#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
TUBA4B	80086	genome.wustl.edu	37	2	220136303	220136303	+	RNA	SNP	C	C	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr2:220136303C>T	ENST00000490341.1	+	0	773					NR_003063.1		Q9H853	TBA4B_HUMAN	tubulin, alpha 4b (pseudogene)						microtubule-based process (GO:0007017)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|structural constituent of cytoskeleton (GO:0005200)										TCCTACCTCACATCCACTTCC	0.532																																																	0								ENSG00000243910																																			TUBA4B			0			-	HGNC	AK024002		2q35	2014-03-20	2007-03-16	2007-02-12	ENSG00000243910	ENSG00000243910		"""Tubulins"""	18637	pseudogene	pseudogene			"""tubulin, alpha 4"", ""tubulin, alpha 4b"""	TUBA4		3785200	Standard	NR_003063		Approved	FLJ13940	uc002vkv.1	Q9H853	OTTHUMG00000154516		2.37:g.220136303C>T		Somatic	1	114	0.87		0.473291439996773	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	56	45.63		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000490341.1	37	NULL		2																																																																																			-	-		0.532	TUBA4B-001	KNOWN	basic	processed_transcript	TUBA4B	pseudogene	OTTHUMT00000335637.1	C	NR_003063	-		220136303	+1	no_errors	ENST00000473885	ensembl	human	known	74_37	rna	SNP	1.000	T
TCHH	7062	genome.wustl.edu	37	1	152085283	152085283	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr1:152085283C>T	ENST00000368804.1	-	2	409	c.410G>A	c.(409-411)cGc>cAc	p.R137H		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	137					keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTTCTGCCTGCGTCGTTGCCC	0.572																																																	0								ENSG00000159450						251.0	248.0	249.0					1																	152085283		2038	4182	6220	TCHH	SO:0001583	missense	0			-	HGNC	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.410G>A	1.37:g.152085283C>T	ENSP00000357794:p.Arg137His	Somatic	0	51	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	15	54.55	Q5VUI3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.R137H	ENST00000368804.1	37	c.410	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	c	2.759	-0.258258	0.05791	.	.	ENSG00000159450	ENST00000368804	T	0.06371	3.31	5.01	-1.36	0.09085	.	.	.	.	.	T	0.00875	0.0029	N	0.08118	0	0.09310	N	1	B	0.19817	0.039	B	0.08055	0.003	T	0.46965	-0.9153	9	0.34782	T	0.22	-0.6981	5.8919	0.18917	0.0:0.3852:0.1359:0.4789	.	137	Q07283	TRHY_HUMAN	H	137	ENSP00000357794:R137H	ENSP00000357794:R137H	R	-	2	0	TCHH	150351907	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-0.240000	0.08952	-0.153000	0.11137	-1.189000	0.01698	CGC	-	NULL		0.572	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	protein_coding	OTTHUMT00000036671.2	C	NM_007113	-		152085283	-1	no_errors	ENST00000368804	ensembl	human	known	74_37	missense	SNP	0.000	T
CASC5	57082	genome.wustl.edu	37	15	40913679	40913679	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr15:40913679C>T	ENST00000346991.5	+	11	1685	c.1295C>T	c.(1294-1296)gCc>gTc	p.A432V	CASC5_ENST00000527044.1_3'UTR|CASC5_ENST00000399668.2_Missense_Mutation_p.A406V			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	432	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AATCAGGATGCCAGAATATTA	0.368																																																	0								ENSG00000137812						101.0	101.0	101.0					15																	40913679		1823	4077	5900	CASC5	SO:0001583	missense	0			-	HGNC	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.1295C>T	15.37:g.40913679C>T	ENSP00000335463:p.Ala432Val	Somatic	0	35	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A432V	ENST00000346991.5	37	c.1295	CCDS42023.1	15	.	.	.	.	.	.	.	.	.	.	C	4.982	0.182426	0.09495	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000399668	T;T	0.05580	3.42;3.43	5.17	-1.65	0.08291	.	1.592950	0.03263	N	0.183510	T	0.07818	0.0196	M	0.61703	1.905	0.09310	N	1	B;B;B	0.20052	0.019;0.019;0.041	B;B;B	0.14578	0.011;0.011;0.011	T	0.37911	-0.9685	10	0.40728	T	0.16	.	2.095	0.03666	0.1059:0.4174:0.2249:0.2518	.	406;432;406	Q8NG31-2;Q8NG31;Q8NG31-4	.;CASC5_HUMAN;.	V	432;406;406	ENSP00000335463:A432V;ENSP00000382576:A406V	ENSP00000260369:A406V	A	+	2	0	CASC5	38700971	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.696000	0.05104	-0.490000	0.06707	0.460000	0.39030	GCC	-	NULL		0.368	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CASC5	protein_coding	OTTHUMT00000390224.2	C	NM_144508	-		40913679	+1	no_errors	ENST00000346991	ensembl	human	known	74_37	missense	SNP	0.000	T
DERA	51071	genome.wustl.edu	37	12	16189290	16189290	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr12:16189290C>T	ENST00000428559.2	+	8	1087	c.875C>T	c.(874-876)aCt>aTt	p.T292I	DERA_ENST00000532964.1_Missense_Mutation_p.T249I|DERA_ENST00000526530.1_Missense_Mutation_p.T204I	NM_015954.2	NP_057038.2	Q9Y315	DEOC_HUMAN	deoxyribose-phosphate aldolase (putative)	292					deoxyribonucleoside catabolic process (GO:0046121)|deoxyribonucleotide catabolic process (GO:0009264)|deoxyribose phosphate catabolic process (GO:0046386)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	deoxyribose-phosphate aldolase activity (GO:0004139)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)	7		Hepatocellular(102;0.121)				GGTGCCAGTACTCTGCTCTCG	0.433																																																	0								ENSG00000023697						104.0	101.0	102.0					12																	16189290		1866	4109	5975	DERA	SO:0001583	missense	0			-	HGNC	AF132960	CCDS44838.1, CCDS73451.1	12p12.3	2010-06-24	2010-06-24		ENSG00000023697	ENSG00000023697	4.1.2.4		24269	protein-coding gene	gene with protein product			"""2-deoxyribose-5-phosphate aldolase homolog (C. elegans)"""			12546782	Standard	XM_006719083		Approved	CGI-26, DEOC	uc001rde.3	Q9Y315	OTTHUMG00000165537	ENST00000428559.2:c.875C>T	12.37:g.16189290C>T	ENSP00000416583:p.Thr292Ile	Somatic	0	45	0.00		0.473291439996773	14	57.58	19	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	18	56.10	Q53HN9|Q6PHW2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DeoC/FbaB/lacD_aldolase,pirsf_DeoC,tigrfam_DeoC	p.T292I	ENST00000428559.2	37	c.875	CCDS44838.1	12	.	.	.	.	.	.	.	.	.	.	C	15.08	2.725937	0.48833	.	.	ENSG00000023697	ENST00000428559;ENST00000532964;ENST00000526530	.	.	.	5.57	4.67	0.58626	Aldolase-type TIM barrel (1);	0.365666	0.32987	N	0.005405	T	0.45236	0.1332	L	0.39245	1.2	0.29389	N	0.862764	B	0.28470	0.213	B	0.34385	0.181	T	0.52253	-0.8600	9	0.87932	D	0	-6.6333	15.6664	0.77234	0.0:0.7016:0.2984:0.0	.	292	Q9Y315	DEOC_HUMAN	I	292;249;204	.	ENSP00000416583:T292I	T	+	2	0	DERA	16080557	0.354000	0.24912	0.251000	0.24312	0.845000	0.48019	3.167000	0.50793	1.337000	0.45525	0.655000	0.94253	ACT	-	pfam_DeoC/FbaB/lacD_aldolase,pirsf_DeoC		0.433	DERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DERA	protein_coding	OTTHUMT00000384731.1	C	NM_015954	-		16189290	+1	no_errors	ENST00000428559	ensembl	human	known	74_37	missense	SNP	0.979	T
LYRM2	57226	genome.wustl.edu	37	6	90347454	90347454	+	Intron	SNP	T	T	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr6:90347454T>A	ENST00000523377.1	-	2	223				LYRM2_ENST00000517396.1_5'UTR|LYRM2_ENST00000520441.1_Missense_Mutation_p.T65S|LYRM2_ENST00000520318.1_Missense_Mutation_p.T65S	NM_020466.4	NP_065199.1	Q9NU23	LYRM2_HUMAN	LYR motif containing 2							mitochondrion (GO:0005739)				kidney(1)|large_intestine(1)|lung(1)	3		all_cancers(76;2.76e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;3.72e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0131)		CATGATTTTGTTCTCACCTCT	0.383																																																	0								ENSG00000083099						162.0	156.0	158.0					6																	90347454		2203	4300	6503	LYRM2	SO:0001627	intron_variant	0			-	HGNC	BC009782	CCDS5023.1	6q15	2006-09-19			ENSG00000083099	ENSG00000083099		"""LYR motif containing"""	25229	protein-coding gene	gene with protein product						12477932	Standard	NM_020466		Approved	DJ122O8.2	uc003pnm.3	Q9NU23	OTTHUMG00000015203	ENST00000523377.1:c.186+6A>T	6.37:g.90347454T>A		Somatic	0	75	0.00		0.473291439996773	1	75.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	24	59.32	B2R4U2|E1P517	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Complex1_LYR	p.T65S	ENST00000523377.1	37	c.193	CCDS5023.1	6	.	.	.	.	.	.	.	.	.	.	T	7.189	0.591129	0.13812	.	.	ENSG00000083099	ENST00000520441;ENST00000520318	T;T	0.70986	-0.53;-0.53	4.4	0.849	0.18972	.	.	.	.	.	T	0.47303	0.1438	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.48958	-0.8988	6	0.72032	D	0.01	.	4.3605	0.11199	0.0:0.1986:0.189:0.6124	.	.	.	.	S	65	ENSP00000427859:T65S;ENSP00000428207:T65S	ENSP00000428207:T65S	T	-	1	0	LYRM2	90404175	0.962000	0.33011	0.254000	0.24359	0.130000	0.20726	1.558000	0.36309	0.152000	0.19188	-0.490000	0.04691	ACA	-	NULL		0.383	LYRM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LYRM2	protein_coding	OTTHUMT00000041498.2	T	NM_020466	-		90347454	-1	no_errors	ENST00000520441	ensembl	human	putative	74_37	missense	SNP	0.192	A
SNX33	257364	genome.wustl.edu	37	15	75942421	75942421	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr15:75942421C>G	ENST00000308527.5	+	1	2175	c.978C>G	c.(976-978)taC>taG	p.Y326*	IMP3_ENST00000565349.1_5'Flank|IMP3_ENST00000314852.2_5'Flank	NM_153271.1	NP_695003.1	Q8WV41	SNX33_HUMAN	sorting nexin 33	326	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|macropinocytosis (GO:0044351)|membrane tubulation (GO:0097320)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|negative regulation of endocytosis (GO:0045806)|negative regulation of protein localization to cell surface (GO:2000009)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein localization to cell surface (GO:2000010)|protein import (GO:0017038)	cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	19						TCTCCCAGTACGAAGGCTTCC	0.592																																																	0								ENSG00000173548						84.0	88.0	86.0					15																	75942421		2197	4294	6491	SNX33	SO:0001587	stop_gained	0			-	HGNC	AK091291	CCDS10283.1	15q23	2008-04-18	2008-03-25	2008-03-25	ENSG00000173548	ENSG00000173548			28468	protein-coding gene	gene with protein product			"""SH3 and PX domain containing 3"""	SH3PX3		16374509, 16782399, 18353773	Standard	NM_153271		Approved	MGC32065, SH3PXD3C, SNX30	uc002bau.3	Q8WV41	OTTHUMG00000142835	ENST00000308527.5:c.978C>G	15.37:g.75942421C>G	ENSP00000311427:p.Tyr326*	Somatic	0	68	0.00		0.473291439996773	5	16.67	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	19	45.95	B1NM17	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sorting_nexin_WASP-bd-dom,pfam_Phox,pfam_SH3_domain,pfam_SH3_2,superfamily_Phox,superfamily_SH3_domain,smart_SH3_domain,smart_Phox,pirsf_Snx9,pfscan_Phox,pfscan_SH3_domain	p.Y326*	ENST00000308527.5	37	c.978	CCDS10283.1	15	.	.	.	.	.	.	.	.	.	.	C	14.52	2.559099	0.45590	.	.	ENSG00000173548	ENST00000308527	.	.	.	5.68	-11.4	0.00090	.	0.263771	0.38548	N	0.001644	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-23.63	14.0861	0.64957	0.0783:0.6398:0.0:0.2819	.	.	.	.	X	326	.	ENSP00000311427:Y326X	Y	+	3	2	SNX33	73729476	0.001000	0.12720	0.513000	0.27749	0.838000	0.47535	-1.442000	0.02407	-2.234000	0.00715	-1.193000	0.01689	TAC	-	pfam_Phox,superfamily_Phox,smart_Phox,pirsf_Snx9,pfscan_Phox		0.592	SNX33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX33	protein_coding	OTTHUMT00000286471.1	C	NM_153271	-		75942421	+1	no_errors	ENST00000308527	ensembl	human	known	74_37	nonsense	SNP	0.267	G
TRPC7	57113	genome.wustl.edu	37	5	135692561	135692561	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr5:135692561G>A	ENST00000513104.1	-	2	797	c.515C>T	c.(514-516)gCg>gTg	p.A172V	TRPC7_ENST00000355180.3_Missense_Mutation_p.A172V|TRPC7_ENST00000426057.2_Missense_Mutation_p.A172V	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	172					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTGGCAGTGCGCCGCCAGGAT	0.632																																																	0								ENSG00000069018						128.0	137.0	134.0					5																	135692561		2203	4300	6503	TRPC7	SO:0001583	missense	0			-	HGNC	AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.515C>T	5.37:g.135692561G>A	ENSP00000426070:p.Ala172Val	Somatic	0	27	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	13	40.91	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,prints_TRPC7_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.A172V	ENST00000513104.1	37	c.515	CCDS47267.2	5	.	.	.	.	.	.	.	.	.	.	G	34	5.335741	0.95758	.	.	ENSG00000069018	ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193	T;T;T	0.72725	-0.68;-0.68;-0.68	5.26	5.26	0.73747	Ankyrin repeat-containing domain (2);	0.000000	0.85682	D	0.000000	D	0.85225	0.5648	M	0.80616	2.505	0.47737	D	0.999508	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;D;D;D	0.75020	0.97;0.985;0.965;0.965	D	0.86781	0.1979	10	0.87932	D	0	-16.9024	19.0783	0.93171	0.0:0.0:1.0:0.0	.	172;172;172;172	Q8IWP7;F5H5U9;Q70T25;Q9HCX4	.;.;.;TRPC7_HUMAN	V	172	ENSP00000347312:A172V;ENSP00000441628:A172V;ENSP00000426070:A172V	ENSP00000265193:A172V	A	-	2	0	TRPC7	135720460	1.000000	0.71417	0.980000	0.43619	0.988000	0.76386	9.657000	0.98554	2.731000	0.93534	0.650000	0.86243	GCG	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,tigrfam_TRP_channel		0.632	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC7	protein_coding	OTTHUMT00000366975.1	G	NM_020389	-		135692561	-1	no_errors	ENST00000513104	ensembl	human	known	74_37	missense	SNP	1.000	A
FAM104B	90736	genome.wustl.edu	37	X	55170270	55170270	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chrX:55170270G>T	ENST00000358460.4	-	4	443	c.290C>A	c.(289-291)tCc>tAc	p.S97Y	FAM104B_ENST00000332132.4_Missense_Mutation_p.S98Y|FAM104B_ENST00000478918.1_5'Flank			Q5XKR9	F104B_HUMAN	family with sequence similarity 104, member B	97										endometrium(3)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	8						AGGACCAAAGGACATAAACCA	0.368																																																	0								ENSG00000182518						142.0	124.0	130.0					X																	55170270		2203	4300	6503	FAM104B	SO:0001583	missense	0			-	HGNC	BC000919	CCDS35305.1, CCDS35305.2, CCDS55422.1, CCDS55423.1, CCDS55424.1, CCDS55425.1, CCDS55426.1	Xp11.22	2008-02-05	2006-05-16	2006-05-16	ENSG00000182518	ENSG00000182518			25085	protein-coding gene	gene with protein product			"""chromosome X open reading frame 44"""	CXorf44		12477932	Standard	NM_138362		Approved	FLJ20434	uc004dug.2	Q5XKR9	OTTHUMG00000021646	ENST00000358460.4:c.290C>A	X.37:g.55170270G>T	ENSP00000364101:p.Ser97Tyr	Somatic	0	71	0.00		0.473291439996773	35	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A6NEH1|B4DSV6|D6R9S5|D6RDJ5|E9PH40|Q8WVU5|Q9BRA1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S98Y	ENST00000358460.4	37	c.293	CCDS35305.2	X	.	.	.	.	.	.	.	.	.	.	g	5.046	0.194102	0.09599	.	.	ENSG00000182518	ENST00000358460;ENST00000332132	T;T	0.45668	0.89;0.89	1.22	0.236	0.15471	.	21.583900	0.01591	U	0.021569	T	0.32406	0.0828	N	0.08118	0	0.09310	N	1	D;D	0.62365	0.991;0.991	P;P	0.50231	0.635;0.635	T	0.19614	-1.0300	10	0.72032	D	0.01	.	4.7436	0.13026	0.0:0.3996:0.6004:0.0	.	97;98	Q5XKR9;Q5XKR9-2	F104B_HUMAN;.	Y	97;98	ENSP00000364101:S97Y;ENSP00000333394:S98Y	ENSP00000333394:S98Y	S	-	2	0	FAM104B	55186995	0.007000	0.16637	0.001000	0.08648	0.035000	0.12851	0.341000	0.19909	0.013000	0.14918	0.513000	0.50165	TCC	-	NULL		0.368	FAM104B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM104B	protein_coding	OTTHUMT00000056851.1	G	NM_138362	-		55170270	-1	no_errors	ENST00000332132	ensembl	human	known	74_37	missense	SNP	0.001	T
OBSCN	84033	genome.wustl.edu	37	1	228494137	228494137	+	Silent	SNP	C	C	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr1:228494137C>A	ENST00000422127.1	+	44	11768	c.11724C>A	c.(11722-11724)acC>acA	p.T3908T	OBSCN_ENST00000366707.4_Silent_p.T1542T|OBSCN_ENST00000366709.4_Silent_p.T1027T|OBSCN_ENST00000570156.2_Silent_p.T4865T|OBSCN_ENST00000284548.11_Silent_p.T3908T	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3908	Ig-like 40.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCACGGCCACCCTGCAGTGTG	0.687																																																	0								ENSG00000154358						15.0	17.0	17.0					1																	228494137		1927	4095	6022	OBSCN	SO:0001819	synonymous_variant	0			-	HGNC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11724C>A	1.37:g.228494137C>A		Somatic	0	24	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	6	57.14	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.T3908	ENST00000422127.1	37	c.11724	CCDS58065.1	1																																																																																			-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom		0.687	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	protein_coding		C	NM_052843	-		228494137	+1	no_errors	ENST00000422127	ensembl	human	known	74_37	silent	SNP	0.006	A
GPM6A	2823	genome.wustl.edu	37	4	176556169	176556169	+	Missense_Mutation	SNP	C	C	A	rs1049820	byFrequency	TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr4:176556169C>A	ENST00000280187.7	-	8	769	c.724G>T	c.(724-726)Gtg>Ttg	p.V242L	GPM6A_ENST00000506894.1_Missense_Mutation_p.V231L|GPM6A_ENST00000393658.2_Missense_Mutation_p.V242L|GPM6A_ENST00000506219.1_5'UTR|GPM6A_ENST00000515090.1_Missense_Mutation_p.V235L	NM_005277.4	NP_005268.1	P51674	GPM6A_HUMAN	glycoprotein M6A	242			V -> L (in dbSNP:rs1049820).		neural retina development (GO:0003407)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|positive regulation of filopodium assembly (GO:0051491)|stem cell differentiation (GO:0048863)|synapse assembly (GO:0007416)	axonal growth cone (GO:0044295)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium channel activity (GO:0005262)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		GCGTCTTTCACATAGGCCCAG	0.438																																																	0								ENSG00000150625						83.0	77.0	79.0					4																	176556169		2203	4300	6503	GPM6A	SO:0001583	missense	0			-	HGNC		CCDS3824.1, CCDS54822.1, CCDS58936.1	4q34	2008-08-29				ENSG00000150625			4460	protein-coding gene	gene with protein product		601275		GPM6		8661015, 18574501	Standard	NM_005277		Approved		uc003iug.4	P51674		ENST00000280187.7:c.724G>T	4.37:g.176556169C>A	ENSP00000280187:p.Val242Leu	Somatic	0	20	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	3	75.00	B7Z642|E9PHI5|Q92602	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myelin_PLP,smart_Myelin_PLP,prints_Myelin_PLP	p.V242L	ENST00000280187.7	37	c.724	CCDS3824.1	4	.	.	.	.	.	.	.	.	.	.	C	11.19	1.566063	0.27915	.	.	ENSG00000150625	ENST00000280187;ENST00000393658;ENST00000506894;ENST00000515090	D;D;D;D	0.98807	-5.15;-5.15;-5.15;-5.15	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.92430	0.7597	N	0.00771	-1.2	0.80722	D	1	B;B;B	0.11235	0.004;0.004;0.004	B;B;B	0.12837	0.007;0.007;0.008	D	0.89068	0.3467	10	0.02654	T	1	-19.8899	20.3627	0.98863	0.0:1.0:0.0:0.0	rs1049820;rs1803466;rs3189995;rs1049820	235;231;242	B7Z642;E9PHI5;P51674	.;.;GPM6A_HUMAN	L	242;242;231;235	ENSP00000280187:V242L;ENSP00000377268:V242L;ENSP00000421578:V231L;ENSP00000423984:V235L	ENSP00000280187:V242L	V	-	1	0	GPM6A	176793163	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.445000	0.80570	2.885000	0.99019	0.655000	0.94253	GTG	-	pfam_Myelin_PLP		0.438	GPM6A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPM6A	protein_coding	OTTHUMT00000362163.1	C		rs1049820		176556169	-1	no_errors	ENST00000280187	ensembl	human	known	74_37	missense	SNP	1.000	A
ANK3	288	genome.wustl.edu	37	10	61835172	61835172	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr10:61835172G>A	ENST00000280772.2	-	37	5658	c.5467C>T	c.(5467-5469)Cca>Tca	p.P1823S	ANK3_ENST00000503366.1_Intron|ANK3_ENST00000355288.2_Intron|ANK3_ENST00000373827.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1823	Ser-rich.				axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GAGTATACTGGCACTGTTATA	0.413																																																	0								ENSG00000151150						132.0	138.0	136.0					10																	61835172		2203	4300	6503	ANK3	SO:0001583	missense	0			-	HGNC	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.5467C>T	10.37:g.61835172G>A	ENSP00000280772:p.Pro1823Ser	Somatic	0	34	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.P1823S	ENST00000280772.2	37	c.5467	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	G	16.85	3.236854	0.58886	.	.	ENSG00000151150	ENST00000280772	T	0.77098	-1.07	5.54	5.54	0.83059	.	0.000000	0.41823	D	0.000809	D	0.87293	0.6141	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.87312	0.2312	10	0.59425	D	0.04	.	19.5542	0.95335	0.0:0.0:1.0:0.0	.	1823	Q12955	ANK3_HUMAN	S	1823	ENSP00000280772:P1823S	ENSP00000280772:P1823S	P	-	1	0	ANK3	61505178	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.472000	0.97709	2.643000	0.89663	0.461000	0.40582	CCA	-	NULL		0.413	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	protein_coding	OTTHUMT00000048201.4	G	NM_020987	-		61835172	-1	no_errors	ENST00000280772	ensembl	human	known	74_37	missense	SNP	1.000	A
TMEM74	157753	genome.wustl.edu	37	8	109797134	109797134	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr8:109797134G>A	ENST00000297459.3	-	2	372	c.194C>T	c.(193-195)gCa>gTa	p.A65V	TMEM74_ENST00000518838.1_Intron	NM_153015.1	NP_694560.1	Q96NL1	TMM74_HUMAN	transmembrane protein 74	65					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			GGAGGGGGATGCTGGAGAAGA	0.512																																																	0								ENSG00000164841						122.0	122.0	122.0					8																	109797134		2203	4300	6503	TMEM74	SO:0001583	missense	0			-	HGNC	AK055230	CCDS6310.1	8q23.1	2009-11-06				ENSG00000164841			26409	protein-coding gene	gene with protein product		613935				12477932	Standard	NM_153015		Approved	FLJ30668, NET36	uc003ymy.1	Q96NL1		ENST00000297459.3:c.194C>T	8.37:g.109797134G>A	ENSP00000297459:p.Ala65Val	Somatic	0	72	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	44	43.59		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A65V	ENST00000297459.3	37	c.194	CCDS6310.1	8	.	.	.	.	.	.	.	.	.	.	G	2.063	-0.414932	0.04766	.	.	ENSG00000164841	ENST00000297459	.	.	.	5.9	2.01	0.26516	.	0.562189	0.19115	N	0.122338	T	0.24624	0.0597	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.14952	-1.0454	9	0.45353	T	0.12	-1.7759	5.026	0.14385	0.199:0.0:0.5558:0.2452	.	65	Q96NL1	TMM74_HUMAN	V	65	.	ENSP00000297459:A65V	A	-	2	0	TMEM74	109866310	0.004000	0.15560	0.029000	0.17559	0.241000	0.25554	1.203000	0.32284	0.086000	0.17137	-0.136000	0.14681	GCA	-	NULL		0.512	TMEM74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM74	protein_coding	OTTHUMT00000380755.1	G	NM_153015	-		109797134	-1	no_errors	ENST00000297459	ensembl	human	known	74_37	missense	SNP	0.000	A
ACOX2	8309	genome.wustl.edu	37	3	58514611	58514611	+	Nonsense_Mutation	SNP	A	A	C			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr3:58514611A>C	ENST00000302819.5	-	9	1356	c.1065T>G	c.(1063-1065)taT>taG	p.Y355*	ACOX2_ENST00000459701.2_Nonsense_Mutation_p.Y341*	NM_003500.3	NP_003491.1	Q99424	ACOX2_HUMAN	acyl-CoA oxidase 2, branched chain	355					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity (GO:0033791)|acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		AATGGAAGGCATAACTGATGG	0.507																																																	0								ENSG00000168306						135.0	128.0	130.0					3																	58514611		2203	4300	6503	ACOX2	SO:0001587	stop_gained	0			-	HGNC	X95190	CCDS33775.1	3p14.3	2012-07-13	2010-04-30		ENSG00000168306	ENSG00000168306	1.17.99.3		120	protein-coding gene	gene with protein product	"""trihydroxycoprostanoyl-CoA oxidase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholestanoyl-CoA 24-hydroxylase"""	601641	"""acyl-Coenzyme A oxidase 2, branched chain"""			8943006, 9070889	Standard	NM_003500		Approved	BRCACOX, BRCOX, THCCox	uc003dkl.3	Q99424	OTTHUMG00000159154	ENST00000302819.5:c.1065T>G	3.37:g.58514611A>C	ENSP00000307697:p.Tyr355*	Somatic	0	97	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	29	53.23	A6NF16|B2R8U5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Acyl-CoA_oxidase_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,superfamily_AcylCo_DH/oxidase_C,superfamily_AcylCoA_DH/oxidase_NM_dom,pirsf_Acyl-CoA_oxidase	p.Y355*	ENST00000302819.5	37	c.1065	CCDS33775.1	3	.	.	.	.	.	.	.	.	.	.	A	38	6.732831	0.97796	.	.	ENSG00000168306	ENST00000459701;ENST00000302819	.	.	.	5.08	-5.89	0.02282	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-28.2052	15.3923	0.74755	0.4504:0.0:0.5496:0.0	.	.	.	.	X	341;355	.	ENSP00000307697:Y355X	Y	-	3	2	ACOX2	58489651	0.055000	0.20627	0.388000	0.26195	0.945000	0.59286	-0.855000	0.04295	-1.009000	0.03400	-0.441000	0.05720	TAT	-	superfamily_AcylCo_DH/oxidase_C,pirsf_Acyl-CoA_oxidase		0.507	ACOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACOX2	protein_coding	OTTHUMT00000353541.1	A		-		58514611	-1	no_errors	ENST00000302819	ensembl	human	known	74_37	nonsense	SNP	0.874	C
HIST1H1D	3007	genome.wustl.edu	37	6	26234678	26234678	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr6:26234678G>T	ENST00000244534.5	-	1	538	c.484C>A	c.(484-486)Cca>Aca	p.P162T		NM_005320.2	NP_005311.1	P16402	H13_HUMAN	histone cluster 1, H1d	162					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				GCGGTTGCTGGCTTCTTTACC	0.537																																																	0								ENSG00000124575						95.0	102.0	99.0					6																	26234678		2203	4300	6503	HIST1H1D	SO:0001583	missense	0			-	HGNC	M60747	CCDS4597.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000124575	ENSG00000124575		"""Histones / Replication-dependent"""	4717	protein-coding gene	gene with protein product		142210	"""H1 histone family, member 3"", ""histone 1, H1d"""	H1F3		1916825, 12408966	Standard	NM_005320		Approved	H1.3, H1d, H1s-2	uc003nhd.3	P16402	OTTHUMG00000014432	ENST00000244534.5:c.484C>A	6.37:g.26234678G>T	ENSP00000244534:p.Pro162Thr	Somatic	0	60	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B2R751|Q2M2I2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	p.P162T	ENST00000244534.5	37	c.484	CCDS4597.1	6	.	.	.	.	.	.	.	.	.	.	.	9.356	1.066761	0.20067	.	.	ENSG00000124575	ENST00000244534	T	0.25414	1.8	5.22	4.35	0.52113	.	0.057257	0.64402	D	0.000001	T	0.06645	0.0170	N	0.08118	0	0.50039	D	0.999845	B	0.30851	0.297	B	0.33890	0.172	T	0.21484	-1.0244	10	0.21014	T	0.42	-16.0129	15.3421	0.74306	0.0:0.1402:0.8598:0.0	.	162	P16402	H13_HUMAN	T	162	ENSP00000244534:P162T	ENSP00000244534:P162T	P	-	1	0	HIST1H1D	26342657	1.000000	0.71417	0.889000	0.34880	0.011000	0.07611	4.080000	0.57620	1.348000	0.45733	-0.156000	0.13503	CCA	-	NULL		0.537	HIST1H1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1D	protein_coding	OTTHUMT00000040095.1	G	NM_005320	-		26234678	-1	no_errors	ENST00000244534	ensembl	human	known	74_37	missense	SNP	1.000	T
STRN	6801	genome.wustl.edu	37	2	37111108	37111108	+	Missense_Mutation	SNP	G	G	T	rs541490607		TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr2:37111108G>T	ENST00000263918.4	-	9	1161	c.1153C>A	c.(1153-1155)Ctt>Att	p.L385I	STRN_ENST00000379213.2_Missense_Mutation_p.L336I	NM_003162.3	NP_003153.2	O43815	STRN_HUMAN	striatin, calmodulin binding protein	385					dendrite development (GO:0016358)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|tight junction assembly (GO:0070830)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|estrogen receptor binding (GO:0030331)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33		Ovarian(717;0.0129)|all_hematologic(82;0.21)				TGTTCAGGAAGCCTGGAGCTG	0.393																																																	0								ENSG00000115808						88.0	81.0	83.0					2																	37111108		2203	4300	6503	STRN	SO:0001583	missense	0			-	HGNC	AJ223814	CCDS1784.1	2p22.2	2013-01-10	2001-11-28		ENSG00000115808	ENSG00000115808		"""WD repeat domain containing"""	11424	protein-coding gene	gene with protein product		614765	"""striatin, calmodulin-binding protein"""			9693043, 8769426	Standard	NM_003162		Approved	SG2NA	uc002rpn.3	O43815	OTTHUMG00000100959	ENST00000263918.4:c.1153C>A	2.37:g.37111108G>T	ENSP00000263918:p.Leu385Ile	Somatic	0	39	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q3KP65|Q53TQ8|Q9NP38	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Striatin_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L385I	ENST00000263918.4	37	c.1153	CCDS1784.1	2	.	.	.	.	.	.	.	.	.	.	G	11.37	1.619147	0.28801	.	.	ENSG00000115808	ENST00000263918;ENST00000538092;ENST00000379213	T;T	0.64803	-0.12;-0.07	5.63	4.73	0.59995	.	0.184614	0.49305	D	0.000153	T	0.42698	0.1214	N	0.14661	0.345	0.44129	D	0.996912	B;B	0.09022	0.002;0.001	B;B	0.15052	0.012;0.008	T	0.23833	-1.0177	10	0.20519	T	0.43	-8.5338	11.293	0.49261	0.0:0.1376:0.7194:0.1429	.	336;385	O43815-2;O43815	.;STRN_HUMAN	I	385;360;336	ENSP00000263918:L385I;ENSP00000368513:L336I	ENSP00000263918:L385I	L	-	1	0	STRN	36964612	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.793000	0.47845	1.308000	0.44962	0.650000	0.86243	CTT	-	NULL		0.393	STRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRN	protein_coding	OTTHUMT00000218568.1	G		-		37111108	-1	no_errors	ENST00000263918	ensembl	human	known	74_37	missense	SNP	1.000	T
LCN12	286256	genome.wustl.edu	37	9	139849851	139849851	+	Nonstop_Mutation	SNP	A	A	G			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr9:139849851A>G	ENST00000371633.3	+	6	579	c.579A>G	c.(577-579)tgA>tgG	p.*193W	LCN12_ENST00000466277.1_3'UTR	NM_178536.3	NP_848631.2	Q6JVE5	LCN12_HUMAN	lipocalin 12	0					lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|lung(1)|prostate(2)	5	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		GCGTCTGTTGAAGGATGAAGC	0.627																																																	0								ENSG00000184925						52.0	61.0	58.0					9																	139849851		2093	4221	6314	LCN12	SO:0001578	stop_lost	0			-	HGNC	BC041168	CCDS7018.2	9q34	2011-10-24	2007-12-18		ENSG00000184925	ENSG00000184925		"""Lipocalins"""	28733	protein-coding gene	gene with protein product		612905				15363845	Standard	XM_005266068		Approved	MGC48935	uc004ckb.3	Q6JVE5	OTTHUMG00000020968	ENST00000371633.3:c.579A>G	9.37:g.139849851A>G	ENSP00000360696:p.*193Trpext*?	Somatic	0	78	0.00		0.473291439996773	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.33	A2AMJ7	Nonstop_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_PstgldnD_synth,prints_N_gelatinase	p.*193W	ENST00000371633.3	37	c.579	CCDS7018.2	9	.	.	.	.	.	.	.	.	.	.	A	9.622	1.134213	0.21123	.	.	ENSG00000184925	ENST00000371633	.	.	.	1.85	1.85	0.25348	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.7384	0.18079	1.0:0.0:0.0:0.0	.	.	.	.	W	193	.	.	X	+	3	0	LCN12	138969672	0.039000	0.19947	0.109000	0.21407	0.041000	0.13682	1.052000	0.30429	1.129000	0.42072	0.391000	0.25812	TGA	-	NULL		0.627	LCN12-015	KNOWN	basic|appris_principal|CCDS	protein_coding	LCN12	protein_coding	OTTHUMT00000257990.1	A	NM_178536	-		139849851	+1	no_errors	ENST00000371633	ensembl	human	known	74_37	nonstop	SNP	0.134	G
PANK4	55229	genome.wustl.edu	37	1	2453358	2453358	+	Intron	DEL	G	G	-			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr1:2453358delG	ENST00000378466.3	-	2	137				PANK4_ENST00000435556.3_Intron|PANK4_ENST00000491212.1_Intron	NM_018216.1	NP_060686.1	Q9NVE7	PANK4_HUMAN	pantothenate kinase 4						coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	23	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.54e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-23)|GBM - Glioblastoma multiforme(42;2.81e-08)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.00445)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		TGAGGGGTTTGGGGCTACTGG	0.522																																																	0								ENSG00000157881																																			PANK4	SO:0001627	intron_variant	0				HGNC	AK001644	CCDS42.1	1p36.32	2008-02-05			ENSG00000157881	ENSG00000157881			19366	protein-coding gene	gene with protein product		606162				11479594	Standard	XR_241034		Approved	FLJ10782	uc001ajm.1	Q9NVE7	OTTHUMG00000000791	ENST00000378466.3:c.125-119C>-	1.37:g.2453358delG		Somatic	0	52	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	16	42.86	B9DI84|Q53EU3|Q5TA84|Q7RTX3|Q9H3X5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.K50fs	ENST00000378466.3	37	c.147	CCDS42.1	1																																																																																			-	NULL		0.522	PANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANK4	protein_coding	OTTHUMT00000002082.1	G				2453358	-1	no_errors	ENST00000502770	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
NTRK2	4915	genome.wustl.edu	37	9	87339224	87339224	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr9:87339224A>T	ENST00000323115.4	+	7	1159	c.806A>T	c.(805-807)gAa>gTa	p.E269V	NTRK2_ENST00000376214.1_Missense_Mutation_p.E269V|NTRK2_ENST00000359847.3_Missense_Mutation_p.E269V|NTRK2_ENST00000376213.1_Missense_Mutation_p.E269V|NTRK2_ENST00000395866.2_Missense_Mutation_p.E113V|NTRK2_ENST00000304053.6_Missense_Mutation_p.E269V|NTRK2_ENST00000277120.3_Missense_Mutation_p.E269V|NTRK2_ENST00000376208.1_Missense_Mutation_p.E269V|NTRK2_ENST00000395882.1_Missense_Mutation_p.E269V			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	269	Ig-like C2-type 1.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	TGTGTGGCGGAAAATCTTGTA	0.408										TSP Lung(25;0.17)																																							0								ENSG00000148053						219.0	207.0	211.0					9																	87339224		2203	4300	6503	NTRK2	SO:0001583	missense	0			-	HGNC	AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.806A>T	9.37:g.87339224A>T	ENSP00000314586:p.Glu269Val	Somatic	0	96	0.00		0.473291439996773	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.16	B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_LRR-contain_N,superfamily_Kinase-like_dom,smart_LRR-contain_N,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_NGF_rcpt,prints_Tyr_kin_neurotrophic_rcpt_2	p.E269V	ENST00000323115.4	37	c.806	CCDS35050.1	9	.	.	.	.	.	.	.	.	.	.	A	24.1	4.490587	0.84962	.	.	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000395882;ENST00000376208;ENST00000304053;ENST00000277120;ENST00000323115;ENST00000359847;ENST00000395866	T;T;T;T;T;T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32;-0.32;-0.32;-0.32;-0.32;-0.32	5.27	5.27	0.74061	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.051349	0.85682	D	0.000000	T	0.78515	0.4295	L	0.55743	1.74	0.58432	D	0.999999	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.999;0.997;0.997;0.999;0.995;0.992;0.999;0.997	T	0.80645	-0.1290	10	0.72032	D	0.01	.	15.4917	0.75611	1.0:0.0:0.0:0.0	.	113;269;269;269;269;269;315;269	B4DFV9;Q16620-3;Q16620-5;Q5VWE5;Q16620;Q16620-4;Q59GJ1;Q16620-2	.;.;.;.;NTRK2_HUMAN;.;.;.	V	269;269;269;269;269;269;269;269;113	ENSP00000365387:E269V;ENSP00000365386:E269V;ENSP00000379221:E269V;ENSP00000365381:E269V;ENSP00000306167:E269V;ENSP00000277120:E269V;ENSP00000314586:E269V;ENSP00000352906:E269V;ENSP00000379207:E113V	ENSP00000277120:E269V	E	+	2	0	NTRK2	86529044	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.708000	0.84633	2.123000	0.65237	0.377000	0.23210	GAA	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom,prints_Tyr_kinase_NGF_rcpt		0.408	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTRK2	protein_coding	OTTHUMT00000052882.1	A		-		87339224	+1	no_errors	ENST00000277120	ensembl	human	known	74_37	missense	SNP	1.000	T
PDE4DIP	9659	genome.wustl.edu	37	1	144868067	144868067	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr1:144868067C>G	ENST00000369354.3	-	33	5561	c.5372G>C	c.(5371-5373)aGg>aCg	p.R1791T	RP4-791M13.4_ENST00000532137.1_RNA|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.R1927T|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.R1876T|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.R1685T|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.R1791T			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1791					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TATGGTGCCCCTTGGAGGAGA	0.557			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0								ENSG00000178104						184.0	192.0	189.0					1																	144868067		2203	4296	6499	PDE4DIP	SO:0001583	missense	0			-	HGNC	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.5372G>C	1.37:g.144868067C>G	ENSP00000358360:p.Arg1791Thr	Somatic	0	153	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	118	18.62	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spindle_assoc,superfamily_ARM-type_fold	p.R1791T	ENST00000369354.3	37	c.5372	CCDS30824.1	1	.	.	.	.	.	.	.	.	.	.	C	0.820	-0.748914	0.03065	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	T;T;T;T;T	0.01584	4.75;4.85;4.85;4.84;4.85	5.44	4.52	0.55395	.	.	.	.	.	T	0.00724	0.0024	L	0.46157	1.445	0.34958	D	0.751949	B;B	0.09022	0.001;0.002	B;B	0.09377	0.003;0.004	T	0.38200	-0.9672	9	0.08599	T	0.76	.	12.0401	0.53448	0.0:0.8268:0.1732:0.0	.	1685;1791	Q5VU43-3;Q5VU43	.;MYOME_HUMAN	T	1685;1791;1791;1876;1927	ENSP00000327209:R1685T;ENSP00000358360:R1791T;ENSP00000358363:R1791T;ENSP00000435654:R1876T;ENSP00000358366:R1927T	ENSP00000327209:R1685T	R	-	2	0	PDE4DIP	143579424	0.010000	0.17322	0.009000	0.14445	0.010000	0.07245	1.701000	0.37825	1.508000	0.48769	0.650000	0.86243	AGG	-	NULL		0.557	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	protein_coding	OTTHUMT00000038858.2	C	NM_022359	-		144868067	-1	no_errors	ENST00000369356	ensembl	human	known	74_37	missense	SNP	0.013	G
GDF1	2657	genome.wustl.edu	37	19	18979418	18979418	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr19:18979418G>T	ENST00000247005.6	-	8	2452	c.1107C>A	c.(1105-1107)tgC>tgA	p.C369*	CERS1_ENST00000427170.2_3'UTR			P27539	GDF1_HUMAN	growth differentiation factor 1	369					growth (GO:0040007)	extracellular space (GO:0005615)											AGCGGCAGCCGCACTCGTCCA	0.662																																																	0								ENSG00000130283						8.0	11.0	10.0					19																	18979418		2061	4100	6161	GDF1	SO:0001587	stop_gained	0			-	HGNC	M62302	CCDS42526.1	19p13.11	2014-01-30			ENSG00000130283	ENSG00000130283		"""Endogenous ligands"""	4214	protein-coding gene	gene with protein product		602880				2034669	Standard	NM_001492		Approved			P27539		ENST00000247005.6:c.1107C>A	19.37:g.18979418G>T	ENSP00000247005:p.Cys369*	Somatic	0	31	0.00		0.473291439996773	91	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	O43344	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_asu	p.C369*	ENST00000247005.6	37	c.1107	CCDS42526.1	19	.	.	.	.	.	.	.	.	.	.	g	45	11.823942	0.99607	.	.	ENSG00000130283	ENST00000247005	.	.	.	3.75	-5.85	0.02311	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.24671	N	0.993415	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.8991	0.70664	0.8234:0.0:0.1766:0.0	.	.	.	.	X	369	.	ENSP00000247005:C369X	C	-	3	2	GDF1	18840418	0.002000	0.14202	0.844000	0.33320	0.461000	0.32589	-1.087000	0.03383	-1.947000	0.01034	-1.940000	0.00497	TGC	-	pfam_TGF-b_C,smart_TGF-b_C		0.662	GDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF1	protein_coding	OTTHUMT00000465926.1	G	NM_001492	-		18979418	-1	no_errors	ENST00000247005	ensembl	human	known	74_37	nonsense	SNP	0.597	T
GABBR1	2550	genome.wustl.edu	37	6	29550086	29550086	+	Intron	SNP	C	C	G	rs112412437		TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr6:29550086C>G	ENST00000355973.3	-	18	2784				SNORD32B_ENST00000364460.1_RNA			Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1						adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	ATGAGACCAACCCCATGCACT	0.423																																																	0								ENSG00000201330						58.0	54.0	56.0					6																	29550086		876	1991	2867	SNORD32B	SO:0001627	intron_variant	0			-	HGNC	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000355973.3:c.2532+21231G>C	6.37:g.29550086C>G		Somatic	0	196	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	56	72	43.75	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000355973.3	37	NULL	CCDS4665.1	6																																																																																			-	-		0.423	GABBR1-002	KNOWN	basic|CCDS	protein_coding	SNORD32B	protein_coding	OTTHUMT00000194822.3	C		-		29550086	+1	no_errors	ENST00000364460	ensembl	human	known	74_37	rna	SNP	0.997	G
CRHR1	1394	genome.wustl.edu	37	17	43713849	43713849	+	Intron	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr17:43713849G>T	ENST00000293493.7	+	2	396				CRHR1-IT1_ENST00000455565.1_RNA|RP11-105N13.4_ENST00000587305.1_RNA|CRHR1_ENST00000339069.5_Intron	NM_001256299.1	NP_001243228.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1						activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		GGCCACATCAGCTAGCCTCTG	0.502																																					Ovarian(110;57 1568 10207 38216 49865)												0								ENSG00000204650																																			CRHR1-IT1	SO:0001627	intron_variant	0			-	HGNC	L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000293493.7:c.-493+6325G>T	17.37:g.43713849G>T		Somatic	0	59	0.00		0.473291439996773	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.30	B4DIE9|Q13008|Q4QRJ1|Q9UK64	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000293493.7	37	NULL	CCDS58556.1	17																																																																																			-	-		0.502	CRHR1-201	KNOWN	basic|CCDS	protein_coding	CRHR1-IT1	protein_coding		G		-		43713849	+1	no_errors	ENST00000455565	ensembl	human	known	74_37	rna	SNP	0.832	T
CXXC1P1	392459	genome.wustl.edu	37	X	47583404	47583404	+	RNA	SNP	C	C	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chrX:47583404C>T	ENST00000483225.1	+	0	674					NR_033924.1				CXXC finger protein 1 pseudogene 1																		GGTGGGGTGGCACATGGGTGG	0.547																																																	0								ENSG00000187893																																			CXXC1P1			0			-	HGNC	AK094108		Xp11.3	2011-12-01	2011-12-01	2010-07-02	ENSG00000187893	ENSG00000187893			27864	pseudogene	pseudogene			"""chromosome X open reading frame 25"", ""non-protein coding RNA 236"", ""CXXC finger 1 pseudogene 1"""	CXorf25, NCRNA00236		14702039	Standard	NR_033924		Approved	FLJ36789	uc004dio.1		OTTHUMG00000021450		X.37:g.47583404C>T		Somatic	0	49	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000483225.1	37	NULL		X																																																																																			-	-		0.547	CXXC1P1-001	KNOWN	basic	processed_transcript	CXXC1P1	pseudogene	OTTHUMT00000056433.2	C		-		47583404	+1	no_errors	ENST00000483225	ensembl	human	known	74_37	rna	SNP	0.000	T
CYB5R2	51700	genome.wustl.edu	37	11	7686508	7686508	+	3'UTR	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr11:7686508G>T	ENST00000533558.1	-	0	1484				CYB5R2_ENST00000299498.6_3'UTR|CYB5R2_ENST00000528585.1_5'UTR|CYB5R2_ENST00000524790.1_3'UTR			Q6BCY4	NB5R2_HUMAN	cytochrome b5 reductase 2						oxidation-reduction process (GO:0055114)|sterol biosynthetic process (GO:0016126)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11				Epithelial(150;5.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TACATGGCAAGGCACTTTTGA	0.502																																																	0								ENSG00000166394																																			CYB5R2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF169802	CCDS7780.1	11p15.4	2014-08-12			ENSG00000166394	ENSG00000166394	1.6.2.2		24376	protein-coding gene	gene with protein product		608342				10611283	Standard	XM_005252973		Approved		uc001mfm.3	Q6BCY4	OTTHUMG00000165665	ENST00000533558.1:c.*97C>A	11.37:g.7686508G>T		Somatic	0	37	0.00		0.473291439996773	53	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	Q9BVA3|Q9UF68|Q9UHJ0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000533558.1	37	NULL	CCDS7780.1	11																																																																																			-	-		0.502	CYB5R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5R2	protein_coding	OTTHUMT00000385679.1	G	NM_016229	-		7686508	-1	no_errors	ENST00000528585	ensembl	human	known	74_37	rna	SNP	0.001	T
MMP17	4326	genome.wustl.edu	37	12	132329694	132329694	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr12:132329694A>T	ENST00000360564.1	+	7	1102	c.1000A>T	c.(1000-1002)Act>Tct	p.T334S	MMP17_ENST00000535004.1_5'Flank|MMP17_ENST00000535182.1_3'UTR|MMP17_ENST00000535291.1_Missense_Mutation_p.T250S	NM_016155.4	NP_057239.4	Q9ULZ9	MMP17_HUMAN	matrix metallopeptidase 17 (membrane-inserted)	334					positive regulation of catalytic activity (GO:0043085)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.82e-07)|Epithelial(86;1.51e-06)|all cancers(50;2.35e-05)	Marimastat(DB00786)	CAGATGCAGCACTCACTTTGA	0.667																																																	0								ENSG00000198598						110.0	102.0	105.0					12																	132329694		2203	4300	6503	MMP17	SO:0001583	missense	0			-	HGNC	X89576	CCDS31927.1	12q24.3	2005-08-08	2005-08-08		ENSG00000198598	ENSG00000198598			7163	protein-coding gene	gene with protein product		602285	"""matrix metalloproteinase 17 (membrane-inserted)"""			9878265	Standard	NM_016155		Approved	MT4-MMP	uc001ujc.1	Q9ULZ9	OTTHUMG00000168050	ENST00000360564.1:c.1000A>T	12.37:g.132329694A>T	ENSP00000353767:p.Thr334Ser	Somatic	0	85	0.00		0.473291439996773	42	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	56	8.20	Q14850	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	p.T334S	ENST00000360564.1	37	c.1000	CCDS31927.1	12	.	.	.	.	.	.	.	.	.	.	A	8.659	0.900125	0.17686	.	.	ENSG00000198598	ENST00000360564;ENST00000535291;ENST00000534865	T;T;T	0.16196	2.36;2.4;2.59	4.12	0.618	0.17624	Hemopexin/matrixin (2);	0.731147	0.13224	N	0.404174	T	0.12646	0.0307	L	0.33485	1.01	0.09310	N	1	B	0.13145	0.007	B	0.16722	0.016	T	0.24870	-1.0148	10	0.49607	T	0.09	.	8.3017	0.32019	0.5929:0.0:0.4071:0.0	.	334	Q9ULZ9	MMP17_HUMAN	S	334;250;175	ENSP00000353767:T334S;ENSP00000441106:T250S;ENSP00000442104:T175S	ENSP00000353767:T334S	T	+	1	0	MMP17	130895647	0.001000	0.12720	0.001000	0.08648	0.319000	0.28217	0.261000	0.18442	-0.115000	0.11915	0.472000	0.43445	ACT	-	superfamily_Hemopexin-like_dom,pirsf_Pept_M10A_Metazoans		0.667	MMP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP17	protein_coding	OTTHUMT00000397757.1	A	NM_016155	-		132329694	+1	no_errors	ENST00000360564	ensembl	human	known	74_37	missense	SNP	0.001	T
ARHGAP18	93663	genome.wustl.edu	37	6	129920086	129920087	+	5'UTR	INS	-	-	GTGTGT	rs71028166|rs527670245|rs139994403|rs376498570	byFrequency	TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr6:129920086_129920087insGTGTGT	ENST00000463225.1	-	0	19_20				ARHGAP18_ENST00000368149.2_Intron					Rho GTPase activating protein 18											NS(2)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(3)	18				OV - Ovarian serous cystadenocarcinoma(136;0.0621)|GBM - Glioblastoma multiforme(226;0.0638)|all cancers(137;0.074)		GGGGTGTAGGGgtgtgtgtgtg	0.446																																																	0								ENSG00000146376																																			ARHGAP18	SO:0001623	5_prime_UTR_variant	0				HGNC	AB053293	CCDS34535.1	6q23.1	2011-06-29			ENSG00000146376	ENSG00000146376		"""Rho GTPase activating proteins"""	21035	protein-coding gene	gene with protein product		613351					Standard	NM_033515		Approved	MacGAP, bA307O14.2	uc003qbr.3	Q8N392	OTTHUMG00000015547	ENST00000463225.1:c.-445->ACACAC	6.37:g.129920087_129920092dupGTGTGT		Somatic	NA	NA	NA		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000463225.1	37	NULL		6																																																																																			-	-		0.446	ARHGAP18-003	KNOWN	basic	processed_transcript	ARHGAP18	protein_coding	OTTHUMT00000042187.1	-	NM_033515			129920087	-1	no_errors	ENST00000463225	ensembl	human	known	74_37	rna	INS	0.000:0.001	GTGTGT
KCNB1	3745	genome.wustl.edu	37	20	48098845	48098845	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr20:48098845C>A	ENST00000371741.4	-	1	339	c.173G>T	c.(172-174)gGc>gTc	p.G58V		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	58					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	GCGGAGCTTGCCCAGCCGCGT	0.692																																																	0								ENSG00000158445						16.0	16.0	16.0					20																	48098845		2189	4264	6453	KCNB1	SO:0001583	missense	0			-	HGNC	AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.173G>T	20.37:g.48098845C>A	ENSP00000360806:p.Gly58Val	Somatic	0	31	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	17	19.05	Q14193	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_volt-dep_Kv2,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv2.1,prints_K_chnl_volt-dep_Kv2,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv8	p.G58V	ENST00000371741.4	37	c.173	CCDS13418.1	20	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958852	0.92726	.	.	ENSG00000158445	ENST00000371741;ENST00000538812	T	0.78816	-1.21	4.86	4.86	0.63082	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.92018	0.7471	H	0.96142	3.775	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.94474	0.7687	10	0.87932	D	0	.	17.8086	0.88609	0.0:1.0:0.0:0.0	.	58	Q14721	KCNB1_HUMAN	V	58;13	ENSP00000360806:G58V	ENSP00000360806:G58V	G	-	2	0	KCNB1	47532252	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.646000	0.83445	2.528000	0.85240	0.563000	0.77884	GGC	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv9		0.692	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNB1	protein_coding	OTTHUMT00000080374.3	C	NM_004975	-		48098845	-1	no_errors	ENST00000371741	ensembl	human	known	74_37	missense	SNP	1.000	A
SNRNP40	9410	genome.wustl.edu	37	1	31766006	31766006	+	Intron	DEL	A	A	-	rs112391814		TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr1:31766006delA	ENST00000263694.4	-	2	290				SNRNP40_ENST00000446633.2_Intron	NM_004814.2	NP_004805.2	Q96DI7	SNR40_HUMAN	small nuclear ribonucleoprotein 40kDa (U5)						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	7						CCCAAGATTTAAAAAAAAAAA	0.398																																																	0								ENSG00000060688																																			SNRNP40	SO:0001627	intron_variant	0				HGNC	AF090988	CCDS340.1	1p35.2	2013-01-09	2008-10-29	2008-10-29	ENSG00000060688	ENSG00000060688		"""WD repeat domain containing"""	30857	protein-coding gene	gene with protein product		607797	"""WD repeat domain 57 (U5 snRNP specific)"""	WDR57		9774689, 9731529, 10788320	Standard	NM_004814		Approved	PRP8BP, SPF38, PRPF8BP, HPRP8BP	uc009vtt.3	Q96DI7	OTTHUMG00000003790	ENST00000263694.4:c.271+59T>-	1.37:g.31766006delA		Somatic	0	30	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	21	19.23	B4DQJ1|O75938|O95320	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000263694.4	37	NULL	CCDS340.1	1																																																																																			-	-		0.398	SNRNP40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP40	protein_coding	OTTHUMT00000010657.1	A	NM_004814			31766006	-1	no_errors	ENST00000463988	ensembl	human	known	74_37	rna	DEL	0.422	-
OR10C1	442194	genome.wustl.edu	37	6	29408456	29408456	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr6:29408456G>T	ENST00000444197.2	+	1	1374	c.664G>T	c.(664-666)Gtt>Ttt	p.V222F	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GCGTATCCTCGTTACCATCTT	0.587																																																	0								ENSG00000206474						206.0	222.0	216.0					6																	29408456		1511	2709	4220	OR10C1	SO:0001583	missense	0			-	HGNC		CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.664G>T	6.37:g.29408456G>T	ENSP00000419119:p.Val222Phe	Somatic	0	61	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	18	55.00	Q5SUN7|Q96R18	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.V222F	ENST00000444197.2	37	c.664	CCDS34364.1	6	.	.	.	.	.	.	.	.	.	.	G	0.290	-0.980684	0.02197	.	.	ENSG00000206474	ENST00000444197	T	0.37235	1.21	3.49	2.62	0.31277	GPCR, rhodopsin-like superfamily (1);	0.408635	0.17808	N	0.161305	T	0.10121	0.0248	L	0.38692	1.165	0.09310	N	1	B	0.11235	0.004	B	0.18871	0.023	T	0.32241	-0.9914	10	0.19147	T	0.46	.	8.7036	0.34340	0.199:0.0:0.801:0.0	.	222	Q96KK4	O10C1_HUMAN	F	222	ENSP00000419119:V222F	ENSP00000419119:V222F	V	+	1	0	OR10C1	29516435	0.000000	0.05858	0.008000	0.14137	0.003000	0.03518	-1.396000	0.02513	0.680000	0.31366	-0.216000	0.12614	GTT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.587	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10C1	protein_coding	OTTHUMT00000076415.2	G		-		29408456	+1	no_errors	ENST00000444197	ensembl	human	known	74_37	missense	SNP	0.005	T
CDK10	8558	genome.wustl.edu	37	16	89760638	89760638	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr16:89760638G>T	ENST00000353379.7	+	9	709	c.666G>T	c.(664-666)atG>atT	p.M222I	CDK10_ENST00000505473.1_Missense_Mutation_p.M151I|CDK10_ENST00000331006.8_Missense_Mutation_p.M175I	NM_001098533.2|NM_001160367.1|NM_052988.4	NP_001092003.2|NP_001153839.1|NP_443714.3	Q15131	CDK10_HUMAN	cyclin-dependent kinase 10	222	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|traversing start control point of mitotic cell cycle (GO:0007089)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			ovary(1)	1		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0276)		GCATCGACATGTGGTGAGGAG	0.627																																																	0								ENSG00000185324						92.0	71.0	78.0					16																	89760638		2198	4300	6498	CDK10	SO:0001583	missense	0			-	HGNC	L33264	CCDS10984.2, CCDS32514.1, CCDS32514.2	16q24.3	2011-11-08	2007-11-21		ENSG00000185324	ENSG00000185324		"""Cyclin-dependent kinases"""	1770	protein-coding gene	gene with protein product		603464	"""cyclin-dependent kinase (CDC2-like) 10"""			8208557, 8084611	Standard	NM_052988		Approved	PISSLRE	uc010cio.3	Q15131	OTTHUMG00000138049	ENST00000353379.7:c.666G>T	16.37:g.89760638G>T	ENSP00000338673:p.Met222Ile	Somatic	0	74	0.00		0.473291439996773	274	0.36	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A8K370|A8K8I6|A8MXU6|B3KQJ3|B7Z420|D3DX82|D3DX83|Q0VGZ7|Q15130|Q6PJC0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.M222I	ENST00000353379.7	37	c.666	CCDS10984.2	16	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604197	0.66445	.	.	ENSG00000185324	ENST00000331006;ENST00000393082;ENST00000505473;ENST00000353379	T;T;T	0.62232	0.04;0.04;0.04	5.82	5.82	0.92795	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.034048	0.85682	D	0.000000	T	0.46367	0.1389	N	0.10685	0.025	0.80722	D	1	B;B;B	0.12013	0.001;0.001;0.005	B;B;B	0.16722	0.016;0.007;0.004	T	0.33111	-0.9881	10	0.37606	T	0.19	-50.0794	18.9133	0.92494	0.0:0.0:1.0:0.0	.	222;151;151	Q15131;Q15131-3;Q15131-4	CDK10_HUMAN;.;.	I	175;193;151;222	ENSP00000329957:M175I;ENSP00000424415:M151I;ENSP00000338673:M222I	ENSP00000329957:M175I	M	+	3	0	CDK10	88288139	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.349000	0.73013	2.768000	0.95171	0.650000	0.86243	ATG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.627	CDK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK10	protein_coding	OTTHUMT00000269925.2	G		-		89760638	+1	no_errors	ENST00000353379	ensembl	human	known	74_37	missense	SNP	1.000	T
CELSR2	1952	genome.wustl.edu	37	1	109794550	109794550	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr1:109794550G>T	ENST00000271332.3	+	1	1910	c.1849G>T	c.(1849-1851)Gtg>Ttg	p.V617L		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	617	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		AGAGTACACAGTGCGGCTCAA	0.562																																					NSCLC(158;1285 2011 34800 34852 42084)												0								ENSG00000143126						172.0	150.0	158.0					1																	109794550		2203	4300	6503	CELSR2	SO:0001583	missense	0			-	HGNC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.1849G>T	1.37:g.109794550G>T	ENSP00000271332:p.Val617Leu	Somatic	0	82	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q5T2Y7|Q92566	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.V617L	ENST00000271332.3	37	c.1849	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	N	8.480	0.859603	0.17178	.	.	ENSG00000143126	ENST00000271332	T	0.01584	4.75	4.95	4.95	0.65309	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.00552	0.0018	L	0.35854	1.095	0.31312	N	0.686983	B	0.06786	0.001	B	0.06405	0.002	T	0.48433	-0.9036	9	0.07990	T	0.79	.	7.2426	0.26104	0.1285:0.1577:0.7138:0.0	.	617	Q9HCU4	CELR2_HUMAN	L	617	ENSP00000271332:V617L	ENSP00000271332:V617L	V	+	1	0	CELSR2	109596073	0.059000	0.20769	0.981000	0.43875	0.876000	0.50452	0.460000	0.21924	2.600000	0.87896	0.650000	0.86243	GTG	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin		0.562	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	protein_coding	OTTHUMT00000033200.1	G	NM_001408	-		109794550	+1	no_errors	ENST00000271332	ensembl	human	known	74_37	missense	SNP	0.955	T
CDH23	64072	genome.wustl.edu	37	10	73545427	73545427	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr10:73545427C>T	ENST00000224721.6	+	43	5772	c.5767C>T	c.(5767-5769)Cgg>Tgg	p.R1923W		NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	1918	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						GGACCGCGAGCGGATCCCAGA	0.592																																																	0								ENSG00000107736						47.0	53.0	51.0					10																	73545427		2109	4206	6315	CDH23	SO:0001583	missense	0			-	HGNC	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.5767C>T	10.37:g.73545427C>T	ENSP00000224721:p.Arg1923Trp	Somatic	0	75	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	43	10.42	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R1923W	ENST00000224721.6	37	c.5767		10	.	.	.	.	.	.	.	.	.	.	C	17.66	3.444241	0.63067	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721	.	.	.	5.2	1.89	0.25635	Cadherin (4);Cadherin-like (1);	0.074456	0.53938	D	0.000048	T	0.69522	0.3120	M	0.77103	2.36	0.80722	D	1	D	0.71674	0.998	P	0.61722	0.893	T	0.69544	-0.5117	9	0.48119	T	0.1	.	10.3235	0.43780	0.3714:0.525:0.1036:0.0	.	1918	Q9H251	CAD23_HUMAN	W	1923;1918;1921	.	ENSP00000224721:R1923W	R	+	1	2	CDH23	73215433	1.000000	0.71417	0.989000	0.46669	0.659000	0.38960	1.214000	0.32419	0.531000	0.28639	0.455000	0.32223	CGG	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.592	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	CDH23	protein_coding	OTTHUMT00000051227.4	C	NM_052836	-		73545427	+1	no_errors	ENST00000224721	ensembl	human	putative	74_37	missense	SNP	1.000	T
KIAA0195	9772	genome.wustl.edu	37	17	73484164	73484164	+	Silent	SNP	C	C	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr17:73484164C>T	ENST00000314256.7	+	6	955	c.561C>T	c.(559-561)atC>atT	p.I187I	KIAA0195_ENST00000579208.1_Intron|KIAA0195_ENST00000375248.5_Silent_p.I197I|KIAA0195_ENST00000583795.1_3'UTR	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	187						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			AAGGAGACATCATAGCTTTGA	0.557																																																	0								ENSG00000177728						133.0	105.0	115.0					17																	73484164		2203	4300	6503	KIAA0195	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.561C>T	17.37:g.73484164C>T		Somatic	0	84	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	45	45.12	O75536|Q86XF1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_cation-transptr_C	p.I187	ENST00000314256.7	37	c.561	CCDS32732.1	17																																																																																			-	NULL		0.557	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0195	protein_coding	OTTHUMT00000447303.1	C	NM_014738	-		73484164	+1	no_errors	ENST00000314256	ensembl	human	known	74_37	silent	SNP	1.000	T
DNAH12	201625	genome.wustl.edu	37	3	57445409	57445409	+	Silent	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr3:57445409G>T	ENST00000351747.2	-	20	2952	c.2772C>A	c.(2770-2772)atC>atA	p.I924I		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	924	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						TCTGTTGCATGATATCCTCAG	0.413																																																	0								ENSG00000174844						197.0	153.0	166.0					3																	57445409		692	1591	2283	DNAH12	SO:0001819	synonymous_variant	0			-	HGNC	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.2772C>A	3.37:g.57445409G>T		Somatic	0	89	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	55	8.33	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.I924	ENST00000351747.2	37	c.2772		3																																																																																			-	pfam_Dynein_heavy_dom-2		0.413	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	protein_coding		G	NM_178504	-		57445409	-1	no_errors	ENST00000351747	ensembl	human	known	74_37	silent	SNP	0.999	T
C1orf159	54991	genome.wustl.edu	37	1	1021377	1021377	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr1:1021377G>T	ENST00000379339.1	-	9	644	c.434C>A	c.(433-435)gCc>gAc	p.A145D	C1orf159_ENST00000482816.1_5'UTR|C1orf159_ENST00000294576.5_Missense_Mutation_p.A109D|C1orf159_ENST00000448924.1_Missense_Mutation_p.A145D|C1orf159_ENST00000379319.1_Missense_Mutation_p.A109D|C1orf159_ENST00000437760.1_Missense_Mutation_p.A109D|C1orf159_ENST00000421241.2_Missense_Mutation_p.A109D|C1orf159_ENST00000379320.1_Missense_Mutation_p.A109D			Q96HA4	CA159_HUMAN	chromosome 1 open reading frame 159	145						integral component of membrane (GO:0016021)						all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.96e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.77e-22)|Colorectal(212;6.51e-05)|COAD - Colon adenocarcinoma(227;0.000214)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		GAGGGAGGCGGCCACGCGCGG	0.667																																																	0								ENSG00000131591						52.0	53.0	52.0					1																	1021377		2203	4300	6503	C1orf159	SO:0001583	missense	0			-	HGNC	AK128434	CCDS7.2	1p36.33	2008-02-05			ENSG00000131591	ENSG00000131591			26062	protein-coding gene	gene with protein product						12975309	Standard	NM_017891		Approved	FLJ20584	uc001acu.2	Q96HA4	OTTHUMG00000000745	ENST00000379339.1:c.434C>A	1.37:g.1021377G>T	ENSP00000368644:p.Ala145Asp	Somatic	0	42	0.00		0.473291439996773	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B3KQ46|Q5T2W6|Q6UX67|Q6ZR77|Q9NWV0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A145D	ENST00000379339.1	37	c.434		1	.	.	.	.	.	.	.	.	.	.	G	14.66	2.601685	0.46423	.	.	ENSG00000131591	ENST00000379339;ENST00000448924;ENST00000294576;ENST00000421241;ENST00000379320;ENST00000379319;ENST00000434641;ENST00000457999;ENST00000437760	.	.	.	4.53	2.57	0.30868	.	0.000000	0.85682	D	0.000000	T	0.70640	0.3247	M	0.73962	2.25	0.50467	D	0.999876	D;D;D;D;D	0.89917	0.997;0.999;1.0;0.999;0.999	D;D;D;D;D	0.74023	0.925;0.982;0.977;0.982;0.925	T	0.69308	-0.5179	9	0.87932	D	0	-7.6332	7.8186	0.29274	0.2208:0.0:0.7792:0.0	.	109;145;109;109;109	Q5T2W7;Q96HA4;Q96HA4-4;Q5T2W9;E9PBW5	.;CA159_HUMAN;.;.;.	D	145;145;109;109;109;109;109;120;109	.	ENSP00000294576:A109D	A	-	2	0	C1orf159	1011240	0.997000	0.39634	0.311000	0.25182	0.025000	0.11179	2.616000	0.46376	0.322000	0.23283	0.491000	0.48974	GCC	-	NULL		0.667	C1orf159-002	KNOWN	basic|appris_candidate_longest	protein_coding	C1orf159	protein_coding	OTTHUMT00000001851.2	G	NM_017891	-		1021377	-1	no_errors	ENST00000379339	ensembl	human	known	74_37	missense	SNP	0.972	T
RXFP2	122042	genome.wustl.edu	37	13	32356836	32356836	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr13:32356836G>T	ENST00000298386.2	+	11	952	c.881G>T	c.(880-882)gGt>gTt	p.G294V	RXFP2_ENST00000380314.1_Intron	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	294					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)			cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		AATCAAATTGGTTTTGTTCCA	0.388																																																	0								ENSG00000133105						82.0	80.0	80.0					13																	32356836		2203	4300	6503	RXFP2	SO:0001583	missense	0			-	HGNC	AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.881G>T	13.37:g.32356836G>T	ENSP00000298386:p.Gly294Val	Somatic	0	75	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	38	40.62	B1ALE9|Q3KU23	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_Leu-rich_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Leu-rich_rpt_typical-subtyp,pfscan_LDrepeatLR_classA_rpt,pfscan_GPCR_Rhodpsn_7TM,prints_Relaxin_rcpt,prints_GPCR_Rhodpsn,prints_Gphrmn_rcpt_fam	p.G294V	ENST00000298386.2	37	c.881	CCDS9342.1	13	.	.	.	.	.	.	.	.	.	.	G	10.95	1.494376	0.26774	.	.	ENSG00000133105	ENST00000298386	T	0.57273	0.41	5.6	1.68	0.24146	.	0.571237	0.19519	N	0.112325	T	0.36826	0.0981	N	0.17345	0.48	0.80722	D	1	B	0.19583	0.037	B	0.34346	0.18	T	0.07693	-1.0759	10	0.32370	T	0.25	.	7.9229	0.29857	0.6665:0.0:0.3335:0.0	.	294	Q8WXD0	RXFP2_HUMAN	V	294	ENSP00000298386:G294V	ENSP00000298386:G294V	G	+	2	0	RXFP2	31254836	0.961000	0.32948	1.000000	0.80357	0.995000	0.86356	1.005000	0.29834	0.101000	0.17610	-0.290000	0.09829	GGT	-	smart_Leu-rich_rpt_typical-subtyp		0.388	RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RXFP2	protein_coding	OTTHUMT00000044399.1	G	NM_130806	-		32356836	+1	no_errors	ENST00000298386	ensembl	human	known	74_37	missense	SNP	1.000	T
LAMB1	3912	genome.wustl.edu	37	7	107601660	107601660	+	Silent	SNP	C	C	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr7:107601660C>T	ENST00000222399.6	-	17	2330	c.2100G>A	c.(2098-2100)ctG>ctA	p.L700L	LAMB1_ENST00000393561.1_Silent_p.L724L|LAMB1_ENST00000393560.1_Silent_p.L700L	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	700	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						CAGAATCGATCAGCGTGTAGG	0.552																																																	0								ENSG00000091136						120.0	108.0	112.0					7																	107601660		2203	4300	6503	LAMB1	SO:0001819	synonymous_variant	0			-	HGNC	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.2100G>A	7.37:g.107601660C>T		Somatic	0	81	0.00		0.473291439996773	10	52.38	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	35	35.19	Q14D91	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Prefoldin,superfamily_t-SNARE,superfamily_P-loop_NTPase,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.L700	ENST00000222399.6	37	c.2100	CCDS5750.1	7																																																																																			-	pfscan_Laminin_IV		0.552	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	protein_coding	OTTHUMT00000314584.1	C	NM_002291	-		107601660	-1	no_errors	ENST00000222399	ensembl	human	known	74_37	silent	SNP	0.963	T
SLC26A6	65010	genome.wustl.edu	37	3	48667882	48667882	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr3:48667882C>A	ENST00000395550.2	-	11	1362	c.1315G>T	c.(1315-1317)Gac>Tac	p.D439Y	SLC26A6_ENST00000420764.2_Missense_Mutation_p.D439Y|SLC26A6_ENST00000455886.2_Missense_Mutation_p.D403Y|SLC26A6_ENST00000358747.6_Missense_Mutation_p.D418Y|SLC26A6_ENST00000337000.8_Missense_Mutation_p.D332Y|SLC26A6_ENST00000383733.3_Missense_Mutation_p.D439Y|SLC26A6_ENST00000482282.1_5'Flank			Q9BXS9	S26A6_HUMAN	solute carrier family 26 (anion exchanger), member 6	439					angiotensin-activated signaling pathway (GO:0038166)|anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular response to cAMP (GO:0071320)|cellular response to fructose stimulus (GO:0071332)|cellular response to interferon-gamma (GO:0071346)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|epithelial fluid transport (GO:0042045)|formate transport (GO:0015724)|intestinal absorption (GO:0050892)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|mannitol transport (GO:0015797)|oxalate transport (GO:0019532)|oxalic acid secretion (GO:0046724)|positive regulation of dipeptide transmembrane transport (GO:2001150)|protein kinase C signaling (GO:0070528)|regulation of intracellular pH (GO:0051453)|sperm capacitation (GO:0048240)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transepithelial chloride transport (GO:0030321)|transepithelial transport (GO:0070633)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|chloride channel complex (GO:0034707)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle membrane (GO:0012506)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|chloride transmembrane transporter activity (GO:0015108)|efflux transmembrane transporter activity (GO:0015562)|formate efflux transmembrane transporter activity (GO:0015660)|formate transmembrane transporter activity (GO:0015499)|formate uptake transmembrane transporter activity (GO:0015659)|oxalate transmembrane transporter activity (GO:0019531)|PDZ domain binding (GO:0030165)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)		SLC26A6/PRKAR2A(2)	NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		TTGGGCAGGTCATGGAAGAGT	0.587																																					NSCLC(13;369 479 28271 30152 44026)												0								ENSG00000225697						46.0	53.0	51.0					3																	48667882		1973	4123	6096	SLC26A6	SO:0001583	missense	0			-	HGNC	AF279265	CCDS43087.1, CCDS46824.1, CCDS46825.1, CCDS46826.1, CCDS63627.1, CCDS63628.1	3p21.31	2013-08-05	2013-07-18		ENSG00000225697	ENSG00000225697		"""Solute carriers"""	14472	protein-coding gene	gene with protein product	"""pendrin-like protein 1"", ""pendrin L1"", ""sulfate anion transporter"", ""anion transporter 1"""	610068	"""solute carrier family 26, member 6"""			11087667, 11247665	Standard	NM_022911		Approved	DKFZp586E1422		Q9BXS9	OTTHUMG00000186381	ENST00000395550.2:c.1315G>T	3.37:g.48667882C>A	ENSP00000378920:p.Asp439Tyr	Somatic	0	92	0.00		0.473291439996773	14	26.32	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	35	45.31	B4DMZ1|Q548A7|Q96Q90|Q9NQU1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.D439Y	ENST00000395550.2	37	c.1315	CCDS43087.1	3	.	.	.	.	.	.	.	.	.	.	C	12.61	1.988187	0.35036	.	.	ENSG00000225697	ENST00000420764;ENST00000395550;ENST00000383733;ENST00000337000;ENST00000447978;ENST00000358747;ENST00000455886;ENST00000421649	D;D;D;D;D;D;D	0.91577	-2.87;-2.87;-2.87;-2.87;-2.87;-2.87;-2.87	5.6	2.67	0.31697	Sulphate transporter (1);	.	.	.	.	D	0.89815	0.6824	N	0.25647	0.755	0.09310	N	0.999999	D;B;D;P;D;D;P	0.67145	0.996;0.045;0.981;0.896;0.98;0.958;0.81	D;B;D;P;D;D;B	0.71184	0.972;0.029;0.935;0.745;0.935;0.935;0.34	T	0.79313	-0.1855	9	0.66056	D	0.02	.	5.3201	0.15876	0.1377:0.5228:0.2667:0.0728	.	403;452;332;439;439;439;3844	B4DMZ1;Q86YZ4;G3XAC1;Q9BXS9-2;Q548A7;Q9BXS9;Q5Y190	.;.;.;.;.;S26A6_HUMAN;.	Y	439;439;439;332;452;418;403;247	ENSP00000404684:D439Y;ENSP00000378920:D439Y;ENSP00000373239:D439Y;ENSP00000337648:D332Y;ENSP00000351597:D418Y;ENSP00000401066:D403Y;ENSP00000389922:D247Y	ENSP00000337648:D332Y	D	-	1	0	SLC26A6	48642886	0.201000	0.23410	0.453000	0.27007	0.345000	0.29048	0.608000	0.24223	0.694000	0.31654	0.655000	0.94253	GAC	-	pfam_Sulph_transpt,tigrfam_SulP_transpt		0.587	SLC26A6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC26A6	protein_coding	OTTHUMT00000345040.1	C	NM_022911	-		48667882	-1	no_errors	ENST00000395550	ensembl	human	known	74_37	missense	SNP	0.079	A
PRR14L	253143	genome.wustl.edu	37	22	32108558	32108558	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr22:32108558G>A	ENST00000327423.6	-	4	5456	c.5267C>T	c.(5266-5268)cCg>cTg	p.P1756L	PRR14L_ENST00000397493.2_Missense_Mutation_p.P1756L|PRR14L_ENST00000434485.1_Missense_Mutation_p.P1756L	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	1756										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						AGGTTGAGACGGGCACTGGAG	0.552																																																	0								ENSG00000183530						34.0	36.0	35.0					22																	32108558		692	1591	2283	PRR14L	SO:0001583	missense	0			-	HGNC	BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.5267C>T	22.37:g.32108558G>A	ENSP00000331845:p.Pro1756Leu	Somatic	0	32	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	13	51.85	Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P1756L	ENST00000327423.6	37	c.5267	CCDS13900.2	22	.	.	.	.	.	.	.	.	.	.	G	7.781	0.709431	0.15239	.	.	ENSG00000183530	ENST00000397493;ENST00000327423;ENST00000434485	T;T;T	0.07216	3.21;3.23;3.21	5.81	-0.139	0.13460	.	0.724111	0.12900	N	0.429849	T	0.03263	0.0095	N	0.12182	0.205	0.09310	N	1	B;B;B	0.28667	0.219;0.219;0.219	B;B;B	0.20184	0.028;0.028;0.028	T	0.41288	-0.9517	10	0.30078	T	0.28	0.7532	1.7142	0.02898	0.2907:0.1276:0.45:0.1317	.	1756;1756;1756	Q5THK1-2;Q5THK1;Q5THK1-4	.;PR14L_HUMAN;.	L	1756	ENSP00000380630:P1756L;ENSP00000331845:P1756L;ENSP00000388314:P1756L	ENSP00000331845:P1756L	P	-	2	0	PRR14L	30438558	0.322000	0.24634	0.016000	0.15963	0.182000	0.23217	0.781000	0.26774	-0.156000	0.11079	-0.182000	0.12963	CCG	-	NULL		0.552	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PRR14L	protein_coding	OTTHUMT00000074993.2	G	NM_173566	-		32108558	-1	no_errors	ENST00000397493	ensembl	human	known	74_37	missense	SNP	0.001	A
RP11-597A11.2	0	genome.wustl.edu	37	14	20151749	20151749	+	lincRNA	SNP	T	T	A	rs377278686	byFrequency	TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr14:20151749T>A	ENST00000547175.1	+	0	344																											TAGAGATATGTATAAAGGCTT	0.438													.|||	245	0.0489217	0.0061	0.0634	5008	,	,		32007	0.0496		0.0954	False		,,,				2504	0.0481																0								ENSG00000257395																																			RP11-597A11.2			0			-	Clone_based_vega_gene																													14.37:g.20151749T>A		Somatic	0	17	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	17	22.73		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000547175.1	37	NULL		14																																																																																			-	-		0.438	RP11-597A11.2-001	KNOWN	basic	lincRNA	ENSG00000257395	lincRNA	OTTHUMT00000409598.1	T		-		20151749	+1	no_errors	ENST00000547175	ensembl	human	known	74_37	rna	SNP	1.000	A
LOR	4014	genome.wustl.edu	37	1	153233991	153233992	+	In_Frame_Ins	INS	-	-	CTCTGGCGGCGG	rs11272549|rs547333583|rs561634896	byFrequency	TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr1:153233991_153233992insCTCTGGCGGCGG	ENST00000368742.3	+	2	623_624	c.566_567insCTCTGGCGGCGG	c.(565-570)tactct>taCTCTGGCGGCGGctct	p.194_195insGGGS		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	194					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gtctgcggctactctggcggcg	0.743														3247	0.648363	0.6664	0.7954	5008	,	,		5032	0.4563		0.7147	False		,,,				2504	0.6493																0								ENSG00000203782			178,190		86,6,92						-7.1	0.0		dbSNP_120	1	749,435		350,49,193	no	coding	LOR	NM_000427.2		436,55,285	A1A1,A1R,RR		36.7399,48.3696,40.2706				927,625				LOR	SO:0001652	inframe_insertion	0				HGNC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.567_578dupCTCTGGCGGCGG	1.37:g.153233991_153233992insCTCTGGCGGCGG	ENSP00000357731:p.Gly191_Ser194dup	Somatic	NA	NA	NA		0.473291439996773	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5T869|Q5XKF8	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.193in_frame_insGSGG	ENST00000368742.3	37	c.566_567	CCDS30870.1	1																																																																																			-	NULL		0.743	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOR	protein_coding	OTTHUMT00000039107.1	-	NM_000427			153233992	+1	no_errors	ENST00000368742	ensembl	human	known	74_37	in_frame_ins	INS	0.014:0.200	CTCTGGCGGCGG
ABCA12	26154	genome.wustl.edu	37	2	215940283	215940284	+	Intron	INS	-	-	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr2:215940283_215940284insA	ENST00000272895.7	-	3	383				ABCA12_ENST00000412081.1_Frame_Shift_Ins_p.S74fs	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12						cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		atttatGCAGGAAAAAAAAAAA	0.376																																					Ovarian(66;664 1488 5121 34295)												0								ENSG00000144452																																			ABCA12	SO:0001627	intron_variant	0				HGNC	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.164-11341->T	2.37:g.215940294_215940294dupA		Somatic	0	59	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	54	12.90	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.S74fs	ENST00000272895.7	37	c.221_220	CCDS33372.1	2																																																																																			-	NULL		0.376	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	protein_coding	OTTHUMT00000337111.1	-	NM_173076			215940284	-1	no_errors	ENST00000412081	ensembl	human	novel	74_37	frame_shift_ins	INS	0.094:0.082	A
NPAS4	266743	genome.wustl.edu	37	11	66192048	66192048	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr11:66192048G>A	ENST00000311034.2	+	7	1863	c.1687G>A	c.(1687-1689)Gcc>Acc	p.A563T		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	563					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						GACTTACTTTGCCCAGGAGGG	0.587																																																	0								ENSG00000174576						102.0	111.0	108.0					11																	66192048		2200	4295	6495	NPAS4	SO:0001583	missense	0			-	HGNC	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.1687G>A	11.37:g.66192048G>A	ENSP00000311196:p.Ala563Thr	Somatic	0	39	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	18	50.00	B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PAS_fold_3,superfamily_PAS,smart_PAS,pfscan_PAS	p.A563T	ENST00000311034.2	37	c.1687	CCDS8138.1	11	.	.	.	.	.	.	.	.	.	.	G	10.99	1.506066	0.26949	.	.	ENSG00000174576	ENST00000311034	T	0.50277	0.75	4.69	1.5	0.22942	.	0.364605	0.23893	N	0.043534	T	0.18593	0.0446	N	0.08118	0	0.27821	N	0.941798	B	0.33694	0.421	B	0.30029	0.11	T	0.05084	-1.0907	10	0.30078	T	0.28	-3.1907	1.0957	0.01672	0.2215:0.1828:0.4295:0.1662	.	563	Q8IUM7	NPAS4_HUMAN	T	563	ENSP00000311196:A563T	ENSP00000311196:A563T	A	+	1	0	NPAS4	65948624	0.993000	0.37304	0.995000	0.50966	0.973000	0.67179	0.560000	0.23500	0.542000	0.28846	0.655000	0.94253	GCC	-	NULL		0.587	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAS4	protein_coding	OTTHUMT00000392634.1	G	NM_178864	-		66192048	+1	no_errors	ENST00000311034	ensembl	human	known	74_37	missense	SNP	0.933	A
CACNA1A	773	genome.wustl.edu	37	19	13410084	13410084	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr19:13410084G>C	ENST00000360228.5	-	19	2362	c.2363C>G	c.(2362-2364)gCc>gGc	p.A788G	CACNA1A_ENST00000573710.2_Missense_Mutation_p.A789G	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	789					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CTCCCGGCTGGCCAGCAAGTT	0.597																																																	0								ENSG00000141837						74.0	81.0	78.0					19																	13410084		2073	4202	6275	CACNA1A	SO:0001583	missense	0			-	HGNC	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.2363C>G	19.37:g.13410084G>C	ENSP00000353362:p.Ala788Gly	Somatic	0	73	0.00		0.473291439996773	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	33	47.62	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.A788G	ENST00000360228.5	37	c.2363	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	G	9.636	1.137807	0.21123	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.96300	-3.97	4.0	4.0	0.46444	.	0.635417	0.11828	U	0.525526	D	0.93838	0.8029	L	0.47190	1.495	0.26200	N	0.979463	B;P;P	0.37864	0.255;0.571;0.61	B;B;B	0.37550	0.038;0.121;0.253	D	0.89669	0.3882	10	0.72032	D	0.01	.	10.4237	0.44365	0.0:0.0:0.8044:0.1956	.	789;792;788	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	G	788;792;789;789	ENSP00000353362:A788G	ENSP00000317661:A789G	A	-	2	0	CACNA1A	13271084	1.000000	0.71417	1.000000	0.80357	0.599000	0.36880	7.358000	0.79466	2.073000	0.62155	0.561000	0.74099	GCC	-	NULL		0.597	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	protein_coding	OTTHUMT00000104062.2	G	NM_000068	-		13410084	-1	no_errors	ENST00000360228	ensembl	human	known	74_37	missense	SNP	1.000	C
COL11A1	1301	genome.wustl.edu	37	1	103404612	103404612	+	Silent	SNP	G	G	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr1:103404612G>A	ENST00000370096.3	-	44	3729	c.3417C>T	c.(3415-3417)agC>agT	p.S1139S	COL11A1_ENST00000512756.1_Silent_p.S1023S|COL11A1_ENST00000353414.4_Silent_p.S1100S|COL11A1_ENST00000358392.2_Silent_p.S1151S	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1139	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TGTCACCCTTGCTGCCTTTTT	0.328																																																	0								ENSG00000060718						156.0	156.0	156.0					1																	103404612		2203	4300	6503	COL11A1	SO:0001819	synonymous_variant	0			-	HGNC	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3417C>T	1.37:g.103404612G>A		Somatic	0	81	0.00		0.473291439996773	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.S1151	ENST00000370096.3	37	c.3453	CCDS778.1	1																																																																																			-	NULL		0.328	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	protein_coding	OTTHUMT00000029997.1	G	NM_080630	-		103404612	-1	no_errors	ENST00000358392	ensembl	human	known	74_37	silent	SNP	1.000	A
ZZEF1	23140	genome.wustl.edu	37	17	4008090	4008090	+	Silent	SNP	T	T	C			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr17:4008090T>C	ENST00000381638.2	-	8	1534	c.1410A>G	c.(1408-1410)ccA>ccG	p.P470P	ZZEF1_ENST00000574474.1_5'UTR	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	470							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						GTTCTACCTCTGGGGTAGAAC	0.438																																																	0								ENSG00000074755						70.0	65.0	67.0					17																	4008090		2203	4300	6503	ZZEF1	SO:0001819	synonymous_variant	0			-	HGNC	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.1410A>G	17.37:g.4008090T>C		Somatic	0	44	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_CUB_dom,smart_EF_hand_dom,smart_Znf_ZZ,pfscan_EF_hand_dom,pfscan_Znf_ZZ	p.P470	ENST00000381638.2	37	c.1410	CCDS11043.1	17																																																																																			-	NULL		0.438	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZEF1	protein_coding	OTTHUMT00000207480.1	T	NM_015113	-		4008090	-1	no_errors	ENST00000381638	ensembl	human	known	74_37	silent	SNP	1.000	C
ERLEC1	27248	genome.wustl.edu	37	2	54041683	54041683	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr2:54041683G>T	ENST00000185150.4	+	12	1361	c.1230G>T	c.(1228-1230)atG>atT	p.M410I	ERLEC1_ENST00000378239.5_Missense_Mutation_p.M356I|ERLEC1_ENST00000405123.3_Intron|ASB3_ENST00000498475.2_Intron|ASB3_ENST00000406625.2_Intron|GPR75-ASB3_ENST00000352846.3_Intron	NM_015701.4	NP_056516.2	Q96DZ1	ERLEC_HUMAN	endoplasmic reticulum lectin 1	410	PRKCSH 2.				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum lumen (GO:0005788)	glycoprotein binding (GO:0001948)			endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|stomach(1)|urinary_tract(1)	18						GATTCAGGATGGTGTCACATT	0.338																																																	0								ENSG00000068912						83.0	86.0	85.0					2																	54041683		2203	4299	6502	ERLEC1	SO:0001583	missense	0			-	HGNC	AF131849	CCDS1848.1, CCDS46283.1, CCDS46284.1	2p16	2010-03-19	2009-08-26	2009-08-26	ENSG00000068912	ENSG00000068912			25222	protein-coding gene	gene with protein product	"""erlectin 1"""	611229	"""chromosome 2 open reading frame 30"""	C2orf30		9110174, 8619474, 16531414, 18264092	Standard	NM_015701		Approved	CL25084, XTP3TPB, XTP3-B, ERLECTIN	uc002rxl.3	Q96DZ1	OTTHUMG00000129281	ENST00000185150.4:c.1230G>T	2.37:g.54041683G>T	ENSP00000185150:p.Met410Ile	Somatic	0	50	0.00		0.473291439996773	76	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B2RDB4|B5MC72|O95901|Q6UWN7|Q9NUY7|Q9UQL4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom	p.M410I	ENST00000185150.4	37	c.1230	CCDS1848.1	2	.	.	.	.	.	.	.	.	.	.	G	11.48	1.652766	0.29336	.	.	ENSG00000068912	ENST00000185150;ENST00000378239	T;T	0.03717	3.83;3.83	4.95	4.95	0.65309	Mannose-6-phosphate receptor, binding (1);Glucosidase II beta subunit-like (1);	0.205916	0.52532	D	0.000062	T	0.04861	0.0131	.	.	.	0.30107	N	0.806926	B;B	0.31485	0.325;0.27	B;B	0.29862	0.108;0.085	T	0.08146	-1.0736	9	0.51188	T	0.08	-13.8967	16.7544	0.85495	0.0:0.0:1.0:0.0	.	356;410	Q96DZ1-2;Q96DZ1	.;ERLEC_HUMAN	I	410;356	ENSP00000185150:M410I;ENSP00000367485:M356I	ENSP00000185150:M410I	M	+	3	0	ERLEC1	53895187	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.263000	0.65507	2.455000	0.83008	0.561000	0.74099	ATG	-	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom		0.338	ERLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERLEC1	protein_coding	OTTHUMT00000251404.1	G	NM_015701	-		54041683	+1	no_errors	ENST00000185150	ensembl	human	known	74_37	missense	SNP	1.000	T
TMEM14B	81853	genome.wustl.edu	37	6	10750123	10750123	+	Intron	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr6:10750123G>T	ENST00000379542.5	+	3	267				SYCP2L_ENST00000543878.1_Intron|RP11-421M1.8_ENST00000606522.1_lincRNA|RP11-637O19.3_ENST00000480294.1_Intron|TMEM14B_ENST00000379530.3_Intron|TMEM14B_ENST00000473276.1_Intron|RNA5SP203_ENST00000410451.1_RNA|TMEM14B_ENST00000461342.1_Intron|TMEM14B_ENST00000491103.1_Intron|TMEM14B_ENST00000481240.1_Intron|TMEM14B_ENST00000475942.1_Intron|TMEM14B_ENST00000467317.1_Intron	NM_030969.3	NP_112231.3	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B							integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(2)|skin(2)	11	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				GCTGAGCCAGGCCTCTTGTGG	0.483																																																	0								ENSG00000137210																																			TMEM14B	SO:0001627	intron_variant	0			-	HGNC	AL024498	CCDS4515.1, CCDS47372.1, CCDS75395.1, CCDS75396.1, CCDS75397.1	6p25.1-p23	2008-08-12			ENSG00000137210	ENSG00000137210			21384	protein-coding gene	gene with protein product							Standard	NM_030969		Approved	MGC1223	uc003mzk.4	Q9NUH8	OTTHUMG00000014246	ENST00000379542.5:c.100+192G>T	6.37:g.10750123G>T		Somatic	0	11	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	2	80.00	Q5THN7|Q5THN8|Q96IX7|Q9BVN8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000379542.5	37	NULL	CCDS4515.1	6																																																																																			-	-		0.483	TMEM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM14B	protein_coding	OTTHUMT00000039836.1	G	NM_030969	-		10750123	+1	no_errors	ENST00000492297	ensembl	human	known	74_37	rna	SNP	0.002	T
MED21	9412	genome.wustl.edu	37	12	27179393	27179418	+	Frame_Shift_Del	DEL	AATGTGGTCCTCCTGCCTCTTTCAAT	AATGTGGTCCTCCTGCCTCTTTCAAT	-			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	AATGTGGTCCTCCTGCCTCTTTCAAT	AATGTGGTCCTCCTGCCTCTTTCAAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr12:27179393_27179418delAATGTGGTCCTCCTGCCTCTTTCAAT	ENST00000282892.3	+	2	113_138	c.83_108delAATGTGGTCCTCCTGCCTCTTTCAAT	c.(82-108)caatgtggtcctcctgcctctttcaatfs	p.QCGPPASFN28fs	MED21_ENST00000536503.1_Intron|MED21_ENST00000546323.1_Frame_Shift_Del_p.QCGPPASFN28fs	NM_001271811.1|NM_004264.3	NP_001258740.1|NP_004255.2	Q13503	MED21_HUMAN	mediator complex subunit 21	28					blastocyst development (GO:0001824)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	mediator complex (GO:0016592)	DNA-directed RNA polymerase activity (GO:0003899)|transcription coactivator activity (GO:0003713)					Colorectal(261;0.0847)					GTATTGCAGCAATGTGGTCCTCCTGCCTCTTTCAATAATATTCAGA	0.372																																																	0								ENSG00000152944																																			MED21	SO:0001589	frameshift_variant	0				HGNC	U46837	CCDS8711.1	12p12	2007-07-30	2007-07-30	2007-07-30		ENSG00000152944			11473	protein-coding gene	gene with protein product		603800	"""SRB7 (suppressor of RNA polymerase B, yeast) homolog"", ""SRB7 suppressor of RNA polymerase B homolog (yeast)"""	SURB7		8598913	Standard	NM_004264		Approved	SRB7	uc001rhp.2	Q13503		ENST00000282892.3:c.83_108delAATGTGGTCCTCCTGCCTCTTTCAAT	12.37:g.27179393_27179418delAATGTGGTCCTCCTGCCTCTTTCAAT	ENSP00000282892:p.Gln28fs	Somatic	NA	NA	NA		0.473291439996773	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2R4I3|Q6IB05|Q92811	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Mediator_Med21	p.C29fs	ENST00000282892.3	37	c.83_108	CCDS8711.1	12																																																																																			-	pfam_Mediator_Med21		0.372	MED21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED21	protein_coding	OTTHUMT00000403262.1	AATGTGGTCCTCCTGCCTCTTTCAAT	NM_004264			27179418	+1	no_errors	ENST00000282892	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:0.995:0.686:1.000:1.000:0.944:1.000:1.000:0.985:1.000:1.000:0.995:1.000:1.000:0.994:1.000:1.000:0.997:1.000:1.000:1.000	-
UROD	7389	genome.wustl.edu	37	1	45480040	45480040	+	Intron	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr1:45480040G>T	ENST00000246337.4	+	7	755				UROD_ENST00000494399.1_3'UTR	NM_000374.4	NP_000365.3	P06132	DCUP_HUMAN	uroporphyrinogen decarboxylase						heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	uroporphyrinogen decarboxylase activity (GO:0004853)			endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4	Acute lymphoblastic leukemia(166;0.155)					GGAAAATTGAGGTGGATTTTG	0.398									Porphyria Cutanea Tarda, Type II		OREG0013449	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000126088																																			UROD	SO:0001627	intron_variant	0	Familial Cancer Database	PCT-II	-	HGNC	BC001778	CCDS518.1	1p34	2012-10-02			ENSG00000126088	ENSG00000126088	4.1.1.37		12591	protein-coding gene	gene with protein product		613521				3015909, 3460962	Standard	NM_000374		Approved		uc001cna.2	P06132	OTTHUMG00000008949	ENST00000246337.4:c.637-71G>T	1.37:g.45480040G>T		Somatic	0	28	0.00	931	0.473291439996773	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	A8K762|Q16863|Q16883|Q53YB8|Q53ZP6|Q6IB28|Q9BUZ0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000246337.4	37	NULL	CCDS518.1	1																																																																																			-	-		0.398	UROD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UROD	protein_coding	OTTHUMT00000024803.1	G	NM_000374	-		45480040	+1	no_errors	ENST00000472254	ensembl	human	known	74_37	rna	SNP	0.000	T
ROBO2	6092	genome.wustl.edu	37	3	77614263	77614263	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr3:77614263G>A	ENST00000461745.1	+	12	2741	c.1841G>A	c.(1840-1842)cGc>cAc	p.R614H	ROBO2_ENST00000487694.3_Missense_Mutation_p.R630H|ROBO2_ENST00000332191.8_Missense_Mutation_p.R614H	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	614	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.R614H(1)|p.R630H(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GATCCTGTGCGCACACAAGGT	0.468																																																	2	Substitution - Missense(2)	endometrium(2)						ENSG00000185008						127.0	125.0	126.0					3																	77614263		1967	4155	6122	ROBO2	SO:0001583	missense	0			-	HGNC	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.1841G>A	3.37:g.77614263G>A	ENSP00000417164:p.Arg614His	Somatic	0	97	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	32	58.44	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R614H	ENST00000461745.1	37	c.1841	CCDS43109.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.323084	0.95708	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	D;D;D	0.82711	-1.64;-1.64;-1.64	6.02	6.02	0.97574	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.46145	D	0.000320	D	0.91287	0.7253	M	0.71581	2.175	0.40145	D	0.976884	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.998	D	0.90917	0.4780	9	0.72032	D	0.01	.	20.5373	0.99239	0.0:0.0:1.0:0.0	.	630;614;614	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	H	630;630;634;614;614;335	ENSP00000417335:R630H;ENSP00000417164:R614H;ENSP00000327536:R614H	ENSP00000327536:R614H	R	+	2	0	ROBO2	77696953	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.869000	0.99810	2.857000	0.98124	0.650000	0.86243	CGC	-	superfamily_Fibronectin_type3		0.468	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ROBO2	protein_coding	OTTHUMT00000352600.2	G	XM_031246	-		77614263	+1	no_errors	ENST00000461745	ensembl	human	known	74_37	missense	SNP	1.000	A
KIF5A	3798	genome.wustl.edu	37	12	57962771	57962771	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr12:57962771C>T	ENST00000455537.2	+	9	1014	c.740C>T	c.(739-741)gCc>gTc	p.A247V	KIF5A_ENST00000286452.5_Missense_Mutation_p.A158V	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	247	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.|Microtubule-binding.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						GCAGAGGGAGCCGTGCTGGAC	0.567																																																	0								ENSG00000155980						144.0	112.0	123.0					12																	57962771		2203	4300	6503	KIF5A	SO:0001583	missense	0			-	HGNC	U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.740C>T	12.37:g.57962771C>T	ENSP00000408979:p.Ala247Val	Somatic	0	43	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	A6H8M5|Q4LE26	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.A247V	ENST00000455537.2	37	c.740	CCDS8945.1	12	.	.	.	.	.	.	.	.	.	.	C	20.6	4.014652	0.75161	.	.	ENSG00000155980	ENST00000455537;ENST00000286452	T;T	0.75260	-0.92;-0.92	4.23	4.23	0.50019	Kinesin, motor domain (4);	0.123056	0.53938	D	0.000053	T	0.57446	0.2054	N	0.11927	0.2	0.80722	D	1	B;B	0.28667	0.055;0.219	B;B	0.26693	0.038;0.072	T	0.57487	-0.7803	10	0.32370	T	0.25	.	15.9283	0.79639	0.0:1.0:0.0:0.0	.	158;247	B7Z2M7;Q12840	.;KIF5A_HUMAN	V	247;158	ENSP00000408979:A247V;ENSP00000286452:A158V	ENSP00000286452:A158V	A	+	2	0	KIF5A	56249038	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	7.444000	0.80532	2.362000	0.80069	0.555000	0.69702	GCC	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom		0.567	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5A	protein_coding	OTTHUMT00000407634.1	C	NM_004984	-		57962771	+1	no_errors	ENST00000455537	ensembl	human	known	74_37	missense	SNP	1.000	T
CDC16	8881	genome.wustl.edu	37	13	115012590	115012591	+	Intron	INS	-	-	T	rs5807004		TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr13:115012590_115012591insT	ENST00000356221.3	+	11	1079				CDC16_ENST00000252457.5_Intron|CDC16_ENST00000252458.6_Intron|MIR548AR_ENST00000582191.1_RNA|CDC16_ENST00000375310.1_Intron|CDC16_ENST00000360383.3_Intron|CDC16_ENST00000375308.1_Intron|CDC16_ENST00000375312.3_Intron			Q13042	CDC16_HUMAN	cell division cycle 16						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of mitosis (GO:0007088)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|spindle (GO:0005819)				endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)			AAGAATAAATGttttttttttt	0.351																																																	0								ENSG00000130177																																			CDC16	SO:0001627	intron_variant	0				HGNC	U18291	CCDS9542.2	13q34	2013-01-17	2013-01-17		ENSG00000130177	ENSG00000130177		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1720	protein-coding gene	gene with protein product	"""anaphase-promoting complex, subunit 6"""	603461	"""CDC16 (cell division cycle 16, S. cerevisiae, homolog)"", ""CDC16 cell division cycle 16 homolog (S. cerevisiae)"", ""cell division cycle 16 homolog (S. cerevisiae)"""			7736578	Standard	NM_001078645		Approved	APC6, ANAPC6, CUT9	uc001vul.1	Q13042	OTTHUMG00000017402	ENST00000356221.3:c.971+111->T	13.37:g.115012601_115012601dupT		Somatic	0	27	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	21	8.70	A2A365|Q5T8C8|Q96AE6|Q9Y564	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000356221.3	37	NULL	CCDS9542.2	13																																																																																			-	-		0.351	CDC16-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDC16	protein_coding	OTTHUMT00000276737.1	-	NM_003903			115012591	+1	no_errors	ENST00000494581	ensembl	human	known	74_37	rna	INS	0.000:0.004	T
RFX1	5989	genome.wustl.edu	37	19	14104401	14104401	+	Silent	SNP	C	C	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr19:14104401C>T	ENST00000254325.4	-	2	489	c.255G>A	c.(253-255)tcG>tcA	p.S85S		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	85					immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			CGGTTGGCTGCGAGGGTGCGG	0.647																																																	0								ENSG00000132005						44.0	37.0	40.0					19																	14104401		2203	4300	6503	RFX1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.255G>A	19.37:g.14104401C>T		Somatic	0	62	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.S85	ENST00000254325.4	37	c.255	CCDS12301.1	19																																																																																			-	NULL		0.647	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX1	protein_coding	OTTHUMT00000458510.1	C	NM_002918	-		14104401	-1	no_errors	ENST00000254325	ensembl	human	known	74_37	silent	SNP	0.072	T
COLGALT1	79709	genome.wustl.edu	37	19	17679325	17679325	+	Missense_Mutation	SNP	A	A	G	rs375611652		TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr19:17679325A>G	ENST00000252599.4	+	5	752	c.632A>G	c.(631-633)tAc>tGc	p.Y211C	COLGALT1_ENST00000601354.1_3'UTR	NM_024656.2	NP_078932.2	Q8NBJ5	GT251_HUMAN	collagen beta(1-O)galactosyltransferase 1	211					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	procollagen galactosyltransferase activity (GO:0050211)										CAGGGCTACTACAAGCGCACA	0.597																																																	0								ENSG00000130309	A	CYS/TYR	0,4406		0,0,2203	93.0	76.0	82.0		632	4.8	1.0	19		82	1,8599	1.2+/-3.3	0,1,4299	no	missense	GLT25D1	NM_024656.2	194	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging	211/623	17679325	1,13005	2203	4300	6503	COLGALT1	SO:0001583	missense	0			-	HGNC	AK075541	CCDS12363.1	19p13.11	2013-02-27	2013-02-27	2013-02-27	ENSG00000130309	ENSG00000130309			26182	protein-coding gene	gene with protein product			"""glycosyltransferase 25 domain containing 1"""	GLT25D1		19075007	Standard	NM_024656		Approved	FLJ22329	uc002nhc.1	Q8NBJ5		ENST00000252599.4:c.632A>G	19.37:g.17679325A>G	ENSP00000252599:p.Tyr211Cys	Somatic	0	44	0.00		0.473291439996773	13	40.91	9	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	22	50.00	Q8NC64	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_25	p.Y211C	ENST00000252599.4	37	c.632	CCDS12363.1	19	.	.	.	.	.	.	.	.	.	.	A	20.7	4.038684	0.75617	0.0	1.16E-4	ENSG00000130309	ENST00000252599	T	0.24908	1.83	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.59542	0.2201	M	0.94101	3.495	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.70417	-0.4877	10	0.87932	D	0	-9.8249	12.1992	0.54315	1.0:0.0:0.0:0.0	.	211	Q8NBJ5	GT251_HUMAN	C	211	ENSP00000252599:Y211C	ENSP00000252599:Y211C	Y	+	2	0	GLT25D1	17540325	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.156000	0.94705	1.788000	0.52465	0.402000	0.26972	TAC	-	NULL		0.597	COLGALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLGALT1	protein_coding	OTTHUMT00000464216.1	A	NM_024656	-		17679325	+1	no_errors	ENST00000252599	ensembl	human	known	74_37	missense	SNP	1.000	G
PCDH11Y	83259	genome.wustl.edu	37	Y	4925493	4925493	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chrY:4925493T>A	ENST00000333703.4	+	4	1109	c.596T>A	c.(595-597)cTa>cAa	p.L199Q	PCDH11Y_ENST00000362095.5_Missense_Mutation_p.L210Q|PCDH11Y_ENST00000215473.6_Missense_Mutation_p.L210Q	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	210	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						AACTACGAACTAATTAAGGTG	0.318																																																	0								ENSG00000099715																																			PCDH11Y	SO:0001583	missense	0			-	HGNC	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.596T>A	Y.37:g.4925493T>A	ENSP00000330552:p.Leu199Gln	Somatic	0	107	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	98	1	98.99	Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L210Q	ENST00000333703.4	37	c.629	CCDS14776.1	Y																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.318	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH11Y	protein_coding	OTTHUMT00000084979.2	T	NM_032973	-		4925493	+1	no_errors	ENST00000215473	ensembl	human	known	74_37	missense	SNP	1.000	A
FLT3	2322	genome.wustl.edu	37	13	28623854	28623854	+	Missense_Mutation	SNP	G	G	T	rs117240821		TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr13:28623854G>T	ENST00000241453.7	-	7	881	c.800C>A	c.(799-801)cCc>cAc	p.P267H	FLT3_ENST00000537084.1_Missense_Mutation_p.P267H|FLT3_ENST00000380982.4_Missense_Mutation_p.P267H	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	267	Ig-like C2-type.				B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	TATCCATAAGGGTTCCCCTAC	0.398			"""Mis, O"""		"""AML, ALL"""																																			Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	0								ENSG00000122025						123.0	115.0	118.0					13																	28623854		2203	4300	6503	FLT3	SO:0001583	missense	0			-	HGNC	U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.800C>A	13.37:g.28623854G>T	ENSP00000241453:p.Pro267His	Somatic	0	70	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P267H	ENST00000241453.7	37	c.800	CCDS31953.1	13	.	.	.	.	.	.	.	.	.	.	G	21.4	4.144552	0.77888	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	T;T;T	0.20200	2.09;2.09;2.09	5.74	5.74	0.90152	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.35970	0.0950	L	0.27053	0.805	0.47511	D	0.99944	D;D	0.89917	1.0;1.0	D;D	0.81914	0.993;0.995	T	0.04752	-1.0929	10	0.59425	D	0.04	.	18.4627	0.90745	0.0:0.0:1.0:0.0	.	267;267	P36888-2;P36888	.;FLT3_HUMAN	H	267	ENSP00000241453:P267H;ENSP00000370369:P267H;ENSP00000438139:P267H	ENSP00000241453:P267H	P	-	2	0	FLT3	27521854	1.000000	0.71417	0.878000	0.34440	0.899000	0.52679	6.013000	0.70776	2.873000	0.98535	0.561000	0.74099	CCC	-	pfam_Immunoglobulin,pfscan_Ig-like_dom		0.398	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLT3	protein_coding	OTTHUMT00000044319.2	G		-		28623854	-1	no_errors	ENST00000380982	ensembl	human	known	74_37	missense	SNP	0.970	T
RALGAPA1	253959	genome.wustl.edu	37	14	36277946	36277946	+	Silent	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr14:36277946G>T	ENST00000389698.3	-	1	486	c.96C>A	c.(94-96)cgC>cgA	p.R32R	AL162311.1_ENST00000582013.1_RNA|RALGAPA1_ENST00000382366.3_Silent_p.R32R|RALGAPA1_ENST00000258840.6_Silent_p.R32R|RALGAPA1_ENST00000307138.6_Silent_p.R32R	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	32					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CGATGACGATGCGCAGGTGCT	0.647																																																	0								ENSG00000174373						78.0	54.0	62.0					14																	36277946		2203	4300	6503	RALGAPA1	SO:0001819	synonymous_variant	0			-	HGNC	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.96C>A	14.37:g.36277946G>T		Somatic	0	55	0.00		0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Rap_GAP_dom,superfamily_ARM-type_fold,pfscan_Rap_GAP_dom	p.R32	ENST00000389698.3	37	c.96	CCDS32065.1	14																																																																																			-	NULL		0.647	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	RALGAPA1	protein_coding	OTTHUMT00000409829.1	G	XM_210022	-		36277946	-1	no_errors	ENST00000258840	ensembl	human	known	74_37	silent	SNP	1.000	T
C9orf62	157927	genome.wustl.edu	37	9	138235894	138235894	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr9:138235894C>A	ENST00000320778.2	+	2	250	c.100C>A	c.(100-102)Ctg>Atg	p.L34M		NM_173520.2	NP_775791.1	Q8N4C0	CI062_HUMAN	chromosome 9 open reading frame 62	34																	CGCCACTGTGCTGACGCCTGG	0.652											OREG0019607	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000178243																																			C9orf62	SO:0001583	missense	0			-	HGNC	BC034752	CCDS59154.1	9q34.3	2008-02-05			ENSG00000178243	ENSG00000178243			28581	protein-coding gene	gene with protein product						12477932	Standard	NM_173520		Approved	MGC35463	uc004cfo.3	Q8N4C0	OTTHUMG00000020900	ENST00000320778.2:c.100C>A	9.37:g.138235894C>A	ENSP00000326574:p.Leu34Met	Somatic	0	53	0.00	1639	0.473291439996773	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	Q5T7E2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L34M	ENST00000320778.2	37	c.100	CCDS59154.1	9	.	.	.	.	.	.	.	.	.	.	C	9.633	1.136880	0.21123	.	.	ENSG00000178243	ENST00000320778	.	.	.	2.58	-0.661	0.11417	.	.	.	.	.	T	0.21921	0.0528	.	.	.	0.09310	N	1	B	0.33318	0.408	B	0.27076	0.076	T	0.15578	-1.0432	7	0.87932	D	0	.	5.0153	0.14333	0.4203:0.3737:0.206:0.0	.	34	Q8N4C0	CI062_HUMAN	M	34	.	ENSP00000326574:L34M	L	+	1	2	C9orf62	137375715	0.003000	0.15002	0.001000	0.08648	0.002000	0.02628	0.324000	0.19610	-0.153000	0.11137	-0.268000	0.10319	CTG	-	NULL		0.652	C9orf62-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	C9orf62	protein_coding	OTTHUMT00000054980.2	C	NM_173520	-		138235894	+1	no_errors	ENST00000320778	ensembl	human	putative	74_37	missense	SNP	0.002	A
