#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PSIP1	11168	genome.wustl.edu	37	9	15472612	15472612	+	Intron	DEL	A	A	-	rs201263257		TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr9:15472612delA	ENST00000380733.4	-	10	1321				PSIP1_ENST00000380715.1_Intron|PSIP1_ENST00000397519.2_Intron|PSIP1_ENST00000380738.4_Intron|PSIP1_ENST00000380716.4_Intron			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1						establishment of integrated proviral latency (GO:0075713)|mRNA 5'-splice site recognition (GO:0000395)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to heat (GO:0009408)|response to oxidative stress (GO:0006979)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription coactivator activity (GO:0001105)|supercoiled DNA binding (GO:0097100)			breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)		CAAAATTTAGAAAAAAAAAAA	0.343																																																	0								ENSG00000164985						81.0	78.0	79.0					9																	15472612		2202	4297	6499	PSIP1	SO:0001627	intron_variant	0				HGNC	AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985			9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2		9822615, 9885563	Standard	NM_033222		Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.977+17T>-	9.37:g.15472612delA		Somatic	0	21	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	35	20.45	D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000380733.4	37	NULL	CCDS6479.1	9																																																																																			-	-		0.343	PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PSIP1	protein_coding	OTTHUMT00000055445.1	A	NM_033222			15472612	-1	no_errors	ENST00000495873	ensembl	human	known	74_37	rna	DEL	0.001	-
RPL31P11	641311	genome.wustl.edu	37	1	161654571	161654572	+	RNA	INS	-	-	T	rs36089916	byFrequency	TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr1:161654571_161654572insT	ENST00000426558.1	-	0	470_471					NR_002595.1				ribosomal protein L31 pseudogene 11																		GAACCTATGTCTTTTTTTTTTT	0.322													|||unknown(HR)	1686	0.336661	0.2595	0.4294	5008	,	,		18871	0.4306		0.2813	False		,,,				2504	0.3354																0								ENSG00000213075																																			RPL31P11			0				HGNC			1q23.3	2010-06-16			ENSG00000213075	ENSG00000213075			35849	pseudogene	pseudogene						19123937	Standard	NR_002595		Approved		uc001gbc.3		OTTHUMG00000034536		1.37:g.161654582_161654582dupT		Somatic	0	10	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	4	50.00		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000426558.1	37	NULL		1																																																																																			-	-		0.322	RPL31P11-002	KNOWN	basic	processed_transcript	RPL31P11	pseudogene	OTTHUMT00000347090.2	-	NR_002595			161654572	-1	no_errors	ENST00000426558	ensembl	human	known	74_37	rna	INS	0.140:0.150	T
FIG4	9896	genome.wustl.edu	37	6	110059609	110059609	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr6:110059609A>G	ENST00000230124.3	+	7	852	c.728A>G	c.(727-729)cAt>cGt	p.H243R	FIG4_ENST00000368941.1_Intron|FIG4_ENST00000441478.2_Intron	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	243	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		AGTACTGTGCATCGTGACTGG	0.338																																																	0								ENSG00000112367						155.0	156.0	156.0					6																	110059609		2203	4299	6502	FIG4	SO:0001583	missense	0			-	HGNC	D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.728A>G	6.37:g.110059609A>G	ENSP00000230124:p.His243Arg	Somatic	0	54	0.00		0.5152294697123943	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	57	20.83	Q53H49|Q5TCS6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Syja_N,pfscan_Syja_N	p.H243R	ENST00000230124.3	37	c.728	CCDS5078.1	6	.	.	.	.	.	.	.	.	.	.	A	15.32	2.797930	0.50208	.	.	ENSG00000112367	ENST00000230124;ENST00000454215	T;T	0.56611	0.45;0.45	5.67	4.52	0.55395	Synaptojanin, N-terminal (2);	0.110613	0.64402	D	0.000009	T	0.40522	0.1120	L	0.42245	1.32	0.80722	D	1	P	0.51057	0.941	P	0.55577	0.779	T	0.27938	-1.0059	10	0.15952	T	0.53	-8.829	11.3622	0.49651	0.9294:0.0:0.0706:0.0	.	243	Q92562	FIG4_HUMAN	R	243;222	ENSP00000230124:H243R;ENSP00000412156:H222R	ENSP00000230124:H243R	H	+	2	0	FIG4	110166302	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.167000	0.77562	0.987000	0.38709	0.533000	0.62120	CAT	-	pfam_Syja_N,pfscan_Syja_N		0.338	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIG4	protein_coding	OTTHUMT00000041768.1	A	NM_014845	-		110059609	+1	no_errors	ENST00000230124	ensembl	human	known	74_37	missense	SNP	1.000	G
ZNF608	57507	genome.wustl.edu	37	5	123973290	123973290	+	3'UTR	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr5:123973290G>A	ENST00000306315.5	-	0	5277				ZNF608_ENST00000504926.1_3'UTR|ZNF608_ENST00000513985.1_5'UTR	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608								metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TGAGTGGTTTGCGACGTGGCA	0.303																																																	0								ENSG00000168916																																			ZNF608	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.*303C>T	5.37:g.123973290G>A		Somatic	0	102	0.00		0.5152294697123943	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	76	15.56	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000306315.5	37	NULL	CCDS34219.1	5																																																																																			-	-		0.303	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF608	protein_coding	OTTHUMT00000371300.1	G	XM_114432	-		123973290	-1	no_errors	ENST00000513985	ensembl	human	known	74_37	rna	SNP	1.000	A
MUC19	283463	genome.wustl.edu	37	12	40815937	40815937	+	Silent	SNP	T	T	C			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr12:40815937T>C	ENST00000454784.4	+	10	853	c.120T>C	c.(118-120)agT>agC	p.S40S	RP11-115F18.1_ENST00000552757.1_RNA			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric	40	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						TTGCCAATAGTAAAATTCCTG	0.313																																																	0								ENSG00000205592																																			MUC19	SO:0001819	synonymous_variant	0			-	HGNC	AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.120T>C	12.37:g.40815937T>C		Somatic	0	51	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q8NA85	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich	p.S40	ENST00000454784.4	37	c.120		12																																																																																			-	NULL		0.313	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	protein_coding	OTTHUMT00000384257.6	T	XM_003403524	-		40815937	+1	no_errors	ENST00000454784	ensembl	human	novel	74_37	silent	SNP	0.911	C
DNAJC11	55735	genome.wustl.edu	37	1	6696236	6696236	+	Missense_Mutation	SNP	C	C	T	rs558222069		TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr1:6696236C>T	ENST00000377577.5	-	15	1718	c.1595G>A	c.(1594-1596)cGg>cAg	p.R532Q	DNAJC11_ENST00000349363.6_Intron|DNAJC11_ENST00000465508.1_5'UTR|DNAJC11_ENST00000542246.1_Missense_Mutation_p.R494Q|DNAJC11_ENST00000377573.5_Missense_Mutation_p.R442Q|DNAJC11_ENST00000294401.7_Missense_Mutation_p.R480Q	NM_018198.3	NP_060668.2	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	532						extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)|urinary_tract(1)	32	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		CAGGACGCCCCGGAACTGATA	0.557													C|||	1	0.000199681	0.0	0.0	5008	,	,		18357	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000007923						90.0	77.0	82.0					1																	6696236		2203	4300	6503	DNAJC11	SO:0001583	missense	0			-	HGNC	AF306695	CCDS87.1	1p36.23	2011-09-02			ENSG00000007923	ENSG00000007923		"""Heat shock proteins / DNAJ (HSP40)"""	25570	protein-coding gene	gene with protein product		614827				12964007	Standard	NM_018198		Approved	FLJ10737	uc001aof.2	Q9NVH1	OTTHUMG00000001443	ENST00000377577.5:c.1595G>A	1.37:g.6696236C>T	ENSP00000366800:p.Arg532Gln	Somatic	0	74	0.00		0.5152294697123943	26	39.53	17	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	66	19.51	Q4VWF5|Q5VZN0|Q6PK20|Q6PK70|Q8NDM2|Q96CL7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DnaJ-like_C11_C,pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.R532Q	ENST00000377577.5	37	c.1595	CCDS87.1	1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.781825	0.90282	.	.	ENSG00000007923	ENST00000377577;ENST00000294401;ENST00000542246;ENST00000377573	T;T;T;T	0.26373	2.37;2.43;2.09;1.74	5.52	4.61	0.57282	DnaJ-like protein C11, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.40322	0.1112	L	0.48935	1.535	0.58432	D	0.999993	D;P;D	0.89917	1.0;0.933;0.978	D;B;P	0.67231	0.95;0.41;0.598	T	0.08868	-1.0701	10	0.27082	T	0.32	-15.5675	13.4422	0.61119	0.0:0.925:0.0:0.075	.	442;480;532	B4DGD5;Q9NVH1-3;Q9NVH1	.;.;DJC11_HUMAN	Q	532;480;494;442	ENSP00000366800:R532Q;ENSP00000294401:R480Q;ENSP00000444020:R494Q;ENSP00000366796:R442Q	ENSP00000294401:R480Q	R	-	2	0	DNAJC11	6618823	1.000000	0.71417	0.893000	0.35052	0.991000	0.79684	7.298000	0.78815	1.329000	0.45376	0.655000	0.94253	CGG	-	pfam_DnaJ-like_C11_C		0.557	DNAJC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC11	protein_coding	OTTHUMT00000004216.3	C	NM_018198	-		6696236	-1	no_errors	ENST00000377577	ensembl	human	known	74_37	missense	SNP	0.999	T
JPH2	57158	genome.wustl.edu	37	20	42789014	42789014	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr20:42789014C>T	ENST00000372980.3	-	2	1285	c.413G>A	c.(412-414)cGc>cAc	p.R138H		NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	138	Gly-rich.				calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GTAGCCATGGCGCATGCCGTT	0.711																																																	0								ENSG00000149596						22.0	12.0	15.0					20																	42789014		2086	4080	6166	JPH2	SO:0001583	missense	0			-	HGNC	AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.413G>A	20.37:g.42789014C>T	ENSP00000362071:p.Arg138His	Somatic	0	90	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	73	13.10	E1P5X1|O95913|Q5JY74|Q9UJN4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MORN,smart_MORN,pirsf_Junctophilin	p.R138H	ENST00000372980.3	37	c.413	CCDS13325.1	20	.	.	.	.	.	.	.	.	.	.	c	21.3	4.133132	0.77662	.	.	ENSG00000149596	ENST00000372980	T	0.60040	0.22	3.34	3.34	0.38264	.	0.000000	0.85682	U	0.000000	T	0.73032	0.3535	M	0.66439	2.03	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77981	-0.2383	10	0.87932	D	0	.	14.8586	0.70362	0.0:1.0:0.0:0.0	.	138	Q9BR39	JPH2_HUMAN	H	138	ENSP00000362071:R138H	ENSP00000362071:R138H	R	-	2	0	JPH2	42222428	1.000000	0.71417	1.000000	0.80357	0.494000	0.33585	7.241000	0.78201	1.700000	0.51204	0.306000	0.20318	CGC	-	pfam_MORN,smart_MORN,pirsf_Junctophilin		0.711	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH2	protein_coding	OTTHUMT00000080307.1	C		-		42789014	-1	no_errors	ENST00000372980	ensembl	human	known	74_37	missense	SNP	1.000	T
C14orf39	317761	genome.wustl.edu	37	14	60945104	60945104	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr14:60945104C>T	ENST00000321731.3	-	5	396	c.237G>A	c.(235-237)tgG>tgA	p.W79*		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	79					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		ATGTTGGCTTCCAGCTATAGA	0.264																																																	0								ENSG00000179008						55.0	54.0	54.0					14																	60945104		2201	4293	6494	C14orf39	SO:0001587	stop_gained	0			-	HGNC	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.237G>A	14.37:g.60945104C>T	ENSP00000324920:p.Trp79*	Somatic	0	123	0.00		0.5152294697123943	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	71	40.34	Q08AQ4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.W79*	ENST00000321731.3	37	c.237	CCDS9746.1	14	.	.	.	.	.	.	.	.	.	.	C	11.03	1.518601	0.27211	.	.	ENSG00000179008	ENST00000321731;ENST00000555476;ENST00000556799	.	.	.	5.56	5.56	0.83823	.	0.090504	0.49916	D	0.000125	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.3696	17.3748	0.87389	0.0:1.0:0.0:0.0	.	.	.	.	X	79;50;79	.	ENSP00000324920:W79X	W	-	3	0	C14orf39	60014857	1.000000	0.71417	1.000000	0.80357	0.061000	0.15899	4.769000	0.62300	2.771000	0.95319	0.650000	0.86243	TGG	-	NULL		0.264	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf39	protein_coding	OTTHUMT00000276948.1	C	NM_174978	-		60945104	-1	no_errors	ENST00000321731	ensembl	human	known	74_37	nonsense	SNP	1.000	T
CLK1	1195	genome.wustl.edu	37	2	201726031	201726035	+	Frame_Shift_Del	DEL	CTACC	CTACC	-			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	CTACC	CTACC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr2:201726031_201726035delCTACC	ENST00000321356.4	-	3	451_455	c.316_320delGGTAG	c.(316-321)ggtagafs	p.GR106fs	Y_RNA_ENST00000516950.1_RNA|CLK1_ENST00000492793.1_5'UTR|CLK1_ENST00000434813.2_Frame_Shift_Del_p.GR148fs	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	106					cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						TCTTCCACTTCTACCAGAAGACTTG	0.405																																																	0								ENSG00000013441																																			CLK1	SO:0001589	frameshift_variant	0				HGNC	L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.316_320delGGTAG	2.37:g.201726031_201726035delCTACC	ENSP00000326830:p.Gly106fs	Somatic	NA	NA	NA		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DFW7|Q0P694|Q8N5V8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G106fs	ENST00000321356.4	37	c.320_316	CCDS2331.1	2																																																																																			-	NULL		0.405	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLK1	protein_coding	OTTHUMT00000256192.2	CTACC				201726035	-1	no_errors	ENST00000321356	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:0.999:0.997:1.000:1.000	-
PMP22	5376	genome.wustl.edu	37	17	15134333	15134333	+	Silent	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr17:15134333C>T	ENST00000395938.2	-	5	578	c.384G>A	c.(382-384)tcG>tcA	p.S128S	PMP22_ENST00000494511.1_Missense_Mutation_p.G69R|PMP22_ENST00000395936.1_3'UTR|PMP22_ENST00000312280.3_Silent_p.S128S	NM_001281455.1|NM_153321.1	NP_001268384.1|NP_696996.1	Q01453	PMP22_HUMAN	peripheral myelin protein 22	128					cell death (GO:0008219)|peripheral nervous system development (GO:0007422)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	8				UCEC - Uterine corpus endometrioid carcinoma (92;0.0884)|BRCA - Breast invasive adenocarcinoma(8;4.92e-06)		AGGAGTAATCCGAGTTGAGAT	0.597																																																	0								ENSG00000109099						73.0	64.0	67.0					17																	15134333		2203	4300	6503	PMP22	SO:0001819	synonymous_variant	0			-	HGNC	D11428	CCDS11168.1	17p12	2014-09-17			ENSG00000109099	ENSG00000109099			9118	protein-coding gene	gene with protein product		601097				8482547, 1497668	Standard	NM_001281456		Approved	HNPP, GAS-3, Sp110	uc002goj.3	Q01453	OTTHUMG00000058960	ENST00000395938.2:c.384G>A	17.37:g.15134333C>T		Somatic	0	64	0.00		0.5152294697123943	17	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	41	21.15	Q8WV01	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G69R	ENST00000395938.2	37	c.205	CCDS11168.1	17																																																																																			-	NULL		0.597	PMP22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMP22	protein_coding	OTTHUMT00000130378.1	C	NM_000304	-		15134333	-1	no_errors	ENST00000494511	ensembl	human	novel	74_37	missense	SNP	0.000	T
PYGO1	26108	genome.wustl.edu	37	15	55838428	55838428	+	Silent	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr15:55838428G>A	ENST00000302000.6	-	3	1147	c.1053C>T	c.(1051-1053)aaC>aaT	p.N351N	PYGO1_ENST00000563719.1_Silent_p.N351N	NM_015617.1	NP_056432.1	Q9Y3Y4	PYGO1_HUMAN	pygopus family PHD finger 1	351	Interaction with H3K4me2.				hematopoietic progenitor cell differentiation (GO:0002244)|kidney development (GO:0001822)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein localization to nucleus (GO:0034504)|spermatid nucleus differentiation (GO:0007289)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(6)|lung(6)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	27				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		CCTGATCATCGTTCACCTCGT	0.448																																																	0								ENSG00000171016						210.0	185.0	193.0					15																	55838428		2193	4292	6485	PYGO1	SO:0001819	synonymous_variant	0			-	HGNC	AF457207	CCDS10155.1	15q21.1	2013-10-09	2013-10-09		ENSG00000171016	ENSG00000171016		"""Zinc fingers, PHD-type"""	30256	protein-coding gene	gene with protein product		606902	"""pygopus homolog 1 (Drosophila)"""			11988739	Standard	NM_015617		Approved		uc002adf.1	Q9Y3Y4	OTTHUMG00000132009	ENST00000302000.6:c.1053C>T	15.37:g.55838428G>A		Somatic	0	17	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	A7Y2D6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.N351	ENST00000302000.6	37	c.1053	CCDS10155.1	15																																																																																			-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger		0.448	PYGO1-001	KNOWN	basic|CCDS	protein_coding	PYGO1	protein_coding	OTTHUMT00000254977.2	G	NM_015617	-		55838428	-1	no_errors	ENST00000302000	ensembl	human	known	74_37	silent	SNP	0.996	A
CEP78	84131	genome.wustl.edu	37	9	80879143	80879143	+	Silent	SNP	T	T	C			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr9:80879143T>C	ENST00000424347.2	+	13	1825	c.1536T>C	c.(1534-1536)aaT>aaC	p.N512N	CEP78_ENST00000376597.4_Silent_p.N513N|CEP78_ENST00000487108.2_3'UTR|CEP78_ENST00000415759.2_Silent_p.N513N|CEP78_ENST00000376598.2_Silent_p.N512N|CEP78_ENST00000277082.5_Silent_p.N512N			Q5JTW2	CEP78_HUMAN	centrosomal protein 78kDa	512					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|cervix(1)|endometrium(5)|large_intestine(7)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	21						CATTGACAAATATGATCCTGG	0.358																																																	0								ENSG00000148019						105.0	98.0	100.0					9																	80879143		1846	4089	5935	CEP78	SO:0001819	synonymous_variant	0			-	HGNC	BC058931	CCDS47984.1, CCDS47985.1	9q21.2	2014-02-20	2005-12-01	2005-12-01	ENSG00000148019	ENSG00000148019			25740	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 81"""	C9orf81		14654843	Standard	NM_001098802		Approved	FLJ12643	uc004aky.4	Q5JTW2	OTTHUMG00000020062	ENST00000424347.2:c.1536T>C	9.37:g.80879143T>C		Somatic	0	71	0.00		0.5152294697123943	3	25.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	40	39.39	A1A4S8|E9PHX5|Q5BJE3|Q5JTW0|Q5JTW1|Q9H9N3	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.N513	ENST00000424347.2	37	c.1539		9																																																																																			-	NULL		0.358	CEP78-001	KNOWN	basic|appris_candidate	protein_coding	CEP78	protein_coding	OTTHUMT00000052766.2	T	XM_095991	-		80879143	+1	no_errors	ENST00000376597	ensembl	human	known	74_37	silent	SNP	0.948	C
TTLL10	254173	genome.wustl.edu	37	1	1117778	1117778	+	Missense_Mutation	SNP	C	C	T	rs367856945		TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr1:1117778C>T	ENST00000379290.1	+	10	1041	c.868C>T	c.(868-870)Cgc>Tgc	p.R290C	TTLL10-AS1_ENST00000379317.1_RNA|TTLL10_ENST00000379289.1_Missense_Mutation_p.R290C|TTLL10_ENST00000379288.3_Missense_Mutation_p.R217C			Q6ZVT0	TTL10_HUMAN	tubulin tyrosine ligase-like family, member 10	290	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)					haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.75e-36)|OV - Ovarian serous cystadenocarcinoma(86;5.82e-22)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		AGAGACCTACCGCCTGGACCT	0.617																																																	0								ENSG00000162571		CYS/ARG,CYS/ARG	3,4403	4.2+/-10.8	0,3,2200	119.0	117.0	117.0		868,649	3.2	1.0	1		117	0,8600		0,0,4300	no	missense,missense	TTLL10	NM_001130045.1,NM_153254.2	180,180	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	probably-damaging,probably-damaging	290/674,217/405	1117778	3,13003	2203	4300	6503	TTLL10	SO:0001583	missense	0			-	HGNC	AK093438	CCDS8.1, CCDS44036.1	1p36.33	2014-01-28	2005-07-29	2005-07-29	ENSG00000162571	ENSG00000162571		"""Tubulin tyrosine ligase-like family"""	26693	protein-coding gene	gene with protein product			"""tubulin tyrosine ligase-like family, member 5"""	TTLL5		15890843	Standard	NM_153254		Approved	FLJ36119	uc001acy.2	Q6ZVT0	OTTHUMG00000000851	ENST00000379290.1:c.868C>T	1.37:g.1117778C>T	ENSP00000368592:p.Arg290Cys	Somatic	0	73	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	53	43.01	B1AMF6|Q5T2W4|Q5T2W5|Q8N9X2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TTL/TTLL_fam	p.R290C	ENST00000379290.1	37	c.868	CCDS44036.1	1	.	.	.	.	.	.	.	.	.	.	C	14.21	2.468080	0.43839	6.81E-4	0.0	ENSG00000162571	ENST00000379290;ENST00000379289;ENST00000379288	T;T;T	0.05717	3.4;3.4;3.4	3.16	3.16	0.36331	.	0.581837	0.15621	N	0.252865	T	0.17238	0.0414	L	0.52573	1.65	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.73380	0.97;0.98	T	0.01909	-1.1249	10	0.36615	T	0.2	.	12.1869	0.54245	0.0:1.0:0.0:0.0	.	217;290	Q6ZVT0-3;Q6ZVT0	.;TTL10_HUMAN	C	290;290;217	ENSP00000368592:R290C;ENSP00000368591:R290C;ENSP00000368590:R217C	ENSP00000368590:R217C	R	+	1	0	TTLL10	1107641	1.000000	0.71417	0.968000	0.41197	0.038000	0.13279	6.094000	0.71431	1.793000	0.52555	0.479000	0.44913	CGC	-	pfam_TTL/TTLL_fam		0.617	TTLL10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL10	protein_coding	OTTHUMT00000002421.3	C	NM_153254	-		1117778	+1	no_errors	ENST00000379289	ensembl	human	known	74_37	missense	SNP	1.000	T
LAMA2	3908	genome.wustl.edu	37	6	129826487	129826487	+	Missense_Mutation	SNP	G	G	A	rs201696115		TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr6:129826487G>A	ENST00000421865.2	+	61	8739	c.8690G>A	c.(8689-8691)cGa>cAa	p.R2897Q		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2897	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TACACTACCCGAAGAATTGGT	0.403																																																	0								ENSG00000196569						82.0	83.0	83.0					6																	129826487		2203	4300	6503	LAMA2	SO:0001583	missense	0			-	HGNC	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.8690G>A	6.37:g.129826487G>A	ENSP00000400365:p.Arg2897Gln	Somatic	0	71	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	54	21.74	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.R2897Q	ENST00000421865.2	37	c.8690	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	G	21.9	4.220377	0.79464	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865;ENST00000443169	T	0.75821	-0.97	5.78	4.91	0.64330	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.102971	0.64402	D	0.000002	T	0.46483	0.1395	L	0.40543	1.245	0.40440	D	0.980034	D;D	0.53312	0.959;0.959	B;B	0.37692	0.256;0.256	T	0.51442	-0.8705	9	.	.	.	.	9.1664	0.37054	0.2165:0.0:0.7835:0.0	.	2898;2897	A6NF00;P24043	.;LAMA2_HUMAN	Q	2897;2896;2897;915	ENSP00000400365:R2897Q	.	R	+	2	0	LAMA2	129868180	0.998000	0.40836	0.759000	0.31340	0.997000	0.91878	2.929000	0.48916	1.448000	0.47680	0.655000	0.94253	CGA	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.403	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	protein_coding	OTTHUMT00000042180.1	G		rs201696115		129826487	+1	no_errors	ENST00000421865	ensembl	human	known	74_37	missense	SNP	0.985	A
GSX2	170825	genome.wustl.edu	37	4	54968099	54968099	+	3'UTR	SNP	T	T	C			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr4:54968099T>C	ENST00000326902.2	+	0	1239				AC110298.1_ENST00000408292.1_RNA|GSX2_ENST00000503800.1_3'UTR|FIP1L1_ENST00000507166.1_Intron|GSX2_ENST00000548609.1_3'UTR	NM_133267.2	NP_573574.1	Q9BZM3	GSX2_HUMAN	GS homeobox 2						forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain morphogenesis (GO:0048853)|hindbrain morphogenesis (GO:0021575)|neuron fate specification (GO:0048665)|olfactory bulb interneuron differentiation (GO:0021889)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of transcription, DNA-templated (GO:0006355)|spinal cord association neuron differentiation (GO:0021527)|subpallium neuron fate commitment (GO:0060163)|telencephalon regionalization (GO:0021978)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(2)|lung(2)	6	all_cancers(7;0.00671)|Lung NSC(11;0.0154)|all_neural(26;0.0209)|Glioma(25;0.08)|all_epithelial(27;0.147)		LUSC - Lung squamous cell carcinoma(32;0.00216)			AGGGAGGGCCTCCTCCCTCAC	0.647																																																	0								ENSG00000180613						16.0	17.0	16.0					4																	54968099		2201	4293	6494	GSX2	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS3494.1	4q12	2012-03-09			ENSG00000180613	ENSG00000180613		"""Homeoboxes / ANTP class : HOXL subclass"""	24959	protein-coding gene	gene with protein product						11861295, 12205114	Standard	NM_133267		Approved	Gsh2	uc010igp.1	Q9BZM3	OTTHUMG00000128696	ENST00000326902.2:c.*10T>C	4.37:g.54968099T>C		Somatic	0	68	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	41	19.61		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000326902.2	37	NULL	CCDS3494.1	4																																																																																			-	-		0.647	GSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSX2	protein_coding	OTTHUMT00000250595.1	T	NM_133267	-		54968099	+1	no_errors	ENST00000548609	ensembl	human	known	74_37	rna	SNP	0.000	C
KIAA1731	85459	genome.wustl.edu	37	11	93400776	93400776	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr11:93400776C>T	ENST00000325212.6	+	3	274	c.112C>T	c.(112-114)Cga>Tga	p.R38*	KIAA1731_ENST00000411936.1_Nonsense_Mutation_p.R38*|KIAA1731_ENST00000344196.4_5'UTR			Q9C0D2	K1731_HUMAN	KIAA1731	38						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TCTTTAGGTTCGAGAACAAGA	0.343																																																	0								ENSG00000166004						43.0	35.0	37.0					11																	93400776		692	1590	2282	KIAA1731	SO:0001587	stop_gained	0			-	HGNC	AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.112C>T	11.37:g.93400776C>T	ENSP00000316681:p.Arg38*	Somatic	0	96	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	29	27.50	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R38*	ENST00000325212.6	37	c.112	CCDS44708.1	11	.	.	.	.	.	.	.	.	.	.	C	34	5.407002	0.96051	.	.	ENSG00000166004	ENST00000325212;ENST00000411936	.	.	.	5.12	2.92	0.33932	.	0.000000	0.56097	D	0.000029	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.0702	11.7244	0.51702	0.5922:0.4078:0.0:0.0	.	.	.	.	X	38	.	ENSP00000316681:R38X	R	+	1	2	KIAA1731	93040424	1.000000	0.71417	1.000000	0.80357	0.728000	0.41692	2.101000	0.41787	1.268000	0.44264	-0.182000	0.12963	CGA	-	NULL		0.343	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1731	protein_coding	OTTHUMT00000394640.1	C	NM_033395	-		93400776	+1	no_errors	ENST00000411936	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ZFYVE19	84936	genome.wustl.edu	37	15	41101257	41101257	+	Intron	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr15:41101257C>T	ENST00000355341.4	+	2	780				ZFYVE19_ENST00000570108.1_Intron|ZFYVE19_ENST00000299173.10_Intron|ZFYVE19_ENST00000564258.1_Intron|ZFYVE19_ENST00000336455.5_Intron|DNAJC17_ENST00000220496.4_5'Flank|ZFYVE19_ENST00000563530.1_3'UTR	NM_001077268.1	NP_001070736.1	Q96K21	ANCHR_HUMAN	zinc finger, FYVE domain containing 19						abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis checkpoint (GO:0031565)|negative regulation of cytokinesis (GO:0032466)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|midbody (GO:0030496)	phosphatidylinositol-3-phosphate binding (GO:0032266)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		TTGGAGAGTCCCTGGGAGCAG	0.567																																																	0								ENSG00000166140																																			ZFYVE19	SO:0001627	intron_variant	0			-	HGNC	AK027746	CCDS42025.1, CCDS58353.1, CCDS58354.1, CCDS58355.1	15q14	2008-05-02				ENSG00000166140		"""Zinc fingers, FYVE domain containing"""	20758	protein-coding gene	gene with protein product							Standard	NM_001077268		Approved	FLJ14840	uc031qrk.1	Q96K21		ENST00000355341.4:c.280-60C>T	15.37:g.41101257C>T		Somatic	0	57	0.00		0.5152294697123943	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B3KVB2|C9JNF4|H3BUF9|Q86WC2|Q8WU96	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000355341.4	37	NULL	CCDS42025.1	15																																																																																			-	-		0.567	ZFYVE19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFYVE19	protein_coding	OTTHUMT00000418996.1	C	NM_032850	-		41101257	+1	no_errors	ENST00000563530	ensembl	human	known	74_37	rna	SNP	0.004	T
RNASE2	6036	genome.wustl.edu	37	14	21424364	21424364	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr14:21424364G>A	ENST00000304625.2	+	2	524	c.434G>A	c.(433-435)cGa>cAa	p.R145Q		NM_002934.2	NP_002925.1	P10153	RNAS2_HUMAN	ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin)	145					chemotaxis (GO:0006935)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)|ribonuclease activity (GO:0004540)			breast(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	17	all_cancers(95;0.00381)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)		GATCAACGACGAGACCCTCCA	0.468																																																	0								ENSG00000169385						125.0	123.0	124.0					14																	21424364		2203	4300	6503	RNASE2	SO:0001583	missense	0			-	HGNC	X55988	CCDS9561.1	14q11.2	2014-03-13			ENSG00000169385	ENSG00000169385		"""Ribonucleases, RNase A"""	10045	protein-coding gene	gene with protein product		131410		RNS2		1577491, 2734298	Standard	NM_002934		Approved	EDN	uc001vyl.1	P10153	OTTHUMG00000029607	ENST00000304625.2:c.434G>A	14.37:g.21424364G>A	ENSP00000303276:p.Arg145Gln	Somatic	0	77	0.00		0.5152294697123943	123	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	53	50.47	Q52M39|Q9H2B7|Q9UCG7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	p.R145Q	ENST00000304625.2	37	c.434	CCDS9561.1	14	.	.	.	.	.	.	.	.	.	.	g	1.685	-0.505460	0.04261	.	.	ENSG00000169385	ENST00000304625	T	0.13538	2.58	2.88	-4.08	0.03963	Ribonuclease A, domain (4);	.	.	.	.	T	0.06917	0.0176	L	0.32530	0.975	0.09310	N	1	P	0.36874	0.572	B	0.28991	0.097	T	0.36817	-0.9732	9	0.10377	T	0.69	.	9.2925	0.37795	0.6961:0.0:0.3039:0.0	.	145	P10153	RNAS2_HUMAN	Q	145	ENSP00000303276:R145Q	ENSP00000303276:R145Q	R	+	2	0	RNASE2	20494204	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.672000	0.00843	-1.128000	0.02922	-1.280000	0.01385	CGA	-	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain		0.468	RNASE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASE2	protein_coding	OTTHUMT00000073799.2	G		-		21424364	+1	no_errors	ENST00000304625	ensembl	human	known	74_37	missense	SNP	0.000	A
FAM83G	644815	genome.wustl.edu	37	17	18881217	18881217	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr17:18881217C>T	ENST00000388995.6	-	5	1985	c.1762G>A	c.(1762-1764)Gta>Ata	p.V588I	SLC5A10_ENST00000395647.2_Intron|SLC5A10_ENST00000395643.2_Intron|SLC5A10_ENST00000417251.2_Intron|FAM83G_ENST00000585154.2_Missense_Mutation_p.V588I|SLC5A10_ENST00000395642.1_Intron|FAM83G_ENST00000345041.4_Missense_Mutation_p.V588I|SLC5A10_ENST00000317977.6_Intron|SLC5A10_ENST00000395645.3_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	588					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						CTGAGGGTTACGTAGTCGTCA	0.637																																																	0								ENSG00000188522						43.0	50.0	47.0					17																	18881217		2027	4165	6192	FAM83G	SO:0001583	missense	0			-	HGNC	AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.1762G>A	17.37:g.18881217C>T	ENSP00000373647:p.Val588Ile	Somatic	0	25	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	19	26.92	Q3KQZ4|Q6ZW60	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1669	p.V588I	ENST00000388995.6	37	c.1762	CCDS42276.1	17	.	.	.	.	.	.	.	.	.	.	C	8.715	0.912901	0.17907	.	.	ENSG00000188522	ENST00000388995;ENST00000345041	T;T	0.13901	2.55;2.55	5.91	3.81	0.43845	.	0.606625	0.15652	N	0.251339	T	0.12774	0.0310	L	0.55103	1.725	0.30727	N	0.747607	B	0.26708	0.157	B	0.15052	0.012	T	0.18398	-1.0338	10	0.14252	T	0.57	-18.1311	11.2998	0.49298	0.0:0.7548:0.0:0.2452	.	588	A6ND36	FA83G_HUMAN	I	588	ENSP00000373647:V588I;ENSP00000343279:V588I	ENSP00000343279:V588I	V	-	1	0	FAM83G	18821942	0.526000	0.26298	0.663000	0.29738	0.839000	0.47603	0.827000	0.27421	0.344000	0.23847	-0.797000	0.03246	GTA	-	NULL		0.637	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM83G	protein_coding	OTTHUMT00000253108.4	C		-		18881217	-1	no_errors	ENST00000345041	ensembl	human	known	74_37	missense	SNP	0.853	T
AFF2	2334	genome.wustl.edu	37	X	147967440	147967440	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chrX:147967440G>T	ENST00000370460.2	+	8	1763	c.1284G>T	c.(1282-1284)aaG>aaT	p.K428N	AFF2_ENST00000370457.5_Missense_Mutation_p.K395N|AFF2_ENST00000342251.3_Missense_Mutation_p.K395N|AFF2_ENST00000286437.5_Missense_Mutation_p.K69N|AFF2_ENST00000370458.1_Missense_Mutation_p.K389N	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	428					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					ATGACCTGAAGCTGAGCAGTG	0.448																																																	0								ENSG00000155966						342.0	294.0	311.0					X																	147967440		2203	4300	6503	AFF2	SO:0001583	missense	0			-	HGNC	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1284G>T	X.37:g.147967440G>T	ENSP00000359489:p.Lys428Asn	Somatic	0	32	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_AF4/FMR2	p.K428N	ENST00000370460.2	37	c.1284	CCDS14684.1	X	.	.	.	.	.	.	.	.	.	.	G	16.59	3.165033	0.57476	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458;ENST00000286437	T;T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47;-0.47	5.45	4.47	0.54385	.	0.058459	0.64402	D	0.000004	T	0.80110	0.4563	M	0.73598	2.24	0.46131	D	0.998887	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;0.998	D;D;D;D;D;D;D	0.87578	0.998;0.997;0.997;0.997;0.997;0.998;0.943	T	0.81008	-0.1127	10	0.72032	D	0.01	.	5.5048	0.16848	0.2821:0.0:0.7179:0.0	.	69;393;395;389;418;428;389	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;.;AFF2_HUMAN;.	N	428;395;395;389;69	ENSP00000359489:K428N;ENSP00000359486:K395N;ENSP00000345459:K395N;ENSP00000359487:K389N;ENSP00000286437:K69N	ENSP00000286437:K69N	K	+	3	2	AFF2	147775133	1.000000	0.71417	0.998000	0.56505	0.599000	0.36880	2.078000	0.41567	2.259000	0.74868	0.594000	0.82650	AAG	-	pfam_TF_AF4/FMR2		0.448	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	protein_coding	OTTHUMT00000058673.2	G	NM_002025	-		147967440	+1	no_errors	ENST00000370460	ensembl	human	known	74_37	missense	SNP	0.999	T
NPIPB11	728888	genome.wustl.edu	37	16	29394893	29394895	+	In_Frame_Del	DEL	TAT	TAT	-			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	TAT	TAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr16:29394893_29394895delTAT	ENST00000524087.1	-	8	1432_1434	c.1358_1360delATA	c.(1357-1362)aatatc>atc	p.N453del	SNX29P2_ENST00000398878.3_lincRNA			E5RHQ5	NPB11_HUMAN	nuclear pore complex interacting protein family, member B11	453	Pro-rich.					integral component of membrane (GO:0016021)											GGTGTCTTGATATTATCATCTGC	0.591																																																	0								ENSG00000254206																																			NPIPB11	SO:0001651	inframe_deletion	0				HGNC			16p11.2	2013-06-11			ENSG00000254206	ENSG00000254206			37453	protein-coding gene	gene with protein product							Standard	XM_006721110		Approved			E5RHQ5	OTTHUMG00000170467	ENST00000524087.1:c.1358_1360delATA	16.37:g.29394896_29394898delTAT	ENSP00000430853:p.Asn453del	Somatic	0	12	0.00		0.5152294697123943	18	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	9	47.06		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.N453in_frame_del	ENST00000524087.1	37	c.1360_1358		16																																																																																			-	NULL		0.591	NPIPB11-001	PUTATIVE	not_best_in_genome_evidence|basic|appris_principal	protein_coding	NPIPB11	protein_coding	OTTHUMT00000374094.1	TAT	XM_002343430			29394895	-1	no_errors	ENST00000524087	ensembl	human	putative	74_37	in_frame_del	DEL	0.023:0.025:0.027	-
HIST1H4C	8364	genome.wustl.edu	37	6	26104193	26104193	+	Silent	SNP	A	A	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr6:26104193A>G	ENST00000377803.2	+	1	90	c.18A>G	c.(16-18)aaA>aaG	p.K6K		NM_003542.3	NP_003533.1	P62805	H4_HUMAN	histone cluster 1, H4c	6					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)	7						GTCGCGGCAAAGGCGGAAAAG	0.498																																																	0								ENSG00000197061						53.0	55.0	54.0					6																	26104193		2203	4300	6503	HIST1H4C	SO:0001819	synonymous_variant	0			-	HGNC	X60486	CCDS4583.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000197061	ENSG00000197061		"""Histones / Replication-dependent"""	4787	protein-coding gene	gene with protein product		602827	"""H4 histone family, member G"", ""histone 1, H4c"""	H4FG		9119399, 12408966	Standard	NM_003542		Approved	H4/g, dJ221C16.1	uc003ngi.3	P62805	OTTHUMG00000014429	ENST00000377803.2:c.18A>G	6.37:g.26104193A>G		Somatic	0	29	0.00		0.5152294697123943	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	12	45.83	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.K6	ENST00000377803.2	37	c.18	CCDS4583.1	6																																																																																			-	superfamily_Histone-fold,prints_Histone_H4		0.498	HIST1H4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4C	protein_coding	OTTHUMT00000040092.2	A	NM_003542	-		26104193	+1	no_errors	ENST00000377803	ensembl	human	known	74_37	silent	SNP	0.254	G
SARDH	1757	genome.wustl.edu	37	9	136535785	136535785	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr9:136535785G>A	ENST00000371872.4	-	19	2673	c.2416C>T	c.(2416-2418)Ccc>Tcc	p.P806S	SARDH_ENST00000371868.1_Missense_Mutation_p.P234S|SARDH_ENST00000422262.2_Missense_Mutation_p.P638S|SARDH_ENST00000439388.1_Missense_Mutation_p.P806S	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	806					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CCCAGGAAGGGCACCGGCGAC	0.701																																																	0								ENSG00000123453						13.0	13.0	13.0					9																	136535785		2175	4273	6448	SARDH	SO:0001583	missense	0			-	HGNC		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.2416C>T	9.37:g.136535785G>A	ENSP00000360938:p.Pro806Ser	Somatic	0	76	0.00		0.5152294697123943	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	50	10.71	B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C	p.P806S	ENST00000371872.4	37	c.2416	CCDS6978.1	9	.	.	.	.	.	.	.	.	.	.	G	16.96	3.266732	0.59540	.	.	ENSG00000123453	ENST00000371872;ENST00000371868;ENST00000439388;ENST00000422262	D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64	5.01	4.1	0.47936	.	0.000000	0.85682	D	0.000000	D	0.85522	0.5716	L	0.52206	1.635	0.80722	D	1	P;P	0.43750	0.814;0.816	P;P	0.52343	0.696;0.688	D	0.86070	0.1537	10	0.56958	D	0.05	-23.641	15.5165	0.75828	0.0:0.1386:0.8614:0.0	.	806;234	Q9UL12;Q5SYV2	SARDH_HUMAN;.	S	806;234;806;638	ENSP00000360938:P806S;ENSP00000360934:P234S;ENSP00000403084:P806S;ENSP00000415537:P638S	ENSP00000360934:P234S	P	-	1	0	SARDH	135525606	1.000000	0.71417	0.959000	0.39883	0.246000	0.25737	7.494000	0.81503	1.084000	0.41184	0.585000	0.79938	CCC	-	NULL		0.701	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SARDH	protein_coding	OTTHUMT00000054931.1	G		-		136535785	-1	no_errors	ENST00000371872	ensembl	human	known	74_37	missense	SNP	1.000	A
VCX2	51480	genome.wustl.edu	37	X	8138101	8138101	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chrX:8138101A>T	ENST00000317103.4	-	3	698	c.392T>A	c.(391-393)tTt>tAt	p.F131Y		NM_016378.2	NP_057462.2	Q9H322	VCX2_HUMAN	variable charge, X-linked 2	131										endometrium(1)	1		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)				GACAGGGGAAAAGCTGGCCAT	0.572																																																	0								ENSG00000177504						105.0	100.0	101.0					X																	8138101		2201	4283	6484	VCX2	SO:0001583	missense	0			-	HGNC	AF159127	CCDS35200.1	Xp22.32	2008-02-05			ENSG00000177504	ENSG00000177504			18158	protein-coding gene	gene with protein product		300532				10607842	Standard	NM_016378		Approved	VCX-2r, VCX-2R	uc004csb.3	Q9H322	OTTHUMG00000021105	ENST00000317103.4:c.392T>A	X.37:g.8138101A>T	ENSP00000321309:p.Phe131Tyr	Somatic	0	70	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	20	64.91	A3KPB6|Q4V9T2|Q9P0H5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.F131Y	ENST00000317103.4	37	c.392	CCDS35200.1	X	.	.	.	.	.	.	.	.	.	.	T	4.936	0.173830	0.09391	.	.	ENSG00000177504	ENST00000317103	T	0.15718	2.4	.	.	.	.	.	.	.	.	T	0.06690	0.0171	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.46091	-0.9216	7	0.02654	T	1	.	.	.	.	.	131	Q9H322	VCX2_HUMAN	Y	131	ENSP00000321309:F131Y	ENSP00000321309:F131Y	F	-	2	0	VCX2	8098101	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.906000	0.04071	-2.269000	0.00684	-2.333000	0.00248	TTT	-	NULL		0.572	VCX2-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	VCX2	protein_coding	OTTHUMT00000055690.1	A	NM_016378	-		8138101	-1	no_errors	ENST00000317103	ensembl	human	known	74_37	missense	SNP	0.000	T
MEIS3	56917	genome.wustl.edu	37	19	47909762	47909762	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr19:47909762T>A	ENST00000558555.1	-	12	1287	c.1100A>T	c.(1099-1101)aAc>aTc	p.N367I	MEIS3_ENST00000560253.1_Intron|MEIS3_ENST00000561096.1_Missense_Mutation_p.N455I|MEIS3_ENST00000441740.2_Missense_Mutation_p.N350I|MEIS3_ENST00000561293.1_Missense_Mutation_p.N413I|MEIS3_ENST00000331559.5_Missense_Mutation_p.N396I|MEIS3_ENST00000559524.1_Missense_Mutation_p.N413I			Q99687	MEIS3_HUMAN	Meis homeobox 3	367				MSLNLEG -> DEFGTRKE (in Ref. 5). {ECO:0000305}.	negative regulation of apoptotic signaling pathway (GO:2001234)|positive regulation of protein kinase B signaling (GO:0051897)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			breast(1)|large_intestine(5)|lung(11)|prostate(1)|skin(2)	20		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000198)|OV - Ovarian serous cystadenocarcinoma(262;0.000439)|Epithelial(262;0.0113)|GBM - Glioblastoma multiforme(486;0.0223)		TCCTTCCAAGTTCAAACTCAT	0.493																																																	0								ENSG00000105419						101.0	90.0	94.0					19																	47909762		2203	4300	6503	MEIS3	SO:0001583	missense	0			-	HGNC	BC025404	CCDS33064.1, CCDS46132.1, CCDS74406.1	19q13.32	2012-10-02	2007-02-15		ENSG00000105419	ENSG00000105419		"""Homeoboxes / TALE class"""	29537	protein-coding gene	gene with protein product			"""Meis1, myeloid ecotropic viral integration site 1 homolog 3 (mouse)"""			8950991	Standard	NM_020160		Approved	MRG2, DKFZp547H236	uc002pgt.4	Q99687	OTTHUMG00000172280	ENST00000558555.1:c.1100A>T	19.37:g.47909762T>A	ENSP00000454073:p.Asn367Ile	Somatic	0	48	0.00		0.5152294697123943	385	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	A8K1N5|Q6NT73|Q8TC66|Q9NPW2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.N413I	ENST00000558555.1	37	c.1238		19	.	.	.	.	.	.	.	.	.	.	T	13.73	2.324206	0.41197	.	.	ENSG00000105419	ENST00000331559;ENST00000441740;ENST00000437609	D	0.87491	-2.26	3.55	3.55	0.40652	.	0.270402	0.31041	N	0.008368	D	0.88966	0.6581	L	0.44542	1.39	0.33667	D	0.610467	D;P;D;D	0.76494	0.997;0.57;0.958;0.999	P;B;P;D	0.75020	0.879;0.254;0.74;0.985	D	0.90927	0.4787	10	0.87932	D	0	-43.1811	8.7894	0.34841	0.0:0.0:0.0:1.0	.	259;367;350;413	Q8TCW1;Q99687;Q99687-3;Q99687-2	.;MEIS3_HUMAN;.;.	I	413;350;44	ENSP00000388667:N350I	ENSP00000333552:N413I	N	-	2	0	MEIS3	52601574	1.000000	0.71417	0.996000	0.52242	0.953000	0.61014	1.873000	0.39558	1.857000	0.53885	0.352000	0.21897	AAC	-	NULL		0.493	MEIS3-005	NOVEL	basic|appris_candidate_longest	protein_coding	MEIS3	protein_coding	OTTHUMT00000417642.1	T	XM_085929	-		47909762	-1	no_errors	ENST00000559524	ensembl	human	known	74_37	missense	SNP	0.996	A
PHLDB1	23187	genome.wustl.edu	37	11	118498020	118498020	+	Splice_Site	SNP	G	G	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr11:118498020G>T	ENST00000361417.2	+	7	892		c.e7-1		PHLDB1_ENST00000356063.5_Splice_Site	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1											breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		TTTCCCTCCAGCAGAATCAGA	0.532																																																	0								ENSG00000019144						54.0	53.0	53.0					11																	118498020		2200	4295	6495	PHLDB1	SO:0001630	splice_region_variant	0			-	HGNC		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.482-1G>T	11.37:g.118498020G>T		Somatic	0	85	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e5-1	ENST00000361417.2	37	c.482-1	CCDS8401.1	11	.	.	.	.	.	.	.	.	.	.	G	0.514	-0.865014	0.02590	.	.	ENSG00000019144	ENST00000361417;ENST00000545313;ENST00000356063	.	.	.	5.82	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.23893	N	0.996545	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9625	0.53017	0.0807:0.0:0.9193:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PHLDB1	118003230	0.403000	0.25319	0.078000	0.20375	0.050000	0.14768	0.837000	0.27558	1.466000	0.48025	0.563000	0.77884	.	-	-		0.532	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	protein_coding	OTTHUMT00000389279.1	G	NM_015157	-	Intron	118498020	+1	no_errors	ENST00000361417	ensembl	human	known	74_37	splice_site	SNP	0.174	T
PLEKHM2	23207	genome.wustl.edu	37	1	16054813	16054813	+	Missense_Mutation	SNP	G	G	A	rs199779846		TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr1:16054813G>A	ENST00000375799.3	+	11	2109	c.1882G>A	c.(1882-1884)Gtg>Atg	p.V628M	PLEKHM2_ENST00000375793.2_Missense_Mutation_p.V608M|RP11-288I21.1_ENST00000453804.1_RNA	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	628					Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		GCTGCTGTACGTGCTGCTCAC	0.642																																																	0								ENSG00000116786						39.0	47.0	45.0					1																	16054813		2149	4255	6404	PLEKHM2	SO:0001583	missense	0			-	HGNC	AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.1882G>A	1.37:g.16054813G>A	ENSP00000364956:p.Val628Met	Somatic	0	41	0.00		0.5152294697123943	15	6.25	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	21	36.36	O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Run,pfam_Pleckstrin_homology,smart_Run,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Run	p.V628M	ENST00000375799.3	37	c.1882	CCDS44063.1	1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.570298	0.86542	.	.	ENSG00000116786	ENST00000375799;ENST00000375793	T;T	0.55234	0.54;0.53	5.61	5.61	0.85477	.	0.144546	0.49305	D	0.000154	T	0.53158	0.1779	N	0.24115	0.695	0.54753	D	0.999981	D	0.63880	0.993	P	0.52758	0.708	T	0.57757	-0.7756	10	0.72032	D	0.01	-23.3302	17.8127	0.88620	0.0:0.0:1.0:0.0	.	628	Q8IWE5	PKHM2_HUMAN	M	628;608	ENSP00000364956:V628M;ENSP00000364950:V608M	ENSP00000364950:V608M	V	+	1	0	PLEKHM2	15927400	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.546000	0.73887	2.652000	0.90054	0.655000	0.94253	GTG	-	NULL		0.642	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM2	protein_coding	OTTHUMT00000008463.1	G	NM_015164	rs199779846		16054813	+1	no_errors	ENST00000375799	ensembl	human	known	74_37	missense	SNP	1.000	A
RQCD1	9125	genome.wustl.edu	37	2	219458967	219458967	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr2:219458967G>A	ENST00000273064.6	+	8	1243	c.868G>A	c.(868-870)Gat>Aat	p.D290N	RQCD1_ENST00000509807.2_Missense_Mutation_p.D322N|RQCD1_ENST00000542068.1_Missense_Mutation_p.D290N	NM_005444.2	NP_005435.1	Q92600	RCD1_HUMAN	RCD1 required for cell differentiation1 homolog (S. pombe)	290					cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of ligand-dependent nuclear receptor transcription coactivator activity (GO:2000327)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|sex differentiation (GO:0007548)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)	15		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000192)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCAGGTCACCGATCCCCGGGG	0.577																																																	0								ENSG00000144580						67.0	63.0	64.0					2																	219458967		2203	4300	6503	RQCD1	SO:0001583	missense	0			-	HGNC	D87957	CCDS33379.1, CCDS63123.1	2q35	2010-04-23	2001-11-28		ENSG00000144580	ENSG00000144580			10445	protein-coding gene	gene with protein product	"""cancer/testis antigen 129"""	612054	"""rcd1 (required for cell differentiation, S.pombe) homolog 1"""			9447985	Standard	NM_001271634		Approved	RCD1, RCD1+, CNOT9, CT129	uc010zki.3	Q92600	OTTHUMG00000154750	ENST00000273064.6:c.868G>A	2.37:g.219458967G>A	ENSP00000273064:p.Asp290Asn	Somatic	0	67	0.00		0.5152294697123943	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B2RPI0|B5MDQ4|B7Z1E5|Q96IX4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rcd1,superfamily_ARM-type_fold	p.D322N	ENST00000273064.6	37	c.964	CCDS33379.1	2	.	.	.	.	.	.	.	.	.	.	G	11.95	1.791239	0.31685	.	.	ENSG00000144580	ENST00000273064;ENST00000509807;ENST00000542068	T;T;T	0.44482	0.92;1.5;0.92	5.71	4.83	0.62350	.	0.044027	0.85682	D	0.000000	T	0.25865	0.0630	N	0.20986	0.625	0.80722	D	1	P;P	0.48640	0.913;0.804	B;B	0.36378	0.223;0.06	T	0.04203	-1.0969	10	0.12103	T	0.63	-6.0835	16.1593	0.81686	0.0:0.0:0.8656:0.1344	.	322;290	B7Z1E5;Q92600	.;RCD1_HUMAN	N	290;322;290	ENSP00000273064:D290N;ENSP00000441357:D322N;ENSP00000443687:D290N	ENSP00000273064:D290N	D	+	1	0	RQCD1	219167211	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	9.754000	0.98908	1.404000	0.46819	0.591000	0.81541	GAT	-	NULL		0.577	RQCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RQCD1	protein_coding	OTTHUMT00000336920.1	G	NM_005444	-		219458967	+1	no_errors	ENST00000509807	ensembl	human	known	74_37	missense	SNP	1.000	A
ROBO3	64221	genome.wustl.edu	37	11	124738935	124738935	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr11:124738935G>A	ENST00000397801.1	+	2	590	c.398G>A	c.(397-399)cGc>cAc	p.R133H	ROBO3_ENST00000538940.1_Missense_Mutation_p.R111H	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	133	Ig-like C2-type 1.				axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		CACGGGCGCCGCGCGCGGCCG	0.701																																																	0								ENSG00000154134						10.0	12.0	12.0					11																	124738935		1909	4097	6006	ROBO3	SO:0001583	missense	0			-	HGNC	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.398G>A	11.37:g.124738935G>A	ENSP00000380903:p.Arg133His	Somatic	0	36	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	12	40.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R133H	ENST00000397801.1	37	c.398	CCDS44755.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.301445	0.95601	.	.	ENSG00000154134	ENST00000397801;ENST00000538940	T;T	0.65178	-0.14;-0.13	5.03	4.12	0.48240	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	0.177399	0.27406	N	0.019506	T	0.67287	0.2877	N	0.25647	0.755	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.69194	-0.5209	10	0.56958	D	0.05	.	12.8358	0.57771	0.0801:0.0:0.9199:0.0	.	133	Q96MS0	ROBO3_HUMAN	H	133;111	ENSP00000380903:R133H;ENSP00000441797:R111H	ENSP00000380903:R133H	R	+	2	0	ROBO3	124244145	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.627000	0.67784	1.124000	0.41980	0.462000	0.41574	CGC	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.701	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO3	protein_coding	OTTHUMT00000387091.1	G	XM_370663	-		124738935	+1	no_errors	ENST00000397801	ensembl	human	known	74_37	missense	SNP	1.000	A
PPIL6	285755	genome.wustl.edu	37	6	109714072	109714072	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr6:109714072A>G	ENST00000521072.2	-	8	1473	c.893T>C	c.(892-894)aTa>aCa	p.I298T	PPIL6_ENST00000440797.2_Missense_Mutation_p.I324T|PPIL6_ENST00000424445.2_Missense_Mutation_p.I266T	NM_173672.4	NP_775943.1	Q8IXY8	PPIL6_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 6	298	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)		peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			large_intestine(3)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.00684)|BRCA - Breast invasive adenocarcinoma(108;0.00889)|all cancers(137;0.0106)|OV - Ovarian serous cystadenocarcinoma(136;0.0259)		ACACATATGTATTGGTCTTTC	0.318																																																	0								ENSG00000185250						225.0	204.0	211.0					6																	109714072		2203	4300	6503	PPIL6	SO:0001583	missense	0			-	HGNC		CCDS5074.1, CCDS47466.1, CCDS47466.2, CCDS69169.1	6q21	2009-11-18			ENSG00000185250	ENSG00000185250			21557	protein-coding gene	gene with protein product	"""radial spoke 12 homolog (Chlamydomonas)"""						Standard	NM_173672		Approved	bA425D10.6, MGC41939, dJ919F19.1, RSPH12	uc010kdp.3	Q8IXY8	OTTHUMG00000036593	ENST00000521072.2:c.893T>C	6.37:g.109714072A>G	ENSP00000427929:p.Ile298Thr	Somatic	0	39	0.00		0.5152294697123943	27	41.30	19	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	A9NIU0|A9NIU9|E7EX15	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.I298T	ENST00000521072.2	37	c.893	CCDS5074.1	6	.	.	.	.	.	.	.	.	.	.	A	5.536	0.283757	0.10458	.	.	ENSG00000185250	ENST00000424445;ENST00000440797;ENST00000521072	T;T;T	0.41758	0.99;0.99;0.99	5.39	0.0629	0.14346	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (3);Cyclophilin-like (1);	0.800802	0.11154	N	0.593822	T	0.04182	0.0116	N	0.02985	-0.445	0.09310	N	1	B;B;B	0.12013	0.003;0.003;0.005	B;B;B	0.12156	0.007;0.007;0.007	T	0.42172	-0.9467	10	0.13108	T	0.6	-1.0202	3.422	0.07397	0.504:0.0:0.2207:0.2754	.	324;266;298	A9NIU9;E7EX15;Q8IXY8	.;.;PPIL6_HUMAN	T	266;324;298	ENSP00000407731:I266T;ENSP00000392257:I324T;ENSP00000427929:I298T	ENSP00000407731:I266T	I	-	2	0	PPIL6	109820765	0.002000	0.14202	0.001000	0.08648	0.085000	0.17905	0.709000	0.25734	-0.134000	0.11516	-0.516000	0.04426	ATA	-	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom		0.318	PPIL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIL6	protein_coding	OTTHUMT00000089003.4	A		-		109714072	-1	no_errors	ENST00000521072	ensembl	human	known	74_37	missense	SNP	0.001	G
PLA2G4F	255189	genome.wustl.edu	37	15	42436674	42436674	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr15:42436674G>T	ENST00000382396.4	-	17	2035	c.1949C>A	c.(1948-1950)gCt>gAt	p.A650D	PLA2G4F_ENST00000397272.3_Missense_Mutation_p.A652D			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	650	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		CTCCCTGCCAGCCACATAGTC	0.612																																																	0								ENSG00000168907						67.0	60.0	62.0					15																	42436674		2203	4299	6502	PLA2G4F	SO:0001583	missense	0			-	HGNC		CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.1949C>A	15.37:g.42436674G>T	ENSP00000371833:p.Ala650Asp	Somatic	0	50	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q6ZMC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LysoPLipase_cat_dom,pfam_C2_dom,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_dom,smart_C2_dom,smart_LysoPLipase_cat_dom,pfscan_C2_dom,pfscan_LysoPLipase_cat_dom	p.A652D	ENST00000382396.4	37	c.1955	CCDS32204.1	15	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241659	0.58995	.	.	ENSG00000168907	ENST00000290497;ENST00000397272;ENST00000382396;ENST00000443825	T;T	0.12569	2.67;2.67	5.84	4.9	0.64082	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.541645	0.18219	N	0.147939	T	0.11410	0.0278	L	0.46157	1.445	0.09310	N	1	B;B	0.31680	0.335;0.335	B;B	0.25140	0.058;0.058	T	0.15178	-1.0446	10	0.26408	T	0.33	-10.2029	9.7032	0.40200	0.0:0.2098:0.5624:0.2277	.	437;650	A2RRC4;Q68DD2	.;PA24F_HUMAN	D	646;652;650;650	ENSP00000380442:A652D;ENSP00000371833:A650D	ENSP00000290497:A646D	A	-	2	0	PLA2G4F	40223966	0.000000	0.05858	0.064000	0.19789	0.938000	0.57974	0.604000	0.24164	2.758000	0.94735	0.609000	0.83330	GCT	-	superfamily_Acyl_Trfase/lysoPLipase,smart_LysoPLipase_cat_dom,pfscan_LysoPLipase_cat_dom		0.612	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLA2G4F	protein_coding	OTTHUMT00000420463.1	G	NM_213600	-		42436674	-1	no_errors	ENST00000397272	ensembl	human	known	74_37	missense	SNP	0.011	T
TDRD7	23424	genome.wustl.edu	37	9	100240849	100240849	+	Silent	SNP	A	A	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr9:100240849A>G	ENST00000355295.4	+	13	2590	c.2295A>G	c.(2293-2295)ccA>ccG	p.P765P	TDRD7_ENST00000422139.2_Silent_p.P691P|TDRD7_ENST00000540902.1_Silent_p.P85P	NM_014290.2	NP_055105.2	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	765					germ cell development (GO:0007281)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|posttranscriptional regulation of gene expression (GO:0010608)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|P granule (GO:0043186)|ribonucleoprotein granule (GO:0035770)	mRNA binding (GO:0003729)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Acute lymphoblastic leukemia(62;0.158)				TTGCAATACCACCTCAGGTAC	0.413																																																	0								ENSG00000196116						98.0	95.0	96.0					9																	100240849		2203	4300	6503	TDRD7	SO:0001819	synonymous_variant	0			-	HGNC	AB025254	CCDS6725.1	9q22.33	2013-01-23			ENSG00000196116	ENSG00000196116		"""Tudor domain containing"""	30831	protein-coding gene	gene with protein product		611258				21436445	Standard	NM_014290		Approved	PCTAIRE2BP	uc004axj.3	Q8NHU6	OTTHUMG00000020326	ENST00000355295.4:c.2295A>G	9.37:g.100240849A>G		Somatic	0	74	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	69	18.60	A6NCI6|B2RBX3|B4DG99|B4DXF7|E7EQD4|Q5VV27|Q96JT1|Q9UFF0|Q9Y2M3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.P765	ENST00000355295.4	37	c.2295	CCDS6725.1	9																																																																																			-	pfam_Tudor		0.413	TDRD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRD7	protein_coding	OTTHUMT00000053322.1	A	NM_014290	-		100240849	+1	no_errors	ENST00000355295	ensembl	human	known	74_37	silent	SNP	1.000	G
MMP25	64386	genome.wustl.edu	37	16	3105799	3105799	+	Intron	SNP	G	G	T	rs568269857	byFrequency	TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr16:3105799G>T	ENST00000336577.4	+	5	898				RP11-473M20.7_ENST00000576250.1_RNA|RP11-473M20.7_ENST00000597579.1_RNA|RP11-473M20.7_ENST00000572574.1_RNA|RP11-473M20.7_ENST00000573953.1_RNA|RP11-473M20.7_ENST00000573130.1_RNA|RP11-473M20.7_ENST00000573878.1_RNA|MMP25_ENST00000570755.1_Intron|RP11-473M20.7_ENST00000572222.1_RNA|RP11-473M20.7_ENST00000570949.1_RNA|RP11-473M20.7_ENST00000572930.1_RNA|RP11-473M20.7_ENST00000572427.1_RNA	NM_022468.4	NP_071913.1	Q9H239	MMP28_HUMAN	matrix metallopeptidase 25						negative regulation of macrophage chemotaxis (GO:0010760)	cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	14					Marimastat(DB00786)	CTGTGGTGCTGCGGGGCTGTG	0.597																																					NSCLC(147;665 1067 3888 6863 19894 30469 40247 45633 51336)												0								ENSG00000261971																																			RP11-473M20.7	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AF145442	CCDS10492.1	16p13.3	2008-02-05	2005-08-08			ENSG00000008516			14246	protein-coding gene	gene with protein product		608482	"""matrix metalloproteinase 25"", ""matrix metallopeptidase-like 1"""	MMPL1, MMP20		10628838, 10706098	Standard	NM_022468		Approved	MT6-MMP	uc002cth.3	Q9NPA2		ENST00000336577.4:c.662-1235G>T	16.37:g.3105799G>T		Somatic	0	56	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.16	Q96F04|Q96TE2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000336577.4	37	NULL	CCDS10492.1	16																																																																																			-	-		0.597	MMP25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261971	protein_coding	OTTHUMT00000437116.1	G	NM_022468	-		3105799	-1	no_errors	ENST00000570949	ensembl	human	known	74_37	rna	SNP	0.001	T
GAREML	150946	genome.wustl.edu	37	2	26407188	26407188	+	Silent	SNP	G	G	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr2:26407188G>T	ENST00000401533.2	+	4	601	c.471G>T	c.(469-471)gcG>gcT	p.A157A	GAREML_ENST00000407684.1_Silent_p.A80A	NM_001168241.1	NP_001161713.1	Q75VX8	GAREL_HUMAN	GRB2 associated, regulator of MAPK1-like	157	CABIT.					extracellular vesicular exosome (GO:0070062)											TGGGCCAGGCGGAGATCCTGT	0.692																																																	0								ENSG00000157833						31.0	29.0	29.0					2																	26407188		692	1591	2283	GAREML	SO:0001819	synonymous_variant	0			-	HGNC	AK090454, AB015349, AB124552	CCDS54336.1, CCDS54337.1	2p23.3	2012-11-30	2012-11-30	2012-11-30	ENSG00000157833	ENSG00000157833			27172	protein-coding gene	gene with protein product			"""family with sequence similarity 59, member B"""	FAM59B			Standard	NM_001168241		Approved	KIAA2038, FLJ00375	uc002rgw.2	Q75VX8	OTTHUMG00000151935	ENST00000401533.2:c.471G>T	2.37:g.26407188G>T		Somatic	0	50	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B5MC97|B7WNK9|Q8NF27|Q9UIK8	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_SAM/pointed	p.A157	ENST00000401533.2	37	c.471	CCDS54336.1	2																																																																																			-	NULL		0.692	GAREML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAREML	protein_coding	OTTHUMT00000324498.2	G	NM_001168241	-		26407188	+1	no_errors	ENST00000401533	ensembl	human	known	74_37	silent	SNP	0.997	T
CDH15	1013	genome.wustl.edu	37	16	89251598	89251598	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr16:89251598G>T	ENST00000289746.2	+	5	585	c.520G>T	c.(520-522)Gca>Tca	p.A174S		NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	174	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		TGTGACCAGGGCAGAGGCCAC	0.677																																																	0								ENSG00000129910						35.0	35.0	35.0					16																	89251598		2188	4294	6482	CDH15	SO:0001583	missense	0			-	HGNC	D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.520G>T	16.37:g.89251598G>T	ENSP00000289746:p.Ala174Ser	Somatic	0	55	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.30		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A174S	ENST00000289746.2	37	c.520	CCDS10976.1	16	.	.	.	.	.	.	.	.	.	.	G	23.3	4.404156	0.83230	.	.	ENSG00000129910	ENST00000289746	T	0.51817	0.69	4.76	4.76	0.60689	Cadherin (5);Cadherin-like (1);	0.114099	0.37136	N	0.002225	T	0.60894	0.2304	L	0.47190	1.495	0.42157	D	0.99158	D	0.61080	0.989	D	0.64144	0.922	T	0.65701	-0.6104	10	0.87932	D	0	.	16.5411	0.84385	0.0:0.0:1.0:0.0	.	174	P55291	CAD15_HUMAN	S	174	ENSP00000289746:A174S	ENSP00000289746:A174S	A	+	1	0	CDH15	87779099	0.898000	0.30612	0.962000	0.40283	0.548000	0.35241	2.558000	0.45879	2.187000	0.69744	0.462000	0.41574	GCA	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.677	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH15	protein_coding	OTTHUMT00000269920.1	G	NM_004933	-		89251598	+1	no_errors	ENST00000289746	ensembl	human	known	74_37	missense	SNP	1.000	T
ALDH1L1	10840	genome.wustl.edu	37	3	125855695	125855695	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr3:125855695C>T	ENST00000393434.2	-	11	1605	c.1256G>A	c.(1255-1257)cGc>cAc	p.R419H	ALDH1L1_ENST00000472186.1_Missense_Mutation_p.R419H|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.R318H|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.R429H|ALDH1L1_ENST00000393431.2_Missense_Mutation_p.R419H	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	419	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	GTGGGGCATGCGGACAGTGCG	0.577																																																	0								ENSG00000144908						97.0	83.0	88.0					3																	125855695		2203	4300	6503	ALDH1L1	SO:0001583	missense	0			-	HGNC	AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.1256G>A	3.37:g.125855695C>T	ENSP00000377083:p.Arg419His	Somatic	0	36	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.R419H	ENST00000393434.2	37	c.1256	CCDS3034.1	3	.	.	.	.	.	.	.	.	.	.	C	3.901	-0.022104	0.07634	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434;ENST00000393431	T;T;T;T;T	0.08008	3.14;3.14;3.14;3.14;3.21	3.67	-7.34	0.01427	Acyl carrier protein-like (1);Aldehyde/histidinol dehydrogenase (1);	1.411540	0.04478	N	0.377306	T	0.07234	0.0183	L	0.28400	0.85	0.09310	N	1	B;B;B	0.15719	0.014;0.009;0.004	B;B;B	0.06405	0.002;0.002;0.001	T	0.26155	-1.0111	10	0.44086	T	0.13	.	13.8719	0.63624	0.0:0.2998:0.0:0.7002	.	318;471;419	E9PBX3;Q59G10;O75891	.;.;AL1L1_HUMAN	H	429;419;318;419;419	ENSP00000273450:R429H;ENSP00000420293:R419H;ENSP00000395881:R318H;ENSP00000377083:R419H;ENSP00000377081:R419H	ENSP00000273450:R429H	R	-	2	0	ALDH1L1	127338385	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-1.418000	0.02462	-1.781000	0.01277	-0.483000	0.04790	CGC	-	superfamily_Ald_DH/histidinol_DH,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH		0.577	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L1	protein_coding	OTTHUMT00000354391.1	C	NM_012190	-		125855695	-1	no_errors	ENST00000393434	ensembl	human	known	74_37	missense	SNP	0.001	T
FAF1	11124	genome.wustl.edu	37	1	51267315	51267315	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr1:51267315C>T	ENST00000396153.2	-	3	600	c.149G>A	c.(148-150)gGc>gAc	p.G50D	FAF1_ENST00000371778.4_Missense_Mutation_p.G50D	NM_007051.2	NP_008982.1	Q9UNN5	FAF1_HUMAN	Fas (TNFRSF6) associated factor 1	50	UBA.				apoptotic process (GO:0006915)|cell death (GO:0008219)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein complex assembly (GO:0031334)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of cell adhesion (GO:0030155)|regulation of protein catabolic process (GO:0042176)|regulation of protein kinase activity (GO:0045859)	CD95 death-inducing signaling complex (GO:0031265)|Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	heat shock protein binding (GO:0031072)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.0?(3)		breast(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		TTGTAGAATGCCATTTTCCTG	0.348																																																	3	Whole gene deletion(3)	thyroid(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)						ENSG00000185104						146.0	149.0	148.0					1																	51267315		2203	4300	6503	FAF1	SO:0001583	missense	0			-	HGNC	AF132938	CCDS554.1	1p32.3	2012-09-20			ENSG00000185104	ENSG00000185104		"""UBX domain containing"""	3578	protein-coding gene	gene with protein product	"""TNFRSF6-associated factor 1"", ""UBX domain protein 3A"""	604460				10462485	Standard	NM_007051		Approved	CGI-03, hFAF1, HFAF1s, UBXD12, UBXN3A	uc001cse.1	Q9UNN5	OTTHUMG00000007930	ENST00000396153.2:c.149G>A	1.37:g.51267315C>T	ENSP00000379457:p.Gly50Asp	Somatic	0	35	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q549F0|Q9UF34|Q9UNT3|Q9Y2Z3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UBX,superfamily_UBA-like,smart_UAS,smart_UBX,pfscan_UBX	p.G50D	ENST00000396153.2	37	c.149	CCDS554.1	1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.809125	0.31961	.	.	ENSG00000185104	ENST00000396153;ENST00000371778;ENST00000371780;ENST00000543607	.	.	.	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.60586	0.2280	L	0.34521	1.04	0.80722	D	1	D	0.60575	0.988	P	0.57204	0.815	T	0.61941	-0.6959	9	0.51188	T	0.08	-23.4151	14.1249	0.65213	0.0:1.0:0.0:0.0	.	50	Q9UNN5	FAF1_HUMAN	D	50;50;42;50	.	ENSP00000360843:G50D	G	-	2	0	FAF1	51039903	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.085000	0.57657	2.475000	0.83589	0.561000	0.74099	GGC	-	NULL		0.348	FAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAF1	protein_coding	OTTHUMT00000021807.1	C	NM_007051	-		51267315	-1	no_errors	ENST00000371778	ensembl	human	known	74_37	missense	SNP	1.000	T
APOL4	80832	genome.wustl.edu	37	22	36598054	36598054	+	Missense_Mutation	SNP	A	A	G	rs71296614		TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr22:36598054A>G	ENST00000404685.3	-	2	253	c.29T>C	c.(28-30)tTt>tCt	p.F10S	APOL4_ENST00000332987.1_5'UTR|APOL4_ENST00000405511.1_5'UTR|APOL4_ENST00000429038.2_5'UTR|APOL4_ENST00000328429.4_5'UTR|APOL4_ENST00000352371.1_Missense_Mutation_p.F10S|APOL4_ENST00000397275.2_5'UTR|APOL4_ENST00000479929.1_Intron	NM_145660.1	NP_663693.1	Q9BPW4	APOL4_HUMAN	apolipoprotein L, 4	10					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	extracellular space (GO:0005615)	lipid binding (GO:0008289)			lung(1)	1						GCAGACGACAAAGATTTTCAG	0.602																																																	0								ENSG00000100336						56.0	61.0	59.0					22																	36598054		2203	4300	6503	APOL4	SO:0001583	missense	0			-	HGNC	AF305226	CCDS74851.1, CCDS74852.1	22q11.2-q13.2	2013-01-24			ENSG00000100336	ENSG00000100336		"""Apolipoproteins"""	14867	protein-coding gene	gene with protein product		607254				11374903	Standard	NM_030643		Approved	APOLIV	uc003aox.3	Q9BPW4	OTTHUMG00000150630	ENST00000404685.3:c.29T>C	22.37:g.36598054A>G	ENSP00000385119:p.Phe10Ser	Somatic	0	50	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	Q9BQ37|Q9BXQ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ApoL	p.F10S	ENST00000404685.3	37	c.29		22	.	.	.	.	.	.	.	.	.	.	A	6.320	0.427186	0.11987	.	.	ENSG00000100336	ENST00000404685;ENST00000352371	T;T	0.32023	1.47;3.81	1.3	0.165	0.14995	.	2.280070	0.03776	U	0.260568	T	0.18923	0.0454	.	.	.	0.24278	N	0.99521	B	0.10296	0.003	B	0.04013	0.001	T	0.17289	-1.0374	9	0.31617	T	0.26	.	3.52	0.07739	0.2916:0.0:0.7084:0.0	.	10	Q9BPW4	APOL4_HUMAN	S	10	ENSP00000385119:F10S;ENSP00000338260:F10S	ENSP00000338260:F10S	F	-	2	0	APOL4	34928000	0.173000	0.23056	0.138000	0.22173	0.108000	0.19459	0.389000	0.20751	0.083000	0.17047	0.172000	0.16884	TTT	-	NULL		0.602	APOL4-001	PUTATIVE	basic	protein_coding	APOL4	protein_coding	OTTHUMT00000319255.2	A	NM_145660	-		36598054	-1	no_errors	ENST00000352371	ensembl	human	known	74_37	missense	SNP	0.174	G
MFSD3	113655	genome.wustl.edu	37	8	145739006	145739006	+	IGR	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr8:145739006C>T	ENST00000301327.4	+	0	1548				RECQL4_ENST00000428558.2_Missense_Mutation_p.A717T|RECQL4_ENST00000532237.1_5'UTR|CTD-2517M22.17_ENST00000580385.1_RNA	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			AGGAGCGCAGCGATCCGCTCT	0.602																																																	0								ENSG00000160957						29.0	33.0	32.0					8																	145739006		2085	4217	6302	RECQL4	SO:0001628	intergenic_variant	0			-	HGNC		CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177		8.37:g.145739006C>T		Somatic	0	38	0.00		0.5152294697123943	31	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_DNA_rep_checkpnt_protein,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.A717T	ENST00000301327.4	37	c.2149	CCDS6431.1	8																																																																																			-	superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ		0.602	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECQL4	protein_coding	OTTHUMT00000382478.2	C	NM_138431	-		145739006	-1	no_errors	ENST00000428558	ensembl	human	known	74_37	missense	SNP	0.987	T
RNF217	154214	genome.wustl.edu	37	6	125330511	125330511	+	Intron	SNP	C	C	T	rs560259873		TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr6:125330511C>T	ENST00000521654.2	+	2	882				RNF217_ENST00000359704.2_Intron|RNF217_ENST00000454842.2_Intron|RNF217_ENST00000368414.2_Intron|RNF217_ENST00000560949.1_Intron			Q8TC41	RN217_HUMAN	ring finger protein 217						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)		CTGTGAAGCCCTCTCACAGAC	0.393																																																	0								ENSG00000146373						70.0	58.0	61.0					6																	125330511		692	1591	2283	RNF217	SO:0001627	intron_variant	0			-	HGNC	BC026087	CCDS5129.1, CCDS69191.1	6q22.33	2014-07-15	2007-08-20	2007-08-20	ENSG00000146373	ENSG00000146373		"""RING-type (C3HC4) zinc fingers"""	21487	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 172"", ""IBR domain containing 1"""	C6orf172, IBRDC1			Standard	NM_001286398		Approved	MGC26996, dJ84N20.1	uc003pzs.3	Q8TC41	OTTHUMG00000015504	ENST00000521654.2:c.883-35846C>T	6.37:g.125330511C>T		Somatic	0	51	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	36	32.08	H7C5V4|Q5TCA4|Q9BX48	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000521654.2	37	NULL		6																																																																																			-	-		0.393	RNF217-002	NOVEL	basic|appris_principal	protein_coding	RNF217	protein_coding	OTTHUMT00000042063.3	C	NM_152553	-		125330511	+1	no_errors	ENST00000431104	ensembl	human	known	74_37	rna	SNP	0.001	T
ROCK2	9475	genome.wustl.edu	37	2	11355735	11355735	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr2:11355735G>T	ENST00000315872.6	-	14	1946	c.1498C>A	c.(1498-1500)Cag>Aag	p.Q500K	ROCK2_ENST00000401753.1_Missense_Mutation_p.Q257K	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	500	Interaction with PPP1R12A.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		CTTTCTAACTGTCTTAATGCT	0.308																																																	0								ENSG00000134318						73.0	69.0	71.0					2																	11355735		1812	4069	5881	ROCK2	SO:0001583	missense	0			-	HGNC	D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.1498C>A	2.37:g.11355735G>T	ENSP00000317985:p.Gln500Lys	Somatic	0	56	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	Q53QZ0|Q53SJ7|Q9UQN5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Rho-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_tRNA-bd_arm,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Rho-assoc_coiled-coil_kin,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.Q500K	ENST00000315872.6	37	c.1498	CCDS42654.1	2	.	.	.	.	.	.	.	.	.	.	G	17.39	3.378604	0.61735	.	.	ENSG00000134318	ENST00000315872;ENST00000401753	D;D	0.83163	-1.69;-1.69	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.81138	0.4760	M	0.63843	1.955	0.58432	D	0.999999	B	0.29341	0.242	B	0.29353	0.101	T	0.77635	-0.2514	10	0.18710	T	0.47	.	18.4356	0.90645	0.0:0.0:1.0:0.0	.	500	O75116	ROCK2_HUMAN	K	500;257	ENSP00000317985:Q500K;ENSP00000385509:Q257K	ENSP00000317985:Q500K	Q	-	1	0	ROCK2	11273186	1.000000	0.71417	0.993000	0.49108	0.973000	0.67179	7.676000	0.84012	2.434000	0.82447	0.655000	0.94253	CAG	-	pirsf_Rho-assoc_coiled-coil_kin		0.308	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROCK2	protein_coding	OTTHUMT00000313886.3	G		-		11355735	-1	no_errors	ENST00000315872	ensembl	human	known	74_37	missense	SNP	1.000	T
DDX28	55794	genome.wustl.edu	37	16	68055551	68055551	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr16:68055551C>T	ENST00000332395.5	-	1	2219	c.1555G>A	c.(1555-1557)Gct>Act	p.A519T	DUS2_ENST00000565263.1_5'Flank|DUS2_ENST00000358896.6_5'Flank|DUS2_ENST00000432752.1_5'Flank	NM_018380.3	NP_060850.2	Q9NUL7	DDX28_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 28	519	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	13		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0116)|Epithelial(162;0.0474)|all cancers(182;0.233)		CTTCGGCGAGCCGCCAGCTCA	0.542																																																	0								ENSG00000182810						44.0	43.0	43.0					16																	68055551		2198	4300	6498	DDX28	SO:0001583	missense	0			-	HGNC	AF329821	CCDS10858.1	16q22.1-q22.3	2008-02-05	2003-06-13		ENSG00000182810	ENSG00000182810		"""DEAD-boxes"""	17330	protein-coding gene	gene with protein product		607618	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 28"""			10493829, 11350955	Standard	NM_018380		Approved	MDDX28, FLJ11282	uc002evh.2	Q9NUL7	OTTHUMG00000137549	ENST00000332395.5:c.1555G>A	16.37:g.68055551C>T	ENSP00000332340:p.Ala519Thr	Somatic	0	44	0.00		0.5152294697123943	97	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.A519T	ENST00000332395.5	37	c.1555	CCDS10858.1	16	.	.	.	.	.	.	.	.	.	.	C	32	5.133185	0.94517	.	.	ENSG00000182810	ENST00000332395	T	0.03181	4.02	5.81	5.81	0.92471	Helicase, C-terminal (1);	0.055140	0.64402	D	0.000001	T	0.07458	0.0188	N	0.11255	0.115	0.58432	D	0.999997	D	0.63880	0.993	D	0.63703	0.917	T	0.59862	-0.7374	10	0.22109	T	0.4	-10.0988	20.089	0.97809	0.0:1.0:0.0:0.0	.	519	Q9NUL7	DDX28_HUMAN	T	519	ENSP00000332340:A519T	ENSP00000332340:A519T	A	-	1	0	DDX28	66613052	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	5.723000	0.68492	2.752000	0.94435	0.557000	0.71058	GCT	-	pfscan_Helicase_C		0.542	DDX28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX28	protein_coding	OTTHUMT00000268883.1	C	NM_018380	-		68055551	-1	no_errors	ENST00000332395	ensembl	human	known	74_37	missense	SNP	1.000	T
IL18RAP	8807	genome.wustl.edu	37	2	103068622	103068622	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr2:103068622C>A	ENST00000264260.2	+	12	2370	c.1781C>A	c.(1780-1782)tCc>tAc	p.S594Y	IL18RAP_ENST00000409369.1_Missense_Mutation_p.S452Y	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	594					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						GGGAGGAGCTCCCAGCCTAAG	0.512																																																	0								ENSG00000115607						70.0	79.0	76.0					2																	103068622		2203	4300	6503	IL18RAP	SO:0001583	missense	0			-	HGNC	AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.1781C>A	2.37:g.103068622C>A	ENSP00000264260:p.Ser594Tyr	Somatic	0	48	0.00		0.5152294697123943	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like_dom	p.S594Y	ENST00000264260.2	37	c.1781	CCDS2061.1	2	.	.	.	.	.	.	.	.	.	.	C	15.72	2.915987	0.52546	.	.	ENSG00000115607	ENST00000264260;ENST00000409369	T;T	0.02709	4.26;4.19	5.92	4.97	0.65823	.	3.468750	0.00531	N	0.000215	T	0.02767	0.0083	N	0.14661	0.345	0.09310	N	0.999998	B	0.34290	0.447	B	0.27715	0.082	T	0.24440	-1.0160	10	0.72032	D	0.01	.	8.4648	0.32949	0.2101:0.7075:0.0:0.0824	.	594	O95256	I18RA_HUMAN	Y	594;452	ENSP00000264260:S594Y;ENSP00000387201:S452Y	ENSP00000264260:S594Y	S	+	2	0	IL18RAP	102435054	0.000000	0.05858	1.000000	0.80357	0.925000	0.55904	0.198000	0.17217	2.801000	0.96364	0.650000	0.86243	TCC	-	NULL		0.512	IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL18RAP	protein_coding	OTTHUMT00000253291.2	C	NM_003853	-		103068622	+1	no_errors	ENST00000264260	ensembl	human	known	74_37	missense	SNP	0.273	A
TP53	7157	genome.wustl.edu	37	17	7579328	7579329	+	Frame_Shift_Ins	INS	-	-	TAAG	rs121912658		TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr17:7579328_7579329insTAAG	ENST00000269305.4	-	4	547_548	c.358_359insCTTA	c.(358-360)aagfs	p.K120fs	TP53_ENST00000420246.2_Frame_Shift_Ins_p.K120fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.K120fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.K120fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.K120fs|TP53_ENST00000413465.2_Frame_Shift_Ins_p.K120fs|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	120	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.	Interaction with DNA.	K -> E (in sporadic cancers; somatic mutation).|K -> M (in sporadic cancers; somatic mutation).|K -> Q (in a sporadic cancer; somatic mutation).|K -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.K120M(5)|p.K120E(3)|p.G59fs*23(3)|p.K120fs*3(2)|p.K120R(2)|p.K120*(2)|p.V73fs*9(1)|p.G105_T125del21(1)|p.G112_V122delGFLHSGTAKSV(1)|p.T118fs*27(1)|p.H115fs*27(1)|p.Y107fs*44(1)|p.K120Q(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGTCACAGACTTGGCTGTCCCA	0.564		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	34	Substitution - Missense(11)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(2)|Substitution - Nonsense(2)	upper_aerodigestive_tract(5)|urinary_tract(5)|bone(5)|lung(4)|breast(4)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(2)|stomach(1)|soft_tissue(1)|liver(1)|ovary(1)|pancreas(1)|prostate(1)	GRCh37	CM921039	TP53	M	rs121912658	ENSG00000141510																																			TP53	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.358_359insCTTA	17.37:g.7579328_7579329insTAAG	ENSP00000269305:p.Lys120fs	Somatic	0	126	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	60	88	40.54	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.K120fs	ENST00000269305.4	37	c.359_358	CCDS11118.1	17																																																																																			-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.564	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	-	NM_000546			7579329	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	TAAG
CCDC129	223075	genome.wustl.edu	37	7	31683399	31683399	+	Silent	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr7:31683399C>T	ENST00000407970.3	+	11	2453	c.2415C>T	c.(2413-2415)tgC>tgT	p.C805C	CCDC129_ENST00000451887.2_Silent_p.C831C|CCDC129_ENST00000409210.1_Silent_p.C713C|CCDC129_ENST00000319386.3_Silent_p.C657C	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	805	Cys-rich.									cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						CTGCCCACTGCTGCATCTGCT	0.582																																																	0								ENSG00000180347						89.0	78.0	82.0					7																	31683399		2203	4300	6503	CCDC129	SO:0001819	synonymous_variant	0			-	HGNC	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.2415C>T	7.37:g.31683399C>T		Somatic	0	28	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C831	ENST00000407970.3	37	c.2493	CCDS5435.2	7																																																																																			-	NULL		0.582	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC129	protein_coding	OTTHUMT00000318975.1	C	NM_194300	-		31683399	+1	no_errors	ENST00000451887	ensembl	human	known	74_37	silent	SNP	0.033	T
NCOA1	8648	genome.wustl.edu	37	2	24974871	24974871	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr2:24974871G>T	ENST00000406961.1	+	20	4379	c.3727G>T	c.(3727-3729)Gcc>Tcc	p.A1243S	NCOA1_ENST00000348332.3_Missense_Mutation_p.A1243S|NCOA1_ENST00000405141.1_Missense_Mutation_p.A1243S|NCOA1_ENST00000395856.3_Missense_Mutation_p.A1243S|NCOA1_ENST00000538539.1_Missense_Mutation_p.A1243S|NCOA1_ENST00000407230.1_Missense_Mutation_p.A1092S|NCOA1_ENST00000288599.5_Missense_Mutation_p.A1243S			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	1243					androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCAAGGTGAGGCCAACTTTGC	0.448			T	PAX3	alveolar rhadomyosarcoma																																			Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	0								ENSG00000084676						79.0	72.0	75.0					2																	24974871		2203	4300	6503	NCOA1	SO:0001583	missense	0			-	HGNC	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.3727G>T	2.37:g.24974871G>T	ENSP00000385216:p.Ala1243Ser	Somatic	0	53	0.00		0.5152294697123943	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.A1243S	ENST00000406961.1	37	c.3727	CCDS1712.1	2	.	.	.	.	.	.	.	.	.	.	G	14.77	2.635907	0.47049	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83;1.83;1.83	5.34	3.47	0.39725	Domain of unknown function DUF1518 (1);	0.117560	0.56097	D	0.000022	T	0.12689	0.0308	N	0.08118	0	0.25964	N	0.982585	B;B;B;B;B	0.29481	0.089;0.206;0.245;0.206;0.245	B;B;B;B;B	0.31946	0.098;0.085;0.138;0.085;0.138	T	0.23797	-1.0178	10	0.22109	T	0.4	.	9.9441	0.41598	0.0857:0.2256:0.6886:0.0	.	1243;1243;1243;1243;1092	A8K1V4;Q15788-3;Q15788;Q15788-2;B5MCN7	.;.;NCOA1_HUMAN;.;.	S	1243;1243;1092;1243;1243;1243;1243	ENSP00000385216:A1243S;ENSP00000385097:A1243S;ENSP00000385195:A1092S;ENSP00000444039:A1243S;ENSP00000320940:A1243S;ENSP00000288599:A1243S;ENSP00000379197:A1243S	ENSP00000288599:A1243S	A	+	1	0	NCOA1	24828375	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.865000	0.48412	1.485000	0.48380	0.585000	0.79938	GCC	-	pfam_DUF1518,pirsf_Nuclear_rcpt_coactivator		0.448	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA1	protein_coding	OTTHUMT00000246852.3	G	NM_147223	-		24974871	+1	no_errors	ENST00000348332	ensembl	human	known	74_37	missense	SNP	1.000	T
CIRBP	1153	genome.wustl.edu	37	19	1271446	1271446	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr19:1271446G>T	ENST00000588030.1	+	4	589	c.329G>T	c.(328-330)cGg>cTg	p.R110L	CIRBP_ENST00000413636.2_Intron|CIRBP_ENST00000588090.1_Missense_Mutation_p.R110L|CIRBP_ENST00000587323.1_Missense_Mutation_p.R110L|CIRBP_ENST00000589686.1_Missense_Mutation_p.R110L|CIRBP_ENST00000587896.1_Missense_Mutation_p.R110L|CIRBP_ENST00000589235.1_Missense_Mutation_p.R110L|CIRBP_ENST00000320936.5_Missense_Mutation_p.R110L|CIRBP_ENST00000586472.1_Missense_Mutation_p.R110L|CIRBP_ENST00000589660.1_Missense_Mutation_p.R110L|CIRBP-AS1_ENST00000600215.1_RNA|CIRBP_ENST00000586773.1_Missense_Mutation_p.R110L|CIRBP_ENST00000589710.1_Missense_Mutation_p.R110L|CIRBP_ENST00000585630.1_Missense_Mutation_p.R110L|CIRBP_ENST00000444172.2_Missense_Mutation_p.R57L|CIRBP-AS1_ENST00000585832.1_RNA|CIRBP_ENST00000588230.1_Missense_Mutation_p.R110L|CIRBP_ENST00000591935.1_Missense_Mutation_p.R110L			Q14011	CIRBP_HUMAN	cold inducible RNA binding protein	110	Gly-rich.				mRNA stabilization (GO:0048255)|positive regulation of translation (GO:0045727)|response to cold (GO:0009409)|response to UV (GO:0009411)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|small ribosomal subunit rRNA binding (GO:0070181)|translation repressor activity (GO:0030371)			endometrium(1)|large_intestine(1)|lung(3)	5		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCCGAGGACGGGGCCGTGGG	0.627																																																	0								ENSG00000099622						55.0	70.0	65.0					19																	1271446		2202	4299	6501	CIRBP	SO:0001583	missense	0			-	HGNC	D78134	CCDS12059.1, CCDS74244.1, CCDS74245.1	19p13.3	2013-02-12	2001-11-28		ENSG00000099622	ENSG00000099622		"""RNA binding motif (RRM) containing"""	1982	protein-coding gene	gene with protein product	"""Cold-inducible RNA-binding protein"", ""glycine-rich RNA binding protein"""	602649	"""cold inducible RNA-binding protein"""			9434172, 9151692	Standard	NM_001280		Approved	CIRP	uc002lrr.4	Q14011		ENST00000588030.1:c.329G>T	19.37:g.1271446G>T	ENSP00000468788:p.Arg110Leu	Somatic	0	54	0.00		0.5152294697123943	33	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B3KT17|B4E2X2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R57L	ENST00000588030.1	37	c.170	CCDS12059.1	19	.	.	.	.	.	.	.	.	.	.	G	16.24	3.067745	0.55539	.	.	ENSG00000099622	ENST00000320936;ENST00000444172	T	0.75477	-0.94	4.55	2.36	0.29203	.	0.072466	0.52532	D	0.000061	T	0.64260	0.2582	M	0.69358	2.11	0.54753	D	0.999986	B;B;B	0.29136	0.016;0.234;0.001	B;B;B	0.23574	0.006;0.047;0.001	T	0.52351	-0.8587	10	0.12103	T	0.63	.	7.45	0.27234	0.0898:0.0:0.7434:0.1668	.	110;110;110	Q53XX5;D6W5Y5;Q14011	.;.;CIRBP_HUMAN	L	110;57	ENSP00000322887:R110L	ENSP00000322887:R110L	R	+	2	0	CIRBP	1222446	1.000000	0.71417	0.652000	0.29579	0.940000	0.58332	9.047000	0.93823	0.342000	0.23796	0.462000	0.41574	CGG	-	NULL		0.627	CIRBP-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CIRBP	protein_coding	OTTHUMT00000449969.1	G	NM_001280	-		1271446	+1	no_errors	ENST00000444172	ensembl	human	known	74_37	missense	SNP	0.999	T
NRK	203447	genome.wustl.edu	37	X	105183864	105183864	+	Splice_Site	SNP	A	A	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chrX:105183864A>G	ENST00000243300.9	+	23	4102		c.e23-1		NRK_ENST00000428173.2_Splice_Site	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase						activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						CTTATCTATCAGGTCATAAGA	0.284										HNSCC(51;0.14)																																							0								ENSG00000123572						35.0	30.0	32.0					X																	105183864		1791	4056	5847	NRK	SO:0001630	splice_region_variant	0			-	HGNC	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.3800-1A>G	X.37:g.105183864A>G		Somatic	0	27	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	Q32ND6|Q5H9K2|Q6ZMP2	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e23-2	ENST00000243300.9	37	c.3803-2		X	.	.	.	.	.	.	.	.	.	.	A	15.84	2.951499	0.53186	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8137	0.63278	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NRK	105070520	1.000000	0.71417	0.373000	0.26003	0.159000	0.22180	7.574000	0.82434	1.943000	0.56356	0.441000	0.28932	.	-	-		0.284	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	NRK	protein_coding	OTTHUMT00000106480.6	A	NM_198465	-	Intron	105183864	+1	no_errors	ENST00000428173	ensembl	human	known	74_37	splice_site	SNP	0.991	G
SLC6A12	6539	genome.wustl.edu	37	12	306033	306033	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr12:306033delA	ENST00000428720.1	-	11	1834	c.1091delT	c.(1090-1092)ttcfs	p.F364fs	SLC6A12_ENST00000397296.2_Frame_Shift_Del_p.F364fs|SLC6A12_ENST00000536824.1_Frame_Shift_Del_p.F364fs|SLC6A12_ENST00000424061.2_Frame_Shift_Del_p.F364fs|SLC6A12_ENST00000538272.1_5'Flank|SLC6A12_ENST00000359674.4_Frame_Shift_Del_p.F364fs|RP11-283I3.1_ENST00000544067.1_RNA	NM_001122848.2	NP_001116320.1	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 12	364					amino acid transport (GO:0006865)|cellular hyperosmotic response (GO:0071474)|cellular water homeostasis (GO:0009992)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|response to organic substance (GO:0010033)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			GAAGGCGATGAAGGCCAGCCC	0.577																																																	0								ENSG00000111181						91.0	83.0	86.0					12																	306033		2203	4300	6503	SLC6A12	SO:0001589	frameshift_variant	0				HGNC	L42300	CCDS8501.1	12p13	2013-07-19	2013-07-19		ENSG00000111181	ENSG00000111181		"""Solute carriers"""	11045	protein-coding gene	gene with protein product	"""betaine/GABA transporter-1"""	603080	"""solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12"""			7589472	Standard	NM_003044		Approved	BGT-1	uc009zdh.2	P48065	OTTHUMG00000090309	ENST00000428720.1:c.1091delT	12.37:g.306033delA	ENSP00000388184:p.Phe364fs	Somatic	0	48	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	A0AV52|B2R992|D3DUN8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_betaine	p.F364fs	ENST00000428720.1	37	c.1091	CCDS8501.1	12																																																																																			-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.577	SLC6A12-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A12	protein_coding	OTTHUMT00000206671.2	A	NM_003044			306033	-1	no_errors	ENST00000359674	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
PHKA1	5255	genome.wustl.edu	37	X	71855041	71855041	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chrX:71855041G>A	ENST00000373542.4	-	16	1837	c.1678C>T	c.(1678-1680)Ccc>Tcc	p.P560S	PHKA1_ENST00000541944.1_Missense_Mutation_p.P560S|PHKA1_ENST00000373539.3_Missense_Mutation_p.P560S|PHKA1_ENST00000373545.3_Missense_Mutation_p.P560S|PHKA1_ENST00000339490.3_Missense_Mutation_p.P560S	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	560					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					GTGATGGTGGGCTGGCCTGTC	0.498																																																	0								ENSG00000067177						120.0	95.0	103.0					X																	71855041		2203	4300	6503	PHKA1	SO:0001583	missense	0			-	HGNC		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.1678C>T	X.37:g.71855041G>A	ENSP00000362643:p.Pro560Ser	Somatic	0	33	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	38	24.00	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.P560S	ENST00000373542.4	37	c.1678	CCDS14421.1	X	.	.	.	.	.	.	.	.	.	.	G	18.76	3.692499	0.68271	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.96365	-3.93;-3.99;-3.87;-3.92;-3.98	4.47	4.47	0.54385	Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.98532	0.9510	H	0.94847	3.59	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.998;1.0	D	0.99593	1.0976	10	0.87932	D	0	-24.9069	13.9669	0.64213	0.0:0.0:1.0:0.0	.	560;560;560	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	S	560	ENSP00000362646:P560S;ENSP00000362643:P560S;ENSP00000441251:P560S;ENSP00000342469:P560S;ENSP00000362640:P560S	ENSP00000342469:P560S	P	-	1	0	PHKA1	71771766	1.000000	0.71417	1.000000	0.80357	0.481000	0.33189	9.705000	0.98719	1.956000	0.56807	0.415000	0.27848	CCC	-	pfam_Glyco_hydro_15		0.498	PHKA1-001	KNOWN	basic|CCDS	protein_coding	PHKA1	protein_coding	OTTHUMT00000058896.1	G		-		71855041	-1	no_errors	ENST00000373539	ensembl	human	known	74_37	missense	SNP	1.000	A
LINGO1	84894	genome.wustl.edu	37	15	77906924	77906924	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr15:77906924A>G	ENST00000355300.6	-	2	1499	c.1325T>C	c.(1324-1326)gTg>gCg	p.V442A	LINGO1_ENST00000561030.1_Missense_Mutation_p.V436A	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	442	Ig-like C2-type.				central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						CACAAACTGCACCGTGTGGCC	0.662																																																	0								ENSG00000169783						13.0	17.0	15.0					15																	77906924		2084	4170	6254	LINGO1	SO:0001583	missense	0			-	HGNC	AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.1325T>C	15.37:g.77906924A>G	ENSP00000347451:p.Val442Ala	Somatic	0	31	0.00		0.5152294697123943	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	13	27.78	D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_Ig_I-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.V442A	ENST00000355300.6	37	c.1325	CCDS45313.1	15	.	.	.	.	.	.	.	.	.	.	A	13.38	2.220851	0.39201	.	.	ENSG00000169783	ENST00000355300	T	0.32272	1.46	4.55	4.55	0.56014	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.26268	0.0641	N	0.13168	0.305	0.80722	D	1	B	0.33120	0.398	P	0.44860	0.462	T	0.10965	-1.0607	10	0.18710	T	0.47	.	13.8933	0.63753	1.0:0.0:0.0:0.0	.	442	Q96FE5	LIGO1_HUMAN	A	442	ENSP00000347451:V442A	ENSP00000347451:V442A	V	-	2	0	LINGO1	75693979	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.339000	0.96797	1.686000	0.51046	0.379000	0.24179	GTG	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.662	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO1	protein_coding	OTTHUMT00000419546.1	A	NM_032808	-		77906924	-1	no_errors	ENST00000355300	ensembl	human	known	74_37	missense	SNP	1.000	G
MARK4	57787	genome.wustl.edu	37	19	45801209	45801209	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr19:45801209G>A	ENST00000262891.4	+	15	2205	c.1874G>A	c.(1873-1875)cGa>cAa	p.R625Q	MARK4_ENST00000300843.4_Missense_Mutation_p.R625Q	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	625					microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)			NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		AAACTGACCCGAAGGTGAGCT	0.677																																																	0								ENSG00000007047						4.0	4.0	4.0					19																	45801209		1983	3874	5857	MARK4	SO:0001583	missense	0			-	HGNC	AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.1874G>A	19.37:g.45801209G>A	ENSP00000262891:p.Arg625Gln	Somatic	0	26	0.00		0.5152294697123943	27	32.50	13	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	18	21.74	Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KA1_dom,pfam_UBA/Ts_N,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.R625Q	ENST00000262891.4	37	c.1874	CCDS56097.1	19	.	.	.	.	.	.	.	.	.	.	G	32	5.143308	0.94560	.	.	ENSG00000007047	ENST00000262891;ENST00000300843	T;D	0.82344	0.55;-1.6	4.37	4.37	0.52481	.	0.082600	0.48767	D	0.000163	D	0.88403	0.6427	L	0.55990	1.75	0.58432	D	0.999996	D;D	0.71674	0.997;0.998	D;D	0.75484	0.968;0.986	D	0.89488	0.3755	10	0.72032	D	0.01	.	14.5049	0.67746	0.0:0.0:1.0:0.0	.	625;625	Q96L34;Q96L34-2	MARK4_HUMAN;.	Q	625	ENSP00000262891:R625Q;ENSP00000300843:R625Q	ENSP00000262891:R625Q	R	+	2	0	MARK4	50493049	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	8.888000	0.92464	2.255000	0.74692	0.454000	0.30748	CGA	-	NULL		0.677	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK4	protein_coding	OTTHUMT00000457537.1	G	NM_031417	-		45801209	+1	no_errors	ENST00000262891	ensembl	human	known	74_37	missense	SNP	1.000	A
ABTB2	25841	genome.wustl.edu	37	11	34181876	34181876	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr11:34181876C>T	ENST00000435224.2	-	12	2846	c.2422G>A	c.(2422-2424)Gct>Act	p.A808T	ABTB2_ENST00000298992.2_Missense_Mutation_p.A622T	NM_145804.2	NP_665803.2	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing 2	808					cellular response to toxic substance (GO:0097237)	nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				AAGATGGTAGCCAGTTGCTGG	0.622																																																	0								ENSG00000166016						90.0	90.0	90.0					11																	34181876		2202	4298	6500	ABTB2	SO:0001583	missense	0			-	HGNC	AK056863	CCDS7890.1, CCDS7890.2	11p13	2013-10-02			ENSG00000166016	ENSG00000166016		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23842	protein-coding gene	gene with protein product							Standard	NM_145804		Approved	DKFZP586C1619, BTBD22, ABTB2A	uc001mvl.2	Q8N961	OTTHUMG00000044382	ENST00000435224.2:c.2422G>A	11.37:g.34181876C>T	ENSP00000410157:p.Ala808Thr	Somatic	0	45	0.00		0.5152294697123943	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A8K6S9|E9PRW7|Q52LD6|Q6MZW4|Q8NB44	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_Histone-fold,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.A808T	ENST00000435224.2	37	c.2422	CCDS7890.2	11	.	.	.	.	.	.	.	.	.	.	C	18.05	3.536807	0.65085	.	.	ENSG00000166016	ENST00000435224;ENST00000298992	T;T	0.62639	0.02;0.01	5.09	5.09	0.68999	.	0.055992	0.64402	D	0.000001	T	0.66157	0.2761	M	0.76574	2.34	0.58432	D	0.999998	P	0.44139	0.827	B	0.40901	0.343	T	0.73773	-0.3877	10	0.72032	D	0.01	-9.3397	18.0892	0.89469	0.0:1.0:0.0:0.0	.	622	Q8N961	ABTB2_HUMAN	T	808;622	ENSP00000410157:A808T;ENSP00000298992:A622T	ENSP00000298992:A622T	A	-	1	0	ABTB2	34138452	1.000000	0.71417	0.996000	0.52242	0.923000	0.55619	2.381000	0.44336	2.370000	0.80446	0.561000	0.74099	GCT	-	NULL		0.622	ABTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABTB2	protein_coding	OTTHUMT00000388703.3	C	NM_145804	-		34181876	-1	no_errors	ENST00000435224	ensembl	human	known	74_37	missense	SNP	1.000	T
RP11-764K9.1	0	genome.wustl.edu	37	9	68400476	68400476	+	lincRNA	SNP	G	G	C			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr9:68400476G>C	ENST00000417843.2	-	0	1343																											AGGCCACAGTGTGGACtgttg	0.483																																																	0								ENSG00000225411																																			RP11-764K9.1			0			-	Clone_based_vega_gene																													9.37:g.68400476G>C		Somatic	0	11	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	14	26.32		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			-	-		0.483	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	lincRNA	OTTHUMT00000129817.2	G		-		68400476	-1	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	SNP	0.009	C
ZNF613	79898	genome.wustl.edu	37	19	52448392	52448392	+	Missense_Mutation	SNP	G	G	T	rs138087596	byFrequency	TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr19:52448392G>T	ENST00000293471.6	+	6	1935	c.1256G>T	c.(1255-1257)cGa>cTa	p.R419L	ZNF613_ENST00000601794.1_3'UTR|ZNF613_ENST00000391794.4_Missense_Mutation_p.R383L	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	419					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		CTTATTCATCGACGTACTCAC	0.408																																																	0								ENSG00000176024						73.0	70.0	71.0					19																	52448392		2203	4300	6503	ZNF613	SO:0001583	missense	0			-	HGNC	AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.1256G>T	19.37:g.52448392G>T	ENSP00000293471:p.Arg419Leu	Somatic	0	64	0.00		0.5152294697123943	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	8.89	Q96SS9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R419L	ENST00000293471.6	37	c.1256	CCDS33089.1	19	.	.	.	.	.	.	.	.	.	.	G	11.80	1.745583	0.30955	.	.	ENSG00000176024	ENST00000293471;ENST00000391794;ENST00000535279	T;T	0.37235	1.21;1.21	3.36	1.17	0.20885	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.467838	0.15964	N	0.236109	T	0.15955	0.0384	N	0.03881	-0.34	0.23594	N	0.997334	B	0.02656	0.0	B	0.10450	0.005	T	0.22347	-1.0219	10	0.87932	D	0	.	7.902	0.29740	0.8919:0.0:0.1081:0.0	.	419	Q6PF04	ZN613_HUMAN	L	419;383;93	ENSP00000293471:R419L;ENSP00000375671:R383L	ENSP00000293471:R419L	R	+	2	0	ZNF613	57140204	0.000000	0.05858	0.830000	0.32933	0.826000	0.46750	-0.494000	0.06451	0.436000	0.26393	-0.436000	0.05848	CGA	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.408	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF613	protein_coding	OTTHUMT00000461104.2	G	NM_024840	-		52448392	+1	no_errors	ENST00000293471	ensembl	human	known	74_37	missense	SNP	0.846	T
ABCB4	5244	genome.wustl.edu	37	7	87104780	87104780	+	Start_Codon_SNP	SNP	A	A	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr7:87104780A>G	ENST00000265723.4	-	2	113	c.2T>C	c.(1-3)aTg>aCg	p.M1T	ABCB4_ENST00000359206.3_Start_Codon_SNP_p.M1T|ABCB4_ENST00000545634.1_Start_Codon_SNP_p.M1T|ABCB4_ENST00000453593.1_Start_Codon_SNP_p.M1T|ABCB4_ENST00000358400.3_Start_Codon_SNP_p.M1T	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	1					cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	CTCAAGATCCATCTCAGCCTG	0.667																																																	0								ENSG00000005471						59.0	55.0	56.0					7																	87104780		2203	4300	6503	ABCB4	SO:0001582	initiator_codon_variant	0			-	HGNC	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.2T>C	7.37:g.87104780A>G	ENSP00000265723:p.Met1Thr	Somatic	0	122	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	71	26.80	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,pfam_Zeta_toxin_domain,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.M1T	ENST00000265723.4	37	c.2	CCDS5606.1	7	.	.	.	.	.	.	.	.	.	.	A	16.98	3.270468	0.59540	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634;ENST00000417608	D;D;D;D;D	0.86432	-2.05;-2.12;-2.09;-2.12;-2.05	3.85	3.85	0.44370	.	.	.	.	.	D	0.89743	0.6803	.	.	.	0.80722	D	1	P;P;P;P	0.50156	0.932;0.826;0.814;0.717	P;B;P;P	0.55391	0.775;0.255;0.774;0.599	D	0.89962	0.4087	8	0.87932	D	0	-7.1163	8.9687	0.35892	1.0:0.0:0.0:0.0	.	1;1;1;1	Q6PJ81;A4D1D5;P21439-2;P21439	.;.;.;MDR3_HUMAN	T	1	ENSP00000352135:M1T;ENSP00000351172:M1T;ENSP00000265723:M1T;ENSP00000392983:M1T;ENSP00000437465:M1T	ENSP00000265723:M1T	M	-	2	0	ABCB4	86942716	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	3.659000	0.54489	1.615000	0.50252	0.519000	0.50382	ATG	-	NULL		0.667	ABCB4-002	KNOWN	basic|CCDS	protein_coding	ABCB4	protein_coding	OTTHUMT00000336083.1	A	NM_000443	-	Missense_Mutation	87104780	-1	no_errors	ENST00000265723	ensembl	human	known	74_37	missense	SNP	1.000	G
ZNF229	7772	genome.wustl.edu	37	19	44933794	44933794	+	Nonsense_Mutation	SNP	G	G	A	rs377446964		TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr19:44933794G>A	ENST00000588931.1	-	6	1595	c.1162C>T	c.(1162-1164)Cga>Tga	p.R388*	ZNF229_ENST00000591289.1_Intron|ZNF229_ENST00000291187.4_Nonsense_Mutation_p.R382*|CTC-512J12.4_ENST00000588655.1_RNA	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	388					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				TTTGAACTTCGACCAAATGCC	0.478																																																	0								ENSG00000167383						102.0	112.0	108.0					19																	44933794		2198	4299	6497	ZNF229	SO:0001587	stop_gained	0			-	HGNC	AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.1162C>T	19.37:g.44933794G>A	ENSP00000466519:p.Arg388*	Somatic	0	98	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	77	24	76.24	B2RWN3|Q59FV2|Q86WL9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R388*	ENST00000588931.1	37	c.1162	CCDS42574.1	19	.	.	.	.	.	.	.	.	.	.	G	42	9.345153	0.99143	.	.	ENSG00000167383	ENST00000291187	.	.	.	3.86	1.55	0.23275	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	.	6.8977	0.24265	0.0981:0.0:0.7298:0.1721	.	.	.	.	X	388	.	ENSP00000291187:R388X	R	-	1	2	ZNF229	49625634	0.000000	0.05858	0.001000	0.08648	0.946000	0.59487	-0.041000	0.12084	0.604000	0.29930	0.609000	0.83330	CGA	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.478	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF229	protein_coding	OTTHUMT00000460833.1	G	NM_014518	-		44933794	-1	no_errors	ENST00000588931	ensembl	human	known	74_37	nonsense	SNP	0.004	A
ATP13A5	344905	genome.wustl.edu	37	3	193028437	193028437	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr3:193028437G>C	ENST00000342358.4	-	21	2632	c.2515C>G	c.(2515-2517)Cag>Gag	p.Q839E	ATP13A5-AS1_ENST00000414634.1_RNA|ATP13A5_ENST00000495496.1_5'UTR	NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	839						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TTTAATTTCTGAAATTCTTCA	0.363																																																	0								ENSG00000187527						117.0	106.0	110.0					3																	193028437		2203	4300	6503	ATP13A5	SO:0001583	missense	0			-	HGNC	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.2515C>G	3.37:g.193028437G>C	ENSP00000341942:p.Gln839Glu	Somatic	0	46	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	42	22.22	Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.Q839E	ENST00000342358.4	37	c.2515	CCDS33914.1	3	.	.	.	.	.	.	.	.	.	.	G	20.5	3.994461	0.74703	.	.	ENSG00000187527	ENST00000342358	T	0.58358	0.34	5.78	5.78	0.91487	HAD-like domain (2);	0.000000	0.64402	D	0.000001	T	0.77498	0.4139	M	0.89534	3.04	0.43729	D	0.996215	D	0.60575	0.988	D	0.65573	0.936	T	0.81145	-0.1066	10	0.72032	D	0.01	-12.3617	17.8559	0.88762	0.0:0.0:1.0:0.0	.	839	Q4VNC0	AT135_HUMAN	E	839	ENSP00000341942:Q839E	ENSP00000341942:Q839E	Q	-	1	0	ATP13A5	194511131	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.088000	0.71371	2.894000	0.99253	0.655000	0.94253	CAG	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase		0.363	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A5	protein_coding	OTTHUMT00000343012.1	G	NM_198505	-		193028437	-1	no_errors	ENST00000342358	ensembl	human	known	74_37	missense	SNP	1.000	C
SULF1	23213	genome.wustl.edu	37	8	70571559	70571559	+	3'UTR	SNP	T	T	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr8:70571559T>A	ENST00000260128.4	+	0	4122				SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000458141.2_3'UTR|SULF1_ENST00000402687.4_3'UTR|SULF1_ENST00000419716.3_3'UTR	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1						apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			TCTGATTAGATGAAACTGTTA	0.418																																																	0								ENSG00000137573																																			SULF1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.*789T>A	8.37:g.70571559T>A		Somatic	0	50	0.00		0.5152294697123943	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	Q86YV8|Q8NCA2|Q9UPS5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000260128.4	37	NULL	CCDS6204.1	8																																																																																			-	-		0.418	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	protein_coding	OTTHUMT00000378885.2	T	NM_015170	-		70571559	+1	no_errors	ENST00000521946	ensembl	human	known	74_37	rna	SNP	0.487	A
LAPTM5	7805	genome.wustl.edu	37	1	31212769	31212769	+	Silent	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr1:31212769G>A	ENST00000294507.3	-	4	348	c.274C>T	c.(274-276)Ctg>Ttg	p.L92L	LAPTM5_ENST00000476492.1_5'Flank|MIR4420_ENST00000583944.1_RNA	NM_006762.2	NP_006753.1	Q13571	LAPM5_HUMAN	lysosomal protein transmembrane 5	92					transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)				large_intestine(2)|lung(7)|skin(1)	10		Colorectal(325;0.0199)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0966)|Medulloblastoma(700;0.151)|Ovarian(437;0.192)		STAD - Stomach adenocarcinoma(196;0.0196)|READ - Rectum adenocarcinoma(331;0.0649)		AAGGGCAGCAGGTACTTCTCC	0.592																																																	0								ENSG00000162511						152.0	112.0	126.0					1																	31212769		2203	4300	6503	LAPTM5	SO:0001819	synonymous_variant	0			-	HGNC	U51240	CCDS337.1	1p34	2009-07-20	2009-07-20		ENSG00000162511	ENSG00000162511			29612	protein-coding gene	gene with protein product		601476	"""lysosomal multispanning membrane protein 5"""			8661146, 12527926	Standard	NM_006762		Approved		uc001bsc.2	Q13571	OTTHUMG00000003707	ENST00000294507.3:c.274C>T	1.37:g.31212769G>A		Somatic	0	57	0.00		0.5152294697123943	71	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q13240|Q14698|Q3KP54	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_LAPTM4/5,tigrfam_LAPTM_4A/5	p.L92	ENST00000294507.3	37	c.274	CCDS337.1	1																																																																																			-	pfam_LAPTM4/5,tigrfam_LAPTM_4A/5		0.592	LAPTM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAPTM5	protein_coding	OTTHUMT00000010463.1	G	NM_006762	-		31212769	-1	no_errors	ENST00000294507	ensembl	human	known	74_37	silent	SNP	1.000	A
PRKAA2	5563	genome.wustl.edu	37	1	57173295	57173295	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr1:57173295G>A	ENST00000371244.4	+	9	1634	c.1568G>A	c.(1567-1569)aGc>aAc	p.S523N		NM_006252.3	NP_006243.2	P54646	AAPK2_HUMAN	protein kinase, AMP-activated, alpha 2 catalytic subunit	523			S -> G (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		autophagy (GO:0006914)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|cellular response to glucose starvation (GO:0042149)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of glycolytic process (GO:0045821)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(6)|endometrium(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|stomach(1)	23					Acetylsalicylic acid(DB00945)	TTGACCGGAAGCACATTGTCT	0.468																																																	0								ENSG00000162409						177.0	158.0	164.0					1																	57173295		2203	4300	6503	PRKAA2	SO:0001583	missense	0			-	HGNC	BC069823	CCDS605.1	1p31	2011-08-25			ENSG00000162409	ENSG00000162409			9377	protein-coding gene	gene with protein product		600497		PRKAA		7959015	Standard	NM_006252		Approved	AMPK, AMPKa2	uc001cyk.4	P54646	OTTHUMG00000008282	ENST00000371244.4:c.1568G>A	1.37:g.57173295G>A	ENSP00000360290:p.Ser523Asn	Somatic	0	26	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q9H1E8|Q9UD43	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S523N	ENST00000371244.4	37	c.1568	CCDS605.1	1	.	.	.	.	.	.	.	.	.	.	G	13.67	2.307104	0.40795	.	.	ENSG00000162409	ENST00000371244	T	0.72615	-0.67	5.46	4.55	0.56014	.	0.105227	0.64402	D	0.000009	T	0.62877	0.2464	L	0.40543	1.245	0.58432	D	0.999999	B	0.11235	0.004	B	0.12837	0.008	T	0.59830	-0.7380	10	0.42905	T	0.14	-12.4265	14.4749	0.67539	0.0701:0.0:0.9299:0.0	.	523	P54646	AAPK2_HUMAN	N	523	ENSP00000360290:S523N	ENSP00000360290:S523N	S	+	2	0	PRKAA2	56945883	1.000000	0.71417	0.971000	0.41717	0.609000	0.37215	5.204000	0.65180	1.538000	0.49270	0.655000	0.94253	AGC	-	NULL		0.468	PRKAA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAA2	protein_coding	OTTHUMT00000022753.2	G	NM_006252	-		57173295	+1	no_errors	ENST00000371244	ensembl	human	known	74_37	missense	SNP	1.000	A
FSTL1	11167	genome.wustl.edu	37	3	120122120	120122120	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr3:120122120G>T	ENST00000295633.3	-	8	1019	c.663C>A	c.(661-663)tgC>tgA	p.C221*	FSTL1_ENST00000424703.2_Nonsense_Mutation_p.C186*	NM_007085.4	NP_009016.1	Q12841	FSTL1_HUMAN	follistatin-like 1	221	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.			C -> S (in Ref. 4; BAF83827). {ECO:0000305}.	BMP signaling pathway (GO:0030509)|response to starvation (GO:0042594)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|skin(1)	20				GBM - Glioblastoma multiforme(114;0.189)		ATGGGTTGAGGCACTTGAGAA	0.443																																																	0								ENSG00000163430						109.0	110.0	110.0					3																	120122120		2203	4300	6503	FSTL1	SO:0001587	stop_gained	0			-	HGNC	U06863	CCDS2998.1	3q13.33	2013-01-10			ENSG00000163430	ENSG00000163430		"""EF-hand domain containing"""	3972	protein-coding gene	gene with protein product		605547				7957230, 9786430	Standard	NM_007085		Approved	FRP, FSL1	uc003eds.3	Q12841	OTTHUMG00000159440	ENST00000295633.3:c.663C>A	3.37:g.120122120G>T	ENSP00000295633:p.Cys221*	Somatic	0	40	0.00		0.5152294697123943	209	0.48	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A8K523|B4DTT5|D3DN90|Q549Z0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kazal_dom,pfam_Follistatin/Osteonectin_EGF,smart_Fol_N,smart_Kazal_dom,pfscan_EF_hand_dom	p.C221*	ENST00000295633.3	37	c.663	CCDS2998.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.424183|5.424183	0.96111|0.96111	.|.	.|.	ENSG00000163430|ENSG00000163430	ENST00000295633;ENST00000539471;ENST00000424703|ENST00000480823	.|.	.|.	.|.	6.16|6.16	2.49|2.49	0.30216|0.30216	.|.	0.122794|.	0.85682|.	D|.	0.000000|.	.|T	.|0.50429	.|0.1615	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.56920	.|-0.7899	.|3	0.02654|.	T|.	1|.	-19.8937|-19.8937	9.6129|9.6129	0.39674|0.39674	0.2627:0.0:0.7373:0.0|0.2627:0.0:0.7373:0.0	.|.	.|.	.|.	.|.	X|T	221;164;186|9	.|.	ENSP00000295633:C221X|.	C|P	-|-	3|1	2|0	FSTL1|FSTL1	121604810|121604810	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	2.995000|2.995000	0.49441|0.49441	0.195000|0.195000	0.20347|0.20347	-0.143000|-0.143000	0.13931|0.13931	TGC|CCT	-	pfscan_EF_hand_dom		0.443	FSTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSTL1	protein_coding	OTTHUMT00000355399.1	G	NM_007085	-		120122120	-1	no_errors	ENST00000295633	ensembl	human	known	74_37	nonsense	SNP	1.000	T
CNR2	1269	genome.wustl.edu	37	1	24202015	24202015	+	Silent	SNP	G	G	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr1:24202015G>T	ENST00000374472.4	-	2	254	c.93C>A	c.(91-93)ccC>ccA	p.P31P	CNR2_ENST00000536471.1_Silent_p.P31P	NM_001841.2	NP_001832.1	P34972	CNR2_HUMAN	cannabinoid receptor 2 (macrophage)	31					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of action potential (GO:0045759)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|response to amphetamine (GO:0001975)|response to lipopolysaccharide (GO:0032496)|sensory perception of pain (GO:0019233)	dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(9)|pancreas(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(2)	26		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Dronabinol(DB00470)|Nabilone(DB00486)	CTGTCTTCTGGGGACCACTCA	0.547																																																	0								ENSG00000188822						90.0	94.0	93.0					1																	24202015		2203	4300	6503	CNR2	SO:0001819	synonymous_variant	0			-	HGNC	X74328	CCDS245.1	1p	2012-08-08			ENSG00000188822	ENSG00000188822		"""GPCR / Class A : Cannabinoid receptors"""	2160	protein-coding gene	gene with protein product		605051					Standard	NM_001841		Approved	CB2	uc001bif.3	P34972	OTTHUMG00000013892	ENST00000374472.4:c.93C>A	1.37:g.24202015G>T		Somatic	0	37	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	C6ES44|Q4VBK8|Q5JRH7|Q6B0G7|Q6NSY0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Canbinoid_rcpt_2,prints_Cnbnoid_rcpt,prints_GPCR_Rhodpsn	p.P31	ENST00000374472.4	37	c.93	CCDS245.1	1																																																																																			-	prints_Cnbnoid_rcpt		0.547	CNR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNR2	protein_coding	OTTHUMT00000038949.1	G	NM_001841	-		24202015	-1	no_errors	ENST00000374472	ensembl	human	known	74_37	silent	SNP	0.737	T
TRIM51HP	440041	genome.wustl.edu	37	11	55063041	55063041	+	RNA	SNP	T	T	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr11:55063041T>G	ENST00000526016.1	-	0	596					NR_038174.2				tripartite motif-containing 51H, pseudogene																		TTTCATTGAGTTGCTGAAAAA	0.423																																																	0								ENSG00000166007																																			TRIM51HP			0			-	HGNC			11q11	2012-11-02			ENSG00000166007	ENSG00000166007		"""Triparite motif-containing / Pseudogenes"""	43977	pseudogene	pseudogene							Standard	NR_038174		Approved		uc021qjb.1		OTTHUMG00000166775		11.37:g.55063041T>G		Somatic	0	196	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	155	20.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000526016.1	37	NULL		11																																																																																			-	-		0.423	TRIM51HP-002	PUTATIVE	basic|exp_conf	processed_transcript	TRIM51HP	pseudogene	OTTHUMT00000391438.1	T		-		55063041	-1	no_errors	ENST00000526016	ensembl	human	putative	74_37	rna	SNP	0.155	G
KCND2	3751	genome.wustl.edu	37	7	119915492	119915492	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr7:119915492C>T	ENST00000331113.4	+	1	1771	c.806C>T	c.(805-807)gCc>gTc	p.A269V		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	269					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	GACGTGGTGGCCATCCTGCCT	0.512																																																	0								ENSG00000184408						173.0	144.0	154.0					7																	119915492		2203	4300	6503	KCND2	SO:0001583	missense	0			-	HGNC	AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.806C>T	7.37:g.119915492C>T	ENSP00000333496:p.Ala269Val	Somatic	0	46	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_volt-dep_Kv4_C,pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Shal-type,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.2,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.A269V	ENST00000331113.4	37	c.806	CCDS5776.1	7	.	.	.	.	.	.	.	.	.	.	C	27.4	4.830433	0.91036	.	.	ENSG00000184408	ENST00000331113	D	0.98150	-4.75	5.27	5.27	0.74061	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98538	0.9512	M	0.74647	2.275	0.80722	D	1	D	0.61080	0.989	D	0.70016	0.967	D	0.98755	1.0722	9	.	.	.	.	19.2668	0.93990	0.0:1.0:0.0:0.0	.	269	Q9NZV8	KCND2_HUMAN	V	269	ENSP00000333496:A269V	.	A	+	2	0	KCND2	119702728	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.776000	0.85560	2.636000	0.89361	0.557000	0.71058	GCC	-	pfam_Ion_trans_dom,prints_K_chnl		0.512	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCND2	protein_coding	OTTHUMT00000346996.1	C	NM_012281	-		119915492	+1	no_errors	ENST00000331113	ensembl	human	known	74_37	missense	SNP	1.000	T
NELL1	4745	genome.wustl.edu	37	11	20699519	20699519	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr11:20699519G>A	ENST00000357134.5	+	2	249	c.97G>A	c.(97-99)Gtc>Atc	p.V33I	NELL1_ENST00000298925.5_Missense_Mutation_p.V61I|NELL1_ENST00000532434.1_Missense_Mutation_p.V33I|NELL1_ENST00000325319.5_Missense_Mutation_p.V33I	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	33					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						GATGGATATCGTCACCGAGCT	0.473																																																	0								ENSG00000165973						179.0	163.0	168.0					11																	20699519		2203	4300	6503	NELL1	SO:0001583	missense	0			-	HGNC	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.97G>A	11.37:g.20699519G>A	ENSP00000349654:p.Val33Ile	Somatic	0	52	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	27	47.06	B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_VWF_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_VWC_out,smart_VWF_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_VWF_C	p.V33I	ENST00000357134.5	37	c.97	CCDS7855.1	11	.	.	.	.	.	.	.	.	.	.	A	0.035	-1.310797	0.01342	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.01933	4.55;4.55;4.55;4.55	6.11	1.11	0.20524	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.138090	0.46758	N	0.000266	T	0.00580	0.0019	N	0.00197	-1.87	0.09310	N	0.999999	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.001;0.0	T	0.46610	-0.9179	10	0.11794	T	0.64	-7.2337	6.934	0.24457	0.6621:0.1117:0.2262:0.0	.	33;61;33;33	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	I	61;33;33;33	ENSP00000298925:V61I;ENSP00000349654:V33I;ENSP00000317837:V33I;ENSP00000437170:V33I	ENSP00000298925:V61I	V	+	1	0	NELL1	20656095	0.910000	0.30920	0.004000	0.12327	0.274000	0.26718	1.521000	0.35910	-0.296000	0.08947	-2.261000	0.00279	GTC	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G		0.473	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL1	protein_coding	OTTHUMT00000387588.1	G	NM_006157	-		20699519	+1	no_errors	ENST00000357134	ensembl	human	known	74_37	missense	SNP	0.660	A
SLC8A2	6543	genome.wustl.edu	37	19	47969082	47969082	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr19:47969082C>G	ENST00000236877.6	-	2	974	c.579G>C	c.(577-579)aaG>aaC	p.K193N	SLC8A2_ENST00000542837.1_Intron|SLC8A2_ENST00000539381.1_Intron	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	193					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		CTCTCAGGTGCTTGATCTTGC	0.562																																																	0								ENSG00000118160						70.0	48.0	55.0					19																	47969082		2203	4300	6503	SLC8A2	SO:0001583	missense	0			-	HGNC	AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.579G>C	19.37:g.47969082C>G	ENSP00000236877:p.Lys193Asn	Somatic	0	53	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	31	20.51	B4DYQ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Calx_beta,pfam_NaCa_Exmemb,smart_Calx_beta,prints_Na_Ca_Ex,tigrfam_Na_Ca_Ex	p.K193N	ENST00000236877.6	37	c.579	CCDS33065.1	19	.	.	.	.	.	.	.	.	.	.	C	18.05	3.537919	0.65085	.	.	ENSG00000118160	ENST00000391903;ENST00000236877	T	0.64438	-0.1	4.04	4.04	0.47022	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	T	0.76033	0.3931	M	0.64080	1.96	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.971	T	0.79688	-0.1699	10	0.87932	D	0	.	15.1426	0.72623	0.0:1.0:0.0:0.0	.	21;193	E9PGS7;Q9UPR5	.;NAC2_HUMAN	N	21;193	ENSP00000236877:K193N	ENSP00000236877:K193N	K	-	3	2	SLC8A2	52660894	0.998000	0.40836	1.000000	0.80357	0.991000	0.79684	0.600000	0.24104	2.098000	0.63641	0.462000	0.41574	AAG	-	pfam_NaCa_Exmemb,tigrfam_Na_Ca_Ex		0.562	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC8A2	protein_coding	OTTHUMT00000466997.1	C		-		47969082	-1	no_errors	ENST00000236877	ensembl	human	known	74_37	missense	SNP	1.000	G
OR4M1	441670	genome.wustl.edu	37	14	20249201	20249201	+	Silent	SNP	C	C	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr14:20249201C>G	ENST00000315957.4	+	1	801	c.720C>G	c.(718-720)tcC>tcG	p.S240S		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	240						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GGGCCATGTCCACCTGCTATT	0.458																																																	0								ENSG00000176299						270.0	236.0	247.0					14																	20249201		2203	4300	6503	OR4M1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.720C>G	14.37:g.20249201C>G		Somatic	0	202	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	163	14.21	B9EH18|Q6IFA3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S240	ENST00000315957.4	37	c.720	CCDS32021.1	14																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.458	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4M1	protein_coding	OTTHUMT00000409770.1	C		-		20249201	+1	no_errors	ENST00000315957	ensembl	human	known	74_37	silent	SNP	0.994	G
HMCN1	83872	genome.wustl.edu	37	1	186113796	186113796	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr1:186113796G>A	ENST00000271588.4	+	91	14456	c.14227G>A	c.(14227-14229)Gat>Aat	p.D4743N	HMCN1_ENST00000367492.2_Missense_Mutation_p.D4743N	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4743	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CGAAGGGAGTGATGTCCAGAG	0.473																																																	0								ENSG00000143341						119.0	111.0	113.0					1																	186113796		2203	4300	6503	HMCN1	SO:0001583	missense	0			-	HGNC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.14227G>A	1.37:g.186113796G>A	ENSP00000271588:p.Asp4743Asn	Somatic	0	51	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.D4743N	ENST00000271588.4	37	c.14227	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	17.11	3.306105	0.60305	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.60672	0.17;0.17	5.82	5.82	0.92795	.	0.188525	0.53938	D	0.000043	T	0.43964	0.1271	N	0.25201	0.72	0.43745	D	0.996245	B	0.16603	0.018	B	0.16289	0.015	T	0.26018	-1.0115	10	0.22109	T	0.4	.	15.2714	0.73705	0.0687:0.0:0.9313:0.0	.	4743	Q96RW7	HMCN1_HUMAN	N	4743	ENSP00000271588:D4743N;ENSP00000356462:D4743N	ENSP00000271588:D4743N	D	+	1	0	HMCN1	184380419	1.000000	0.71417	0.982000	0.44146	0.897000	0.52465	7.594000	0.82698	2.765000	0.95021	0.650000	0.86243	GAT	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.473	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	protein_coding	OTTHUMT00000131848.1	G	NM_031935	-		186113796	+1	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	SNP	0.998	A
RASD1	51655	genome.wustl.edu	37	17	17398573	17398578	+	In_Frame_Del	DEL	CGCCGC	CGCCGC	-	rs551947598|rs200956285|rs146717971	byFrequency	TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	CGCCGC	CGCCGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr17:17398573_17398578delCGCCGC	ENST00000225688.3	-	2	918_923	c.707_712delGCGGCG	c.(706-714)ggcggcgac>gac	p.GG236del	RASD1_ENST00000579152.1_3'UTR	NM_001199989.1|NM_016084.4	NP_001186918.1|NP_057168.1	Q9Y272	RASD1_HUMAN	RAS, dexamethasone-induced 1	236					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of transcription, DNA-templated (GO:0045892)|nitric oxide mediated signal transduction (GO:0007263)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	4						TCGCCCGGGTcgccgccgccgccgcc	0.704														17	0.00339457	0.0076	0.0014	5008	,	,		14973	0.004		0.001	False		,,,				2504	0.001																0								ENSG00000108551		,	5,17,25,3003		2,0,0,1,3,0,11,5,15,1488					,	2.4	0.9			5	1,12,99,6120		0,0,0,1,4,0,4,10,79,3018	no	codingComplex,utr-3	RASD1	NM_016084.4,NM_001199989.1	,	2,0,0,2,7,0,15,15,94,4506	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		1.7972,1.541,1.713	,	,		6,29,124,9123				RASD1	SO:0001651	inframe_deletion	0				HGNC	AF069506	CCDS11185.1, CCDS58519.1	17p11.2	2014-05-09			ENSG00000108551	ENSG00000108551			15828	protein-coding gene	gene with protein product	"""ras-related protein"", ""dexamethasone-induced ras-related protein 1"", ""activator of G protein signaling"""	605550				10947988	Standard	NM_001199989		Approved	DEXRAS1, AGS1	uc002gri.3	Q9Y272	OTTHUMG00000059292	ENST00000225688.3:c.707_712delGCGGCG	17.37:g.17398579_17398584delCGCCGC	ENSP00000225688:p.Gly236_Gly237del	Somatic	NA	NA	NA		0.5152294697123943	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2R709|B4DFF4|Q9NYB4	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.GG236in_frame_del	ENST00000225688.3	37	c.712_707	CCDS11185.1	17																																																																																			-	smart_Ran_GTPase		0.704	RASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASD1	protein_coding	OTTHUMT00000131668.1	CGCCGC	NM_016084			17398578	-1	no_errors	ENST00000225688	ensembl	human	known	74_37	in_frame_del	DEL	0.406:0.464:0.573:0.575:0.556:0.538	-
ZNF568	374900	genome.wustl.edu	37	19	37482159	37482159	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr19:37482159C>T	ENST00000455427.2	+	7	624	c.295C>T	c.(295-297)Cga>Tga	p.R99*		NM_001204839.1	NP_001191768.1	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	166	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGATTTGTACCGAGATGTAAT	0.453																																																	0								ENSG00000198453																																			ZNF568	SO:0001587	stop_gained	0			-	HGNC	BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000455427.2:c.295C>T	19.37:g.37482159C>T	ENSP00000413396:p.Arg99*	Somatic	0	44	0.00		0.5152294697123943	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	28	9.68	B4DS92|E7ER33|Q6N060|Q8NA64	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R99*	ENST00000455427.2	37	c.295	CCDS56093.1	19	.	.	.	.	.	.	.	.	.	.	C	33	5.226641	0.95173	.	.	ENSG00000198453	ENST00000444991;ENST00000455427;ENST00000433993	.	.	.	3.36	-4.04	0.04010	.	.	.	.	.	.	.	.	.	.	.	0.21967	N	0.999441	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.0134	0.42001	0.7522:0.1596:0.0:0.0882	.	.	.	.	X	163;99;31	.	ENSP00000399643:R31X	R	+	1	2	ZNF568	42173999	0.000000	0.05858	0.131000	0.22000	0.970000	0.65996	-7.012000	0.00046	-0.644000	0.05465	0.430000	0.28490	CGA	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.453	ZNF568-007	KNOWN	basic|CCDS	protein_coding	ZNF568	protein_coding	OTTHUMT00000457465.1	C	NM_198539	-		37482159	+1	no_errors	ENST00000455427	ensembl	human	known	74_37	nonsense	SNP	0.054	T
RALYL	138046	genome.wustl.edu	37	8	85686863	85686863	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr8:85686863C>A	ENST00000521268.1	+	3	1411	c.306C>A	c.(304-306)aaC>aaA	p.N102K	RALYL_ENST00000521376.1_Missense_Mutation_p.N29K|RALYL_ENST00000521695.1_Missense_Mutation_p.N102K|RALYL_ENST00000522455.1_Missense_Mutation_p.N102K|RALYL_ENST00000517638.1_Missense_Mutation_p.N115K|RALYL_ENST00000523850.1_Missense_Mutation_p.N29K|RALYL_ENST00000518566.1_Missense_Mutation_p.N102K	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	102							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						AACCTGGAAACAAGAGGCCCC	0.358																																																	0								ENSG00000184672						63.0	63.0	63.0					8																	85686863		1830	4095	5925	RALYL	SO:0001583	missense	0			-	HGNC		CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.306C>A	8.37:g.85686863C>A	ENSP00000430367:p.Asn102Lys	Somatic	0	88	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	38	25.49	B3KTH2|G3V129|Q6ZW87|Q8N1C2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.N102K	ENST00000521268.1	37	c.306	CCDS55253.1	8	.	.	.	.	.	.	.	.	.	.	C	14.85	2.658367	0.47467	.	.	ENSG00000184672	ENST00000522455;ENST00000521695;ENST00000521268;ENST00000518566;ENST00000517638;ENST00000523850;ENST00000521376	T;T;T;T;T;T;T	0.16457	2.98;2.98;2.98;2.95;2.96;2.6;2.34	5.78	2.95	0.34219	Nucleotide-binding, alpha-beta plait (1);	0.425662	0.27031	N	0.021273	T	0.07773	0.0195	N	0.08118	0	0.24736	N	0.993064	B;B;B;B;B	0.32467	0.002;0.354;0.372;0.051;0.354	B;B;B;B;B	0.30943	0.005;0.09;0.114;0.122;0.09	T	0.27297	-1.0078	10	0.35671	T	0.21	-11.917	7.7059	0.28650	0.0:0.7268:0.0:0.2732	.	102;102;29;115;102	B3KT61;B3KSX3;Q86SE5-2;G3V129;Q86SE5	.;.;.;.;RALYL_HUMAN	K	102;102;102;102;115;29;29	ENSP00000430394:N102K;ENSP00000428667:N102K;ENSP00000430367:N102K;ENSP00000430065:N102K;ENSP00000430128:N115K;ENSP00000428807:N29K;ENSP00000428310:N29K	ENSP00000430128:N115K	N	+	3	2	RALYL	85849418	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.797000	0.26999	0.325000	0.23359	0.655000	0.94253	AAC	-	pirsf_hnRNP_C_Raly		0.358	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALYL	protein_coding	OTTHUMT00000379448.1	C		-		85686863	+1	no_errors	ENST00000521268	ensembl	human	known	74_37	missense	SNP	1.000	A
PLCE1	51196	genome.wustl.edu	37	10	95995711	95995711	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr10:95995711C>T	ENST00000371380.3	+	6	2489	c.2254C>T	c.(2254-2256)Cga>Tga	p.R752*	PLCE1_ENST00000371385.3_Nonsense_Mutation_p.R444*|PLCE1_ENST00000371375.1_Nonsense_Mutation_p.R444*|PLCE1_ENST00000260766.3_Nonsense_Mutation_p.R752*			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	752	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				TTTCTTACAACGAGTGGGACA	0.408																																																	0								ENSG00000138193						100.0	96.0	97.0					10																	95995711		1853	4110	5963	PLCE1	SO:0001587	stop_gained	0			-	HGNC		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.2254C>T	10.37:g.95995711C>T	ENSP00000360431:p.Arg752*	Somatic	0	50	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_Ras-assoc,pfam_RasGRF_CDC25,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_Ras_GEF_dom,superfamily_C2_dom,smart_RasGRF_CDC25,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,smart_Ras-assoc,pfscan_C2_dom,pfscan_Ras-assoc,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,pfscan_RasGRF_CDC25,prints_Pinositol_PLipase_C	p.R752*	ENST00000371380.3	37	c.2254	CCDS41552.1	10	.	.	.	.	.	.	.	.	.	.	C	46	12.416272	0.99665	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	.	.	.	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.1808	0.93622	0.0:1.0:0.0:0.0	.	.	.	.	X	752;752;444;444	.	ENSP00000260766:R752X	R	+	1	2	PLCE1	95985701	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.350000	0.52224	2.521000	0.84997	0.655000	0.94253	CGA	-	superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25		0.408	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCE1	protein_coding	OTTHUMT00000049469.3	C	NM_016341	-		95995711	+1	no_errors	ENST00000260766	ensembl	human	known	74_37	nonsense	SNP	1.000	T
HSPA1B	3304	genome.wustl.edu	37	6	31797299	31797299	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr6:31797299G>T	ENST00000375650.3	+	1	1788	c.1572G>T	c.(1570-1572)aaG>aaT	p.K524N	HSPA1B_ENST00000545241.1_Missense_Mutation_p.K433N	NM_005346.4	NP_005337.2	P08107	HSP71_HUMAN	heat shock 70kDa protein 1B	524					ATP catabolic process (GO:0006200)|cellular heat acclimation (GO:0070370)|cellular response to heat (GO:0034605)|gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of inclusion body assembly (GO:0090084)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of erythrocyte differentiation (GO:0045648)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)	aggresome (GO:0016235)|blood microparticle (GO:0072562)|centriole (GO:0005814)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|inclusion body (GO:0016234)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|double-stranded RNA binding (GO:0003725)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|protein N-terminus binding (GO:0047485)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|virus receptor activity (GO:0001618)			breast(1)|large_intestine(1)|prostate(1)	3						AGGCGGAGAAGTACAAAGCGG	0.617																																																	0								ENSG00000204388						10.0	7.0	8.0					6																	31797299		1588	3164	4752	HSPA1B	SO:0001583	missense	0			-	HGNC		CCDS34415.1	6p21.3	2011-09-02	2002-08-29		ENSG00000204388	ENSG00000204388		"""Heat shock proteins / HSP70"""	5233	protein-coding gene	gene with protein product		603012	"""heat shock 70kD protein 1B"""			1700760	Standard	NM_005346		Approved	HSP70-2	uc003nxk.2	P08107	OTTHUMG00000031202	ENST00000375650.3:c.1572G>T	6.37:g.31797299G>T	ENSP00000364801:p.Lys524Asn	Somatic	0	46	0.00		0.5152294697123943	80	25.93	28	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	B4E3B6|P19790|Q5JQI4|Q5SP17|Q9UQL9|Q9UQM0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.K524N	ENST00000375650.3	37	c.1572	CCDS34415.1	6	.	.	.	.	.	.	.	.	.	.	G	10.20	1.285485	0.23478	.	.	ENSG00000204388	ENST00000542758;ENST00000375650;ENST00000545429;ENST00000545241	T;T	0.05855	3.38;3.38	4.2	2.28	0.28536	.	0.000000	0.40064	N	0.001186	T	0.05227	0.0139	.	.	.	0.48288	D	0.999622	.	.	.	.	.	.	T	0.17561	-1.0365	7	0.72032	D	0.01	-19.9116	4.772	0.13160	0.2063:0.2056:0.5881:0.0	.	.	.	.	N	591;524;507;433	ENSP00000364801:K524N;ENSP00000442789:K433N	ENSP00000364801:K524N	K	+	3	2	HSPA1B	31905278	0.065000	0.20965	0.994000	0.49952	0.980000	0.70556	-0.066000	0.11598	0.823000	0.34589	0.467000	0.42956	AAG	-	pfam_Hsp_70_fam		0.617	HSPA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA1B	protein_coding	OTTHUMT00000076402.2	G		-		31797299	+1	no_errors	ENST00000375650	ensembl	human	known	74_37	missense	SNP	0.991	T
GCSAM	257144	genome.wustl.edu	37	3	111849243	111849243	+	Intron	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr3:111849243G>A	ENST00000308910.4	-	2	283				C3orf52_ENST00000467942.2_3'UTR|GCSAM_ENST00000484193.1_Intron	NM_001190259.1|NM_001190260.1|NM_152785.4	NP_001177188.1|NP_001177189.1|NP_689998.1	Q8N6F7	GCSAM_HUMAN	germinal center-associated, signaling and motility						negative regulation of lymphocyte migration (GO:2000402)|regulation of B cell receptor signaling pathway (GO:0050855)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|myosin II binding (GO:0045159)|protein kinase binding (GO:0019901)										GACATACTTCGTTCTCCTTGG	0.478																																																	0								ENSG00000114529						155.0	157.0	156.0					3																	111849243		2203	4300	6503	C3orf52	SO:0001627	intron_variant	0			-	HGNC	BC030506	CCDS2964.1, CCDS54621.1, CCDS54622.1	3q13.13	2012-09-03	2012-08-23	2012-08-23	ENSG00000174500	ENSG00000174500			20253	protein-coding gene	gene with protein product	"""human germinal center-associated lymphoma"""	607792	"""germinal center expressed transcript 2"""	GCET2			Standard	NM_152785		Approved	MGC40441, HGAL	uc021xcl.1	Q8N6F7	OTTHUMG00000159231	ENST00000308910.4:c.98+48C>T	3.37:g.111849243G>A		Somatic	0	72	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	65	21.69	C9JD17|C9JUG6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000308910.4	37	NULL	CCDS2964.1	3																																																																																			-	-		0.478	GCSAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C3orf52	protein_coding	OTTHUMT00000353967.2	G	NM_152785	-		111849243	+1	no_errors	ENST00000467942	ensembl	human	known	74_37	rna	SNP	0.000	A
MMP24	10893	genome.wustl.edu	37	20	33851599	33851599	+	Missense_Mutation	SNP	G	G	A	rs376734021		TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr20:33851599G>A	ENST00000246186.6	+	5	908	c.823G>A	c.(823-825)Gac>Aac	p.D275N	MMP24-AS1_ENST00000438751.1_RNA|MMP24-AS1_ENST00000454184.1_RNA|MMP24-AS1_ENST00000456350.1_RNA|MMP24-AS1_ENST00000566203.2_RNA|MMP24-AS1_ENST00000453892.1_RNA|EDEM2_ENST00000540582.1_Intron|MMP24-AS1_ENST00000433764.1_RNA	NM_006690.3	NP_006681.1	Q9Y5R2	MMP24_HUMAN	matrix metallopeptidase 24 (membrane-inserted)	275					cell-cell adhesion (GO:0098609)|cell-cell adhesion mediated by cadherin (GO:0044331)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|glial cell differentiation (GO:0010001)|neuronal stem cell maintenance (GO:0097150)|positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|large_intestine(1)|lung(2)|prostate(2)|skin(5)	14			BRCA - Breast invasive adenocarcinoma(18;0.00252)		Marimastat(DB00786)	CACAGGGAACGACCTCTTCCT	0.627																																																	0								ENSG00000125966						18.0	19.0	19.0					20																	33851599		2202	4299	6501	MMP24	SO:0001583	missense	0			-	HGNC	AF131284	CCDS46593.1	20q11.2	2008-07-16	2005-08-08		ENSG00000125966	ENSG00000125966			7172	protein-coding gene	gene with protein product	"""membrane-type 5 matrix metalloproteinase"""	604871	"""matrix metalloproteinase 24 (membrane-inserted)"""			10363975	Standard	NM_006690		Approved	MT5-MMP	uc002xbu.2	Q9Y5R2	OTTHUMG00000032330	ENST00000246186.6:c.823G>A	20.37:g.33851599G>A	ENSP00000246186:p.Asp275Asn	Somatic	0	36	0.00		0.5152294697123943	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	39	15.22	B7ZBG8|Q9H440	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.D275N	ENST00000246186.6	37	c.823	CCDS46593.1	20	.	.	.	.	.	.	.	.	.	.	G	28.6	4.936445	0.92458	.	.	ENSG00000125966	ENST00000246186;ENST00000540655	T	0.21191	2.02	5.05	5.05	0.67936	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.29389	0.0732	N	0.17838	0.53	0.80722	D	1	D	0.63880	0.993	P	0.61592	0.891	T	0.03000	-1.1084	10	0.38643	T	0.18	.	17.547	0.87865	0.0:0.0:1.0:0.0	.	275	Q9Y5R2	MMP24_HUMAN	N	275;223	ENSP00000246186:D275N	ENSP00000246186:D275N	D	+	1	0	MMP24	33315015	1.000000	0.71417	0.995000	0.50966	0.934000	0.57294	6.481000	0.73608	2.606000	0.88127	0.655000	0.94253	GAC	-	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo		0.627	MMP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP24	protein_coding	OTTHUMT00000078851.4	G	NM_006690	-		33851599	+1	no_errors	ENST00000246186	ensembl	human	known	74_37	missense	SNP	1.000	A
N4BP2	55728	genome.wustl.edu	37	4	40123372	40123372	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr4:40123372A>G	ENST00000261435.6	+	9	4057	c.3641A>G	c.(3640-3642)cAt>cGt	p.H1214R		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	1214					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						CCTGAAAACCATGAATCGATG	0.418																																																	0								ENSG00000078177						74.0	73.0	74.0					4																	40123372		2203	4300	6503	N4BP2	SO:0001583	missense	0			-	HGNC	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.3641A>G	4.37:g.40123372A>G	ENSP00000261435:p.His1214Arg	Somatic	0	38	0.00		0.5152294697123943	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1771,pfam_Smr/MutS2_C,superfamily_P-loop_NTPase,superfamily_UBA-like,smart_Smr/MutS2_C,pfscan_CUE,pfscan_Smr/MutS2_C	p.H1214R	ENST00000261435.6	37	c.3641	CCDS3457.1	4	.	.	.	.	.	.	.	.	.	.	A	1.930	-0.446146	0.04604	.	.	ENSG00000078177	ENST00000261435;ENST00000381804	T	0.16597	2.33	5.6	1.83	0.25207	.	1.176710	0.06286	N	0.698344	T	0.13114	0.0318	N	0.22421	0.69	0.09310	N	1	B;B	0.22909	0.077;0.046	B;B	0.25140	0.058;0.026	T	0.38243	-0.9670	10	0.48119	T	0.1	0.1539	6.9921	0.24761	0.4512:0.4684:0.0:0.0804	.	1214;1214	Q86UW6-2;Q86UW6	.;N4BP2_HUMAN	R	1214;1134	ENSP00000261435:H1214R	ENSP00000261435:H1214R	H	+	2	0	N4BP2	39799767	0.946000	0.32159	0.000000	0.03702	0.032000	0.12392	0.804000	0.27098	0.029000	0.15352	-0.286000	0.09958	CAT	-	NULL		0.418	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP2	protein_coding	OTTHUMT00000250458.2	A	NM_018177	-		40123372	+1	no_errors	ENST00000261435	ensembl	human	known	74_37	missense	SNP	0.001	G
