#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PCDH15	65217	genome.wustl.edu	37	10	55581545	55581545	+	3'UTR	SNP	G	G	A	rs184835185	byFrequency	TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr10:55581545G>A	ENST00000320301.6	-	0	6335				PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000395430.1_3'UTR|PCDH15_ENST00000395433.1_3'UTR|PCDH15_ENST00000395432.2_3'UTR|PCDH15_ENST00000395445.1_Intron|PCDH15_ENST00000361849.3_3'UTR|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000373957.3_3'UTR|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000373965.2_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15						equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CTTCTTTGACGTTCAAATTTG	0.308										HNSCC(58;0.16)																																							0								ENSG00000150275																																			PCDH15	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.*73C>T	10.37:g.55581545G>A		Somatic	0	48	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	18	28.00	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000320301.6	37	NULL	CCDS7248.1	10																																																																																			-	-		0.308	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	protein_coding	OTTHUMT00000048121.2	G	NM_033056	-		55581545	-1	no_errors	ENST00000463095	ensembl	human	known	74_37	rna	SNP	0.158	A
LPL	4023	genome.wustl.edu	37	8	19811678	19811678	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr8:19811678C>T	ENST00000311322.8	+	5	1059	c.589C>T	c.(589-591)Cgt>Tgt	p.R197C		NM_000237.2	NP_000228.1	P06858	LIPL_HUMAN	lipoprotein lipase	197					chylomicron remodeling (GO:0034371)|fatty acid biosynthetic process (GO:0006633)|lipoprotein metabolic process (GO:0042157)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of sequestering of triglyceride (GO:0010890)|response to cold (GO:0009409)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle remodeling (GO:0034372)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|lipoprotein lipase activity (GO:0004465)|phospholipase activity (GO:0004620)|receptor binding (GO:0005102)|triglyceride binding (GO:0017129)|triglyceride lipase activity (GO:0004806)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	36				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	AST-120(DB05269)|Tyloxapol(DB06439)	AGCCCCGAGTCGTCTTTCTCC	0.463																																																	0								ENSG00000175445						133.0	128.0	130.0					8																	19811678		2203	4300	6503	LPL	SO:0001583	missense	0			-	HGNC		CCDS6012.1	8p22	2012-10-02			ENSG00000175445	ENSG00000175445	3.1.1.34		6677	protein-coding gene	gene with protein product		609708		LIPD			Standard	NM_000237		Approved		uc003wzk.4	P06858	OTTHUMG00000036645	ENST00000311322.8:c.589C>T	8.37:g.19811678C>T	ENSP00000309757:p.Arg197Cys	Somatic	0	87	0.00		0.5130446035623836	156	25.00	52	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	43	33.85	B2R5T9|Q16282|Q16283|Q96FC4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Lipoprotein_lipase_LIPH,pfam_Lipase_N,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,prints_Lipo_Lipase,prints_Lipase,pfscan_PLAT/LH2_dom,tigrfam_Lipo_Lipase	p.R197C	ENST00000311322.8	37	c.589	CCDS6012.1	8	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639105	0.67244	.	.	ENSG00000175445	ENST00000311322;ENST00000538071;ENST00000535763	D	0.93366	-3.21	6.17	6.17	0.99709	Lipase, N-terminal (1);	0.226102	0.47852	D	0.000212	D	0.97476	0.9174	H	0.94306	3.52	0.31507	N	0.664025	D	0.89917	1.0	D	0.76575	0.988	D	0.98183	1.0458	8	.	.	.	-23.5122	13.211	0.59825	0.1589:0.8411:0.0:0.0	.	197	P06858	LIPL_HUMAN	C	197;121;183	ENSP00000309757:R197C	.	R	+	1	0	LPL	19855958	0.992000	0.36948	0.997000	0.53966	0.393000	0.30537	2.861000	0.48380	2.941000	0.99782	0.655000	0.94253	CGT	-	pirsf_Lipoprotein_lipase_LIPH,pfam_Lipase_N,tigrfam_Lipo_Lipase		0.463	LPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPL	protein_coding	OTTHUMT00000089113.3	C		-		19811678	+1	no_errors	ENST00000311322	ensembl	human	known	74_37	missense	SNP	0.989	T
LINC01235	401492	genome.wustl.edu	37	9	13408345	13408345	+	lincRNA	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr9:13408345C>T	ENST00000604724.1	-	0	361					NR_033863.1																						aatatcccatcaatatcccac	0.428																																																	0								ENSG00000270547																																			RP11-536O18.2			0			-	Clone_based_vega_gene																													9.37:g.13408345C>T		Somatic	0	64	0.00		0.5130446035623836	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	32	20.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000604724.1	37	NULL		9																																																																																			-	-		0.428	RP11-536O18.2-001	KNOWN	basic	lincRNA	FLJ41200	lincRNA	OTTHUMT00000469529.1	C		-		13408345	-1	no_errors	ENST00000604724	ensembl	human	known	74_37	rna	SNP	0.000	T
ST8SIA1	6489	genome.wustl.edu	37	12	22354420	22354420	+	3'UTR	SNP	C	C	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr12:22354420C>A	ENST00000396037.4	-	0	1618				ST8SIA1_ENST00000539510.1_3'UTR	NM_003034.3	NP_003025.1	Q92185	SIA8A_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1						carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|glycosphingolipid biosynthetic process (GO:0006688)|positive regulation of cell proliferation (GO:0008284)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25						TGACCATTCCCTCTTGGAGTC	0.438																																																	0								ENSG00000111728																																			ST8SIA1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	L32867	CCDS8697.1	12p12.1-p11.2	2013-03-01	2003-01-14	2005-02-07	ENSG00000111728	ENSG00000111728	2.4.99.8	"""Sialyltransferases"""	10869	protein-coding gene	gene with protein product	"""ST8Sia I"""	601123	"""sialyltransferase 8 (alpha-N-acetylneuraminate: alpha-2,8-sialytransferase, GD3 synthase) A"""	SIAT8, SIAT8A		7901202	Standard	NM_003034		Approved		uc001rfo.4	Q92185	OTTHUMG00000169098	ENST00000396037.4:c.*66G>T	12.37:g.22354420C>A		Somatic	0	50	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A8K4H6|Q17RL0|Q6PZN5|Q93064	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000396037.4	37	NULL	CCDS8697.1	12																																																																																			-	-		0.438	ST8SIA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST8SIA1	protein_coding	OTTHUMT00000402245.2	C	NM_003034	-		22354420	-1	no_errors	ENST00000545494	ensembl	human	known	74_37	rna	SNP	0.225	A
MS4A14	84689	genome.wustl.edu	37	11	60172032	60172032	+	Intron	SNP	T	T	G			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:60172032T>G	ENST00000300187.6	+	4	745				MS4A14_ENST00000531787.1_Intron|MS4A14_ENST00000395001.1_Missense_Mutation_p.L49R|MS4A14_ENST00000395005.2_Intron|MS4A14_ENST00000531783.1_Intron	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14							integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						ttcatccttctcactcctcca	0.448																																																	0								ENSG00000166928																																			MS4A14	SO:0001627	intron_variant	0			-	HGNC	AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.468+1498T>G	11.37:g.60172032T>G		Somatic	0	105	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	45	15.09	E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CD20-like	p.L161R	ENST00000300187.6	37	c.482	CCDS31569.1	11	.	.	.	.	.	.	.	.	.	.	T	11.57	1.677943	0.29783	.	.	ENSG00000166928	ENST00000395001	.	.	.	2.08	0.919	0.19392	.	.	.	.	.	T	0.37489	0.1005	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37337	-0.9710	5	0.87932	D	0	.	3.9481	0.09356	0.0:0.1861:0.0:0.8139	.	.	.	.	R	49	.	ENSP00000378449:L49R	L	+	2	0	MS4A14	59928608	0.001000	0.12720	0.002000	0.10522	0.073000	0.16967	-0.172000	0.09868	0.265000	0.21872	0.451000	0.29950	CTC	-	NULL		0.448	MS4A14-002	KNOWN	basic|CCDS	protein_coding	MS4A14	protein_coding	OTTHUMT00000395383.2	T		-		60172032	+1	no_errors	ENST00000525397	ensembl	human	known	74_37	missense	SNP	0.003	G
MPST	4357	genome.wustl.edu	37	22	37420488	37420488	+	Frame_Shift_Del	DEL	G	G	-	rs370740546		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr22:37420488delG	ENST00000397225.2	+	2	1147	c.232delG	c.(232-234)gggfs	p.G78fs	MPST_ENST00000429360.2_Frame_Shift_Del_p.G78fs|MPST_ENST00000404393.1_Frame_Shift_Del_p.G78fs|MPST_ENST00000341116.3_Frame_Shift_Del_p.G78fs|MPST_ENST00000401419.3_Frame_Shift_Del_p.G78fs|MPST_ENST00000397129.1_Frame_Shift_Del_p.G98fs|MPST_ENST00000404802.3_Frame_Shift_Del_p.G78fs			P25325	THTM_HUMAN	mercaptopyruvate sulfurtransferase	78	Rhodanese 1. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cyanate catabolic process (GO:0009440)|hydrogen sulfide biosynthetic process (GO:0070814)|response to toxic substance (GO:0009636)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|neuron projection (GO:0043005)|synapse (GO:0045202)	3-mercaptopyruvate sulfurtransferase activity (GO:0016784)|thiosulfate sulfurtransferase activity (GO:0004792)			central_nervous_system(2)|kidney(1)|lung(2)|prostate(1)|skin(1)	7						CATGCTGCCCGGGGCCGAGCA	0.711																																																	0								ENSG00000128309						10.0	8.0	9.0					22																	37420488		2133	4207	6340	MPST	SO:0001589	frameshift_variant	0				HGNC	X59434	CCDS13939.1	22q13.1	2010-04-27			ENSG00000128309	ENSG00000128309	2.8.1.2		7223	protein-coding gene	gene with protein product	"""human liver rhodanese"""	602496				1953758	Standard	NM_021126		Approved	MST, TST2	uc011amu.3	P25325	OTTHUMG00000150543	ENST00000397225.2:c.232delG	22.37:g.37420488delG	ENSP00000380402:p.Gly78fs	Somatic	0	17	0.00		0.5130446035623836	134	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	7	22.22	A8MZ34|B3KP52|J3KPV7|O75750|Q6FHN9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom	p.A99fs	ENST00000397225.2	37	c.292	CCDS13939.1	22																																																																																			-	pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom		0.711	MPST-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MPST	protein_coding	OTTHUMT00000318832.1	G	NM_001013440			37420488	+1	no_errors	ENST00000397129	ensembl	human	known	74_37	frame_shift_del	DEL	0.004	-
ROBO3	64221	genome.wustl.edu	37	11	124750363	124750363	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:124750363delG	ENST00000397801.1	+	27	4200	c.4008delG	c.(4006-4008)cagfs	p.Q1336fs	ROBO3_ENST00000525482.1_3'UTR|ROBO3_ENST00000543966.1_Frame_Shift_Del_p.Q99fs|ROBO3_ENST00000538940.1_Frame_Shift_Del_p.Q1314fs	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	1336					axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		CCCGGGGCCAGGGCACCAGCA	0.657																																																	0								ENSG00000154134						24.0	29.0	27.0					11																	124750363		2024	4195	6219	ROBO3	SO:0001589	frameshift_variant	0				HGNC	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.4008delG	11.37:g.124750363delG	ENSP00000380903:p.Gln1336fs	Somatic	0	26	0.00		0.5130446035623836	35	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	6	25.00		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G1337fs	ENST00000397801.1	37	c.4008	CCDS44755.1	11																																																																																			-	NULL		0.657	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO3	protein_coding	OTTHUMT00000387091.1	G	XM_370663			124750363	+1	no_errors	ENST00000397801	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
GDPD5	81544	genome.wustl.edu	37	11	75155507	75155508	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:75155507_75155508insC	ENST00000336898.3	-	10	1584_1585	c.747_748insG	c.(745-750)cggaagfs	p.K250fs	GDPD5_ENST00000529721.1_Frame_Shift_Ins_p.K250fs|GDPD5_ENST00000526177.1_Frame_Shift_Ins_p.K112fs|GDPD5_ENST00000376282.3_Frame_Shift_Ins_p.K131fs|GDPD5_ENST00000533805.1_Frame_Shift_Ins_p.K5fs|GDPD5_ENST00000443276.2_3'UTR|GDPD5_ENST00000533784.1_Frame_Shift_Ins_p.K131fs	NM_030792.6	NP_110419.5	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain containing 5	250	GP-PDE.				cerebral cortex neuron differentiation (GO:0021895)|glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)|negative regulation of Notch signaling pathway (GO:0045746)|neuron projection development (GO:0031175)|positive regulation of neuron differentiation (GO:0045666)|regulation of timing of cell differentiation (GO:0048505)|spinal cord motor neuron differentiation (GO:0021522)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|skin(2)	20						TCGAGGGCCTTCCGGAAGGACA	0.589																																																	0								ENSG00000158555																																			GDPD5	SO:0001589	frameshift_variant	0				HGNC	AF318377	CCDS8238.1	11q13.4-q13.5	2011-01-25				ENSG00000158555			28804	protein-coding gene	gene with protein product		609632				18667693, 17275818	Standard	NM_030792		Approved	PP1665, GDE2	uc001owp.4	Q8WTR4		ENST00000336898.3:c.748dupG	11.37:g.75155509_75155509dupC	ENSP00000337972:p.Lys250fs	Somatic	0	72	0.00		0.5130446035623836	35	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	20	9.09	Q49AQ5|Q6UX76|Q7Z4S0|Q8N781|Q8NCB7|Q8TB77	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	p.K249fs	ENST00000336898.3	37	c.748_747	CCDS8238.1	11																																																																																			-	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl		0.589	GDPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDPD5	protein_coding	OTTHUMT00000384409.1	-	NM_030792			75155508	-1	no_errors	ENST00000336898	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:0.998	C
ACTL7B	10880	genome.wustl.edu	37	9	111617550	111617550	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr9:111617550G>A	ENST00000374667.3	-	1	1689	c.661C>T	c.(661-663)Cgc>Tgc	p.R221C		NM_006686.3	NP_006677.1	Q9Y614	ACL7B_HUMAN	actin-like 7B	221						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of cytoskeleton (GO:0005200)	p.R221S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						TAGTCGGCGCGGCTGGTCAGG	0.662																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000148156						50.0	40.0	43.0					9																	111617550		2203	4300	6503	ACTL7B	SO:0001583	missense	0			-	HGNC	BC033789	CCDS6771.1	9q31	2009-05-15			ENSG00000148156	ENSG00000148156			162	protein-coding gene	gene with protein product		604304				10373328, 12907721	Standard	NM_006686		Approved	Tact1	uc004bdi.3	Q9Y614	OTTHUMG00000020462	ENST00000374667.3:c.661C>T	9.37:g.111617550G>A	ENSP00000363799:p.Arg221Cys	Somatic	0	25	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	7	53.33	B2R9Q2|Q5JSV1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.R221C	ENST00000374667.3	37	c.661	CCDS6771.1	9	.	.	.	.	.	.	.	.	.	.	G	15.55	2.867799	0.51588	.	.	ENSG00000148156	ENST00000374667	D	0.95137	-3.62	4.63	3.74	0.42951	.	0.389949	0.18921	N	0.127476	D	0.95487	0.8534	H	0.95043	3.615	0.50632	D	0.999887	B	0.23540	0.087	B	0.22386	0.039	D	0.94507	0.7715	10	0.87932	D	0	.	10.4648	0.44600	0.0948:0.0:0.9052:0.0	.	221	Q9Y614	ACL7B_HUMAN	C	221	ENSP00000363799:R221C	ENSP00000363799:R221C	R	-	1	0	ACTL7B	110657371	0.920000	0.31207	0.018000	0.16275	0.223000	0.24884	1.915000	0.39976	1.177000	0.42855	0.655000	0.94253	CGC	-	pfam_Actin-related,smart_Actin-related		0.662	ACTL7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL7B	protein_coding	OTTHUMT00000053571.1	G	NM_006686	-		111617550	-1	no_errors	ENST00000374667	ensembl	human	known	74_37	missense	SNP	0.808	A
MYO3B	140469	genome.wustl.edu	37	2	171248945	171248945	+	Silent	SNP	T	T	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr2:171248945T>A	ENST00000408978.4	+	16	1874	c.1731T>A	c.(1729-1731)tcT>tcA	p.S577S	MYO3B_ENST00000602629.1_3'UTR|MYO3B_ENST00000334231.6_Silent_p.S586S|MYO3B_ENST00000409044.3_Silent_p.S577S	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	577	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						CCAAGGAGTCTTACAGAAGAC	0.418																																																	0								ENSG00000071909						119.0	109.0	112.0					2																	171248945		1922	4135	6057	MYO3B	SO:0001819	synonymous_variant	0			-	HGNC		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.1731T>A	2.37:g.171248945T>A		Somatic	0	44	0.00		0.5130446035623836	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_dom,prints_Myosin_head_motor_dom	p.S586	ENST00000408978.4	37	c.1758	CCDS42773.1	2																																																																																			-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.418	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	MYO3B	protein_coding	OTTHUMT00000333410.1	T		-		171248945	+1	no_errors	ENST00000334231	ensembl	human	known	74_37	silent	SNP	1.000	A
ODF3	113746	genome.wustl.edu	37	11	198465	198465	+	Splice_Site	DEL	C	C	-			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:198465delC	ENST00000325113.4	+	5	731	c.414delC	c.(412-414)ggc>gg	p.G138fs	BET1L_ENST00000410108.1_Intron|ODF3_ENST00000525282.1_Splice_Site_p.G138fs	NM_053280.3	NP_444510.2	Q96PU9	ODF3A_HUMAN	outer dense fiber of sperm tails 3	138					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	outer dense fiber (GO:0001520)				biliary_tract(1)|breast(1)|kidney(1)|large_intestine(2)|ovary(1)|prostate(2)|skin(1)	9		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		ACCCTGCAGGCCCCGCTGCGT	0.672																																																	0								ENSG00000177947						47.0	47.0	47.0					11																	198465		2203	4300	6503	ODF3	SO:0001630	splice_region_variant	0				HGNC	AB067774	CCDS7688.1, CCDS65981.1	11p15.5	2010-04-23			ENSG00000177947	ENSG00000177947			19905	protein-coding gene	gene with protein product	"""cancer/testis antigen 135"""	608356				11870087	Standard	NM_001286136		Approved	SHIPPO1, hSHIPPO, CT135	uc001lob.3	Q96PU9	OTTHUMG00000119073	ENST00000325113.4:c.413-1C>-	11.37:g.198465delC		Somatic	0	63	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	B7ZLT0|Q69YX0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SHIPPO-rpt	p.A140fs	ENST00000325113.4	37	c.414	CCDS7688.1	11																																																																																			-	NULL		0.672	ODF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODF3	protein_coding	OTTHUMT00000239287.1	C			Frame_Shift_Del	198465	+1	no_errors	ENST00000325113	ensembl	human	known	74_37	frame_shift_del	DEL	0.960	-
ABCC4	10257	genome.wustl.edu	37	13	95696016	95696016	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr13:95696016delT	ENST00000376887.4	-	29	3769	c.3655delA	c.(3655-3657)atcfs	p.I1219fs	ABCC4_ENST00000412704.1_Frame_Shift_Del_p.I1172fs	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	1219	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	TTCTCCCGGATTTTTTTTTGT	0.378																																																	0								ENSG00000125257						105.0	104.0	104.0					13																	95696016		2203	4300	6503	ABCC4	SO:0001589	frameshift_variant	0				HGNC	U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.3655delA	13.37:g.95696016delT	ENSP00000366084:p.Ile1219fs	Somatic	0	34	0.00		0.5130446035623836	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_CysFib_conduc_TM	p.I1219fs	ENST00000376887.4	37	c.3655	CCDS9474.1	13																																																																																			-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.378	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC4	protein_coding	OTTHUMT00000045478.2	T	NM_005845			95696016	-1	no_errors	ENST00000376887	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
CELSR3	1951	genome.wustl.edu	37	3	48700023	48700023	+	Silent	SNP	C	C	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr3:48700023C>A	ENST00000164024.4	-	1	325	c.45G>T	c.(43-45)tcG>tcT	p.S15S	RP11-148G20.1_ENST00000421275.1_RNA|CELSR3_ENST00000544264.1_Silent_p.S15S	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	15					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GTATGGGGGTCGACCGTCCCC	0.741																																																	0								ENSG00000008300						5.0	7.0	6.0					3																	48700023		1994	4057	6051	CELSR3	SO:0001819	synonymous_variant	0			-	HGNC	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.45G>T	3.37:g.48700023C>A		Somatic	0	22	0.00		0.5130446035623836	6	14.29	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	11	38.89	O75092	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_GPCR_2_secretin-like,pfam_Laminin_G,pfam_DUF3497,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.S15	ENST00000164024.4	37	c.45	CCDS2775.1	3																																																																																			-	NULL		0.741	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	protein_coding	OTTHUMT00000257523.1	C	NM_001407	-		48700023	-1	no_errors	ENST00000544264	ensembl	human	known	74_37	silent	SNP	0.009	A
POTEB	100996331	genome.wustl.edu	37	15	22049316	22049316	+	IGR	SNP	G	G	A	rs1814008|rs371883145		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr15:22049316G>A	ENST00000439682.1	-	0	1706				MIR3118-6_ENST00000582779.1_RNA	NM_001277304.1	NP_001264233.1	Q6S5H4	POTEB_HUMAN	POTE ankyrin domain family, member B											endometrium(2)|kidney(8)|lung(4)	14						cacaatcaccgtgtgactgca	0.423																																																	0								ENSG00000265793																																			MIR3118-6	SO:0001628	intergenic_variant	0			-	HGNC	AY465170	CCDS59250.1	15q11.2	2014-01-10	2008-11-26	2008-11-26	ENSG00000233917	ENSG00000233917		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33734	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 5"""	608912	"""ANKRD26-like family B, member 1"""	A26B1			Standard	NM_001277304		Approved	POTE15, POTE-15, CT104.5	uc031qqz.1	Q6S5H4			15.37:g.22049316G>A		Somatic	0	11	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	5	54.55	Q6NXN7|Q6S5H7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000439682.1	37	NULL	CCDS59250.1	15																																																																																			-	-		0.423	POTEB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR3118-6	protein_coding	OTTHUMT00000414911.2	G	NM_207355	-		22049316	+1	no_errors	ENST00000582779	ensembl	human	known	74_37	rna	SNP	0.145	A
ECM2	1842	genome.wustl.edu	37	9	95284902	95284902	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr9:95284902A>G	ENST00000344604.5	-	2	396	c.247T>C	c.(247-249)Ttt>Ctt	p.F83L	ECM2_ENST00000375540.1_Missense_Mutation_p.F83L|CENPP_ENST00000375587.3_Intron|ECM2_ENST00000444490.2_Missense_Mutation_p.F83L	NM_001197295.1|NM_001393.3	NP_001184224.1|NP_001384.1	O94769	ECM2_HUMAN	extracellular matrix protein 2, female organ and adipocyte specific	83					cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27						AAACTTGAAAAGGATTCAAAC	0.383																																																	0								ENSG00000106823						100.0	109.0	106.0					9																	95284902		2203	4300	6503	ECM2	SO:0001583	missense	0			-	HGNC	AB011792	CCDS6698.1, CCDS56578.1	9q22.3	2008-07-21			ENSG00000106823	ENSG00000106823			3154	protein-coding gene	gene with protein product	"""matrix glycoprotein SC1/ECM2"""	603479				9790758	Standard	NM_001393		Approved		uc011lty.2	O94769	OTTHUMG00000020226	ENST00000344604.5:c.247T>C	9.37:g.95284902A>G	ENSP00000344758:p.Phe83Leu	Somatic	0	73	0.00		0.5130446035623836	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	B2R730|E2PU11|Q5T9F2|Q7Z3D0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_VWF_C,smart_VWF_C,smart_Leu-rich_rpt_typical-subtyp,pfscan_VWF_C	p.F83L	ENST00000344604.5	37	c.247	CCDS6698.1	9	.	.	.	.	.	.	.	.	.	.	A	3.290	-0.145140	0.06627	.	.	ENSG00000106823	ENST00000444490;ENST00000344604;ENST00000375540;ENST00000395534	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	4.56	1.09	0.20402	.	0.601209	0.16657	N	0.204964	T	0.11707	0.0285	N	0.11560	0.145	0.09310	N	1	B;B;B;B	0.06786	0.001;0.0;0.0;0.001	B;B;B;B	0.08055	0.001;0.001;0.001;0.003	T	0.26950	-1.0088	10	0.13470	T	0.59	.	3.3937	0.07298	0.3691:0.0:0.4253:0.2056	.	83;83;83;83	Q5T9F3;O94769;B4DK93;O94769-2	.;ECM2_HUMAN;.;.	L	83	ENSP00000393971:F83L;ENSP00000344758:F83L;ENSP00000364690:F83L;ENSP00000378905:F83L	ENSP00000344758:F83L	F	-	1	0	ECM2	94324723	0.039000	0.19947	0.017000	0.16124	0.500000	0.33767	0.628000	0.24522	0.392000	0.25172	0.528000	0.53228	TTT	-	NULL		0.383	ECM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECM2	protein_coding	OTTHUMT00000053091.1	A	NM_001393	-		95284902	-1	no_errors	ENST00000344604	ensembl	human	known	74_37	missense	SNP	0.006	G
PRTG	283659	genome.wustl.edu	37	15	55965592	55965592	+	Missense_Mutation	SNP	G	G	A	rs373946986		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr15:55965592G>A	ENST00000389286.4	-	10	1876	c.1829C>T	c.(1828-1830)aCg>aTg	p.T610M		NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		AGCTTTGGGCGTCCTATGTGA	0.413																																																	0								ENSG00000166450	G	MET/THR	2,3764		0,2,1881	61.0	60.0	60.0		1829	4.7	0.9	15		60	0,8220		0,0,4110	no	missense	PRTG	NM_173814.4	81	0,2,5991	AA,AG,GG		0.0,0.0531,0.0167	probably-damaging	610/1151	55965592	2,11984	1883	4110	5993	PRTG	SO:0001583	missense	0			-	HGNC	AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.1829C>T	15.37:g.55965592G>A	ENSP00000373937:p.Thr610Met	Somatic	0	42	0.00		0.5130446035623836	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	21	25.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.T610M	ENST00000389286.4	37	c.1829	CCDS42040.1	15	.	.	.	.	.	.	.	.	.	.	G	17.44	3.389444	0.61956	5.31E-4	0.0	ENSG00000166450	ENST00000389286	T	0.62364	0.03	4.67	4.67	0.58626	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.78489	0.4291	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81658	-0.0833	10	0.87932	D	0	-15.0501	16.9427	0.86222	0.0:0.0:1.0:0.0	.	610	Q2VWP7	PRTG_HUMAN	M	610	ENSP00000373937:T610M	ENSP00000373937:T610M	T	-	2	0	PRTG	53752884	1.000000	0.71417	0.865000	0.33974	0.346000	0.29079	9.457000	0.97630	2.306000	0.77630	0.650000	0.86243	ACG	-	superfamily_Fibronectin_type3		0.413	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRTG	protein_coding	OTTHUMT00000419357.1	G	NM_173814	-		55965592	-1	no_errors	ENST00000389286	ensembl	human	known	74_37	missense	SNP	1.000	A
SEC16A	9919	genome.wustl.edu	37	9	139336249	139336249	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr9:139336249C>G	ENST00000371706.3	-	28	6396	c.6363G>C	c.(6361-6363)agG>agC	p.R2121S	SEC16A_ENST00000313084.5_Missense_Mutation_p.R372S|INPP5E_ENST00000371712.3_5'Flank|SEC16A_ENST00000431893.2_Missense_Mutation_p.R2141S|SEC16A_ENST00000313050.7_Missense_Mutation_p.R2344S|SEC16A_ENST00000467838.1_5'UTR|SEC16A_ENST00000290037.6_Missense_Mutation_p.R2146S			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	2166	Required for interaction with SEC23A.				COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		TCCTCCCTAGCCTTGAGCTCC	0.612																																																	0								ENSG00000148396						62.0	73.0	70.0					9																	139336249		2106	4234	6340	SEC16A	SO:0001583	missense	0			-	HGNC	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.6363G>C	9.37:g.139336249C>G	ENSP00000360771:p.Arg2121Ser	Somatic	0	32	0.00		0.5130446035623836	32	59.49	47	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	11	52.17	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R2344S	ENST00000371706.3	37	c.7032		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.98|14.98	2.697978|2.697978	0.48307|0.48307	.|.	.|.	ENSG00000148396|ENSG00000148396	ENST00000433860|ENST00000313050;ENST00000277537;ENST00000453963;ENST00000371706;ENST00000313084;ENST00000537660;ENST00000290037;ENST00000431893;ENST00000404925;ENST00000398348	.|T;T;T;T;T;T	.|0.71579	.|0.32;-0.58;0.79;1.29;1.1;1.1	5.26|5.26	2.38|2.38	0.29361|0.29361	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80053|0.80053	0.4553|0.4553	M|M	0.66939|0.66939	2.045|2.045	0.33139|0.33139	D|D	0.544082|0.544082	.|D;D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;0.997;1.0;0.998;1.0;1.0;0.999;1.0	.|D;D;D;D;D;D;D;D;D	.|0.87578	.|0.997;0.994;0.993;0.998;0.991;0.994;0.996;0.996;0.997	D|D	0.83729|0.83729	0.0197|0.0197	5|10	.|0.87932	.|D	.|0	-29.3916|-29.3916	10.1169|10.1169	0.42596|0.42596	0.0:0.7107:0.0:0.2893|0.0:0.7107:0.0:0.2893	.|.	.|184;2321;2188;2141;1714;2166;721;372;187	.|B4DY06;F1T0I1;O15027-5;O15027-4;A4QN19;O15027;C9JVR0;Q8N9G1;F6VLX6	.|.;.;.;.;.;SC16A_HUMAN;.;.;.	P|S	493|2344;738;1046;2121;372;187;2146;2141;1714;721	.|ENSP00000325827:R2344S;ENSP00000277537:R738S;ENSP00000403525:R1046S;ENSP00000360771:R2121S;ENSP00000290037:R2146S;ENSP00000387583:R2141S	.|ENSP00000277537:R738S	A|R	-|-	1|3	0|2	SEC16A|SEC16A	138456070|138456070	0.220000|0.220000	0.23631|0.23631	0.011000|0.011000	0.14972|0.14972	0.010000|0.010000	0.07245|0.07245	0.634000|0.634000	0.24614|0.24614	0.626000|0.626000	0.30322|0.30322	-0.274000|-0.274000	0.10170|0.10170	GCT|AGG	-	NULL		0.612	SEC16A-001	KNOWN	basic	protein_coding	SEC16A	protein_coding	OTTHUMT00000055077.1	C	XM_088459	-		139336249	-1	no_errors	ENST00000313050	ensembl	human	known	74_37	missense	SNP	0.046	G
NCOR2	9612	genome.wustl.edu	37	12	124824721	124824722	+	In_Frame_Ins	INS	-	-	GCCGCTGCT	rs61519723|rs112797765|rs143952466	byFrequency	TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr12:124824721_124824722insGCCGCTGCT	ENST00000405201.1	-	37	5517_5518	c.5517_5518insAGCAGCGGC	c.(5515-5520)ggcggg>ggcAGCAGCGGCggg	p.1838_1839insGSS	NCOR2_ENST00000404621.1_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000356219.3_In_Frame_Ins_p.1845_1846insGSS|NCOR2_ENST00000404121.2_In_Frame_Ins_p.1399_1400insGSS|NCOR2_ENST00000397355.1_In_Frame_Ins_p.1829_1830insGSS|NCOR2_ENST00000429285.2_In_Frame_Ins_p.1828_1829insGSS			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1849					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		cccccacccccgccgctgctgc	0.713														4762	0.950879	0.8979	0.9496	5008	,	,		14227	0.9633		0.9672	False		,,,				2504	0.9939																0								ENSG00000196498																																			NCOR2	SO:0001652	inframe_insertion	0				HGNC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5509_5517dupAGCAGCGGC	12.37:g.124824722_124824730dupGCCGCTGCT	ENSP00000384018:p.Gly1836_Ser1838dup	Somatic	NA	NA	NA		0.5130446035623836	53	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.1846in_frame_insSSG	ENST00000405201.1	37	c.5539_5538	CCDS41858.2	12																																																																																			-	NULL		0.713	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	protein_coding	OTTHUMT00000318173.2	-	NM_006312			124824722	-1	no_errors	ENST00000356219	ensembl	human	known	74_37	in_frame_ins	INS	1.000:0.999	GCCGCTGCT
DROSHA	29102	genome.wustl.edu	37	5	31449481	31449481	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr5:31449481G>T	ENST00000511367.2	-	21	2972	c.2728C>A	c.(2728-2730)Cct>Act	p.P910T	DROSHA_ENST00000513349.1_Missense_Mutation_p.P873T|DROSHA_ENST00000344624.3_Missense_Mutation_p.P910T|DROSHA_ENST00000442743.1_Missense_Mutation_p.P873T	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	910	Necessary for interaction with DGCR8 and pri-miRNA processing activity.|RNase III 1.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						GCATGATCAGGATTCATTCCA	0.388																																																	0								ENSG00000113360						72.0	67.0	68.0					5																	31449481		1877	4109	5986	DROSHA	SO:0001583	missense	0			-	HGNC	AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.2728C>A	5.37:g.31449481G>T	ENSP00000425979:p.Pro910Thr	Somatic	0	58	0.00		0.5130446035623836	61	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNase_III_dom,pfam_dsRNA-bd_dom,superfamily_RNase_III_dom,smart_RNase_III_dom,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom,pfscan_RNase_III_dom	p.P910T	ENST00000511367.2	37	c.2728	CCDS47195.1	5	.	.	.	.	.	.	.	.	.	.	G	32	5.121899	0.94429	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075;ENST00000382188	T;T;T;T	0.48522	1.41;1.41;0.81;0.81	5.76	5.76	0.90799	Ribonuclease III (2);	0.000000	0.85682	D	0.000000	T	0.61261	0.2333	M	0.63428	1.95	0.80722	D	1	D;P	0.54047	0.964;0.624	P;B	0.52598	0.703;0.432	T	0.63655	-0.6588	10	0.87932	D	0	-13.4251	19.9787	0.97318	0.0:0.0:1.0:0.0	.	873;910	E7EMP9;Q9NRR4	.;RNC_HUMAN	T	910;910;873;873;835;866	ENSP00000425979:P910T;ENSP00000339845:P910T;ENSP00000409335:P873T;ENSP00000424161:P873T	ENSP00000265075:P835T	P	-	1	0	DROSHA	31485238	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.310000	0.96267	2.719000	0.93026	0.555000	0.69702	CCT	-	superfamily_RNase_III_dom,pfscan_RNase_III_dom		0.388	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DROSHA	protein_coding	OTTHUMT00000366561.3	G	NM_013235	-		31449481	-1	no_errors	ENST00000344624	ensembl	human	known	74_37	missense	SNP	1.000	T
COL23A1	91522	genome.wustl.edu	37	5	177673297	177673297	+	Silent	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr5:177673297G>A	ENST00000390654.3	-	24	1728	c.1371C>T	c.(1369-1371)ggC>ggT	p.G457G		NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	457	Collagen-like 4.|Gly-rich.				collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		GGCCCGGTGGGCCAACTGGCC	0.552																																																	0								ENSG00000050767						33.0	39.0	37.0					5																	177673297		1856	4055	5911	COL23A1	SO:0001819	synonymous_variant	0			-	HGNC	AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.1371C>T	5.37:g.177673297G>A		Somatic	0	55	0.00		0.5130446035623836	22	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q8IVR4|Q9NT93	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen	p.G457	ENST00000390654.3	37	c.1371	CCDS4436.1	5																																																																																			-	pfam_Collagen		0.552	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL23A1	protein_coding	OTTHUMT00000253475.1	G	NM_173465	-		177673297	-1	no_errors	ENST00000390654	ensembl	human	known	74_37	silent	SNP	0.998	A
CSMD1	64478	genome.wustl.edu	37	8	3072082	3072082	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr8:3072082T>A	ENST00000520002.1	-	31	5362	c.4807A>T	c.(4807-4809)Atc>Ttc	p.I1603F	CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000537824.1_Missense_Mutation_p.I1602F|CSMD1_ENST00000602723.1_Missense_Mutation_p.I1603F|CSMD1_ENST00000400186.3_Missense_Mutation_p.I1603F|CSMD1_ENST00000602557.1_Missense_Mutation_p.I1603F|CSMD1_ENST00000542608.1_Missense_Mutation_p.I1602F|CSMD1_ENST00000539096.1_Missense_Mutation_p.I1602F			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1603	Sushi 9. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACACAGGTGATGGATGAGGGG	0.483																																																	0								ENSG00000183117						79.0	79.0	79.0					8																	3072082		2015	4173	6188	CSMD1	SO:0001583	missense	0			-	HGNC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.4807A>T	8.37:g.3072082T>A	ENSP00000430733:p.Ile1603Phe	Somatic	0	54	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.I1603F	ENST00000520002.1	37	c.4807		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.95|14.95	2.689363|2.689363	0.48097|0.48097	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	.|T;T;T;T;T	.|0.68765	.|-0.35;-0.35;-0.35;-0.35;-0.35	5.53|5.53	5.53|5.53	0.82687|0.82687	.|Complement control module (2);Sushi/SCR/CCP (3);	.|0.073810	.|0.51477	.|D	.|0.000093	T|T	0.81772|0.81772	0.4893|0.4893	M|M	0.79123|0.79123	2.44|2.44	0.58432|0.58432	D|D	0.999995|0.999995	.|D;P;D	.|0.67145	.|0.996;0.889;0.961	.|D;P;P	.|0.77004	.|0.989;0.781;0.838	D|D	0.83490|0.83490	0.0069|0.0069	5|10	.|0.54805	.|T	.|0.06	.|.	15.6593|15.6593	0.77169|0.77169	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1603;1603;1603	.|E5RIG2;Q96PZ7;Q96PZ7-4	.|.;CSMD1_HUMAN;.	L|F	1082|1603;1603;1465;1602;1602;1602	.|ENSP00000383047:I1603F;ENSP00000430733:I1603F;ENSP00000441462:I1602F;ENSP00000446243:I1602F;ENSP00000441675:I1602F	.|ENSP00000320445:I1465F	H|I	-|-	2|1	0|0	CSMD1|CSMD1	3059489|3059489	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.098000|0.098000	0.18820|0.18820	3.788000|3.788000	0.55446|0.55446	2.095000|2.095000	0.63458|0.63458	0.482000|0.482000	0.46254|0.46254	CAT|ATC	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.483	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	protein_coding	OTTHUMT00000374500.2	T	NM_033225	-		3072082	-1	no_errors	ENST00000520002	ensembl	human	known	74_37	missense	SNP	1.000	A
TMIGD1	388364	genome.wustl.edu	37	17	28656451	28656451	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr17:28656451G>T	ENST00000328886.4	-	3	251	c.179C>A	c.(178-180)aCc>aAc	p.T60N	TMIGD1_ENST00000538566.2_Missense_Mutation_p.T60N	NM_206832.1	NP_996663.1	Q6UXZ0	TMIG1_HUMAN	transmembrane and immunoglobulin domain containing 1	60	Ig-like C2-type 1.					integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(1)|lung(5)|skin(2)	12						TTCCTCTCTGGTGTGGTTTTG	0.448																																																	0								ENSG00000182271						110.0	100.0	103.0					17																	28656451		2203	4300	6503	TMIGD1	SO:0001583	missense	0			-	HGNC	AY358153	CCDS32605.1	17q11.2	2013-01-29	2006-07-05	2006-07-05		ENSG00000182271		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32431	protein-coding gene	gene with protein product				TMIGD		12975309	Standard	NM_206832		Approved	UNQ9372	uc002hfa.1	Q6UXZ0		ENST00000328886.4:c.179C>A	17.37:g.28656451G>T	ENSP00000332404:p.Thr60Asn	Somatic	0	52	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A8K2K1|Q6ZMC6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T60N	ENST00000328886.4	37	c.179	CCDS32605.1	17	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784717	0.49997	.	.	ENSG00000182271	ENST00000328886;ENST00000538566	T;T	0.12465	2.68;2.68	5.52	2.23	0.28157	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.495885	0.24630	N	0.036898	T	0.14485	0.0350	L	0.60455	1.87	0.33096	D	0.538631	D;P	0.53462	0.96;0.934	P;B	0.44990	0.466;0.417	T	0.21759	-1.0236	10	0.34782	T	0.22	-2.6684	7.0403	0.25017	0.2031:0.2093:0.5876:0.0	.	60;60	Q6UXZ0-2;Q6UXZ0	.;TMIG1_HUMAN	N	60	ENSP00000332404:T60N;ENSP00000446118:T60N	ENSP00000332404:T60N	T	-	2	0	TMIGD1	25680577	0.887000	0.30362	0.194000	0.23346	0.958000	0.62258	1.298000	0.33412	0.635000	0.30488	0.579000	0.79373	ACC	-	smart_Ig_sub,pfscan_Ig-like_dom		0.448	TMIGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMIGD1	protein_coding	OTTHUMT00000447955.1	G	NM_206832	-		28656451	-1	no_errors	ENST00000328886	ensembl	human	known	74_37	missense	SNP	0.471	T
LPCAT1	79888	genome.wustl.edu	37	5	1461841	1461842	+	3'UTR	INS	-	-	T	rs200268743		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr5:1461841_1461842insT	ENST00000283415.3	-	0	3661_3662				LPCAT1_ENST00000503252.1_5'UTR	NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1						cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|negative regulation of phosphatidylcholine biosynthetic process (GO:2001246)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein catabolic process (GO:0045732)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|surfactant homeostasis (GO:0043129)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphocholine O-acyltransferase activity (GO:0047159)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|1-alkylglycerophosphocholine O-acyltransferase activity (GO:0047191)|calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		TTTATCAGAGATTTTTTTTTCT	0.441																																																	0								ENSG00000153395																																			LPCAT1	SO:0001624	3_prime_UTR_variant	0				HGNC	BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395		"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2		8619474, 16704971	Standard	NM_024830		Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.*1925->A	5.37:g.1461850_1461850dupT		Somatic	0	90	0.00		0.5130446035623836	99	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000283415.3	37	NULL	CCDS3864.1	5																																																																																			-	-		0.441	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT1	protein_coding	OTTHUMT00000304032.1	-	NM_024830			1461842	-1	no_errors	ENST00000503252	ensembl	human	known	74_37	rna	INS	0.665:0.773	T
MARCH7	64844	genome.wustl.edu	37	2	160604560	160604560	+	Missense_Mutation	SNP	C	C	G	rs375346228		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr2:160604560C>G	ENST00000259050.4	+	5	881	c.759C>G	c.(757-759)atC>atG	p.I253M	MARCH7_ENST00000409175.1_Missense_Mutation_p.I253M|MARCH7_ENST00000473749.1_3'UTR|MARCH7_ENST00000409591.1_Missense_Mutation_p.I215M|MARCH7_ENST00000539065.1_Missense_Mutation_p.I197M	NM_001282805.1|NM_001282807.1|NM_022826.2	NP_001269734.1|NP_001269736.1|NP_073737.1	Q9H992	MARH7_HUMAN	membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase	253	Ser-rich.				protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(2)	18						AAGCCCCAATCATAAGCAATT	0.398																																																	0								ENSG00000136536						43.0	42.0	43.0					2																	160604560		2203	4300	6503	MARCH7	SO:0001583	missense	0			-	HGNC	AK022973	CCDS2210.1, CCDS63038.1, CCDS63039.1	2q24.2	2013-01-09	2012-02-23	2005-01-27	ENSG00000136536	ENSG00000136536		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	17393	protein-coding gene	gene with protein product		613334	"""axotrophin"", ""membrane-associated ring finger (C3HC4) 7"""	AXOT		14722266	Standard	XM_005246773		Approved	MARCH-VII, RNF177	uc002uax.3	Q9H992	OTTHUMG00000132029	ENST00000259050.4:c.759C>G	2.37:g.160604560C>G	ENSP00000259050:p.Ile253Met	Somatic	0	74	0.00		0.5130446035623836	24	42.86	18	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	22	26.67	A8K9X1|B7Z7P5|D3DPB0|Q53GQ1|Q9BTR9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.I253M	ENST00000259050.4	37	c.759	CCDS2210.1	2	.	.	.	.	.	.	.	.	.	.	C	9.329	1.060078	0.19987	.	.	ENSG00000136536	ENST00000409175;ENST00000539065;ENST00000259050;ENST00000409591	T;T;T;T	0.11821	2.75;2.75;2.75;2.74	5.87	1.38	0.22167	.	0.613165	0.17128	N	0.185927	T	0.05318	0.0141	N	0.08118	0	0.09310	N	0.999995	B;B;B	0.30709	0.017;0.291;0.291	B;B;B	0.28232	0.002;0.087;0.054	T	0.31558	-0.9939	10	0.45353	T	0.12	-14.5264	2.1867	0.03889	0.1254:0.2899:0.1233:0.4614	.	197;215;253	F5H6W4;B7Z7P5;Q9H992	.;.;MARH7_HUMAN	M	253;197;253;215	ENSP00000386830:I253M;ENSP00000442992:I197M;ENSP00000259050:I253M;ENSP00000387238:I215M	ENSP00000259050:I253M	I	+	3	3	MARCH7	160312806	0.222000	0.23652	0.540000	0.28089	0.804000	0.45430	-0.171000	0.09883	-0.081000	0.12662	0.650000	0.86243	ATC	-	NULL		0.398	MARCH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH7	protein_coding	OTTHUMT00000255040.3	C	NM_022826	-		160604560	+1	no_errors	ENST00000259050	ensembl	human	known	74_37	missense	SNP	0.655	G
CUBN	8029	genome.wustl.edu	37	10	16942707	16942707	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr10:16942707G>T	ENST00000377833.4	-	53	8392	c.8327C>A	c.(8326-8328)tCc>tAc	p.S2776Y		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2776	CUB 20. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CAGCTGATTGGAACCTGACTG	0.448																																																	0								ENSG00000107611						197.0	165.0	175.0					10																	16942707		2203	4300	6503	CUBN	SO:0001583	missense	0			-	HGNC	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.8327C>A	10.37:g.16942707G>T	ENSP00000367064:p.Ser2776Tyr	Somatic	0	78	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	19	44.12	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.S2776Y	ENST00000377833.4	37	c.8327	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	G	17.15	3.316170	0.60524	.	.	ENSG00000107611	ENST00000377833	T	0.24723	1.84	5.59	5.59	0.84812	CUB (5);	0.000000	0.44097	D	0.000500	T	0.57873	0.2083	M	0.82716	2.605	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.61337	-0.7083	10	0.72032	D	0.01	.	19.961	0.97250	0.0:0.0:1.0:0.0	.	2776	O60494	CUBN_HUMAN	Y	2776	ENSP00000367064:S2776Y	ENSP00000367064:S2776Y	S	-	2	0	CUBN	16982713	1.000000	0.71417	1.000000	0.80357	0.025000	0.11179	9.150000	0.94667	2.783000	0.95769	0.655000	0.94253	TCC	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.448	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	protein_coding	OTTHUMT00000047009.1	G	NM_001081	-		16942707	-1	no_errors	ENST00000377833	ensembl	human	known	74_37	missense	SNP	1.000	T
BRF1	2972	genome.wustl.edu	37	14	105678473	105678473	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr14:105678473C>T	ENST00000546474.1	-	16	16760	c.1801G>A	c.(1801-1803)Gca>Aca	p.A601T	BRF1_ENST00000547530.1_Missense_Mutation_p.A127T|BRF1_ENST00000379932.4_Intron|BRF1_ENST00000392557.4_Missense_Mutation_p.A397T|BRF1_ENST00000551787.1_Intron|BRF1_ENST00000440513.3_Missense_Mutation_p.A508T|BRF1_ENST00000379937.2_Missense_Mutation_p.A574T|BRF1_ENST00000327359.3_Missense_Mutation_p.A486T|BRF1_ENST00000446501.2_Missense_Mutation_p.A363T	NM_001242787.1|NM_001519.3	NP_001229716.1|NP_001510.2	Q92994	TF3B_HUMAN	BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit	601					gene expression (GO:0010467)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|tRNA transcription (GO:0009304)	nucleoplasm (GO:0005654)|transcription factor TFIIIB complex (GO:0000126)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		ACCTTCTTTGCTGGCTGCGTA	0.627																																																	0								ENSG00000185024						94.0	74.0	81.0					14																	105678473		2202	4299	6501	BRF1	SO:0001583	missense	0			-	HGNC	U28838	CCDS10001.1, CCDS42001.1, CCDS55949.1, CCDS55950.1, CCDS55951.1, CCDS55952.1, CCDS55953.1	14q32.33	2014-04-02	2013-05-29	2001-12-07	ENSG00000185024	ENSG00000185024		"""General transcription factors"""	11551	protein-coding gene	gene with protein product		604902	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 2"", ""BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)"""	TAF3B2, TAF3C, GTF3B		7624363, 8943358	Standard	NM_145685		Approved	TFIIIB90, BRF, hBRF	uc001yqp.2	Q92994	OTTHUMG00000029884	ENST00000546474.1:c.1801G>A	14.37:g.105678473C>T	ENSP00000448323:p.Ala601Thr	Somatic	0	80	0.00		0.5130446035623836	62	31.87	29	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	51	28.77	B3KU36|B4DIG5|B7Z2N3|F5H5Z7|F8WA46|Q13223|Q3SYD9|Q5PR24|Q6IQ02|Q96KX3|Q9HCW6|Q9HCW7|Q9HCW8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TFIIB_cyclin,pfam_BRF1_TBP-bd,pfam_Znf_TFIIB,superfamily_Cyclin-like,smart_Cyclin-like,pfscan_Znf_TFIIB,prints_TFIIB	p.A601T	ENST00000546474.1	37	c.1801	CCDS10001.1	14	.	.	.	.	.	.	.	.	.	.	C	11.28	1.592632	0.28357	.	.	ENSG00000185024	ENST00000392557;ENST00000379937;ENST00000546474;ENST00000547530;ENST00000446501;ENST00000327359;ENST00000440513	.	.	.	3.93	3.03	0.35002	.	0.228496	0.36066	N	0.002813	T	0.30417	0.0764	L	0.40543	1.245	0.09310	N	0.999993	B;P;P;B	0.35174	0.043;0.488;0.478;0.054	B;B;B;B	0.33254	0.054;0.079;0.16;0.034	T	0.17684	-1.0361	9	0.51188	T	0.08	.	7.972	0.30132	0.0:0.8797:0.0:0.1203	.	508;160;574;601	F5H5Z7;Q6ZV39;Q92994-5;Q92994	.;.;.;TF3B_HUMAN	T	397;574;601;127;363;486;508	.	ENSP00000329029:A486T	A	-	1	0	BRF1	104749518	0.035000	0.19736	0.157000	0.22605	0.559000	0.35586	0.588000	0.23924	0.926000	0.37118	0.430000	0.28490	GCA	-	NULL		0.627	BRF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BRF1	protein_coding	OTTHUMT00000074548.4	C	NM_001519	-		105678473	-1	no_errors	ENST00000546474	ensembl	human	known	74_37	missense	SNP	0.033	T
PRIM2	5558	genome.wustl.edu	37	6	57498984	57498984	+	3'UTR	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr6:57498984G>T	ENST00000389488.2	+	0	1335				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ATTTAGTAAAGGGGACACATT	0.299																																																	0								ENSG00000146143						88.0	80.0	83.0					6																	57498984		1839	4083	5922	PRIM2	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1332G>T	6.37:g.57498984G>T		Somatic	0	165	0.00		0.5130446035623836	88	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	106	14.52	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			-	-		0.299	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	protein_coding	OTTHUMT00000043468.3	G	NM_000947	-		57498984	+1	no_errors	ENST00000389488	ensembl	human	known	74_37	rna	SNP	0.983	T
ZNF549	256051	genome.wustl.edu	37	19	58046710	58046710	+	Intron	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr19:58046710G>T	ENST00000376233.3	+	3	380				ZNF549_ENST00000240719.3_Intron|ZNF549_ENST00000594943.1_Intron|ZNF549_ENST00000602149.1_Intron|ZNF550_ENST00000601415.1_Missense_Mutation_p.D100E	NM_001199295.1	NP_001186224	Q6P9A3	ZN549_HUMAN	zinc finger protein 549						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GGAGTTTCCTGTCTTTCCCAG	0.502																																																	0								ENSG00000251369																																			ZNF550	SO:0001627	intron_variant	0			-	HGNC	AK092236	CCDS12952.1, CCDS56106.1	19q13.43	2013-01-08				ENSG00000121406		"""Zinc fingers, C2H2-type"", ""-"""	26632	protein-coding gene	gene with protein product						12477932	Standard	NM_153263		Approved	FLJ34917	uc002qpb.2	Q6P9A3		ENST00000376233.3:c.199+72G>T	19.37:g.58046710G>T		Somatic	0	64	0.00		0.5130446035623836	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34	B3KV91|O43336|Q8NAR4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.D100E	ENST00000376233.3	37	c.300	CCDS56106.1	19																																																																																			-	NULL		0.502	ZNF549-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF550	protein_coding	OTTHUMT00000466780.1	G	NM_153263	-		58046710	-1	no_errors	ENST00000601415	ensembl	human	putative	74_37	missense	SNP	0.000	T
BRINP2	57795	genome.wustl.edu	37	1	177250848	177250848	+	3'UTR	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr1:177250848G>A	ENST00000361539.4	+	0	2848				BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2						cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											GTGCGTGCGCGcacgcataca	0.522																																																	0								ENSG00000198797																																			BRINP2	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.*184G>A	1.37:g.177250848G>A		Somatic	0	54	0.00		0.5130446035623836	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	27	22.86	O95560|Q6ZWC1|Q7LCZ9|Q8N360	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361539.4	37	NULL	CCDS1320.1	1																																																																																			-	-		0.522	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP2	protein_coding	OTTHUMT00000084599.1	G	NM_021165	-		177250848	+1	no_errors	ENST00000478325	ensembl	human	known	74_37	rna	SNP	0.000	A
HEATR9	256957	genome.wustl.edu	37	17	34191503	34191503	+	Missense_Mutation	SNP	G	G	T	rs143483228		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr17:34191503G>T	ENST00000311880.2	-	5	656	c.508C>A	c.(508-510)Cag>Aag	p.Q170K	C17orf66_ENST00000592980.1_Missense_Mutation_p.Q130K|C17orf66_ENST00000587585.1_5'Flank	NM_152781.2	NP_689994.2	A2RTY3	HEAT9_HUMAN		170					hematopoietic progenitor cell differentiation (GO:0002244)					breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(6)|lung(11)|skin(2)|stomach(4)	38		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		CTTCTCACCTGTGCTGCATAG	0.507																																																	0								ENSG00000172653	G	LYS/GLN	0,4406		0,0,2203	128.0	119.0	122.0		508	4.2	1.0	17	dbSNP_134	122	1,8599	1.2+/-3.3	0,1,4299	no	missense	C17orf66	NM_152781.2	53	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	possibly-damaging	170/571	34191503	1,13005	2203	4300	6503	C17orf66	SO:0001583	missense	0			-	HGNC																												ENST00000311880.2:c.508C>A	17.37:g.34191503G>T	ENSP00000309560:p.Gln170Lys	Somatic	0	42	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	B4DX21|B4DXA4|B4DXF0|Q8N4R4|Q96M46	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.Q170K	ENST00000311880.2	37	c.508	CCDS11299.1	17	.	.	.	.	.	.	.	.	.	.	G	12.77	2.036812	0.35893	0.0	1.16E-4	ENSG00000172653	ENST00000311880	T	0.49432	0.78	5.17	4.19	0.49359	Armadillo-like helical (1);Armadillo-type fold (1);	0.320888	0.22837	N	0.055028	T	0.31734	0.0806	L	0.32530	0.975	0.23661	N	0.99717	B;P;B	0.46784	0.046;0.884;0.056	B;B;B	0.40940	0.011;0.344;0.035	T	0.10132	-1.0643	10	0.11485	T	0.65	.	8.654	0.34051	0.1042:0.0:0.8958:0.0	.	136;130;170	A2RTY3-4;A2RTY3-3;A2RTY3	.;.;CQ066_HUMAN	K	170	ENSP00000309560:Q170K	ENSP00000309560:Q170K	Q	-	1	0	C17orf66	31215616	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	2.734000	0.47368	1.372000	0.46190	0.655000	0.94253	CAG	-	superfamily_ARM-type_fold		0.507	C17orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf66	protein_coding	OTTHUMT00000256487.1	G		rs143483228		34191503	-1	no_errors	ENST00000311880	ensembl	human	known	74_37	missense	SNP	0.998	T
GPR83	10888	genome.wustl.edu	37	11	94134307	94134307	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:94134307G>T	ENST00000243673.2	-	1	278	c.107C>A	c.(106-108)cCc>cAc	p.P36H	GPR83_ENST00000539203.2_Missense_Mutation_p.P36H	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	36					response to glucocorticoid (GO:0051384)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CGAGGCATTGGGCACGGCCAG	0.662																																																	0								ENSG00000123901						51.0	54.0	53.0					11																	94134307		2201	4298	6499	GPR83	SO:0001583	missense	0			-	HGNC	AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901		"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72		10760605, 11060465	Standard	NM_016540		Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000243673.2:c.107C>A	11.37:g.94134307G>T	ENSP00000243673:p.Pro36His	Somatic	0	51	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	16	20.00	B0M0K5|Q6NWR4|Q9P1Y8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.P36H	ENST00000243673.2	37	c.107	CCDS8297.1	11	.	.	.	.	.	.	.	.	.	.	G	16.70	3.195642	0.58126	.	.	ENSG00000123901	ENST00000243673;ENST00000539203	T;T	0.61859	0.07;0.09	4.68	4.68	0.58851	.	0.171432	0.40728	N	0.001030	T	0.67116	0.2859	M	0.62723	1.935	0.45227	D	0.99823	D	0.64830	0.994	P	0.53722	0.733	T	0.71748	-0.4499	10	0.59425	D	0.04	.	16.5734	0.84631	0.0:0.0:1.0:0.0	.	36	Q9NYM4	GPR83_HUMAN	H	36	ENSP00000243673:P36H;ENSP00000441550:P36H	ENSP00000243673:P36H	P	-	2	0	GPR83	93773955	1.000000	0.71417	0.922000	0.36590	0.397000	0.30659	3.838000	0.55828	2.162000	0.67917	0.462000	0.41574	CCC	-	NULL		0.662	GPR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR83	protein_coding	OTTHUMT00000396232.1	G	NM_016540	-		94134307	-1	no_errors	ENST00000243673	ensembl	human	known	74_37	missense	SNP	0.975	T
ZNF469	84627	genome.wustl.edu	37	16	88494675	88494675	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr16:88494675G>A	ENST00000437464.1	+	1	797	c.797G>A	c.(796-798)gGc>gAc	p.G266D	ZNF469_ENST00000565624.1_Missense_Mutation_p.G266D	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	266	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						AGGCCCGGCGGCAGCCCCAGG	0.637																																																	0								ENSG00000225614						13.0	20.0	18.0					16																	88494675		692	1586	2278	ZNF469	SO:0001583	missense	0			-	HGNC	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.797G>A	16.37:g.88494675G>A	ENSP00000402343:p.Gly266Asp	Somatic	0	115	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	56	9.68		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G266D	ENST00000437464.1	37	c.797	CCDS45544.1	16	.	.	.	.	.	.	.	.	.	.	G	3.298	-0.143544	0.06627	.	.	ENSG00000225614	ENST00000437464	T	0.08102	3.13	1.77	0.489	0.16854	.	.	.	.	.	T	0.03959	0.0111	N	0.08118	0	0.09310	N	1	B	0.16802	0.019	B	0.15052	0.012	T	0.40664	-0.9551	9	0.56958	D	0.05	.	4.0454	0.09770	0.3275:0.4454:0.2271:0.0	.	266	Q96JG9	ZN469_HUMAN	D	266	ENSP00000402343:G266D	ENSP00000402343:G266D	G	+	2	0	ZNF469	87022176	0.000000	0.05858	0.017000	0.16124	0.259000	0.26198	0.324000	0.19610	-0.002000	0.14469	0.313000	0.20887	GGC	-	NULL		0.637	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	protein_coding		G	NG_012236	-		88494675	+1	no_errors	ENST00000437464	ensembl	human	known	74_37	missense	SNP	0.006	A
MAPKAP1	79109	genome.wustl.edu	37	9	128434681	128434681	+	Missense_Mutation	SNP	T	T	G	rs559227539		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr9:128434681T>G	ENST00000373498.1	-	1	241	c.173A>C	c.(172-174)aAt>aCt	p.N58T	MAPKAP1_ENST00000394063.1_Intron|MAPKAP1_ENST00000265960.3_Missense_Mutation_p.N58T|MAPKAP1_ENST00000373511.2_Missense_Mutation_p.N58T|MAPKAP1_ENST00000373503.3_Intron|MAPKAP1_ENST00000394060.3_Missense_Mutation_p.N58T|MAPKAP1_ENST00000350766.3_Missense_Mutation_p.N58T			Q9BPZ7	SIN1_HUMAN	mitogen-activated protein kinase associated protein 1	58	Interaction with MAP3K2.|Interaction with NBN.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of Ras protein signal transduction (GO:0046580)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|substantia nigra development (GO:0021762)|T cell costimulation (GO:0031295)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein kinase binding (GO:0019901)|Ras GTPase binding (GO:0017016)			endometrium(2)|kidney(1)|large_intestine(2)|lung(15)|ovary(3)	23						AGTCTCACCATTGCTTCCCTG	0.438																																																	0								ENSG00000119487						150.0	109.0	123.0					9																	128434681		2203	4300	6503	MAPKAP1	SO:0001583	missense	0			-	HGNC	M37191	CCDS6864.1, CCDS35139.1, CCDS35140.1, CCDS35141.1, CCDS48020.1	9q34.11	2008-02-05			ENSG00000119487	ENSG00000119487			18752	protein-coding gene	gene with protein product	"""stress-activated protein kinase-interacting 1"""	610558				15363842	Standard	NM_001006620		Approved	MGC2745, SIN1, MIP1	uc004bpv.3	Q9BPZ7	OTTHUMG00000020683	ENST00000373498.1:c.173A>C	9.37:g.128434681T>G	ENSP00000362597:p.Asn58Thr	Somatic	0	50	0.00		0.5130446035623836	115	27.22	43	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	35	32.69	A8K1Z5|B1AMA4|B7Z309|Q00426|Q5JSV5|Q5JSV6|Q5JSV9|Q658R0|Q699U1|Q699U2|Q699U3|Q699U4|Q6GVJ0|Q6GVJ1|Q6GVJ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SIN1	p.N58T	ENST00000373498.1	37	c.173	CCDS35140.1	9	.	.	.	.	.	.	.	.	.	.	T	8.392	0.839938	0.16891	.	.	ENSG00000119487	ENST00000373511;ENST00000350766;ENST00000373498;ENST00000265960;ENST00000373505;ENST00000394060;ENST00000373496;ENST00000433483	.	.	.	5.71	-0.554	0.11811	.	0.405452	0.32357	N	0.006216	T	0.36963	0.0986	N	0.22421	0.69	0.80722	D	1	B;B;B;B	0.24675	0.082;0.011;0.011;0.109	B;B;B;B	0.30943	0.023;0.014;0.013;0.122	T	0.06127	-1.0844	9	0.13470	T	0.59	-3.1463	8.6113	0.33804	0.0:0.4826:0.1154:0.402	.	58;58;58;58	Q9BPZ7-5;Q9BPZ7-3;Q9BPZ7-2;Q9BPZ7	.;.;.;SIN1_HUMAN	T	58;58;58;58;13;58;58;58	.	ENSP00000265960:N58T	N	-	2	0	MAPKAP1	127474502	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	0.844000	0.27654	-0.126000	0.11682	0.533000	0.62120	AAT	-	pfam_SIN1		0.438	MAPKAP1-009	KNOWN	basic|CCDS	protein_coding	MAPKAP1	protein_coding	OTTHUMT00000054092.1	T		-		128434681	-1	no_errors	ENST00000265960	ensembl	human	known	74_37	missense	SNP	0.988	G
GALC	2581	genome.wustl.edu	37	14	88454869	88454870	+	Splice_Site	INS	-	-	A	rs561184126	byFrequency	TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr14:88454869_88454870insA	ENST00000261304.2	-	2	302		c.e2-2		GALC_ENST00000393568.4_Intron|GALC_ENST00000393569.2_Splice_Site|GALC_ENST00000544807.2_Splice_Site|GALC_ENST00000554916.1_Splice_Site	NM_000153.3|NM_001201401.1	NP_000144.2|NP_001188330.1	P54803	GALC_HUMAN	galactosylceramidase						carbohydrate metabolic process (GO:0005975)|galactosylceramide catabolic process (GO:0006683)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	galactosylceramidase activity (GO:0004336)			endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GGAGGTTGCCTAAAAAAAAAAG	0.351																																																	0								ENSG00000054983																																			GALC	SO:0001630	splice_region_variant	0				HGNC	L23116	CCDS9878.2, CCDS55936.1, CCDS55937.1	14q31	2009-01-06	2005-11-29		ENSG00000054983	ENSG00000054983	3.2.1.46		4115	protein-coding gene	gene with protein product	"""Krabbe disease"""	606890	"""galactosylceramidase (Krabbe disease)"""				Standard	NM_000153		Approved		uc001xvt.3	P54803	OTTHUMG00000028646	ENST00000261304.2:c.196-2->T	14.37:g.88454879_88454879dupA		Somatic	0	29	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	B4DKE8|B4DYN1|B4DZJ8|B7Z7Z2|J3KN25|J3KPP8|Q8J030	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e2-2	ENST00000261304.2	37	c.196-3_196-2	CCDS9878.2	14																																																																																			-	-		0.351	GALC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALC	protein_coding	OTTHUMT00000071559.2	-			Intron	88454870	-1	no_errors	ENST00000261304	ensembl	human	known	74_37	splice_site_ins	INS	1.000:0.945	A
VPS53	55275	genome.wustl.edu	37	17	440273	440273	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr17:440273delA	ENST00000571805.1	-	18	2146	c.2010delT	c.(2008-2010)tttfs	p.F670fs	VPS53_ENST00000401468.3_Frame_Shift_Del_p.F393fs|VPS53_ENST00000576149.1_5'UTR|VPS53_ENST00000446250.2_Frame_Shift_Del_p.F472fs|RP5-1029F21.4_ENST00000570974.1_RNA|VPS53_ENST00000291074.5_Frame_Shift_Del_p.F641fs|VPS53_ENST00000574029.1_Intron|VPS53_ENST00000437048.2_Frame_Shift_Del_p.F670fs			Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 homolog (S. cerevisiae)	670					protein transport (GO:0015031)	endosome (GO:0005768)|GARP complex (GO:0000938)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(5)|lung(8)|prostate(1)	19				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		CTTACTTTGCAAATTTAACGC	0.448																																																	0								ENSG00000141252						138.0	103.0	115.0					17																	440273		2203	4300	6503	VPS53	SO:0001589	frameshift_variant	0				HGNC		CCDS10995.1, CCDS45558.1	17p13.3	2007-07-13	2006-12-19			ENSG00000141252			25608	protein-coding gene	gene with protein product		615850	"""vacuolar protein sorting 53 (yeast)"""			15878329	Standard	NM_018289		Approved	FLJ10979, HCCS1	uc010cjo.2	Q5VIR6		ENST00000571805.1:c.2010delT	17.37:g.440273delA	ENSP00000459312:p.Phe670fs	Somatic	0	55	0.00		0.5130446035623836	17	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	6	25.00	A8K2S8|B3FH42|Q8WYW3|Q9BRR2|Q9BY02|Q9NV25	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Vps53_N,pfam_Vacuolar_sorting-assoc_54	p.F670fs	ENST00000571805.1	37	c.2010		17																																																																																			-	NULL		0.448	VPS53-006	KNOWN	basic	protein_coding	VPS53	protein_coding	OTTHUMT00000436940.2	A	NM_018289			440273	-1	no_errors	ENST00000437048	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
CHAMP1	283489	genome.wustl.edu	37	13	115090079	115090079	+	Silent	SNP	A	A	G			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr13:115090079A>G	ENST00000361283.1	+	3	1071	c.762A>G	c.(760-762)ccA>ccG	p.P254P		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	254	Pro-rich.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										CTGCTTCCCCAGAACCTTGGG	0.562																																																	0								ENSG00000198824						67.0	77.0	74.0					13																	115090079		2203	4300	6503	CHAMP1	SO:0001819	synonymous_variant	0			-	HGNC	AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.762A>G	13.37:g.115090079A>G		Somatic	0	56	0.00		0.5130446035623836	26	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B3KU06|Q6P181|Q8NC88|Q9BST0	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P254	ENST00000361283.1	37	c.762	CCDS9545.1	13																																																																																			-	NULL		0.562	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAMP1	protein_coding	OTTHUMT00000045977.2	A	NM_032436	-		115090079	+1	no_errors	ENST00000361283	ensembl	human	known	74_37	silent	SNP	0.973	G
B3GNTL1	146712	genome.wustl.edu	37	17	80919003	80919003	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr17:80919003C>T	ENST00000320865.3	-	8	668	c.655G>A	c.(655-657)Gtc>Atc	p.V219I	B3GNTL1_ENST00000571954.1_5'UTR|B3GNTL1_ENST00000576599.1_Missense_Mutation_p.V108I	NM_001009905.1	NP_001009905.1	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1	219							transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	8	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			ACGCGGATGACGCCGCCGCCC	0.697																																																	0								ENSG00000175711						36.0	32.0	33.0					17																	80919003		2203	4300	6503	B3GNTL1	SO:0001583	missense	0			-	HGNC	AY634364	CCDS32778.1	17q25.3	2013-02-22	2004-01-13	2004-01-14	ENSG00000175711	ENSG00000175711		"""Glycosyltransferase family 2 domain containing"""	21727	protein-coding gene	gene with protein product		615337					Standard	NM_001009905		Approved	B3GNT8	uc002kgg.1	Q67FW5	OTTHUMG00000177788	ENST00000320865.3:c.655G>A	17.37:g.80919003C>T	ENSP00000319979:p.Val219Ile	Somatic	0	30	0.00		0.5130446035623836	5	37.50	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	20	25.93	Q6GV30|Q8WUT3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_2	p.V219I	ENST00000320865.3	37	c.655	CCDS32778.1	17	.	.	.	.	.	.	.	.	.	.	C	6.049	0.377366	0.11466	.	.	ENSG00000175711	ENST00000320865	T	0.47177	0.85	5.21	1.83	0.25207	.	0.195596	0.43747	D	0.000534	T	0.36248	0.0960	L	0.37630	1.12	0.09310	N	0.999994	B	0.20780	0.048	B	0.20384	0.029	T	0.21245	-1.0251	9	.	.	.	-32.6517	14.347	0.66672	0.0:0.577:0.423:0.0	.	219	Q67FW5	B3GNL_HUMAN	I	219	ENSP00000319979:V219I	.	V	-	1	0	B3GNTL1	78512292	0.035000	0.19736	0.008000	0.14137	0.041000	0.13682	1.447000	0.35101	0.676000	0.31285	0.650000	0.86243	GTC	-	NULL		0.697	B3GNTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNTL1	protein_coding	OTTHUMT00000438949.1	C	NM_001009905	-		80919003	-1	no_errors	ENST00000320865	ensembl	human	known	74_37	missense	SNP	0.056	T
MUC16	94025	genome.wustl.edu	37	19	9087836	9087836	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr19:9087836T>C	ENST00000397910.4	-	1	4182	c.3979A>G	c.(3979-3981)Act>Gct	p.T1327A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1327	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGATCCGTAGTGGTGATGTAG	0.517																																																	0								ENSG00000181143						148.0	148.0	148.0					19																	9087836		2158	4260	6418	MUC16	SO:0001583	missense	0			-	HGNC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.3979A>G	19.37:g.9087836T>C	ENSP00000381008:p.Thr1327Ala	Somatic	0	62	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	46	13.21	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.T1327A	ENST00000397910.4	37	c.3979	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	t	3.926	-0.017107	0.07681	.	.	ENSG00000181143	ENST00000397910	T	0.02301	4.35	1.48	-2.96	0.05547	.	.	.	.	.	T	0.01156	0.0038	N	0.08118	0	.	.	.	B	0.27594	0.182	B	0.21708	0.036	T	0.45760	-0.9239	8	0.87932	D	0	.	2.5182	0.04674	0.4482:0.0:0.2307:0.3211	.	1327	B5ME49	.	A	1327	ENSP00000381008:T1327A	ENSP00000381008:T1327A	T	-	1	0	MUC16	8948836	0.000000	0.05858	0.000000	0.03702	0.248000	0.25809	-0.433000	0.06948	-1.160000	0.02804	0.254000	0.18369	ACT	-	NULL		0.517	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	T	NM_024690	-		9087836	-1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	SNP	0.000	C
E2F7	144455	genome.wustl.edu	37	12	77440013	77440013	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr12:77440013G>A	ENST00000322886.7	-	5	869	c.634C>T	c.(634-636)Cgg>Tgg	p.R212W	E2F7_ENST00000416496.2_Missense_Mutation_p.R212W	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	212					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						AGGCTGTGCCGTCCATGCCAG	0.517																																																	0								ENSG00000165891						104.0	99.0	101.0					12																	77440013		2203	4300	6503	E2F7	SO:0001583	missense	0			-	HGNC	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.634C>T	12.37:g.77440013G>A	ENSP00000323246:p.Arg212Trp	Somatic	0	31	0.00		0.5130446035623836	22	47.83	22	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	14	39.13	A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_E2F_TDP	p.R212W	ENST00000322886.7	37	c.634	CCDS9016.1	12	.	.	.	.	.	.	.	.	.	.	G	25.9	4.682816	0.88542	.	.	ENSG00000165891	ENST00000322886;ENST00000416496;ENST00000550669	T;T;T	0.21361	2.27;2.01;2.01	6.17	4.31	0.51392	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.103999	0.64402	D	0.000002	T	0.46580	0.1400	M	0.76002	2.32	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.44283	-0.9338	10	0.48119	T	0.1	-12.9512	14.932	0.70923	0.0:0.0:0.7388:0.2612	.	212;212	F8VSE7;Q96AV8	.;E2F7_HUMAN	W	212	ENSP00000323246:R212W;ENSP00000393639:R212W;ENSP00000448245:R212W	ENSP00000323246:R212W	R	-	1	2	E2F7	75964144	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	5.733000	0.68571	0.893000	0.36288	0.655000	0.94253	CGG	-	NULL		0.517	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F7	protein_coding	OTTHUMT00000406716.1	G	XM_084871	-		77440013	-1	no_errors	ENST00000322886	ensembl	human	known	74_37	missense	SNP	1.000	A
UBA7	7318	genome.wustl.edu	37	3	49841868	49841868	+	IGR	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr3:49841868C>T	ENST00000333486.3	-	0	3299				MIR5193_ENST00000584510.1_RNA|FAM212A_ENST00000333323.4_Silent_p.S104S	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7						cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		TGTCAGGCAGCACATGGCGAG	0.632																																																	0								ENSG00000185614						95.0	91.0	92.0					3																	49841868		2203	4300	6503	FAM212A	SO:0001628	intergenic_variant	0			-	HGNC	BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267		3.37:g.49841868C>T		Somatic	0	36	0.00		0.5130446035623836	62	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q9BRB2	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S104	ENST00000333486.3	37	c.312	CCDS2805.1	3																																																																																			-	NULL		0.632	UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM212A	protein_coding	OTTHUMT00000350503.1	C	NM_003335	-		49841868	+1	no_errors	ENST00000333323	ensembl	human	known	74_37	silent	SNP	1.000	T
MN1	4330	genome.wustl.edu	37	22	28194934	28194936	+	In_Frame_Del	DEL	TGC	TGC	-	rs34890218|rs45480998|rs45597040	byFrequency	TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	TGC	TGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr22:28194934_28194936delTGC	ENST00000302326.4	-	1	2550_2552	c.1596_1598delGCA	c.(1594-1599)cagcaa>caa	p.532_533QQ>Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	532	Poly-Gln.				intramembranous ossification (GO:0001957)			p.Q532Q(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						ctgctgctgttgctgctgctgct	0.65			T	ETV6	"""AML, meningioma"""																																			Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	1	Substitution - coding silent(1)	prostate(1)						ENSG00000169184			226,138,2110		41,6,138,37,58,957						-0.4	1.0		dbSNP_126	5	429,825,4222		34,24,337,178,445,1720	no	codingComplex	MN1	NM_002430.2		75,30,475,215,503,2677	A1A1,A1A2,A1R,A2A2,A2R,RR		22.8999,14.713,20.3522				655,963,6332				MN1	SO:0001651	inframe_deletion	0				HGNC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1596_1598delGCA	22.37:g.28194943_28194945delTGC	ENSP00000304956:p.Gln550del	Somatic	0	51	0.00		0.5130446035623836	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	30	9.09	A9Z1V9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.Q536in_frame_del	ENST00000302326.4	37	c.1598_1596	CCDS42998.1	22																																																																																			-	NULL		0.650	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MN1	protein_coding	OTTHUMT00000320737.1	TGC	NM_002430			28194936	-1	no_errors	ENST00000302326	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:0.998	-
CEP164P1	100289237	genome.wustl.edu	37	10	45566330	45566332	+	RNA	DEL	TTC	TTC	-			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	TTC	TTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr10:45566330_45566332delTTC	ENST00000456938.2	-	0	87									centrosomal protein 164kDa pseudogene 1																		cttttcctttttcttcttcttct	0.493																																																	0								ENSG00000226937																																			CEP164P1			0				HGNC			10q11.21	2013-05-22			ENSG00000226937	ENSG00000226937			44988	pseudogene	pseudogene							Standard	NG_032712		Approved				OTTHUMG00000018069		10.37:g.45566339_45566341delTTC		Somatic	0	37	0.00		0.5130446035623836	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	10	16.67		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000456938.2	37	NULL		10																																																																																			-	-		0.493	CEP164P1-002	KNOWN	basic	processed_transcript	CEP164P1	pseudogene	OTTHUMT00000047765.2	TTC	NG_032712			45566332	-1	no_errors	ENST00000598522	ensembl	human	known	74_37	rna	DEL	1.000:1.000:0.998	-
SOWAHB	345079	genome.wustl.edu	37	4	77817206	77817206	+	Silent	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr4:77817206C>T	ENST00000334306.2	-	1	1796	c.1797G>A	c.(1795-1797)gaG>gaA	p.E599E		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	599																	TCACAATCCACTCATGCTCCC	0.562																																																	0								ENSG00000186212						64.0	59.0	61.0					4																	77817206		2203	4300	6503	SOWAHB	SO:0001819	synonymous_variant	0			-	HGNC		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.1797G>A	4.37:g.77817206C>T		Somatic	0	43	0.00		0.5130446035623836	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B2RP29	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E599	ENST00000334306.2	37	c.1797	CCDS34017.1	4																																																																																			-	NULL		0.562	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOWAHB	protein_coding	OTTHUMT00000362762.1	C	NM_001029870	-		77817206	-1	no_errors	ENST00000334306	ensembl	human	known	74_37	silent	SNP	0.887	T
OTOA	146183	genome.wustl.edu	37	16	21716518	21716518	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr16:21716518G>A	ENST00000286149.4	+	11	1052	c.1051G>A	c.(1051-1053)Gac>Aac	p.D351N	OTOA_ENST00000388958.3_Missense_Mutation_p.D337N|OTOA_ENST00000569064.1_3'UTR|OTOA_ENST00000388956.4_Missense_Mutation_p.D258N|OTOA_ENST00000388957.3_Missense_Mutation_p.D13N			Q7RTW8	OTOAN_HUMAN	otoancorin	351					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		TTTCTACAATGACCTGGAATT	0.537																																																	0								ENSG00000155719						107.0	100.0	102.0					16																	21716518		2199	4300	6499	OTOA	SO:0001583	missense	0			-	HGNC	AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.1051G>A	16.37:g.21716518G>A	ENSP00000286149:p.Asp351Asn	Somatic	0	69	0.00		0.5130446035623836	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	54	8.47	A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D351N	ENST00000286149.4	37	c.1051		16	.	.	.	.	.	.	.	.	.	.	G	16.93	3.257204	0.59321	.	.	ENSG00000155719	ENST00000388958;ENST00000286149;ENST00000388956;ENST00000388957	T;T;T;T	0.78003	2.67;-1.14;2.67;-1.14	5.3	5.3	0.74995	.	0.233267	0.43110	D	0.000618	T	0.71651	0.3365	L	0.47716	1.5	0.35084	D	0.763723	P;B;P	0.36909	0.573;0.214;0.573	B;B;B	0.34991	0.193;0.098;0.193	T	0.77419	-0.2595	10	0.30078	T	0.28	-8.938	16.4606	0.84044	0.0:0.0:1.0:0.0	.	258;13;337	B3KWU3;Q7RTW8-2;E9PF51	.;.;.	N	337;351;258;13	ENSP00000373610:D337N;ENSP00000286149:D351N;ENSP00000373608:D258N;ENSP00000373609:D13N	ENSP00000286149:D351N	D	+	1	0	OTOA	21624019	1.000000	0.71417	0.975000	0.42487	0.982000	0.71751	3.636000	0.54317	2.480000	0.83734	0.561000	0.74099	GAC	-	NULL		0.537	OTOA-003	KNOWN	basic	protein_coding	OTOA	protein_coding	OTTHUMT00000430021.1	G		-		21716518	+1	no_errors	ENST00000286149	ensembl	human	known	74_37	missense	SNP	1.000	A
FAM155A	728215	genome.wustl.edu	37	13	108518338	108518338	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr13:108518338delC	ENST00000375915.2	-	1	745	c.607delG	c.(607-609)gacfs	p.D203fs		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	203						integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						TCCTGCCCGTCCCCCCCGGCC	0.607																																																	0								ENSG00000204442						55.0	66.0	63.0					13																	108518338		2203	4300	6503	FAM155A	SO:0001589	frameshift_variant	0				HGNC	L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.607delG	13.37:g.108518338delC	ENSP00000365080:p.Asp203fs	Somatic	0	94	0.00		0.5130446035623836	14	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B2RUV1|B7Z334	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.D203fs	ENST00000375915.2	37	c.607	CCDS32006.1	13																																																																																			-	NULL		0.607	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155A	protein_coding	OTTHUMT00000045736.2	C	NM_001080396			108518338	-1	no_errors	ENST00000375915	ensembl	human	known	74_37	frame_shift_del	DEL	0.252	-
SPP2	6694	genome.wustl.edu	37	2	234959657	234959657	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr2:234959657C>T	ENST00000168148.3	+	2	216	c.128C>T	c.(127-129)gCc>gTc	p.A43V	SPP2_ENST00000373368.1_Missense_Mutation_p.A43V|SPP2_ENST00000492481.1_3'UTR	NM_006944.2	NP_008875.1	Q13103	SPP24_HUMAN	secreted phosphoprotein 2, 24kDa	43					bone remodeling (GO:0046849)|negative regulation of endopeptidase activity (GO:0010951)|protein complex assembly (GO:0006461)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	endopeptidase inhibitor activity (GO:0004866)			breast(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12		Breast(86;0.0109)|Renal(207;0.019)|all_lung(227;0.13)|all_hematologic(139;0.182)		Epithelial(121;5.73e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000166)|Lung(119;0.00539)|LUSC - Lung squamous cell carcinoma(224;0.00846)		TTAAGGGATGCCCTCAGTGCC	0.493																																																	0								ENSG00000072080						135.0	112.0	120.0					2																	234959657		2203	4300	6503	SPP2	SO:0001583	missense	0			-	HGNC		CCDS2511.1	2q37.1	2012-08-14	2002-08-29		ENSG00000072080	ENSG00000072080			11256	protein-coding gene	gene with protein product		602637	"""secreted phosphoprotein 2, 24kD"""			9533032	Standard	XM_005246102		Approved	SPP24	uc002vvk.1	Q13103	OTTHUMG00000059208	ENST00000168148.3:c.128C>T	2.37:g.234959657C>T	ENSP00000168148:p.Ala43Val	Somatic	0	39	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	27	25.00	A4QMV3|Q3B892|Q546M5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spp-24,pfam_Prot_inh_cystat	p.A43V	ENST00000168148.3	37	c.128	CCDS2511.1	2	.	.	.	.	.	.	.	.	.	.	C	13.88	2.370472	0.42003	.	.	ENSG00000072080	ENST00000373368;ENST00000168148	T;T	0.69561	-0.41;-0.41	5.38	4.5	0.54988	.	0.142998	0.47455	N	0.000221	T	0.63745	0.2537	M	0.69823	2.125	0.30839	N	0.735835	P	0.52316	0.952	B	0.40636	0.335	T	0.71583	-0.4549	10	0.87932	D	0	-18.5772	10.4176	0.44331	0.0:0.9091:0.0:0.0909	.	43	Q13103	SPP24_HUMAN	V	43	ENSP00000362466:A43V;ENSP00000168148:A43V	ENSP00000168148:A43V	A	+	2	0	SPP2	234624396	0.978000	0.34361	0.108000	0.21378	0.544000	0.35116	2.283000	0.43470	1.261000	0.44149	0.650000	0.86243	GCC	-	pfam_Prot_inh_cystat		0.493	SPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPP2	protein_coding	OTTHUMT00000131313.3	C	NM_006944	-		234959657	+1	no_errors	ENST00000168148	ensembl	human	known	74_37	missense	SNP	0.383	T
ARHGEF10	9639	genome.wustl.edu	37	8	1844543	1844543	+	Silent	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr8:1844543C>T	ENST00000398564.1	+	14	1560	c.1560C>T	c.(1558-1560)aaC>aaT	p.N520N	ARHGEF10_ENST00000262112.6_Silent_p.N520N|ARHGEF10_ENST00000518288.1_Silent_p.N520N|ARHGEF10_ENST00000349830.3_Silent_p.N495N|ARHGEF10_ENST00000520359.1_Silent_p.N457N|ARHGEF10_ENST00000398560.1_Silent_p.N481N			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	520	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		AATATGTGAACAATTTCAGCA	0.408																																																	0								ENSG00000104728						134.0	130.0	132.0					8																	1844543		2203	4300	6503	ARHGEF10	SO:0001819	synonymous_variant	0			-	HGNC	AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.1560C>T	8.37:g.1844543C>T		Somatic	0	67	0.00		0.5130446035623836	95	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	56	8.20	O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,smart_DH-domain,pfscan_DH-domain	p.N520	ENST00000398564.1	37	c.1560		8																																																																																			-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.408	ARHGEF10-203	KNOWN	basic	protein_coding	ARHGEF10	protein_coding		C		-		1844543	+1	no_errors	ENST00000398564	ensembl	human	known	74_37	silent	SNP	0.999	T
RAG2	5897	genome.wustl.edu	37	11	36615530	36615530	+	Silent	SNP	A	A	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:36615530A>T	ENST00000311485.3	-	2	350	c.189T>A	c.(187-189)tcT>tcA	p.S63S	C11orf74_ENST00000534635.1_5'Flank|RAG2_ENST00000528428.1_5'Flank|C11orf74_ENST00000446510.2_5'Flank|C11orf74_ENST00000334307.5_5'Flank|C11orf74_ENST00000347206.4_5'Flank	NM_000536.3|NM_001243785.1|NM_001243786.1	NP_000527.2|NP_001230714.1|NP_001230715.1	P55895	RAG2_HUMAN	recombination activating gene 2	63					B cell differentiation (GO:0030183)|chromatin modification (GO:0016568)|pre-B cell allelic exclusion (GO:0002331)|T cell differentiation in thymus (GO:0033077)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	32	all_lung(20;0.226)	all_hematologic(20;0.00756)				AGGAATCCTTAGAGAAAATTG	0.468									Familial Hemophagocytic Lymphohistiocytosis																																								0								ENSG00000175097						132.0	137.0	135.0					11																	36615530		2202	4298	6500	RAG2	SO:0001819	synonymous_variant	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	-	HGNC	AF080577	CCDS7903.1	11p13	2014-09-17				ENSG00000175097			9832	protein-coding gene	gene with protein product		179616				1283330	Standard	NM_000536		Approved		uc001mwv.4	P55895		ENST00000311485.3:c.189T>A	11.37:g.36615530A>T		Somatic	0	96	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	23	53.06	A8K9E9|Q8TBL4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RAG2,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_Znf_FYVE_PHD	p.S63	ENST00000311485.3	37	c.189	CCDS7903.1	11																																																																																			-	pfam_RAG2,superfamily_Gal_Oxase/kelch_b-propeller		0.468	RAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAG2	protein_coding	OTTHUMT00000389536.1	A	NM_000536	-		36615530	-1	no_errors	ENST00000311485	ensembl	human	known	74_37	silent	SNP	0.411	T
PBX2P1	5088	genome.wustl.edu	37	3	142897154	142897154	+	RNA	SNP	A	A	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr3:142897154A>T	ENST00000560287.1	+	0	2028									pre-B-cell leukemia homeobox 2 pseudogene 1																		ttttttttttAAAGAAAGAAA	0.348																																																	0								ENSG00000244171																																			PBX2P1			0			-	HGNC			3q24	2014-03-25	2007-01-30	2007-01-30	ENSG00000244171	ENSG00000244171		"""Homeoboxes / TALE class"""	8635	pseudogene	pseudogene			"""pre-B-cell leukemia transcription factor pseudogene 1"""	PBX2, PBXP1		1682799	Standard	NG_002434		Approved				OTTHUMG00000159350		3.37:g.142897154A>T		Somatic	0	122	0.00		0.5130446035623836	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	82	8.89		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000560287.1	37	NULL		3																																																																																			-	-		0.348	PBX2P1-002	KNOWN	basic	processed_transcript	PBX2P1	pseudogene	OTTHUMT00000417717.1	A	NG_002434	-		142897154	+1	no_errors	ENST00000560287	ensembl	human	known	74_37	rna	SNP	0.993	T
SYTL3	94120	genome.wustl.edu	37	6	159178331	159178331	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr6:159178331G>A	ENST00000297239.9	+	13	1420	c.1226G>A	c.(1225-1227)gGa>gAa	p.G409E	SYTL3_ENST00000360448.3_Missense_Mutation_p.G341E|SYTL3_ENST00000367081.3_Missense_Mutation_p.G135E			Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	409	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	calcium-dependent phospholipid binding (GO:0005544)			endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|urinary_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		GTGTTTCTTGGAGAAGTGATC	0.602																																																	0								ENSG00000164674						80.0	68.0	72.0					6																	159178331		2203	4300	6503	SYTL3	SO:0001583	missense	0			-	HGNC	AK055750	CCDS34563.1, CCDS56458.1	6q25.3	2008-07-04			ENSG00000164674	ENSG00000164674			15587	protein-coding gene	gene with protein product						11773082	Standard	NM_001242384		Approved	SLP3, exophilin-6	uc003qrp.3	Q4VX76	OTTHUMG00000015916	ENST00000297239.9:c.1226G>A	6.37:g.159178331G>A	ENSP00000297239:p.Gly409Glu	Somatic	0	80	0.00		0.5130446035623836	8	20.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	35	35.19	Q496J4|Q496J6|Q5U3B9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,smart_C2_dom,pfscan_C2_dom,pfscan_Znf_FYVE-typ	p.G409E	ENST00000297239.9	37	c.1226	CCDS56458.1	6	.	.	.	.	.	.	.	.	.	.	G	28.3	4.905204	0.92035	.	.	ENSG00000164674	ENST00000360448;ENST00000543689;ENST00000297239;ENST00000367081	T;T;T	0.70516	-0.49;-0.49;-0.49	5.07	5.07	0.68467	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.058667	0.64402	D	0.000002	D	0.90287	0.6962	H	0.98901	4.365	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.989;0.993;0.999	D	0.94345	0.7574	10	0.87932	D	0	-5.9275	18.4301	0.90622	0.0:0.0:1.0:0.0	.	135;409;341	F8W7H4;Q4VX76;Q4VX76-2	.;SYTL3_HUMAN;.	E	341;409;409;135	ENSP00000353631:G341E;ENSP00000297239:G409E;ENSP00000356048:G135E	ENSP00000297239:G409E	G	+	2	0	SYTL3	159098319	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.712000	0.91403	2.356000	0.79943	0.491000	0.48974	GGA	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.602	SYTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYTL3	protein_coding	OTTHUMT00000042876.1	G		-		159178331	+1	no_errors	ENST00000297239	ensembl	human	known	74_37	missense	SNP	1.000	A
LOC100129345	100129345	genome.wustl.edu	37	14	98099864	98099864	+	lincRNA	SNP	A	A	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr14:98099864A>T	ENST00000355909.3	-	0	789					NR_033943.1																						ATGTTCTAGAACTGTACACCT	0.483																																																	0								ENSG00000197176																																			RP11-76E12.1			0			-	Clone_based_vega_gene																													14.37:g.98099864A>T		Somatic	0	64	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	75	17.58		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000355909.3	37	NULL		14																																																																																			-	-		0.483	RP11-76E12.1-001	KNOWN	basic	lincRNA	LOC100129345	lincRNA	OTTHUMT00000413543.2	A		-		98099864	-1	no_errors	ENST00000355909	ensembl	human	known	74_37	rna	SNP	0.482	T
LPCAT2	54947	genome.wustl.edu	37	16	55559550	55559550	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr16:55559550G>T	ENST00000262134.5	+	2	486	c.302G>T	c.(301-303)gGt>gTt	p.G101V		NM_017839.4	NP_060309.2	Q7L5N7	PCAT2_HUMAN	lysophosphatidylcholine acyltransferase 2	101					glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	12						CCAATAACTGGTTGGAGGAGG	0.323																																																	0								ENSG00000087253						71.0	66.0	68.0					16																	55559550		2198	4300	6498	LPCAT2	SO:0001583	missense	0			-	HGNC	AK000488	CCDS10753.1	16q12.2	2013-01-10	2007-12-17	2007-12-17	ENSG00000087253	ENSG00000087253		"""EF-hand domain containing"""	26032	protein-coding gene	gene with protein product		612040	"""acyltransferase like 1"""	AYTL1		16704971	Standard	NM_017839		Approved	FLJ20481	uc002eie.4	Q7L5N7	OTTHUMG00000133238	ENST00000262134.5:c.302G>T	16.37:g.55559550G>T	ENSP00000262134:p.Gly101Val	Somatic	0	82	0.00		0.5130446035623836	10	16.67	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	26	44.68	A3KBM1|Q6MZJ6|Q9NX23	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EF_hand_dom,pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.G101V	ENST00000262134.5	37	c.302	CCDS10753.1	16	.	.	.	.	.	.	.	.	.	.	G	11.12	1.545044	0.27652	.	.	ENSG00000087253	ENST00000262134	T	0.27890	1.64	5.33	3.29	0.37713	.	0.098557	0.64402	D	0.000001	T	0.35624	0.0938	M	0.79805	2.47	0.80722	D	1	P	0.40302	0.712	B	0.41374	0.355	T	0.09952	-1.0651	10	0.33141	T	0.24	-3.8214	8.9079	0.35535	0.1684:0.0:0.8316:0.0	.	101	Q7L5N7	PCAT2_HUMAN	V	101	ENSP00000262134:G101V	ENSP00000262134:G101V	G	+	2	0	LPCAT2	54117051	1.000000	0.71417	0.839000	0.33178	0.922000	0.55478	1.522000	0.35921	0.637000	0.30526	0.591000	0.81541	GGT	-	NULL		0.323	LPCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT2	protein_coding	OTTHUMT00000256977.2	G	NM_017839	-		55559550	+1	no_errors	ENST00000262134	ensembl	human	known	74_37	missense	SNP	0.986	T
RB1	5925	genome.wustl.edu	37	13	49037932	49037933	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr13:49037932_49037933delTG	ENST00000267163.4	+	21	2310_2311	c.2172_2173delTG	c.(2170-2175)attgtafs	p.V725fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	725	Domain B.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(10)|p.I703_E737del(2)|p.C712_A727del(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TCAAAATCATTGTAACAGCATA	0.302		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	28	Whole gene deletion(15)|Unknown(10)|Deletion - In frame(3)	bone(10)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|lung(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|ovary(1)|prostate(1)|liver(1)						ENSG00000139687																																			RB1	SO:0001589	frameshift_variant	0	Familial Cancer Database			HGNC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2172_2173delTG	13.37:g.49037932_49037933delTG	ENSP00000267163:p.Val725fs	Somatic	0	34	0.00		0.5130446035623836	14	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	19	26.92	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.V725fs	ENST00000267163.4	37	c.2172_2173	CCDS31973.1	13																																																																																			-	pfam_RB_B,superfamily_Cyclin-like,smart_Cyclin-like		0.302	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	TG				49037933	+1	no_errors	ENST00000267163	ensembl	human	known	74_37	frame_shift_del	DEL	0.997:1.000	-
APOA5	116519	genome.wustl.edu	37	11	116660976	116660976	+	Silent	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:116660976G>A	ENST00000227665.4	-	3	1003	c.969C>T	c.(967-969)gcC>gcT	p.A323A	ZNF259_ENST00000227322.3_5'Flank|APOA5_ENST00000542499.1_Silent_p.A323A			Q6Q788	APOA5_HUMAN	apolipoprotein A-V	323					acylglycerol homeostasis (GO:0055090)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|organ regeneration (GO:0031100)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)	chylomicron (GO:0042627)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|lipase activator activity (GO:0060229)|lipase binding (GO:0035473)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|lipoprotein particle receptor binding (GO:0070325)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylcholine binding (GO:0031210)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|urinary_tract(1)	14	all_hematologic(175;0.0487)	all_cancers(61;3.31e-09)|all_epithelial(67;8.03e-06)|Breast(348;0.0126)|Melanoma(852;0.0153)|Acute lymphoblastic leukemia(157;0.0257)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0433)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;4.93e-06)|all cancers(92;0.000123)|OV - Ovarian serous cystadenocarcinoma(223;0.149)		CTGGGGCGAAGGCACTGTGGC	0.592																																																	0								ENSG00000110243						100.0	94.0	96.0					11																	116660976		2201	4296	6497	APOA5	SO:0001819	synonymous_variant	0			-	HGNC	AF202889	CCDS8376.2	11q23	2013-01-24			ENSG00000110243	ENSG00000110243		"""Apolipoproteins"""	17288	protein-coding gene	gene with protein product		606368				11588264, 11577099	Standard	NM_001166598		Approved	RAP3, APOA-V	uc009yzf.3	Q6Q788	OTTHUMG00000046116	ENST00000227665.4:c.969C>T	11.37:g.116660976G>A		Somatic	0	65	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	B0YIV9|Q3MIK6|Q6UWK9|Q9UBJ3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ApoA1_A4_E	p.A323	ENST00000227665.4	37	c.969	CCDS8376.2	11																																																																																			-	NULL		0.592	APOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOA5	protein_coding	OTTHUMT00000106285.2	G		-		116660976	-1	no_errors	ENST00000227665	ensembl	human	known	74_37	silent	SNP	1.000	A
KRT86	3892	genome.wustl.edu	37	12	52648079	52648079	+	Intron	SNP	C	C	T	rs541182091	byFrequency	TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr12:52648079C>T	ENST00000544024.1	+	1	129				KRT121P_ENST00000529785.1_RNA			O43790	KRT86_HUMAN	keratin 86							extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		CTCAGGAAGTCGATCTCCTGG	0.542													C|||	2	0.000399361	0.0	0.0014	5008	,	,		19823	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000135477																																			KRT121P	SO:0001627	intron_variant	0			-	HGNC	X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000544024.1:c.-5+4867C>T	12.37:g.52648079C>T		Somatic	0	105	0.00		0.5130446035623836	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	39	40.91	P78387	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000544024.1	37	NULL	CCDS41785.1	12																																																																																			-	-		0.542	KRT86-202	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT121P	protein_coding		C	NM_002284	-		52648079	-1	no_errors	ENST00000529785	ensembl	human	known	74_37	rna	SNP	0.834	T
SCN1A	6323	genome.wustl.edu	37	2	166854568	166854568	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr2:166854568A>T	ENST00000303395.4	-	23	4455	c.4456T>A	c.(4456-4458)Ttc>Atc	p.F1486I	SCN1A_ENST00000375405.3_Missense_Mutation_p.F1475I|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.F1458I|SCN1A_ENST00000423058.2_Missense_Mutation_p.F1486I|AC010127.3_ENST00000595647.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1486					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGCTGGTTGAAATTATCTATG	0.333																																																	0								ENSG00000144285						74.0	69.0	70.0					2																	166854568		2202	4295	6497	SCN1A	SO:0001583	missense	0			-	HGNC	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.4456T>A	2.37:g.166854568A>T	ENSP00000303540:p.Phe1486Ile	Somatic	0	142	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	18	70.00	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.F1486I	ENST00000303395.4	37	c.4456	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	A	32	5.188809	0.94923	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.97791	-4.54;-4.54;-4.54;-4.54	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.99269	0.9745	H	0.98351	4.21	0.58432	D	0.999998	D;D;D	0.89917	0.999;0.998;1.0	D;D;D	0.91635	0.991;0.981;0.999	D	0.98614	1.0664	10	0.87932	D	0	.	14.9581	0.71135	1.0:0.0:0.0:0.0	.	1475;1458;1486	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	I	1486;1486;1475;1458	ENSP00000407030:F1486I;ENSP00000303540:F1486I;ENSP00000364554:F1475I;ENSP00000386312:F1458I	ENSP00000303540:F1486I	F	-	1	0	SCN1A	166562814	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.204000	0.95041	1.934000	0.56057	0.383000	0.25322	TTC	-	NULL		0.333	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	protein_coding	OTTHUMT00000102661.1	A	NM_006920	-		166854568	-1	no_errors	ENST00000303395	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF518A	9849	genome.wustl.edu	37	10	97922813	97922813	+	RNA	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr10:97922813G>A	ENST00000534948.1	+	0	7589							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		ATAGCAAGGAGAGAGAAGGAA	0.353																																																	0								ENSG00000177853																																			ZNF518A			0			-	HGNC	AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97922813G>A		Somatic	0	49	0.00		0.5130446035623836	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	A0PJI5|O15044|Q32MP4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000534948.1	37	NULL		10																																																																																			-	-		0.353	ZNF518A-202	KNOWN	basic	processed_transcript	ZNF518A	processed_transcript		G	NM_014803	-		97922813	+1	no_errors	ENST00000534948	ensembl	human	known	74_37	rna	SNP	0.000	A
NUDCD3	23386	genome.wustl.edu	37	7	44467221	44467221	+	Silent	SNP	A	A	G			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr7:44467221A>G	ENST00000355451.7	-	3	870	c.591T>C	c.(589-591)acT>acC	p.T197T	NUDCD3_ENST00000460110.1_5'UTR	NM_015332.3	NP_056147.2	Q8IVD9	NUDC3_HUMAN	NudC domain containing 3	197	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.									endometrium(2)|large_intestine(1)|lung(3)|skin(1)	7						CCTCCAGGTCAGTATAGTCCT	0.522																																																	0								ENSG00000015676						134.0	123.0	127.0					7																	44467221		2203	4300	6503	NUDCD3	SO:0001819	synonymous_variant	0			-	HGNC	BC003691	CCDS5490.2	7p13-p12	2005-03-18			ENSG00000015676	ENSG00000015676			22208	protein-coding gene	gene with protein product		610296					Standard	NM_015332		Approved	KIAA1068	uc003tkz.3	Q8IVD9	OTTHUMG00000129174	ENST00000355451.7:c.591T>C	7.37:g.44467221A>G		Somatic	0	66	0.00		0.5130446035623836	163	0.61	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.09	Q9BTI3|Q9H7W9|Q9UPT4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CS_dom,superfamily_HSP20-like_chaperone,pfscan_CS_dom	p.T197	ENST00000355451.7	37	c.591	CCDS5490.2	7																																																																																			-	pfam_CS_dom,superfamily_HSP20-like_chaperone,pfscan_CS_dom		0.522	NUDCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDCD3	protein_coding	OTTHUMT00000251248.3	A	NM_015332	-		44467221	-1	no_errors	ENST00000355451	ensembl	human	known	74_37	silent	SNP	0.022	G
CBR3	874	genome.wustl.edu	37	21	37518768	37518768	+	Silent	SNP	A	A	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr21:37518768A>T	ENST00000290354.5	+	3	1073	c.792A>T	c.(790-792)ccA>ccT	p.P264P	CBR3-AS1_ENST00000608622.1_RNA|CBR3-AS1_ENST00000608690.1_RNA|CBR3-AS1_ENST00000427491.1_RNA|CBR3-AS1_ENST00000608632.1_RNA|CBR3-AS1_ENST00000453159.1_RNA|CBR3-AS1_ENST00000608641.1_RNA|CBR3-AS1_ENST00000413862.1_RNA	NM_001236.3	NP_001227.1	O75828	CBR3_HUMAN	carbonyl reductase 3	264					cognition (GO:0050890)|phylloquinone catabolic process (GO:0042376)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	3-keto sterol reductase activity (GO:0000253)|carbonyl reductase (NADPH) activity (GO:0004090)|NADPH binding (GO:0070402)			kidney(1)|large_intestine(1)|lung(1)	3					Doxorubicin(DB00997)	CCACTGAGCCACAAGGCCAGT	0.498																																																	0								ENSG00000159231						69.0	68.0	69.0					21																	37518768		2203	4300	6503	CBR3	SO:0001819	synonymous_variant	0			-	HGNC	AB004854	CCDS13642.1	21q22.2	2011-09-14			ENSG00000159231	ENSG00000159231	1.1.1.184	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	1549	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 21C, member 2"""	603608				9740676, 19027726	Standard	NM_001236		Approved	SDR21C2	uc002yve.3	O75828	OTTHUMG00000086617	ENST00000290354.5:c.792A>T	21.37:g.37518768A>T		Somatic	0	48	0.00		0.5130446035623836	70	12.35	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	37	15.91	Q6FHP2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.P264	ENST00000290354.5	37	c.792	CCDS13642.1	21																																																																																			-	NULL		0.498	CBR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBR3	protein_coding	OTTHUMT00000194632.1	A		-		37518768	+1	no_errors	ENST00000290354	ensembl	human	known	74_37	silent	SNP	0.996	T
RB1	5925	genome.wustl.edu	37	13	49037972	49037972	+	Splice_Site	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr13:49037972G>A	ENST00000267163.4	+	21	2349		c.e21+1			NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(10)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TGTTCAGGAGGTAGGTAATTT	0.303		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	25	Whole gene deletion(15)|Unknown(10)	bone(10)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|lung(1)|liver(1)	GRCh37	CS013111|CS022882|CS040295	RB1	S		ENSG00000139687						82.0	84.0	84.0					13																	49037972		2203	4291	6494	RB1	SO:0001630	splice_region_variant	0	Familial Cancer Database		-	HGNC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2211+1G>A	13.37:g.49037972G>A		Somatic	0	32	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	13	55.17	A8K5E3|P78499|Q5VW46|Q8IZL4	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e21+1	ENST00000267163.4	37	c.2211+1	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	G	29.4	5.006365	0.93287	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RB1	47935973	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.281000	0.95811	2.941000	0.99782	0.655000	0.94253	.	-	-		0.303	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	G		-	Intron	49037972	+1	no_errors	ENST00000267163	ensembl	human	known	74_37	splice_site	SNP	1.000	A
SERPINA5	5104	genome.wustl.edu	37	14	95053727	95053727	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr14:95053727G>A	ENST00000554866.1	+	2	142	c.28G>A	c.(28-30)Gtg>Atg	p.V10M	SERPINA5_ENST00000554276.1_Missense_Mutation_p.V10M|SERPINA5_ENST00000553780.1_Missense_Mutation_p.V10M|SERPINA5_ENST00000329597.7_Missense_Mutation_p.V10M			P05154	IPSP_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5	10					fusion of sperm to egg plasma membrane (GO:0007342)|lipid transport (GO:0006869)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|spermatogenesis (GO:0007283)	acrosomal membrane (GO:0002080)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|platelet alpha granule (GO:0031091)|platelet dense tubular network (GO:0031094)|protein C inhibitor-coagulation factor V complex (GO:0097181)|protein C inhibitor-coagulation factor Xa complex (GO:0097182)|protein C inhibitor-coagulation factor XI complex (GO:0097183)|protein C inhibitor-KLK3 complex (GO:0036029)|protein C inhibitor-plasma kallikrein complex (GO:0036030)|protein C inhibitor-PLAT complex (GO:0036026)|protein C inhibitor-PLAU complex (GO:0036027)|protein C inhibitor-thrombin complex (GO:0036028)|protein C inhibitor-TMPRSS11E complex (GO:0036025)|protein C inhibitor-TMPRSS7 complex (GO:0036024)|protein complex (GO:0043234)	acrosin binding (GO:0032190)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|phosphatidylcholine binding (GO:0031210)|protease binding (GO:0002020)|retinoic acid binding (GO:0001972)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(3)|large_intestine(5)|lung(18)|ovary(2)|skin(5)|upper_aerodigestive_tract(3)	36				COAD - Colon adenocarcinoma(157;0.21)	Drotrecogin alfa(DB00055)|Urokinase(DB00013)	CTTGTGCCTGGTGCTTCTCAG	0.607																																																	0								ENSG00000188488						75.0	83.0	80.0					14																	95053727		2203	4300	6503	SERPINA5	SO:0001583	missense	0			-	HGNC	M68516	CCDS9928.1	14q32.1	2014-02-18	2005-08-18		ENSG00000188488	ENSG00000188488		"""Serine (or cysteine) peptidase inhibitors"""	8723	protein-coding gene	gene with protein product		601841	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5"""	PLANH3, PCI		1714450, 8381582, 24172014	Standard	NM_000624		Approved	PAI3, PROCI	uc001ydm.3	P05154	OTTHUMG00000170860	ENST00000554866.1:c.28G>A	14.37:g.95053727G>A	ENSP00000451126:p.Val10Met	Somatic	0	57	0.00		0.5130446035623836	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	Q07616|Q9UG30	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.V10M	ENST00000554866.1	37	c.28	CCDS9928.1	14	.	.	.	.	.	.	.	.	.	.	G	8.120	0.780763	0.16120	.	.	ENSG00000188488	ENST00000554220;ENST00000553780;ENST00000554760;ENST00000554866;ENST00000329597;ENST00000556775;ENST00000553511;ENST00000554506;ENST00000554633;ENST00000555681;ENST00000438291;ENST00000554276;ENST00000557598;ENST00000556064	D;D;D;D;D;T;T;T;T;D;T	0.88201	-1.72;-1.72;-2.35;-1.72;-1.72;-0.91;-0.91;-0.91;-0.91;-1.72;-0.91	4.43	-8.86	0.00795	Serpin domain (1);	4.446440	0.00732	N	0.000946	T	0.71281	0.3321	N	0.08118	0	0.18873	N	0.999989	B;B	0.17268	0.021;0.012	B;B	0.15484	0.013;0.006	T	0.61013	-0.7148	10	0.34782	T	0.22	.	1.7214	0.02912	0.3481:0.1695:0.3565:0.1259	.	10;10	G3V5Q9;P05154	.;IPSP_HUMAN	M	10	ENSP00000450484:V10M;ENSP00000450837:V10M;ENSP00000452469:V10M;ENSP00000451126:V10M;ENSP00000333203:V10M;ENSP00000450745:V10M;ENSP00000451215:V10M;ENSP00000451697:V10M;ENSP00000451650:V10M;ENSP00000451610:V10M;ENSP00000450485:V10M	ENSP00000333203:V10M	V	+	1	0	SERPINA5	94123480	0.000000	0.05858	0.019000	0.16419	0.621000	0.37620	-2.502000	0.00965	-1.278000	0.02408	-0.311000	0.09066	GTG	-	superfamily_Serpin_dom		0.607	SERPINA5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPINA5	protein_coding	OTTHUMT00000410726.1	G	NM_000624	-		95053727	+1	no_errors	ENST00000329597	ensembl	human	known	74_37	missense	SNP	0.169	A
CCDC18	343099	genome.wustl.edu	37	1	93730316	93730316	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr1:93730316C>T	ENST00000343253.7	+	27	4242	c.3740C>T	c.(3739-3741)tCt>tTt	p.S1247F	RP4-717I23.3_ENST00000446528.2_RNA|RP4-717I23.3_ENST00000424517.3_RNA|RP4-717I23.3_ENST00000427669.1_RNA|RP4-717I23.3_ENST00000429859.1_RNA|RP4-717I23.3_ENST00000602488.1_RNA|RP4-717I23.3_ENST00000414430.1_RNA|RP4-717I23.3_ENST00000457025.1_RNA|CCDC18_ENST00000334652.5_3'UTR|RP4-717I23.3_ENST00000455474.1_RNA|RP4-717I23.3_ENST00000413606.1_RNA|RP4-717I23.3_ENST00000415150.1_RNA|CCDC18_ENST00000401026.3_Missense_Mutation_p.S1248F|CCDC18_ENST00000338949.4_3'UTR|RP4-717I23.3_ENST00000451302.2_RNA|RP4-717I23.3_ENST00000447577.1_RNA|RP4-717I23.3_ENST00000442860.1_RNA|CCDC18_ENST00000557479.1_Missense_Mutation_p.S1366F			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	1247										breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		TCTCAAAAGTCTTCTGTTCAG	0.353																																																	0								ENSG00000122483						91.0	85.0	86.0					1																	93730316		1856	4099	5955	CCDC18	SO:0001583	missense	0			-	HGNC			1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.3740C>T	1.37:g.93730316C>T	ENSP00000343377:p.Ser1247Phe	Somatic	0	78	0.00		0.5130446035623836	31	13.89	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	37	21.28	Q6ZU17	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.S1366F	ENST00000343253.7	37	c.4097		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.80|12.80	2.045600|2.045600	0.36085|0.36085	.|.	.|.	ENSG00000122483|ENSG00000122483	ENST00000370276|ENST00000343253;ENST00000401026;ENST00000557479	.|.	.|.	.|.	5.77|5.77	3.84|3.84	0.44239|0.44239	.|.	.|0.550760	.|0.19223	.|N	.|0.119626	T|T	0.31295|0.31295	0.0792|0.0792	N|N	0.12182|0.12182	0.205|0.205	0.80722|0.80722	D|D	1|1	.|P;B	.|0.50617	.|0.937;0.384	.|P;B	.|0.53809	.|0.735;0.405	T|T	0.13442|0.13442	-1.0509|-1.0509	5|9	.|0.33141	.|T	.|0.24	.|.	12.839|12.839	0.57790|0.57790	0.0:0.6865:0.3135:0.0|0.0:0.6865:0.3135:0.0	.|.	.|166;1366	.|Q5T9S4;G3V388	.|.;.	F|F	1301|1247;1248;1366	.|.	.|ENSP00000343377:S1247F	L|S	+|+	1|2	0|0	CCDC18|CCDC18	93502904|93502904	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.981000|0.981000	0.71138|0.71138	0.985000|0.985000	0.29578|0.29578	0.748000|0.748000	0.32831|0.32831	0.591000|0.591000	0.81541|0.81541	CTT|TCT	-	superfamily_tRNA-bd_arm		0.353	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	CCDC18	protein_coding	OTTHUMT00000382327.1	C	NM_206886	-		93730316	+1	no_errors	ENST00000557479	ensembl	human	known	74_37	missense	SNP	0.998	T
DSG4	147409	genome.wustl.edu	37	18	28993429	28993429	+	Silent	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr18:28993429G>T	ENST00000308128.4	+	16	3129	c.2994G>T	c.(2992-2994)ggG>ggT	p.G998G	RP11-534N16.1_ENST00000581856.1_RNA|RP11-534N16.1_ENST00000578477.1_RNA|DSG4_ENST00000359747.4_Silent_p.G1017G	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	998					anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TTTTAGTAGGGCCAGAAATTC	0.498																																																	0								ENSG00000175065						125.0	125.0	125.0					18																	28993429		2203	4300	6503	DSG4	SO:0001819	synonymous_variant	0			-	HGNC	AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.2994G>T	18.37:g.28993429G>T		Somatic	0	77	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A2RUI1|Q6Y9L9|Q8IXV4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmosomal_cadherin	p.G1017	ENST00000308128.4	37	c.3051	CCDS11897.1	18																																																																																			-	NULL		0.498	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG4	protein_coding	OTTHUMT00000254941.1	G	NM_177986	-		28993429	+1	no_errors	ENST00000359747	ensembl	human	known	74_37	silent	SNP	0.929	T
SHISA9	729993	genome.wustl.edu	37	16	13297221	13297221	+	Intron	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr16:13297221G>T	ENST00000424107.3	+	3	1136				AC009134.1_ENST00000571939.1_RNA|SHISA9_ENST00000558583.1_Intron			B4DS77	SHSA9_HUMAN	shisa family member 9						regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|dendritic spine membrane (GO:0032591)|ionotropic glutamate receptor complex (GO:0008328)|synapse (GO:0045202)				breast(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)|skin(2)	9						CCCTGTCTGTGACAATCTCCT	0.542																																																	0								ENSG00000262116						115.0	103.0	107.0					16																	13297221		692	1591	2283	AC009134.1	SO:0001627	intron_variant	0			-	Clone_based_vega_gene		CCDS45417.1, CCDS45418.1, CCDS45417.2, CCDS45418.2	16p13.12	2013-07-31	2013-07-31		ENSG00000237515	ENSG00000237515		"""Shisa homologs"""	37231	protein-coding gene	gene with protein product		613346	"""shisa homolog 9 (Xenopus laevis)"""				Standard	NM_001145205		Approved		uc010uyy.2	B4DS77	OTTHUMG00000154258	ENST00000424107.3:c.692-30G>T	16.37:g.13297221G>T		Somatic	0	43	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	C9J314|C9JCE9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000424107.3	37	NULL	CCDS45417.2	16																																																																																			-	-		0.542	SHISA9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000262116	protein_coding	OTTHUMT00000334564.5	G	NM_001145204	-		13297221	-1	no_errors	ENST00000571939	ensembl	human	known	74_37	rna	SNP	0.855	T
THBS1	7057	genome.wustl.edu	37	15	39876249	39876249	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr15:39876249G>A	ENST00000260356.5	+	5	929	c.764G>A	c.(763-765)cGc>cAc	p.R255H		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	255	Laminin G-like.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		CCTGCCATCCGCACTAACTAC	0.512											OREG0023051	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000137801						74.0	70.0	72.0					15																	39876249		2200	4297	6497	THBS1	SO:0001583	missense	0			-	HGNC		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.764G>A	15.37:g.39876249G>A	ENSP00000260356:p.Arg255His	Somatic	0	77	0.00	889	0.5130446035623836	1784	0.28	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_C,pfam_Thrombospondin_1_rpt,pfam_VWF_C,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Thrombospondin_1_rpt,smart_Laminin_G,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.R255H	ENST00000260356.5	37	c.764	CCDS32194.1	15	.	.	.	.	.	.	.	.	.	.	G	29.1	4.977309	0.92982	.	.	ENSG00000137801	ENST00000260356	T	0.77877	-1.13	5.88	5.88	0.94601	.	0.000000	0.36555	N	0.002526	D	0.82337	0.5015	M	0.70275	2.135	0.47511	D	0.999448	D	0.60160	0.987	P	0.48488	0.579	T	0.83162	-0.0098	10	0.51188	T	0.08	-32.5056	19.2015	0.93713	0.0:0.0:1.0:0.0	.	255	P07996	TSP1_HUMAN	H	255	ENSP00000260356:R255H	ENSP00000260356:R255H	R	+	2	0	THBS1	37663541	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.624000	0.74243	2.786000	0.95864	0.655000	0.94253	CGC	-	NULL		0.512	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS1	protein_coding	OTTHUMT00000257831.2	G	NM_003246	-		39876249	+1	no_errors	ENST00000260356	ensembl	human	known	74_37	missense	SNP	1.000	A
TTC1	7265	genome.wustl.edu	37	5	159492027	159492027	+	Silent	SNP	C	C	G			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr5:159492027C>G	ENST00000231238.5	+	8	944	c.834C>G	c.(832-834)ggC>ggG	p.G278G	TTC1_ENST00000522793.1_Silent_p.G278G|TTC1_ENST00000520274.1_3'UTR	NM_001282500.1|NM_003314.1	NP_001269429.1|NP_003305.1	Q99614	TTC1_HUMAN	tetratricopeptide repeat domain 1	278					protein folding (GO:0006457)	peroxisomal membrane (GO:0005778)	unfolded protein binding (GO:0051082)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(1)|prostate(1)|skin(1)	12	Renal(175;0.00196)	all_hematologic(541;0.00014)|Breast(839;0.0101)|all_neural(177;0.0281)|Medulloblastoma(196;0.0425)|Lung NSC(249;0.119)|all_lung(500;0.163)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	Epithelial(171;8.37e-05)|all cancers(165;0.000694)|OV - Ovarian serous cystadenocarcinoma(192;0.0402)		CCTCTACCGGCTCGTACTCCA	0.383																																																	0								ENSG00000113312						62.0	64.0	63.0					5																	159492027		2203	4300	6503	TTC1	SO:0001819	synonymous_variant	0			-	HGNC	U46570	CCDS4348.1	5q32-q33.2	2013-01-10			ENSG00000113312	ENSG00000113312		"""Tetratricopeptide (TTC) repeat domain containing"""	12391	protein-coding gene	gene with protein product		601963				8836031	Standard	NM_003314		Approved	TPR1	uc003lxu.3	Q99614	OTTHUMG00000130326	ENST00000231238.5:c.834C>G	5.37:g.159492027C>G		Somatic	0	51	0.00		0.5130446035623836	62	63.53	108	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	9	65.38	B2RCT2|D3DQJ8|Q9BVT3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G278	ENST00000231238.5	37	c.834	CCDS4348.1	5																																																																																			-	NULL		0.383	TTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC1	protein_coding	OTTHUMT00000252675.3	C	NM_003314	-		159492027	+1	no_errors	ENST00000231238	ensembl	human	known	74_37	silent	SNP	1.000	G
GPR34	2857	genome.wustl.edu	37	X	41555919	41555919	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chrX:41555919C>T	ENST00000378142.4	+	3	1317	c.1033C>T	c.(1033-1035)Cga>Tga	p.R345*	CASK_ENST00000442742.2_Intron|CASK_ENST00000378163.1_Intron|CASK_ENST00000378166.4_Intron|CASK_ENST00000378158.1_Intron|CASK_ENST00000361962.4_Intron|CASK_ENST00000421587.2_Intron|GPR34_ENST00000378138.5_Nonsense_Mutation_p.R345*|CASK_ENST00000318588.9_Intron|CASK_ENST00000378154.1_Intron	NM_001097579.1|NM_005300.3	NP_001091048.1|NP_005291.1	Q9UPC5	GPR34_HUMAN	G protein-coupled receptor 34	345					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	14						TCTTTTTAGACGATTTCAAGG	0.393																																																	0								ENSG00000171659						82.0	70.0	74.0					X																	41555919		2203	4300	6503	GPR34	SO:0001587	stop_gained	0			-	HGNC	AF039686	CCDS14258.1	Xp11.4	2012-08-21			ENSG00000171659	ENSG00000171659		"""GPCR / Class A : Orphans"""	4490	protein-coding gene	gene with protein product		300241				10395919, 10036181	Standard	NM_005300		Approved		uc004dfq.4	Q9UPC5	OTTHUMG00000021375	ENST00000378142.4:c.1033C>T	X.37:g.41555919C>T	ENSP00000367384:p.Arg345*	Somatic	0	28	0.00		0.5130446035623836	57	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	3	90.32	O95853	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.R345*	ENST00000378142.4	37	c.1033	CCDS14258.1	X	.	.	.	.	.	.	.	.	.	.	C	34	5.320000	0.95682	.	.	ENSG00000171659	ENST00000378142;ENST00000378138;ENST00000535368	.	.	.	5.83	0.889	0.19212	.	0.173984	0.36854	N	0.002369	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.7513	11.9899	0.53169	0.5419:0.3766:0.0815:0.0	.	.	.	.	X	345;345;298	.	ENSP00000367378:R345X	R	+	1	2	GPR34	41440863	0.954000	0.32549	0.992000	0.48379	0.990000	0.78478	0.083000	0.14871	0.097000	0.17492	0.591000	0.81541	CGA	-	NULL		0.393	GPR34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR34	protein_coding	OTTHUMT00000056264.1	C	NM_005300	-		41555919	+1	no_errors	ENST00000378138	ensembl	human	known	74_37	nonsense	SNP	0.933	T
PDCD6	10016	genome.wustl.edu	37	5	271858	271869	+	In_Frame_Del	DEL	CCGGCCCTGGGG	CCGGCCCTGGGG	-	rs529816592|rs147793210|rs201564379	byFrequency	TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	CCGGCCCTGGGG	CCGGCCCTGGGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr5:271858_271869delCCGGCCCTGGGG	ENST00000264933.4	+	1	123_134	c.23_34delCCGGCCCTGGGG	c.(22-36)cccggccctggggcc>ccc	p.GPGA9del	PDCD6_ENST00000509581.1_In_Frame_Del_p.GPGA9del|CTD-2083E4.6_ENST00000512642.1_RNA|PDCD6_ENST00000505221.1_In_Frame_Del_p.GPGA9del|PDCD6_ENST00000507528.1_In_Frame_Del_p.GPGA9del	NM_001267556.1|NM_001267558.1|NM_013232.3	NP_001254485.1|NP_001254487.1|NP_037364.1	O75340	PDCD6_HUMAN	programmed cell death 6	9					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)	p.A12_G15delAGPG(2)		breast(2)|endometrium(1)|large_intestine(4)|lung(1)	8			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			TCTTACCGCCCCGGCCCTGGGGCCGGCCCTGG	0.741														513	0.102436	0.1316	0.1657	5008	,	,		10520	0.0546		0.0905	False		,,,				2504	0.0798																2	Deletion - In frame(2)	breast(2)						ENSG00000249915			265,2557		60,145,1206						2.2	1.0		dbSNP_126	6	779,5791		158,463,2664	no	coding	PDCD6	NM_013232.3		218,608,3870	A1A1,A1R,RR		11.8569,9.3905,11.1158				1044,8348				PDCD6	SO:0001651	inframe_deletion	0				HGNC	AF035606	CCDS3854.1, CCDS58940.1, CCDS58941.1, CCDS75222.1, CCDS75223.1	5p15.33	2013-01-10			ENSG00000249915	ENSG00000249915		"""EF-hand domain containing"""	8765	protein-coding gene	gene with protein product	"""apoptosis-linked gene-2"""	601057				8560270	Standard	NM_013232		Approved	ALG-2, PEF1B	uc003jat.1	O75340	OTTHUMG00000090283	ENST00000264933.4:c.23_34delCCGGCCCTGGGG	5.37:g.271858_271869delCCGGCCCTGGGG	ENSP00000264933:p.Gly9_Ala12del	Somatic	NA	NA	NA		0.5130446035623836	66	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.AGPG12in_frame_del	ENST00000264933.4	37	c.23_34	CCDS3854.1	5																																																																																			-	NULL		0.741	PDCD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDCD6	protein_coding	OTTHUMT00000206609.2	CCGGCCCTGGGG	NM_013232			271869	+1	no_errors	ENST00000264933	ensembl	human	known	74_37	in_frame_del	DEL	0.730:0.549:0.748:0.757:0.746:0.751:0.779:0.760:0.906:0.916:0.892:0.925	-
PRIM2	5558	genome.wustl.edu	37	6	57512787	57512788	+	3'UTR	INS	-	-	CACCAAGGC	rs373452397|rs376103961|rs386701662|rs79832250		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr6:57512787_57512788insCACCAAGGC	ENST00000389488.2	+	0	1702_1703				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttgcactctgttgtgtaattgt	0.431																																																	0								ENSG00000146143																																			PRIM2	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1700->CACCAAGGC	6.37:g.57512787_57512788insCACCAAGGC		Somatic	NA	NA	NA		0.5130446035623836	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			-	-		0.431	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	protein_coding	OTTHUMT00000043468.3	-	NM_000947			57512788	+1	no_errors	ENST00000389488	ensembl	human	known	74_37	rna	INS	0.057:0.034	CACCAAGGC
ZMYND19	116225	genome.wustl.edu	37	9	140481430	140481430	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr9:140481430delG	ENST00000298585.2	-	4	574	c.348delC	c.(346-348)tccfs	p.S117fs	ZMYND19_ENST00000471957.1_5'Flank	NM_138462.2	NP_612471.1	Q96E35	ZMY19_HUMAN	zinc finger, MYND-type containing 19	117						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|synapse (GO:0045202)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	13	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000275)|Epithelial(140;0.00047)		TCTGCTTGCTGGAGGTCTCTT	0.627																																																	0								ENSG00000165724						48.0	45.0	46.0					9																	140481430		2203	4300	6503	ZMYND19	SO:0001589	frameshift_variant	0				HGNC	BC012948	CCDS7048.1	9q34.3	2008-02-05			ENSG00000165724	ENSG00000165724		"""Zinc fingers, MYND-type"""	21146	protein-coding gene	gene with protein product		611424					Standard	NM_138462		Approved	MIZIP	uc004cno.1	Q96E35	OTTHUMG00000020992	ENST00000298585.2:c.348delC	9.37:g.140481430delG	ENSP00000298585:p.Ser117fs	Somatic	0	96	0.00		0.5130446035623836	49	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	Q5T366	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_MYND,pfscan_Znf_MYND	p.S117fs	ENST00000298585.2	37	c.348	CCDS7048.1	9																																																																																			-	NULL		0.627	ZMYND19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYND19	protein_coding	OTTHUMT00000055356.1	G	NM_138462			140481430	-1	no_errors	ENST00000298585	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
DNAH9	1770	genome.wustl.edu	37	17	11833231	11833231	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr17:11833231G>C	ENST00000262442.4	+	63	11994	c.11926G>C	c.(11926-11928)Gag>Cag	p.E3976Q	DNAH9_ENST00000454412.2_Intron|DNAH9_ENST00000396001.2_3'UTR|DNAH9_ENST00000608377.1_Missense_Mutation_p.E288Q	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3976	AAA 6. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GAAGAAGCTGGAGGAGCACAG	0.587																																																	0								ENSG00000007174						74.0	57.0	63.0					17																	11833231		2203	4300	6503	DNAH9	SO:0001583	missense	0			-	HGNC	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.11926G>C	17.37:g.11833231G>C	ENSP00000262442:p.Glu3976Gln	Somatic	0	55	0.00		0.5130446035623836	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	130	10.34	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.E3976Q	ENST00000262442.4	37	c.11926	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	G	29.7	5.029954	0.93575	.	.	ENSG00000007174	ENST00000262442;ENST00000396001	T;T	0.09817	2.94;2.94	5.19	5.19	0.71726	Dynein heavy chain (1);	0.053068	0.64402	D	0.000001	T	0.43897	0.1268	M	0.91249	3.19	0.80722	D	1	D	0.69078	0.997	D	0.79784	0.993	T	0.54241	-0.8323	10	0.72032	D	0.01	.	18.9079	0.92471	0.0:0.0:1.0:0.0	.	3976	Q9NYC9	DYH9_HUMAN	Q	3976;288	ENSP00000262442:E3976Q;ENSP00000379323:E288Q	ENSP00000262442:E3976Q	E	+	1	0	DNAH9	11773956	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.601000	0.98297	2.699000	0.92147	0.563000	0.77884	GAG	-	pfam_Dynein_heavy_dom		0.587	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	protein_coding	OTTHUMT00000252756.2	G	NM_001372	-		11833231	+1	no_errors	ENST00000262442	ensembl	human	known	74_37	missense	SNP	1.000	C
SIDT1	54847	genome.wustl.edu	37	3	113325932	113325932	+	Silent	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr3:113325932C>T	ENST00000264852.4	+	15	2175	c.1449C>T	c.(1447-1449)ttC>ttT	p.F483F	SIDT1_ENST00000463226.1_Intron|SIDT1_ENST00000393830.3_Silent_p.F483F	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	483					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)			breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						ACTACAACTTCCTCTGTGCTC	0.488																																																	0								ENSG00000072858						144.0	116.0	126.0					3																	113325932		2203	4300	6503	SIDT1	SO:0001819	synonymous_variant	0			-	HGNC	AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.1449C>T	3.37:g.113325932C>T		Somatic	0	104	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	44	22.81	Q17RR4	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.F483	ENST00000264852.4	37	c.1449	CCDS2974.1	3																																																																																			-	NULL		0.488	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT1	protein_coding	OTTHUMT00000317564.1	C	NM_017699	-		113325932	+1	no_errors	ENST00000393830	ensembl	human	known	74_37	silent	SNP	1.000	T
CCDC40	55036	genome.wustl.edu	37	17	78073483	78073483	+	Missense_Mutation	SNP	G	G	A	rs368814379		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr17:78073483G>A	ENST00000397545.4	+	20	3365	c.3338G>A	c.(3337-3339)cGc>cAc	p.R1113H	GAA_ENST00000390015.3_5'Flank|GAA_ENST00000302262.3_5'Flank	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	1113					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			ATCCTGGACCGCGTGCGGGAC	0.652																																																	0								ENSG00000141519	G	HIS/ARG	0,4124		0,0,2062	42.0	48.0	46.0		3338	-0.3	0.0	17		46	1,8403		0,1,4201	no	missense	CCDC40	NM_017950.3	29	0,1,6263	AA,AG,GG		0.0119,0.0,0.0080	benign	1113/1143	78073483	1,12527	2062	4202	6264	CCDC40	SO:0001583	missense	0			-	HGNC	AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.3338G>A	17.37:g.78073483G>A	ENSP00000380679:p.Arg1113His	Somatic	0	76	0.00		0.5130446035623836	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	37	28.85	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_E3_ubiquit_lig_BRE1	p.R1113H	ENST00000397545.4	37	c.3338	CCDS42395.1	17	.	.	.	.	.	.	.	.	.	.	G	7.263	0.605513	0.14002	0.0	1.19E-4	ENSG00000141519	ENST00000397545	T	0.45668	0.89	4.76	-0.311	0.12761	.	.	.	.	.	T	0.18800	0.0451	N	0.04297	-0.235	0.18873	N	0.999985	B;B	0.22276	0.008;0.067	B;B	0.13407	0.004;0.009	T	0.22906	-1.0203	9	0.22109	T	0.4	-13.0511	10.0461	0.42188	0.6186:0.0:0.3814:0.0	.	1113;896	Q4G0X9;Q4G0X9-3	CCD40_HUMAN;.	H	1113	ENSP00000380679:R1113H	ENSP00000380679:R1113H	R	+	2	0	CCDC40	75688078	0.000000	0.05858	0.001000	0.08648	0.054000	0.15201	-0.114000	0.10757	-0.137000	0.11455	-0.290000	0.09829	CGC	-	NULL		0.652	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC40	protein_coding	OTTHUMT00000256005.2	G	XM_371082	-		78073483	+1	no_errors	ENST00000397545	ensembl	human	known	74_37	missense	SNP	0.107	A
MYCBP2	23077	genome.wustl.edu	37	13	77667412	77667412	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr13:77667412T>A	ENST00000544440.2	-	59	10158	c.10141A>T	c.(10141-10143)Atg>Ttg	p.M3381L	MYCBP2_ENST00000357337.6_Missense_Mutation_p.M3381L|MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2_ENST00000407578.2_Missense_Mutation_p.M3419L					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AGATATCTCATTTCATCCTGG	0.378																																																	0								ENSG00000005810						157.0	152.0	154.0					13																	77667412		2203	4300	6503	MYCBP2	SO:0001583	missense	0			-	HGNC	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.10141A>T	13.37:g.77667412T>A	ENSP00000444596:p.Met3381Leu	Somatic	0	67	0.00		0.5130446035623836	46	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_RCC1/BLIP-II,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.M3419L	ENST00000544440.2	37	c.10255		13	.	.	.	.	.	.	.	.	.	.	T	12.09	1.834375	0.32421	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.25912	1.77;1.77;1.77	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.23965	0.0580	N	0.22421	0.69	0.58432	D	0.999997	B	0.27068	0.167	B	0.41332	0.354	T	0.03651	-1.1016	10	0.06625	T	0.88	.	16.0628	0.80852	0.0:0.0:0.0:1.0	.	3381	O75592	MYCB2_HUMAN	L	3381;3419;3381	ENSP00000349892:M3381L;ENSP00000384288:M3419L;ENSP00000444596:M3381L	ENSP00000349892:M3381L	M	-	1	0	MYCBP2	76565413	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.696000	0.84270	2.189000	0.69895	0.455000	0.32223	ATG	-	superfamily_ARM-type_fold		0.378	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	protein_coding	OTTHUMT00000045326.1	T	NM_015057	-		77667412	-1	no_errors	ENST00000407578	ensembl	human	known	74_37	missense	SNP	1.000	A
PLXDC2	84898	genome.wustl.edu	37	10	20568746	20568746	+	Nonstop_Mutation	SNP	T	T	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr10:20568746T>A	ENST00000377252.4	+	14	2429	c.1588T>A	c.(1588-1590)Taa>Aaa	p.*530K	PLXDC2_ENST00000377242.3_Nonstop_Mutation_p.*481K|PLXDC2_ENST00000377238.2_3'UTR	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	0					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						AGAGCAGTGCTAAAATTTCTA	0.403																																																	0								ENSG00000120594						85.0	84.0	84.0					10																	20568746		2203	4300	6503	PLXDC2	SO:0001578	stop_lost	0			-	HGNC	AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.1588T>A	10.37:g.20568746T>A	ENSP00000366460:p.*530Lysext*3	Somatic	0	59	0.00		0.5130446035623836	54	1.82	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	Q96E59|Q96PD9|Q96SU9	Nonstop_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Plexin_repeat,superfamily_Plexin-like_fold,smart_Plexin-like_fold	p.*530K	ENST00000377252.4	37	c.1588	CCDS7132.1	10	.	.	.	.	.	.	.	.	.	.	T	19.56	3.850395	0.71719	.	.	ENSG00000120594	ENST00000377252;ENST00000377242;ENST00000377238;ENST00000536022	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.18873	N	0.999989	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1146	0.81295	0.0:0.0:0.0:1.0	.	.	.	.	K	530;481;393;516	.	.	X	+	1	0	PLXDC2	20608752	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.333000	0.79214	2.260000	0.74910	0.528000	0.53228	TAA	-	NULL		0.403	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXDC2	protein_coding	OTTHUMT00000047101.2	T	NM_032812	-		20568746	+1	no_errors	ENST00000377252	ensembl	human	known	74_37	nonstop	SNP	1.000	A
SREBF2	6721	genome.wustl.edu	37	22	42269822	42269822	+	Silent	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr22:42269822G>T	ENST00000361204.4	+	5	1054	c.888G>T	c.(886-888)ggG>ggT	p.G296G		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	296	Interaction with LMNA. {ECO:0000250}.				cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						GCAGCAGTGGGACCATTCTGA	0.527																																																	0								ENSG00000198911						51.0	38.0	43.0					22																	42269822		2203	4300	6503	SREBF2	SO:0001819	synonymous_variant	0			-	HGNC	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.888G>T	22.37:g.42269822G>T		Somatic	0	83	0.00		0.5130446035623836	157	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.G296	ENST00000361204.4	37	c.888	CCDS14023.1	22																																																																																			-	NULL		0.527	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF2	protein_coding	OTTHUMT00000321956.1	G	NM_004599	-		42269822	+1	no_errors	ENST00000361204	ensembl	human	known	74_37	silent	SNP	0.999	T
CYP4A11	1579	genome.wustl.edu	37	1	47400674	47400674	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr1:47400674G>C	ENST00000310638.4	-	6	819	c.788C>G	c.(787-789)aCa>aGa	p.T263R	CYP4A11_ENST00000457840.2_Intron|CYP4A11_ENST00000462347.1_Intron|CYP4A11_ENST00000371904.4_Missense_Mutation_p.T263R|CYP4A11_ENST00000371905.1_Missense_Mutation_p.T263R|CYP4A11_ENST00000496519.1_5'Flank	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	263					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)			endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	GACAGAACCTGTGTGCTGATG	0.582																																																	0								ENSG00000187048						117.0	115.0	116.0					1																	47400674		2203	4300	6503	CYP4A11	SO:0001583	missense	0			-	HGNC	L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.788C>G	1.37:g.47400674G>C	ENSP00000311095:p.Thr263Arg	Somatic	0	56	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-II,prints_Cyt_P450_E_grp-IV	p.T263R	ENST00000310638.4	37	c.788	CCDS543.1	1	.	.	.	.	.	.	.	.	.	.	N	23.1	4.373327	0.82573	.	.	ENSG00000187048	ENST00000310638;ENST00000371904;ENST00000371905	T;T;T	0.70045	-0.45;-0.34;-0.45	5.13	5.13	0.70059	.	0.053373	0.64402	D	0.000001	D	0.85230	0.5649	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.88034	0.2777	10	0.87932	D	0	.	18.9327	0.92572	0.0:0.0:1.0:0.0	.	263	Q02928	CP4AB_HUMAN	R	263	ENSP00000311095:T263R;ENSP00000360971:T263R;ENSP00000360972:T263R	ENSP00000311095:T263R	T	-	2	0	CYP4A11	47173261	1.000000	0.71417	1.000000	0.80357	0.685000	0.39939	8.032000	0.88838	2.551000	0.86045	0.650000	0.86243	ACA	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.582	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYP4A11	protein_coding	OTTHUMT00000022022.1	G	NM_000778	-		47400674	-1	no_errors	ENST00000371904	ensembl	human	known	74_37	missense	SNP	1.000	C
ARHGAP31	57514	genome.wustl.edu	37	3	119133384	119133384	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr3:119133384A>T	ENST00000264245.4	+	12	3140	c.2608A>T	c.(2608-2610)Atc>Ttc	p.I870F		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	870					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						GGAGGTTGAGATCGTCTCACA	0.507																																					Pancreas(7;176 297 5394 51128 51241)												0								ENSG00000031081						91.0	94.0	93.0					3																	119133384		2046	4200	6246	ARHGAP31	SO:0001583	missense	0			-	HGNC		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2608A>T	3.37:g.119133384A>T	ENSP00000264245:p.Ile870Phe	Somatic	0	71	0.00		0.5130446035623836	33	15.38	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	31	44.64	Q9ULL6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.I870F	ENST00000264245.4	37	c.2608	CCDS43135.1	3	.	.	.	.	.	.	.	.	.	.	A	13.03	2.115588	0.37339	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.08896	3.04	4.66	-4.97	0.03029	.	1.287970	0.05227	N	0.509661	T	0.04952	0.0133	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.43572	-0.9383	10	0.62326	D	0.03	.	2.0635	0.03597	0.4031:0.1316:0.3374:0.1279	.	870	Q2M1Z3	RHG31_HUMAN	F	870	ENSP00000264245:I870F	ENSP00000264245:I870F	I	+	1	0	ARHGAP31	120616074	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-1.536000	0.02208	-0.767000	0.04633	-0.366000	0.07423	ATC	-	NULL		0.507	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP31	protein_coding	OTTHUMT00000354942.2	A		-		119133384	+1	no_errors	ENST00000264245	ensembl	human	known	74_37	missense	SNP	0.000	T
PPP1R13B	23368	genome.wustl.edu	37	14	104202499	104202499	+	Silent	SNP	C	C	T	rs375070779		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr14:104202499C>T	ENST00000202556.9	-	16	3354	c.3072G>A	c.(3070-3072)gcG>gcA	p.A1024A	PPP1R13B_ENST00000423488.2_Missense_Mutation_p.V388I|PPP1R13B_ENST00000555391.1_5'UTR	NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B	1024	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				ACAGAGCATACGCCACACCTT	0.607																																																	0								ENSG00000088808	C		0,4316		0,0,2158	142.0	145.0	144.0		3072	-0.1	0.6	14		144	1,8503		0,1,4251	no	coding-synonymous	PPP1R13B	NM_015316.2		0,1,6409	TT,TC,CC		0.0118,0.0,0.0078		1024/1091	104202499	1,12819	2158	4252	6410	PPP1R13B	SO:0001819	synonymous_variant	0			-	HGNC	AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.3072G>A	14.37:g.104202499C>T		Somatic	0	80	0.00		0.5130446035623836	30	30.23	13	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	32	39.62	B2RMX5|O94870	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V388I	ENST00000202556.9	37	c.1162	CCDS41997.1	14	.	.	.	.	.	.	.	.	.	.	C	17.30	3.353459	0.61293	0.0	1.18E-4	ENSG00000088808	ENST00000423488	T	0.53640	0.61	5.39	-0.0717	0.13742	.	.	.	.	.	T	0.28797	0.0714	.	.	.	0.21184	N	0.999764	.	.	.	.	.	.	T	0.28235	-1.0050	6	0.16420	T	0.52	.	7.3741	0.26818	0.0:0.4407:0.3602:0.199	.	.	.	.	I	388	ENSP00000395213:V388I	ENSP00000395213:V388I	V	-	1	0	PPP1R13B	103272252	0.995000	0.38212	0.635000	0.29338	0.951000	0.60555	0.527000	0.22987	0.230000	0.21059	0.555000	0.69702	GTA	-	NULL		0.607	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R13B	protein_coding	OTTHUMT00000414591.1	C	NM_015316	-		104202499	-1	no_errors	ENST00000423488	ensembl	human	known	74_37	missense	SNP	1.000	T
ITGAV	3685	genome.wustl.edu	37	2	187529902	187529902	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr2:187529902A>C	ENST00000261023.3	+	21	2397	c.2123A>C	c.(2122-2124)cAg>cCg	p.Q708P	ITGAV_ENST00000433736.2_Missense_Mutation_p.Q662P|AC017101.10_ENST00000453665.1_RNA|ITGAV_ENST00000374907.3_Missense_Mutation_p.Q672P	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	708					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	CAAACTCGCCAGGTGGTATGT	0.353																																					Melanoma(58;108 1995 6081)												0								ENSG00000138448						74.0	75.0	74.0					2																	187529902		2203	4300	6503	ITGAV	SO:0001583	missense	0			-	HGNC		CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.2123A>C	2.37:g.187529902A>C	ENSP00000261023:p.Gln708Pro	Somatic	0	74	0.00		0.5130446035623836	112	53.72	130	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	35	12.50	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.Q708P	ENST00000261023.3	37	c.2123	CCDS2292.1	2	.	.	.	.	.	.	.	.	.	.	A	16.02	3.003951	0.54254	.	.	ENSG00000138448	ENST00000261023;ENST00000374907;ENST00000433736	T;T;T	0.46819	0.86;0.86;0.86	5.89	5.89	0.94794	Integrin alpha-2 (1);	0.276884	0.40222	N	0.001159	T	0.37320	0.0999	N	0.19112	0.55	0.32286	N	0.567009	P;P;P	0.46784	0.884;0.817;0.884	B;P;B	0.45343	0.377;0.477;0.377	T	0.54043	-0.8352	10	0.72032	D	0.01	.	9.7992	0.40753	0.7446:0.0:0.0:0.2554	.	662;672;708	E7EWZ6;P06756-2;P06756	.;.;ITAV_HUMAN	P	708;672;662	ENSP00000261023:Q708P;ENSP00000364042:Q672P;ENSP00000404291:Q662P	ENSP00000261023:Q708P	Q	+	2	0	ITGAV	187238147	0.954000	0.32549	1.000000	0.80357	0.998000	0.95712	2.298000	0.43602	2.250000	0.74265	0.477000	0.44152	CAG	-	pfam_Integrin_alpha-2		0.353	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAV	protein_coding	OTTHUMT00000255882.2	A	NM_002210	-		187529902	+1	no_errors	ENST00000261023	ensembl	human	known	74_37	missense	SNP	0.990	C
HTR1B	3351	genome.wustl.edu	37	6	78172797	78172797	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr6:78172797C>T	ENST00000369947.2	-	1	693	c.324G>A	c.(322-324)atG>atA	p.M108I		NM_000863.1	NP_000854.1	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled	108					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|bone remodeling (GO:0046849)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to temperature stimulus (GO:0071502)|drinking behavior (GO:0042756)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	25		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Methysergide(DB00247)|Naratriptan(DB00952)|Olanzapine(DB00334)|Ondansetron(DB00904)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	TGACAGTGTACATGGTGCTGA	0.607																																																	0								ENSG00000135312						118.0	97.0	104.0					6																	78172797		2203	4300	6503	HTR1B	SO:0001583	missense	0			-	HGNC	BC069065	CCDS4986.1	6q13	2012-08-08	2012-02-03		ENSG00000135312	ENSG00000135312		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5287	protein-coding gene	gene with protein product		182131	"""5-hydroxytryptamine (serotonin) receptor 1B"""			1348246, 11247661	Standard	NM_000863		Approved	S12, 5-HT1B, HTR1D2, 5-HT1DB	uc003pil.1	P28222	OTTHUMG00000015066	ENST00000369947.2:c.324G>A	6.37:g.78172797C>T	ENSP00000358963:p.Met108Ile	Somatic	0	57	0.00		0.5130446035623836	24	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q4VAY7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_5HT1B_rcpt,prints_5HT_rcpt,prints_ADR_fam	p.M108I	ENST00000369947.2	37	c.324	CCDS4986.1	6	.	.	.	.	.	.	.	.	.	.	C	10.47	1.357840	0.24598	.	.	ENSG00000135312	ENST00000369947	T	0.71222	-0.55	5.07	5.07	0.68467	GPCR, rhodopsin-like superfamily (1);	0.364079	0.29822	N	0.011103	T	0.20210	0.0486	N	0.00885	-1.115	0.42311	D	0.992217	B	0.13594	0.008	B	0.17979	0.02	T	0.29549	-1.0008	9	.	.	.	.	11.0963	0.48145	0.0:0.9162:0.0:0.0838	.	108	P28222	5HT1B_HUMAN	I	108	ENSP00000358963:M108I	.	M	-	3	0	HTR1B	78229516	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.120000	0.31271	2.640000	0.89533	0.561000	0.74099	ATG	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_ADR_fam		0.607	HTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1B	protein_coding	OTTHUMT00000041292.1	C	NM_000863	-		78172797	-1	no_errors	ENST00000369947	ensembl	human	known	74_37	missense	SNP	1.000	T
RBM28	55131	genome.wustl.edu	37	7	127965931	127965931	+	Silent	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr7:127965931G>T	ENST00000223073.2	-	11	1257	c.1143C>A	c.(1141-1143)gcC>gcA	p.A381A	RBM28_ENST00000415472.2_Silent_p.A240A	NM_018077.2	NP_060547.2	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	381	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(7)|large_intestine(3)|lung(8)|ovary(2)	21						TCATGAACTGGGCAAATGCAC	0.448																																																	0								ENSG00000106344						71.0	64.0	66.0					7																	127965931		2203	4300	6503	RBM28	SO:0001819	synonymous_variant	0			-	HGNC	AK001239	CCDS5801.1, CCDS55159.1	7q32.2	2013-02-12			ENSG00000106344	ENSG00000106344		"""RNA binding motif (RRM) containing"""	21863	protein-coding gene	gene with protein product		612074					Standard	NM_018077		Approved	FLJ10377	uc003vmp.2	Q9NW13	OTTHUMG00000157711	ENST00000223073.2:c.1143C>A	7.37:g.127965931G>T		Somatic	0	19	0.00		0.5130446035623836	46	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33	A4D100|B4DU52|E9PDD9|Q53H65|Q96CV3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.A381	ENST00000223073.2	37	c.1143	CCDS5801.1	7																																																																																			-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.448	RBM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM28	protein_coding	OTTHUMT00000349442.2	G	NM_018077	-		127965931	-1	no_errors	ENST00000223073	ensembl	human	known	74_37	silent	SNP	0.895	T
OR7E14P	10819	genome.wustl.edu	37	11	17073884	17073884	+	RNA	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:17073884G>A	ENST00000530490.1	+	0	676				AC116533.2_ENST00000583154.1_RNA					olfactory receptor, family 7, subfamily E, member 14 pseudogene																		TCTCCTATGCGGGCTGCCTGA	0.512																																																	0								ENSG00000184669																																			OR7E14P			0			-	HGNC	AF065856		11p15.1	2012-08-09			ENSG00000184669	ENSG00000184669		"""GPCR / Class A : Olfactory receptors"""	8385	pseudogene	pseudogene				OR7E151P		9787077	Standard	NR_045002		Approved	OR11-5	uc021qeh.1		OTTHUMG00000165955		11.37:g.17073884G>A		Somatic	1	100	0.99		0.5130446035623836	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	67	9.46		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000530490.1	37	NULL		11																																																																																			-	-		0.512	OR7E14P-002	KNOWN	basic	processed_transcript	OR7E14P	pseudogene	OTTHUMT00000387319.1	G		-		17073884	+1	no_errors	ENST00000530490	ensembl	human	known	74_37	rna	SNP	0.003	A
DIAPH2	1730	genome.wustl.edu	37	X	96197015	96197015	+	Splice_Site	SNP	A	A	G			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chrX:96197015A>G	ENST00000324765.8	+	13	1672		c.e13-1		DIAPH2_ENST00000373049.4_Splice_Site|DIAPH2_ENST00000373054.4_Splice_Site|DIAPH2_ENST00000355827.4_Splice_Site|DIAPH2_ENST00000373061.3_Splice_Site			O60879	DIAP2_HUMAN	diaphanous-related formin 2						actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						TCTCCTTTTCAGGCCACAATA	0.353																																																	0								ENSG00000147202						101.0	98.0	99.0					X																	96197015		2203	4300	6503	DIAPH2	SO:0001630	splice_region_variant	0			-	HGNC	Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.1326-1A>G	X.37:g.96197015A>G		Somatic	0	49	0.00		0.5130446035623836	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e13-2	ENST00000324765.8	37	c.1326-2	CCDS14467.1	X	.	.	.	.	.	.	.	.	.	.	A	11.84	1.758575	0.31137	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5657	0.68173	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DIAPH2	96083671	1.000000	0.71417	0.948000	0.38648	0.023000	0.10783	8.742000	0.91588	1.900000	0.55004	0.481000	0.45027	.	-	-		0.353	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH2	protein_coding	OTTHUMT00000058871.2	A	NM_006729, NM_007309	-	Intron	96197015	+1	no_errors	ENST00000324765	ensembl	human	known	74_37	splice_site	SNP	0.998	G
ADCYAP1R1	117	genome.wustl.edu	37	7	31124408	31124408	+	Silent	SNP	C	C	G			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr7:31124408C>G	ENST00000304166.4	+	8	784	c.495C>G	c.(493-495)ctC>ctG	p.L165L	ADCYAP1R1_ENST00000409363.1_Silent_p.L144L|ADCYAP1R1_ENST00000409489.1_Silent_p.L165L|ADCYAP1R1_ENST00000396211.2_Silent_p.L165L	NM_001118.4|NM_001199635.1|NM_001199636.1	NP_001109.2|NP_001186564.1|NP_001186565.1	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary) receptor type I	165					activation of adenylate cyclase activity (GO:0007190)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(1)|large_intestine(4)|liver(2)|lung(24)|ovary(1)|skin(2)|stomach(1)	35						GCACATCCCTCGTCACCCTCA	0.557																																					Ovarian(44;225 1186 2158 11092)												0								ENSG00000078549						296.0	218.0	245.0					7																	31124408		2203	4300	6503	ADCYAP1R1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS5433.1, CCDS56480.1, CCDS56481.1	7p14.3	2012-09-20			ENSG00000078549	ENSG00000078549		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	242	protein-coding gene	gene with protein product	"""PACAP receptor 1"""	102981				7902709	Standard	NM_001199635		Approved	PAC1, PACAPR, PAC1R	uc003tcg.3	P41586	OTTHUMG00000023884	ENST00000304166.4:c.495C>G	7.37:g.31124408C>G		Somatic	0	76	0.00		0.5130446035623836	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	54	19.40	A8K1Y1|B7ZLA7|B8ZZK3|Q17S10	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_PACAP_1_rcpt,prints_GPCR_2_secretin-like	p.L165	ENST00000304166.4	37	c.495	CCDS5433.1	7																																																																																			-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like		0.557	ADCYAP1R1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADCYAP1R1	protein_coding	OTTHUMT00000215041.3	C	NM_001118	-		31124408	+1	no_errors	ENST00000304166	ensembl	human	known	74_37	silent	SNP	0.304	G
FNBP1	23048	genome.wustl.edu	37	9	132687393	132687393	+	Missense_Mutation	SNP	G	G	T	rs199820551		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr9:132687393G>T	ENST00000446176.2	-	9	1019	c.833C>A	c.(832-834)cCt>cAt	p.P278H	FNBP1_ENST00000478129.1_5'UTR|FNBP1_ENST00000355681.3_Missense_Mutation_p.P278H|FNBP1_ENST00000420781.1_Missense_Mutation_p.P278H	NM_015033.2	NP_055848.1	Q96RU3	FNBP1_HUMAN	formin binding protein 1	278	F-BAR domain.|Interaction with microtubules. {ECO:0000250}.|Required for self-association and induction of membrane tubulation.				endocytosis (GO:0006897)	coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)						Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)		GTCTCCAGGAGGCTCAAACCC	0.403			T	MLL	AML																																			Dom	yes		9	9q23	23048	formin binding protein 1 (FBP17)		L	0								ENSG00000187239						133.0	125.0	127.0					9																	132687393		1871	4106	5977	FNBP1	SO:0001583	missense	0			-	HGNC	AB011126	CCDS48040.1	9q34	2008-02-05			ENSG00000187239	ENSG00000187239			17069	protein-coding gene	gene with protein product		606191				9628581, 11438682	Standard	XM_005251815		Approved	FBP17, KIAA0554	uc004byw.1	Q96RU3	OTTHUMG00000020800	ENST00000446176.2:c.833C>A	9.37:g.132687393G>T	ENSP00000413625:p.Pro278His	Somatic	0	81	0.00		0.5130446035623836	190	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	O60301|Q3MIN8|Q5TC87|Q5TC88|Q6P658|Q7LGG2|Q9H8H8|Q9NWD1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Ribosomal_S20,superfamily_HR1_rho-bd,smart_FCH_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain	p.P278H	ENST00000446176.2	37	c.833	CCDS48040.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.6|22.6	4.316985|4.316985	0.81469|0.81469	.|.	.|.	ENSG00000187239|ENSG00000187239	ENST00000449089|ENST00000372416;ENST00000446176;ENST00000420781;ENST00000372415;ENST00000355681	.|T;T;T	.|0.19938	.|2.11;2.11;2.11	5.34|5.34	5.34|5.34	0.76211|0.76211	.|.	.|0.104534	.|0.64402	.|D	.|0.000002	T|T	0.51295|0.51295	0.1666|0.1666	M|M	0.81112|0.81112	2.525|2.525	0.80722|0.80722	D|D	1|1	.|P;D;P;D;D;P;D	.|0.89917	.|0.804;1.0;0.895;1.0;1.0;0.876;1.0	.|B;D;B;D;D;B;D	.|0.87578	.|0.181;0.998;0.369;0.992;0.998;0.313;0.992	T|T	0.55289|0.55289	-0.8164|-0.8164	5|10	.|0.87932	.|D	.|0	-17.0034|-17.0034	18.4048|18.4048	0.90532|0.90532	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|278;278;278;278;239;278;278	.|B7ZL12;B7ZL13;B7ZL14;Q96RU3-3;Q5QP69;Q96RU3-2;Q96RU3	.|.;.;.;.;.;.;FNBP1_HUMAN	I|H	240|278	.|ENSP00000413625:P278H;ENSP00000407548:P278H;ENSP00000347907:P278H	.|ENSP00000347907:P278H	L|P	-|-	1|2	0|0	FNBP1|FNBP1	131727214|131727214	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.986000|0.986000	0.74619|0.74619	9.278000|9.278000	0.95766|0.95766	2.655000|2.655000	0.90218|0.90218	0.462000|0.462000	0.41574|0.41574	CTC|CCT	-	NULL		0.403	FNBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FNBP1	protein_coding	OTTHUMT00000054630.2	G		-		132687393	-1	no_errors	ENST00000446176	ensembl	human	known	74_37	missense	SNP	1.000	T
OR5AC2	81050	genome.wustl.edu	37	3	97806244	97806244	+	Silent	SNP	A	A	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr3:97806244A>C	ENST00000358642.2	+	1	228	c.228A>C	c.(226-228)tcA>tcC	p.S76S		NM_054106.1	NP_473447.1	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC, member 2	76					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	28						CTTGTACTTCAACCTCTATAA	0.428																																																	0								ENSG00000196578						232.0	225.0	227.0					3																	97806244		2203	4300	6503	OR5AC2	SO:0001819	synonymous_variant	0			-	HGNC	AF179759	CCDS33796.1	3q11.2	2013-09-23			ENSG00000196578	ENSG00000196578		"""GPCR / Class A : Olfactory receptors"""	15431	protein-coding gene	gene with protein product							Standard	NM_054106		Approved	HSA1	uc011bgs.2	Q9NZP5	OTTHUMG00000160083	ENST00000358642.2:c.228A>C	3.37:g.97806244A>C		Somatic	0	60	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	46	14.81		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S76	ENST00000358642.2	37	c.228	CCDS33796.1	3																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.428	OR5AC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AC2	protein_coding	OTTHUMT00000359116.1	A		-		97806244	+1	no_errors	ENST00000358642	ensembl	human	known	74_37	silent	SNP	0.001	C
XXbac-BPG154L12.4	0	genome.wustl.edu	37	6	32231727	32231727	+	RNA	DEL	T	T	-			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr6:32231727delT	ENST00000425033.1	+	0	1570																											tctttctttCTtttttttttt	0.308																																																	0								ENSG00000225914			47,334,150,13,1154		6,3,11,0,21,50,38,0,193,3,0,95,4,5,420	92.0	74.0	79.0				0.4	6	dbSNP_134	83	19,831,21,39,2792		3,1,1,0,11,119,3,2,587,0,0,17,7,23,1077	no	intergenic				9,4,12,0,32,169,41,2,780,3,0,112,11,28,1497	A1A1,A1A2,A1A3,A1A4,A1R,A2A2,A2A3,A2A4,A2R,A3A3,A3A4,A3R,A4A4,A4R,RR		24.5813,32.0377,26.9259			32231727	66,1165,171,52,3946	692	1585	2277	XXbac-BPG154L12.4			0				Clone_based_vega_gene																													6.37:g.32231727delT		Somatic	0	37	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000425033.1	37	NULL		6																																																																																			-	-		0.308	XXbac-BPG154L12.4-001	KNOWN	basic|exp_conf	antisense	ENSG00000225914	antisense	OTTHUMT00000316882.1	T				32231727	+1	no_errors	ENST00000425033	ensembl	human	known	74_37	rna	DEL	0.374	-
BTG4	54766	genome.wustl.edu	37	11	111369380	111369380	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:111369380G>C	ENST00000356018.2	-	2	321	c.122C>G	c.(121-123)aCa>aGa	p.T41R	BTG4_ENST00000525791.1_Missense_Mutation_p.T41R	NM_017589.3	NP_060059.1	Q9NY30	BTG4_HUMAN	B-cell translocation gene 4	41					cell cycle arrest (GO:0007050)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|neuron differentiation (GO:0030182)					large_intestine(2)|upper_aerodigestive_tract(1)	3		all_cancers(61;3.78e-13)|all_epithelial(67;5.29e-08)|Melanoma(852;3.15e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0204)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;1.22e-06)|BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|all cancers(92;2.18e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0509)		ACTTCTGTATGTTTCAAACAA	0.413																																																	0								ENSG00000137707						129.0	111.0	117.0					11																	111369380		2201	4297	6498	BTG4	SO:0001583	missense	0			-	HGNC	AJ271351	CCDS8346.1	11q23	2008-05-27				ENSG00000137707			13862	protein-coding gene	gene with protein product		605673				10995567	Standard	NM_017589		Approved	PC3B	uc001plj.3	Q9NY30		ENST00000356018.2:c.122C>G	11.37:g.111369380G>C	ENSP00000348300:p.Thr41Arg	Somatic	0	68	0.00		0.5130446035623836	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	38	11.63	Q8NEH7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Anti_prolifrtn,smart_Anti_prolifrtn,prints_Anti_prolifrtn	p.T41R	ENST00000356018.2	37	c.122	CCDS8346.1	11	.	.	.	.	.	.	.	.	.	.	G	11.43	1.635100	0.29068	.	.	ENSG00000137707	ENST00000356018;ENST00000525791;ENST00000456861	.	.	.	5.47	4.48	0.54585	Anti-proliferative protein (3);	0.243504	0.46758	D	0.000278	T	0.14227	0.0344	N	0.01668	-0.77	0.27557	N	0.950305	B;B	0.22003	0.002;0.063	B;B	0.22152	0.01;0.038	T	0.17501	-1.0367	9	0.14656	T	0.56	.	12.7162	0.57117	0.0:0.0:0.445:0.555	.	41;41	Q8NEH7;Q9NY30	.;BTG4_HUMAN	R	41	.	ENSP00000348300:T41R	T	-	2	0	BTG4	110874590	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	3.754000	0.55189	1.103000	0.41568	0.591000	0.81541	ACA	-	pfam_Anti_prolifrtn,smart_Anti_prolifrtn,prints_Anti_prolifrtn		0.413	BTG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTG4	protein_coding	OTTHUMT00000391177.1	G		-		111369380	-1	no_errors	ENST00000356018	ensembl	human	known	74_37	missense	SNP	0.974	C
KAT7	11143	genome.wustl.edu	37	17	47869337	47869337	+	Silent	SNP	A	A	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr17:47869337A>C	ENST00000259021.4	+	2	385	c.105A>C	c.(103-105)acA>acC	p.T35T	KAT7_ENST00000424009.2_Silent_p.T35T|KAT7_ENST00000454930.2_Silent_p.T35T|KAT7_ENST00000510819.1_Silent_p.T35T|KAT7_ENST00000435742.2_5'UTR|KAT7_ENST00000503935.2_5'UTR|KAT7_ENST00000509773.1_Silent_p.T35T|FAM117A_ENST00000514018.1_5'Flank	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	35	Ser-rich.				chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GTGATGGCACATCCCGACGAT	0.478																																																	0								ENSG00000136504						134.0	120.0	125.0					17																	47869337		2203	4300	6503	KAT7	SO:0001819	synonymous_variant	0			-	HGNC	AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.105A>C	17.37:g.47869337A>C		Somatic	0	101	0.00		0.5130446035623836	83	35.88	47	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	50	23.08	B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MOZ_SAS,pfam_Znf_C2HC,superfamily_Acyl_CoA_acyltransferase	p.T35	ENST00000259021.4	37	c.105	CCDS11554.1	17																																																																																			-	NULL		0.478	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT7	protein_coding	OTTHUMT00000366032.1	A	NM_007067	-		47869337	+1	no_errors	ENST00000259021	ensembl	human	known	74_37	silent	SNP	0.112	C
HS3ST1	9957	genome.wustl.edu	37	4	11401252	11401252	+	Silent	SNP	C	C	T	rs190695013		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr4:11401252C>T	ENST00000002596.5	-	2	1552	c.378G>A	c.(376-378)tcG>tcA	p.S126S		NM_005114.2	NP_005105.1	O14792	HS3S1_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 1	126					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|sulfotransferase activity (GO:0008146)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(3)	15						GCACTTTGGGCGACGTGAAAT	0.607																																																	0								ENSG00000002587						65.0	64.0	65.0					4																	11401252		2203	4300	6503	HS3ST1	SO:0001819	synonymous_variant	0			-	HGNC	AF019386	CCDS3408.1	4p16	2008-02-05			ENSG00000002587	ENSG00000002587	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5194	protein-coding gene	gene with protein product		603244				9988767	Standard	NM_005114		Approved	3OST1	uc003gmq.3	O14792	OTTHUMG00000090547	ENST00000002596.5:c.378G>A	4.37:g.11401252C>T		Somatic	0	68	0.00		0.5130446035623836	16	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	26	27.78	B3KUA6|Q6PEY8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.S126	ENST00000002596.5	37	c.378	CCDS3408.1	4																																																																																			-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase		0.607	HS3ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST1	protein_coding	OTTHUMT00000207073.3	C	NM_005114	-		11401252	-1	no_errors	ENST00000002596	ensembl	human	known	74_37	silent	SNP	0.988	T
TBP	6908	genome.wustl.edu	37	6	170871055	170871055	+	Silent	SNP	G	G	A	rs112928724|rs369312237		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr6:170871055G>A	ENST00000392092.2	+	3	510	c.231G>A	c.(229-231)caG>caA	p.Q77Q	TBP_ENST00000230354.6_Silent_p.Q77Q|TBP_ENST00000540980.1_Silent_p.Q57Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	77	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		aacagcagcagcagcagcagc	0.572																																																	0								ENSG00000112592						14.0	18.0	17.0					6																	170871055		1934	3804	5738	TBP	SO:0001819	synonymous_variant	0			-	HGNC	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.231G>A	6.37:g.170871055G>A		Somatic	0	92	0.00		0.5130446035623836	29	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	55	8.20	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TBP,prints_TBP	p.Q77	ENST00000392092.2	37	c.231	CCDS5315.1	6																																																																																			-	NULL		0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	protein_coding	OTTHUMT00000043271.2	G	NM_003194	rs112928724		170871055	+1	no_errors	ENST00000230354	ensembl	human	known	74_37	silent	SNP	0.993	A
ABCA4	24	genome.wustl.edu	37	1	94497568	94497568	+	Silent	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr1:94497568G>A	ENST00000370225.3	-	27	3980	c.3894C>T	c.(3892-3894)aaC>aaT	p.N1298N		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1298					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GGTGTCGGGGGTTGACGTTTT	0.527																																																	0								ENSG00000198691						61.0	69.0	66.0					1																	94497568		2203	4299	6502	ABCA4	SO:0001819	synonymous_variant	0			-	HGNC	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.3894C>T	1.37:g.94497568G>A		Somatic	0	111	0.00		0.5130446035623836	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	30	60.53	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Rim_ABC_transpt	p.N1298	ENST00000370225.3	37	c.3894	CCDS747.1	1																																																																																			-	tigrfam_Rim_ABC_transpt		0.527	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	protein_coding	OTTHUMT00000029320.1	G	NM_000350	-		94497568	-1	no_errors	ENST00000370225	ensembl	human	known	74_37	silent	SNP	0.000	A
CAPN8	388743	genome.wustl.edu	37	1	223718162	223718162	+	Silent	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr1:223718162G>A	ENST00000366872.5	-	17	1817	c.1818C>T	c.(1816-1818)caC>caT	p.H606H				A6NHC0	CAN8_HUMAN	calpain 8	628	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.|EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)	4						TCCTCATCTCGTGGGCATCGA	0.478																																																	0								ENSG00000203697						105.0	91.0	96.0					1																	223718162		692	1591	2283	CAPN8	SO:0001819	synonymous_variant	0			-	HGNC		CCDS73038.1	1q41	2013-01-10	2007-02-21		ENSG00000203697	ENSG00000203697		"""EF-hand domain containing"""	1485	protein-coding gene	gene with protein product			"""calpain 8 (nCL-2)"""			7690035, 8889549	Standard	NM_001143962		Approved	nCL-2	uc009xee.2	A6NHC0	OTTHUMG00000037378	ENST00000366872.5:c.1818C>T	1.37:g.223718162G>A		Somatic	0	89	0.00		0.5130446035623836	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	44	25.42	B2RXL2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.H606	ENST00000366872.5	37	c.1818		1																																																																																			-	NULL		0.478	CAPN8-201	KNOWN	basic|appris_principal	protein_coding	CAPN8	protein_coding		G	NM_001143962	-		223718162	-1	no_errors	ENST00000366872	ensembl	human	known	74_37	silent	SNP	0.534	A
KIAA1210	57481	genome.wustl.edu	37	X	118215393	118215393	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chrX:118215393C>T	ENST00000402510.2	-	14	5028	c.5029G>A	c.(5029-5031)Gcc>Acc	p.A1677T		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1677										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TGGAACTTGGCTGGGAGAGTT	0.468																																																	0								ENSG00000250423						168.0	154.0	158.0					X																	118215393		1897	4102	5999	KIAA1210	SO:0001583	missense	0			-	HGNC	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.5029G>A	X.37:g.118215393C>T	ENSP00000384670:p.Ala1677Thr	Somatic	0	60	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A1677T	ENST00000402510.2	37	c.5029	CCDS48156.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.58|15.58	2.877029|2.877029	0.51801|0.51801	.|.	.|.	ENSG00000250423|ENSG00000248857	ENST00000402510|ENST00000440399	T|.	0.10668|.	2.85|.	5.12|5.12	-2.55|-2.55	0.06288|0.06288	.|.	.|.	.|.	.|.	.|.	T|T	0.31451|0.31451	0.0797|0.0797	L|L	0.46947|0.46947	1.48|1.48	0.09310|0.09310	N|N	1|1	B|.	0.32573|.	0.376|.	B|.	0.33392|.	0.163|.	T|T	0.30504|0.30504	-0.9976|-0.9976	9|5	0.27785|.	T|.	0.31|.	.|.	1.924|1.924	0.03313|0.03313	0.1279:0.3205:0.1287:0.4229|0.1279:0.3205:0.1287:0.4229	.|.	1677|.	Q9ULL0|.	K1210_HUMAN|.	T|N	1677|1083	ENSP00000384670:A1677T|.	ENSP00000384670:A1677T|.	A|S	-|-	1|2	0|0	RP13-347D8.6|KIAA1210	118099421|118099421	0.007000|0.007000	0.16637|0.16637	0.000000|0.000000	0.03702|0.03702	0.007000|0.007000	0.05969|0.05969	-0.427000|-0.427000	0.06999|0.06999	-0.912000|-0.912000	0.03837|0.03837	-1.130000|-1.130000	0.01982|0.01982	GCC|AGC	-	NULL		0.468	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	protein_coding	OTTHUMT00000371251.2	C	NM_020721	-		118215393	-1	no_errors	ENST00000402510	ensembl	human	known	74_37	missense	SNP	0.000	T
TKTL1	8277	genome.wustl.edu	37	X	153537746	153537746	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chrX:153537746G>T	ENST00000369915.3	+	3	491	c.302G>T	c.(301-303)gGa>gTa	p.G101V	TKTL1_ENST00000369912.2_Missense_Mutation_p.G45V|TKTL1_ENST00000217905.7_Intron	NM_001145933.1|NM_012253.3	NP_001139405.1|NP_036385.3	P51854	TKTL1_HUMAN	transketolase-like 1	101					glucose catabolic process (GO:0006007)|thiamine metabolic process (GO:0006772)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			NS(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(5)|prostate(1)|skin(1)|urinary_tract(2)	34	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CAAGGACTGGGAGTTGCATGT	0.532																																																	0								ENSG00000007350						329.0	278.0	296.0					X																	153537746		2203	4300	6503	TKTL1	SO:0001583	missense	0			-	HGNC	X91817	CCDS35448.1, CCDS55541.1	Xq28	2008-02-05			ENSG00000007350	ENSG00000007350			11835	protein-coding gene	gene with protein product		300044				8838793	Standard	NM_012253		Approved	TKR, TKT2	uc004fkg.3	P51854	OTTHUMG00000022707	ENST00000369915.3:c.302G>T	X.37:g.153537746G>T	ENSP00000358931:p.Gly101Val	Somatic	0	47	0.00		0.5130446035623836	0	100.00	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	5	83.33	A8K896|Q5TYJ8|Q5TYJ9|Q8TC75	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transketolase_N,pfam_Transketolase-like_Pyr-bd,pfam_Transketolase_C,pfam_DH_E1,superfamily_Transketo_C/Pyr-ferredox_oxred,smart_Transketolase-like_Pyr-bd	p.G101V	ENST00000369915.3	37	c.302	CCDS35448.1	X	.	.	.	.	.	.	.	.	.	.	G	16.54	3.152625	0.57259	.	.	ENSG00000007350	ENST00000369915;ENST00000441970;ENST00000426989;ENST00000369912	T;T;T	0.30981	1.51;1.51;1.51	4.88	4.88	0.63580	Transketolase, N-terminal (1);	0.055419	0.64402	D	0.000001	T	0.63153	0.2487	M	0.90483	3.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.71189	-0.4666	10	0.59425	D	0.04	-25.6937	16.0378	0.80642	0.0:0.0:1.0:0.0	.	95;101	B7Z7I0;P51854	.;TKTL1_HUMAN	V	101;45;101;45	ENSP00000358931:G101V;ENSP00000401111:G101V;ENSP00000358928:G45V	ENSP00000358928:G45V	G	+	2	0	TKTL1	153190940	1.000000	0.71417	0.842000	0.33263	0.027000	0.11550	9.275000	0.95738	2.391000	0.81399	0.600000	0.82982	GGA	-	pfam_Transketolase_N,pfam_DH_E1		0.532	TKTL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TKTL1	protein_coding	OTTHUMT00000058923.1	G	NM_012253	-		153537746	+1	no_errors	ENST00000369915	ensembl	human	known	74_37	missense	SNP	0.998	T
TBCA	6902	genome.wustl.edu	37	5	77072041	77072041	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr5:77072041C>T	ENST00000380377.4	-	1	144	c.41G>A	c.(40-42)gGc>gAc	p.G14D	TBCA_ENST00000520039.1_Missense_Mutation_p.G14D|TBCA_ENST00000522370.1_Intron|TBCA_ENST00000306388.6_Missense_Mutation_p.G14D|TBCA_ENST00000518338.2_Missense_Mutation_p.G14D|TBCA_ENST00000520361.1_Missense_Mutation_p.G14D	NM_004607.2	NP_004598.1	O75347	TBCA_HUMAN	tubulin folding cofactor A	14					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tubulin complex assembly (GO:0007021)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	chaperone binding (GO:0051087)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(2)|lung(1)|ovary(1)	5		all_lung(232;0.000511)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;1.02e-49)|Epithelial(54;1.05e-44)|all cancers(79;4.08e-40)		CTTCACCACGCCGGTCTTGAT	0.701																																																	0								ENSG00000171530						31.0	28.0	29.0					5																	77072041		2192	4289	6481	TBCA	SO:0001583	missense	0			-	HGNC	AF038952	CCDS4040.1, CCDS75263.1	5q14.1	2008-02-05	2006-11-21		ENSG00000171530	ENSG00000171530			11579	protein-coding gene	gene with protein product		610058	"""tubulin-specific chaperone a"""			9653160, 8706133	Standard	XM_005248586		Approved		uc003kfh.1	O75347	OTTHUMG00000102173	ENST00000380377.4:c.41G>A	5.37:g.77072041C>T	ENSP00000369736:p.Gly14Asp	Somatic	0	54	0.00		0.5130446035623836	702	0.43	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B4DT30	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CofA_tubulin-bd,superfamily_CofA_tubulin-bd	p.G14D	ENST00000380377.4	37	c.41	CCDS4040.1	5	.	.	.	.	.	.	.	.	.	.	C	27.9	4.872930	0.91664	.	.	ENSG00000171530	ENST00000380377;ENST00000306388;ENST00000520361;ENST00000520039	.	.	.	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.73329	0.3573	M	0.78916	2.43	0.31051	N	0.715268	D;P	0.89917	1.0;0.956	D;P	0.76575	0.988;0.869	T	0.76080	-0.3090	9	0.54805	T	0.06	-2.2089	17.6639	0.88199	0.0:1.0:0.0:0.0	.	14;14	B4DT30;O75347	.;TBCA_HUMAN	D	14	.	ENSP00000306362:G14D	G	-	2	0	TBCA	77107797	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.472000	0.60189	2.319000	0.78375	0.555000	0.69702	GGC	-	pfam_CofA_tubulin-bd,superfamily_CofA_tubulin-bd		0.701	TBCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCA	protein_coding	OTTHUMT00000220021.3	C	NM_004607	-		77072041	-1	no_errors	ENST00000380377	ensembl	human	known	74_37	missense	SNP	1.000	T
LRRC63	220416	genome.wustl.edu	37	13	46824581	46824581	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr13:46824581G>T	ENST00000595396.1	+	6	1181	c.1181G>T	c.(1180-1182)aGa>aTa	p.R394I	RN7SKP5_ENST00000517045.1_RNA|LRRC63_ENST00000446175.1_Missense_Mutation_p.R394I			Q05C16	LRC63_HUMAN	leucine rich repeat containing 63	394										lung(1)|ovary(1)	2						GAGTTCCTTAGAATTTTCACC	0.279																																																	0								ENSG00000173988																																			LRRC63	SO:0001583	missense	0			-	HGNC		CCDS61325.1	13q14.12	2014-02-12			ENSG00000173988	ENSG00000173988			34296	protein-coding gene	gene with protein product							Standard	NM_001282460		Approved	RP11-139H14.4	uc001vbc.3	Q05C16	OTTHUMG00000016866	ENST00000595396.1:c.1181G>T	13.37:g.46824581G>T	ENSP00000469337:p.Arg394Ile	Somatic	0	58	0.00		0.5130446035623836	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	Q5TBN0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.R394I	ENST00000595396.1	37	c.1181		13	.	.	.	.	.	.	.	.	.	.	G	16.80	3.222513	0.58668	.	.	ENSG00000173988	ENST00000378805;ENST00000446175	T;T	0.59906	0.23;0.23	5.65	2.37	0.29283	.	.	.	.	.	T	0.66147	0.2760	M	0.64170	1.965	0.39141	D	0.962043	D	0.76494	0.999	D	0.72338	0.977	T	0.68010	-0.5522	9	0.72032	D	0.01	-9.7737	3.9515	0.09371	0.243:0.1912:0.5658:0.0	.	394	Q05C16	LRC63_HUMAN	I	394	ENSP00000368082:R394I;ENSP00000408828:R394I	ENSP00000368082:R394I	R	+	2	0	LRRC63	45722582	0.349000	0.24870	0.954000	0.39281	0.690000	0.40134	0.225000	0.17757	1.394000	0.46624	0.655000	0.94253	AGA	-	smart_Leu-rich_rpt_typical-subtyp		0.279	LRRC63-002	NOVEL	not_organism_supported|basic|appris_candidate_longest	protein_coding	LRRC63	protein_coding	OTTHUMT00000463266.1	G	XM_001718341	-		46824581	+1	no_errors	ENST00000446175	ensembl	human	known	74_37	missense	SNP	0.956	T
ZNF688	146542	genome.wustl.edu	37	16	30582409	30582409	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr16:30582409T>C	ENST00000223459.6	-	2	1336	c.232A>G	c.(232-234)Atg>Gtg	p.M78V	AC002310.7_ENST00000486926.1_RNA|AC002310.7_ENST00000492040.1_RNA|ZNF688_ENST00000567855.1_Missense_Mutation_p.M78V|ZNF688_ENST00000563707.1_Intron|ZNF688_ENST00000395219.1_Missense_Mutation_p.M64V	NM_145271.3	NP_660314.1	P0C7X2	ZN688_HUMAN	zinc finger protein 688	78	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						TCCTGTTCCATCCAAGAGATG	0.632																																																	0								ENSG00000229809						37.0	39.0	38.0					16																	30582409		2197	4300	6497	ZNF688	SO:0001583	missense	0			-	HGNC	AK122680	CCDS10684.1	16p11.2	2013-01-08			ENSG00000229809	ENSG00000229809		"""Zinc fingers, C2H2-type"", ""-"""	30489	protein-coding gene	gene with protein product						10493829	Standard	XM_005255139		Approved		uc002dys.2	P0C7X2	OTTHUMG00000132408	ENST00000223459.6:c.232A>G	16.37:g.30582409T>C	ENSP00000223459:p.Met78Val	Somatic	0	156	0.00		0.5130446035623836	47	22.95	14	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	72	25.77	A8MV39|B3KV51|O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.M78V	ENST00000223459.6	37	c.232	CCDS10684.1	16	.	.	.	.	.	.	.	.	.	.	T	11.44	1.638833	0.29157	.	.	ENSG00000229809	ENST00000395219;ENST00000223459	T;T	0.03413	3.94;5.79	5.2	2.98	0.34508	Krueppel-associated box (3);	.	.	.	.	T	0.01254	0.0041	N	0.01352	-0.895	0.29501	N	0.854958	B;B	0.17852	0.012;0.024	B;B	0.15052	0.004;0.012	T	0.41360	-0.9513	9	0.07030	T	0.85	.	6.2962	0.21087	0.0:0.1893:0.0:0.8107	.	78;64	P0C7X2;A8MV39	ZN688_HUMAN;.	V	64;78	ENSP00000378645:M64V;ENSP00000223459:M78V	ENSP00000223459:M78V	M	-	1	0	ZNF688	30489910	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.227000	0.32576	1.100000	0.41517	0.533000	0.62120	ATG	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.632	ZNF688-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF688	protein_coding	OTTHUMT00000255544.2	T	NM_145271	-		30582409	-1	no_errors	ENST00000223459	ensembl	human	known	74_37	missense	SNP	1.000	C
UFL1	23376	genome.wustl.edu	37	6	96969559	96969578	+	5'Flank	DEL	AACCCCCAGCGCCGCGGTAC	AACCCCCAGCGCCGCGGTAC	-	rs3841018|rs112373805|rs67707404	byFrequency	TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	AACCCCCAGCGCCGCGGTAC	AACCCCCAGCGCCGCGGTAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr6:96969559_96969578delAACCCCCAGCGCCGCGGTAC	ENST00000369278.4	+	0	0				UFL1-AS1_ENST00000430796.1_RNA|UFL1_ENST00000461673.1_3'UTR	NM_015323.4	NP_056138.1	O94874	UFL1_HUMAN	UFM1-specific ligase 1						negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein ufmylation (GO:0071569)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	UFM1 conjugating enzyme activity (GO:0071568)										CGCCGGGAGGAACCCCCAGCGCCGCGGTACAACCACGGCA	0.7														677	0.135184	0.1036	0.1772	5008	,	,		14561	0.0387		0.2157	False		,,,				2504	0.1646																0								ENSG00000014123																																			UFL1	SO:0001631	upstream_gene_variant	0				HGNC	BC036379	CCDS5034.1	6q16.3	2011-08-18	2011-08-18	2011-08-18	ENSG00000014123	ENSG00000014123			23039	protein-coding gene	gene with protein product	"""novel LZAP-binding protein"", ""Regulator of CDK5RAP3 and DDRGK1"""	613372	"""KIAA0776"""	KIAA0776		20018847, 20164180, 20228063, 20531390	Standard	NM_015323		Approved	NLBP, Maxer, RCAD	uc003por.3	O94874	OTTHUMG00000015238		6.37:g.96969559_96969578delAACCCCCAGCGCCGCGGTAC	Exception_encountered	Somatic	NA	NA	NA		0.5130446035623836	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A0PJ53|B4DJ57|C0H5X5|Q8N765|Q9NTQ0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369278.4	37	NULL	CCDS5034.1	6																																																																																			-	-		0.700	UFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFL1	protein_coding	OTTHUMT00000041557.1	AACCCCCAGCGCCGCGGTAC	NM_015323			96969578	+1	no_errors	ENST00000461673	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.001:0.000:0.001:0.001:0.003:0.006:0.006:0.002:0.000:0.000:0.000:0.000:0.000:0.000	-
THOC3	84321	genome.wustl.edu	37	5	175395009	175395009	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr5:175395009C>T	ENST00000265097.4	-	1	293	c.203G>A	c.(202-204)cGt>cAt	p.R68H	THOC3_ENST00000514861.1_Intron|THOC3_ENST00000513482.1_Missense_Mutation_p.R68H|THOC3_ENST00000510300.1_5'Flank	NM_032361.2	NP_115737.1	Q96J01	THOC3_HUMAN	THO complex 3	68					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(2)	4	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		GGCTAGGCGACGCCCGTCGCA	0.672																																																	0								ENSG00000051596						11.0	12.0	12.0					5																	175395009		1939	3876	5815	THOC3	SO:0001583	missense	0			-	HGNC	BC006849	CCDS4397.1	5q35.3	2013-02-11			ENSG00000051596	ENSG00000051596		"""WD repeat domain containing"", ""THO complex subunits"""	19072	protein-coding gene	gene with protein product		606929				11979277	Standard	NM_032361		Approved	TEX1, MGC5469	uc003mdg.5	Q96J01	OTTHUMG00000130658	ENST00000265097.4:c.203G>A	5.37:g.175395009C>T	ENSP00000265097:p.Arg68His	Somatic	0	64	0.00		0.5130446035623836	20	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	Q6NZ53	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,pfam_TIF_beta_prop-like,pfam_PD40,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R68H	ENST00000265097.4	37	c.203	CCDS4397.1	5	.	.	.	.	.	.	.	.	.	.	C	21.7	4.183255	0.78677	.	.	ENSG00000051596	ENST00000265097;ENST00000513482	T;T	0.60171	0.21;0.21	3.97	3.97	0.46021	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.207319	0.36778	N	0.002415	T	0.67135	0.2861	L	0.53249	1.67	0.58432	D	0.999997	P;P	0.51933	0.949;0.868	P;P	0.57244	0.816;0.475	T	0.72093	-0.4394	10	0.72032	D	0.01	-4.2286	15.2133	0.73244	0.0:1.0:0.0:0.0	.	68;68	Q6NZ53;Q96J01	.;THOC3_HUMAN	H	68	ENSP00000265097:R68H;ENSP00000422243:R68H	ENSP00000265097:R68H	R	-	2	0	THOC3	175327615	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	4.246000	0.58740	2.027000	0.59764	0.511000	0.50034	CGT	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.672	THOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC3	protein_coding	OTTHUMT00000253148.1	C		-		175395009	-1	no_errors	ENST00000265097	ensembl	human	known	74_37	missense	SNP	1.000	T
URB2	9816	genome.wustl.edu	37	1	229773015	229773015	+	Silent	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr1:229773015G>A	ENST00000258243.2	+	4	2791	c.2655G>A	c.(2653-2655)caG>caA	p.Q885Q		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	885						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						TCCCTATCCAGCTGGAGGGAG	0.488																																																	0								ENSG00000135763						118.0	117.0	117.0					1																	229773015		2203	4300	6503	URB2	SO:0001819	synonymous_variant	0			-	HGNC	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.2655G>A	1.37:g.229773015G>A		Somatic	0	58	0.00		0.5130446035623836	17	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q5VYC9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Urb2/Npa2_C	p.Q885	ENST00000258243.2	37	c.2655	CCDS31052.1	1																																																																																			-	NULL		0.488	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB2	protein_coding	OTTHUMT00000095232.1	G	NM_014777	-		229773015	+1	no_errors	ENST00000258243	ensembl	human	known	74_37	silent	SNP	0.001	A
LINC00577	100113403	genome.wustl.edu	37	6	105388262	105388262	+	lincRNA	SNP	G	G	A	rs369618674|rs200408621	byFrequency	TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr6:105388262G>A	ENST00000369123.3	-	0	140					NR_046407.1				long intergenic non-protein coding RNA 577																		CGCTGCGCGCGGAGAGCCGGG	0.706																																																	0								ENSG00000203809																																			LINC00577			0			-	HGNC	AW612153, BF223582		6q21	2012-10-12	2012-03-01	2012-03-01	ENSG00000203809	ENSG00000203809		"""Long non-coding RNAs"""	21553	non-coding RNA	RNA, long non-coding			"""chromosome 6 open reading frame 220"""	C6orf220			Standard	NR_046407		Approved	dJ439I14.1	uc031spf.1		OTTHUMG00000015289		6.37:g.105388262G>A		Somatic	0	60	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	17	51.43		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369123.3	37	NULL		6																																																																																			-	-		0.706	LINC00577-001	KNOWN	basic	lincRNA	LINC00577	lincRNA	OTTHUMT00000041645.2	G		-		105388262	-1	no_errors	ENST00000369123	ensembl	human	known	74_37	rna	SNP	0.008	A
LPCAT2	54947	genome.wustl.edu	37	16	55559549	55559549	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr16:55559549G>T	ENST00000262134.5	+	2	485	c.301G>T	c.(301-303)Ggt>Tgt	p.G101C		NM_017839.4	NP_060309.2	Q7L5N7	PCAT2_HUMAN	lysophosphatidylcholine acyltransferase 2	101					glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	12						CCCAATAACTGGTTGGAGGAG	0.323																																																	0								ENSG00000087253						72.0	66.0	68.0					16																	55559549		2198	4300	6498	LPCAT2	SO:0001583	missense	0			-	HGNC	AK000488	CCDS10753.1	16q12.2	2013-01-10	2007-12-17	2007-12-17	ENSG00000087253	ENSG00000087253		"""EF-hand domain containing"""	26032	protein-coding gene	gene with protein product		612040	"""acyltransferase like 1"""	AYTL1		16704971	Standard	NM_017839		Approved	FLJ20481	uc002eie.4	Q7L5N7	OTTHUMG00000133238	ENST00000262134.5:c.301G>T	16.37:g.55559549G>T	ENSP00000262134:p.Gly101Cys	Somatic	0	82	0.00		0.5130446035623836	11	15.38	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	26	44.68	A3KBM1|Q6MZJ6|Q9NX23	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EF_hand_dom,pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.G101C	ENST00000262134.5	37	c.301	CCDS10753.1	16	.	.	.	.	.	.	.	.	.	.	G	17.46	3.395408	0.62066	.	.	ENSG00000087253	ENST00000262134	T	0.29655	1.56	5.33	4.36	0.52297	.	0.098557	0.64402	D	0.000001	T	0.47764	0.1463	M	0.79805	2.47	0.58432	D	0.99999	D	0.54397	0.966	P	0.52309	0.695	T	0.54754	-0.8246	10	0.52906	T	0.07	-3.8214	13.8217	0.63325	0.0753:0.0:0.9247:0.0	.	101	Q7L5N7	PCAT2_HUMAN	C	101	ENSP00000262134:G101C	ENSP00000262134:G101C	G	+	1	0	LPCAT2	54117050	1.000000	0.71417	0.818000	0.32626	0.931000	0.56810	4.846000	0.62860	1.358000	0.45922	0.591000	0.81541	GGT	-	NULL		0.323	LPCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT2	protein_coding	OTTHUMT00000256977.2	G	NM_017839	-		55559549	+1	no_errors	ENST00000262134	ensembl	human	known	74_37	missense	SNP	0.969	T
PPP2R5B	5526	genome.wustl.edu	37	11	64695300	64695300	+	Silent	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:64695300G>A	ENST00000164133.2	+	4	1045	c.423G>A	c.(421-423)ctG>ctA	p.L141L		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	141					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						TCCGGACTCTGCCGCCCAGTG	0.522																																																	0								ENSG00000068971						81.0	81.0	81.0					11																	64695300		2201	4297	6498	PPP2R5B	SO:0001819	synonymous_variant	0			-	HGNC	L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.423G>A	11.37:g.64695300G>A		Somatic	0	75	0.00		0.5130446035623836	81	21.36	22	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	43	27.12	Q13853	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.L141	ENST00000164133.2	37	c.423	CCDS8085.1	11																																																																																			-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56		0.522	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5B	protein_coding	OTTHUMT00000385465.1	G	NM_006244	-		64695300	+1	no_errors	ENST00000164133	ensembl	human	known	74_37	silent	SNP	0.968	A
SEMA4F	10505	genome.wustl.edu	37	2	74903023	74903023	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr2:74903023G>A	ENST00000357877.2	+	12	1779	c.1630G>A	c.(1630-1632)Ggg>Agg	p.G544R	SEMA4F_ENST00000473350.1_3'UTR|SEMA4F_ENST00000339773.5_Missense_Mutation_p.G389R	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	544	PSI.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)			biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						GGCCCATGCCGGGGAGCACCG	0.582																																																	0								ENSG00000135622						65.0	63.0	64.0					2																	74903023		2203	4300	6503	SEMA4F	SO:0001583	missense	0			-	HGNC	AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.1630G>A	2.37:g.74903023G>A	ENSP00000350547:p.Gly544Arg	Somatic	0	44	0.00		0.5130446035623836	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	Q542Y7|Q9NS35	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.G544R	ENST00000357877.2	37	c.1630	CCDS1955.1	2	.	.	.	.	.	.	.	.	.	.	G	4.976	0.181258	0.09495	.	.	ENSG00000135622	ENST00000357877;ENST00000339773	T;T	0.18960	2.18;2.18	4.38	4.38	0.52667	.	1.135720	0.07189	U	0.855427	T	0.20780	0.0500	L	0.33485	1.01	0.09310	N	0.999991	B;B	0.30021	0.227;0.265	B;B	0.26094	0.04;0.066	T	0.20638	-1.0269	10	0.66056	D	0.02	.	14.4764	0.67548	0.0:0.0:1.0:0.0	.	389;544	O95754-2;O95754	.;SEM4F_HUMAN	R	544;389	ENSP00000350547:G544R;ENSP00000342675:G389R	ENSP00000342675:G389R	G	+	1	0	SEMA4F	74756531	0.010000	0.17322	0.669000	0.29828	0.042000	0.13812	0.828000	0.27435	2.280000	0.76307	0.467000	0.42956	GGG	-	pfam_Plexin_repeat,superfamily_Plexin-like_fold,smart_Plexin-like_fold		0.582	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4F	protein_coding	OTTHUMT00000252214.2	G	NM_004263	-		74903023	+1	no_errors	ENST00000357877	ensembl	human	known	74_37	missense	SNP	0.161	A
KIAA0930	23313	genome.wustl.edu	37	22	45607985	45607985	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr22:45607985C>T	ENST00000336156.5	-	2	133	c.68G>A	c.(67-69)tGc>tAc	p.C23Y	KIAA0930_ENST00000251993.7_Missense_Mutation_p.C28Y|KIAA0930_ENST00000443310.3_Missense_Mutation_p.C5Y|KIAA0930_ENST00000391627.2_5'UTR|KIAA0930_ENST00000492273.1_Missense_Mutation_p.C28Y|KIAA0930_ENST00000496226.1_Missense_Mutation_p.C32Y	NM_001009880.1	NP_001009880.1	Q6ICG6	K0930_HUMAN	KIAA0930	23										endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|urinary_tract(1)	15						ATCCTTGAAGCACCCTGCAGA	0.592																																																	0								ENSG00000100364						52.0	49.0	50.0					22																	45607985		2202	4300	6502	KIAA0930	SO:0001583	missense	0			-	HGNC	AK025608	CCDS33665.1, CCDS33666.1	22q13.31	2011-02-23	2011-02-23	2011-02-23	ENSG00000100364	ENSG00000100364			1314	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 9"""	C22orf9		10231032	Standard	NM_015264		Approved	bK268H5.C22.1	uc003bfw.1	Q6ICG6	OTTHUMG00000151263	ENST00000336156.5:c.68G>A	22.37:g.45607985C>T	ENSP00000336720:p.Cys23Tyr	Somatic	0	66	0.00		0.5130446035623836	74	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B0QY17|B0QY19|B3KT48|Q6ZVE5|Q7Z6K9|Q8IZ76|Q9Y2E2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF2045	p.C28Y	ENST00000336156.5	37	c.83	CCDS33665.1	22	.	.	.	.	.	.	.	.	.	.	C	22.7	4.325235	0.81580	.	.	ENSG00000100364	ENST00000336156;ENST00000251993;ENST00000443310;ENST00000424508	.	.	.	5.33	4.3	0.51218	.	0.094831	0.85682	D	0.000000	T	0.49389	0.1554	L	0.29908	0.895	0.54753	D	0.999989	B;B;B;B	0.30439	0.047;0.183;0.279;0.112	B;B;B;B	0.33521	0.017;0.039;0.165;0.08	T	0.52786	-0.8529	9	0.66056	D	0.02	-20.0673	15.2406	0.73468	0.1417:0.8583:0.0:0.0	.	5;23;28;94	B0AZU2;Q6ICG6;Q6ICG6-2;Q8IUY4	.;K0930_HUMAN;.;.	Y	23;28;5;5	.	ENSP00000251993:C28Y	C	-	2	0	KIAA0930	43986649	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.467000	0.53078	1.228000	0.43614	0.561000	0.74099	TGC	-	NULL		0.592	KIAA0930-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0930	protein_coding	OTTHUMT00000321975.2	C	NM_001009880	-		45607985	-1	no_errors	ENST00000251993	ensembl	human	known	74_37	missense	SNP	1.000	T
CATSPER1	117144	genome.wustl.edu	37	11	65788571	65788571	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:65788571A>C	ENST00000312106.5	-	5	1914	c.1777T>G	c.(1777-1779)Tgc>Ggc	p.C593G		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	593					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						ATACAGAGGCAGGTAAACATG	0.662																																																	0								ENSG00000175294						49.0	36.0	40.0					11																	65788571		2200	4295	6495	CATSPER1	SO:0001583	missense	0			-	HGNC	AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.1777T>G	11.37:g.65788571A>C	ENSP00000309052:p.Cys593Gly	Somatic	0	244	0.00		0.5130446035623836	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	95	93	50.53	Q96P76	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_PKD1_2_channel	p.C593G	ENST00000312106.5	37	c.1777	CCDS8127.1	11	.	.	.	.	.	.	.	.	.	.	A	18.43	3.622201	0.66787	.	.	ENSG00000175294	ENST00000312106	D	0.98567	-5.0	4.95	3.81	0.43845	Ion transport (1);	0.210019	0.24229	N	0.040370	D	0.96858	0.8974	N	0.25789	0.76	0.35241	D	0.777809	D	0.58268	0.982	P	0.58780	0.845	D	0.97241	0.9891	10	0.72032	D	0.01	-33.289	8.0064	0.30327	0.8187:0.0:0.0:0.1813	.	593	Q8NEC5	CTSR1_HUMAN	G	593	ENSP00000309052:C593G	ENSP00000309052:C593G	C	-	1	0	CATSPER1	65545147	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.622000	0.67750	0.718000	0.32166	0.459000	0.35465	TGC	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel		0.662	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPER1	protein_coding	OTTHUMT00000391055.1	A	NM_053054	-		65788571	-1	no_errors	ENST00000312106	ensembl	human	known	74_37	missense	SNP	1.000	C
NLRX1	79671	genome.wustl.edu	37	11	119050471	119050471	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:119050471G>T	ENST00000409109.1	+	7	2328	c.1741G>T	c.(1741-1743)Gag>Tag	p.E581*	NLRX1_ENST00000409265.4_Nonsense_Mutation_p.E581*|NLRX1_ENST00000525863.1_Nonsense_Mutation_p.E581*|NLRX1_ENST00000292199.2_Nonsense_Mutation_p.E581*|NLRX1_ENST00000409991.1_Nonsense_Mutation_p.E581*	NM_001282144.1	NP_001269073.1	Q86UT6	NLRX1_HUMAN	NLR family member X1	581	Required for the repression of MAVS- induced interferon signaling.				innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|viral process (GO:0016032)	mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)			cervix(1)|endometrium(2)|kidney(2)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	22	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CATGGTGCTGGAGATGTTTCG	0.607																																																	0								ENSG00000160703						112.0	115.0	114.0					11																	119050471		2200	4295	6495	NLRX1	SO:0001587	stop_gained	0			-	HGNC	AB094095	CCDS8416.1	11q23.3	2007-02-07			ENSG00000160703	ENSG00000160703		"""Nucleotide-binding domain and leucine rich repeat containing"""	29890	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat containing X1"", ""NOD-like receptor X1"", ""NLR family, X1"""	611947				12766759	Standard	XM_005271669		Approved	NOD9, CLR11.3	uc001pvw.3	Q86UT6	OTTHUMG00000154476	ENST00000409109.1:c.1741G>T	11.37:g.119050471G>T	ENSP00000387334:p.Glu581*	Somatic	0	85	0.00		0.5130446035623836	50	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A8K6Q1|B3KPK2|B3KTA2|Q7RTR3|Q96D51|Q9H724	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.E581*	ENST00000409109.1	37	c.1741	CCDS8416.1	11	.	.	.	.	.	.	.	.	.	.	G	44	10.742915	0.99460	.	.	ENSG00000160703	ENST00000409991;ENST00000292199;ENST00000409265;ENST00000409109;ENST00000525863	.	.	.	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	19.0214	0.92917	0.0:0.0:1.0:0.0	.	.	.	.	X	581	.	ENSP00000292199:E581X	E	+	1	0	NLRX1	118555681	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	9.325000	0.96381	2.503000	0.84419	0.561000	0.74099	GAG	-	NULL		0.607	NLRX1-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NLRX1	protein_coding	OTTHUMT00000335403.1	G	NM_170722	-		119050471	+1	no_errors	ENST00000292199	ensembl	human	known	74_37	nonsense	SNP	1.000	T
DDX23	9416	genome.wustl.edu	37	12	49224454	49224454	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr12:49224454C>T	ENST00000308025.3	-	17	2340	c.2261G>A	c.(2260-2262)cGc>cAc	p.R754H		NM_004818.2	NP_004809.2	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	754	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|kidney(4)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(3)	36						TCGTCCCGTGCGGCCAATGCG	0.572																																																	0								ENSG00000174243						93.0	80.0	84.0					12																	49224454		2203	4300	6503	DDX23	SO:0001583	missense	0			-	HGNC	AF026402	CCDS8770.1	12q13.11	2013-07-16				ENSG00000174243		"""DEAD-boxes"""	17347	protein-coding gene	gene with protein product		612172	"""PRP28 homolog, yeast"""			9409622, 9539711	Standard	NM_004818		Approved	prp28, U5-100K, PRPF28, SNRNP100	uc001rsm.3	Q9BUQ8		ENST00000308025.3:c.2261G>A	12.37:g.49224454C>T	ENSP00000310723:p.Arg754His	Somatic	0	66	0.00		0.5130446035623836	155	0.64	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	B2R600|B4DH15|O43188	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.R754H	ENST00000308025.3	37	c.2261	CCDS8770.1	12	.	.	.	.	.	.	.	.	.	.	C	35	5.586395	0.96578	.	.	ENSG00000174243	ENST00000308025	D	0.99143	-5.48	5.97	5.97	0.96955	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99641	0.9868	H	0.98426	4.23	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.97700	1.0184	10	0.87932	D	0	-3.566	19.1994	0.93704	0.0:1.0:0.0:0.0	.	754	Q9BUQ8	DDX23_HUMAN	H	754	ENSP00000310723:R754H	ENSP00000310723:R754H	R	-	2	0	DDX23	47510721	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.731000	0.84895	2.837000	0.97791	0.655000	0.94253	CGC	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C		0.572	DDX23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX23	protein_coding	OTTHUMT00000408897.2	C	NM_004818	-		49224454	-1	no_errors	ENST00000308025	ensembl	human	known	74_37	missense	SNP	1.000	T
YTHDF3	253943	genome.wustl.edu	37	8	64122451	64122451	+	3'UTR	SNP	A	A	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr8:64122451A>T	ENST00000517371.1	+	0	570				YTHDF3_ENST00000542911.2_3'UTR|YTHDF3_ENST00000521674.1_3'UTR|YTHDF3_ENST00000539294.1_3'UTR			Q7Z739	YTHD3_HUMAN	YTH domain family, member 3								N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)					Breast(64;0.0716)	all_cancers(86;0.169)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.146)	BRCA - Breast invasive adenocarcinoma(89;0.161)			TCTTCACCAAACACACTTGAG	0.398																																																	0								ENSG00000185728																																			YTHDF3	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC052970	CCDS75747.1, CCDS75748.1, CCDS75749.1	8q12.3	2013-06-07	2004-11-16		ENSG00000185728	ENSG00000185728			26465	protein-coding gene	gene with protein product			"""YTH domain family 3"""			12477932	Standard	NM_152758		Approved	FLJ31657	uc003xuz.4	Q7Z739	OTTHUMG00000164369	ENST00000517371.1:c.*187A>T	8.37:g.64122451A>T		Somatic	0	60	0.00		0.5130446035623836	145	0.68	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B3KXL4|Q63Z37|Q659A3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000517371.1	37	NULL		8																																																																																			-	-		0.398	YTHDF3-010	PUTATIVE	basic	protein_coding	YTHDF3	protein_coding	OTTHUMT00000378466.4	A	NM_152758	-		64122451	+1	no_errors	ENST00000517303	ensembl	human	known	74_37	rna	SNP	1.000	T
ATF7	11016	genome.wustl.edu	37	12	53911055	53911055	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr12:53911055G>T	ENST00000548446.2	-	12	1463	c.1351C>A	c.(1351-1353)Ctc>Atc	p.L451I	ATF7_ENST00000456903.4_Missense_Mutation_p.L440I|ATF7_ENST00000328463.7_Missense_Mutation_p.L451I|ATF7_ENST00000420353.2_Missense_Mutation_p.L440I|RP11-793H13.10_ENST00000591834.1_Intron|ATF7_ENST00000415113.1_Missense_Mutation_p.L419I|RP11-793H13.3_ENST00000548347.1_RNA|ATF7_ENST00000546661.1_5'UTR			P17544	ATF7_HUMAN	activating transcription factor 7	451	Essential for binding adenovirus 2 E1A.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9					Pseudoephedrine(DB00852)	CGAACACTGAGGCCATTGCTA	0.572																																																	0								ENSG00000170653						88.0	89.0	89.0					12																	53911055		2059	4200	6259	ATF7	SO:0001583	missense	0			-	HGNC	X52943	CCDS44906.1, CCDS58238.1	12q13	2013-01-10				ENSG00000170653		"""basic leucine zipper proteins"""	792	protein-coding gene	gene with protein product		606371				1694576, 11278933	Standard	NM_006856		Approved	ATFA	uc001sdz.3	P17544	OTTHUMG00000169776	ENST00000548446.2:c.1351C>A	12.37:g.53911055G>T	ENSP00000449938:p.Leu451Ile	Somatic	0	21	0.00		0.5130446035623836	53	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27	A5D6Y4|B2RMP1|B4DQL4|Q13814|Q8IVR8|Q9UD83	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bZIP,smart_Znf_C2H2-like,smart_bZIP,pirsf_TF_cAMP-dep,pfscan_Znf_C2H2,pfscan_bZIP	p.L451I	ENST00000548446.2	37	c.1351		12	.	.	.	.	.	.	.	.	.	.	G	18.61	3.661408	0.67700	.	.	ENSG00000170653	ENST00000548446;ENST00000328463;ENST00000306727;ENST00000415113;ENST00000420353;ENST00000456903	T;T;T;T;T	0.48201	0.82;0.82;0.85;0.82;0.82	4.6	4.6	0.57074	.	0.150333	0.45126	D	0.000398	T	0.63260	0.2496	L	0.53249	1.67	0.58432	D	0.999992	D;D;B	0.67145	0.996;0.993;0.267	D;D;B	0.72625	0.978;0.952;0.039	T	0.60974	-0.7156	10	0.38643	T	0.18	-22.2708	16.792	0.85591	0.0:0.0:1.0:0.0	.	419;440;451	P17544-2;B2RMP1;P17544	.;.;ATF7_HUMAN	I	451;451;264;419;440;440	ENSP00000449938:L451I;ENSP00000329212:L451I;ENSP00000404880:L419I;ENSP00000399465:L440I;ENSP00000387406:L440I	ENSP00000304187:L264I	L	-	1	0	ATF7	52197322	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.731000	0.68554	2.582000	0.87167	0.555000	0.69702	CTC	-	pirsf_TF_cAMP-dep		0.572	ATF7-007	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	ATF7	protein_coding	OTTHUMT00000406302.2	G	NM_001130059	-		53911055	-1	no_errors	ENST00000328463	ensembl	human	known	74_37	missense	SNP	1.000	T
ORC2	4999	genome.wustl.edu	37	2	201798656	201798656	+	Silent	SNP	T	T	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr2:201798656T>C	ENST00000234296.2	-	10	999	c.750A>G	c.(748-750)tcA>tcG	p.S250S		NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2	250					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						TTAAAACTTTTGAACTGCTGT	0.343																																																	0								ENSG00000115942						96.0	99.0	98.0					2																	201798656		2203	4298	6501	ORC2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.750A>G	2.37:g.201798656T>C		Somatic	0	62	0.00		0.5130446035623836	32	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	Q13204|Q53TX5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ORC2	p.S250	ENST00000234296.2	37	c.750	CCDS2334.1	2																																																																																			-	NULL		0.343	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORC2	protein_coding	OTTHUMT00000256191.2	T	NM_006190	-		201798656	-1	no_errors	ENST00000234296	ensembl	human	known	74_37	silent	SNP	0.993	C
ZNF185	7739	genome.wustl.edu	37	X	152087570	152087572	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chrX:152087570_152087572delGAG	ENST00000370268.4	+	7	512_514	c.475_477delGAG	c.(475-477)gagdel	p.E165del	ZNF185_ENST00000370270.2_In_Frame_Del_p.E165del|ZNF185_ENST00000449285.2_In_Frame_Del_p.E165del|ZNF185_ENST00000539731.1_In_Frame_Del_p.E165del|ZNF185_ENST00000535861.1_In_Frame_Del_p.E165del|ZNF185_ENST00000324823.6_In_Frame_Del_p.E30del|ZNF185_ENST00000318529.8_In_Frame_Del_p.E30del|ZNF185_ENST00000318504.7_In_Frame_Del_p.E165del			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	165	Poly-Glu.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					AGGGGACACCgaggaggaggagg	0.596																																																	0								ENSG00000147394		,,,,,,	160,3115		6,91,57,1273,478					,,,,,,	-7.0	0.0			54	367,5848		0,178,189,2088,1494	no	coding,coding,coding,coding,coding,coding,coding	ZNF185	NM_007150.3,NM_001178113.1,NM_001178110.1,NM_001178109.1,NM_001178108.1,NM_001178107.1,NM_001178106.1	,,,,,,	6,269,246,3361,1972	A1A1,A1R,A1,RR,R		5.9051,4.8855,5.5532	,,,,,,	,,,,,,		527,8963				ZNF185	SO:0001651	inframe_deletion	0				HGNC	AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.475_477delGAG	X.37:g.152087579_152087581delGAG	ENSP00000359291:p.Glu165del	Somatic	0	33	0.00		0.5130446035623836	62	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67	A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	smart_Znf_LIM,pfscan_Znf_LIM	p.E162in_frame_del	ENST00000370268.4	37	c.475_477	CCDS48184.1	X																																																																																			-	NULL		0.596	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF185	protein_coding	OTTHUMT00000377480.1	GAG	NM_007150			152087572	+1	no_errors	ENST00000370270	ensembl	human	known	74_37	in_frame_del	DEL	0.026:0.052:0.078	-
OR11L1	391189	genome.wustl.edu	37	1	248005032	248005032	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr1:248005032T>C	ENST00000355784.2	-	1	222	c.167A>G	c.(166-168)cAc>cGc	p.H56R		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	56						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CATAGGGGAGTGCAGTCGCAG	0.557																																																	0								ENSG00000197591						75.0	66.0	69.0					1																	248005032		2203	4300	6503	OR11L1	SO:0001583	missense	0			-	HGNC	AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.167A>G	1.37:g.248005032T>C	ENSP00000348033:p.His56Arg	Somatic	0	74	0.00		0.5130446035623836	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	29	29.27		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.H56R	ENST00000355784.2	37	c.167	CCDS31098.1	1	.	.	.	.	.	.	.	.	.	.	T	8.565	0.878660	0.17395	.	.	ENSG00000197591	ENST00000355784	T	0.15952	2.38	4.2	1.45	0.22620	GPCR, rhodopsin-like superfamily (1);	0.198503	0.24532	N	0.037718	T	0.17492	0.0420	L	0.61036	1.89	0.20563	N	0.999885	B	0.20780	0.048	B	0.25614	0.062	T	0.19910	-1.0291	10	0.62326	D	0.03	.	7.435	0.27150	0.0:0.2296:0.0:0.7704	.	56	Q8NGX0	O11L1_HUMAN	R	56	ENSP00000348033:H56R	ENSP00000348033:H56R	H	-	2	0	OR11L1	246071655	0.800000	0.28916	0.217000	0.23759	0.500000	0.33767	1.225000	0.32551	0.161000	0.19458	0.443000	0.29094	CAC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.557	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11L1	protein_coding	OTTHUMT00000096850.1	T	NM_001001959	-		248005032	-1	no_errors	ENST00000355784	ensembl	human	known	74_37	missense	SNP	0.663	C
GUCD1	83606	genome.wustl.edu	37	22	24940035	24940035	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr22:24940035C>T	ENST00000407471.3	-	5	593	c.403G>A	c.(403-405)Gac>Aac	p.D135N	GUCD1_ENST00000490922.1_Intron|GUCD1_ENST00000402766.1_Intron|GUCD1_ENST00000435822.1_Missense_Mutation_p.D135N|GUCD1_ENST00000404664.3_Missense_Mutation_p.D191N|GUCD1_ENST00000447813.2_Intron	NM_001284251.1	NP_001271180.1	Q96NT3	GUCD1_HUMAN	guanylyl cyclase domain containing 1	135																	GCCTGGATGTCCTTCACACTC	0.627																																																	0								ENSG00000138867						62.0	52.0	56.0					22																	24940035		2203	4300	6503	GUCD1	SO:0001583	missense	0			-	HGNC	AK054681	CCDS33621.1, CCDS63426.1, CCDS63427.1, CCDS74831.1, CCDS74832.1, CCDS74833.1	22q11.2	2012-11-13	2012-11-13	2012-11-13	ENSG00000138867	ENSG00000138867			14237	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 13"""	C22orf13		12477932	Standard	XM_005261761		Approved	MGC1842, LLN4	uc003aah.2	Q96NT3	OTTHUMG00000150728	ENST00000407471.3:c.403G>A	22.37:g.24940035C>T	ENSP00000386076:p.Asp135Asn	Somatic	0	35	0.00		0.5130446035623836	118	24.84	39	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	14	22.22	B5MCB8|B5MCL7|Q96Q79|Q9BU32	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Guanylyl_cyclase	p.D135N	ENST00000407471.3	37	c.403	CCDS33621.1	22	.	.	.	.	.	.	.	.	.	.	C	22.9	4.349921	0.82132	.	.	ENSG00000138867	ENST00000407471;ENST00000435822;ENST00000404664	.	.	.	4.89	4.89	0.63831	.	0.168095	0.52532	D	0.000079	T	0.65176	0.2666	M	0.62723	1.935	0.80722	D	1	D;D;P	0.53312	0.959;0.959;0.801	P;P;B	0.50049	0.629;0.629;0.322	T	0.68864	-0.5296	9	0.52906	T	0.07	-43.1115	17.3799	0.87402	0.0:1.0:0.0:0.0	.	191;199;135	B5MCL7;B4DH83;Q96NT3	.;.;CV013_HUMAN	N	135;135;191	.	ENSP00000381297:D135N	D	-	1	0	C22orf13	23270035	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	5.832000	0.69337	2.411000	0.81874	0.563000	0.77884	GAC	-	pfam_Guanylyl_cyclase		0.627	GUCD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GUCD1	protein_coding	OTTHUMT00000319819.1	C	NM_031444	-		24940035	-1	no_errors	ENST00000407471	ensembl	human	known	74_37	missense	SNP	1.000	T
TTC3	7267	genome.wustl.edu	37	21	38461127	38461127	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr21:38461127A>G	ENST00000399017.2	+	5	3114	c.367A>G	c.(367-369)Aag>Gag	p.K123E	TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000399010.1_Missense_Mutation_p.K123E|TTC3_ENST00000354749.2_Missense_Mutation_p.K123E|TTC3_ENST00000540756.1_Intron|TTC3_ENST00000355666.1_Missense_Mutation_p.K123E	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	123					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				GATAAATTTGAAGAAACTACA	0.328																																					Ovarian(38;194 1649 35661)												0								ENSG00000182670						70.0	69.0	70.0					21																	38461127		2203	4300	6503	TTC3	SO:0001583	missense	0			-	HGNC	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.367A>G	21.37:g.38461127A>G	ENSP00000381981:p.Lys123Glu	Somatic	0	84	0.00		0.5130446035623836	27	35.71	15	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	53	29.33	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,superfamily_DEATH-like_dom,smart_TPR_repeat,smart_Znf_RING,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.K123E	ENST00000399017.2	37	c.367	CCDS13651.1	21	.	.	.	.	.	.	.	.	.	.	A	14.12	2.440676	0.43326	.	.	ENSG00000182670	ENST00000418766;ENST00000450533;ENST00000438055;ENST00000355666;ENST00000399010;ENST00000399017;ENST00000354749	T;T;T;T;T;T	0.53423	2.43;0.62;2.39;2.74;2.74;2.74	4.85	3.7	0.42460	.	0.209144	0.32836	N	0.005598	T	0.39708	0.1088	M	0.61703	1.905	0.80722	D	1	B	0.30741	0.293	B	0.26517	0.07	T	0.28202	-1.0051	10	0.49607	T	0.09	-1.9079	5.6629	0.17678	0.7539:0.0:0.2461:0.0	.	123	P53804	TTC3_HUMAN	E	123	ENSP00000403943:K123E;ENSP00000408456:K123E;ENSP00000391891:K123E;ENSP00000347889:K123E;ENSP00000381981:K123E;ENSP00000346791:K123E	ENSP00000346791:K123E	K	+	1	0	TTC3	37382997	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.650000	0.46665	0.733000	0.32492	0.454000	0.30748	AAG	-	NULL		0.328	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC3	protein_coding	OTTHUMT00000194776.1	A		-		38461127	+1	no_errors	ENST00000354749	ensembl	human	known	74_37	missense	SNP	1.000	G
MAPT	4137	genome.wustl.edu	37	17	44060683	44060683	+	Silent	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr17:44060683G>A	ENST00000571987.1	+	5	513	c.513G>A	c.(511-513)tcG>tcA	p.S171S	MAPT_ENST00000574436.1_Intron|MAPT_ENST00000570299.1_Intron|MAPT_ENST00000344290.5_Silent_p.S171S|MAPT_ENST00000576518.1_Intron|MAPT_ENST00000347967.5_Intron|MAPT_ENST00000446361.3_Intron|MAPT_ENST00000351559.5_Intron|MAPT_ENST00000535772.1_Intron|MAPT_ENST00000262410.5_Silent_p.S171S|MAPT_ENST00000334239.8_Intron|MAPT_ENST00000431008.3_Intron|MAPT_ENST00000415613.2_Silent_p.S171S|MAPT_ENST00000340799.5_Intron|MAPT_ENST00000420682.2_Intron			P10636	TAU_HUMAN	microtubule-associated protein tau	171					adult walking behavior (GO:0007628)|apoptotic process (GO:0006915)|axon cargo transport (GO:0008088)|axon extension (GO:0048675)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|generation of neurons (GO:0048699)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of microtubule polymerization (GO:0031116)|regulation of autophagy (GO:0010506)|regulation of microtubule polymerization (GO:0031113)|regulation of microtubule-based movement (GO:0060632)	axon (GO:0030424)|axoneme (GO:0005930)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|growth cone (GO:0030426)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nuclear periphery (GO:0034399)|plasma membrane (GO:0005886)|tubulin complex (GO:0045298)	apolipoprotein binding (GO:0034185)|enzyme binding (GO:0019899)|lipoprotein particle binding (GO:0071813)|microtubule binding (GO:0008017)|SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		Melanoma(429;0.216)			Docetaxel(DB01248)|Paclitaxel(DB01229)	GCCAACCTTCGGGGACAGGAC	0.697																																																	0								ENSG00000186868						12.0	14.0	13.0					17																	44060683		2193	4289	6482	MAPT	SO:0001819	synonymous_variant	0			-	HGNC	J03778	CCDS11499.1, CCDS11500.1, CCDS11501.1, CCDS11502.1, CCDS45715.1, CCDS45716.1, CCDS56033.1	17q21	2014-09-17			ENSG00000186868	ENSG00000186868			6893	protein-coding gene	gene with protein product	"""G protein beta1/gamma2 subunit-interacting factor 1"", ""microtubule-associated protein tau, isoform 4"", ""protein phosphatase 1, regulatory subunit 103"""	157140		DDPAC, MAPTL		7936241, 3131773	Standard	NM_001123067		Approved	MTBT1, tau, PPND, FTDP-17, TAU, MSTD, MTBT2, FLJ31424, MGC138549, PPP1R103	uc010dau.3	P10636	OTTHUMG00000168833	ENST00000571987.1:c.513G>A	17.37:g.44060683G>A		Somatic	0	33	0.00		0.5130446035623836	27	10.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	17	22.73	P18518|Q14799|Q15549|Q15550|Q15551|Q1RMF6|Q53YB1|Q5CZI7|Q5XWF0|Q6QT54|Q9UDJ3|Q9UMH0|Q9UQ96	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MAP_tubulin-bd_rpt,prints_Tau	p.S171	ENST00000571987.1	37	c.513	CCDS11501.1	17																																																																																			-	NULL		0.697	MAPT-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MAPT	protein_coding	OTTHUMT00000440133.1	G	NM_016835	-		44060683	+1	no_errors	ENST00000344290	ensembl	human	known	74_37	silent	SNP	0.000	A
SUPT20H	55578	genome.wustl.edu	37	13	37607692	37607692	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr13:37607692G>T	ENST00000350612.6	-	10	821	c.601C>A	c.(601-603)Cta>Ata	p.L201I	SUPT20H_ENST00000542180.1_Missense_Mutation_p.L189I|SUPT20H_ENST00000356185.3_Missense_Mutation_p.L202I|SUPT20H_ENST00000360252.4_Missense_Mutation_p.L202I|SUPT20H_ENST00000475892.1_Missense_Mutation_p.L201I|SUPT20H_ENST00000464744.1_Missense_Mutation_p.L202I|AL138706.1_ENST00000408173.1_RNA	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)	201					autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										GCTGTAGCTAGGATGAGCTGG	0.393																																																	0								ENSG00000102710						154.0	134.0	141.0					13																	37607692		2203	4300	6503	SUPT20H	SO:0001583	missense	0			-	HGNC	AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.601C>A	13.37:g.37607692G>T	ENSP00000218894:p.Leu201Ile	Somatic	0	77	0.00		0.5130446035623836	113	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	E7ER46|Q71RF3|Q9Y6A6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spt20	p.L201I	ENST00000350612.6	37	c.601	CCDS31959.1	13	.	.	.	.	.	.	.	.	.	.	G	20.4	3.975899	0.74360	.	.	ENSG00000102710	ENST00000360252;ENST00000475892;ENST00000350612;ENST00000356185;ENST00000536874;ENST00000464744;ENST00000542180	T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78	5.85	3.9	0.45041	.	0.000000	0.64402	D	0.000004	T	0.67581	0.2908	M	0.87180	2.865	0.49687	D	0.999814	D;D;D;D;D;D	0.89917	1.0;0.998;0.998;0.995;1.0;1.0	D;D;D;D;D;D	0.97110	0.998;0.979;0.98;0.98;1.0;1.0	T	0.67703	-0.5602	10	0.72032	D	0.01	-11.5162	5.7981	0.18397	0.537:0.0:0.463:0.0	.	189;201;201;202;202;201	B4E2D5;B3KNI1;E7ER46;A8K8L1;Q8NEM7-2;Q8NEM7	.;.;.;.;.;FA48A_HUMAN	I	202;201;201;202;201;202;189	ENSP00000353388:L202I;ENSP00000417510:L201I;ENSP00000218894:L201I;ENSP00000348512:L202I;ENSP00000419754:L202I;ENSP00000439000:L189I	ENSP00000218894:L201I	L	-	1	2	FAM48A	36505692	1.000000	0.71417	0.970000	0.41538	0.997000	0.91878	3.426000	0.52778	0.740000	0.32651	0.655000	0.94253	CTA	-	pfam_Spt20		0.393	SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT20H	protein_coding	OTTHUMT00000354766.1	G	NM_017569	-		37607692	-1	no_errors	ENST00000350612	ensembl	human	known	74_37	missense	SNP	0.999	T
KCNK1	3775	genome.wustl.edu	37	1	233802387	233802387	+	Silent	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr1:233802387C>T	ENST00000366621.3	+	2	570	c.402C>T	c.(400-402)tgC>tgT	p.C134C	KCNK1_ENST00000472190.1_3'UTR|KCNK1_ENST00000366620.1_Silent_p.C18C	NM_002245.3	NP_002236.1	O00180	KCNK1_HUMAN	potassium channel, subfamily K, member 1	134					potassium ion transport (GO:0006813)|response to nicotine (GO:0035094)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)	11		all_cancers(173;0.00217)|all_epithelial(177;0.121)|Prostate(94;0.122)|Acute lymphoblastic leukemia(190;0.175)			Ibutilide(DB00308)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)	AGGCCTTCTGCATCATCTACT	0.567																																																	0								ENSG00000135750						213.0	145.0	168.0					1																	233802387		2203	4300	6503	KCNK1	SO:0001819	synonymous_variant	0			-	HGNC	U33632	CCDS1599.1	1q42-q43	2012-03-07			ENSG00000135750	ENSG00000135750		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6272	protein-coding gene	gene with protein product		601745				8661042, 16382106	Standard	NM_002245		Approved	K2p1.1, DPK, TWIK-1	uc010pxo.1	O00180	OTTHUMG00000037923	ENST00000366621.3:c.402C>T	1.37:g.233802387C>T		Somatic	0	62	0.00		0.5130446035623836	59	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q13307|Q5T5E8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_2pore_dom_K_chnl_dom,pirsf_2pore_dom_K_chnl_TASK,prints_2pore_dom_K_chnl_TWIK1,prints_2pore_dom_K_chnl_TWIK,prints_2pore_dom_K_chnl	p.C134	ENST00000366621.3	37	c.402	CCDS1599.1	1																																																																																			-	pfam_2pore_dom_K_chnl_dom,pirsf_2pore_dom_K_chnl_TASK,prints_2pore_dom_K_chnl		0.567	KCNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK1	protein_coding	OTTHUMT00000092565.1	C	NM_002245	-		233802387	+1	no_errors	ENST00000366621	ensembl	human	known	74_37	silent	SNP	1.000	T
