somatic	0	55	0.00		0.4911483017230278	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	32	17.95		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D346G	ENST00000314099.8	37	c.1037	CCDS47475.1	6	.	.	.	.	.	.	.	.	.	.	-	7.453	0.643095	0.14451	.	.	ENSG00000236761	ENST00000314099	T	0.38401	1.14	.	.	.	.	.	.	.	.	T	0.35422	0.0931	M	0.88450	2.955	0.23855	N	0.996659	D	0.58970	0.984	P	0.59171	0.853	T	0.12293	-1.0553	8	0.35671	T	0.21	.	2.1243	0.03734	0.4998:2.0E-4:2.0E-4:0.4998	.	346	A4FU28	CTGE9_HUMAN	G	346	ENSP00000395587:D346G	ENSP00000395587:D346G	D	-	2	0	CTAGE9	132072814	0.875000	0.30112	0.000000	0.03702	0.000000	0.00434	-0.534000	0.06150	0.000000	0.14550	0.000000	0.15137	GAC	-	NULL		0.323	CTAGE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTAGE9	protein_coding	OTTHUMT00000109220.1	T	NM_001145659	-		132031121	-1	no_errors	ENST00000314099	ensembl	human	known	74_37	missense	SNP	0.942	C
GATA1	2623	genome.wustl.edu	37	X	48651599	48651599	+	Silent	SNP	T	T	C			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chrX:48651599T>C	ENST00000376670.3	+	5	876	c.765T>C	c.(763-765)ggT>ggC	p.G255G	GATA1_ENST00000376665.3_Silent_p.G255G	NM_002049.3	NP_002040.1	P15976	GATA1_HUMAN	GATA binding protein 1 (globin transcription factor 1)	255					basophil differentiation (GO:0030221)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cellular response to thyroid hormone stimulus (GO:0097067)|dendritic cell differentiation (GO:0097028)|embryonic hemopoiesis (GO:0035162)|eosinophil differentiation (GO:0030222)|eosinophil fate commitment (GO:0035854)|erythrocyte development (GO:0048821)|erythrocyte differentiation (GO:0030218)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|megakaryocyte differentiation (GO:0030219)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of definitive erythrocyte differentiation (GO:0010724)|regulation of glycoprotein biosynthetic process (GO:0010559)|transcription from RNA polymerase II promoter (GO:0006366)|transcriptional activation by promoter-enhancer looping (GO:0071733)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	C2H2 zinc finger domain binding (GO:0070742)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(259)|large_intestine(8)|lung(9)|prostate(1)	283						AACGGGCAGGTACTCAGTGCA	0.587			"""Mis, F"""		megakaryoblastic leukemia of Downs Syndrome																																Pancreas(9;429 505 11287 29617)			Dom	yes		X	Xp11.23	2623	GATA binding protein 1 (globin transcription factor 1)		L	0								ENSG00000102145						162.0	110.0	128.0					X																	48651599		2203	4300	6503	GATA1	SO:0001819	synonymous_variant	0			-	HGNC	X17254	CCDS14305.1	Xp11.23	2014-09-17	2001-11-28		ENSG00000102145	ENSG00000102145		"""GATA zinc finger domain containing"""	4170	protein-coding gene	gene with protein product	"""nuclear factor, erythroid 1"""	305371	"""GATA-binding protein 1 (globin transcription factor 1)"""	GF1		1999341	Standard	NM_002049		Approved	ERYF1, NFE1, GATA-1, NF-E1	uc004dkq.4	P15976	OTTHUMG00000021504	ENST00000376670.3:c.765T>C	X.37:g.48651599T>C		Somatic	0	86	0.00		0.4911483017230278	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	37	15.91	Q96GB8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.G255	ENST00000376670.3	37	c.765	CCDS14305.1	X	.	.	.	.	.	.	.	.	.	.	t	9.883	1.202121	0.22121	.	.	ENSG00000102145	ENST00000447551	.	.	.	4.01	-0.008	0.14007	.	.	.	.	.	T	0.39517	0.1081	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22591	-1.0212	4	.	.	.	-9.2994	0.3754	0.00386	0.1869:0.2486:0.1882:0.3763	.	.	.	.	A	20	.	.	V	+	2	0	GATA1	48536543	0.037000	0.19845	0.997000	0.53966	0.920000	0.55202	-1.020000	0.03618	-0.156000	0.11079	0.237000	0.17872	GTA	-	smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA		0.587	GATA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATA1	protein_coding	OTTHUMT00000056517.1	T	NM_002049	-		48651599	+1	no_errors	ENST00000376670	ensembl	human	known	74_37	silent	SNP	0.957	C
TOR1A	1861	genome.wustl.edu	37	9	132580862	132580862	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr9:132580862C>T	ENST00000351698.4	-	4	733	c.685G>A	c.(685-687)Gaa>Aaa	p.E229K	TOR1A_ENST00000473084.1_5'Flank	NM_000113.2	NP_000104.1	O14656	TOR1A_HUMAN	torsin family 1, member A (torsin A)	229	Interaction with SNAPIN.				ATP catabolic process (GO:0006200)|cell adhesion (GO:0007155)|chaperone mediated protein folding requiring cofactor (GO:0051085)|chaperone-mediated protein folding (GO:0061077)|chaperone-mediated protein transport (GO:0072321)|ER-associated misfolded protein catabolic process (GO:0071712)|intermediate filament cytoskeleton organization (GO:0045104)|neuron projection development (GO:0031175)|nuclear envelope organization (GO:0006998)|nuclear membrane organization (GO:0071763)|organelle organization (GO:0006996)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|protein deneddylation (GO:0000338)|protein homooligomerization (GO:0051260)|protein localization to nucleus (GO:0034504)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of protein localization to cell surface (GO:2000008)|response to oxidative stress (GO:0006979)|synaptic vesicle transport (GO:0048489)|wound healing, spreading of cells (GO:0044319)	cell junction (GO:0030054)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cytoskeletal protein binding (GO:0008092)|kinesin binding (GO:0019894)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20		Ovarian(14;0.00556)				TTGATGTCTTCCCTCTGCTTT	0.488																																																	0								ENSG00000136827						189.0	175.0	180.0					9																	132580862		2203	4300	6503	TOR1A	SO:0001583	missense	0			-	HGNC	AF007871	CCDS6930.1	9q32-q34	2008-07-21	2004-11-24	2004-11-26	ENSG00000136827	ENSG00000136827			3098	protein-coding gene	gene with protein product		605204	"""dystonia 1, torsion (autosomal dominant; torsin A)"""	DYT1		10644435	Standard	NM_000113		Approved	DQ2	uc004byl.3	O14656	OTTHUMG00000020794	ENST00000351698.4:c.685G>A	9.37:g.132580862C>T	ENSP00000345719:p.Glu229Lys	Somatic	0	92	0.00		0.4911483017230278	126	40.85	87	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	51	31.08	B2RB58|Q53Y64|Q96CA0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Torsin,superfamily_P-loop_NTPase,pirsf_Torsin_subgr	p.E229K	ENST00000351698.4	37	c.685	CCDS6930.1	9	.	.	.	.	.	.	.	.	.	.	C	34	5.335992	0.95758	.	.	ENSG00000136827	ENST00000427355;ENST00000351698	T	0.40476	1.03	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.71204	0.3312	M	0.86740	2.835	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	T	0.73216	-0.4053	10	0.62326	D	0.03	-10.2461	19.8676	0.96824	0.0:1.0:0.0:0.0	.	229	O14656	TOR1A_HUMAN	K	198;229	ENSP00000345719:E229K	ENSP00000345719:E229K	E	-	1	0	TOR1A	131620683	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.664000	0.68045	2.941000	0.99782	0.655000	0.94253	GAA	-	superfamily_P-loop_NTPase,pirsf_Torsin_subgr		0.488	TOR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOR1A	protein_coding	OTTHUMT00000054611.1	C	NM_000113	-		132580862	-1	no_errors	ENST00000351698	ensembl	human	known	74_37	missense	SNP	1.000	T
CFAP69	79846	genome.wustl.edu	37	7	89933287	89933287	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr7:89933287delA	ENST00000389297.4	+	18	2306	c.2055delA	c.(2053-2055)acafs	p.T685fs	C7orf63_ENST00000497910.1_Frame_Shift_Del_p.T667fs|C7orf63_ENST00000316089.8_Intron	NM_001039706.2|NM_001160138.1	NP_001034795.2|NP_001153610.1	A5D8W1	CG063_HUMAN		685										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|prostate(3)	37						GATTAGATACAAAAAAACCTC	0.308																																																	0								ENSG00000105792						96.0	85.0	88.0					7																	89933287		692	1591	2283	C7orf63	SO:0001589	frameshift_variant	0				HGNC																												ENST00000389297.4:c.2055delA	7.37:g.89933287delA	ENSP00000373948:p.Thr685fs	Somatic	0	55	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	A3KMP9|B4DYW6|B4DZP7|B9EIM7|Q6V705|Q8IY89|Q9H7C2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.K687fs	ENST00000389297.4	37	c.2055	CCDS43613.2	7																																																																																			-	NULL		0.308	C7orf63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C7orf63	protein_coding	OTTHUMT00000139891.4	A				89933287	+1	no_errors	ENST00000389297	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
KPTN	11133	genome.wustl.edu	37	19	47978663	47978663	+	3'UTR	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr19:47978663G>T	ENST00000338134.3	-	0	1428				KPTN_ENST00000536339.1_3'UTR	NM_007059.2	NP_008990.2	Q9Y664	KPTN_HUMAN	kaptin (actin binding protein)						actin filament organization (GO:0007015)|cellular component movement (GO:0006928)|sensory perception of sound (GO:0007605)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(1)|lung(3)|ovary(2)|pancreas(2)	8		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000428)|all cancers(93;0.000631)|Epithelial(262;0.0153)|GBM - Glioblastoma multiforme(486;0.0694)		AAGAGTGGGTGCATGGGTGCT	0.637																																																	0								ENSG00000118162						23.0	26.0	25.0					19																	47978663		2076	4213	6289	KPTN	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF105369	CCDS42583.1	19q13.32	2014-08-13	2001-11-28		ENSG00000118162	ENSG00000118162			6404	protein-coding gene	gene with protein product		615620	"""kaptin (actin-binding protein)"""			10099934	Standard	XM_005258467		Approved	2E4	uc002pgy.3	Q9Y664	OTTHUMG00000183443	ENST00000338134.3:c.*10C>A	19.37:g.47978663G>T		Somatic	0	94	0.00		0.4911483017230278	20	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	53	8.62	B3KN86|B4DQ76|Q96GT1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000338134.3	37	NULL	CCDS42583.1	19																																																																																			-	-		0.637	KPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPTN	protein_coding	OTTHUMT00000466672.2	G		-		47978663	-1	no_errors	ENST00000600551	ensembl	human	known	74_37	rna	SNP	0.000	T
TULP4	56995	genome.wustl.edu	37	6	158924606	158924606	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr6:158924606G>A	ENST00000367097.3	+	13	5268	c.3911G>A	c.(3910-3912)gGc>gAc	p.G1304D	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	1304					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		AGCCACTTGGGCACAGAGGTG	0.582																																																	0								ENSG00000130338						55.0	59.0	57.0					6																	158924606		2203	4300	6503	TULP4	SO:0001583	missense	0			-	HGNC		CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.3911G>A	6.37:g.158924606G>A	ENSP00000356064:p.Gly1304Asp	Somatic	0	66	0.00		0.4911483017230278	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tubby_C,pfam_SOCS_C,pfam_WD40_repeat,superfamily_Tubby_C-like,superfamily_WD40_repeat_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_WD40_repeat,smart_SOCS_C,pfscan_SOCS_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G1304D	ENST00000367097.3	37	c.3911	CCDS34561.1	6	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803059	0.70682	.	.	ENSG00000130338	ENST00000367097	T	0.64803	-0.12	5.18	5.18	0.71444	.	0.057950	0.64402	D	0.000001	T	0.62036	0.2395	L	0.59436	1.845	0.80722	D	1	D	0.54964	0.969	P	0.50490	0.642	T	0.63769	-0.6562	10	0.49607	T	0.09	-29.3102	18.8692	0.92306	0.0:0.0:1.0:0.0	.	1304	Q9NRJ4	TULP4_HUMAN	D	1304	ENSP00000356064:G1304D	ENSP00000356064:G1304D	G	+	2	0	TULP4	158844594	1.000000	0.71417	0.981000	0.43875	0.702000	0.40608	4.731000	0.62022	2.696000	0.92011	0.561000	0.74099	GGC	-	NULL		0.582	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP4	protein_coding	OTTHUMT00000042869.1	G	NM_020245	-		158924606	+1	no_errors	ENST00000367097	ensembl	human	known	74_37	missense	SNP	0.335	A
ZNF684	127396	genome.wustl.edu	37	1	41012818	41012818	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr1:41012818G>T	ENST00000372699.3	+	5	1074	c.823G>T	c.(823-825)Gaa>Taa	p.E275*	ZNF684_ENST00000493756.1_3'UTR	NM_152373.3	NP_689586.3	Q5T5D7	ZN684_HUMAN	zinc finger protein 684	275					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(2)|lung(3)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;5.42e-18)			TGAATGTAAGGAATGTGGGAA	0.383																																																	0								ENSG00000117010						66.0	69.0	68.0					1																	41012818		2203	4300	6503	ZNF684	SO:0001587	stop_gained	0			-	HGNC		CCDS454.1	1p34.2	2013-01-08			ENSG00000117010	ENSG00000117010		"""Zinc fingers, C2H2-type"", ""-"""	28418	protein-coding gene	gene with protein product	"""hypothetical protein MGC27466"""					12477932	Standard	NM_152373		Approved	MGC27466	uc001cft.2	Q5T5D7	OTTHUMG00000007359	ENST00000372699.3:c.823G>T	1.37:g.41012818G>T	ENSP00000361784:p.Glu275*	Somatic	0	62	0.00		0.4911483017230278	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	Q2NKY4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E275*	ENST00000372699.3	37	c.823	CCDS454.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.327556	0.95733	.	.	ENSG00000117010	ENST00000372699	.	.	.	4.29	3.3	0.37823	.	0.000000	0.36519	N	0.002556	.	.	.	.	.	.	0.32893	D	0.512158	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	12.0772	0.53652	0.0:0.1758:0.8242:0.0	.	.	.	.	X	275	.	ENSP00000361784:E275X	E	+	1	0	ZNF684	40785405	0.003000	0.15002	1.000000	0.80357	0.998000	0.95712	0.469000	0.22067	2.393000	0.81446	0.591000	0.81541	GAA	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.383	ZNF684-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF684	protein_coding	OTTHUMT00000019260.3	G	NM_152373	-		41012818	+1	no_errors	ENST00000372699	ensembl	human	known	74_37	nonsense	SNP	0.556	T
MIR205HG	642587	genome.wustl.edu	37	1	209605637	209605648	+	lincRNA	DEL	AGCAGCAGCAGC	AGCAGCAGCAGC	-	rs71788170|rs74820836|rs150848171|rs3842530		TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	AGCAGCAGCAGC	AGCAGCAGCAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr1:209605637_209605648delAGCAGCAGCAGC	ENST00000384891.1	+	0	220					NR_029622.1				MIR205 host gene (non-protein coding)																		ccaccaccgTagcagcagcagcagcagcagca	0.561																																																	0								ENSG00000230937																																			MIR205HG			0				HGNC			1q32.2	2014-02-12	2011-11-07		ENSG00000230937	ENSG00000230937		"""Long non-coding RNAs"""	43562	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 510"""						Standard	NM_001104548		Approved	LINC00510	uc009xcn.3		OTTHUMG00000036267		1.37:g.209605637_209605648delAGCAGCAGCAGC		Somatic	NA	NA	NA		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000384891.1	37	NULL		1																																																																																			-	-		0.561	MIR205HG-202	KNOWN	basic	miRNA	MIR205HG	lincRNA		AGCAGCAGCAGC				209605648	+1	no_errors	ENST00000366437	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.002:0.000:0.000:0.000:0.000:0.000:0.000	-
SECISBP2L	9728	genome.wustl.edu	37	15	49301523	49301523	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr15:49301523G>T	ENST00000559471.1	-	14	2180	c.1917C>A	c.(1915-1917)aaC>aaA	p.N639K	SECISBP2L_ENST00000261847.3_Missense_Mutation_p.N594K	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	639							poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						AGTATGGAGAGTTCTGACTTG	0.433																																																	0								ENSG00000138593						176.0	159.0	164.0					15																	49301523		2197	4295	6492	SECISBP2L	SO:0001583	missense	0			-	HGNC	BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.1917C>A	15.37:g.49301523G>T	ENSP00000453854:p.Asn639Lys	Somatic	0	47	0.00		0.4911483017230278	29	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	Q8N767	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	p.N639K	ENST00000559471.1	37	c.1917	CCDS53942.1	15	.	.	.	.	.	.	.	.	.	.	G	18.77	3.695351	0.68386	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	T	0.72505	-0.66	5.07	-1.07	0.09968	.	0.000000	0.85682	D	0.000000	T	0.71467	0.3343	L	0.50919	1.6	0.45962	D	0.998782	D;D	0.89917	0.999;1.0	D;D	0.74348	0.941;0.983	T	0.69859	-0.5031	10	0.07175	T	0.84	.	10.0224	0.42051	0.5793:0.0:0.4207:0.0	.	639;594	Q93073;Q93073-2	SBP2L_HUMAN;.	K	594;639	ENSP00000261847:N594K	ENSP00000261847:N594K	N	-	3	2	SECISBP2L	47088815	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	0.803000	0.27083	-0.061000	0.13110	0.655000	0.94253	AAC	-	NULL		0.433	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SECISBP2L	protein_coding	OTTHUMT00000417277.1	G	NM_014701	-		49301523	-1	no_errors	ENST00000559471	ensembl	human	known	74_37	missense	SNP	0.997	T
CYP4F11	57834	genome.wustl.edu	37	19	16024597	16024597	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr19:16024597C>T	ENST00000402119.4	-	12	1946	c.1520G>A	c.(1519-1521)cGc>cAc	p.R507H	CYP4F11_ENST00000248041.8_Missense_Mutation_p.R507H|CYP4F11_ENST00000326742.8_3'UTR|CYP4F11_ENST00000591841.1_Missense_Mutation_p.R182H	NM_021187.3	NP_067010.3			cytochrome P450, family 4, subfamily F, polypeptide 11											NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						ACCCTCTGCGCGCAATATCAG	0.612																																																	0								ENSG00000171903						61.0	55.0	57.0					19																	16024597		2203	4300	6503	CYP4F11	SO:0001583	missense	0			-	HGNC	AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903		"""Cytochrome P450s"""	13265	protein-coding gene	gene with protein product		611517	"""cytochrome P450, subfamily IVF, polypeptide 11"""			10964514, 9068972	Standard	NM_021187		Approved		uc002nbu.2	Q9HBI6		ENST00000402119.4:c.1520G>A	19.37:g.16024597C>T	ENSP00000384588:p.Arg507His	Somatic	0	79	0.00		0.4911483017230278	3	25.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	27	30.77		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.R507H	ENST00000402119.4	37	c.1520	CCDS12337.1	19	.	.	.	.	.	.	.	.	.	.	c	12.70	2.017687	0.35606	.	.	ENSG00000171903	ENST00000402119;ENST00000248041	T;T	0.79845	-1.31;-1.31	2.74	0.475	0.16774	.	0.000000	0.64402	U	0.000011	D	0.86108	0.5854	M	0.86028	2.79	0.44719	D	0.997717	D	0.61697	0.99	P	0.60949	0.881	D	0.83488	0.0068	10	0.66056	D	0.02	.	6.7411	0.23437	0.0:0.742:0.0:0.258	.	507	Q9HBI6	CP4FB_HUMAN	H	507	ENSP00000384588:R507H;ENSP00000248041:R507H	ENSP00000248041:R507H	R	-	2	0	CYP4F11	15885597	1.000000	0.71417	0.056000	0.19401	0.001000	0.01503	5.003000	0.63959	0.052000	0.16007	-0.369000	0.07265	CGC	-	superfamily_Cyt_P450		0.612	CYP4F11-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYP4F11	protein_coding	OTTHUMT00000460385.2	C	NM_021187	-		16024597	-1	no_errors	ENST00000248041	ensembl	human	known	74_37	missense	SNP	0.800	T
FBLN2	2199	genome.wustl.edu	37	3	13611824	13611824	+	5'UTR	SNP	G	G	C			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr3:13611824G>C	ENST00000295760.7	+	0	38				FBLN2_ENST00000492059.1_5'UTR|FBLN2_ENST00000535798.1_Missense_Mutation_p.R16T|FBLN2_ENST00000404922.3_5'UTR	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2						extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			GGGTCTTACAGGAGAGGGGAC	0.682																																																	0								ENSG00000163520						4.0	5.0	5.0					3																	13611824		1989	4091	6080	FBLN2	SO:0001623	5_prime_UTR_variant	0			-	HGNC	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.-32G>C	3.37:g.13611824G>C		Somatic	0	35	0.00		0.4911483017230278	18	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	19	24.00	B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_Anaphylatoxin/fibulin,superfamily_Anaphylatoxin_comp_syst,smart_EG-like_dom,smart_Anaphylatoxin/fibulin,smart_EGF-like_Ca-bd_dom,pfscan_Anaphylatoxin/fibulin,pfscan_EG-like_dom	p.R16T	ENST00000295760.7	37	c.47	CCDS46762.1	3	.	.	.	.	.	.	.	.	.	.	G	2.436	-0.329709	0.05314	.	.	ENSG00000163520	ENST00000535798	T	0.79454	-1.27	2.26	-0.669	0.11388	.	.	.	.	.	T	0.63510	0.2517	.	.	.	0.09310	N	1	B	0.30281	0.275	B	0.24269	0.052	T	0.53507	-0.8429	8	0.87932	D	0	.	6.3974	0.21620	0.3811:0.0:0.6189:0.0	.	16	F5H1F3	.	T	16	ENSP00000445705:R16T	ENSP00000445705:R16T	R	+	2	0	FBLN2	13586824	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.361000	0.20267	-0.199000	0.10317	-1.012000	0.02466	AGG	-	NULL		0.682	FBLN2-002	KNOWN	basic|CCDS	protein_coding	FBLN2	protein_coding	OTTHUMT00000340083.3	G	NM_001004019	-		13611824	+1	no_errors	ENST00000535798	ensembl	human	known	74_37	missense	SNP	0.004	C
STT3A	3703	genome.wustl.edu	37	11	125472725	125472725	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr11:125472725A>C	ENST00000529196.1	+	6	505	c.299A>C	c.(298-300)tAc>tCc	p.Y100S	STT3A_ENST00000531491.1_Missense_Mutation_p.Y8S|STT3A_ENST00000392708.4_Missense_Mutation_p.Y100S			P46977	STT3A_HUMAN	STT3A, subunit of the oligosaccharyltransferase complex (catalytic)	100					cellular protein metabolic process (GO:0044267)|co-translational protein modification (GO:0043686)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			NS(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	33	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		GCTGCAATCTACCATGTACTC	0.453																																																	0								ENSG00000134910						239.0	208.0	219.0					11																	125472725		2201	4299	6500	STT3A	SO:0001583	missense	0			-	HGNC	BC020965	CCDS8458.1, CCDS60998.1	11q23.3	2013-03-06	2013-03-06	2006-02-07	ENSG00000134910	ENSG00000134910	2.4.99.18		6172	protein-coding gene	gene with protein product	"""dolichyl-diphosphooligosaccharide protein glycotransferase"""	601134	"""integral membrane protein 1"", ""STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)"", ""STT3A, cataylic subunit of the oligosaccharyltransferase complex"""	ITM1		8941377, 8634329, 10234787	Standard	NM_152713		Approved	TMC, MGC9042, STT3-A	uc001qcd.2	P46977	OTTHUMG00000165852	ENST00000529196.1:c.299A>C	11.37:g.125472725A>C	ENSP00000436962:p.Tyr100Ser	Somatic	0	59	0.00		0.4911483017230278	155	25.12	52	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	32	20.00	B4DJ24|E9PNQ1|Q86XU9|Q8TE35|Q8WUB4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Oligo_trans_STT3	p.Y100S	ENST00000529196.1	37	c.299	CCDS8458.1	11	.	.	.	.	.	.	.	.	.	.	A	26.9	4.784945	0.90282	.	.	ENSG00000134910	ENST00000527606;ENST00000392708;ENST00000529196;ENST00000531491;ENST00000525652;ENST00000529886	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.85066	0.5612	M	0.92923	3.36	0.80722	D	1	D;D	0.53885	0.963;0.963	D;P	0.64321	0.924;0.906	D	0.88548	0.3114	9	0.72032	D	0.01	-13.2495	15.9216	0.79580	1.0:0.0:0.0:0.0	.	8;100	E9PNQ1;P46977	.;STT3A_HUMAN	S	100;100;100;8;100;100	.	ENSP00000376472:Y100S	Y	+	2	0	STT3A	124977935	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.287000	0.95975	2.291000	0.77112	0.533000	0.62120	TAC	-	pfam_Oligo_trans_STT3		0.453	STT3A-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	STT3A	protein_coding	OTTHUMT00000386691.1	A	NM_152713	-		125472725	+1	no_errors	ENST00000392708	ensembl	human	known	74_37	missense	SNP	1.000	C
LZTR1	8216	genome.wustl.edu	37	22	21336825	21336825	+	Silent	SNP	G	G	C			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr22:21336825G>C	ENST00000215739.8	+	1	524	c.165G>C	c.(163-165)cgG>cgC	p.R55R	LZTR1_ENST00000389355.3_Silent_p.R55R|LZTR1_ENST00000479606.1_Intron|XXbac-B135H6.18_ENST00000610278.1_lincRNA	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	55					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			ATCGCTGGCGGCGCCTCCCGC	0.662																																																	0								ENSG00000099949						27.0	25.0	25.0					22																	21336825		2203	4300	6503	LZTR1	SO:0001819	synonymous_variant	0			-	HGNC	D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.165G>C	22.37:g.21336825G>C		Somatic	0	141	0.00		0.4911483017230278	29	40.82	20	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	76	24.00	Q14776|Q20WK0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_Kelch_1,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.R55	ENST00000215739.8	37	c.165	CCDS33606.1	22																																																																																			-	NULL		0.662	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTR1	protein_coding	OTTHUMT00000320387.1	G	NM_006767	-		21336825	+1	no_errors	ENST00000215739	ensembl	human	known	74_37	silent	SNP	0.999	C
AL441988.1	0	genome.wustl.edu	37	20	29637246	29637247	+	RNA	DEL	TA	TA	-			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	TA	TA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr20:29637246_29637247delTA	ENST00000408392.1	+	0	85_86																											gggacatgcttatactaaaata	0.277																																																	0								ENSG00000221319																																			AL441988.1			0				Clone_based_ensembl_gene																													20.37:g.29637248_29637249delTA		Somatic	0	128	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	71	25.26		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408392.1	37	NULL		20																																																																																			-	-		0.277	AL441988.1-201	NOVEL	basic	miRNA	ENSG00000221319	miRNA		TA				29637247	+1	no_errors	ENST00000408392	ensembl	human	novel	74_37	rna	DEL	0.029:0.028	-
HIP1	3092	genome.wustl.edu	37	7	75185340	75185340	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr7:75185340G>A	ENST00000336926.6	-	18	1843	c.1817C>T	c.(1816-1818)gCc>gTc	p.A606V	HIP1_ENST00000434438.2_Missense_Mutation_p.A606V	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	606					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						CTCTGTGCTGGCCAGTTTGAG	0.607			T	PDGFRB	CMML																																			Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	0								ENSG00000127946						169.0	151.0	157.0					7																	75185340		2203	4300	6503	HIP1	SO:0001583	missense	0			-	HGNC	AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.1817C>T	7.37:g.75185340G>A	ENSP00000336747:p.Ala606Val	Somatic	0	42	0.00		0.4911483017230278	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANTH_dom,pfam_ILWEQ_dom,pfam_Epsin_dom_N,superfamily_ENTH_VHS,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Epsin-like_N,smart_ILWEQ_dom,pfscan_Epsin-like_N,pfscan_ILWEQ_dom	p.A606V	ENST00000336926.6	37	c.1817	CCDS34669.1	7	.	.	.	.	.	.	.	.	.	.	G	9.483	1.098612	0.20552	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.15256	2.68;2.44	5.29	3.45	0.39498	.	1.657620	0.02713	N	0.113045	T	0.11367	0.0277	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.001;0.003	T	0.22347	-1.0219	10	0.49607	T	0.09	-2.5951	7.3997	0.26956	0.0868:0.324:0.5891:0.0	.	606;606	E7ES17;O00291	.;HIP1_HUMAN	V	606	ENSP00000336747:A606V;ENSP00000410300:A606V	ENSP00000336747:A606V	A	-	2	0	HIP1	75023276	0.094000	0.21725	0.087000	0.20705	0.753000	0.42808	1.824000	0.39072	0.764000	0.33197	0.650000	0.86243	GCC	-	NULL		0.607	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1	protein_coding	OTTHUMT00000342863.2	G	NM_005338	-		75185340	-1	no_errors	ENST00000336926	ensembl	human	known	74_37	missense	SNP	0.018	A
GOLGA6L4	643707	genome.wustl.edu	37	15	82932257	82932288	+	5'UTR	DEL	ACACAAATAAATTTAAACTATAAATTAGAAAC	ACACAAATAAATTTAAACTATAAATTAGAAAC	-	rs555363824	byFrequency	TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	ACACAAATAAATTTAAACTATAAATTAGAAAC	ACACAAATAAATTTAAACTATAAATTAGAAAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr15:82932257_82932288delACACAAATAAATTTAAACTATAAATTAGAAAC	ENST00000560844.1	-	0	2502_2533																				NS(1)	1						taaattagaaacacaaataaatttaaactataaattagaaacacaaataaat	0.207																																																	0								ENSG00000215749																																			RP13-996F3.5	SO:0001623	5_prime_UTR_variant	0				Clone_based_vega_gene																												ENST00000560844.1:c.-1851GTTTCTAATTTATAGTTTAAATTTATTTGTGT>-	15.37:g.82932257_82932288delACACAAATAAATTTAAACTATAAATTAGAAAC		Somatic	NA	NA	NA		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000560844.1	37	NULL		15																																																																																			-	-		0.207	RP13-996F3.5-002	KNOWN	basic	processed_transcript	GOLGA6L4	protein_coding	OTTHUMT00000419267.1	ACACAAATAAATTTAAACTATAAATTAGAAAC				82932288	-1	no_errors	ENST00000560844	ensembl	human	known	74_37	rna	DEL	0.140:0.148:0.154:0.160:0.165:0.169:0.172:0.175:0.177:0.178:0.179:0.179:0.180:0.179:0.135:0.131:0.126:0.121:0.112:0.097:0.077:0.050:0.041:0.040:0.045:0.047:0.048:0.046:0.049:0.052:0.050:0.046	-
HP1BP3	50809	genome.wustl.edu	37	1	21106864	21106864	+	Silent	SNP	G	G	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr1:21106864G>A	ENST00000312239.5	-	2	209	c.70C>T	c.(70-72)Ctg>Ttg	p.L24L	HP1BP3_ENST00000375000.1_Silent_p.L24L|HP1BP3_ENST00000487117.1_5'UTR	NM_016287.3	NP_057371.2	Q5SSJ5	HP1B3_HUMAN	heterochromatin protein 1, binding protein 3	24					nucleosome assembly (GO:0006334)	nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(2)|skin(2)|urinary_tract(1)	16		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		GCGTGGATCAGCTGAGCTCCT	0.502																																																	0								ENSG00000127483						130.0	103.0	112.0					1																	21106864		2203	4300	6503	HP1BP3	SO:0001819	synonymous_variant	0			-	HGNC	BC053327	CCDS30621.1	1p36.12	2008-02-05			ENSG00000127483	ENSG00000127483			24973	protein-coding gene	gene with protein product						12477932	Standard	NM_016287		Approved	HP1-BP74	uc001bdw.1	Q5SSJ5	OTTHUMG00000002622	ENST00000312239.5:c.70C>T	1.37:g.21106864G>A		Somatic	0	110	0.00		0.4911483017230278	46	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A6NI71|A8K5D7|B3KMZ8|B4E210|Q05BI0|Q5SSJ6|Q5SWC6|Q6PIM9|Q8NDF0|Q9UHY0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15	p.L24	ENST00000312239.5	37	c.70	CCDS30621.1	1																																																																																			-	NULL		0.502	HP1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HP1BP3	protein_coding	OTTHUMT00000007457.2	G	NM_016287	-		21106864	-1	no_errors	ENST00000312239	ensembl	human	known	74_37	silent	SNP	1.000	A
CPT2	1376	genome.wustl.edu	37	1	53668131	53668131	+	Intron	SNP	C	C	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr1:53668131C>A	ENST00000371486.3	+	3	855				CPT2_ENST00000468572.1_3'UTR	NM_000098.2	NP_000089.1	P23786	CPT2_HUMAN	carnitine palmitoyltransferase 2						carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	15					L-Carnitine(DB00583)|Perhexiline(DB01074)	GGTATGATTTCTCCCAGAGCC	0.438																																																	0								ENSG00000157184						66.0	64.0	65.0					1																	53668131		2203	4300	6503	CPT2	SO:0001627	intron_variant	0			-	HGNC	BC002445	CCDS575.1	1p32.3	2014-01-09	2009-03-04		ENSG00000157184	ENSG00000157184	2.3.1.21		2330	protein-coding gene	gene with protein product		600650	"""carnitine palmitoyltransferase II"""	CPT1		1339389	Standard	NM_000098		Approved	CPTASE	uc001cvb.4	P23786	OTTHUMG00000008942	ENST00000371486.3:c.340+30C>A	1.37:g.53668131C>A		Somatic	0	75	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	20	25.93	B2R6S0|Q5SW68|Q9BQ26	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371486.3	37	NULL	CCDS575.1	1																																																																																			-	-		0.438	CPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPT2	protein_coding	OTTHUMT00000024757.1	C	NM_000098	-		53668131	+1	no_errors	ENST00000468572	ensembl	human	known	74_37	rna	SNP	0.000	A
SEC24A	10802	genome.wustl.edu	37	5	134050773	134050773	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr5:134050773A>T	ENST00000398844.2	+	19	3075	c.2787A>T	c.(2785-2787)caA>caT	p.Q929H	RNU6-757P_ENST00000410334.1_RNA	NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A	929					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTATGTGTCAAGTGAAAAACC	0.393																																																	0								ENSG00000113615						159.0	144.0	149.0					5																	134050773		1872	4110	5982	SEC24A	SO:0001583	missense	0			-	HGNC	AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.2787A>T	5.37:g.134050773A>T	ENSP00000381823:p.Gln929His	Somatic	0	77	0.00		0.4911483017230278	47	30.43	21	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	38	43.28	A8MVW3|Q8WUV2|Q96GP7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom	p.Q929H	ENST00000398844.2	37	c.2787	CCDS43363.1	5	.	.	.	.	.	.	.	.	.	.	A	20.5	3.995446	0.74703	.	.	ENSG00000113615	ENST00000398844	D	0.89746	-2.56	5.93	5.93	0.95920	Sec23/Sec24, helical domain (2);	0.000000	0.85682	D	0.000000	D	0.93858	0.8035	M	0.86651	2.83	0.80722	D	1	D;D	0.76494	0.995;0.999	P;D	0.68192	0.817;0.956	D	0.92476	0.5989	10	0.18710	T	0.47	-12.4558	12.1777	0.54194	0.932:0.0:0.068:0.0	.	693;929	B4E205;O95486	.;SC24A_HUMAN	H	929	ENSP00000381823:Q929H	ENSP00000381823:Q929H	Q	+	3	2	SEC24A	134078672	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.756000	0.47549	2.270000	0.75569	0.460000	0.39030	CAA	-	pfam_Sec23/24_helical_dom,superfamily_Sec23/24_helical_dom		0.393	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24A	protein_coding	OTTHUMT00000371563.1	A		-		134050773	+1	no_errors	ENST00000398844	ensembl	human	known	74_37	missense	SNP	1.000	T
NPC1L1	29881	genome.wustl.edu	37	7	44578865	44578865	+	Silent	SNP	C	C	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr7:44578865C>T	ENST00000289547.4	-	2	1186	c.1131G>A	c.(1129-1131)acG>acA	p.T377T	NPC1L1_ENST00000381160.3_Silent_p.T377T|NPC1L1_ENST00000423141.1_Silent_p.T377T|NPC1L1_ENST00000546276.1_Silent_p.T377T	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	377					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	CCACGGGGTCCGTAGTGAGTT	0.612																																																	0								ENSG00000015520						72.0	81.0	78.0					7																	44578865		2203	4300	6503	NPC1L1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.1131G>A	7.37:g.44578865C>T		Somatic	0	55	0.00		0.4911483017230278	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Patched,pfscan_SSD	p.T377	ENST00000289547.4	37	c.1131	CCDS5491.1	7																																																																																			-	NULL		0.612	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	NPC1L1	protein_coding	OTTHUMT00000251256.1	C	NM_013389	-		44578865	-1	no_errors	ENST00000289547	ensembl	human	known	74_37	silent	SNP	0.015	T
ENPP1	5167	genome.wustl.edu	37	6	132185704	132185704	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr6:132185704G>A	ENST00000360971.2	+	10	1104	c.1084G>A	c.(1084-1086)Gat>Aat	p.D362N		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	362	Phosphodiesterase.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	GCTTCCTAAAGATGAAAGGTC	0.299																																					Colon(104;336 1535 5856 11019 33782)												0								ENSG00000197594						78.0	75.0	76.0					6																	132185704		2203	4296	6499	ENPP1	SO:0001583	missense	0			-	HGNC	M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.1084G>A	6.37:g.132185704G>A	ENSP00000354238:p.Asp362Asn	Somatic	0	19	0.00		0.4911483017230278	11	8.33	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53	Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.D362N	ENST00000360971.2	37	c.1084	CCDS5150.2	6	.	.	.	.	.	.	.	.	.	.	G	12.05	1.822964	0.32237	.	.	ENSG00000197594	ENST00000360971	T	0.74106	-0.81	5.98	2.22	0.28083	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.464926	0.24965	N	0.034192	T	0.30386	0.0763	N	0.25890	0.77	0.33269	D	0.560749	B	0.19583	0.037	B	0.21546	0.035	T	0.04607	-1.0939	10	0.08179	T	0.78	-7.6094	4.1728	0.10337	0.127:0.2328:0.5199:0.1204	.	362	P22413	ENPP1_HUMAN	N	362	ENSP00000354238:D362N	ENSP00000354238:D362N	D	+	1	0	ENPP1	132227397	0.058000	0.20735	0.658000	0.29665	0.747000	0.42532	0.604000	0.24164	0.124000	0.18369	0.650000	0.86243	GAT	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core		0.299	ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP1	protein_coding	OTTHUMT00000042238.2	G		-		132185704	+1	no_errors	ENST00000360971	ensembl	human	known	74_37	missense	SNP	0.907	A
HINFP	25988	genome.wustl.edu	37	11	119004898	119004898	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr11:119004898T>C	ENST00000350777.2	+	10	1307	c.1244T>C	c.(1243-1245)cTg>cCg	p.L415P	HINFP_ENST00000527410.1_3'UTR	NM_001243259.1|NM_015517.4|NM_198971.2	NP_001230188.1|NP_056332.2|NP_945322.1	Q9BQA5	HINFP_HUMAN	histone H4 transcription factor	415	Interaction with NPAT.				DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|establishment of protein localization (GO:0045184)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|myoblast differentiation (GO:0045445)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						GGATCGGGCCTGGGAACGTCG	0.567											OREG0021397	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000172273						62.0	63.0	63.0					11																	119004898		2200	4295	6495	HINFP	SO:0001583	missense	0			-	HGNC	AL080201	CCDS8414.1, CCDS58188.1	11q23.3	2013-01-08	2009-01-22	2009-01-22	ENSG00000172273	ENSG00000172273		"""Zinc fingers, C2H2-type"""	17850	protein-coding gene	gene with protein product	"""histone nuclear factor P"""	607099	"""MBD2-interacting zinc finger 1"", ""MBD2-interacting zinc finger"""	MIZF		11553631	Standard	NM_015517		Approved	DKFZP434F162, HiNF-P, ZNF743	uc001pvq.3	Q9BQA5	OTTHUMG00000166168	ENST00000350777.2:c.1244T>C	11.37:g.119004898T>C	ENSP00000318085:p.Leu415Pro	Somatic	0	56	0.00	1492	0.4911483017230278	44	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	B3KPH6|B4DWB4|E9PQF4|Q96E65|Q9Y4M7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L415P	ENST00000350777.2	37	c.1244	CCDS8414.1	11	.	.	.	.	.	.	.	.	.	.	T	8.652	0.898551	0.17686	.	.	ENSG00000172273	ENST00000350777	T	0.08720	3.06	5.31	1.72	0.24424	.	0.364292	0.20332	N	0.094416	T	0.02727	0.0082	N	0.02916	-0.46	0.09310	N	0.999993	B	0.02656	0.0	B	0.01281	0.0	T	0.41680	-0.9495	10	0.28530	T	0.3	-2.8576	3.2646	0.06860	0.2272:0.3059:0.0:0.4669	.	415	Q9BQA5	HINFP_HUMAN	P	415	ENSP00000318085:L415P	ENSP00000318085:L415P	L	+	2	0	HINFP	118510108	0.997000	0.39634	0.694000	0.30210	0.446000	0.32137	1.007000	0.29860	0.489000	0.27749	0.533000	0.62120	CTG	-	NULL		0.567	HINFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HINFP	protein_coding	OTTHUMT00000388201.2	T	NM_015517	-		119004898	+1	no_errors	ENST00000350777	ensembl	human	known	74_37	missense	SNP	0.130	C
BRDT	676	genome.wustl.edu	37	1	92470012	92470012	+	Silent	SNP	C	C	G			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr1:92470012C>G	ENST00000362005.3	+	18	2848	c.2430C>G	c.(2428-2430)ggC>ggG	p.G810G	BRDT_ENST00000394530.3_Silent_p.G764G|BRDT_ENST00000399546.2_Silent_p.G810G|BRDT_ENST00000402388.1_Silent_p.G810G|BRDT_ENST00000370389.2_Silent_p.G737G	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	810					cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		AAAGTTTAGGCAAACCAGTGA	0.358																																																	0								ENSG00000137948						81.0	88.0	86.0					1																	92470012		2202	4300	6502	BRDT	SO:0001819	synonymous_variant	0			-	HGNC	AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.2430C>G	1.37:g.92470012C>G		Somatic	0	65	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.G810	ENST00000362005.3	37	c.2430	CCDS735.1	1																																																																																			-	NULL		0.358	BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRDT	protein_coding	OTTHUMT00000027980.2	C	NM_207189	-		92470012	+1	no_errors	ENST00000362005	ensembl	human	known	74_37	silent	SNP	1.000	G
SURF2	6835	genome.wustl.edu	37	9	136226880	136226882	+	In_Frame_Del	DEL	GGA	GGA	-	rs149969130		TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	GGA	GGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr9:136226880_136226882delGGA	ENST00000371964.4	+	4	433_435	c.392_394delGGA	c.(391-396)cggagg>cgg	p.131_132RR>R	SURF2_ENST00000495524.1_3'UTR	NM_017503.3	NP_059973.4	Q15527	SURF2_HUMAN	surfeit 2	131						nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(4)	6				OV - Ovarian serous cystadenocarcinoma(145;4.87e-07)|Epithelial(140;4.02e-06)|all cancers(34;3.71e-05)		CTGGTGCACCGGAGGAGGAGGAG	0.635																																																	0								ENSG00000148291																																			SURF2	SO:0001651	inframe_deletion	0				HGNC		CCDS6967.1	9q33-q34	2008-07-21			ENSG00000148291	ENSG00000148291			11475	protein-coding gene	gene with protein product	"""surfeit locus protein 2"""	185630					Standard	NM_017503		Approved		uc004cdi.2	Q15527	OTTHUMG00000020867	ENST00000371964.4:c.392_394delGGA	9.37:g.136226889_136226891delGGA	ENSP00000361032:p.Arg135del	Somatic	0	48	0.00		0.4911483017230278	143	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	28	9.68	Q6IBP9|Q96CD1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Surf2	p.R135in_frame_del	ENST00000371964.4	37	c.392_394	CCDS6967.1	9																																																																																			-	pfam_Surf2		0.635	SURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SURF2	protein_coding	OTTHUMT00000054883.1	GGA	NM_017503			136226882	+1	no_errors	ENST00000371964	ensembl	human	known	74_37	in_frame_del	DEL	0.001:0.001:0.000	-
MT1L	4500	genome.wustl.edu	37	16	56652634	56652634	+	RNA	SNP	G	G	A	rs553003977		TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr16:56652634G>A	ENST00000565768.1	+	0	315					NR_001447.2		Q93083	MT1L_HUMAN	metallothionein 1L (gene/pseudogene)						cellular response to zinc ion (GO:0071294)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)										AGAGCAACCTGCACAAACCTG	0.463																																																	0								ENSG00000260549																																			MT1L			0			-	HGNC	X97261		16q13	2012-04-20	2007-03-02		ENSG00000260549	ENSG00000260549		"""Metallothioneins"""	7404	protein-coding gene	gene with protein product		156358		MT1		16395595, 8049263, 9074634	Standard	NR_001447		Approved	MTF, MT1R	uc002ejj.4	Q93083	OTTHUMG00000176212		16.37:g.56652634G>A		Somatic	0	50	0.00		0.4911483017230278	144	0.68	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000565768.1	37	NULL		16																																																																																			-	-		0.463	MT1L-002	KNOWN	basic	processed_transcript	MT1L	pseudogene	OTTHUMT00000434383.1	G		-		56652634	+1	no_errors	ENST00000565768	ensembl	human	known	74_37	rna	SNP	0.001	A
SCN7A	6332	genome.wustl.edu	37	2	167263047	167263047	+	Silent	SNP	C	C	T	rs370436682		TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr2:167263047C>T	ENST00000409855.1	-	25	4218	c.4092G>A	c.(4090-4092)aaG>aaA	p.K1364K		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1364					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TATGAAACACCTTTGGTCCTT	0.443																																																	0								ENSG00000136546	C		0,3950		0,0,1975	112.0	106.0	108.0		4092	4.4	1.0	2		108	2,8314		0,2,4156	no	coding-synonymous	SCN7A	NM_002976.3		0,2,6131	TT,TC,CC		0.0241,0.0,0.0163		1364/1683	167263047	2,12264	1975	4158	6133	SCN7A	SO:0001819	synonymous_variant	0			-	HGNC	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.4092G>A	2.37:g.167263047C>T		Somatic	0	70	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	25	40.48		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.K1364	ENST00000409855.1	37	c.4092	CCDS46442.1	2																																																																																			-	pfam_Ion_trans_dom		0.443	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	protein_coding	OTTHUMT00000333745.1	C		-		167263047	-1	no_errors	ENST00000409855	ensembl	human	known	74_37	silent	SNP	1.000	T
GVINP1	387751	genome.wustl.edu	37	11	6739019	6739019	+	RNA	SNP	T	T	C			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr11:6739019T>C	ENST00000526769.3	-	0	4185					NR_003945.1		Q7Z2Y8	GVIN1_HUMAN	GTPase, very large interferon inducible pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										TCTCATGCAGTTCTTCCAAGT	0.418																																																	0								ENSG00000254838																																			GVINP1			0			-	HGNC	BX538318		11p15.4	2014-03-18	2010-09-28	2010-09-28	ENSG00000254838	ENSG00000254838			25813	pseudogene	pseudogene	"""very large inducible GTPase 1"""		"""GTPase, very large interferon inducible 1"", ""GTPase, very large interferon inducible 1, pseudogene"""	GVIN1, GVIN1P		12874213, 19369598	Standard	NR_003945		Approved	VLIG-1, FLJ13373, VLIG1	uc001meo.4	Q7Z2Y8	OTTHUMG00000165506		11.37:g.6739019T>C		Somatic	0	21	0.00		0.4911483017230278	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27	A6NFL2|Q9H8N5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000526769.3	37	NULL		11																																																																																			-	-		0.418	GVINP1-002	KNOWN	basic|exp_conf	processed_transcript	GVINP1	pseudogene	OTTHUMT00000386960.3	T	NR_003945	-		6739019	-1	no_errors	ENST00000526769	ensembl	human	known	74_37	rna	SNP	0.013	C
MYL6	4637	genome.wustl.edu	37	12	56553456	56553456	+	Silent	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr12:56553456G>T	ENST00000550697.1	+	3	358	c.117G>T	c.(115-117)ctG>ctT	p.L39L	MYL6_ENST00000549566.1_Intron|MYL6_ENST00000548400.1_Intron|RP11-977G19.5_ENST00000553176.1_RNA|MYL6_ENST00000549017.1_Intron|MYL6_ENST00000551589.1_Silent_p.L39L|MYL6_ENST00000548580.1_Intron|MYL6_ENST00000547408.1_Silent_p.L39L|MYL6_ENST00000547649.1_Silent_p.L39L|MYL6_ENST00000293422.5_Silent_p.L40L|RP11-603J24.14_ENST00000548731.1_RNA|MYL6_ENST00000536128.1_Silent_p.L132L|MYL6_ENST00000548293.1_Silent_p.L39L|MYL6_ENST00000348108.4_Silent_p.L40L	NM_021019.4	NP_066299.2	P60660	MYL6_HUMAN	myosin, light chain 6, alkali, smooth muscle and non-muscle	39	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle tissue development (GO:0007519)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|myosin complex (GO:0016459)|unconventional myosin complex (GO:0016461)|vesicle (GO:0031982)	actin-dependent ATPase activity (GO:0030898)|calcium ion binding (GO:0005509)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			large_intestine(1)|lung(1)|ovary(1)|prostate(3)|skin(1)	7			OV - Ovarian serous cystadenocarcinoma(18;0.0979)			TGAGGGCCCTGGGCCAGAACC	0.572																																																	0								ENSG00000092841						117.0	108.0	111.0					12																	56553456		2203	4300	6503	MYL6	SO:0001819	synonymous_variant	0			-	HGNC	AB046613	CCDS8906.1, CCDS31834.1	12q13.13	2013-01-10	2006-09-29			ENSG00000092841		"""Myosins / Light chain"", ""EF-hand domain containing"""	7587	protein-coding gene	gene with protein product		609931	"""myosin, light polypeptide 6, alkali, smooth muscle and non-muscle"""			8188229, 2304459, 2722814	Standard	NM_021019		Approved	ESMLC, MLC3NM, MLC1SM	uc001sjx.2	P60660		ENST00000550697.1:c.117G>T	12.37:g.56553456G>T		Somatic	0	131	0.00		0.4911483017230278	21242	0.11	24	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.00	P16475|P24572|P24573|Q12790|Q561V9|Q6IAZ0|Q6IPY5	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_EF_hand_dom,pfscan_EF_hand_dom	p.L39	ENST00000550697.1	37	c.117	CCDS8906.1	12																																																																																			-	smart_EF_hand_dom,pfscan_EF_hand_dom		0.572	MYL6-003	KNOWN	NAGNAG_splice_site|basic|CCDS	protein_coding	MYL6	protein_coding	OTTHUMT00000407928.3	G		-		56553456	+1	no_errors	ENST00000547649	ensembl	human	known	74_37	silent	SNP	1.000	T
GRIK3	2899	genome.wustl.edu	37	1	37267481	37267481	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr1:37267481T>G	ENST00000373091.3	-	16	2747	c.2731A>C	c.(2731-2733)Agc>Cgc	p.S911R		NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	911					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				AAGGATGTGCTGCAGGCCATG	0.602																																																	0								ENSG00000163873						93.0	75.0	81.0					1																	37267481		2203	4300	6503	GRIK3	SO:0001583	missense	0			-	HGNC	U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2731A>C	1.37:g.37267481T>G	ENSP00000362183:p.Ser911Arg	Somatic	0	30	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.S911R	ENST00000373091.3	37	c.2731	CCDS416.1	1	.	.	.	.	.	.	.	.	.	.	T	16.51	3.143042	0.57044	.	.	ENSG00000163873	ENST00000373091	T	0.12039	2.72	5.86	4.73	0.59995	.	0.115971	0.56097	D	0.000024	T	0.09247	0.0228	N	0.14661	0.345	0.80722	D	1	B	0.19583	0.037	B	0.18263	0.021	T	0.10917	-1.0609	10	0.59425	D	0.04	.	11.604	0.51020	0.0:0.0692:0.0:0.9308	.	911	Q13003	GRIK3_HUMAN	R	911	ENSP00000362183:S911R	ENSP00000362183:S911R	S	-	1	0	GRIK3	37040068	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.615000	0.83006	1.050000	0.40346	0.523000	0.50628	AGC	-	NULL		0.602	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	protein_coding	OTTHUMT00000012053.1	T	NM_000831	-		37267481	-1	no_errors	ENST00000373091	ensembl	human	known	74_37	missense	SNP	1.000	G
CR381670.1	0	genome.wustl.edu	37	21	9683195	9683195	+	RNA	SNP	G	G	A	rs372098410		TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr21:9683195G>A	ENST00000459169.1	+	0	5																											ttagaccctcgcagcagtgtt	0.468																																																	0								ENSG00000238411																																			CR381670.1			0			-	Clone_based_ensembl_gene																													21.37:g.9683195G>A		Somatic	0	14	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	11	35.29		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000459169.1	37	NULL		21																																																																																			-	-		0.468	CR381670.1-201	NOVEL	basic	miRNA	ENSG00000238411	miRNA		G		-		9683195	+1	no_errors	ENST00000459169	ensembl	human	novel	74_37	rna	SNP	0.002	A
KLHL36	79786	genome.wustl.edu	37	16	84695592	84695592	+	Silent	SNP	C	C	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr16:84695592C>T	ENST00000564996.1	+	5	1845	c.1704C>T	c.(1702-1704)taC>taT	p.Y568Y	KLHL36_ENST00000258157.5_Silent_p.Y505Y	NM_024731.2	NP_079007.2	Q8N4N3	KLH36_HUMAN	kelch-like family member 36	568					protein ubiquitination (GO:0016567)					endometrium(3)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						TGCAGGTGTACGACCGCGAGG	0.677																																																	0								ENSG00000135686						20.0	22.0	21.0					16																	84695592		2197	4296	6493	KLHL36	SO:0001819	synonymous_variant	0			-	HGNC	AK022605	CCDS10948.1	16q24.1	2013-02-22	2013-02-22	2008-07-07	ENSG00000135686	ENSG00000135686		"""Kelch-like"", ""BTB/POZ domain containing"""	17844	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 44"", ""kelch-like 36 (Drosophila)"""	C16orf44			Standard	NM_024731		Approved	FLJ12543	uc002fig.3	Q8N4N3	OTTHUMG00000137642	ENST00000564996.1:c.1704C>T	16.37:g.84695592C>T		Somatic	0	85	0.00		0.4911483017230278	70	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q8N5G6|Q9H9U6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.Y568	ENST00000564996.1	37	c.1704	CCDS10948.1	16																																																																																			-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin		0.677	KLHL36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL36	protein_coding	OTTHUMT00000269084.2	C		-		84695592	+1	no_errors	ENST00000564996	ensembl	human	known	74_37	silent	SNP	0.995	T
CCDC13	152206	genome.wustl.edu	37	3	42793507	42793507	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr3:42793507G>A	ENST00000310232.6	-	5	607	c.524C>T	c.(523-525)gCc>gTc	p.A175V	CCDC13_ENST00000435327.2_5'UTR	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	175										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						CCTGGTCAGGGCTGTCTGCAG	0.557																																																	0								ENSG00000244607						63.0	60.0	61.0					3																	42793507		2203	4300	6503	CCDC13	SO:0001583	missense	0			-	HGNC	AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.524C>T	3.37:g.42793507G>A	ENSP00000309836:p.Ala175Val	Somatic	0	31	0.00		0.4911483017230278	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	18.75		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin	p.A175V	ENST00000310232.6	37	c.524	CCDS2705.1	3	.	.	.	.	.	.	.	.	.	.	G	14.80	2.643291	0.47153	.	.	ENSG00000244607	ENST00000310232	T	0.25250	1.81	4.01	4.01	0.46588	.	0.431263	0.25997	N	0.026980	T	0.46541	0.1398	M	0.79475	2.455	0.09310	N	1	D;D;D	0.89917	0.999;0.996;1.0	D;D;D	0.87578	0.996;0.99;0.998	T	0.35871	-0.9771	10	0.14656	T	0.56	.	11.938	0.52884	0.0:0.0:1.0:0.0	.	175;175;175	B4DZD2;Q96LI1;Q8IYE1	.;.;CCD13_HUMAN	V	175	ENSP00000309836:A175V	ENSP00000309836:A175V	A	-	2	0	CCDC13	42768511	0.661000	0.27430	0.013000	0.15412	0.326000	0.28443	3.148000	0.50647	2.508000	0.84585	0.655000	0.94253	GCC	-	NULL		0.557	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC13	protein_coding	OTTHUMT00000256652.1	G	NM_144719	-		42793507	-1	no_errors	ENST00000310232	ensembl	human	known	74_37	missense	SNP	0.013	A
ABHD11	83451	genome.wustl.edu	37	7	73150897	73150897	+	Silent	SNP	G	G	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr7:73150897G>A	ENST00000222800.3	-	6	1009	c.940C>T	c.(940-942)Ctg>Ttg	p.L314L	ABHD11_ENST00000458339.1_3'UTR|ABHD11_ENST00000468998.1_5'Flank|ABHD11_ENST00000395147.4_Silent_p.L257L|ABHD11_ENST00000437775.2_Silent_p.L307L|LINC00035_ENST00000427153.1_RNA	NM_148912.2	NP_683710.1	Q8NFV4	ABHDB_HUMAN	abhydrolase domain containing 11	314						mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Lung NSC(55;0.0908)|all_lung(88;0.198)				TCTTAGACCAGGAAGCCTCGG	0.617																																																	0								ENSG00000106077						90.0	87.0	88.0					7																	73150897		2203	4300	6503	ABHD11	SO:0001819	synonymous_variant	0			-	HGNC	AF217971	CCDS5558.1, CCDS47607.1, CCDS47608.1, CCDS75615.1	7q11.23	2010-08-05	2005-01-24	2005-01-27	ENSG00000106077	ENSG00000106077		"""Abhydrolase domain containing"""	16407	protein-coding gene	gene with protein product			"""Williams Beuren syndrome chromosome region 21"""	WBSCR21		12073013	Standard	NR_026910		Approved	PP1226	uc003tzb.3	Q8NFV4	OTTHUMG00000130029	ENST00000222800.3:c.940C>T	7.37:g.73150897G>A		Somatic	0	54	0.00		0.4911483017230278	81	1.22	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	H7BYM8|Q6PJU0|Q8N722|Q8N723|Q8NFV2|Q8NFV3|Q9HBS8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_AB_hydrolase_1,pfam_PGAP1-like,pfam_Thioesterase,pfam_Esterase_put,prints_AB_hydrolase_1	p.L314	ENST00000222800.3	37	c.940	CCDS5558.1	7																																																																																			-	NULL		0.617	ABHD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD11	protein_coding	OTTHUMT00000252306.1	G		-		73150897	-1	no_errors	ENST00000222800	ensembl	human	known	74_37	silent	SNP	1.000	A
PLCB2	5330	genome.wustl.edu	37	15	40590121	40590121	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr15:40590121A>G	ENST00000260402.3	-	12	1444	c.1195T>C	c.(1195-1197)Tcc>Ccc	p.S399P	PLCB2_ENST00000557821.1_Missense_Mutation_p.S399P|PLCB2-AS1_ENST00000559520.1_RNA|PLCB2_ENST00000456256.2_Missense_Mutation_p.S399P	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	399	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		GGATAGGGGGAGGTCTTAAAG	0.542																																																	0								ENSG00000137841						100.0	120.0	113.0					15																	40590121		2145	4253	6398	PLCB2	SO:0001583	missense	0			-	HGNC		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.1195T>C	15.37:g.40590121A>G	ENSP00000260402:p.Ser399Pro	Somatic	0	81	0.00		0.4911483017230278	18	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	49	9.26	A8K6J2|B9EGH5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLC-beta_C,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,prints_Pinositol_PLipase_C,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.S399P	ENST00000260402.3	37	c.1195	CCDS42020.1	15	.	.	.	.	.	.	.	.	.	.	A	25.5	4.647898	0.87958	.	.	ENSG00000137841	ENST00000260402;ENST00000456256	T;T	0.60920	0.15;0.15	4.87	4.87	0.63330	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.000000	0.85682	D	0.000000	D	0.84552	0.5497	H	0.97983	4.12	0.80722	D	1	D;D;D	0.89917	1.0;0.996;1.0	D;D;D	0.97110	1.0;0.927;0.999	D	0.90389	0.4394	10	0.87932	D	0	.	14.935	0.70948	1.0:0.0:0.0:0.0	.	399;399;399	B9EGH5;Q00722-2;Q00722	.;.;PLCB2_HUMAN	P	399	ENSP00000260402:S399P;ENSP00000411991:S399P	ENSP00000260402:S399P	S	-	1	0	PLCB2	38377413	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	9.109000	0.94291	2.181000	0.69327	0.460000	0.39030	TCC	-	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom		0.542	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCB2	protein_coding	OTTHUMT00000418430.1	A		-		40590121	-1	no_errors	ENST00000260402	ensembl	human	known	74_37	missense	SNP	1.000	G
IL37	27178	genome.wustl.edu	37	2	113676368	113676368	+	Silent	SNP	C	C	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr2:113676368C>A	ENST00000263326.3	+	5	681	c.639C>A	c.(637-639)ccC>ccA	p.P213P	IL37_ENST00000352179.3_Silent_p.P192P|IL37_ENST00000353225.3_Silent_p.P173P|IL37_ENST00000311328.2_Silent_p.P187P|IL37_ENST00000349806.3_Silent_p.P152P	NM_014439.3	NP_055254.2	Q9NZH6	IL37_HUMAN	interleukin 37	213					immune response (GO:0006955)|inflammatory response (GO:0006954)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)	interleukin-1 receptor binding (GO:0005149)			NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(7)|ovary(2)|skin(3)	19						AAATGAGCCCCAGTGAGGTCA	0.413																																																	0								ENSG00000125571						63.0	67.0	66.0					2																	113676368		2203	4300	6503	IL37	SO:0001819	synonymous_variant	0			-	HGNC	AF201832	CCDS2103.1, CCDS2104.1, CCDS2105.1, CCDS2106.1, CCDS2107.1	2q12-q14.1	2011-06-06	2011-06-06	2011-06-06	ENSG00000125571	ENSG00000125571		"""Interleukins and interleukin receptors"""	15563	protein-coding gene	gene with protein product	"""interleukin 1, zeta"", ""interleukin-1 homolog 4"", ""interleukin-1-related protein"""	605510	"""interleukin 1 family, member 7 (zeta)"""	IL1F7		10625660, 10512743, 12496389	Standard	NM_014439		Approved	FIL1, FIL1Z, FIL1(ZETA), IL-1H4, IL-1RP1, IL-1F7	uc002tij.3	Q9NZH6	OTTHUMG00000131345	ENST00000263326.3:c.639C>A	2.37:g.113676368C>A		Somatic	0	25	0.00		0.4911483017230278	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	13	40.91	B5BU97|Q56AP9|Q8TD04|Q8TD05|Q9HBF2|Q9HBF3|Q9UHA6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IL-1,superfamily_Cytokine_IL1-like,smart_IL-1,prints_IL-1,prints_IL-1RA/IL-36	p.P213	ENST00000263326.3	37	c.639	CCDS2103.1	2																																																																																			-	NULL		0.413	IL37-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL37	protein_coding	OTTHUMT00000254126.1	C	NM_014439	-		113676368	+1	no_errors	ENST00000263326	ensembl	human	known	74_37	silent	SNP	0.000	A
MDC1	9656	genome.wustl.edu	37	6	30679822	30679822	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr6:30679822G>T	ENST00000376406.3	-	5	2544	c.1897C>A	c.(1897-1899)Caa>Aaa	p.Q633K	MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000494654.1_5'Flank|MDC1_ENST00000376405.2_Missense_Mutation_p.Q633K	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	633					DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						TGCTCCACTTGTGCCACAGGT	0.602								Other conserved DNA damage response genes																																									0								ENSG00000137337						68.0	59.0	62.0					6																	30679822		1510	2709	4219	MDC1	SO:0001583	missense	0			-	HGNC	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.1897C>A	6.37:g.30679822G>T	ENSP00000365588:p.Gln633Lys	Somatic	0	47	0.00		0.4911483017230278	32	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FHA_dom,superfamily_BRCT_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_BRCT_dom,pfscan_FHA_dom	p.Q633K	ENST00000376406.3	37	c.1897	CCDS34384.1	6	.	.	.	.	.	.	.	.	.	.	G	0.421	-0.908350	0.02434	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	T;T	0.02369	4.4;4.32	4.57	2.69	0.31865	.	0.490323	0.15224	N	0.273784	T	0.00936	0.0031	L	0.44542	1.39	0.09310	N	1	B;B;P;B	0.38535	0.325;0.194;0.635;0.047	B;B;B;B	0.29077	0.074;0.074;0.098;0.037	T	0.50118	-0.8865	10	0.42905	T	0.14	-0.4669	6.8483	0.24000	0.0:0.1937:0.606:0.2003	.	633;505;633;633	Q14676-2;B4DYH4;Q14676;Q14676-4	.;.;MDC1_HUMAN;.	K	633;633;633;505	ENSP00000365588:Q633K;ENSP00000365587:Q633K	ENSP00000365587:Q633K	Q	-	1	0	MDC1	30787801	0.001000	0.12720	0.052000	0.19188	0.916000	0.54674	0.669000	0.25142	2.378000	0.81104	0.462000	0.41574	CAA	-	NULL		0.602	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDC1	protein_coding	OTTHUMT00000076103.1	G	NM_014641	-		30679822	-1	no_errors	ENST00000376406	ensembl	human	known	74_37	missense	SNP	0.019	T
C19orf66	55337	genome.wustl.edu	37	19	10200774	10200774	+	Intron	SNP	T	T	C			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr19:10200774T>C	ENST00000253110.11	+	5	682				C19orf66_ENST00000397881.3_Intron|C19orf66_ENST00000591813.1_Intron|CTD-2240E14.4_ENST00000589622.1_RNA	NM_018381.2	NP_060851.2	Q9NUL5	CS066_HUMAN	chromosome 19 open reading frame 66											large_intestine(3)|skin(1)	4						ACTCCACTCCTGACTCCTATC	0.542																																																	0								ENSG00000267387						26.0	33.0	31.0					19																	10200774		1238	2233	3471	CTD-2240E14.4	SO:0001627	intron_variant	0			-	Clone_based_vega_gene		CCDS45957.1	19p13.2	2012-10-26			ENSG00000130813	ENSG00000130813			25649	protein-coding gene	gene with protein product						12477932	Standard	NM_018381		Approved	FLJ11286	uc002mmu.4	Q9NUL5		ENST00000253110.11:c.384+51T>C	19.37:g.10200774T>C		Somatic	0	30	0.00		0.4911483017230278	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	A8MQT9|Q4G188|Q8IYH6|Q8N8V1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000253110.11	37	NULL	CCDS45957.1	19																																																																																			-	-		0.542	C19orf66-001	KNOWN	basic|CCDS	protein_coding	ENSG00000267387	protein_coding	OTTHUMT00000451129.1	T	NM_018381	-		10200774	-1	no_errors	ENST00000589622	ensembl	human	known	74_37	rna	SNP	0.000	C
TET1	80312	genome.wustl.edu	37	10	70432803	70432803	+	Splice_Site	SNP	G	G	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr10:70432803G>A	ENST00000373644.4	+	8	5033		c.e8+1			NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1						chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						TCCCTTACATGTAAGTGTCCT	0.318																																																	0								ENSG00000138336						95.0	89.0	91.0					10																	70432803		2203	4300	6503	TET1	SO:0001630	splice_region_variant	0			-	HGNC	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.4824+1G>A	10.37:g.70432803G>A		Somatic	0	86	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	32	8.57	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e7+1	ENST00000373644.4	37	c.4824+1	CCDS7281.1	10	.	.	.	.	.	.	.	.	.	.	G	23.1	4.379149	0.82682	.	.	ENSG00000138336	ENST00000373644;ENST00000545846	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1935	0.98237	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TET1	70102809	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	6.451000	0.73481	2.779000	0.95612	0.591000	0.81541	.	-	-		0.318	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TET1	protein_coding	OTTHUMT00000048354.1	G	NM_030625	-	Intron	70432803	+1	no_errors	ENST00000373644	ensembl	human	known	74_37	splice_site	SNP	1.000	A
HSPG2	3339	genome.wustl.edu	37	1	22168130	22168130	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr1:22168130G>T	ENST00000374695.3	-	70	9309	c.9230C>A	c.(9229-9231)aCc>aAc	p.T3077N		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	3077	Ig-like C2-type 16.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GCCCACGATGGTGATGATGGA	0.602																																																	0								ENSG00000142798						123.0	101.0	108.0					1																	22168130		2203	4300	6503	HSPG2	SO:0001583	missense	0			-	HGNC	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.9230C>A	1.37:g.22168130G>T	ENSP00000363827:p.Thr3077Asn	Somatic	0	89	0.00		0.4911483017230278	339	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Laminin_G,pfam_Laminin_B_type_IV,pfam_EGF_laminin,pfam_LDrepeatLR_classA_rpt,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_SEA_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Laminin_B_subgr,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_LDrepeatLR_classA_rpt,pfscan_SEA_dom,pfscan_Ig-like_dom,prints_LDrepeatLR_classA_rpt	p.T3077N	ENST00000374695.3	37	c.9230	CCDS30625.1	1	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711079	0.68730	.	.	ENSG00000142798	ENST00000374695	T	0.69926	-0.44	5.22	3.34	0.38264	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.177776	0.27035	N	0.021247	T	0.76990	0.4065	M	0.73217	2.22	0.34550	D	0.711257	D;D	0.67145	0.996;0.994	D;D	0.74348	0.983;0.974	T	0.80113	-0.1518	10	0.38643	T	0.18	.	9.4259	0.38578	0.0794:0.145:0.7756:0.0	.	1017;3077	Q59EG0;P98160	.;PGBM_HUMAN	N	3077	ENSP00000363827:T3077N	ENSP00000363827:T3077N	T	-	2	0	HSPG2	22040717	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.175000	0.77632	0.587000	0.29643	-0.304000	0.09214	ACC	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.602	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	protein_coding	OTTHUMT00000007598.1	G	NM_005529	-		22168130	-1	no_errors	ENST00000374695	ensembl	human	known	74_37	missense	SNP	1.000	T
RNPC3	55599	genome.wustl.edu	37	1	104076466	104076467	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr1:104076466_104076467insA	ENST00000533099.1	+	4	582_583	c.346_347insA	c.(346-348)gaafs	p.E116fs	RNPC3_ENST00000524631.1_Frame_Shift_Ins_p.E116fs|RNPC3_ENST00000423855.2_Frame_Shift_Ins_p.E116fs			Q96LT9	RBM40_HUMAN	RNA-binding region (RNP1, RRM) containing 3	116	Necessary for interaction with PDCD7.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)		TTCAGGCTCTGAAAAAAAAAAA	0.322																																																	0								ENSG00000185946																																			RNPC3	SO:0001589	frameshift_variant	0				HGNC	AB058742, AY099329	CCDS781.1	1p21.1	2013-07-16			ENSG00000185946	ENSG00000185946		"""RNA binding motif (RRM) containing"""	18666	protein-coding gene	gene with protein product	"""U11/U12 snRNP 65K"""					14974681, 15146077	Standard	NM_017619		Approved	KIAA1839, FLJ20008, RBM40, SNRNP65	uc010oun.2	Q96LT9	OTTHUMG00000166613	ENST00000533099.1:c.358dupA	1.37:g.104076477_104076477dupA	ENSP00000432886:p.Glu116fs	Somatic	0	46	0.00		0.4911483017230278	20	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	31	16.22	A8K1C9|D3DT74|Q5TZ87|Q96FK7|Q96JI8|Q9NSU7|Q9NXX2	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K120fs	ENST00000533099.1	37	c.346_347	CCDS781.1	1																																																																																			-	NULL		0.322	RNPC3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNPC3	protein_coding	OTTHUMT00000390812.1	-	NM_017619			104076467	+1	no_errors	ENST00000423855	ensembl	human	known	74_37	frame_shift_ins	INS	0.748:0.784	A
CTDSPL2	51496	genome.wustl.edu	37	15	44811494	44811494	+	Splice_Site	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr15:44811494G>T	ENST00000260327.4	+	11	1802		c.e11+1		CTDSPL2_ENST00000558966.1_Splice_Site|CTD-2329K10.1_ENST00000561324.1_RNA|CTDSPL2_ENST00000396780.1_Splice_Site|CTDSPL2_ENST00000558373.1_Splice_Site	NM_016396.2	NP_057480.2	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2								phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	13		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		TGCATATCAGGTAGGAAGAAA	0.328																																																	0								ENSG00000137770						57.0	64.0	61.0					15																	44811494		2198	4296	6494	CTDSPL2	SO:0001630	splice_region_variant	0			-	HGNC	AF161478	CCDS10110.1	15q15.3-q21.1	2010-06-21			ENSG00000137770	ENSG00000137770		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	26936	protein-coding gene	gene with protein product							Standard	NM_016396		Approved	HSPC129, FLJ10523	uc001ztr.3	Q05D32	OTTHUMG00000131159	ENST00000260327.4:c.1239+1G>T	15.37:g.44811494G>T		Somatic	0	114	0.00		0.4911483017230278	0	87.50	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	46	34.29	Q3ZTU1|Q6AI06|Q8IYI9|Q9NVT2|Q9NZX8|Q9P030	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e10+1	ENST00000260327.4	37	c.1239+1	CCDS10110.1	15	.	.	.	.	.	.	.	.	.	.	G	21.0	4.088020	0.76642	.	.	ENSG00000137770	ENST00000260327;ENST00000396780	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9306	0.97117	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CTDSPL2	42598786	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.841000	0.99482	2.728000	0.93425	0.650000	0.86243	.	-	-		0.328	CTDSPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDSPL2	protein_coding	OTTHUMT00000253851.1	G	NM_016396	-	Intron	44811494	+1	no_errors	ENST00000260327	ensembl	human	known	74_37	splice_site	SNP	1.000	T
ZNF423	23090	genome.wustl.edu	37	16	49671660	49671660	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr16:49671660G>T	ENST00000561648.1	-	4	1456	c.1403C>A	c.(1402-1404)gCc>gAc	p.A468D	ZNF423_ENST00000262383.2_Missense_Mutation_p.A468D|ZNF423_ENST00000535559.1_Missense_Mutation_p.A351D|ZNF423_ENST00000563137.2_Missense_Mutation_p.A408D|ZNF423_ENST00000562871.1_Missense_Mutation_p.A408D|ZNF423_ENST00000567169.1_Missense_Mutation_p.A351D|ZNF423_ENST00000562520.1_Missense_Mutation_p.A408D	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	468					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				CACAGGGTAGGCATGGTTCTT	0.567																																																	0								ENSG00000102935						148.0	123.0	131.0					16																	49671660		2198	4300	6498	ZNF423	SO:0001583	missense	0			-	HGNC	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.1403C>A	16.37:g.49671660G>T	ENSP00000455426:p.Ala468Asp	Somatic	0	64	0.00		0.4911483017230278	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A468D	ENST00000561648.1	37	c.1403	CCDS32445.1	16	.	.	.	.	.	.	.	.	.	.	G	4.043	0.005694	0.07866	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.09538	2.97;3.05	5.05	5.05	0.67936	.	0.106857	0.64402	D	0.000006	T	0.08846	0.0219	N	0.24115	0.695	0.46654	D	0.999142	B	0.31680	0.335	B	0.28139	0.086	T	0.33085	-0.9882	9	.	.	.	.	18.4335	0.90634	0.0:0.0:1.0:0.0	.	468	Q2M1K9	ZN423_HUMAN	D	468;351	ENSP00000262383:A468D;ENSP00000442321:A351D	.	A	-	2	0	ZNF423	48229161	1.000000	0.71417	0.999000	0.59377	0.767000	0.43475	7.313000	0.78978	2.346000	0.79739	0.561000	0.74099	GCC	-	NULL		0.567	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF423	protein_coding	OTTHUMT00000423258.1	G	NM_015069	-		49671660	-1	no_errors	ENST00000262383	ensembl	human	known	74_37	missense	SNP	1.000	T
CD81	975	genome.wustl.edu	37	11	2417894	2417894	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr11:2417894G>C	ENST00000263645.5	+	7	854	c.598G>C	c.(598-600)Ggg>Cgg	p.G200R	CD81_ENST00000381036.3_Missense_Mutation_p.G238R|CD81_ENST00000526072.1_Missense_Mutation_p.G129R|CD81_ENST00000481687.1_Missense_Mutation_p.G206R|CD81_ENST00000492627.1_Missense_Mutation_p.G129R	NM_004356.3	NP_004347.1	P60033	CD81_HUMAN	CD81 molecule	200					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of 1-phosphatidylinositol 4-kinase activity (GO:0043128)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein localization (GO:0008104)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of immune response (GO:0050776)|viral entry into host cell (GO:0046718)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	MHC class II protein complex binding (GO:0023026)			endometrium(1)|lung(3)|skin(1)	5		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000338)|LUSC - Lung squamous cell carcinoma(625;0.191)		CCTCTTCTCCGGGAAGCTGTA	0.677																																																	0								ENSG00000110651						94.0	89.0	91.0					11																	2417894		2202	4298	6500	CD81	SO:0001583	missense	0			-	HGNC		CCDS7734.1, CCDS73240.1	11p15.5	2014-09-17	2006-03-28		ENSG00000110651	ENSG00000110651		"""CD molecules"", ""Tetraspanins"""	1701	protein-coding gene	gene with protein product		186845	"""CD81 antigen (target of antiproliferative antibody 1)"""	TAPA1		1650385	Standard	XM_005253260		Approved	TAPA-1, TSPAN28	uc001lwf.1	P60033	OTTHUMG00000009892	ENST00000263645.5:c.598G>C	11.37:g.2417894G>C	ENSP00000263645:p.Gly200Arg	Somatic	0	49	0.00		0.4911483017230278	1929	41.46	1369	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	26	29.73	P18582|Q5U0J6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.G200R	ENST00000263645.5	37	c.598	CCDS7734.1	11	.	.	.	.	.	.	.	.	.	.	G	14.90	2.672820	0.47781	.	.	ENSG00000110651	ENST00000263645;ENST00000492627;ENST00000527343;ENST00000381036;ENST00000492252;ENST00000526072;ENST00000481687	D;D;D;D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23;-2.23;-2.23;-2.23	3.39	3.39	0.38822	Tetraspanin, EC2 domain (1);CD81 extracellular domain (1);	0.779778	0.12008	N	0.508137	D	0.86192	0.5874	N	0.25647	0.755	0.18873	N	0.999986	D;D	0.71674	0.998;0.973	D;P	0.65684	0.937;0.687	T	0.74411	-0.3674	10	0.33940	T	0.23	.	6.7103	0.23274	0.1299:0.0:0.8701:0.0	.	238;200	A6NMH8;P60033	.;CD81_HUMAN	R	200;129;189;238;193;129;206	ENSP00000263645:G200R;ENSP00000437242:G129R;ENSP00000433767:G189R;ENSP00000370424:G238R;ENSP00000432249:G193R;ENSP00000431780:G129R;ENSP00000432033:G206R	ENSP00000263645:G200R	G	+	1	0	CD81	2374470	0.984000	0.35163	0.975000	0.42487	0.952000	0.60782	2.994000	0.49433	1.919000	0.55581	0.462000	0.41574	GGG	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2		0.677	CD81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD81	protein_coding	OTTHUMT00000027357.4	G	NM_004356	-		2417894	+1	no_errors	ENST00000263645	ensembl	human	known	74_37	missense	SNP	0.081	C
ZIC4	84107	genome.wustl.edu	37	3	147124340	147124340	+	5'UTR	SNP	A	A	C			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr3:147124340A>C	ENST00000383075.3	-	0	307				ZIC4_ENST00000484399.1_5'Flank|ZIC4_ENST00000425731.3_5'Flank|ZIC4_ENST00000525172.2_5'Flank|ZIC4_ENST00000473123.1_5'Flank|ZIC1_ENST00000282928.4_5'Flank|ZIC4_ENST00000491672.1_5'UTR	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4							nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						CGTCAGGATGATATTTTAATG	0.478																																																	0								ENSG00000174963																																			ZIC4	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.-206T>G	3.37:g.147124340A>C		Somatic	0	103	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	61	10.29	A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000383075.3	37	NULL	CCDS43160.1	3																																																																																			-	-		0.478	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	protein_coding	OTTHUMT00000355504.1	A		-		147124340	-1	no_errors	ENST00000464144	ensembl	human	putative	74_37	rna	SNP	1.000	C
TMEM260	54916	genome.wustl.edu	37	14	57099977	57099977	+	Intron	DEL	T	T	-	rs540850011|rs60675114	byFrequency	TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr14:57099977delT	ENST00000261556.6	+	13	1846				TMEM260_ENST00000536419.1_Intron|TMEM260_ENST00000538838.1_Intron|RP11-1085N6.2_ENST00000555924.1_RNA|RP11-1085N6.2_ENST00000553800.1_RNA	NM_017799.3	NP_060269.3	Q9NX78	TM260_HUMAN	transmembrane protein 260							integral component of membrane (GO:0016021)											TGCCTTCtaattttttttttt	0.299																																																	0								ENSG00000258428																																			RP11-1085N6.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	AK000399	CCDS9727.2	14q22.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000070269	ENSG00000070269			20185	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 101"""	C14orf101			Standard	XR_245695		Approved	FLJ20392	uc001xcm.3	Q9NX78	OTTHUMG00000152337	ENST00000261556.6:c.1724+88T>-	14.37:g.57099977delT		Somatic	0	20	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	17	19.05	A8KAN4|B3KPF5|Q86XE1	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000261556.6	37	NULL	CCDS9727.2	14																																																																																			-	-		0.299	TMEM260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000258428	protein_coding	OTTHUMT00000276924.1	T	NM_017799			57099977	-1	no_errors	ENST00000553800	ensembl	human	known	74_37	rna	DEL	0.002	-
ABCC8	6833	genome.wustl.edu	37	11	17449472	17449472	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr11:17449472G>T	ENST00000389817.3	-	15	2126	c.2058C>A	c.(2056-2058)ttC>ttA	p.F686L	ABCC8_ENST00000528202.1_5'Flank|ABCC8_ENST00000302539.4_Missense_Mutation_p.F686L			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	686	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.		F -> S (in HHF1). {ECO:0000269|PubMed:15562009, ECO:0000269|PubMed:16357843}.		carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	GGGTCCACGTGAAGTAGCCTC	0.587																																																	0								ENSG00000006071						162.0	126.0	138.0					11																	17449472		2200	4293	6493	ABCC8	SO:0001583	missense	0			-	HGNC	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.2058C>A	11.37:g.17449472G>T	ENSP00000374467:p.Phe686Leu	Somatic	0	63	0.00		0.4911483017230278	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Surea_rcpt-1,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.F686L	ENST00000389817.3	37	c.2058	CCDS31437.1	11	.	.	.	.	.	.	.	.	.	.	G	22.4	4.284478	0.80803	.	.	ENSG00000006071	ENST00000389817;ENST00000302539;ENST00000379493	D;D	0.91631	-2.88;-2.88	5.3	4.38	0.52667	ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.93255	0.7851	M	0.79805	2.47	0.54753	D	0.999982	P	0.45283	0.855	P	0.47251	0.542	D	0.93410	0.6768	10	0.87932	D	0	.	12.7833	0.57489	0.0808:0.0:0.9192:0.0	.	686	Q09428	ABCC8_HUMAN	L	686;686;690	ENSP00000374467:F686L;ENSP00000303960:F686L	ENSP00000303960:F686L	F	-	3	2	ABCC8	17406048	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	4.918000	0.63376	1.224000	0.43551	0.561000	0.74099	TTC	-	superfamily_P-loop_NTPase,pfscan_ABC_transporter-like		0.587	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCC8	protein_coding	OTTHUMT00000389093.1	G	NM_000352	-		17449472	-1	no_errors	ENST00000302539	ensembl	human	known	74_37	missense	SNP	1.000	T
AKNAD1	254268	genome.wustl.edu	37	1	109400923	109400924	+	5'Flank	INS	-	-	T	rs77814137|rs376504620		TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr1:109400923_109400924insT	ENST00000370001.3	-	0	0				SPATA42_ENST00000417241.1_RNA|AKNAD1_ENST00000357393.4_Intron|AKNAD1_ENST00000369995.3_5'Flank|SPATA42_ENST00000369989.2_RNA	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1							cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						AAACTTTTGTCTTTTTTTTTTT	0.361																																																	0								ENSG00000203897																																			SPATA42	SO:0001631	upstream_gene_variant	0				HGNC	AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231		1.37:g.109400934_109400934dupT	Exception_encountered	Somatic	0	11	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	9	30.77	B9EK62|Q5T1N0|Q8N990|Q8NCN9	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370001.3	37	NULL	CCDS791.2	1																																																																																			-	-		0.361	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA42	protein_coding	OTTHUMT00000030923.2	-	NM_152763			109400924	+1	no_errors	ENST00000417241	ensembl	human	known	74_37	rna	INS	0.000:0.000	T
GNE	10020	genome.wustl.edu	37	9	36246334	36246334	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr9:36246334G>T	ENST00000539815.1	-	2	350	c.310C>A	c.(310-312)Cct>Act	p.P104T	GNE_ENST00000396594.3_Missense_Mutation_p.P135T|GNE_ENST00000539208.1_Missense_Mutation_p.P45T|GNE_ENST00000377902.5_Missense_Mutation_p.P104T|GNE_ENST00000447283.2_Missense_Mutation_p.P104T|GNE_ENST00000543356.2_Missense_Mutation_p.P99T			Q9Y223	GLCNE_HUMAN	glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase	104					carbohydrate phosphorylation (GO:0046835)|cell adhesion (GO:0007155)|N-acetylglucosamine biosynthetic process (GO:0006045)|N-acetylneuraminate metabolic process (GO:0006054)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|metal ion binding (GO:0046872)|N-acylmannosamine kinase activity (GO:0009384)|UDP-N-acetylglucosamine 2-epimerase activity (GO:0008761)			endometrium(8)|kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			STAD - Stomach adenocarcinoma(86;0.228)			ATGATATCAGGCTTCAGGCGA	0.522																																					GBM(184;106 2118 20004 35750 50727)												0								ENSG00000159921						77.0	67.0	71.0					9																	36246334		2203	4300	6503	GNE	SO:0001583	missense	0			-	HGNC	AF051852	CCDS6602.1, CCDS47965.1, CCDS55308.1, CCDS55309.1, CCDS55310.1	9p13.1	2008-02-05	2003-12-01		ENSG00000159921	ENSG00000159921			23657	protein-coding gene	gene with protein product		603824	"""UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase"""	IBM2		9305887, 9305888	Standard	NM_005476		Approved	Uae1	uc010mli.3	Q9Y223	OTTHUMG00000019899	ENST00000539815.1:c.310C>A	9.37:g.36246334G>T	ENSP00000439155:p.Pro104Thr	Somatic	0	40	0.00		0.4911483017230278	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	A6PZH2|A6PZH3|A7UNU7|B2R6E1|B7Z372|B7Z428|D3DRP7|F5H499|H0YFA7|Q0VA94	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UDP_GlcNAc_Epimerase_2,pfam_ROK,prints_Hexokinase,tigrfam_UDP-GlcNAc_Epase	p.P135T	ENST00000539815.1	37	c.403	CCDS6602.1	9	.	.	.	.	.	.	.	.	.	.	G	23.5	4.425616	0.83667	.	.	ENSG00000159921	ENST00000377902;ENST00000396594;ENST00000339267;ENST00000539815;ENST00000543356;ENST00000539208;ENST00000447283	D;D;D;D;D	0.99876	-7.41;-7.41;-7.41;-7.41;-7.41	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.99876	0.9941	M	0.89095	3.005	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;0.999;1.0;0.999;0.999	D	0.96553	0.9409	10	0.87932	D	0	-9.0225	17.0847	0.86608	0.0:0.0:1.0:0.0	.	45;63;135;104;104	F5H499;Q9Y223-3;Q9Y223-2;Q9Y223;A7UNU7	.;.;.;GLCNE_HUMAN;.	T	104;135;99;104;76;45;104	ENSP00000367134:P104T;ENSP00000379839:P135T;ENSP00000439155:P104T;ENSP00000445117:P45T;ENSP00000414760:P104T	ENSP00000340770:P99T	P	-	1	0	GNE	36236334	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.029000	0.93718	2.627000	0.88993	0.467000	0.42956	CCT	-	pfam_UDP_GlcNAc_Epimerase_2,tigrfam_UDP-GlcNAc_Epase		0.522	GNE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GNE	protein_coding	OTTHUMT00000052412.4	G	NM_005476	-		36246334	-1	no_errors	ENST00000396594	ensembl	human	known	74_37	missense	SNP	1.000	T
MYO6	4646	genome.wustl.edu	37	6	76599857	76599858	+	Frame_Shift_Ins	INS	-	-	A	rs551348450	byFrequency	TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr6:76599857_76599858insA	ENST00000369977.3	+	26	2881_2882	c.2742_2743insA	c.(2743-2745)aaafs	p.K915fs	MYO6_ENST00000369981.3_Frame_Shift_Ins_p.K915fs|MYO6_ENST00000369975.1_Frame_Shift_Ins_p.K915fs|MYO6_ENST00000369985.4_Frame_Shift_Ins_p.K915fs	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	915					actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)	p.K917fs*10(1)		breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		GTGCATTACAGAAAAAAAAACA	0.381													AAAAAAAAA|AAAAAAAAA|AAAAAAAAAA|insertion	18	0.00359425	0.0083	0.0014	5008	,	,		16538	0.0		0.0	False		,,,				2504	0.0061																1	Deletion - Frameshift(1)	large_intestine(1)						ENSG00000196586			9,4255		0,9,2123						5.8	1.0			86	31,8223		0,31,4096	no	frameshift	MYO6	NM_004999.3		0,40,6219	A1A1,A1R,RR		0.3756,0.2111,0.3195				40,12478				MYO6	SO:0001589	frameshift_variant	0				HGNC	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.2751dupA	6.37:g.76599866_76599866dupA	ENSP00000358994:p.Lys915fs	Somatic	0	50	0.00		0.4911483017230278	29	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	24	17.24	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.Q917fs	ENST00000369977.3	37	c.2742_2743	CCDS34487.1	6																																																																																			-	NULL		0.381	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO6	protein_coding	OTTHUMT00000041279.2	-	NM_004999			76599858	+1	no_errors	ENST00000369981	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
MPP5	64398	genome.wustl.edu	37	14	67787071	67787071	+	Missense_Mutation	SNP	G	G	T	rs200780431		TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr14:67787071G>T	ENST00000261681.4	+	12	2155	c.1494G>T	c.(1492-1494)agG>agT	p.R498S	MPP5_ENST00000555925.1_Missense_Mutation_p.R464S|ATP6V1D_ENST00000553974.1_Intron	NM_022474.3	NP_071919.2	Q8N3R9	MPP5_HUMAN	membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)	498	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|establishment of protein localization to plasma membrane (GO:0090002)|morphogenesis of an epithelial sheet (GO:0002011)|myelin assembly (GO:0032288)|peripheral nervous system myelin maintenance (GO:0032287)|protein localization to myelin sheath abaxonal region (GO:0035750)|tight junction assembly (GO:0070830)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lateral loop (GO:0043219)|myelin sheath adaxonal region (GO:0035749)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein domain specific binding (GO:0019904)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|skin(1)	18				all cancers(60;0.000388)|OV - Ovarian serous cystadenocarcinoma(108;0.00762)|BRCA - Breast invasive adenocarcinoma(234;0.0106)		TGCGTCAGAGGCTCATGAACA	0.433																																																	0								ENSG00000072415						115.0	108.0	110.0					14																	67787071		2203	4300	6503	MPP5	SO:0001583	missense	0			-	HGNC	AK022677	CCDS9779.1, CCDS58325.1	14q23.3	2008-08-11				ENSG00000072415			18669	protein-coding gene	gene with protein product	"""stardust"""	606958				11927608	Standard	NM_022474		Approved	PALS1, FLJ12615	uc001xjc.4	Q8N3R9		ENST00000261681.4:c.1494G>T	14.37:g.67787071G>T	ENSP00000261681:p.Arg498Ser	Somatic	0	60	0.00		0.4911483017230278	30	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A1L380|Q7Z631|Q86T98|Q8N7I5|Q9H9Q0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GK/Ca_channel_bsu,pfam_L27_N,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,pfam_L27_C,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.R498S	ENST00000261681.4	37	c.1494	CCDS9779.1	14	.	.	.	.	.	.	.	.	.	.	G	20.5	3.998609	0.74818	.	.	ENSG00000072415	ENST00000261681;ENST00000555925	T;T	0.40756	1.02;1.02	5.58	3.73	0.42828	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.042800	0.85682	D	0.000000	T	0.63510	0.2517	M	0.85945	2.785	0.80722	D	1	D	0.69078	0.997	D	0.73708	0.981	T	0.65340	-0.6192	10	0.87932	D	0	.	8.1537	0.31156	0.3325:0.0:0.6675:0.0	.	498	Q8N3R9	MPP5_HUMAN	S	498;464	ENSP00000261681:R498S;ENSP00000451488:R464S	ENSP00000261681:R498S	R	+	3	2	MPP5	66856824	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.664000	0.25068	0.792000	0.33850	0.655000	0.94253	AGG	-	pfam_GK/Ca_channel_bsu,superfamily_P-loop_NTPase,smart_GK/Ca_channel_bsu,pfscan_Guanylate_kin-like		0.433	MPP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPP5	protein_coding	OTTHUMT00000412498.1	G	NM_022474	-		67787071	+1	no_errors	ENST00000261681	ensembl	human	known	74_37	missense	SNP	1.000	T
ARHGAP10	79658	genome.wustl.edu	37	4	148876500	148876500	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr4:148876500A>T	ENST00000336498.3	+	16	1664	c.1425A>T	c.(1423-1425)ttA>ttT	p.L475F	ARHGAP10_ENST00000414545.2_Missense_Mutation_p.L124F	NM_024605.3	NP_078881.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 10	1238					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			autonomic_ganglia(2)|endometrium(5)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		CCTATGAGTTACATGGAGATT	0.348																																																	0								ENSG00000071205						155.0	173.0	167.0					4																	148876500		2203	4299	6502	ARHGAP10	SO:0001583	missense	0			-	HGNC	BC047914	CCDS34075.1	4q31.23	2013-09-20			ENSG00000071205	ENSG00000071205		"""Rho GTPase activating proteins"""	26099	protein-coding gene	gene with protein product		609746				8288572	Standard	NM_024605		Approved	FLJ20896, FLJ41791, GRAF2	uc003ilf.3	A1A4S6	OTTHUMG00000161460	ENST00000336498.3:c.1425A>T	4.37:g.148876500A>T	ENSP00000336923:p.Leu475Phe	Somatic	0	51	0.00		0.4911483017230278	339	14.18	56	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	68	11.69	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_RhoGAP_dom,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.L475F	ENST00000336498.3	37	c.1425	CCDS34075.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.98|14.98	2.697793|2.697793	0.48307|0.48307	.|.	.|.	ENSG00000071205|ENSG00000071205	ENST00000336498;ENST00000414545|ENST00000507661	T;T|.	0.24538|.	1.85;1.85|.	5.26|5.26	2.81|2.81	0.32909|0.32909	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);|.	0.145380|.	0.44688|.	D|.	0.000424|.	T|T	0.56077|0.56077	0.1961|0.1961	L|L	0.49778|0.49778	1.585|1.585	0.54753|0.54753	D|D	0.999987|0.999987	P;D;D|.	0.63880|.	0.605;0.993;0.958|.	B;P;P|.	0.61070|.	0.264;0.883;0.77|.	T|T	0.47262|0.47262	-0.9131|-0.9131	10|5	0.28530|.	T|.	0.3|.	.|.	8.1991|8.1991	0.31413|0.31413	0.6796:0.0:0.3204:0.0|0.6796:0.0:0.3204:0.0	.|.	56;124;475|.	Q86T21;E7EUW5;A1A4S6|.	.;.;RHG10_HUMAN|.	F|S	475;124|153	ENSP00000336923:L475F;ENSP00000406624:L124F|.	ENSP00000336923:L475F|.	L|T	+|+	3|1	2|0	ARHGAP10|ARHGAP10	149095950|149095950	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.885000|0.885000	0.51271|0.51271	1.709000|1.709000	0.37909|0.37909	0.404000|0.404000	0.25506|0.25506	-0.290000|-0.290000	0.09829|0.09829	TTA|ACA	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.348	ARHGAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP10	protein_coding	OTTHUMT00000365005.1	A	NM_024605	-		148876500	+1	no_errors	ENST00000336498	ensembl	human	known	74_37	missense	SNP	1.000	T
BAZ1B	9031	genome.wustl.edu	37	7	72912943	72912943	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr7:72912943G>T	ENST00000339594.4	-	4	793	c.455C>A	c.(454-456)tCt>tAt	p.S152Y	BAZ1B_ENST00000404251.1_Missense_Mutation_p.S152Y	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	152	Mediates the tyrosine-protein kinase activity.				cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				GGCACCATCAGATTTCTTCTC	0.443																																					Esophageal Squamous(112;1167 1561 21085 43672 48228)												0								ENSG00000009954						145.0	138.0	140.0					7																	72912943		2203	4300	6503	BAZ1B	SO:0001583	missense	0			-	HGNC	AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.455C>A	7.37:g.72912943G>T	ENSP00000342434:p.Ser152Tyr	Somatic	0	39	0.00		0.4911483017230278	74	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WSTF_Acf1_Cbp146,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_WSTF_Acf1_Cbp146,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.S152Y	ENST00000339594.4	37	c.455	CCDS5549.1	7	.	.	.	.	.	.	.	.	.	.	G	17.04	3.287101	0.59867	.	.	ENSG00000009954	ENST00000339594;ENST00000404251	T;T	0.60672	0.17;0.17	5.55	5.55	0.83447	.	0.259543	0.37623	N	0.002011	T	0.54191	0.1843	L	0.27053	0.805	0.43688	D	0.996138	D	0.62365	0.991	P	0.51999	0.687	T	0.45131	-0.9282	10	0.10902	T	0.67	-8.7753	18.0691	0.89400	0.0:0.0:1.0:0.0	.	152	Q9UIG0	BAZ1B_HUMAN	Y	152	ENSP00000342434:S152Y;ENSP00000385442:S152Y	ENSP00000342434:S152Y	S	-	2	0	BAZ1B	72550879	1.000000	0.71417	0.990000	0.47175	0.351000	0.29236	7.109000	0.77062	2.600000	0.87896	0.563000	0.77884	TCT	-	NULL		0.443	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ1B	protein_coding	OTTHUMT00000252123.4	G	NM_032408	-		72912943	-1	no_errors	ENST00000339594	ensembl	human	known	74_37	missense	SNP	0.999	T
ITPR3	3710	genome.wustl.edu	37	6	33646250	33646250	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr6:33646250A>G	ENST00000374316.5	+	30	4761	c.3701A>G	c.(3700-3702)aAg>aGg	p.K1234R	ITPR3_ENST00000605930.1_Missense_Mutation_p.K1234R			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	1234					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	TTCCTGCAGAAGTTCTGTGCA	0.632																																																	0								ENSG00000096433						71.0	64.0	66.0					6																	33646250		2203	4300	6503	ITPR3	SO:0001583	missense	0			-	HGNC	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.3701A>G	6.37:g.33646250A>G	ENSP00000363435:p.Lys1234Arg	Somatic	0	37	0.00		0.4911483017230278	3	25.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	22	42.11	Q14649|Q5TAQ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.K1234R	ENST00000374316.5	37	c.3701	CCDS4783.1	6	.	.	.	.	.	.	.	.	.	.	A	34	5.364374	0.95877	.	.	ENSG00000096433	ENST00000374316	D	0.95377	-3.69	5.65	5.65	0.86999	Intracellular calcium-release channel (1);	0.000000	0.85682	D	0.000000	D	0.94696	0.8289	L	0.50333	1.59	0.58432	D	0.999997	P	0.48294	0.908	P	0.52386	0.697	D	0.95422	0.8508	10	0.72032	D	0.01	-41.5509	15.8765	0.79166	1.0:0.0:0.0:0.0	.	1234	Q14573	ITPR3_HUMAN	R	1234	ENSP00000363435:K1234R	ENSP00000363435:K1234R	K	+	2	0	ITPR3	33754228	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.332000	0.96446	2.154000	0.67381	0.459000	0.35465	AAG	-	pfam_Ca-rel_channel		0.632	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR3	protein_coding	OTTHUMT00000040204.2	A	NM_002224	-		33646250	+1	no_errors	ENST00000374316	ensembl	human	known	74_37	missense	SNP	1.000	G
MYH8	4626	genome.wustl.edu	37	17	10323509	10323509	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A7EL-01A-12D-A36J-09	TCGA-DX-A7EL-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac690007-d6de-4a5c-b7fc-72c128815ebe	26b5714d-b99a-4e34-9e74-e7746a0bd867	g.chr17:10323509delA	ENST00000403437.2	-	3	130	c.36delT	c.(34-36)tttfs	p.F12fs	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	12					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CAGCTTCGCCAAAAACAGCCA	0.488									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																																								0								ENSG00000133020						93.0	87.0	89.0					17																	10323509		2203	4300	6503	MYH8	SO:0001589	frameshift_variant	0	Familial Cancer Database	Carney Complex Variant		HGNC		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.36delT	17.37:g.10323509delA	ENSP00000384330:p.Phe12fs	Somatic	0	33	0.00		0.4911483017230278	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	Q14910	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.F12fs	ENST00000403437.2	37	c.36	CCDS11153.1	17																																																																																			-	NULL		0.488	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	protein_coding	OTTHUMT00000252724.2	A	NM_002472			10323509	-1	no_errors	ENST00000403437	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
