#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CCL20	6364	genome.wustl.edu	37	2	228680154	228680154	+	Intron	DEL	T	T	-	rs34834265		TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr2:228680154delT	ENST00000358813.4	+	2	134				CCL20_ENST00000409189.3_Intron|CCL20_ENST00000473642.1_3'UTR			P78556	CCL20_HUMAN	chemokine (C-C motif) ligand 20						cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemokinesis (GO:0042466)|chemotaxis (GO:0006935)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of T cell migration (GO:2000406)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			cervix(1)|lung(2)	3		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;7.3e-11)|all cancers(144;4.13e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		TACCTTTCACTTTTTTTTTTT	0.363																																																	0								ENSG00000115009						49.0	57.0	55.0					2																	228680154		2201	4300	6501	CCL20	SO:0001627	intron_variant	0				HGNC	D86955	CCDS2469.1, CCDS46536.1	2q36.3	2013-02-25	2002-08-22	2002-08-23	ENSG00000115009	ENSG00000115009		"""Chemokine ligands"", ""Endogenous ligands"""	10619	protein-coding gene	gene with protein product		601960	"""small inducible cytokine subfamily A (Cys-Cys), member 20"""	SCYA20		9038201, 11352563	Standard	NM_004591		Approved	LARC, MIP-3a, exodus-1, ST38, CKb4	uc002vpl.2	P78556	OTTHUMG00000133189	ENST00000358813.4:c.77-16T>-	2.37:g.228680154delT		Somatic	0	16	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	20	20.00	Q53S51|Q99664	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000358813.4	37	NULL	CCDS2469.1	2																																																																																			-	-		0.363	CCL20-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCL20	protein_coding	OTTHUMT00000331641.1	T	NM_004591			228680154	+1	no_errors	ENST00000473642	ensembl	human	known	74_37	rna	DEL	0.010	-
KLHL33	123103	genome.wustl.edu	37	14	20898562	20898562	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr14:20898562C>G	ENST00000344581.4	-	2	495	c.273G>C	c.(271-273)tgG>tgC	p.W91C		NM_001109997.2	NP_001103467.2	A6NCF5	KLH33_HUMAN	kelch-like family member 33	91												all_cancers(95;0.00123)		Epithelial(56;7.57e-08)|all cancers(55;8.63e-07)	GBM - Glioblastoma multiforme(265;0.0223)|READ - Rectum adenocarcinoma(17;0.193)		GGGCTTTGCTCCAGAGCCTCT	0.612																																																	0								ENSG00000185271						68.0	76.0	73.0					14																	20898562		692	1591	2283	KLHL33	SO:0001583	missense	0			-	HGNC		CCDS53882.1	14q11.2	2013-10-15	2013-02-22		ENSG00000185271	ENSG00000185271		"""Kelch-like"""	31952	protein-coding gene	gene with protein product			"""kelch-like 33 (Drosophila)"""				Standard	NM_001109997		Approved		uc010tli.2	A6NCF5	OTTHUMG00000170982	ENST00000344581.4:c.273G>C	14.37:g.20898562C>G	ENSP00000341549:p.Trp91Cys	Somatic	0	24	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	34	17.07		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,superfamily_BTB/POZ_fold,smart_BACK,smart_Kelch_1	p.W91C	ENST00000344581.4	37	c.273	CCDS53882.1	14	.	.	.	.	.	.	.	.	.	.	C	12.02	1.811270	0.32053	.	.	ENSG00000185271	ENST00000344581	T	0.68331	-0.32	4.52	4.52	0.55395	BTB/Kelch-associated (2);	0.308958	0.27172	N	0.020596	T	0.59918	0.2229	N	0.11427	0.14	0.44275	D	0.997136	D	0.63046	0.992	P	0.60117	0.869	T	0.64317	-0.6436	10	0.66056	D	0.02	.	8.3957	0.32555	0.0:0.8955:0.0:0.1045	.	91	A6NCF5	KLH33_HUMAN	C	91	ENSP00000341549:W91C	ENSP00000341549:W91C	W	-	3	0	KLHL33	19968402	0.886000	0.30341	1.000000	0.80357	0.995000	0.86356	0.968000	0.29357	2.347000	0.79759	0.655000	0.94253	TGG	-	pfam_BACK,smart_BACK		0.612	KLHL33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL33	protein_coding	OTTHUMT00000411038.1	C	XM_063481	-		20898562	-1	no_errors	ENST00000344581	ensembl	human	known	74_37	missense	SNP	0.954	G
DOCK11	139818	genome.wustl.edu	37	X	117744376	117744376	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chrX:117744376C>A	ENST00000276202.7	+	28	3154	c.3091C>A	c.(3091-3093)Ctg>Atg	p.L1031M	DOCK11_ENST00000276204.6_Missense_Mutation_p.L1031M	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1031					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						GGCTAGCTTCCTGAAGGTGAG	0.433																																																	0								ENSG00000147251						91.0	78.0	82.0					X																	117744376		2203	4300	6503	DOCK11	SO:0001583	missense	0			-	HGNC	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.3091C>A	X.37:g.117744376C>A	ENSP00000276202:p.Leu1031Met	Somatic	0	59	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	44	12.00	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L1031M	ENST00000276202.7	37	c.3091	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	C	16.14	3.038419	0.55003	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.75050	-0.9;-0.9	5.14	3.38	0.38709	.	0.071602	0.56097	D	0.000034	T	0.82176	0.4980	M	0.82323	2.585	0.37226	D	0.905459	D;D	0.63046	0.984;0.992	P;P	0.59948	0.823;0.866	T	0.82849	-0.0254	10	0.72032	D	0.01	-6.7619	6.3086	0.21153	0.1471:0.695:0.0:0.1579	.	1031;1031	A6NIW2;Q5JSL3	.;DOC11_HUMAN	M	1031	ENSP00000276204:L1031M;ENSP00000276202:L1031M	ENSP00000276202:L1031M	L	+	1	2	DOCK11	117628404	1.000000	0.71417	0.812000	0.32479	0.901000	0.52897	3.385000	0.52485	0.502000	0.28037	-0.198000	0.12761	CTG	-	NULL		0.433	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	protein_coding	OTTHUMT00000356002.1	C	NM_144658	-		117744376	+1	no_errors	ENST00000276202	ensembl	human	known	74_37	missense	SNP	0.998	A
MYLIP	29116	genome.wustl.edu	37	6	16148585	16148586	+	IGR	INS	-	-	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr6:16148585_16148586insT	ENST00000356840.3	+	0	1666				U3_ENST00000515984.1_RNA	NM_013262.3	NP_037394.2	Q8WY64	MYLIP_HUMAN	myosin regulatory light chain interacting protein						cellular component movement (GO:0006928)|cholesterol homeostasis (GO:0042632)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|nervous system development (GO:0007399)|positive regulation of protein catabolic process (GO:0045732)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	cytoskeletal protein binding (GO:0008092)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28	Breast(50;0.0799)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.241)			CGGGaatttaattttttttttt	0.287																																																	0								ENSG00000251793																																			U3	SO:0001628	intergenic_variant	0				RFAM	AF187016	CCDS4536.1	6p23-p22.3	2011-11-17			ENSG00000007944	ENSG00000007944			21155	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase-inducible degrader of the low density lipoprotein receptor"""	610082				10593918, 11162443, 19688294	Standard	NM_013262		Approved	MIR, IDOL	uc003nbq.3	Q8WY64	OTTHUMG00000016405		6.37:g.16148596_16148596dupT		Somatic	0	28	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	Q5TIA4|Q9BU73|Q9NRL9|Q9UHE7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000356840.3	37	NULL	CCDS4536.1	6																																																																																			-	-		0.287	MYLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000251793	protein_coding	OTTHUMT00000043864.1	-	NM_013262			16148586	-1	no_errors	ENST00000515984	ensembl	human	novel	74_37	rna	INS	0.008:0.031	T
RP11-782C8.2	0	genome.wustl.edu	37	1	143210557	143210557	+	lincRNA	SNP	A	A	G			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr1:143210557A>G	ENST00000412204.2	-	0	513				RP11-782C8.1_ENST00000438000.1_lincRNA																							AAGTCAATGAATTTATAAAAG	0.313																																																	0								ENSG00000232274																																			RP11-782C8.2			0			-	Clone_based_vega_gene																													1.37:g.143210557A>G		Somatic	0	34	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			-	-		0.313	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	lincRNA	OTTHUMT00000037567.2	A		-		143210557	-1	no_errors	ENST00000412204	ensembl	human	known	74_37	rna	SNP	0.012	G
LRRK2	120892	genome.wustl.edu	37	12	40704301	40704301	+	Silent	SNP	C	C	T	rs35363614		TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr12:40704301C>T	ENST00000298910.7	+	31	4444	c.4386C>T	c.(4384-4386)cgC>cgT	p.R1462R		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1462	Roc. {ECO:0000255|PROSITE- ProRule:PRU00758}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				AGAAGCAACGCAAAGCCTGCA	0.483																																																	0								ENSG00000188906						154.0	147.0	149.0					12																	40704301		2203	4300	6503	LRRK2	SO:0001819	synonymous_variant	0			-	HGNC	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.4386C>T	12.37:g.40704301C>T		Somatic	0	30	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	72	11.11	A6NJU2|Q6ZS50|Q8NCX9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.R1462	ENST00000298910.7	37	c.4386	CCDS31774.1	12																																																																																			-	superfamily_P-loop_NTPase,smart_Small_GTPase_Rab_type,tigrfam_Small_GTP-bd_dom		0.483	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	protein_coding	OTTHUMT00000277179.1	C	XM_058513	-		40704301	+1	no_errors	ENST00000298910	ensembl	human	known	74_37	silent	SNP	0.996	T
BCL11B	64919	genome.wustl.edu	37	14	99724166	99724166	+	Missense_Mutation	SNP	G	G	T	rs200739087		TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr14:99724166G>T	ENST00000357195.3	-	2	78	c.69C>A	c.(67-69)gaC>gaA	p.D23E	BCL11B_ENST00000443726.2_Intron|BCL11B_ENST00000345514.2_Missense_Mutation_p.D23E	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	23					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		CCTCCACATGGTCAGCCTCTG	0.607			T	TLX3	T-ALL																																			Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	0								ENSG00000127152						37.0	41.0	40.0					14																	99724166		2203	4300	6503	BCL11B	SO:0001583	missense	0			-	HGNC	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.69C>A	14.37:g.99724166G>T	ENSP00000349723:p.Asp23Glu	Somatic	0	34	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q9H162	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D23E	ENST00000357195.3	37	c.69	CCDS9950.1	14	.	.	.	.	.	.	.	.	.	.	G	3.928	-0.016771	0.07681	.	.	ENSG00000127152	ENST00000357195;ENST00000345514	T;T	0.09350	3.03;2.99	6.08	3.19	0.36642	.	1.050250	0.07554	N	0.915841	T	0.05547	0.0146	N	0.05280	-0.08	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.10450	0.003;0.005	T	0.29852	-0.9998	10	0.02654	T	1	-15.209	11.5647	0.50798	0.0638:0.2481:0.6881:0.0	.	23;23	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	E	23	ENSP00000349723:D23E;ENSP00000280435:D23E	ENSP00000280435:D23E	D	-	3	2	BCL11B	98793919	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.032000	0.49736	0.402000	0.25451	0.655000	0.94253	GAC	-	NULL		0.607	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL11B	protein_coding	OTTHUMT00000072332.2	G	NM_138576	-		99724166	-1	no_errors	ENST00000357195	ensembl	human	known	74_37	missense	SNP	1.000	T
TAL1	6886	genome.wustl.edu	37	1	47685823	47685823	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr1:47685823G>T	ENST00000294339.3	-	4	1141	c.565C>A	c.(565-567)Cgt>Agt	p.R189S	TAL1_ENST00000371883.3_Missense_Mutation_p.R191S|TAL1_ENST00000459729.1_5'UTR|TAL1_ENST00000371884.2_Missense_Mutation_p.R189S	NM_003189.2	NP_003180.1	P17542	TAL1_HUMAN	T-cell acute lymphocytic leukemia 1	189	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				angiogenesis (GO:0001525)|astrocyte fate commitment (GO:0060018)|basophil differentiation (GO:0030221)|cell fate commitment (GO:0045165)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|hemangioblast cell differentiation (GO:0060217)|hematopoietic stem cell differentiation (GO:0060218)|hemopoiesis (GO:0030097)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|platelet formation (GO:0030220)|positive regulation of cell division (GO:0051781)|positive regulation of chromatin assembly or disassembly (GO:0045799)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell proliferation (GO:0042127)|regulation of mast cell differentiation (GO:0060375)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord association neuron differentiation (GO:0021527)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|E-box binding (GO:0070888)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			haematopoietic_and_lymphoid_tissue(1)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	15						GTGAAGATACGCCGCACAACT	0.557			T	"""TRD@, SIL"""	lymphoblastic leukemia/biphasic																																			Dom	yes		1	1p32	6886	T-cell acute lymphocytic leukemia 1 (SCL)		L	0								ENSG00000162367						36.0	35.0	35.0					1																	47685823		2203	4300	6503	TAL1	SO:0001583	missense	0			-	HGNC	M29038	CCDS547.1	1p32	2013-05-21	2001-12-04		ENSG00000162367	ENSG00000162367		"""Basic helix-loop-helix proteins"""	11556	protein-coding gene	gene with protein product		187040		TCL5		2740341	Standard	NM_001287347		Approved	SCL, bHLHa17	uc009vyq.2	P17542	OTTHUMG00000007847	ENST00000294339.3:c.565C>A	1.37:g.47685823G>T	ENSP00000294339:p.Arg189Ser	Somatic	0	54	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	D3DQ24	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.R191S	ENST00000294339.3	37	c.571	CCDS547.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.484753	0.96323	.	.	ENSG00000162367	ENST00000371884;ENST00000371883;ENST00000294339	D;D;D	0.99129	-5.46;-5.46;-5.46	5.53	5.53	0.82687	Helix-loop-helix DNA-binding (4);	0.000000	0.85682	D	0.000000	D	0.99417	0.9794	M	0.88031	2.925	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98931	1.0787	10	0.87932	D	0	.	19.4674	0.94948	0.0:0.0:1.0:0.0	.	189	P17542	TAL1_HUMAN	S	189;191;189	ENSP00000360951:R189S;ENSP00000360950:R191S;ENSP00000294339:R189S	ENSP00000294339:R189S	R	-	1	0	TAL1	47458410	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.941000	0.87700	2.607000	0.88179	0.579000	0.79373	CGT	-	pfam_bHLH_dom,superfamily_bHLH_dom,pfscan_bHLH_dom		0.557	TAL1-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	TAL1	protein_coding	OTTHUMT00000021640.1	G	NM_003189	-		47685823	-1	no_errors	ENST00000371883	ensembl	human	known	74_37	missense	SNP	1.000	T
DNAH7	56171	genome.wustl.edu	37	2	196771666	196771666	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr2:196771666G>T	ENST00000312428.6	-	26	4272	c.4172C>A	c.(4171-4173)tCt>tAt	p.S1391Y		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1391	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						AGCAACCACAGAGAGTACTTC	0.358																																																	0								ENSG00000118997						94.0	86.0	88.0					2																	196771666		1876	4102	5978	DNAH7	SO:0001583	missense	0			-	HGNC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.4172C>A	2.37:g.196771666G>T	ENSP00000311273:p.Ser1391Tyr	Somatic	0	30	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_hand_dom	p.S1391Y	ENST00000312428.6	37	c.4172	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	G	19.85	3.902999	0.72754	.	.	ENSG00000118997	ENST00000312428	T	0.45276	0.9	5.07	5.07	0.68467	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.80412	0.4618	H	0.99238	4.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88958	0.3391	10	0.87932	D	0	.	18.2423	0.89971	0.0:0.0:1.0:0.0	.	1391	Q8WXX0	DYH7_HUMAN	Y	1391	ENSP00000311273:S1391Y	ENSP00000311273:S1391Y	S	-	2	0	DNAH7	196479911	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.711000	0.84669	2.634000	0.89283	0.557000	0.71058	TCT	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.358	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	protein_coding	OTTHUMT00000335202.3	G	NM_018897	-		196771666	-1	no_errors	ENST00000312428	ensembl	human	known	74_37	missense	SNP	1.000	T
DSC3	1825	genome.wustl.edu	37	18	28612217	28612217	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr18:28612217C>T	ENST00000360428.4	-	2	175	c.95G>A	c.(94-96)tGc>tAc	p.C32Y	DSC3_ENST00000434452.1_Missense_Mutation_p.C32Y	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	32					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			CACCTTTTTGCAGGCTTCACC	0.294																																																	0								ENSG00000134762						82.0	79.0	80.0					18																	28612217		2202	4300	6502	DSC3	SO:0001583	missense	0			-	HGNC	X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.95G>A	18.37:g.28612217C>T	ENSP00000353608:p.Cys32Tyr	Somatic	0	43	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A6NN35|Q14200|Q9HAZ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Cadherin/Desmocollin,prints_Desmosomal_cadherin	p.C32Y	ENST00000360428.4	37	c.95	CCDS32810.1	18	.	.	.	.	.	.	.	.	.	.	C	20.2	3.948661	0.73787	.	.	ENSG00000134762	ENST00000360428;ENST00000434452	T;T	0.41065	1.01;1.01	5.35	5.35	0.76521	Cadherin prodomain-like (1);Cadherin-like (1);	.	.	.	.	T	0.57184	0.2036	M	0.81112	2.525	0.58432	D	0.999995	P;P	0.52170	0.865;0.951	P;P	0.49665	0.519;0.618	T	0.60131	-0.7323	9	0.44086	T	0.13	.	17.9938	0.89176	0.0:1.0:0.0:0.0	.	32;32	Q14574;Q14574-2	DSC3_HUMAN;.	Y	32	ENSP00000353608:C32Y;ENSP00000392068:C32Y	ENSP00000353608:C32Y	C	-	2	0	DSC3	26866215	1.000000	0.71417	0.999000	0.59377	0.793000	0.44817	3.242000	0.51384	2.780000	0.95670	0.655000	0.94253	TGC	-	pfam_Cadherin_pro_dom,superfamily_Cadherin-like		0.294	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	DSC3	protein_coding	OTTHUMT00000447384.1	C	NM_001941, NM_024423	-		28612217	-1	no_errors	ENST00000360428	ensembl	human	known	74_37	missense	SNP	1.000	T
DYNC1I2	1781	genome.wustl.edu	37	2	172602373	172602373	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr2:172602373A>G	ENST00000397119.3	+	17	1906	c.1739A>G	c.(1738-1740)cAt>cGt	p.H580R	DYNC1I2_ENST00000409453.1_Missense_Mutation_p.H580R|DYNC1I2_ENST00000263811.4_Missense_Mutation_p.H574R|DYNC1I2_ENST00000508530.1_Missense_Mutation_p.H554R|DYNC1I2_ENST00000358002.6_Missense_Mutation_p.H572R|DYNC1I2_ENST00000410079.3_Missense_Mutation_p.H572R|DYNC1I2_ENST00000534253.2_Missense_Mutation_p.H580R|DYNC1I2_ENST00000409773.1_Missense_Mutation_p.H580R|DYNC1I2_ENST00000409317.1_Missense_Mutation_p.H574R|DYNC1I2_ENST00000340296.4_Missense_Mutation_p.H554R|DYNC1I2_ENST00000409197.1_Missense_Mutation_p.H554R	NM_001378.1	NP_001369.1	Q13409	DC1I2_HUMAN	dynein, cytoplasmic 1, intermediate chain 2	580					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|microtubule (GO:0005874)|vesicle (GO:0031982)	microtubule motor activity (GO:0003777)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.198)			AGATGGACCCATTCTGGCAGA	0.433																																																	0								ENSG00000077380						205.0	202.0	203.0					2																	172602373		1942	4134	6076	DYNC1I2	SO:0001583	missense	0			-	HGNC	AK055491	CCDS46450.1, CCDS63054.1, CCDS63056.1, CCDS63057.1	2q31.1	2013-01-10	2005-11-24	2005-11-24	ENSG00000077380	ENSG00000077380		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2964	protein-coding gene	gene with protein product		603331	"""dynein, cytoplasmic, intermediate polypeptide 2"""	DNCI2		10049579, 16260502	Standard	NM_001378		Approved		uc002uha.2	Q13409	OTTHUMG00000154061	ENST00000397119.3:c.1739A>G	2.37:g.172602373A>G	ENSP00000380308:p.His580Arg	Somatic	0	85	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	46	22.03	B7ZA04|D3DPD4|D3DPD5|D3DPD6|Q32LY9|Q53S84|Q5BJF8|Q7Z4X1|Q96NG7|Q96S87|Q9BXZ5|Q9NT58	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_IC_1/2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.H580R	ENST00000397119.3	37	c.1739	CCDS46450.1	2	.	.	.	.	.	.	.	.	.	.	A	12.69	2.012147	0.35511	.	.	ENSG00000077380	ENST00000340296;ENST00000534253;ENST00000263811;ENST00000397119;ENST00000410079;ENST00000508530;ENST00000409197;ENST00000409317;ENST00000409773;ENST00000409453;ENST00000358002	T;T;T;T;T;T;T;T;T;T;T	0.75367	-0.79;-0.93;-0.8;-0.72;-0.56;-0.56;-0.79;-0.8;-0.72;-0.58;-0.56	5.74	5.74	0.90152	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.088351	0.85682	D	0.000000	T	0.60508	0.2274	N	0.17594	0.5	0.80722	D	1	B;B;B;B;B	0.17268	0.0;0.021;0.007;0.007;0.021	B;B;B;B;B	0.22152	0.001;0.027;0.038;0.038;0.017	T	0.56263	-0.8008	10	0.16420	T	0.52	-3.8319	16.0448	0.80714	1.0:0.0:0.0:0.0	.	303;572;554;554;580	B4DX93;B7ZA04;Q13409-6;Q13409-3;Q13409	.;.;.;.;DC1I2_HUMAN	R	554;580;574;580;572;554;554;574;580;580;572	ENSP00000339430:H554R;ENSP00000433791:H580R;ENSP00000263811:H574R;ENSP00000380308:H580R;ENSP00000386522:H572R;ENSP00000423339:H554R;ENSP00000386397:H554R;ENSP00000386591:H574R;ENSP00000386415:H580R;ENSP00000386886:H580R;ENSP00000350692:H572R	ENSP00000263811:H574R	H	+	2	0	DYNC1I2	172310619	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.221000	0.95188	2.206000	0.71126	0.482000	0.46254	CAT	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.433	DYNC1I2-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	DYNC1I2	protein_coding	OTTHUMT00000333683.2	A	NM_001378	-		172602373	+1	no_errors	ENST00000397119	ensembl	human	known	74_37	missense	SNP	1.000	G
INCENP	3619	genome.wustl.edu	37	11	61913137	61913137	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr11:61913137delA	ENST00000394818.3	+	14	2075	c.1873delA	c.(1873-1875)aaafs	p.K626fs	INCENP_ENST00000278849.4_Frame_Shift_Del_p.K622fs	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	626					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						GAAGGCCAAGAAAAAGGCGGC	0.617																																																	0								ENSG00000149503						69.0	49.0	56.0					11																	61913137		2192	4293	6485	INCENP	SO:0001589	frameshift_variant	0				HGNC	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.1873delA	11.37:g.61913137delA	ENSP00000378295:p.Lys626fs	Somatic	0	41	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	A8MQD2|Q5Y192	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_INCENP_N,pfam_Inner_centromere_prot_ARK-bd	p.K626fs	ENST00000394818.3	37	c.1873	CCDS44624.1	11																																																																																			-	NULL		0.617	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INCENP	protein_coding	OTTHUMT00000394723.2	A	NM_020238			61913137	+1	no_errors	ENST00000394818	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
NARFL	64428	genome.wustl.edu	37	16	784146	784146	+	Intron	SNP	C	C	A			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr16:784146C>A	ENST00000251588.2	-	6	710				NARFL_ENST00000301694.5_Intron|NARFL_ENST00000568545.1_Intron|NARFL_ENST00000540986.1_Intron|NARFL_ENST00000562862.1_5'UTR|HAGHL_ENST00000569604.1_3'UTR	NM_022493.1	NP_071938.1	Q9H6Q4	NARFL_HUMAN	nuclear prelamin A recognition factor-like						hematopoietic progenitor cell differentiation (GO:0002244)|iron-sulfur cluster assembly (GO:0016226)|oxygen homeostasis (GO:0032364)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	CIA complex (GO:0097361)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|large_intestine(1)|lung(7)	9		Hepatocellular(780;0.0218)				GACTCTGTTTCCTGCAGCCTC	0.627																																																	0								ENSG00000103245																																			NARFL	SO:0001627	intron_variant	0			-	HGNC	AY129231	CCDS10425.1	16p13.3	2009-12-17			ENSG00000103245	ENSG00000103245			14179	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 1"""	611118				16956324	Standard	NM_022493		Approved	FLJ21988, PRN, HPRN, IOP1	uc002cjr.3	Q9H6Q4	OTTHUMG00000122093	ENST00000251588.2:c.693+82G>T	16.37:g.784146C>A		Somatic	0	40	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A1L385|B3KTJ3|Q53GC6|Q96S10|Q9H6J8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000251588.2	37	NULL	CCDS10425.1	16																																																																																			-	-		0.627	NARFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARFL	protein_coding	OTTHUMT00000242855.1	C	NM_022493	-		784146	-1	no_errors	ENST00000562862	ensembl	human	known	74_37	rna	SNP	0.000	A
PTPN3	5774	genome.wustl.edu	37	9	112172683	112172683	+	Silent	SNP	C	C	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr9:112172683C>T	ENST00000374541.2	-	15	1430	c.1326G>A	c.(1324-1326)gaG>gaA	p.E442E	PTPN3_ENST00000412145.1_Silent_p.E311E|PTPN3_ENST00000394827.3_5'UTR|PTPN3_ENST00000262539.3_Silent_p.E288E|PTPN3_ENST00000446349.1_Silent_p.E266E	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	442					negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						CCGGATTGTTCTCGGATAAAC	0.483																																																	0								ENSG00000070159						81.0	88.0	85.0					9																	112172683		2202	4300	6502	PTPN3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.1326G>A	9.37:g.112172683C>T		Somatic	0	51	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	75	32	70.09	A0AUW9|E7EN99|E9PGU7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_PDZ,pfam_Dual-sp_phosphatase_cat-dom,superfamily_FERM_central,superfamily_PDZ,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-3/4,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,prints_Ez/rad/moesin_like,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.E442	ENST00000374541.2	37	c.1326	CCDS6776.1	9																																																																																			-	pirsf_Tyr_Pase_non-rcpt_typ-3/4		0.483	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN3	protein_coding	OTTHUMT00000053598.4	C		-		112172683	-1	no_errors	ENST00000374541	ensembl	human	known	74_37	silent	SNP	1.000	T
EXTL2	2135	genome.wustl.edu	37	1	101342367	101342367	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr1:101342367C>T	ENST00000370114.3	-	4	1923	c.487G>A	c.(487-489)Gct>Act	p.A163T	EXTL2_ENST00000370113.3_Missense_Mutation_p.A163T|EXTL2_ENST00000535414.1_Missense_Mutation_p.A150T	NM_001033025.2|NM_001261440.1	NP_001028197.1|NP_001248369.1	Q9UBQ6	EXTL2_HUMAN	exostosin-like glycosyltransferase 2	163					heparan sulfate proteoglycan biosynthetic process (GO:0015012)|N-acetylglucosamine metabolic process (GO:0006044)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	alpha-1,4-N-acetylgalactosaminyltransferase activity (GO:0035248)|glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|skin(1)|urinary_tract(1)	14		all_epithelial(167;2.48e-06)|all_lung(203;0.000414)|Lung NSC(277;0.000946)		Epithelial(280;0.0425)|all cancers(265;0.0628)|COAD - Colon adenocarcinoma(174;0.148)|Colorectal(144;0.167)|Lung(183;0.195)		ACTGAGAAAGCAAAAACAAGG	0.368																																																	0								ENSG00000162694						150.0	137.0	141.0					1																	101342367		2203	4299	6502	EXTL2	SO:0001583	missense	0			-	HGNC	U76189	CCDS775.1, CCDS72831.1	1p21	2013-03-01	2013-03-01		ENSG00000162694	ENSG00000162694	2.4.1.223	"""Exostosin glycosyltransferase family"""	3516	protein-coding gene	gene with protein product	"""alpha-1,4-N-acteylhexosaminyltransferase"""	602411	"""exostoses (multiple)-like 2"""			9450183, 15831490	Standard	NM_001439		Approved		uc001dtk.2	Q9UBQ6	OTTHUMG00000011814	ENST00000370114.3:c.487G>A	1.37:g.101342367C>T	ENSP00000359132:p.Ala163Thr	Somatic	0	56	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	54	8.47	B2R795|D3DT60	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HexNAc_Trfase_a	p.A163T	ENST00000370114.3	37	c.487	CCDS775.1	1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.000837	0.93227	.	.	ENSG00000162694	ENST00000370114;ENST00000370113;ENST00000535414;ENST00000450240	D;D;D;D	0.92099	-2.97;-2.97;-2.97;-2.97	5.67	5.67	0.87782	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	0.000000	0.85682	D	0.000000	D	0.96343	0.8807	M	0.87547	2.89	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.68039	0.955;0.94	D	0.96454	0.9336	10	0.87932	D	0	-21.6885	19.7556	0.96287	0.0:1.0:0.0:0.0	.	162;163	Q8N8F1;Q9UBQ6	.;EXTL2_HUMAN	T	163;163;150;171	ENSP00000359132:A163T;ENSP00000359131:A163T;ENSP00000444385:A150T;ENSP00000403363:A171T	ENSP00000359131:A163T	A	-	1	0	EXTL2	101114955	1.000000	0.71417	0.991000	0.47740	0.755000	0.42902	7.219000	0.78000	2.660000	0.90430	0.650000	0.86243	GCT	-	pfam_HexNAc_Trfase_a		0.368	EXTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXTL2	protein_coding	OTTHUMT00000032705.1	C	NM_001439	-		101342367	-1	no_errors	ENST00000370114	ensembl	human	known	74_37	missense	SNP	1.000	T
PTPRQ	374462	genome.wustl.edu	37	12	81028739	81028739	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr12:81028739G>T	ENST00000266688.5	+	40	5790	c.5790G>T	c.(5788-5790)caG>caT	p.Q1930H				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1976					regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						GACAGAAGCAGAAAGAAGGTG	0.393																																																	0								ENSG00000139304						88.0	74.0	78.0					12																	81028739		692	1591	2283	PTPRQ	SO:0001583	missense	0			-	HGNC	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.5790G>T	12.37:g.81028739G>T	ENSP00000266688:p.Gln1930His	Somatic	0	29	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.Q1930H	ENST00000266688.5	37	c.5790		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.77|11.77	1.736841|1.736841	0.30774|0.30774	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000266688|ENST00000532722;ENST00000547881	T|.	0.36340|.	1.26|.	5.39|5.39	3.55|3.55	0.40652|0.40652	.|.	.|.	.|.	.|.	.|.	T|T	0.59569|0.59569	0.2203|0.2203	.|.	.|.	.|.	0.35134|0.35134	D|D	0.768276|0.768276	D|.	0.71674|.	0.998|.	D|.	0.68192|.	0.956|.	T|T	0.63453|0.63453	-0.6634|-0.6634	8|4	0.46703|.	T|.	0.11|.	.|.	10.8974|10.8974	0.47031|0.47031	0.2711:0.0:0.7289:0.0|0.2711:0.0:0.7289:0.0	.|.	1976|.	Q9UMZ3|.	PTPRQ_HUMAN|.	H|I	1930|1631;29	ENSP00000266688:Q1930H|.	ENSP00000266688:Q1930H|.	Q|R	+|+	3|2	2|0	PTPRQ|PTPRQ	79552870|79552870	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.531000|0.531000	0.34715|0.34715	3.066000|3.066000	0.50002|0.50002	0.274000|0.274000	0.22072|0.22072	-0.797000|-0.797000	0.03246|0.03246	CAG|AGA	-	NULL		0.393	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	protein_coding		G	NM_001145026	-		81028739	+1	no_errors	ENST00000266688	ensembl	human	known	74_37	missense	SNP	1.000	T
TGM1	7051	genome.wustl.edu	37	14	24723980	24723980	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr14:24723980C>T	ENST00000206765.6	-	13	2101	c.1978G>A	c.(1978-1980)Gtg>Atg	p.V660M	TGM1_ENST00000544573.1_Missense_Mutation_p.V218M	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	660					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	CCCTGGTCCACAAGATGGGGC	0.627																																																	0								ENSG00000092295						74.0	69.0	71.0					14																	24723980		2203	4300	6503	TGM1	SO:0001583	missense	0			-	HGNC	D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.1978G>A	14.37:g.24723980C>T	ENSP00000206765:p.Val660Met	Somatic	0	44	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.64	B4DWR7|Q197M4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.V660M	ENST00000206765.6	37	c.1978	CCDS9622.1	14	.	.	.	.	.	.	.	.	.	.	C	27.4	4.829143	0.90955	.	.	ENSG00000092295	ENST00000206765;ENST00000544573	T;T	0.71461	-0.57;-0.57	5.31	5.31	0.75309	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.83653	0.5301	M	0.74647	2.275	0.53688	D	0.999976	D	0.89917	1.0	D	0.79784	0.993	D	0.85020	0.0911	10	0.72032	D	0.01	-16.2017	16.5174	0.84304	0.0:1.0:0.0:0.0	.	660	P22735	TGM1_HUMAN	M	660;218	ENSP00000206765:V660M;ENSP00000439446:V218M	ENSP00000206765:V660M	V	-	1	0	TGM1	23793820	0.994000	0.37717	0.976000	0.42696	0.954000	0.61252	3.160000	0.50739	2.754000	0.94517	0.655000	0.94253	GTG	-	pfam_Transglutaminase_C,superfamily_Transglutaminase_C		0.627	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM1	protein_coding	OTTHUMT00000073160.6	C	NM_000359	-		24723980	-1	no_errors	ENST00000206765	ensembl	human	known	74_37	missense	SNP	1.000	T
KDM2A	22992	genome.wustl.edu	37	11	67013488	67013488	+	Silent	SNP	C	C	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr11:67013488C>T	ENST00000529006.2	+	15	2312	c.1866C>T	c.(1864-1866)ctC>ctT	p.L622L	KDM2A_ENST00000308783.5_Silent_p.L80L|KDM2A_ENST00000530342.1_Silent_p.L183L|KDM2A_ENST00000398645.2_Silent_p.L622L|KDM2A_ENST00000526258.1_3'UTR	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	622					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						CATGTTCCCTCTGTGGAGAGG	0.443																																																	0								ENSG00000173120						117.0	115.0	115.0					11																	67013488		1952	4147	6099	KDM2A	SO:0001819	synonymous_variant	0			-	HGNC	BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.1866C>T	11.37:g.67013488C>T		Somatic	0	48	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	25	28.57	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_CXXC,pfam_F-box_dom,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.L622	ENST00000529006.2	37	c.1866	CCDS44657.1	11																																																																																			-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger		0.443	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	protein_coding	OTTHUMT00000393140.2	C	NM_012308	-		67013488	+1	no_errors	ENST00000529006	ensembl	human	known	74_37	silent	SNP	0.997	T
ANGEL1	23357	genome.wustl.edu	37	14	77275610	77275610	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr14:77275610C>T	ENST00000251089.2	-	2	553	c.441G>A	c.(439-441)tgG>tgA	p.W147*	ANGEL1_ENST00000554941.1_5'UTR	NM_015305.3	NP_056120.2	Q9UNK9	ANGE1_HUMAN	angel homolog 1 (Drosophila)	147										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	22			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)		GGATAGCTGCCCACATGGAGC	0.632																																																	0								ENSG00000013523						33.0	35.0	34.0					14																	77275610		2203	4300	6503	ANGEL1	SO:0001587	stop_gained	0			-	HGNC	AF111169	CCDS9852.1	14q24.3	2014-06-17		2005-08-04	ENSG00000013523	ENSG00000013523			19961	protein-coding gene	gene with protein product				KIAA0759		11943475	Standard	NM_015305		Approved	Ccr4e	uc001xsv.3	Q9UNK9	OTTHUMG00000171494	ENST00000251089.2:c.441G>A	14.37:g.77275610C>T	ENSP00000251089:p.Trp147*	Somatic	0	23	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53	B4DWL7|O94859|Q8NCS9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.W147*	ENST00000251089.2	37	c.441	CCDS9852.1	14	.	.	.	.	.	.	.	.	.	.	C	19.13	3.767922	0.69878	.	.	ENSG00000013523	ENST00000251089	.	.	.	5.6	5.6	0.85130	.	0.000000	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-1.8548	17.7836	0.88531	0.0:1.0:0.0:0.0	.	.	.	.	X	147	.	ENSP00000251089:W147X	W	-	3	0	ANGEL1	76345363	1.000000	0.71417	0.997000	0.53966	0.439000	0.31926	3.264000	0.51553	2.644000	0.89710	0.655000	0.94253	TGG	-	NULL		0.632	ANGEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL1	protein_coding	OTTHUMT00000413712.2	C	NM_015305	-		77275610	-1	no_errors	ENST00000251089	ensembl	human	known	74_37	nonsense	SNP	0.998	T
IGLV2-18	28814	genome.wustl.edu	37	22	23077063	23077063	+	RNA	SNP	C	C	A			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr22:23077063C>A	ENST00000390310.2	+	0	0				D87007.1_ENST00000579613.1_RNA					immunoglobulin lambda variable 2-18																		GGGTCAGGCCCAGTGCTGGGA	0.627																																																	0								ENSG00000264629																																			D87007.1			0			-	Clone_based_ensembl_gene	Z73642		22q11.2	2012-02-08			ENSG00000211664	ENSG00000211664		"""Immunoglobulins / IGL locus"""	5889	other	immunoglobulin gene							Standard	NG_000002		Approved				OTTHUMG00000151232		22.37:g.23077063C>A		Somatic	0	46	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000390310.2	37	NULL		22																																																																																			-	-		0.627	IGLV2-18-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000264629	IG_V_gene	OTTHUMT00000321836.1	C	NG_000002	-		23077063	+1	no_errors	ENST00000579613	ensembl	human	novel	74_37	rna	SNP	0.050	A
C22orf34	348645	genome.wustl.edu	37	22	50017914	50017914	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr22:50017914G>T	ENST00000444628.1	-	4	1618	c.547C>A	c.(547-549)Ctc>Atc	p.L183I	C22orf34_ENST00000405854.1_Intron|C22orf34_ENST00000400023.1_Intron			Q6ZV56	CV034_HUMAN	chromosome 22 open reading frame 34	0										pancreas(1)	1						TTGGGAGGGAGGGCACAGTGA	0.642																																																	0								ENSG00000188511																																			C22orf34	SO:0001583	missense	0			-	HGNC	BC048207		22q13.33	2013-01-15			ENSG00000188511	ENSG00000188511			28010	other	unknown						12477932	Standard	NR_026997		Approved		uc003bit.3	Q6ZV56	OTTHUMG00000030424	ENST00000444628.1:c.547C>A	22.37:g.50017914G>T	ENSP00000395549:p.Leu183Ile	Somatic	0	32	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	Q147Y0|Q5R3D1|Q6ZTN8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L183I	ENST00000444628.1	37	c.547		22	.	.	.	.	.	.	.	.	.	.	G	3.230	-0.157656	0.06544	.	.	ENSG00000188511	ENST00000444628	.	.	.	0.463	0.463	0.16700	.	.	.	.	.	T	0.22126	0.0533	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23119	-1.0197	4	.	.	.	.	2.9664	0.05909	0.3817:0.0:0.6183:0.0	.	.	.	.	I	183	.	.	L	-	1	0	C22orf34	48403918	0.005000	0.15991	0.038000	0.18304	0.171000	0.22731	-1.139000	0.03213	0.518000	0.28383	0.121000	0.15741	CTC	-	NULL		0.642	C22orf34-201	KNOWN	basic|appris_candidate_longest	protein_coding	C22orf34	protein_coding		G	NR_026997	-		50017914	-1	no_errors	ENST00000444628	ensembl	human	known	74_37	missense	SNP	0.078	T
DPY19L2P1	554236	genome.wustl.edu	37	7	35131338	35131338	+	RNA	SNP	C	C	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr7:35131338C>T	ENST00000436258.1	-	0	2031							Q6NXN4	D19P1_HUMAN	DPY19L2 pseudogene 1							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										ACTTCCAGTACGAAAATGAGG	0.388																																																	0								ENSG00000189212																																			DPY19L2P1			0			-	HGNC	BC066987		7p14.2	2014-03-18	2013-09-12		ENSG00000189212	ENSG00000189212			22305	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 1 (C. elegans)"""				Standard	NR_002833		Approved		uc031swy.1	Q6NXN4	OTTHUMG00000155026		7.37:g.35131338C>T		Somatic	0	21	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	18	25.00	B4E2E3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000436258.1	37	NULL		7																																																																																			-	-		0.388	DPY19L2P1-002	KNOWN	basic	processed_transcript	DPY19L2P1	pseudogene	OTTHUMT00000338113.1	C		-		35131338	-1	no_errors	ENST00000436258	ensembl	human	known	74_37	rna	SNP	0.000	T
SATB1	6304	genome.wustl.edu	37	3	18390964	18390964	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr3:18390964G>A	ENST00000338745.6	-	11	3724	c.1990C>T	c.(1990-1992)Caa>Taa	p.Q664*	SATB1_ENST00000417717.2_Nonsense_Mutation_p.Q696*|TBC1D5_ENST00000414318.2_Intron|SATB1_ENST00000454909.2_Nonsense_Mutation_p.Q664*	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	664					activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						CCCACGTCTTGTATGAAACTC	0.532																																																	0								ENSG00000182568						108.0	109.0	108.0					3																	18390964		2203	4300	6503	SATB1	SO:0001587	stop_gained	0			-	HGNC		CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.1990C>T	3.37:g.18390964G>A	ENSP00000341024:p.Gln664*	Somatic	0	82	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	57	17.39	B3KXF1|C9JTR6|Q59EQ0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.Q696*	ENST00000338745.6	37	c.2086	CCDS2631.1	3	.	.	.	.	.	.	.	.	.	.	G	38	6.662395	0.97743	.	.	ENSG00000182568	ENST00000338745;ENST00000454909;ENST00000417717	.	.	.	5.1	4.23	0.50019	.	0.168155	0.53938	D	0.000053	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-15.4861	13.4057	0.60911	0.0762:0.0:0.9238:0.0	.	.	.	.	X	664;664;696	.	ENSP00000341024:Q664X	Q	-	1	0	SATB1	18365968	1.000000	0.71417	0.906000	0.35671	0.901000	0.52897	7.713000	0.84693	1.140000	0.42260	0.563000	0.77884	CAA	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.532	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SATB1	protein_coding	OTTHUMT00000252138.4	G	NM_001131010	-		18390964	-1	no_errors	ENST00000417717	ensembl	human	known	74_37	nonsense	SNP	1.000	A
MAB21L3	126868	genome.wustl.edu	37	1	116675980	116675980	+	Silent	SNP	G	G	A	rs540660033		TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr1:116675980G>A	ENST00000369500.3	+	7	1348	c.1083G>A	c.(1081-1083)ccG>ccA	p.P361P		NM_152367.2	NP_689580.2	Q8N8X9	MB213_HUMAN	mab-21-like 3 (C. elegans)	361										breast(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|urinary_tract(1)	19						AGATCGGCCCGCCCTGATGGT	0.562													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16916	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000173212						39.0	40.0	40.0					1																	116675980		2203	4300	6503	MAB21L3	SO:0001819	synonymous_variant	0			-	HGNC	AK096035	CCDS886.1	1p13.1	2011-02-23	2011-02-23	2011-02-23	ENSG00000173212	ENSG00000173212			26787	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 161"""	C1orf161		14702039	Standard	NM_152367		Approved	FLJ38716	uc001egc.1	Q8N8X9	OTTHUMG00000012110	ENST00000369500.3:c.1083G>A	1.37:g.116675980G>A		Somatic	0	84	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	94	11.32	Q5TDL7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Mab-21_dom	p.P361	ENST00000369500.3	37	c.1083	CCDS886.1	1																																																																																			-	NULL		0.562	MAB21L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L3	protein_coding	OTTHUMT00000033486.1	G	NM_152367	-		116675980	+1	no_errors	ENST00000369500	ensembl	human	known	74_37	silent	SNP	0.628	A
BEND7	222389	genome.wustl.edu	37	10	13570579	13570584	+	5'Flank	DEL	GCGGCA	GCGGCA	-	rs184014070		TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	GCGGCA	GCGGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr10:13570579_13570584delGCGGCA	ENST00000396900.2	-	0	0				BEND7_ENST00000396898.2_5'Flank|RP11-214D15.2_ENST00000438431.1_RNA			Q8N7W2	BEND7_HUMAN	BEN domain containing 7							extracellular vesicular exosome (GO:0070062)				breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|stomach(1)	17						ggcggcagcggcggcagcggcagcgg	0.738																																																	0								ENSG00000227175																																			RP11-214D15.2	SO:0001631	upstream_gene_variant	0				Clone_based_vega_gene	BC031618	CCDS7099.1, CCDS41490.1	10p14	2012-11-22	2008-10-03	2008-10-03	ENSG00000165626	ENSG00000165626		"""BEN domain containing"""	23514	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 30"""	C10orf30			Standard	NM_152751		Approved	FLJ40283	uc001imm.2	Q8N7W2	OTTHUMG00000017699		10.37:g.13570585_13570590delGCGGCA	Exception_encountered	Somatic	NA	NA	NA		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5SYY7|Q5SYY8|Q5SYY9|Q8N5T7	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000396900.2	37	NULL		10																																																																																			-	-		0.738	BEND7-202	KNOWN	basic	protein_coding	ENSG00000227175	protein_coding		GCGGCA	NM_152751			13570584	+1	no_errors	ENST00000438431	ensembl	human	known	74_37	rna	DEL	0.013:0.012:0.010:0.008:0.006:0.003	-
PABPC4	8761	genome.wustl.edu	37	1	40030432	40030432	+	Missense_Mutation	SNP	G	G	A	rs567524034		TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr1:40030432G>A	ENST00000372857.3	-	9	2051	c.1259C>T	c.(1258-1260)cCt>cTt	p.P420L	PABPC4_ENST00000372856.3_Missense_Mutation_p.P420L|PABPC4_ENST00000372858.3_Missense_Mutation_p.P420L|RP11-69E11.8_ENST00000415255.1_RNA|SNORA55_ENST00000364587.1_RNA|PABPC4_ENST00000372862.3_Missense_Mutation_p.P420L	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	420					blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			ATAATATGGAGGCCTTCCCTG	0.498													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19751	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000090621						129.0	117.0	121.0					1																	40030432		2203	4300	6503	PABPC4	SO:0001583	missense	0			-	HGNC	U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.1259C>T	1.37:g.40030432G>A	ENSP00000361948:p.Pro420Leu	Somatic	0	42	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	33	19.51	B1ANQ8|Q4VC03|Q6P0N3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.P420L	ENST00000372857.3	37	c.1259	CCDS438.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.4|21.4	4.140404|4.140404	0.77775|0.77775	.|.	.|.	ENSG00000090621|ENSG00000090621	ENST00000421687;ENST00000527718|ENST00000372862;ENST00000372858;ENST00000372857;ENST00000372856	.|T;T;T;T	.|0.15952	.|2.44;2.42;2.47;2.38	5.94|5.94	5.94|5.94	0.96194|0.96194	.|.	.|0.052254	.|0.85682	.|D	.|0.000000	T|T	0.19886|0.19886	0.0478|0.0478	L|L	0.48642|0.48642	1.525|1.525	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.22541	.|0.071;0.0;0.002	.|B;B;B	.|0.23275	.|0.045;0.008;0.004	T|T	0.04678|0.04678	-1.0934|-1.0934	5|10	.|0.21014	.|T	.|0.42	.|.	20.3591|20.3591	0.98849|0.98849	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|420;420;420	.|Q13310;Q13310-2;Q4VC03	.|PABP4_HUMAN;.;.	F|L	322;147|420	.|ENSP00000361953:P420L;ENSP00000361949:P420L;ENSP00000361948:P420L;ENSP00000361947:P420L	.|ENSP00000361947:P420L	L|P	-|-	1|2	0|0	PABPC4|PABPC4	39803019|39803019	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	9.835000|9.835000	0.99442|0.99442	2.816000|2.816000	0.96949|0.96949	0.561000|0.561000	0.74099|0.74099	CTC|CCT	-	tigrfam_PABP_1234		0.498	PABPC4-001	KNOWN	basic|CCDS	protein_coding	PABPC4	protein_coding	OTTHUMT00000025220.1	G	NM_001135653	-		40030432	-1	no_errors	ENST00000372858	ensembl	human	known	74_37	missense	SNP	1.000	A
PSRC1	84722	genome.wustl.edu	37	1	109823657	109823657	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr1:109823657G>A	ENST00000438534.2	-	5	874	c.736C>T	c.(736-738)Ccc>Tcc	p.P246S	PSRC1_ENST00000369907.3_Missense_Mutation_p.P216S|PSRC1_ENST00000369903.2_Missense_Mutation_p.P216S|PSRC1_ENST00000409138.2_Missense_Mutation_p.P246S|PSRC1_ENST00000369909.2_Missense_Mutation_p.P216S|PSRC1_ENST00000409267.1_Missense_Mutation_p.P216S|PSRC1_ENST00000369904.3_Intron	NM_001005290.3	NP_001005290.1	Q6PGN9	PSRC1_HUMAN	proline/serine-rich coiled-coil 1	246	4 X 4 AA repeats of P-X-X-P.|Pro/Ser-rich.				microtubule bundle formation (GO:0001578)|mitotic metaphase plate congression (GO:0007080)|negative regulation of cell growth (GO:0030308)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mitotic spindle organization (GO:0060236)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)	microtubule binding (GO:0008017)			endometrium(1)|large_intestine(1)|lung(2)|prostate(2)|skin(1)	7		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0286)|Lung(183;0.0658)|COAD - Colon adenocarcinoma(174;0.112)|Epithelial(280;0.188)|all cancers(265;0.213)		GATCTGATGGGGGTGGGTGGG	0.607																																																	0								ENSG00000134222						35.0	42.0	40.0					1																	109823657		2203	4300	6503	PSRC1	SO:0001583	missense	0			-	HGNC		CCDS797.1, CCDS30791.1	1p13.3	2008-02-05			ENSG00000134222	ENSG00000134222			24472	protein-coding gene	gene with protein product	"""differential display and activated by p53"""	613126				12427559, 10618717	Standard	NM_001032291		Approved	DDA3	uc001dxd.3	Q6PGN9	OTTHUMG00000012000	ENST00000438534.2:c.736C>T	1.37:g.109823657G>A	ENSP00000413591:p.Pro246Ser	Somatic	0	54	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	54	27.03	Q5T2Z3|Q6ZTI8|Q71MG3|Q9BV77	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P246S	ENST00000438534.2	37	c.736		1	.	.	.	.	.	.	.	.	.	.	G	12.30	1.897578	0.33535	.	.	ENSG00000134222	ENST00000409267;ENST00000369907;ENST00000438534;ENST00000369909;ENST00000369903;ENST00000429031	T;T;T;T;T	0.49720	0.86;0.86;0.77;0.86;0.86	6.17	0.554	0.17241	.	0.411149	0.23876	N	0.043699	T	0.13030	0.0316	L	0.32530	0.975	0.09310	N	1	B;B;B	0.15141	0.006;0.001;0.012	B;B;B	0.15052	0.012;0.007;0.008	T	0.14868	-1.0457	10	0.62326	D	0.03	0.0495	2.2425	0.04023	0.1494:0.1284:0.4582:0.264	.	246;216;216	Q6PGN9;Q6PGN9-2;A8K0M8	PSRC1_HUMAN;.;.	S	216;216;246;216;216;216	ENSP00000386323:P216S;ENSP00000358923:P216S;ENSP00000413591:P246S;ENSP00000358925:P216S;ENSP00000358919:P216S	ENSP00000358919:P216S	P	-	1	0	PSRC1	109625180	0.010000	0.17322	0.001000	0.08648	0.006000	0.05464	0.083000	0.14871	0.481000	0.27557	0.655000	0.94253	CCC	-	NULL		0.607	PSRC1-202	KNOWN	basic	protein_coding	PSRC1	protein_coding	OTTHUMT00000335567.3	G	NM_032636	-		109823657	-1	no_errors	ENST00000409138	ensembl	human	known	74_37	missense	SNP	0.000	A
EIF4A2	1974	genome.wustl.edu	37	3	186504939	186504939	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr3:186504939T>G	ENST00000323963.5	+	8	859	c.795T>G	c.(793-795)tgT>tgG	p.C265W	SNORA63_ENST00000363548.1_RNA|RP11-573D15.9_ENST00000577781.1_RNA|EIF4A2_ENST00000356531.5_Missense_Mutation_p.C170W|SNORA4_ENST00000584302.1_RNA|SNORD2_ENST00000459163.1_RNA|EIF4A2_ENST00000440191.2_Missense_Mutation_p.C266W|SNORA81_ENST00000408493.2_RNA|SNORA63_ENST00000363450.1_RNA			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	265	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		ATACACTTTGTGACTTGTACG	0.408			T	BCL6	NHL																																			Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	0								ENSG00000156976						114.0	116.0	115.0					3																	186504939		2203	4300	6503	EIF4A2	SO:0001583	missense	0			-	HGNC	D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.795T>G	3.37:g.186504939T>G	ENSP00000326381:p.Cys265Trp	Somatic	0	95	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	65	15.58	D3DNU9|Q53XJ6|Q96B90|Q96EA8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.C266W	ENST00000323963.5	37	c.798	CCDS3282.1	3	.	.	.	.	.	.	.	.	.	.	T	17.94	3.512103	0.64522	.	.	ENSG00000156976	ENST00000323963;ENST00000440191;ENST00000356531	T;T;T	0.04654	3.58;3.58;3.58	5.12	5.12	0.69794	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.19685	0.0473	M	0.72894	2.215	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.85130	0.997;0.982;0.983;0.961	T	0.00120	-1.2030	10	0.87932	D	0	-22.7477	13.1874	0.59688	0.0:0.0:0.0:1.0	.	121;170;266;265	B4DJX6;Q9NZE6;Q14240-2;Q14240	.;.;.;IF4A2_HUMAN	W	265;266;170	ENSP00000326381:C265W;ENSP00000398370:C266W;ENSP00000348925:C170W	ENSP00000326381:C265W	C	+	3	2	EIF4A2	187987633	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.720000	0.54933	2.272000	0.75746	0.460000	0.39030	TGT	-	superfamily_P-loop_NTPase,pfscan_Helicase_C		0.408	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4A2	protein_coding	OTTHUMT00000344609.1	T	NM_001967	-		186504939	+1	no_errors	ENST00000440191	ensembl	human	known	74_37	missense	SNP	1.000	G
PAQR5	54852	genome.wustl.edu	37	15	69652383	69652383	+	5'UTR	SNP	C	C	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr15:69652383C>T	ENST00000340965.3	+	0	632				PAQR5_ENST00000561153.1_5'UTR|PAQR5_ENST00000395407.2_5'UTR|PAQR5_ENST00000561027.1_3'UTR	NM_001104554.1	NP_001098024.1	Q9NXK6	MPRG_HUMAN	progestin and adipoQ receptor family member V						multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)|steroid binding (GO:0005496)			endometrium(3)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|skin(1)	11						AACAGGGAGGCGCTGTCACCT	0.562																																																	0								ENSG00000137819						88.0	78.0	82.0					15																	69652383		2200	4298	6498	PAQR5	SO:0001623	5_prime_UTR_variant	0			-	HGNC		CCDS10232.1	15q22.31	2012-08-10			ENSG00000137819	ENSG00000137819			29645	protein-coding gene	gene with protein product	"""membrane progestin receptor gamma"""	607781				12574519	Standard	NM_001104554		Approved	FLJ20190, MPRG	uc002arz.2	Q9NXK6	OTTHUMG00000133322	ENST00000340965.3:c.-37C>T	15.37:g.69652383C>T		Somatic	0	46	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	27	20.59	Q8IXU2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000340965.3	37	NULL	CCDS10232.1	15																																																																																			-	-		0.562	PAQR5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PAQR5	protein_coding	OTTHUMT00000416671.1	C	NM_017705	-		69652383	+1	no_errors	ENST00000561027	ensembl	human	known	74_37	rna	SNP	0.000	T
ST6GALNAC5	81849	genome.wustl.edu	37	1	77528785	77528785	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr1:77528785G>A	ENST00000477717.1	+	5	1140	c.905G>A	c.(904-906)cGa>cAa	p.R302Q		NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	302					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						ACAGAGAAACGAGTCTTTAAG	0.413																																																	0								ENSG00000117069						141.0	131.0	134.0					1																	77528785		2203	4300	6503	ST6GALNAC5	SO:0001583	missense	0			-	HGNC		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.905G>A	1.37:g.77528785G>A	ENSP00000417583:p.Arg302Gln	Somatic	0	89	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	57	24.00	B1AK82	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.R302Q	ENST00000477717.1	37	c.905	CCDS673.1	1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.399730	0.83120	.	.	ENSG00000117069	ENST00000477717;ENST00000438953	T	0.31247	1.5	5.93	5.93	0.95920	.	0.174129	0.50627	D	0.000114	T	0.18923	0.0454	L	0.49350	1.555	0.48762	D	0.999704	P	0.39696	0.683	B	0.36885	0.235	T	0.03394	-1.1041	10	0.17369	T	0.5	-38.9358	20.3422	0.98769	0.0:0.0:1.0:0.0	.	302	Q9BVH7	SIA7E_HUMAN	Q	302;212	ENSP00000417583:R302Q	ENSP00000406658:R212Q	R	+	2	0	ST6GALNAC5	77301373	1.000000	0.71417	0.995000	0.50966	0.991000	0.79684	4.463000	0.60128	2.810000	0.96702	0.655000	0.94253	CGA	-	pirsf_Sialyl_trans		0.413	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALNAC5	protein_coding	OTTHUMT00000026692.2	G	NM_030965	-		77528785	+1	no_errors	ENST00000477717	ensembl	human	known	74_37	missense	SNP	0.983	A
TRO	7216	genome.wustl.edu	37	X	54956774	54956774	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chrX:54956774A>G	ENST00000173898.7	+	12	3729	c.3617A>G	c.(3616-3618)aAt>aGt	p.N1206S	TRO_ENST00000375022.4_Intron|TRO_ENST00000399736.1_Intron|SNORA11_ENST00000408823.1_RNA|TRO_ENST00000375041.2_Missense_Mutation_p.N809S|TRO_ENST00000420798.2_Missense_Mutation_p.N737S|TRO_ENST00000319167.8_Intron	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	1206	62 X 10 AA approximate tandem repeats.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						TTAAGCACCAATGCTGGATTT	0.542																																																	0								ENSG00000067445						60.0	58.0	59.0					X																	54956774		2050	4176	6226	TRO	SO:0001583	missense	0			-	HGNC	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.3617A>G	X.37:g.54956774A>G	ENSP00000173898:p.Asn1206Ser	Somatic	0	24	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	24	31.43	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfscan_MAGE	p.N1206S	ENST00000173898.7	37	c.3617	CCDS43959.1	X	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.661597	0.00772	.	.	ENSG00000067445	ENST00000173898;ENST00000420798;ENST00000375041	T;T;T	0.07114	3.22;3.22;3.22	2.85	1.98	0.26296	.	.	.	.	.	T	0.02455	0.0075	N	0.01705	-0.755	0.09310	N	1	B;B	0.19817	0.039;0.039	B;B	0.25884	0.044;0.064	T	0.46541	-0.9184	9	0.02654	T	1	.	4.6909	0.12780	0.3235:0.0:0.6765:0.0	.	809;1206	B1AKE9;Q12816	.;TROP_HUMAN	S	1206;737;809	ENSP00000173898:N1206S;ENSP00000405126:N737S;ENSP00000364181:N809S	ENSP00000173898:N1206S	N	+	2	0	TRO	54973499	0.002000	0.14202	0.001000	0.08648	0.018000	0.09664	-0.236000	0.09003	0.153000	0.19213	-0.228000	0.12330	AAT	-	NULL		0.542	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRO	protein_coding	OTTHUMT00000056837.3	A	NM_016157	-		54956774	+1	no_errors	ENST00000173898	ensembl	human	known	74_37	missense	SNP	0.015	G
PILRB	29990	genome.wustl.edu	37	7	99943558	99943558	+	5'UTR	SNP	T	T	C	rs2405445	byFrequency	TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr7:99943558T>C	ENST00000610247.1	+	0	498				STAG3L5P_ENST00000493499.1_RNA|STAG3L5P-PVRIG2P-PILRB_ENST00000310771.4_RNA			Q9UKJ0	PILRB_HUMAN	paired immunoglobin-like type 2 receptor beta						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGGGATTTTTTTTTTTCAGAT	0.423																																																	0								ENSG00000272752																																			STAG3L5P-PVRIG2P-PILRB	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF161081, AJ400845	CCDS43622.1	7q22.1	2014-05-16			ENSG00000121716	ENSG00000121716		"""Immunoglobulin superfamily / V-set domain containing"""	18297	protein-coding gene	gene with protein product		605342				10660620	Standard	NM_178238		Approved	FDFACT1, FDFACT2	uc022ail.1	Q9UKJ0	OTTHUMG00000155363	ENST00000610247.1:c.-1999T>C	7.37:g.99943558T>C		Somatic	0	21	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	19	24.00	Q69YF9|Q9HBS0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000610247.1	37	NULL	CCDS43622.1	7																																																																																			-	-		0.423	PILRB-202	KNOWN	basic|appris_principal|CCDS	protein_coding	STAG3L5P-PVRIG2P-PILRB	protein_coding		T	NM_178238	rs2405445		99943558	+1	no_errors	ENST00000310771	ensembl	human	known	74_37	rna	SNP	0.001	C
LINC01257	116437	genome.wustl.edu	37	12	131649621	131649621	+	lincRNA	SNP	G	G	A	rs199500836	byFrequency	TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr12:131649621G>A	ENST00000376678.2	+	0	66					NR_026670.2																						CTGGGAATGAGCAATGCAACC	0.552																																																	0								ENSG00000204603																																			RP11-638F5.1			0			-	Clone_based_vega_gene																													12.37:g.131649621G>A		Somatic	0	25	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376678.2	37	NULL		12																																																																																			-	-		0.552	RP11-638F5.1-001	KNOWN	basic	lincRNA	LOC101929974	lincRNA	OTTHUMT00000399382.1	G		rs199500836		131649621	+1	no_errors	ENST00000376678	ensembl	human	known	74_37	rna	SNP	0.005	A
GPKOW	27238	genome.wustl.edu	37	X	48973411	48973429	+	Frame_Shift_Del	DEL	CCTGCTGGGAGACAGGCCG	CCTGCTGGGAGACAGGCCG	-	rs368470725		TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	CCTGCTGGGAGACAGGCCG	CCTGCTGGGAGACAGGCCG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chrX:48973411_48973429delCCTGCTGGGAGACAGGCCG	ENST00000156109.5	-	6	946_964	c.868_886delCGGCCTGTCTCCCAGCAGG	c.(868-888)cggcctgtctcccagcaggagfs	p.RPVSQQE290fs		NM_015698.4	NP_056513.2	Q92917	GPKOW_HUMAN	G patch domain and KOW motifs	290						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)	21						TTGTCAAACTCCTGCTGGGAGACAGGCCGCAGGTAGTAC	0.566																																																	0								ENSG00000068394																																			GPKOW	SO:0001589	frameshift_variant	0				HGNC	U66359	CCDS35251.1	Xp11.23	2013-01-28			ENSG00000068394	ENSG00000068394		"""G patch domain containing"""	30677	protein-coding gene	gene with protein product	"""G patch domain containing 5"""					21880142, 22365833	Standard	NM_015698		Approved	T54, GPATC5, GPATCH5, Spp2	uc004dmr.3	Q92917	OTTHUMG00000021511	ENST00000156109.5:c.868_886delCGGCCTGTCTCCCAGCAGG	X.37:g.48973411_48973429delCCTGCTGGGAGACAGGCCG	ENSP00000156109:p.Arg290fs	Somatic	NA	NA	NA		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q59EK5|Q9BQA8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_KOW,pfam_G_patch_dom,superfamily_Translation_prot_SH3-like,smart_G_patch_dom,smart_KOW,pfscan_G_patch_dom	p.R290fs	ENST00000156109.5	37	c.886_868	CCDS35251.1	X																																																																																			-	NULL		0.566	GPKOW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPKOW	protein_coding	OTTHUMT00000056535.2	CCTGCTGGGAGACAGGCCG	NM_015698			48973429	-1	no_errors	ENST00000156109	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:0.998:0.990:0.536:0.595:0.805:0.856:0.830:0.816:0.730:0.514:0.607:0.575:0.077:0.077:0.054:0.028:0.016:0.001	-
POFUT2	23275	genome.wustl.edu	37	21	46703407	46703407	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr21:46703407G>T	ENST00000349485.5	-	3	444	c.418C>A	c.(418-420)Ctg>Atg	p.L140M	POFUT2_ENST00000331343.7_Missense_Mutation_p.L140M|POFUT2_ENST00000471540.1_5'UTR	NM_133635.4	NP_598368.2	Q9Y2G5	OFUT2_HUMAN	protein O-fucosyltransferase 2	140					fucose metabolic process (GO:0006004)|mesoderm formation (GO:0001707)|protein O-linked fucosylation (GO:0036066)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of gene expression (GO:0010468)|regulation of secretion (GO:0051046)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	peptide-O-fucosyltransferase activity (GO:0046922)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	20				Colorectal(79;0.243)		TAACTTTGCAGGACGTAAACC	0.532																																																	0								ENSG00000186866						248.0	220.0	229.0					21																	46703407		2203	4300	6503	POFUT2	SO:0001583	missense	0			-	HGNC	AJ203079	CCDS13719.1, CCDS13721.1	21q22.3	2013-03-06	2004-06-07	2004-06-09	ENSG00000186866	ENSG00000186866	2.4.1.221	"""Fucosyltransferases"""	14683	protein-coding gene	gene with protein product	"""peptide-O-fucosyltransferase"", ""GDP-fucose protein O-fucosyltransferase 2"""	610249	"""chromosome 21 open reading frame 80"""	C21orf80			Standard	NM_133635		Approved	KIAA0958, FUT13	uc002zhc.3	Q9Y2G5	OTTHUMG00000084874	ENST00000349485.5:c.418C>A	21.37:g.46703407G>T	ENSP00000339613:p.Leu140Met	Somatic	0	55	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	Q6PJV1|Q7Z4N0|Q8WWU6|Q9BQS4|Q9BQS5|Q9UFY3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GDP-Fuc_O-FucTrfase,superfamily_DUF749	p.L140M	ENST00000349485.5	37	c.418	CCDS13719.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.15|14.15	2.450447|2.450447	0.43531|0.43531	.|.	.|.	ENSG00000186866|ENSG00000186866	ENST00000331343;ENST00000349485|ENST00000451615	T;T|.	0.34275|.	1.37;1.37|.	4.52|4.52	3.63|3.63	0.41609|0.41609	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76205|0.76205	0.3955|0.3955	M|M	0.87971|0.87971	2.92|2.92	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	T|T	0.78099|0.78099	-0.2336|-0.2336	10|5	0.62326|.	D|.	0.03|.	-21.8352|-21.8352	10.6054|10.6054	0.45392|0.45392	0.0965:0.0:0.9035:0.0|0.0965:0.0:0.9035:0.0	.|.	140;140|.	Q9Y2G5-1;Q9Y2G5|.	.;OFUT2_HUMAN|.	M|H	140|17	ENSP00000329682:L140M;ENSP00000339613:L140M|.	ENSP00000329682:L140M|.	L|P	-|-	1|2	2|0	POFUT2|POFUT2	45527835|45527835	1.000000|1.000000	0.71417|0.71417	0.954000|0.954000	0.39281|0.39281	0.029000|0.029000	0.11900|0.11900	7.299000|7.299000	0.78831|0.78831	1.034000|1.034000	0.39945|0.39945	-0.142000|-0.142000	0.14014|0.14014	CTG|CCT	-	pfam_GDP-Fuc_O-FucTrfase		0.532	POFUT2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	POFUT2	protein_coding	OTTHUMT00000192573.2	G	NM_015227	-		46703407	-1	no_errors	ENST00000349485	ensembl	human	known	74_37	missense	SNP	1.000	T
PAN2	9924	genome.wustl.edu	37	12	56722345	56722345	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr12:56722345C>A	ENST00000425394.2	-	3	739	c.363G>T	c.(361-363)caG>caT	p.Q121H	PAN2_ENST00000440411.3_Missense_Mutation_p.Q121H|PAN2_ENST00000548043.1_Missense_Mutation_p.Q121H|PAN2_ENST00000257931.5_Missense_Mutation_p.Q121H	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	GGCTCTGGATCTGCCGAATAT	0.468																																																	0								ENSG00000135473						75.0	74.0	74.0					12																	56722345		2203	4300	6503	PAN2	SO:0001583	missense	0			-	HGNC	AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.363G>T	12.37:g.56722345C>A	ENSP00000401721:p.Gln121His	Somatic	0	44	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Exonuclease_RNaseT/DNA_pol3,pfam_Peptidase_C19/C67,superfamily_RNaseH-like_dom,superfamily_WD40_repeat_dom,smart_Exonuclease,pfscan_Peptidase_C19/C67	p.Q121H	ENST00000425394.2	37	c.363	CCDS44922.1	12	.	.	.	.	.	.	.	.	.	.	C	12.90	2.075477	0.36662	.	.	ENSG00000135473	ENST00000425394;ENST00000440411;ENST00000257931;ENST00000548043	T;T;T;T	0.61859	0.07;0.07;0.07;0.07	5.07	1.13	0.20643	WD40 repeat-like-containing domain (1);	0.113886	0.64402	N	0.000009	T	0.36552	0.0971	N	0.19112	0.55	0.34792	D	0.735888	B;B;B	0.21821	0.061;0.061;0.036	B;B;B	0.23716	0.032;0.048;0.014	T	0.22382	-1.0218	10	0.37606	T	0.19	-7.8219	6.3169	0.21196	0.0:0.6378:0.1336:0.2286	.	121;121;121	Q504Q3-3;Q504Q3-2;Q504Q3	.;.;PAN2_HUMAN	H	121	ENSP00000401721:Q121H;ENSP00000388231:Q121H;ENSP00000257931:Q121H;ENSP00000449861:Q121H	ENSP00000257931:Q121H	Q	-	3	2	PAN2	55008612	0.999000	0.42202	0.998000	0.56505	0.989000	0.77384	0.558000	0.23469	0.106000	0.17784	0.650000	0.86243	CAG	-	superfamily_WD40_repeat_dom		0.468	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAN2	protein_coding	OTTHUMT00000409024.1	C	NM_014871	-		56722345	-1	no_errors	ENST00000425394	ensembl	human	known	74_37	missense	SNP	1.000	A
APOA5	116519	genome.wustl.edu	37	11	116661095	116661095	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr11:116661095G>A	ENST00000227665.4	-	3	884	c.850C>T	c.(850-852)Cga>Tga	p.R284*	ZNF259_ENST00000227322.3_5'Flank|APOA5_ENST00000542499.1_Nonsense_Mutation_p.R284*			Q6Q788	APOA5_HUMAN	apolipoprotein A-V	284					acylglycerol homeostasis (GO:0055090)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|organ regeneration (GO:0031100)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)	chylomicron (GO:0042627)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|lipase activator activity (GO:0060229)|lipase binding (GO:0035473)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|lipoprotein particle receptor binding (GO:0070325)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylcholine binding (GO:0031210)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|urinary_tract(1)	14	all_hematologic(175;0.0487)	all_cancers(61;3.31e-09)|all_epithelial(67;8.03e-06)|Breast(348;0.0126)|Melanoma(852;0.0153)|Acute lymphoblastic leukemia(157;0.0257)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0433)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;4.93e-06)|all cancers(92;0.000123)|OV - Ovarian serous cystadenocarcinoma(223;0.149)		GCCTGAAGTCGCTGGCGCACC	0.662																																																	0								ENSG00000110243						66.0	72.0	70.0					11																	116661095		2201	4296	6497	APOA5	SO:0001587	stop_gained	0			-	HGNC	AF202889	CCDS8376.2	11q23	2013-01-24			ENSG00000110243	ENSG00000110243		"""Apolipoproteins"""	17288	protein-coding gene	gene with protein product		606368				11588264, 11577099	Standard	NM_001166598		Approved	RAP3, APOA-V	uc009yzf.3	Q6Q788	OTTHUMG00000046116	ENST00000227665.4:c.850C>T	11.37:g.116661095G>A	ENSP00000227665:p.Arg284*	Somatic	0	40	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	36	25.00	B0YIV9|Q3MIK6|Q6UWK9|Q9UBJ3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ApoA1_A4_E	p.R284*	ENST00000227665.4	37	c.850	CCDS8376.2	11	.	.	.	.	.	.	.	.	.	.	G	16.13	3.036702	0.54896	.	.	ENSG00000110243	ENST00000227665;ENST00000542499	.	.	.	4.75	-2.01	0.07410	.	0.000000	0.40908	D	0.000997	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.8156	15.491	0.75605	0.0:0.0:0.2763:0.7237	.	.	.	.	X	284	.	ENSP00000227665:R284X	R	-	1	2	APOA5	116166305	0.331000	0.24713	0.995000	0.50966	0.418000	0.31294	0.455000	0.21843	-0.187000	0.10516	-1.194000	0.01681	CGA	-	pfam_ApoA1_A4_E		0.662	APOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOA5	protein_coding	OTTHUMT00000106285.2	G		-		116661095	-1	no_errors	ENST00000227665	ensembl	human	known	74_37	nonsense	SNP	0.960	A
TUBA4A	7277	genome.wustl.edu	37	2	220118077	220118077	+	Intron	DEL	G	G	-	rs60456844		TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr2:220118077delG	ENST00000248437.4	-	1	177				TUBA4A_ENST00000498660.1_Intron|TUBA4B_ENST00000490341.1_RNA|TUBA4A_ENST00000392088.2_Intron	NM_006000.2	NP_005991.1	P68366	TBA4A_HUMAN	tubulin, alpha 4a						'de novo' posttranslational protein folding (GO:0051084)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Cabazitaxel(DB06772)|Podofilox(DB01179)|Vincristine(DB00541)	GCTGAGTCACGGGGGGGGGGT	0.647																																																	0								ENSG00000243910																																			TUBA4B	SO:0001627	intron_variant	0				HGNC	AK054731	CCDS2438.1, CCDS63131.1	2q36.1	2012-10-02	2007-02-12	2007-02-12	ENSG00000127824	ENSG00000127824		"""Tubulins"""	12407	protein-coding gene	gene with protein product		191110	"""tubulin, alpha 1 (testis specific)"", ""tubulin, alpha 1"""	TUBA1		3785200	Standard	NM_006000		Approved	FLJ30169, H2-ALPHA	uc002vkt.1	P68366	OTTHUMG00000133126	ENST00000248437.4:c.3+500C>-	2.37:g.220118077delG		Somatic	0	14	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53	A8MUB1|B3KNQ6|P05215	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000248437.4	37	NULL	CCDS2438.1	2																																																																																			-	-		0.647	TUBA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA4B	protein_coding	OTTHUMT00000256816.3	G	NM_006000			220118077	+1	no_errors	ENST00000473885	ensembl	human	known	74_37	rna	DEL	0.000	-
BMP10	27302	genome.wustl.edu	37	2	69093564	69093564	+	Silent	SNP	G	G	A	rs375928014		TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr2:69093564G>A	ENST00000295379.1	-	2	632	c.474C>T	c.(472-474)taC>taT	p.Y158Y		NM_014482.1	NP_055297.1	O95393	BMP10_HUMAN	bone morphogenetic protein 10	158					activin receptor signaling pathway (GO:0032924)|adult heart development (GO:0007512)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heart trabecula formation (GO:0060347)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell migration (GO:0010596)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction (GO:0055117)|sarcomere organization (GO:0045214)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Z disc (GO:0030018)	hormone activity (GO:0005179)|receptor serine/threonine kinase binding (GO:0033612)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(15)|ovary(2)	27						CTACTCCATCGTATATCATAC	0.453																																																	0								ENSG00000163217	G		0,4406		0,0,2203	79.0	67.0	71.0		474	-0.9	1.0	2		71	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	BMP10	NM_014482.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		158/425	69093564	1,13005	2203	4300	6503	BMP10	SO:0001819	synonymous_variant	0			-	HGNC	AF101441	CCDS1890.1	2p13.2	2014-09-17			ENSG00000163217	ENSG00000163217		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	20869	protein-coding gene	gene with protein product		608748				10072785	Standard	NM_014482		Approved		uc002sez.1	O95393	OTTHUMG00000129573	ENST00000295379.1:c.474C>T	2.37:g.69093564G>A		Somatic	0	52	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	29	9.38	Q53R17|Q6NTE0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_asu	p.Y158	ENST00000295379.1	37	c.474	CCDS1890.1	2																																																																																			-	pfam_TGF-b_N		0.453	BMP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP10	protein_coding	OTTHUMT00000251768.1	G	NM_014482	-		69093564	-1	no_errors	ENST00000295379	ensembl	human	known	74_37	silent	SNP	0.820	A
LINC01257	116437	genome.wustl.edu	37	12	131649643	131649643	+	lincRNA	SNP	G	G	A	rs199649948	byFrequency	TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr12:131649643G>A	ENST00000376678.2	+	0	88					NR_026670.2																						AATGACACCCGGAGCTCCTGA	0.557																																																	0								ENSG00000204603																																			RP11-638F5.1			0			-	Clone_based_vega_gene																													12.37:g.131649643G>A		Somatic	0	32	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376678.2	37	NULL		12																																																																																			-	-		0.557	RP11-638F5.1-001	KNOWN	basic	lincRNA	LOC101929974	lincRNA	OTTHUMT00000399382.1	G		rs199649948		131649643	+1	no_errors	ENST00000376678	ensembl	human	known	74_37	rna	SNP	0.000	A
LINC00200	399706	genome.wustl.edu	37	10	1205736	1205736	+	lincRNA	SNP	A	A	G	rs60415666		TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr10:1205736A>G	ENST00000425630.1	+	0	29					NR_015376.2				long intergenic non-protein coding RNA 200																		ATGAGGGATGACGCAGGCACA	0.667																																																	0								ENSG00000229205						15.0	18.0	17.0					10																	1205736		687	1591	2278	LINC00200			0			-	HGNC	AK097673		10p15.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000229205	ENSG00000229205		"""Long non-coding RNAs"""	30974	non-coding RNA	RNA, long non-coding			"""chromosome 10 open reading frame 139"", ""non-protein coding RNA 200"""	C10orf139, NCRNA00200			Standard	NR_015376		Approved	FLJ40354	uc010qag.1		OTTHUMG00000017539		10.37:g.1205736A>G		Somatic	0	22	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	22	18.52		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000425630.1	37	NULL		10																																																																																			-	-		0.667	LINC00200-001	KNOWN	basic	lincRNA	LINC00200	lincRNA	OTTHUMT00000046417.2	A	NR_015376	rs60415666		1205736	+1	no_errors	ENST00000425630	ensembl	human	known	74_37	rna	SNP	0.155	G
CEP250	11190	genome.wustl.edu	37	20	34055380	34055380	+	Splice_Site	SNP	G	G	A	rs139021763		TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr20:34055380G>A	ENST00000397527.1	+	9	1571	c.851G>A	c.(850-852)cGg>cAg	p.R284Q	CEP250_ENST00000397524.1_Splice_Site_p.R284Q|CEP250_ENST00000342580.4_Splice_Site_p.R284Q	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	284					centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			CTTCAGGACCGGTGAGATGGC	0.572																																																	0								ENSG00000126001	G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	60.0	52.0	55.0		851	5.1	1.0	20	dbSNP_134	55	0,8600		0,0,4300	no	missense-near-splice	CEP250	NM_007186.3	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	284/2443	34055380	1,13005	2203	4300	6503	CEP250	SO:0001630	splice_region_variant	0			-	HGNC	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.851+1G>A	20.37:g.34055380G>A		Somatic	0	21	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin	p.R284Q	ENST00000397527.1	37	c.851	CCDS13255.1	20	.	.	.	.	.	.	.	.	.	.	G	17.47	3.397522	0.62177	2.27E-4	0.0	ENSG00000126001	ENST00000397527;ENST00000342580;ENST00000397524;ENST00000425934	T;T;T;T	0.64438	2.17;2.17;-0.1;1.28	6.08	5.14	0.70334	.	0.602442	0.14926	N	0.290385	T	0.52322	0.1727	L	0.51914	1.62	0.43740	D	0.996238	B;P	0.43287	0.135;0.802	B;B	0.32533	0.016;0.147	T	0.53208	-0.8471	10	0.39692	T	0.17	.	12.5871	0.56424	0.0771:0.0:0.9229:0.0	.	284;284	A6PVI9;Q9BV73	.;CP250_HUMAN	Q	284	ENSP00000380661:R284Q;ENSP00000341541:R284Q;ENSP00000380658:R284Q;ENSP00000413827:R284Q	ENSP00000341541:R284Q	R	+	2	0	CEP250	33518794	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	3.910000	0.56371	1.582000	0.49881	0.655000	0.94253	CGG	-	NULL		0.572	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP250	protein_coding	OTTHUMT00000078877.7	G	NM_007186	rs139021763	Missense_Mutation	34055380	+1	no_errors	ENST00000397527	ensembl	human	known	74_37	missense	SNP	1.000	A
CXADRP3	440224	genome.wustl.edu	37	18	14478199	14478199	+	lincRNA	SNP	G	G	A			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr18:14478199G>A	ENST00000581457.1	-	0	1709					NR_024076.1				coxsackie virus and adenovirus receptor pseudogene 3																		CTCTGTGCGGGAATCATCACA	0.468																																																	0								ENSG00000265766																																			CXADRP3			0			-	HGNC			18p11.21	2013-09-19			ENSG00000265766	ENSG00000265766			33974	pseudogene	pseudogene							Standard	NR_024076		Approved		uc010xai.2		OTTHUMG00000178700		18.37:g.14478199G>A		Somatic	0	62	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	44	20.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000581457.1	37	NULL		18																																																																																			-	-		0.468	CXADRP3-001	KNOWN	basic	lincRNA	CXADRP3	lincRNA	OTTHUMT00000443008.1	G	NR_024076	-		14478199	-1	no_errors	ENST00000581457	ensembl	human	known	74_37	rna	SNP	1.000	A
GNAS	2778	genome.wustl.edu	37	20	57430245	57430245	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr20:57430245C>T	ENST00000371100.4	+	1	2477	c.1925C>T	c.(1924-1926)gCg>gTg	p.A642V	GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371099.2_Missense_Mutation_p.A642V|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000371102.4_Missense_Mutation_p.A642V|GNAS_ENST00000371098.2_Intron|GNAS_ENST00000306120.3_Missense_Mutation_p.R579W	NM_001077490.1|NM_080425.2	NP_001070958.1|NP_536350.2	P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GTACCCCTGGCGGAGAAGCGC	0.592			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0								ENSG00000087460						24.0	28.0	27.0					20																	57430245		2027	4202	6229	GNAS	SO:0001583	missense	0			-	HGNC	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371100.4:c.1925C>T	20.37:g.57430245C>T	ENSP00000360141:p.Ala642Val	Somatic	0	45	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	53	8.62	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_S,prints_Gprotein_alpha_su	p.A642V	ENST00000371100.4	37	c.1925	CCDS46622.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.632|3.632	-0.075297|-0.075297	0.07184|0.07184	.|.	.|.	ENSG00000087460|ENSG00000087460	ENST00000371099;ENST00000371100;ENST00000371102;ENST00000349036|ENST00000306120;ENST00000423897	D;D;D|.	0.89810|.	-2.41;-2.41;-2.57|.	3.84|3.84	-3.82|-3.82	0.04281|0.04281	.|.	11.375600|.	0.00166|.	N|.	0.000002|.	T|T	0.16981|0.16981	0.0408|0.0408	N|N	0.08118|0.08118	0|0	0.24069|0.24069	N|N	0.995984|0.995984	B|.	0.28178|.	0.202|.	B|.	0.17433|.	0.018|.	T|T	0.28332|0.28332	-1.0047|-1.0047	10|6	0.44086|0.87932	T|D	0.13|0	.|.	4.5295|4.5295	0.11997|0.11997	0.5251:0.2857:0.0:0.1892|0.5251:0.2857:0.0:0.1892	.|.	642|.	Q5JWF2|.	GNAS1_HUMAN|.	V|W	642;642;642;15|579;5	ENSP00000360141:A642V;ENSP00000360143:A642V;ENSP00000265621:A15V|.	ENSP00000265621:A15V|ENSP00000302237:R579W	A|R	+|+	2|1	0|2	GNAS|GNAS	56863640|56863640	0.002000|0.002000	0.14202|0.14202	0.204000|0.204000	0.23530|0.23530	0.101000|0.101000	0.19017|0.19017	-0.367000|-0.367000	0.07553|0.07553	-0.810000|-0.810000	0.04375|0.04375	-0.362000|-0.362000	0.07510|0.07510	GCG|CGG	-	NULL		0.592	GNAS-001	PUTATIVE	basic|CCDS	protein_coding	GNAS	protein_coding	OTTHUMT00000080417.3	C	NM_000516	-		57430245	+1	no_errors	ENST00000371100	ensembl	human	putative	74_37	missense	SNP	0.333	T
VIT	5212	genome.wustl.edu	37	2	36986282	36986282	+	Intron	SNP	G	G	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr2:36986282G>T	ENST00000389975.3	+	6	789				VIT_ENST00000379242.3_Intron|VIT_ENST00000497382.1_Intron|VIT_ENST00000404084.1_Intron|VIT_ENST00000457137.2_Missense_Mutation_p.G194C|VIT_ENST00000401530.1_Intron|VIT_ENST00000379241.3_Intron	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin						extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)			autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				CATCTTAACCGGTCAAGCTCC	0.463																																																	0								ENSG00000205221																																			VIT	SO:0001627	intron_variant	0			-	HGNC	AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.487+93G>T	2.37:g.36986282G>T		Somatic	0	43	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	23	25.81	A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LCCL,superfamily_LCCL,smart_LCCL,pfscan_LCCL	p.G194C	ENST00000389975.3	37	c.580	CCDS54347.1	2	.	.	.	.	.	.	.	.	.	.	G	2.597	-0.293759	0.05568	.	.	ENSG00000205221	ENST00000457137	D	0.92199	-2.99	4.45	-4.09	0.03951	.	.	.	.	.	D	0.89887	0.6845	.	.	.	0.09310	N	1	P	0.48407	0.91	P	0.48454	0.578	T	0.83355	-0.0001	7	.	.	.	.	11.6163	0.51092	0.7431:0.0:0.2569:0.0	.	194	Q6UXI7-3	.	C	194	ENSP00000393561:G194C	.	G	+	1	0	VIT	36839786	0.000000	0.05858	0.000000	0.03702	0.320000	0.28249	-2.145000	0.01295	-0.730000	0.04869	-0.226000	0.12346	GGT	-	NULL		0.463	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	VIT	protein_coding		G		-		36986282	+1	no_errors	ENST00000457137	ensembl	human	known	74_37	missense	SNP	0.000	T
CEP164	22897	genome.wustl.edu	37	11	117222648	117222648	+	Frame_Shift_Del	DEL	A	A	-	rs75301270		TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr11:117222648delA	ENST00000278935.3	+	5	484	c.337delA	c.(337-339)aaafs	p.K116fs		NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	116	Interaction with ATRIP.|Lys-rich.				cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		Taagaagaagaaaaaaaaaaa	0.507																																																	0								ENSG00000110274						35.0	36.0	36.0					11																	117222648		2201	4296	6497	CEP164	SO:0001589	frameshift_variant	0				HGNC	AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.337delA	11.37:g.117222648delA	ENSP00000278935:p.Lys116fs	Somatic	0	55	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	44	15.38	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.K116fs	ENST00000278935.3	37	c.337	CCDS31683.1	11																																																																																			-	NULL		0.507	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP164	protein_coding	OTTHUMT00000392893.1	A	NM_014956			117222648	+1	no_errors	ENST00000278935	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
CCAR1	55749	genome.wustl.edu	37	10	70531091	70531091	+	Silent	SNP	T	T	C			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr10:70531091T>C	ENST00000265872.6	+	18	2546	c.2427T>C	c.(2425-2427)gaT>gaC	p.D809D	CCAR1_ENST00000535016.1_Silent_p.D794D|CCAR1_ENST00000543719.1_Silent_p.D794D	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	809	Glu-rich.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						gcaaaaaagatgagagaaaag	0.318																																																	0								ENSG00000060339						52.0	53.0	53.0					10																	70531091		2202	4298	6500	CCAR1	SO:0001819	synonymous_variant	0			-	HGNC	AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.2427T>C	10.37:g.70531091T>C		Somatic	0	77	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	64	18.75	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SAP_dom,superfamily_NA-bd_OB-fold,smart_SAP_dom,pfscan_SAP_dom	p.D809	ENST00000265872.6	37	c.2427	CCDS7282.1	10																																																																																			-	NULL		0.318	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCAR1	protein_coding	OTTHUMT00000048356.2	T	NM_018237	-		70531091	+1	no_errors	ENST00000265872	ensembl	human	known	74_37	silent	SNP	0.932	C
GLIPR1L1	256710	genome.wustl.edu	37	12	75737700	75737700	+	Silent	SNP	C	C	G			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr12:75737700C>G	ENST00000378695.4	+	2	492	c.402C>G	c.(400-402)gtC>gtG	p.V134V	GLIPR1L1_ENST00000312442.2_Silent_p.V134V|CAPS2_ENST00000442339.2_Intron			Q6UWM5	GPRL1_HUMAN	GLI pathogenesis-related 1 like 1	134	SCP.				binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)|sperm connecting piece (GO:0097224)				endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	10						GCTCCAGAGTCTGTGGCCATT	0.333																																																	0								ENSG00000173401						83.0	82.0	82.0					12																	75737700		2203	4300	6503	GLIPR1L1	SO:0001819	synonymous_variant	0			-	HGNC	BC014603	CCDS9009.1	12q21.1	2014-06-03				ENSG00000173401			28392	protein-coding gene	gene with protein product		610395				12477932	Standard	NM_152779		Approved	MGC26856	uc001sxn.3	Q6UWM5	OTTHUMG00000169755	ENST00000378695.4:c.402C>G	12.37:g.75737700C>G		Somatic	0	91	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	166	92	64.34	Q96L06	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1,prints_V5_allergen	p.V134	ENST00000378695.4	37	c.402		12																																																																																			-	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_V5_allergen		0.333	GLIPR1L1-002	KNOWN	basic|appris_candidate_longest	protein_coding	GLIPR1L1	protein_coding	OTTHUMT00000405714.1	C	NM_152779	-		75737700	+1	no_errors	ENST00000378695	ensembl	human	known	74_37	silent	SNP	0.031	G
LINC01257	116437	genome.wustl.edu	37	12	131649622	131649622	+	lincRNA	SNP	C	C	A	rs200829826	byFrequency	TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr12:131649622C>A	ENST00000376678.2	+	0	67					NR_026670.2																						TGGGAATGAGCAATGCAACCT	0.552																																																	0								ENSG00000204603																																			RP11-638F5.1			0			-	Clone_based_vega_gene																													12.37:g.131649622C>A		Somatic	0	26	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376678.2	37	NULL		12																																																																																			-	-		0.552	RP11-638F5.1-001	KNOWN	basic	lincRNA	LOC101929974	lincRNA	OTTHUMT00000399382.1	C		rs200829826		131649622	+1	no_errors	ENST00000376678	ensembl	human	known	74_37	rna	SNP	0.002	A
HYDIN	54768	genome.wustl.edu	37	16	71196449	71196449	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr16:71196449T>A	ENST00000393567.2	-	6	851	c.701A>T	c.(700-702)cAc>cTc	p.H234L	HYDIN_ENST00000448691.1_Missense_Mutation_p.H234L|HYDIN_ENST00000448089.2_Missense_Mutation_p.H234L|HYDIN_ENST00000541601.1_Missense_Mutation_p.H251L|HYDIN_ENST00000393550.2_Missense_Mutation_p.H234L|HYDIN_ENST00000288168.10_Missense_Mutation_p.H251L|HYDIN_ENST00000321489.5_Missense_Mutation_p.H234L|HYDIN_ENST00000538248.1_Missense_Mutation_p.H261L	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	234					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				AGTTTTGATGTGAAATACAGC	0.388																																																	0								ENSG00000157423						62.0	59.0	60.0					16																	71196449		2196	4296	6492	HYDIN	SO:0001583	missense	0			-	HGNC	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.701A>T	16.37:g.71196449T>A	ENSP00000377197:p.His234Leu	Somatic	0	73	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	48	17.24	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_PapD-like	p.H234L	ENST00000393567.2	37	c.701	CCDS59269.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.96|11.96	1.796117|1.796117	0.31777|0.31777	.|.	.|.	ENSG00000157423|ENSG00000157423	ENST00000393567;ENST00000316490;ENST00000448089;ENST00000448691;ENST00000321489;ENST00000538248;ENST00000541601;ENST00000288168;ENST00000393550|ENST00000538382	T;T;T;T;T;T;T;T|.	0.14266|.	5.6;3.76;3.76;3.76;3.75;3.76;3.39;2.52|.	4.92|4.92	4.92|4.92	0.64577|0.64577	.|.	0.000000|.	0.32819|.	U|.	0.005610|.	T|T	0.69142|0.69142	0.3078|0.3078	L|L	0.57536|0.57536	1.79|1.79	0.40268|0.40268	D|D	0.978254|0.978254	B;B;B;B;P|.	0.40180|.	0.0;0.0;0.001;0.0;0.705|.	B;B;B;B;B|.	0.38327|.	0.003;0.003;0.004;0.003;0.271|.	T|T	0.69480|0.69480	-0.5134|-0.5134	10|5	0.07175|.	T|.	0.84|.	.|.	14.5089|14.5089	0.67772|0.67772	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	261;251;251;234;234|.	B4DRN4;F5H6V3;F8WD03;Q4G0P3-5;F8WD23|.	.;.;.;.;.|.	L|S	234;234;234;234;234;261;251;251;234|73	ENSP00000377197:H234L;ENSP00000398544:H234L;ENSP00000394826:H234L;ENSP00000314736:H234L;ENSP00000444970:H261L;ENSP00000437341:H251L;ENSP00000288168:H251L;ENSP00000377181:H234L|.	ENSP00000288168:H251L|.	H|T	-|-	2|1	0|0	HYDIN|HYDIN	69753950|69753950	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.867000|0.867000	0.49689|0.49689	1.507000|1.507000	0.35758|0.35758	1.980000|1.980000	0.57719|0.57719	0.482000|0.482000	0.46254|0.46254	CAC|ACA	-	superfamily_PapD-like		0.388	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	protein_coding	OTTHUMT00000398624.3	T		-		71196449	-1	no_errors	ENST00000448089	ensembl	human	known	74_37	missense	SNP	1.000	A
ITGA11	22801	genome.wustl.edu	37	15	68612722	68612722	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr15:68612722C>T	ENST00000315757.7	-	20	2503	c.2417G>A	c.(2416-2418)tGc>tAc	p.C806Y	ITGA11_ENST00000423218.2_Missense_Mutation_p.C806Y	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	806					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						CACCCTCTGGCAGTACTCCCT	0.587																																																	0								ENSG00000137809						26.0	27.0	27.0					15																	68612722		2028	4191	6219	ITGA11	SO:0001583	missense	0			-	HGNC	AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.2417G>A	15.37:g.68612722C>T	ENSP00000327290:p.Cys806Tyr	Somatic	0	13	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	14	22.22	J3KQM2|Q8WYI8|Q9UKQ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.C806Y	ENST00000315757.7	37	c.2417	CCDS45291.1	15	.	.	.	.	.	.	.	.	.	.	C	23.1	4.376544	0.82682	.	.	ENSG00000137809	ENST00000315757;ENST00000423218;ENST00000535491	T;T	0.60672	0.17;0.18	5.62	5.62	0.85841	Integrin alpha-2 (1);	0.000000	0.85682	D	0.000000	T	0.75831	0.3903	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.995;1.0	T	0.77482	-0.2571	10	0.87932	D	0	.	18.6297	0.91355	0.0:1.0:0.0:0.0	.	806;806	A8K8T0;Q9UKX5	.;ITA11_HUMAN	Y	806;806;441	ENSP00000327290:C806Y;ENSP00000403392:C806Y	ENSP00000327290:C806Y	C	-	2	0	ITGA11	66399776	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.825000	0.69286	2.651000	0.90000	0.561000	0.74099	TGC	-	pfam_Integrin_alpha-2		0.587	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGA11	protein_coding		C	NM_012211	-		68612722	-1	no_errors	ENST00000315757	ensembl	human	known	74_37	missense	SNP	1.000	T
KCNH2	3757	genome.wustl.edu	37	7	150647132	150647132	+	Intron	SNP	G	G	A			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr7:150647132G>A	ENST00000262186.5	-	9	2800				KCNH2_ENST00000392968.2_Intron|KCNH2_ENST00000330883.4_Intron|KCNH2_ENST00000430723.3_Missense_Mutation_p.P841L	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2						cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	GTGAATTAAAGGAGCCCAGTG	0.602																																					GBM(137;110 1844 13671 20123 45161)												0								ENSG00000055118						28.0	39.0	35.0					7																	150647132		1291	2273	3564	KCNH2	SO:0001627	intron_variant	0			-	HGNC	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.2398+123C>T	7.37:g.150647132G>A		Somatic	0	75	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	51	19.05	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,tigrfam_PAS	p.P841L	ENST00000262186.5	37	c.2522	CCDS5910.1	7	.	.	.	.	.	.	.	.	.	.	G	12.42	1.931912	0.34096	.	.	ENSG00000055118	ENST00000430723	D	0.99259	-5.64	2.85	0.967	0.19674	.	.	.	.	.	D	0.95424	0.8514	N	0.08118	0	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	D	0.92297	0.5846	9	0.62326	D	0.03	.	4.6046	0.12371	0.3281:0.0:0.6719:0.0	.	841;501	G5E9I0;Q708S9	.;.	L	841	ENSP00000387657:P841L	ENSP00000387657:P841L	P	-	2	0	KCNH2	150278065	0.757000	0.28394	0.007000	0.13788	0.375000	0.29983	0.355000	0.20163	0.244000	0.21351	0.462000	0.41574	CCT	-	smart_cNMP-bd_dom		0.602	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH2	protein_coding	OTTHUMT00000350741.2	G	NM_000238	-		150647132	-1	no_errors	ENST00000430723	ensembl	human	known	74_37	missense	SNP	0.080	A
PSMD1	5707	genome.wustl.edu	37	2	231937071	231937071	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr2:231937071A>G	ENST00000308696.6	+	7	985	c.823A>G	c.(823-825)Att>Gtt	p.I275V	PSMD1_ENST00000373635.4_Missense_Mutation_p.I275V|PSMD1_ENST00000409643.1_Missense_Mutation_p.I275V	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	275					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	TGGCACCCCTATTGCTTCTGT	0.408																																																	0								ENSG00000173692						162.0	165.0	164.0					2																	231937071		2203	4300	6503	PSMD1	SO:0001583	missense	0			-	HGNC	D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.823A>G	2.37:g.231937071A>G	ENSP00000309474:p.Ile275Val	Somatic	0	104	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	70	14.63	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Proteasome/cyclosome_rpt,superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn2	p.I275V	ENST00000308696.6	37	c.823	CCDS2482.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.41|14.41	2.526903|2.526903	0.44969|0.44969	.|.	.|.	ENSG00000173692|ENSG00000173692	ENST00000308696;ENST00000373635;ENST00000409643|ENST00000444007	.|.	.|.	.|.	5.98|5.98	3.55|3.55	0.40652|0.40652	Armadillo-type fold (1);|.	0.043220|.	0.85682|.	D|.	0.000000|.	T|T	0.67297|0.67297	0.2878|0.2878	L|L	0.58925|0.58925	1.835|1.835	0.58432|0.58432	D|D	0.999994|0.999994	B;B|.	0.30973|.	0.027;0.302|.	B;B|.	0.22386|.	0.021;0.039|.	T|T	0.63134|0.63134	-0.6705|-0.6705	9|5	0.23302|.	T|.	0.38|.	-7.3897|-7.3897	13.0469|13.0469	0.58931|0.58931	0.7462:0.2538:0.0:0.0|0.7462:0.2538:0.0:0.0	.|.	275;275|.	Q99460;Q99460-2|.	PSMD1_HUMAN;.|.	V|C	275|126	.|.	ENSP00000309474:I275V|.	I|Y	+|+	1|2	0|0	PSMD1|PSMD1	231645315|231645315	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.984000|0.984000	0.73092|0.73092	5.142000|5.142000	0.64820|0.64820	0.479000|0.479000	0.27511|0.27511	0.528000|0.528000	0.53228|0.53228	ATT|TAT	-	superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn2		0.408	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD1	protein_coding	OTTHUMT00000256958.2	A		-		231937071	+1	no_errors	ENST00000308696	ensembl	human	known	74_37	missense	SNP	0.996	G
PODXL	5420	genome.wustl.edu	37	7	131241029	131241030	+	In_Frame_Ins	INS	-	-	GGCGAC	rs11277659|rs547816245|rs532078953|rs79759078|rs571821675	byFrequency	TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr7:131241029_131241030insGGCGAC	ENST00000378555.3	-	1	336_337	c.89_90insGTCGCC	c.(88-90)ccc>ccGTCGCCc	p.30_30P>PSP	PODXL_ENST00000541194.1_In_Frame_Ins_p.30_30P>PSP|PODXL_ENST00000322985.9_In_Frame_Ins_p.30_30P>PSP|PODXL_ENST00000465001.1_Intron|PODXL_ENST00000537928.1_In_Frame_Ins_p.30_30P>PSP			O00592	PODXL_HUMAN	podocalyxin-like	30					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					CATTCTGGGAGggcgacggcga	0.752																																																	2	Deletion - In frame(2)	prostate(2)						ENSG00000128567																																			PODXL	SO:0001652	inframe_insertion	0				HGNC		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89dupGTCGCC	7.37:g.131241030_131241035dupGGCGAC	ENSP00000367817:p.SerPro30dup	Somatic	NA	NA	NA		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_CD34/Podocalyxin,pirsf_Podocalyxin-like_p1	p.32in_frame_insPS	ENST00000378555.3	37	c.90_89	CCDS34755.1	7																																																																																			-	pirsf_Podocalyxin-like_p1		0.752	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PODXL	protein_coding	OTTHUMT00000337627.2	-	NM_001018111			131241030	-1	no_errors	ENST00000541194	ensembl	human	known	74_37	in_frame_ins	INS	0.002:0.003	GGCGAC
NUP107	57122	genome.wustl.edu	37	12	69113363	69113363	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr12:69113363G>C	ENST00000229179.4	+	14	1512	c.1180G>C	c.(1180-1182)Gaa>Caa	p.E394Q	NUP107_ENST00000378905.2_Missense_Mutation_p.E243Q|NUP107_ENST00000539906.1_Missense_Mutation_p.E365Q	NM_020401.2	NP_065134.1	P57740	NU107_HUMAN	nucleoporin 107kDa	394					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|structural constituent of nuclear pore (GO:0017056)		NUP107/LGR5(2)	breast(3)|endometrium(4)|kidney(4)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(2)	39	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			TATAGGAACAGAATTAGAACC	0.299																																																	0								ENSG00000111581						40.0	45.0	43.0					12																	69113363		2191	4295	6486	NUP107	SO:0001583	missense	0			-	HGNC	AK055629	CCDS8985.1	12q14	2004-03-19			ENSG00000111581	ENSG00000111581			29914	protein-coding gene	gene with protein product		607617				12552102, 12705868	Standard	XM_005269037		Approved	NUP84	uc001suf.3	P57740	OTTHUMG00000169265	ENST00000229179.4:c.1180G>C	12.37:g.69113363G>C	ENSP00000229179:p.Glu394Gln	Somatic	0	58	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	77	41.22	B4DZ67|Q6PJE1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nup84_Nup100	p.E394Q	ENST00000229179.4	37	c.1180	CCDS8985.1	12	.	.	.	.	.	.	.	.	.	.	G	20.9	4.070557	0.76301	.	.	ENSG00000111581	ENST00000229179;ENST00000378905;ENST00000539906	.	.	.	5.4	4.51	0.55191	.	0.043741	0.85682	D	0.000000	T	0.77452	0.4132	M	0.76574	2.34	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.998	D;D;D	0.74674	0.984;0.978;0.976	T	0.79017	-0.1975	8	.	.	.	-12.8188	14.4398	0.67309	0.0714:0.0:0.9286:0.0	.	365;243;394	B4DZ67;Q6PJE1;P57740	.;.;NU107_HUMAN	Q	394;243;365	.	.	E	+	1	0	NUP107	67399630	1.000000	0.71417	0.999000	0.59377	0.909000	0.53808	7.292000	0.78731	1.425000	0.47237	0.484000	0.47621	GAA	-	pfam_Nup84_Nup100		0.299	NUP107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP107	protein_coding	OTTHUMT00000403195.1	G	NM_020401	-		69113363	+1	no_errors	ENST00000229179	ensembl	human	known	74_37	missense	SNP	1.000	C
SEC22C	9117	genome.wustl.edu	37	3	42602771	42602771	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr3:42602771C>A	ENST00000264454.3	-	4	507	c.364G>T	c.(364-366)Gtg>Ttg	p.V122L	SEC22C_ENST00000423701.2_Missense_Mutation_p.V122L|SEC22C_ENST00000536332.1_Missense_Mutation_p.V52L|SEC22C_ENST00000273156.7_Missense_Mutation_p.V122L|SEC22C_ENST00000493107.1_5'UTR|SEC22C_ENST00000417572.1_Missense_Mutation_p.V122L			Q9BRL7	SC22C_HUMAN	SEC22 vesicle trafficking protein homolog C (S. cerevisiae)	122					ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)	3				KIRC - Kidney renal clear cell carcinoma(284;0.222)		TGCCACTTCACTTTCTGAATG	0.393																																																	0								ENSG00000093183						77.0	76.0	76.0					3																	42602771		2203	4300	6503	SEC22C	SO:0001583	missense	0			-	HGNC	AF039568	CCDS2699.1, CCDS2700.1, CCDS56246.1	3p24.3-p22.1	2006-04-25	2006-04-25	2006-04-25	ENSG00000093183	ENSG00000093183			16828	protein-coding gene	gene with protein product		604028	"""SEC22 vesicle trafficking protein-like 3 (S. cerevisiae)"""	SEC22L3		9501016, 11001058	Standard	NM_004206		Approved	MGC13261, MGC5373	uc003clj.3	Q9BRL7	OTTHUMG00000131797	ENST00000264454.3:c.364G>T	3.37:g.42602771C>A	ENSP00000264454:p.Val122Leu	Somatic	0	41	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	O95152|Q68CX3|Q6UW18	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Longin-like_dom,pfscan_Longin_dom	p.V122L	ENST00000264454.3	37	c.364	CCDS2700.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.842|9.842	1.191293|1.191293	0.21954|0.21954	.|.	.|.	ENSG00000093183|ENSG00000093183	ENST00000451653|ENST00000423701;ENST00000273156;ENST00000417572;ENST00000536332;ENST00000264454;ENST00000456515;ENST00000450981	.|T;T;T;T;T;T;T	.|0.19532	.|2.14;2.14;2.14;2.14;2.14;2.14;2.14	5.59|5.59	2.37|2.37	0.29283|0.29283	.|Longin (1);Longin-like (1);	.|0.471757	.|0.23293	.|N	.|0.049779	T|T	0.09905|0.09905	0.0243|0.0243	N|N	0.12569|0.12569	0.235|0.235	0.31697|0.31697	N|N	0.641137|0.641137	.|B;B;B;B	.|0.10296	.|0.0;0.002;0.0;0.003	.|B;B;B;B	.|0.08055	.|0.002;0.002;0.001;0.003	T|T	0.20571|0.20571	-1.0271|-1.0271	5|10	.|0.20046	.|T	.|0.44	-9.5655|-9.5655	7.8433|7.8433	0.29410|0.29410	0.0:0.7213:0.0:0.2787|0.0:0.7213:0.0:0.2787	.|.	.|52;122;122;122	.|F5H0H7;Q9BRL7-3;Q9BRL7;Q9BRL7-2	.|.;.;SC22C_HUMAN;.	I|L	43|122;122;122;52;122;122;122	.|ENSP00000414576:V122L;ENSP00000273156:V122L;ENSP00000407564:V122L;ENSP00000439845:V52L;ENSP00000264454:V122L;ENSP00000391170:V122L;ENSP00000397170:V122L	.|ENSP00000264454:V122L	S|V	-|-	2|1	0|0	SEC22C|SEC22C	42577775|42577775	0.993000|0.993000	0.37304|0.37304	0.997000|0.997000	0.53966|0.53966	0.937000|0.937000	0.57800|0.57800	1.378000|1.378000	0.34328|0.34328	0.565000|0.565000	0.29255|0.29255	-0.290000|-0.290000	0.09829|0.09829	AGT|GTG	-	superfamily_Longin-like_dom		0.393	SEC22C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC22C	protein_coding	OTTHUMT00000254734.1	C	NM_004206	-		42602771	-1	no_errors	ENST00000264454	ensembl	human	known	74_37	missense	SNP	1.000	A
PLXNA2	5362	genome.wustl.edu	37	1	208200404	208200404	+	3'UTR	SNP	G	G	A			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr1:208200404G>A	ENST00000367033.3	-	0	6626				PLXNA2_ENST00000483048.1_5'UTR	NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2						axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GTCTCTCCCAGCTGGAACTGG	0.627																																																	0								ENSG00000076356																																			PLXNA2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.*184C>T	1.37:g.208200404G>A		Somatic	0	62	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000367033.3	37	NULL	CCDS31013.1	1																																																																																			-	-		0.627	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	protein_coding	OTTHUMT00000088932.6	G	NM_025179	-		208200404	-1	no_errors	ENST00000483048	ensembl	human	known	74_37	rna	SNP	0.000	A
MVP	9961	genome.wustl.edu	37	16	29852944	29852944	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr16:29852944A>G	ENST00000357402.5	+	9	1357	c.1219A>G	c.(1219-1221)Atg>Gtg	p.M407V	MVP_ENST00000395353.1_Missense_Mutation_p.M407V|MVP_ENST00000452209.2_3'UTR	NM_005115.4|NM_017458.3	NP_005106.2|NP_059447.2	Q14764	MVP_HUMAN	major vault protein	407					cell proliferation (GO:0008283)|ERBB signaling pathway (GO:0038127)|mRNA transport (GO:0051028)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of signaling (GO:0023057)|protein activation cascade (GO:0072376)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(7)|ovary(2)|skin(3)|soft_tissue(1)|stomach(1)	27						AAGCACCTACATGCTGACCCA	0.622																																																	0								ENSG00000013364						26.0	24.0	25.0					16																	29852944		2197	4299	6496	MVP	SO:0001583	missense	0			-	HGNC	X79882	CCDS10656.1	16p11.2	2012-04-25			ENSG00000013364	ENSG00000013364			7531	protein-coding gene	gene with protein product	"""lung resistance-related protein"""	605088				7585126	Standard	NM_005115		Approved	LRP, VAULT1	uc002dui.3	Q14764	OTTHUMG00000048227	ENST00000357402.5:c.1219A>G	16.37:g.29852944A>G	ENSP00000349977:p.Met407Val	Somatic	0	39	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	Q96BG4|Q9BPW6|Q9BQT1|Q9UBD1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Vault_N,pfam_MVP_shoulder	p.M407V	ENST00000357402.5	37	c.1219	CCDS10656.1	16	.	.	.	.	.	.	.	.	.	.	A	16.60	3.167990	0.57476	.	.	ENSG00000013364	ENST00000357402;ENST00000395353	T;T	0.11604	2.76;2.76	5.61	5.61	0.85477	.	0.036730	0.85682	D	0.000000	T	0.36413	0.0966	M	0.91972	3.26	0.80722	D	1	D	0.58268	0.982	P	0.58266	0.836	T	0.42015	-0.9476	10	0.54805	T	0.06	-41.5369	13.7625	0.62975	1.0:0.0:0.0:0.0	.	407	Q14764	MVP_HUMAN	V	407	ENSP00000349977:M407V;ENSP00000378760:M407V	ENSP00000349977:M407V	M	+	1	0	MVP	29760445	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.324000	0.79115	2.123000	0.65237	0.460000	0.39030	ATG	-	NULL		0.622	MVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MVP	protein_coding	OTTHUMT00000109711.3	A	NM_005115	-		29852944	+1	no_errors	ENST00000357402	ensembl	human	known	74_37	missense	SNP	1.000	G
RGL4	266747	genome.wustl.edu	37	22	24037625	24037626	+	Intron	INS	-	-	CTGTTG	rs144531389|rs71200896|rs530374575	byFrequency	TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr22:24037625_24037626insCTGTTG	ENST00000290691.5	+	6	2256				KB-1572G7.2_ENST00000421064.1_RNA|RGL4_ENST00000401461.1_Intron|GUSBP11_ENST00000455485.1_RNA|AP000347.2_ENST00000417194.1_RNA	NM_153615.1	NP_705843.1	Q8IZJ4	RGDSR_HUMAN	ral guanine nucleotide dissociation stimulator-like 4						small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(3)	15						AAGCCAGGCCTctgctgctgct	0.629																																																	0								ENSG00000273000																																			KB-1572G7.2	SO:0001627	intron_variant	0				Clone_based_vega_gene		CCDS13811.1	22q11.23	2008-02-22			ENSG00000159496	ENSG00000159496			31911	protein-coding gene	gene with protein product	"""RalGDS related oncogene"""	612214				9178890, 10851075	Standard	NM_153615		Approved	Rgr	uc002zxn.3	Q8IZJ4	OTTHUMG00000150711	ENST00000290691.5:c.1086+419->CTGTTG	22.37:g.24037625_24037626insCTGTTG		Somatic	NA	NA	NA		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q495L8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000290691.5	37	NULL	CCDS13811.1	22																																																																																			-	-		0.629	RGL4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000273000	protein_coding	OTTHUMT00000319711.1	-	NM_153615			24037626	-1	no_errors	ENST00000421064	ensembl	human	known	74_37	rna	INS	0.001:0.005	CTGTTG
C16orf96	342346	genome.wustl.edu	37	16	4643291	4643291	+	Silent	SNP	C	C	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr16:4643291C>T	ENST00000444310.4	+	12	2841	c.2841C>T	c.(2839-2841)tgC>tgT	p.C947C		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						CCAACAGCTGCGAGTACTTGC	0.667																																																	0								ENSG00000205832						23.0	30.0	28.0					16																	4643291		692	1591	2283	C16orf96	SO:0001819	synonymous_variant	0			-	HGNC		CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.2841C>T	16.37:g.4643291C>T		Somatic	0	72	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	58	20.55		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C947	ENST00000444310.4	37	c.2841	CCDS53986.1	16																																																																																			-	NULL		0.667	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	protein_coding	OTTHUMT00000432384.1	C	NM_001145011	-		4643291	+1	no_errors	ENST00000444310	ensembl	human	known	74_37	silent	SNP	0.844	T
U2SURP	23350	genome.wustl.edu	37	3	142720221	142720222	+	5'Flank	INS	-	-	GGACAACGA	rs3832221|rs11282240	byFrequency	TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr3:142720221_142720222insGGACAACGA	ENST00000473835.2	+	0	0				RP11-372E1.6_ENST00000497652.1_RNA|U2SURP_ENST00000493598.2_5'Flank|RP11-372E1.6_ENST00000595248.1_RNA|RP11-91G21.1_ENST00000597953.1_lincRNA|U2SURP_ENST00000397933.2_5'Flank|RP11-372E1.6_ENST00000595774.1_RNA	NM_001080415.1	NP_001073884.1	O15042	SR140_HUMAN	U2 snRNP-associated SURP domain containing						RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	31						CAGCTGGCCCTGATTCTCTGAA	0.515														3604	0.719649	0.8949	0.6988	5008	,	,		19350	0.7212		0.6183	False		,,,				2504	0.6002																0								ENSG00000241570																																			RP11-372E1.6	SO:0001631	upstream_gene_variant	0				Clone_based_vega_gene	BK000564	CCDS46928.1	3q23	2013-02-12			ENSG00000163714	ENSG00000163714		"""RNA binding motif (RRM) containing"""	30855	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein a"", ""Ser/Arg-rich domain protein, 140 kDa"", ""U2 associated SR140 protein"""					9205841, 12234937	Standard	NM_001080415		Approved	fSAPa, SR140	uc003evh.1	O15042	OTTHUMG00000159323		3.37:g.142720221_142720222insGGACAACGA	Exception_encountered	Somatic	NA	NA	NA		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A0PJ60|Q0D2M1|Q2NKQ7|Q9BR70	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000473835.2	37	NULL	CCDS46928.1	3																																																																																			-	-		0.515	U2SURP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927832	protein_coding	OTTHUMT00000354603.2	-	NM_001080415			142720222	+1	no_errors	ENST00000595248	ensembl	human	known	74_37	rna	INS	0.005:0.015	GGACAACGA
PSMC5	5705	genome.wustl.edu	37	17	61904054	61904054	+	5'Flank	SNP	G	G	A			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr17:61904054G>A	ENST00000310144.6	+	0	0				PSMC5_ENST00000375812.4_5'Flank|PSMC5_ENST00000581882.1_5'Flank|FTSJ3_ENST00000427159.2_Intron|FTSJ3_ENST00000580295.1_5'Flank|PSMC5_ENST00000580864.1_5'Flank	NM_002805.5	NP_002796.4	P62195	PRS8_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 5						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of inclusion body assembly (GO:0090261)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|nuclear proteasome complex (GO:0031595)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|thyrotropin-releasing hormone receptor binding (GO:0031531)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(2)|large_intestine(8)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	20						AACCAAGTGCGCAAACTGCTT	0.547																																																	0								ENSG00000108592						48.0	45.0	46.0					17																	61904054		2203	4300	6503	FTSJ3	SO:0001631	upstream_gene_variant	0			-	HGNC	L38810	CCDS11645.1, CCDS56043.1	17q23.3	2010-04-21			ENSG00000087191	ENSG00000087191		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9552	protein-coding gene	gene with protein product		601681				9473509, 9048938	Standard	NM_002805		Approved	SUG1, p45/SUG, TBP10, p45, S8, TRIP1, SUG-1	uc002jcb.3	P62195			17.37:g.61904054G>A	Exception_encountered	Somatic	0	52	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A8K3Z3|A8K763|O35051|O43208|P47210|P52915|P52916	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C24	ENST00000310144.6	37	c.72	CCDS11645.1	17																																																																																			-	NULL		0.547	PSMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTSJ3	protein_coding	OTTHUMT00000444404.1	G	NM_002805	-		61904054	-1	no_errors	ENST00000584193	ensembl	human	known	74_37	silent	SNP	0.000	A
RABEP2	79874	genome.wustl.edu	37	16	28931200	28931202	+	In_Frame_Del	DEL	CTG	CTG	-	rs373504496		TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	CTG	CTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr16:28931200_28931202delCTG	ENST00000358201.4	-	3	925_927	c.337_339delCAG	c.(337-339)cagdel	p.Q113del	RABEP2_ENST00000561803.1_5'UTR|RABEP2_ENST00000357573.6_In_Frame_Del_p.Q113del|RABEP2_ENST00000544477.1_In_Frame_Del_p.Q42del	NM_024816.2	NP_079092.2	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	113	Poly-Gln.				endocytosis (GO:0006897)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	16						CCTCACAGTCCTGCTGCTGCTGC	0.64																																					Pancreas(66;639 1284 10093 31061 49099)												0								ENSG00000177548																																			RABEP2	SO:0001651	inframe_deletion	0				HGNC	AK026935	CCDS42140.1	16p11.2	2014-09-11			ENSG00000177548	ENSG00000177548			24817	protein-coding gene	gene with protein product		611869				12477932	Standard	NM_024816		Approved	FRA, FLJ23282	uc002drq.3	Q9H5N1	OTTHUMG00000176593	ENST00000358201.4:c.337_339delCAG	16.37:g.28931209_28931211delCTG	ENSP00000350934:p.Gln113del	Somatic	0	31	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Rabaptin_coiled-coil,pfam_Rabaptin_Rab5-bd_dom,prints_Rabaptin	p.Q113in_frame_del	ENST00000358201.4	37	c.339_337	CCDS42140.1	16																																																																																			-	pfam_Rabaptin_coiled-coil		0.640	RABEP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RABEP2	protein_coding	OTTHUMT00000432691.1	CTG	NM_024816			28931202	-1	no_errors	ENST00000358201	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
KDM5A	5927	genome.wustl.edu	37	12	495084	495084	+	Silent	SNP	G	G	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr12:495084G>T	ENST00000399788.2	-	2	584	c.222C>A	c.(220-222)gtC>gtA	p.V74V	KDM5A_ENST00000382815.4_Silent_p.V74V	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	74					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						TCAGGCGCTGGACTCTTGGAG	0.383			T	NUP98	AML																																			Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	0								ENSG00000073614						109.0	107.0	107.0					12																	495084		1842	4107	5949	KDM5A	SO:0001819	synonymous_variant	0			-	HGNC		CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.222C>A	12.37:g.495084G>T		Somatic	0	72	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A8MV76|Q4LE72|Q86XZ1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.V74	ENST00000399788.2	37	c.222	CCDS41736.1	12																																																																																			-	superfamily_ARID/BRIGHT_DNA-bd		0.383	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5A	protein_coding	OTTHUMT00000397812.1	G	NM_005056	-		495084	-1	no_errors	ENST00000399788	ensembl	human	known	74_37	silent	SNP	0.990	T
CPM	1368	genome.wustl.edu	37	12	69264130	69264130	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ES-01A-31D-A38Z-09	TCGA-DX-A7ES-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	350f490c-6cb9-42f6-a54e-4707072be422	f5ab5ae4-49e5-4a01-9112-6aa58c023e0e	g.chr12:69264130C>T	ENST00000551568.1	-	5	541	c.481G>A	c.(481-483)Gaa>Aaa	p.E161K	CPM_ENST00000338356.3_Missense_Mutation_p.E161K|CPM_ENST00000546373.1_Missense_Mutation_p.E161K	NM_001005502.2|NM_198320.3	NP_001005502.1|NP_938079.1	P14384	CBPM_HUMAN	carboxypeptidase M	161					anatomical structure morphogenesis (GO:0009653)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(6)|prostate(2)	9	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			TTATTATATTCAAAAGCATCG	0.418																																																	0								ENSG00000135678						81.0	83.0	82.0					12																	69264130		2203	4300	6503	CPM	SO:0001583	missense	0			-	HGNC	AF368463	CCDS8987.1	12q15	2012-02-10			ENSG00000135678	ENSG00000135678	3.4.17.12		2311	protein-coding gene	gene with protein product	"""renal carboxypeptidase"", ""urinary carboxypeptidase B"""	114860				8586455	Standard	NM_001874		Approved		uc001suq.3	P14384	OTTHUMG00000169300	ENST00000551568.1:c.481G>A	12.37:g.69264130C>T	ENSP00000448517:p.Glu161Lys	Somatic	0	44	0.00		0.5344377943210737	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	120	360	25.00	B2R800|Q9H2K9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M14,pfam_Aste_AspA,superfamily_CarboxyPept-like_regulatory,smart_Peptidase_M14,prints_Peptidase_M14	p.E161K	ENST00000551568.1	37	c.481	CCDS8987.1	12	.	.	.	.	.	.	.	.	.	.	C	9.359	1.067446	0.20067	.	.	ENSG00000135678	ENST00000551568;ENST00000338356;ENST00000546373;ENST00000548954	T;T;T;T	0.10763	2.84;2.84;2.84;2.84	5.37	5.37	0.77165	Peptidase M14, carboxypeptidase A (2);	0.684609	0.14495	N	0.316092	T	0.09379	0.0231	L	0.31371	0.925	0.58432	D	0.999998	B	0.19200	0.034	B	0.19148	0.024	T	0.23691	-1.0181	9	.	.	.	-8.2792	12.8027	0.57594	0.0:0.9248:0.0:0.0751	.	161	P14384	CBPM_HUMAN	K	161	ENSP00000448517:E161K;ENSP00000339157:E161K;ENSP00000447255:E161K;ENSP00000446799:E161K	.	E	-	1	0	CPM	67550397	1.000000	0.71417	0.982000	0.44146	0.283000	0.27025	1.781000	0.38644	2.689000	0.91719	0.655000	0.94253	GAA	-	pfam_Peptidase_M14,pfam_Aste_AspA,smart_Peptidase_M14		0.418	CPM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPM	protein_coding	OTTHUMT00000403355.1	C	NM_198320	-		69264130	-1	no_errors	ENST00000338356	ensembl	human	known	74_37	missense	SNP	1.000	T
